Single atom self-diffusion on nickel surfaces

International Nuclear Information System (INIS)

Tung, R.T.; Graham, W.R.

1980-01-01

Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

International Nuclear Information System (INIS)

Hou, W C; Hong, Franklin Chau-Nan

2009-01-01

This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

Tracer surface diffusion on UO2

International Nuclear Information System (INIS)

Zhou, S.Y.; Olander, D.R.

1983-06-01

Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

Diffusion and surface alloying of gradient nanostructured metals

Directory of Open Access Journals (Sweden)

Zhenbo Wang

2017-03-01

Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

Diffusion processes in bombardment-induced surface topography

International Nuclear Information System (INIS)

Robinson, R.S.

1984-01-01

A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

Modifying glass surfaces via internal diffusion

DEFF Research Database (Denmark)

Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

2010-01-01

leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

Plasma diffusion in systems with disrupted magnetic surfaces

International Nuclear Information System (INIS)

Morozov, D.K.; Pogutse, O.P.

1982-01-01

Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1988-09-01

The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

Science.gov (United States)

Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

2015-05-21

Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

Reactive solid surface morphology variation via ionic diffusion.

Science.gov (United States)

Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

2012-08-14

In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

International Nuclear Information System (INIS)

Seddeek, M.A.; Abdelmeguid, M.S.

2006-01-01

The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

OpenAIRE

M. R. Monazzam

2006-01-01

Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

Energy Technology Data Exchange (ETDEWEB)

Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

2013-12-14

The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

Cholesterol enhances surface water diffusion of phospholipid bilayers

Energy Technology Data Exchange (ETDEWEB)

Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

2014-12-14

Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

Atomic diffusion in laser surface modified AISI H13 steel

Science.gov (United States)

Aqida, S. N.; Brabazon, D.; Naher, S.

2013-07-01

This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

Chemical diffusion on solid surfaces. Final report

International Nuclear Information System (INIS)

Hudson, J.B.

1980-12-01

The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

The effect of step thickness on the surface diffusion of a Pt adatom

International Nuclear Information System (INIS)

Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

2009-01-01

The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

International Nuclear Information System (INIS)

Ma, Z.; Whitley, R.D.; Wang, N.H.L.

1996-01-01

A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

Friction and diffusion dynamics of adsorbates at surfaces

NARCIS (Netherlands)

Fusco, C.

2005-01-01

A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

Czech Academy of Sciences Publication Activity Database

Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

2008-01-01

Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

Thermal diffusivity effect in opto-thermal skin measurements

International Nuclear Information System (INIS)

Xiao, P; Imhof, R E; Cui, Y; Ciortea, L I; Berg, E P

2010-01-01

We present our latest study on the thermal diffusivity effect in opto-thermal skin measurements. We discuss how thermal diffusivity affects the shape of opto-thermal signal, and how to measure thermal diffusivity in opto-thermal measurements of arbitrary sample surfaces. We also present a mathematical model for a thermally gradient material, and its corresponding opto-thermal signal. Finally, we show some of our latest experimental results of this thermal diffusivity effect study.

Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

Science.gov (United States)

Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

2012-09-24

We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

A diffuse radar scattering model from Martian surface rocks

Science.gov (United States)

Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

1987-01-01

Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

Science.gov (United States)

Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

2015-01-01

We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

Direct measurement of Cu surface self-diffusion on a checked surface

International Nuclear Information System (INIS)

Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

1976-01-01

A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

International Nuclear Information System (INIS)

Goddard, P.J.

1989-01-01

The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

Laser-induced desorption determinations of surface diffusion on Rh(111)

International Nuclear Information System (INIS)

Seebauer, E.G.; Schmidt, L.D.

1987-01-01

Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

International Nuclear Information System (INIS)

Cousty, J.P.

1981-12-01

In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

Linear response theory of activated surface diffusion with interacting adsorbates

Energy Technology Data Exchange (ETDEWEB)

Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

2010-05-12

Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

Science.gov (United States)

M. C. Sagis, Leonard

2001-03-01

In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

DEFF Research Database (Denmark)

Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

2002-01-01

We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

Diffusion accessibility as a method for visualizing macromolecular surface geometry.

Science.gov (United States)

Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

2015-10-01

Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

International Nuclear Information System (INIS)

Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

2014-01-01

We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

Directory of Open Access Journals (Sweden)

María I. Vázquez

2015-12-01

Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

Energy Technology Data Exchange (ETDEWEB)

Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

2016-04-15

We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

Science.gov (United States)

O'Neill, Kelly C; Lee, Young Jin

2018-05-01

The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

Energy Technology Data Exchange (ETDEWEB)

Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

2017-02-01

Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

Directory of Open Access Journals (Sweden)

Muhammad Qasim

2013-01-01

Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

Creep effects in diffusion bonding of oxygen-free copper

CERN Document Server

Moilanen, Antti

Diffusion is the transport of atoms or particles through the surrounding material. Various microstructural changes in metals are based on the diffusion phenomena. In solid metals the diffusion is closely related to crystallographic defects. In single-component metals the dominant mechanism of diffusion is the vacancy mechanism. Diffusion bonding is a direct technological application of diffusion. It is an advanced solidstate joining process in which the surfaces of two components are brought to contact with each other and heated under a pressing load in a controlled environment. During the process, the contact surfaces are bonded by atomic diffusion across the interface and as a result, one solid piece is formed. The condition of high temperature and low applied stress combined with relatively long process duration enables the creep effects to take place in bonded metals. Furthermore, creep causes unwanted permanent deformations in the bonded components. Some authors suggest that there could be a threshold fo...

Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

Science.gov (United States)

Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

2005-09-01

We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

Palladium diffusion into bulk copper via the (100) surface

Energy Technology Data Exchange (ETDEWEB)

Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

2009-08-05

Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

Fractional Diffusion Equations and Anomalous Diffusion

Science.gov (United States)

Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

2018-01-01

Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

Energy Technology Data Exchange (ETDEWEB)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

2016-08-15

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

Science.gov (United States)

Naderi, Ebadollah; Ghaisas, S. V.

2016-08-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

International Nuclear Information System (INIS)

Naderi, Ebadollah; Ghaisas, S. V.

2016-01-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

Diffusion of particles adsorbed on reconstructive surface

Czech Academy of Sciences Publication Activity Database

Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

2005-01-01

Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

Cleaning of diffusion bonding surface by argon ion bombardment treatment

International Nuclear Information System (INIS)

Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

2003-01-01

The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

KAUST Repository

Kailasanathan, Ranjith Kumar Abhinavam

2014-05-20

Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

International Nuclear Information System (INIS)

Olin, M.; Valkiainen, M.; Aalto, H.

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

Energy Technology Data Exchange (ETDEWEB)

Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

DEFF Research Database (Denmark)

Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

2012-01-01

This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

Directory of Open Access Journals (Sweden)

Louena Shtrepi

2017-02-01

Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

Science.gov (United States)

Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

2017-06-01

Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

2005-01-01

We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

Self-diffusion on copper surfaces

DEFF Research Database (Denmark)

Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

1991-01-01

The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

Bulk-mediated surface diffusion: non-Markovian desorption dynamics

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

2005-01-01

Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

Energy Technology Data Exchange (ETDEWEB)

Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

1988-03-31

In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

Diffusion of N adatoms on the Fe(100) surface

DEFF Research Database (Denmark)

Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

2000-01-01

The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

International Nuclear Information System (INIS)

Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

2016-01-01

Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

Effects of electrode properties and fabricated pressure on Li ion diffusion and diffusion-induced stresses in cylindrical Li-ion batteries

International Nuclear Information System (INIS)

Zhang, Tao; Guo, Zhansheng

2014-01-01

The effects of electrode properties and fabricated pressure on Li ion diffusion and diffusion-induced stress in a cylindrical Li-ion battery are studied. It is found that hydrostatic pressure or elastic modulus variation in the active layer have little effect on the distribution of Li ions for a higher diffusivity coefficient, but both can facilitate Li ion diffusion for a lower diffusivity coefficient. The elastic modulus variation has a significant effect on the distribution of stress and hydrostatic pressure can reduce the surface stress for the lower diffusivity coefficient. A higher charging rate causes a more transient response in the stress history, but a linear charging history is observed for slow charging rates. A higher charging rate would not inflict extra damage on the electrode for the higher diffusivity coefficient and the stress history becomes highly transient and charging rate dependent for the lower diffusivity coefficient. The effect of fabricated pressure can be neglected. (paper)

A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

International Nuclear Information System (INIS)

Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

2016-01-01

The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

Science.gov (United States)

1992-11-01

is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

International Nuclear Information System (INIS)

Livadiotis, George

2007-01-01

The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

International Nuclear Information System (INIS)

Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

1979-01-01

Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

Science.gov (United States)

Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

2017-07-01

Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

Classically exact surface diffusion constants at arbitrary temperature

International Nuclear Information System (INIS)

Voter, A.F.; Cohen, J.M.

1989-01-01

An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

Science.gov (United States)

Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

2014-05-01

Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

Science.gov (United States)

Hatakeyama, S.; Horiuchi, W.; Kohama, A.

2018-05-01

The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

International Nuclear Information System (INIS)

Durakanoglu, S.

2004-01-01

Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

Science.gov (United States)

Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

Science.gov (United States)

Chu, Khim Hoong

2017-11-09

Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

Effect of Vegetable Oils on the Surface Tension, Diffusion and Efficiency of Sethoxydim to Control Wild oat (Avena ludoviciana Durieu.

Directory of Open Access Journals (Sweden)

H. Hammami

2017-08-01

Full Text Available Introduction: During last century, population explosion has been pressing man to produce more supplies of food by consuming more energy in agroecosystems like applying chemical management strategies. herbicides have increasingly become a key component of weed management programs. In Iran, using herbicides led to increasing wheat yield about 20% and 22% in rainfed and irrigated farms respectively (20. Nonetheless, herbicides have also a negative impact on environment. A tool for reducing the herbicide usage which allows to decreasing their cost and side effects is the use of adjuvants. They increase the effectiveness of the post-emergence herbicides. Some adjuvants have toxic effects on living organisms such as Polyethoxylated tallowamine adjuvants that they are very toxic in fairy shrimp (Thamnocephalus platyurus (6. Vegetable oils are not phytotoxic and likely are degraded and metabolized quickly in the environment (8. Sethoxydim is an acetyl coenzyme A carboxylase (ACCase inhibitor that is considered to be a key enzyme in lipid biosynthesis. Similar to other foliar applied herbicides, it need to be associated with an adjuvant for more effective control. Vegetable oils can be developed characteristics of sethoxydim solution such as surface tension and spry drop diffusion. Therefore, the objective of this research is to determine the effect of vegetable oils on the surface tension, diffusion and efficiency of sethoxydim to control wild oat (Avena ludoviciana Durieu.. Materials and Metods: To evaluate the effect of vegetable oils on properties of sethoxydim solution, a series of experiments were separately conducted at Ferdowsi University of Mashhad and Khorasan Science and Technology Park in 2012. For evaluating the effect of vegetable oils on surface tension of distilled water and sethoxydim solution and the sethoxydim efficiency on wild oat control, three experiments were conducted as factorial based on completely randomized design. In other

Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

International Nuclear Information System (INIS)

Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

2007-01-01

Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

Jump rates for surface diffusion of large molecules from first principles

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2015-04-21

We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

Science.gov (United States)

Skoch, Gary J.

2002-01-01

Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

International Nuclear Information System (INIS)

Vree, C; Mayr, S G

2010-01-01

The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

DEFF Research Database (Denmark)

Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

2017-01-01

Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

International Nuclear Information System (INIS)

Ionescu, M.

1977-01-01

An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

Coupling between diffusion and orientation of pentacene molecules on an organic surface.

Science.gov (United States)

Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

2016-04-01

The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

Investigation of ion diffusion towards plasmonic surfaces

International Nuclear Information System (INIS)

Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

2013-01-01

Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

On the diffusion and self-trapping of surface dimers

Science.gov (United States)

Kappus, W.

1982-03-01

The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

Energy Technology Data Exchange (ETDEWEB)

Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

1996-11-01

The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

Convergence of surface diffusion parameters with model crystal size

Science.gov (United States)

Cohen, Jennifer M.; Voter, Arthur F.

1994-07-01

A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

Diffusion Influenced Adsorption Kinetics.

Science.gov (United States)

Miura, Toshiaki; Seki, Kazuhiko

2015-08-27

When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

Diffusion of particles on a fluctuating surface

Czech Academy of Sciences Publication Activity Database

Tarasenko, Alexander; Jastrabík, Lubomír

2011-01-01

Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

Collisional diffusion in a torus with imperfect magnetic surfaces

International Nuclear Information System (INIS)

White, R.B.

1983-03-01

A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

Plateau diffusion coefficient for arbitrary flux surface geometry

International Nuclear Information System (INIS)

Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

1981-03-01

A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

A new approach to the problem of bulk-mediated surface diffusion.

Science.gov (United States)

Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

2015-08-28

This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Tang Jianfeng

2011-01-01

The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

DEFF Research Database (Denmark)

Johannesson, Björn

2008-01-01

Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

KAUST Repository

Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

2014-01-01

Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

Development of an atmospheric diffusion numerical model for a nuclear facility. Numerical calculation method incorporating building effects

International Nuclear Information System (INIS)

Sada, Koichi; Michioka, Takenobu; Ichikawa, Yoichi

2002-01-01

Because effluent gas is sometimes released from low positions, viz., near the ground surface and around buildings, the effects caused by buildings within the site area are not negligible for gas diffusion predictions. For these reasons, the effects caused by buildings for gas diffusion are considered under the terrain following calculation coordinate system in this report. Numerical calculation meshes on the ground surface are treated as the building with the adaptation of wall function techniques of turbulent quantities in the flow calculations using a turbulence closure model. The reflection conditions of released particles on building surfaces are taken into consideration in the diffusion calculation using the Lagrangian particle model. Obtained flow and diffusion calculation results are compared with those of wind tunnel experiments around the building. It was apparent that features observed in a wind tunnel, viz., the formation of cavity regions behind the building and the gas diffusion to the ground surface behind the building, are also obtained by numerical calculation. (author)

Dimer-flipping-assisted diffusion on a Si(001) surface

International Nuclear Information System (INIS)

Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

2000-01-01

The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

Directory of Open Access Journals (Sweden)

N. Javid Rouzi

2009-04-01

Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

Nitrogen diffusion in near-surface range of ion doped molybdenum

CERN Document Server

Zamalin, E Y

2001-01-01

The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

International Nuclear Information System (INIS)

Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

1976-01-01

Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

KAUST Repository

Chroneos, Alexander I.

2012-01-26

In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

OpenAIRE

Li, Xiaofan; Nie, Qing

2009-01-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

Transient enhanced diffusion in preamorphized silicon: the role of the surface

Science.gov (United States)

Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

1999-01-01

Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

Diffusion of zinc into an unpassivated surface of indium phosphide

International Nuclear Information System (INIS)

Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

1989-01-01

Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

Directory of Open Access Journals (Sweden)

Ivan E Collier

Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

[Analyze nanofiltration separation rule of chlorogenic acid from low concentration ethanol by Donnan effect and solution-diffusion effect].

Science.gov (United States)

Li, Cun-Yu; Liu, Li-Cheng; Jin, Li-Yang; Li, Hong-Yang; Peng, Guo-Ping

2017-07-01

To separate chlorogenic acid from low concentration ethanol and explore the influence of Donnan effect and solution-diffusion effect on the nanofiltration separation rule. The experiment showed that solution pH and ethanol volume percent had influences on the separation of chlorogenic acid. Within the pH values from 3 to 7 for chlorogenic acid in 30% ethanol, the rejection rate of chlorogenic acid was changed by 70.27%. Through the response surface method for quadratic regression model, an interaction had been found in molecule weight cut-off, pH and ethanol volume percent. In fixed nanofiltration apparatus, the existence states of chlorogenic acid determinedits separation rules. With the increase of ethanol concentration, the free form chlorogenic acid was easily adsorbed, dissolved on membrane surface and then caused high transmittance due to the solution-diffusion effect. However, at the same time, due to the double effects of Donnan effect and solution-diffusion effect, the ionic state of chlorogenic acid was hard to be adsorbed in membrane surface and thus caused high rejection rate. The combination of Box-Behnken design and response surface analysis can well optimize the concentrate process by nanofiltration, and the results showed that nanofiltration had several big advantages over the traditional vacuum concentrate technology, meanwhile, and solved the problems of low efficiency and serious component lossesin the Chinese medicines separation process for low concentration organic solvent-water solution. Copyright© by the Chinese Pharmaceutical Association.

Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

DEFF Research Database (Denmark)

Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

2009-01-01

form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

A dissolution-diffusion sliding model for soft rock grains with hydro-mechanical effect

Directory of Open Access Journals (Sweden)

Z. Liu

2018-06-01

Full Text Available The deformation and failure of soft rock affected by hydro-mechanical (HM effect are one of the most concerns in geotechnical engineering, which are basically attributed to the grain sliding of soft rock. This study tried to develop a dissolution-diffusion sliding model for the typical red bed soft rock in South China. Based on hydration film, mineral dissolution and diffusion theory, and geochemical thermodynamics, a dissolution-diffusion sliding model with the HM effect was established to account for the sliding rate. Combined with the digital image processing technology, the relationship between the grain size of soft rock and the amplitude of sliding surface was presented. An equation for the strain rate of soft rocks under steady state was also derived. The reliability of the dissolution-diffusion sliding model was verified by triaxial creep tests on the soft rock with the HM coupling effect and by the relationship between the inversion average disjoining pressure and the average thickness of the hydration film. The results showed that the sliding rate of the soft rock grains was affected significantly by the waviness of sliding surface, the shear stress, and the average thickness of hydration film. The average grain size is essential for controlling the steady-state creep rate of soft rock. This study provides a new idea for investigating the deformation and failure of soft rock with the HM effect. Keywords: Soft rock, Hydro-mechanical (HM effect, Mineral dissolution-diffusion, Grain sliding model

Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

Directory of Open Access Journals (Sweden)

Szajnar J.

2014-10-01

Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

International Nuclear Information System (INIS)

Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

2012-01-01

The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

International Nuclear Information System (INIS)

Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

2014-01-01

We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

Surface modifications by field induced diffusion.

Directory of Open Access Journals (Sweden)

Martin Olsen

Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

Science.gov (United States)

Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

2018-02-01

Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

Dynamics of an optically confined nanoparticle diffusing normal to a surface.

Science.gov (United States)

Schein, Perry; O'Dell, Dakota; Erickson, David

2016-06-01

Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

Energy Technology Data Exchange (ETDEWEB)

Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

2016-05-15

Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

Effects of microstructure of clay on diffusion behavior of radionuclides in buffer materials

International Nuclear Information System (INIS)

Ohashi, Hiroshi; Sato, Seichi; Kozaki, Tamotsu

2001-03-01

Diffusion behavior of radionuclides in compacted bentonite plays an important role in the performance assessment of bentonite buffer material in geological disposal of high-level radioactive waste. Microstructure of bentonite is considered to be one of the key parameters to affect on the diffusion behavior. In this study, therefore, two kinds of montmorillonite (major clay mineral of bentonite) with different particle sizes were prepared, and characterized with several methods. In addition, the apparent and effective diffusion coefficients of HTO, Cl - , and Cs + were determined using the montmorillonite samples with different particle sizes and dry densities. In the sample characterization, the specific surface areas of montmorillonite samples with different particle sizes were determined by the BET and the EGME methods, and the particle size distributions of each sample were analyzed by laser diffraction/scattering particle size analysis. Microstructure of the samples was also observed by scanning electron microscopy (SEM) and atomic force microscopy (AFM). The BET method gave a higher specific surface area of the fine grained sample than of the coarse sample, while the EGME method gave same values for both samples. The laser diffraction/scattering particle size analysis using ethanol as a dispersion medium gave different particle size distributions, but when the samples were dispersed in water with Na 6 (PO 3 ) 6 , the particle size distributions were similar. These findings indicate that the montmorillonite layers, which compose the montmorillonite particles, have the same size, even if the particle sizes of the samples are different. In the diffusion experiments, it was found that the apparent diffusion coefficients of HTO and Cl - for the fine grained sample were higher than for the coarse grained sample at two dry densities, 1.0 and 1.8 Mg m -3 , while the opposite particle size effect was observed for Cs + ions. These findings cannot be explained by changes

Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

Science.gov (United States)

Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

2018-01-01

Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

International Nuclear Information System (INIS)

Ferrieri, R.A.; Wolf, A.P.

1984-01-01

A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

DEFF Research Database (Denmark)

Mejlbro, Leif

1996-01-01

Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

Science.gov (United States)

Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

2018-02-01

The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

Diffusion effects in undulator radiation

Directory of Open Access Journals (Sweden)

Ilya Agapov

2014-11-01

Full Text Available Quantum diffusion effects in undulator radiation in semiclassical approximation are considered. Short-term effects on the electron beam motion are discussed and it is shown that approaches based on diffusion approximation with drift-diffusion coefficients derived from undulator or bending magnet radiation spectrum, and on Poisson statistics with radiation spectrum defined by the local beding field, all lead to similar results in terms of electron energy spread for cases of practical interest. An analytical estimate of the influence of quantum diffusion on the undulator radiation spectrum is derived.

A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

Science.gov (United States)

Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

2014-02-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

Science.gov (United States)

Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

2011-01-01

Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

Diffusion bonding

International Nuclear Information System (INIS)

Anderson, R.C.

1976-01-01

A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

Effect of Reynolds number and saturation level on gas diffusion in and out of a superhydrophobic surface

Science.gov (United States)

Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus

2017-12-01

This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power

Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

Science.gov (United States)

Zhan, Hanyu; Voelz, David G.

2016-12-01

The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

DEFF Research Database (Denmark)

Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

2015-01-01

We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

Effects of surface and interface scattering on anomalous Hall effect in Co/Pd multilayers

KAUST Repository

Guo, Zaibing; Mi, W. B.; Aboljadayel, Razan; Zhang, Bei; Zhang, Q.; Gonzalez Barba, Priscila; Manchon, Aurelien; Zhang, Xixiang

2012-01-01

. By scaling surface scattering contribution with ρAHs∼ργss, the exponent γ has been found to decrease with the increase of surface scattering resistivity, which could account for the thickness-dependent anomalous Hall effect. Interface diffusion induced

Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

Energy Technology Data Exchange (ETDEWEB)

Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

2012-06-08

Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

Science.gov (United States)

Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

2014-01-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

Nuclear Quantum Effects in H(+) and OH(-) Diffusion along Confined Water Wires.

Science.gov (United States)

Rossi, Mariana; Ceriotti, Michele; Manolopoulos, David E

2016-08-04

The diffusion of protons and hydroxide ions along water wires provides an efficient mechanism for charge transport that is exploited by biological membrane channels and shows promise for technological applications such as fuel cells. However, what is lacking for a better control and design of these systems is a thorough theoretical understanding of the diffusion process at the atomic scale. Here we focus on two aspects of this process that are often disregarded because of their high computational cost: the use of first-principles potential energy surfaces and the treatment of the nuclei as quantum particles. We consider proton and hydroxide ions in finite water wires using density functional theory augmented with an apolar cylindrical confining potential. We employ machine learning techniques to identify the charged species, thus obtaining an agnostic definition that takes explicitly into account the delocalization of the charge in the Grotthus-like mechanism. We include nuclear quantum effects (NQEs) through the thermostated ring polymer molecular dynamics method and model finite system size effects by considering Langevin dynamics on the potential of mean force of the charged species, allowing us to extract the same "universal" diffusion coefficient from simulations with different wire sizes. In the classical case, diffusion coefficients depend significantly on the potential energy surface, in particular on how dispersion forces modulate water-water distances. NQEs, however, make the diffusion less sensitive to the underlying potential and geometry of the wire.

Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

Science.gov (United States)

Tränkle, B; Ruh, D; Rohrbach, A

2016-03-14

Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Chen Shuguang

2010-01-01

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

Energy Technology Data Exchange (ETDEWEB)

Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

2007-02-21

During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

International Nuclear Information System (INIS)

Luniakov, Yu V

2013-01-01

A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

International Nuclear Information System (INIS)

Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

2012-01-01

The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

Effects of surface and interface scattering on anomalous Hall effect in Co/Pd multilayers

KAUST Repository

Guo, Zaibing

2012-09-27

In this paper, we report the results of surface and interface scattering on anomalous Hall effect in Co/Pd multilayers with perpendicular magnetic anisotropy. The surface scattering effect has been extracted from the total anomalous Hall effect. By scaling surface scattering contribution with ρAHs∼ργss, the exponent γ has been found to decrease with the increase of surface scattering resistivity, which could account for the thickness-dependent anomalous Hall effect. Interface diffusion induced by rapid thermal annealing modifies not only the magnetization and longitudinal resistivity but also the anomalous Hall effect; a large exponent γ ∼ 5.7 has been attributed to interface scattering-dominated anomalous Hall effect.

Diffusion Under Geometrical Constraint

OpenAIRE

Ogawa, Naohisa

2014-01-01

Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...

Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

International Nuclear Information System (INIS)

Kim, Sung Hoon

2001-01-01

Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO ₂ (110)

Energy Technology Data Exchange (ETDEWEB)

Goldman, Nir; Browning, Nigel D.

2011-06-16

Gold clusters on rutile TiO₂ are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO₂(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

Fractional diffusion equations and anomalous diffusion

CERN Document Server

Evangelista, Luiz Roberto

2018-01-01

Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

International Nuclear Information System (INIS)

Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

Novel exchange mechanisms in the surface diffusion of oxides

International Nuclear Information System (INIS)

Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

2004-01-01

We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

Energy Technology Data Exchange (ETDEWEB)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

Science.gov (United States)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Effect of substrate surface on electromigration-induced sliding at hetero-interfaces

International Nuclear Information System (INIS)

Kumar, Praveen; Dutta, Indranath

2013-01-01

Electromigration (EM)-induced interfacial sliding between a metal film and Si substrate occurs when (i) only few grains exist across the width of the film and (ii) diffusivity through the interfacial region is significantly greater than diffusivity through the film. Here, the effect of the substrate surface layer on the kinetics of EM-induced interfacial sliding is assessed using Si substrates coated with various thin film interlayers. The kinetics of interfacial sliding, and therefore the EM-driven mass flow rate, strongly depends on the type of the interlayer (and hence the substrate surface composition), such that strongly bonded interfaces with slower interfacial diffusivity produce slower sliding. (paper)

Diffusion and sorption properties of radionuclides in compacted bentonite

Energy Technology Data Exchange (ETDEWEB)

Yu Ji-Wei; Neretnieks, I. [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Chemical Engineering and Technology

1997-07-01

In this report, recent studies on sorption and diffusion of radionuclides in compacted bentonite have been reviewed. The sorption distribution coefficient and diffusion coefficient data obtained from experiments in the literature have been compiled. Based on these experimental data and the report SKB-TR--91-16 (Brandberg and Skagius, 1991), this report proposes a set of sorption distribution coefficient and diffusion coefficient values for modelling purpose for safety analysis of nuclear waste repositories. The variability and uncertainty of the diffusivity data span somewhat more than an order or magnitude up and down. Most of the nuclides have an effective diffusivity in around 10{sup -10} m{sup 2}/s. Ion exclusion effects are observed for C, Cl and for Tc in oxidizing waters. Effective diffusivities are nearly tow orders of magnitude lower for these elements and of the order of 10{sup -12} m{sup 2}/s. Surface diffusion effects are found for Cs, Ni, Pa, Pb, Ra, Sn, Sr and Zr. Effective diffusivities for these elements are of the order of 10{sup -8} m{sup 2}/s. The surface diffusion effect should decrease in saline waters which is seen for Cs and Sr where there are data available. It is also deemed that Ra will have this effect because of its similarity with Sr. The other nuclides should also show this decrease but no data is available. Sorption and diffusion mechanisms in compacted bentonite are discussed in the report. In highly compacted bentonite, sorption and hence its distribution coefficient is not well defined, and a pore diffusion coefficient or a surface diffusion coefficient is not well defined either. Therefore, an apparent diffusion coefficient and a total concentration gradient should be more relevant in describing the diffusion process in compacted bentonite. 99 refs.

Diffusion behavior of anion in hardened low-heat portland cement paste containing fly ash. Dependence of effective diffusion coefficient on pore structure

International Nuclear Information System (INIS)

Chida, Taiji; Yoshida, Takahiro

2012-01-01

In the sub-surface disposal system, the closely packed concrete layer is expected the low diffusivity to retard the migration of radionuclides. Low-heat portland cement containing 30 wt% fly ash (FAC) is a candidate cement material for the construction of sub-surface repository because of its high dense structure and its resistance to cracking. Previously, we reported that FAC has lower diffusivity than Ordinary Portland Cement (OPC) for acetic acid and iodine. However, the mechanism for low diffusivity of FAC was not clear. In this study, the diffusion of multiple trace ions (chlorine, bromine and iodine) in hardened cement pastes was examined by through-diffusion experiments. The effective diffusion coefficients, D e , of the trace ions for hardened OPC cement pastes were on the order of 10 -12 m 2 s -1 for trace ions, and D e for hardened FAC cement pastes were on the order of 10 -13 m 2 s -1 for chlorine, 10 -14 m 2 s -1 for bromine and 10 -15 m 2 s -1 for iodine. Additionally, the pore size distribution and porosity of FAC changed to more closely packed structure for 13 months by the pozzolanic reaction, and the pore size distribution of FAC (mainly 3-10 nm) were an order of magnitude smaller than that of OPC. These results suggest that the low diffusivity of FAC is based on the continuous change in the pore structure and the nano-scale pore size retarding the migration of trace ions. (author)

Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

Science.gov (United States)

Ku, Bon Ki; Kulkarni, Pramod

2012-05-01

We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

Oxidative Corrosion of the UO ₂ (001) Surface by Nonclassical Diffusion

Energy Technology Data Exchange (ETDEWEB)

Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

2017-11-07

Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

Science.gov (United States)

Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

2016-04-01

Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

Diffusion in the matrix of rocks from Olkiluoto. The effect of anion exclusion

International Nuclear Information System (INIS)

Valkiainen, M.; Aalto, H.; Olin, M.; Lindberg, A.; Siitari-Kauppi, M.

1995-12-01

Diffusion in the rock matrix is dependent on two basic factors: the effective diffusion conductivity of the rock and the rock-capacity factor. The aim of this ongoing research is to study both of these factors more closely by finding evidence and studying the significance of anion exclusion and surface diffusion. The material for the study was selected form the drill-core of the drill-hole OL-KR5 from Olkiluoto investigations site. Six rock-types were included in the study, three unaltered and three altered. The water-types selected can be divided to two groups: in one the ionic strength is varied, in the another the ionic type is varied. The diffusion measurements were carried out partly by the equilibration-leaching method, partly by the through-diffusion method. The measurements by the equilibration-leaching method were performed in the anaerobic cabinet and the through-diffusion measurement in laboratory room conditions. Radioactive isotopes 3 H, 35 S, 36 Cl and 22 Na were selected as tracers. This report contains results of the equilibration-leaching measurements and through- diffusion measurements using 3 H (HTO), 36 Cl (Cl-) and 35 S(SO 4 2- ) as tracers. The rock-types under study were also studied in the University of Helsinki, Department of Chemistry using polymethylmethacrylate labelled with 14 C revealing the pore structure. Also, results of specific surface area measurements made in BAM, Berlin are given. The comparison of results obtained by the gas diffusion method at the University of Jyvaeskylae to the results obtained by tritium are also appended. (12 refs., 20 figs., 10 tabs.)

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

Energy Technology Data Exchange (ETDEWEB)

Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

2010-05-03

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

Applicability of the Fokker-Planck equation to the description of diffusion effects on nucleation

Science.gov (United States)

Sorokin, M. V.; Dubinko, V. I.; Borodin, V. A.

2017-01-01

The nucleation of islands in a supersaturated solution of surface adatoms is considered taking into account the possibility of diffusion profile formation in the island vicinity. It is shown that the treatment of diffusion-controlled cluster growth in terms of the Fokker-Planck equation is justified only provided certain restrictions are satisfied. First of all, the standard requirement that diffusion profiles of adatoms quickly adjust themselves to the actual island sizes (adiabatic principle) can be realized only for sufficiently high island concentration. The adiabatic principle is essential for the probabilities of adatom attachment to and detachment from island edges to be independent of the adatom diffusion profile establishment kinetics, justifying the island nucleation treatment as the Markovian stochastic process. Second, it is shown that the commonly used definition of the "diffusion" coefficient in the Fokker-Planck equation in terms of adatom attachment and detachment rates is justified only provided the attachment and detachment are statistically independent, which is generally not the case for the diffusion-limited growth of islands. We suggest a particular way to define the attachment and detachment rates that allows us to satisfy this requirement as well. When applied to the problem of surface island nucleation, our treatment predicts the steady-state nucleation barrier, which coincides with the conventional thermodynamic expression, even though no thermodynamic equilibrium is assumed and the adatom diffusion is treated explicitly. The effect of adatom diffusional profiles on the nucleation rate preexponential factor is also discussed. Monte Carlo simulation is employed to analyze the applicability domain of the Fokker-Planck equation and the diffusion effect beyond it. It is demonstrated that a diffusional cloud is slowing down the nucleation process for a given monomer interaction with the nucleus edge.

Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

Directory of Open Access Journals (Sweden)

N. Tsukahara

2012-01-01

Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

Urban diffusion problems

International Nuclear Information System (INIS)

Hanna, S.R.

1976-01-01

It is hoped that urban diffusion models of air pollutants can eventually confidently be used to make major decisions, such as in planning the layout of a new industrial park, determining the effects of a new highway on air quality, or estimating the results of a new automobile emissions exhaust system. The urban diffusion model itself should be able to account for point, line, and area sources, and the local aerodynamic effects of street canyons and building wakes. Removal or transformations due to dry or wet deposition and chemical reactions are often important. It would be best if the model included meteorological parameters such as wind speed and temperature as dependent variables, since these parameters vary significantly when air passes from rural surfaces over urban surfaces

Effect of TiO2 additive on the sintering of nuclear fuel (U,Pu)O2. Contribution of surface diffusion to plutonium distribution

International Nuclear Information System (INIS)

Bremier, Stephane

1997-01-01

This thesis has as objective the study of the effect of TiO 2 additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO 2 in the presence of TiO 2 has been established and the influence of the PuO 2 distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO 2 and UO 2 -PuO 2 . The results concerning the influence of TiO 2 upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO 2 alone or in the presence of TiO 2 are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO 2 -PuO 2 preparation upon the initial microstructure of the materials and the role played by the PuO 2 grains in sintering. The potentiality of surface diffusion as a means of PuO 2 spreading in the UO 2 is evaluated and correlated with the reduced capacity of sintering the UO 2 ceramics containing PuO 2 . The last chapter deals with the influence of TiO 2 on the development of microstructure in UO 2 -PuO 2 ceramics. While at temperatures below 1500 deg.C the TiO 2 additive affects the surface diffusion and so the plutonium distribution, at values T≥ 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO 2 , PuO 2 and titanium oxide. Thus the objective is the optimizing the temperature conditions, the oxygen potential as sintering gas and the additive

First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

2014-01-01

Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

Effects on atmospheric diffusion of meterological processes in coastal zones

International Nuclear Information System (INIS)

Raynor, G.S.

1977-01-01

Meteorological processes in coastal zones differ from those inland because of the surface discontinuity between land and water. The difference in heating between the two surfaces gives rise to sea or lake breeze circulations which can transport pollutants in nongradient directions and recirculate them over source areas. The step change in surface characteristics at the land-water interface also causes formation of internal boundary layers having different transport velocities and diffusion rates than unmodified air upwind or above the boundary. These features require a more extensive measurement program and more versatile diffusion models than at inland sites

Non-rigid registration of breast surfaces using the laplace and diffusion equations

Directory of Open Access Journals (Sweden)

Ou Jao J

2010-02-01

Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

Thermodynamics, diffusion and the Kirkendall effect in solids

CERN Document Server

Paul, Aloke; Vuorinen, Vesa; Divinski, Sergiy V

2014-01-01

Covering both basic and advanced thermodynamic and phase  principles,  as well as providing stability diagrams relevant for diffusion studies, Thermodynamics, Diffusion and the Kirkendall Effect in Solids maximizes reader insights into Fick’s laws of diffusion, atomic mechanisms, interdiffusion, intrinsic diffusion, tracer diffusion and the Kirkendall effect. Recent advances in the area of interdiffusion will be introduced, while the many practical examples and large number of illustrations given will serve to aid researches working in this area in learning the practical evaluation of various diffusion parameters from experimental results. With a unique approach to the two main focal points in solid state transformations, energetics (thermodynamics) and kinetics (interdiffusion) are extensively studied and their combined use in practise is discussed. Recent developments in the area of Kirkendall effect, grain boundary diffusion and multicomponent diffusion are also covered extensively. This book will appe...

Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

International Nuclear Information System (INIS)

Strubelj, Luka; Tiselj, Izrok

2008-01-01

Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

Science.gov (United States)

Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

2013-06-01

In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

NARCIS (Netherlands)

Schoots, Koen

2007-01-01

This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

A model for diffuse and global irradiation on horizontal surface

International Nuclear Information System (INIS)

Jain, P.C.

1984-01-01

The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

The influence of excess vacancy generation on the diffusion of ion implanted phosphorus into silicon

International Nuclear Information System (INIS)

Bakowski, A.

1985-01-01

The diffusion of ion implanted phosphorus in silicon has been studied. It was found that the diffusion coefficient is not only dependent on the phosphorus surface concentration (the concentration effect) but also on the conditions at the silicon surface (the surface effect). The phosphorus diffusion coefficient is considerably lower when the silicon surface during annealing is covered with a CVD oxide layer. It is suggested that excess vacancies generated at the surface are reponsible for both the concentration and surface effects. Enhanced phosphorus diffusion is attributed to the disturbance of thermodynamic equilibrium in the crystal through phosphorus-vacancy part formation by vacancies introduced into silicon at the surface. On the basis of the data presented, it can be concluded that two mechanisms for excess vacancy generation are involved. Assuming that phosphorus diffuses via E-centers, calculations of the concentration profiles and the diffusion coefficient were performed for different concentrations and surface conditions. (orig.)

Effects of thermal vapor diffusion on seasonal dynamics of water in the unsaturated zone

Science.gov (United States)

Milly, Paul C.D.

1996-01-01

The response of water in the unsaturated zone to seasonal changes of temperature (T) is determined analytically using the theory of nonisothermal water transport in porous media, and the solutions are tested against field observations of moisture potential and bomb fallout isotopic (36Cl and 3H) concentrations. Seasonally varying land surface temperatures and the resulting subsurface temperature gradients induce thermal vapor diffusion. The annual mean vertical temperature gradient is close to zero; however, the annual mean thermal vapor flux is downward, because the temperature‐dependent vapor diffusion coefficient is larger, on average, during downward diffusion (occurring at high T) than during upward diffusion (low T). The annual mean thermal vapor flux is shown to decay exponentially with depth; the depth (about 1 m) at which it decays to e−1of its surface value is one half of the corresponding decay depth for the amplitude of seasonal temperature changes. This depth‐dependent annual mean flux is effectively a source of water, which must be balanced by a flux divergence associated with other transport processes. In a relatively humid environment the liquid fluxes greatly exceed the thermal vapor fluxes, so such a balance is readily achieved without measurable effect on the dynamics of water in the unsaturated zone. However, if the mean vertical water flux through the unsaturated zone is very small (theoretical prediction is supported by long‐term field measurements in the Chihuahuan Desert. The analysis also makes predictions, confirmed by the field observations, regarding the seasonal variations of matric potential at a given depth. The conceptual model of unsaturated zone water transport developed here implies the possibility of near‐surface trapping of any aqueous constituent introduced at the surface.

Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

Science.gov (United States)

Cox, Trevor John

Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

Second generation diffusion model of interacting gravity waves on the surface of deep fluid

Directory of Open Access Journals (Sweden)

A. Pushkarev

2004-01-01

Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

Electrolyte diffusion in compacted montmorillonite engineered barriers

International Nuclear Information System (INIS)

Jahnke, F.M.; Radke, C.J.

1985-09-01

The bentonite-based engineered barrier or packing is a proposed component of several designs conceived to dispose of high-level nuclear waste in geologic repositories. Once radionuclides escape the waste package, they must first diffuse through the highly impermeable clay-rich barrier before they reach the host repository. To determine the effectiveness of the packing as a sorption barrier in the transient release period and as a mass-transfer barrier in the steady release period over the geologic time scales involved in nuclear waste disposal, a fundamental understanding of the diffusion of electrolytes in compacted clays is required. We present, and compare with laboratory data, a model quantifying the diffusion rates of cationic cesium and uncharged tritium in compacted montmorillonite clay. Neutral tritium characterizes the geometry (i.e., tortuosity) of the particulate gel. After accounting for cation exchange, we find that surface diffusion is the dominant mechanism of cation transport, with an approximate surface diffusion coefficient of 2 x 10 -6 cm 2 /s for cesium. This value increases slightly with increasing background ionic strength. The implications of this work for the packing as a migration barrier are twofold. During the transient release period, K/sub d/ values are of little importance in retarding ion migration. This is because sorption also gives rise to a surface diffusion path, and it is surface diffusion which controls the diffusion rate of highly sorbing cations in compacted montmorillonite. During the steady release period, the presence of surface diffusion leads to a flux through the packing which is greatly enhanced. In either case, if surface diffusion is neglected, the appropriate diffusion coefficient of ions in compacted packing will be in considerable error relative to current design recommendations. 11 refs., 4 figs., 1 tab

Surface sealing using self-assembled monolayers and its effect on metal diffusion in porous low-k dielectrics studied using monoenergetic positron beams

International Nuclear Information System (INIS)

Uedono, Akira; Armini, Silvia; Zhang, Yu; Kakizaki, Takeaki; Krause-Rehberg, Reinhard; Anwand, Wolfgang; Wagner, Andreas

2016-01-01

Graphical abstract: - Highlights: • Pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the low-k film. • For the sample without the SAM sealing process, metal atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. Almost all pore interiors were covered by those metals. • For the sample damaged by a plasma etch treatment before the SAM sealing process, self-assembled molecules diffused into the OSG film, and they were preferentially trapped by larger pores. - Abstract: Surface sealing effects on the diffusion of metal atoms in porous organosilicate glass (OSG) films were studied by monoenergetic positron beams. For a Cu(5 nm)/MnN(3 nm)/OSG(130 nm) sample fabricated with pore stuffing, C_4F_8 plasma etch, unstuffing, and a self-assembled monolayer (SAM) sealing process, it was found that pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the OSG film. For the sample without the SAM sealing process, metal (Cu and Mn) atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. As a result, almost all pore interiors were covered with those metals. For the sample damaged by an Ar/C_4F_8 plasma etch treatment before the SAM sealing process, SAMs diffused into the OSG film, and they were preferentially trapped by larger pores. The cubic pore side length in these pores containing self-assembled molecules was estimated to be 0.7 nm. Through this work, we have demonstrated that monoenergetic positron beams are a powerful tool for characterizing capped porous films and the trapping of atoms and molecules by pores.

An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

Directory of Open Access Journals (Sweden)

Yan-Zi Yu

2015-01-01

Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

Transport and diffusion on crystalline surfaces under external forces

International Nuclear Information System (INIS)

Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

2005-01-01

We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

International Nuclear Information System (INIS)

Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

2016-01-01

A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

Measurements of cesium and strontium diffusion in biotite gneiss

International Nuclear Information System (INIS)

Skagius, K.; Neretnieks, I.

1988-01-01

A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interactions between the nuclides in the ground water and the rock material, such as sorption. To calculate the retardation, it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result shows that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurement of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel

Diffusion measurements of cesium and strontium in biotite gneiss

International Nuclear Information System (INIS)

Skagius, K.; Neretnieks, I.

1985-01-01

A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interaction between the nuclides in the groundwater and the rock material, such as sorption. To calculate the retardation it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result show that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurements of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel. (author)

Effects of repository environment on diffusion behavior of radionuclides in buffer materials

International Nuclear Information System (INIS)

Kozaki, Tamotsu; Sato, Seichi

2004-03-01

Compacted bentonite is considered as a candidate buffer material in the geological disposal of high-level radioactive waste. An important function of the compacted bentonite is to retard the transport of radionuclides from waste forms to the surrounding host rock after degradation of an overpack. Therefore, diffusion behavior of radionuclides in the compacted bentonite has been extensively studied by many researchers for the performance assessments of the geological disposal. However, diffusion mechanism of radionuclides in the bentonite cannot be fully understood, and most experimental data have been obtained at room temperature for the bentonite saturated with low salinity water, which would disagree often with real repository conditions. In this study, therefore, apparent diffusion coefficients were determined at various diffusion temperatures for chloride ions in Na-montmorillonite samples saturated with NaCl solution of high salinity. Activation energies for the apparent diffusion were also obtained from the temperature dependence of the diffusion coefficients at different salinity. As the salinity increased, the apparent diffusion coefficients of chloride ions in montmorillonite were found to increase slightly. On the other hand, the activation energies for the chloride diffusion were found to be almost constant (approximately 12 kJ mol -1 ) and less than that in free water (17.4 kJ mol -1 ). Effects of salinity on diffusion behavior of radionuclides in montmorillonite were discussed from the viewpoints of microstructure of montmorillonite and distribution of ions in the montmorillonite. As a result, the diffusion behavior of sodium ions could be explained by the changes of the predominant diffusion process among pore water diffusion, surface diffusion, and interlayer diffusion that could be caused by the increase of salinity. (author)

Hydrogen Diffusion and H{sub 2}S Corrosion in Steel

Energy Technology Data Exchange (ETDEWEB)

Haugstveit, Bjarte Erlend

2001-01-01

The electrochemical permeation technique introduced by Devanathan and Stachurski has been used to measure the effective diffusivity of hydrogen in steel in a H{sub 2}S-saturated aqueous environment. The linear polarization resistance (LPR) method has been used to measure the corrosion rate. The effective diffusion coefficient of hydrogen has been found to be in the range of 1*10-12 to 7*10-11, depending on the environmental conditions. The corrosion film was identified as mackinawite, and it affected the permeation process of hydrogen. The results supported the assumption that the diffusion process can be described by a three layer model and indicated that the model could be reduced to a two layer model in the cases of iron and steel. A model aimed to describe the reaction pathway of hydrogen through the surface film and into the steel is proposed. The corrosion film influenced the corrosion rate, and it was least protective against corrosion at pH 6.5. Corrosion rates were in the range of 0.2-1 mm/year. The corrosion rate was increased significantly at pH 3.5, but the effect of the surface film was stronger and overshadowed the pH effect at the higher pH values. Increased flow velocity also lead to increased corrosion rate, but this effect was less significant compared to the effect of pH and the surface film. DEG decreased the corrosion rate. The uncertainty in the diffusion measurements was mainly due to the assumption of a constant sub-surface concentration of atomic hydrogen, which was not fulfilled. A method less dependent on constant surface conditions would probably yield better estimates of the effective diffusivity. The uncertainty in the corrosion measurements was mainly due to the uncertainty in the value of the Stern-Geary constant. The qualitative assumptions based on the results in this thesis are assumed to be valid. A test section designed for this thesis was tested and was found successful in corrosion rate measurements, but proved to be

The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

Directory of Open Access Journals (Sweden)

K.A. Widi

2016-09-01

Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Energy Technology Data Exchange (ETDEWEB)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

2015-01-15

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Science.gov (United States)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

International Nuclear Information System (INIS)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

Science.gov (United States)

Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

2014-08-21

The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

Science.gov (United States)

Boisvert, Ghyslain

Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

Science.gov (United States)

Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

2018-05-01

Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

Energy Technology Data Exchange (ETDEWEB)

Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

1996-01-12

The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

Numerical model for atmospheric diffusion analysis and evaluation of effective dose for safety analysis

International Nuclear Information System (INIS)

Sada, Koichi; Michioka, Takenobu; Ichikawa, Yoichi; Komiyama, Sumito

2009-01-01

A numerical simulation method has been developed to predict atmospheric flow and stack gas diffusion, considering the buildings and complex terrain located near and relatively far from a stack, respectively. The turbulence closure technique was used for flow calculation, some calculation grids on the ground near a stack were treated as buildings, and stack gas diffusion was predicted using the Lagrangian particle model. The calculated flow and stack gas diffusion results were compared with those obtained by wind tunnel experiments under actual terrain containing buildings. Effective stack height was estimated by comparing the surface concentration along the plume axis with those under a flat-plate condition, and it was apparent that the effective stack heights estimated by calculations were almost the same as those obtained by the wind tunnel experiment. Then, the effective dose and relative concentration of stack gas were calculated using the effective stack heights obtained by a numerical model. Almost the same effective dose and relative concentration were obtained when compared with those using the effective stack height obtained by wind tunnel experiment. (author)

Boron Diffusion in Surface-Treated Framing Lumber

Science.gov (United States)

Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson

2013-01-01

The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...

Surface treatment systems for concrete in marine environment: Effect of concrete cover thickness

Directory of Open Access Journals (Sweden)

Marcelo Henrique Farias de Medeiros

Full Text Available Abstract There are some ways to extend the service life of a reinforced concrete structure. This paper focuses on the extension of the service life by treating the surface of reinforced concrete, specifically on the effect of the concrete cover thickness on the surface treatment system efficacy. Thus, chloride migration tests were performed and diffusion chloride coefficients were calculated. The service life of each case (treated or non-treated concrete was estimated using these data and Fick's second law of diffusion. Results indicated that the thicker the concrete cover is, the greater the efficacy of the concrete surface treatment system will be. The dissemination of this information is important, since it is almost intuitive to think that the effect of a surface treatment system depends only on itself and this study shows the opposite.

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

International Nuclear Information System (INIS)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-01-01

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

Energy Technology Data Exchange (ETDEWEB)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-12-14

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

Science.gov (United States)

Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

2017-05-17

A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

DEFF Research Database (Denmark)

Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

1996-01-01

and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

Study of Surface Wettability Change of Unconsolidated Sand Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy and Thermogravimetric Analysis.

Science.gov (United States)

Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V

2018-04-01

The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.

Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

Directory of Open Access Journals (Sweden)

Sorenson Donna J

2009-12-01

Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

Directory of Open Access Journals (Sweden)

Saiful Islam

2008-01-01

Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

Science.gov (United States)

Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

2017-01-01

The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

Moisture diffusivity in structure of random fractal fiber bed

Energy Technology Data Exchange (ETDEWEB)

Zhu, Fanglong, E-mail: zhufanglong_168@163.com [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); The Chinese People' s Armed Police Forces Academy, Langfan City (China); Zhou, Yu; Feng, Qianqian [College of Textile, Zhongyuan University of Technology, Zhengzhou City (China); Xia, Dehong [School of Mechanical Engineering, University of Science and Technology, Beijing (China)

2013-11-08

A theoretical expression related to effective moisture diffusivity to random fiber bed is derived by using fractal theory and considering both parallel and perpendicular channels to diffusion flow direction. In this Letter, macroporous structure of hydrophobic nonwoven material is investigated, and Knudsen diffusion and surface diffusion are neglected. The effective moisture diffusivity predicted by the present fractal model are compared with water vapor transfer rate (WVTR) experiment data and calculated values obtained from other theoretical models. This verifies the validity of the present fractal diffusivity of fibrous structural beds.

Symmetrical and overloaded effect of diffusion in information filtering

Science.gov (United States)

Zhu, Xuzhen; Tian, Hui; Chen, Guilin; Cai, Shimin

2017-10-01

In physical dynamics, mass diffusion theory has been applied to design effective information filtering models on bipartite network. In previous works, researchers unilaterally believe objects' similarities are determined by single directional mass diffusion from the collected object to the uncollected, meanwhile, inadvertently ignore adverse influence of diffusion overload. It in some extent veils the essence of diffusion in physical dynamics and hurts the recommendation accuracy and diversity. After delicate investigation, we argue that symmetrical diffusion effectively discloses essence of mass diffusion, and high diffusion overload should be published. Accordingly, in this paper, we propose an symmetrical and overload penalized diffusion based model (SOPD), which shows excellent performances in extensive experiments on benchmark datasets Movielens and Netflix.

Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

Science.gov (United States)

Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

2004-07-05

Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

Excluded-volume effects in the diffusion of hard spheres

KAUST Repository

Bruna, Maria

2012-01-03

Excluded-volume effects can play an important role in determining transport properties in diffusion of particles. Here, the diffusion of finite-sized hard-core interacting particles in two or three dimensions is considered systematically using the method of matched asymptotic expansions. The result is a nonlinear diffusion equation for the one-particle distribution function, with excluded-volume effects enhancing the overall collective diffusion rate. An expression for the effective (collective) diffusion coefficient is obtained. Stochastic simulations of the full particle system are shown to compare well with the solution of this equation for two examples. © 2012 American Physical Society.

Effect of Porosity and Concentration Polarization on Electrolyte Diffusive Transport Parameters through Ceramic Membranes with Similar Nanopore Size

Directory of Open Access Journals (Sweden)

Virginia Romero

2014-08-01

Full Text Available Diffusive transport through nanoporous alumina membranes (NPAMs produced by the two-step anodization method, with similar pore size but different porosity, is studied by analyzing membrane potential measured with NaCl solutions at different concentrations. Donnan exclusion of co-ions at the solution/membrane interface seem to exert a certain control on the diffusive transport of ions through NPAMs with low porosity, which might be reduced by coating the membrane surface with appropriated materials, as it is the case of SiO2. Our results also show the effect of concentration polarization at the membrane surface on ionic transport numbers (or diffusion coefficients for low-porosity and high electrolyte affinity membranes, which could mask values of those characteristic electrochemical parameters.

Random diffusion and leverage effect in financial markets.

Science.gov (United States)

Perelló, Josep; Masoliver, Jaume

2003-03-01

We prove that Brownian market models with random diffusion coefficients provide an exact measure of the leverage effect [J-P. Bouchaud et al., Phys. Rev. Lett. 87, 228701 (2001)]. This empirical fact asserts that past returns are anticorrelated with future diffusion coefficient. Several models with random diffusion have been suggested but without a quantitative study of the leverage effect. Our analysis lets us to fully estimate all parameters involved and allows a deeper study of correlated random diffusion models that may have practical implications for many aspects of financial markets.

Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

Science.gov (United States)

Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

2017-01-01

Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

Diffusion processes and memory effects

International Nuclear Information System (INIS)

Mokshin, Anatolii V; Yulmetyev, Renat M; Haenggi, Peter

2005-01-01

We report the results of the numerical estimation of statistical memory effects in diffusion for two various systems: Lennard-Jones fluids and the model of the Brownian particle in a one-dimensional harmonic lattice. We have found the relation between the diffusion coefficient and the non-Markovity parameter, which is linear for the Lennard-Jones systems in liquid state. The relation between the memory measure and the excess entropy is also discussed here

Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

International Nuclear Information System (INIS)

Lou, D.C.; Solberg, J.K.; Borvik, T.

2009-01-01

This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

Heat Diffusion in Gases, Including Effects of Chemical Reaction

Science.gov (United States)

Hansen, C. Frederick

1960-01-01

The diffusion of heat through gases is treated where the coefficients of thermal conductivity and diffusivity are functions of temperature. The diffusivity is taken proportional to the integral of thermal conductivity, where the gas is ideal, and is considered constant over the temperature interval in which a chemical reaction occurs. The heat diffusion equation is then solved numerically for a semi-infinite gas medium with constant initial and boundary conditions. These solutions are in a dimensionless form applicable to gases in general, and they are used, along with measured shock velocity and heat flux through a shock reflecting surface, to evaluate the integral of thermal conductivity for air up to 5000 degrees Kelvin. This integral has the properties of a heat flux potential and replaces temperature as the dependent variable for problems of heat diffusion in media with variable coefficients. Examples are given in which the heat flux at the stagnation region of blunt hypersonic bodies is expressed in terms of this potential.

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

NARCIS (Netherlands)

Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

Directory of Open Access Journals (Sweden)

Kaewploy Somsak

2015-01-01

Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

International Nuclear Information System (INIS)

Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

2014-01-01

Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

International Nuclear Information System (INIS)

Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

2009-01-01

Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

Modeling diffuse sources of surface water contamination with plant protection products

Science.gov (United States)

Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

2015-04-01

Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

Effects of rational surface density on resistive g turbulence

International Nuclear Information System (INIS)

Beklemishev, A.D.; Sugama, H.; Horton, W.

1993-01-01

The Beklemishev-Horton theory states that the anomalous transport coefficient is proportional to the density of rational surfaces provided that the interaction between the modes localized around different rational surfaces is weak compared with modes of the same helicity. The authors examine the effects of the density of states ρ using resistive g turbulence in 2D (single-helicity) and 3D (multi-helicity) simulations. They find that the modes with different helicities do not equipartition the available energy, but rather the coalescence or inverse cascade effect is strong so that a few low order mode rational surfaces receive most of the energy. The quasilinear flattening at the surfaces is a strong effect and they use bifurcation theory to derive that the effective diffusivity increases as χ eff = χ 0 ρ/(1 - Cρ) where C is a constant determined by interaction integrals. For a sufficiently high density of states Cρ ≤ 1, the higher order nonlinear interaction must be taken into account

Diffusion in coastal and harbour zones, effects of Waves,Wind and Currents

Science.gov (United States)

Diez, M.; Redondo, J. M.

2009-04-01

As there are multiple processes at different scales that produce turbulent mixing in the ocean, thus giving a large variation of horizontal eddy diffusivities, we use a direct method to evaluate the influence of different ambient parameters such as wave height and wind on coastal dispersion. Measurements of the diffusivity are made by digital processing of images taken from from video recordings of the sea surface near the coast. The use of image analysis allows to estimate both spatial and temporal characteristics of wave fields, surface circulation and mixing in the surf zone, near Wave breakers and inside Harbours. The study of near-shore dispersion [1], with the added complexity of the interaction between wave fields, longshore currents, turbulence and beach morphology, needs detailed measurements of simple mixing processes to compare the respective influences of forcings at different scales. The measurements include simultaneous time series of waves, currents, wind velocities from the studied area. Cuantitative information from the video images is accomplished using the DigImage video processing system [3], and a frame grabber. The video may be controlled by the computer, allowing, remote control of the processing. Spectral analysis on the images has also used n order to estimate dominant wave periods as well as the dispersion relations of dominant instabilities. The measurements presented here consist mostly on the comarison of difussion coeficients measured by evaluating the spread of blobs of dye (milk) as well as by measuring the separation between different buoys released at the same time. We have used a techniques, developed by Bahia(1997), Diez(1998) and Bezerra(2000)[1-3] to study turbulent diffusion by means of digital processing of images taken from remote sensing and video recordings of the sea surface. The use of image analysis allows to measure variations of several decades in horizontal diffusivity values, the comparison of the diffusivities

Germania and Alumina Dopant Diffusion and Viscous Flow Effects at Preparation of Doped Optical Fibers

Directory of Open Access Journals (Sweden)

Jens Kobelke

2017-01-01

Full Text Available We report on germania and alumina dopant profile shift effects at preparation of compact optical fibers using packaging methods (Stack-and-Draw method, Rod-in-Tube (RiT technique. The sintering of package hollow volume by viscous flow results in a shift of the core-pitch ratio in all-solid microstructured fibers. The ratio is increased by about 5% in the case of a hexagonal package. The shift by diffusion effects of both dopants is simulated for typical slow speed drawing parameters. Thermodynamic approximations of surface dissociation of germania doped silica suggest the need of an adequate undoped silica barrier layer to prevent an undesired bubble formation at fiber drawing. In contrast, alumina doping does not estimate critical dissociation effects with vaporous aluminium oxide components. We report guide values of diffusion length of germania and alumina for the drawing process by kinetic approximation. The germania diffusion involves a small core enlargement, typically in the sub-micrometer scale. Though, the alumina diffusion enlarges it by a few micrometers. A drawn pure alumina preform core rod transforms to an amorphous aluminosilicate core with a molar alumina concentration of only about 50% and a non-gaussian concentration profile.

An inverse diffusivity problem for the helium production–diffusion equation

International Nuclear Information System (INIS)

Bao, Gang; Xu, Xiang

2012-01-01

Thermochronology is a technique for the extraction of information about the thermal history of rocks. Such information is crucial for determining the depth below the surface at which rocks were located at a given time (Bao G et al 2011 Commun. Comput. Phys. 9 129). Mathematically, extracting the time–temperature path can be formulated as an inverse diffusivity problem for the helium production–diffusion equation which is the underlying process of thermochronology. In this paper, to reconstruct the diffusivity which depends on space only and accounts for the structural information of rocks, a local Hölder conditional stability is obtained by a Carleman estimate. A uniqueness result is also proven for extracting the thermal history, i.e. identifying the time-dependant part of the diffusion coefficient, provided that it is analytical with respect to time. Numerical examples are presented to illustrate the validity and effectiveness of the proposed regularization scheme. (paper)

The effects of diffusion in hot subdwarf progenitors from the common envelope channel

Science.gov (United States)

Byrne, Conor M.; Jeffery, C. Simon; Tout, Christopher A.; Hu, Haili

2018-04-01

Diffusion of elements in the atmosphere and envelope of a star can drastically alter its surface composition, leading to extreme chemical peculiarities. We consider the case of hot subdwarfs, where surface helium abundances range from practically zero to almost 100 percent. Since hot subdwarfs can form via a number of different evolution channels, a key question concerns how the formation mechanism is connected to the present surface chemistry. A sequence of extreme horizontal branch star models was generated by producing post-common envelope stars from red giants. Evolution was computed with MESA from envelope ejection up to core-helium ignition. Surface abundances were calculated at the zero-age horizontal branch for models with and without diffusion. A number of simulations also included radiative levitation. The goal was to study surface chemistry during evolution from cool giant to hot subdwarf and determine when the characteristic subdwarf surface is established. Only stars leaving the giant branch close to core-helium ignition become hydrogen-rich subdwarfs at the zero-age horizontal branch. Diffusion, including radiative levitation, depletes the initial surface helium in all cases. All subdwarf models rapidly become more depleted than observations allow. Surface abundances of other elements follow observed trends in general, but not in detail. Additional physics is required.

Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

International Nuclear Information System (INIS)

Kutovyi, V.A.; Komir, A.I.

2013-01-01

The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

Effective reaction rates in diffusion-limited phosphorylation-dephosphorylation cycles

Science.gov (United States)

Szymańska, Paulina; Kochańczyk, Marek; Miekisz, Jacek; Lipniacki, Tomasz

2015-02-01

We investigate the kinetics of the ubiquitous phosphorylation-dephosphorylation cycle on biological membranes by means of kinetic Monte Carlo simulations on the triangular lattice. We establish the dependence of effective macroscopic reaction rate coefficients as well as the steady-state phosphorylated substrate fraction on the diffusion coefficient and concentrations of opposing enzymes: kinases and phosphatases. In the limits of zero and infinite diffusion, the numerical results agree with analytical predictions; these two limits give the lower and the upper bound for the macroscopic rate coefficients, respectively. In the zero-diffusion limit, which is important in the analysis of dense systems, phosphorylation and dephosphorylation reactions can convert only these substrates which remain in contact with opposing enzymes. In the most studied regime of nonzero but small diffusion, a contribution linearly proportional to the diffusion coefficient appears in the reaction rate. In this regime, the presence of opposing enzymes creates inhomogeneities in the (de)phosphorylated substrate distributions: The spatial correlation function shows that enzymes are surrounded by clouds of converted substrates. This effect becomes important at low enzyme concentrations, substantially lowering effective reaction rates. Effective reaction rates decrease with decreasing diffusion and this dependence is more pronounced for the less-abundant enzyme. Consequently, the steady-state fraction of phosphorylated substrates can increase or decrease with diffusion, depending on relative concentrations of both enzymes. Additionally, steady states are controlled by molecular crowders which, mostly by lowering the effective diffusion of reactants, favor the more abundant enzyme.

Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

Science.gov (United States)

Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

2016-12-01

The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

Laser-induced pressure-wave and barocaloric effect during flash diffusivity measurements

International Nuclear Information System (INIS)

Wang, Hsin; Porter, Wallace D.; Dinwiddie, Ralph Barton

2017-01-01

We report laser-induced pressure-wave and barocaloric effect captured by an infrared detector during thermal diffusivity measurements. Very fast (< 1 ms) and negative transients during laser flash measurements were captured by the infrared detector on thin, high thermal conductivity samples. Standard thermal diffusivity analysis only focuses the longer time scale thermal transient measured from the back surface due to thermal conduction. These negative spikes are filtered out and ignored as noise or anomaly from instrument. This study confirmed that the initial negative signal was indeed a temperature drop induced by the laser pulse. The laser pulse induced instantaneous volume expansion and the associated cooling in the specimen can be explained by the barocaloric effect. The initial cooling (< 100 microsecond) is also known as thermoelastic effect in which a negative temperature change is generated when the material is elastically deformed by volume expansion. A subsequent temperature oscillation in the sample was observed and only lasted about one millisecond. The pressure-wave induced thermal signal was systematically studied and analyzed. In conclusion, the underlying physics of photon-mechanical-thermal energy conversions and the potential of using this signal to study barocaloric effects in solids are discussed.

Nuclear diffuseness as a degree of freedom

Science.gov (United States)

Myers, W. D.; ŚwiaŢecki, W. J.

1998-12-01

The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Süssmann width b.

Nuclear diffuseness as a degree of freedom

International Nuclear Information System (INIS)

Myers, W.D.; Swiatecki, W.J.

1998-01-01

The response of the nuclear energy to changes in neutron and proton surface diffusenesses is investigated using the Thomas-Fermi model. Algebraic expressions are provided for the energy cost of changing the two diffusenesses away from their equilibrium values. This will make it possible to generalize the macroscopic-microscopic calculations of nuclear masses and deformation energies by the inclusion of the neutron and proton diffusenesses as degrees of freedom (to be varied along with the shape degrees of freedom). One result, which is suggested by the relatively low cost in macroscopic energy of increasing the diffuseness of a heavy nucleus by 10% (about 4 MeV), is that superheavy nuclei near Z=126, N=184 may have a fair chance of becoming stabilized by shell effects. An appendix introduces an improved measure of surface diffuseness, with certain advantages over the conventional Suessmann width b. copyright 1998 The American Physical Society

Effects of Impeller-Diffuser Interaction on Centrifugal Compressor Performance

Science.gov (United States)

Tan, Choon S.

2003-01-01

This research program focuses on characterizing the effect of impeller-diffuser interactions in a centrifugal compressor stage on its performance using unsteady threedimensional Reynolds-averaged Navier-Stokes simulations. The computed results show that the interaction between the downstream diffuser pressure field and the impeller tip clearance flow can account for performance changes in the impeller. The magnitude of performance change due to this interaction was examined for an impeller with varying tip clearance followed by a vaned or vaneless diffuser. The impact of unsteady impeller-diffuser interaction, primarily through the impeller tip clearance flow, is reflected through a time-averaged change in impeller loss, blockage and slip. The results show that there exists a tip clearance where the beneficial effect of the impeller-diffuser interaction on the impeller performance is at a maximum. A flow feature that consists of tip flow back leakage was shown to occur at design speed for the centrifugal compressor stage. This flow phenomenon is described as tip flow that originates in one passage, flows downstream of the impeller trailing edge and then returns to upstream of the impeller trailing edge of a neighboring passage. Such a flow feature is a source of loss in the impeller. A hypothesis is put forth to show that changing the diffuser vane count and changing impeller-diffuser gap has an analogous effect on the impeller performance. The centrifugal compressor stage was analyzed using diffusers of different vane counts, producing an impeller performance trend similar to that when the impeller-diffuser gap was varied, thus supporting the hypothesis made. This has the implication that the effect impeller performance associated with changing the impeller-diffuser gap and changing diffuser vane count can be described by the non-dimensional ratio of impeller-diffuser gap to diffuser vane pitch. A procedure is proposed and developed for isolating impeller passage

Effects of Defects on Hydrogen Diffusion in NbC

Energy Technology Data Exchange (ETDEWEB)

Salehinia, Iman, E-mail: isalehinia@niu.edu [Department of Mechanical Engineering, Northern Illinois University, DeKalb, IL 60115 (United States); Mastorakos, Ioannis [Department of Mechanical and Aeronautical Engineering, Clarkson University, Potsdam, NY 13699 (United States); Zbib, Hussein M. [School of Mechanical and Materials Engineering, Washington State University, Pullman, WA 99164 (United States)

2017-04-15

Highlights: • MD simulations are used to study the effects of defects on the H diffusion in NbC. • Buckingham potential is more accurate for diffusion of H atoms than LJ potential. • H diffusion coefficient (D) increases with carbon vacancy concentration. • H diffusion coefficient for 6 Å pore (radius = 6 Å) is as high as that for 20 Å pore. • For small pores, H diffusion coefficient drops notably at elevated temperatures. - Abstract: Exceptional mechanical and physical properties of transition metal carbides and nitrides make them good coating-material candidates for extreme corrosive environments such as oil and natural gas wells. However, existence of small pores, pinholes and columnar structures of these ceramics significantly affect their resistance to corrosion, as pore sites would accelerate the diffusion of corrosive media into the substrate. In this research, molecular dynamics atomistic simulations are employed to investigate the effects of the isolated vacancies and the columnar structure on the diffusion rate of H atoms in NbC single crystal at various temperatures. Diffusion coefficient (D) of H atoms in NbC increased with C vacancy concentration. At elevated temperatures, the trapping effect of Nb vacancies is less effective when C vacancies are also present, as H atoms gain enough energy to jump back and forth between the C vacancies. Atomistic simulations also showed a jump in diffusion coefficient for cylindrical pore size of larger than 3 Å radius. Furthermore, D increased monotonically with temperature up to 1000 K in the presence of cylindrical pores. Further increase in temperature resulted in a drop in the diffusion coefficient for small pores while the large pores only showed a lower increasing trend in diffusion coefficient with the temperature.

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

Energy Technology Data Exchange (ETDEWEB)

Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

2014-02-28

A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

Diffraction and diffusion in room acoustics

DEFF Research Database (Denmark)

Rindel, Jens Holger; Rasmussen, Birgit

1996-01-01

Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....

Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

International Nuclear Information System (INIS)

El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

2010-01-01

The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

Calculating effective diffusivities in the limit of vanishing molecular diffusion

International Nuclear Information System (INIS)

Pavliotis, G.A.; Stuart, A.M.; Zygalakis, K.C.

2009-01-01

In this paper we study the problem of the numerical calculation (by Monte Carlo methods) of the effective diffusivity for a particle moving in a periodic divergent-free velocity field, in the limit of vanishing molecular diffusion. In this limit traditional numerical methods typically fail, since they do not represent accurately the geometry of the underlying deterministic dynamics. We propose a stochastic splitting method that takes into account the volume-preserving property of the equations of motion in the absence of noise, and when inertial effects can be neglected. An extension of the method is then proposed for the cases where the noise has a non-trivial time-correlation structure and when inertial effects cannot be neglected. The method of modified equations is used to explain failings of Euler-based methods. The new stochastic geometric integrators are shown to outperform standard Euler-based integrators. Various asymptotic limits of physical interest are investigated by means of numerical experiments, using the new integrators

Effects of carbon on phosphorus diffusion in SiGe:C and the implications on phosphorus diffusion mechanisms

International Nuclear Information System (INIS)

Lin, Yiheng; Xia, Guangrui; Yasuda, Hiroshi; Wise, Rick; Schiekofer, Manfred; Benna, Bernhard

2014-01-01

The use of carbon (C) in SiGe base layers is an important approach to control the base layer dopant phosphorus (P) diffusion and thus enhance PNP heterojunction bipolar transistor (HBT) performance. This work quantitatively investigated the carbon impacts on P diffusion in Si 0.82 Ge 0.18 :C and Si:C under rapid thermal anneal conditions. The carbon molar fraction is up to 0.32%. The results showed that the carbon retardation effect on P diffusion is less effective for Si 0.82 Ge 0.18 :C than for Si:C. In Si 0.82 Ge 0.18 :C, there is an optimum carbon content at around 0.05% to 0.1%, beyond which more carbon incorporation does not retard P diffusion any more. This behavior is different from the P diffusion behavior in Si:C and the B in Si:C and low Ge SiGe:C, which can be explained by the decreased interstitial-mediated diffusion fraction f I P, SiGe to 95% as Ge content increases to 18%. Empirical models were established to calculate the time-averaged point defect concentrations and effective diffusivities as a function of carbon and was shown to agree with previous studies on boron, phosphorus, arsenic and antimony diffusion with carbon.

Diffusion of multiple species with excluded-volume effects

KAUST Repository

Bruna, Maria; Chapman, S. Jonathan

2012-01-01

Stochastic models of diffusion with excluded-volume effects are used to model many biological and physical systems at a discrete level. The average properties of the population may be described by a continuum model based on partial differential equations. In this paper we consider multiple interacting subpopulations/species and study how the inter-species competition emerges at the population level. Each individual is described as a finite-size hard core interacting particle undergoing Brownian motion. The link between the discrete stochastic equations of motion and the continuum model is considered systematically using the method of matched asymptotic expansions. The system for two species leads to a nonlinear cross-diffusion system for each subpopulation, which captures the enhancement of the effective diffusion rate due to excluded-volume interactions between particles of the same species, and the diminishment due to particles of the other species. This model can explain two alternative notions of the diffusion coefficient that are often confounded, namely collective diffusion and self-diffusion. Simulations of the discrete system show good agreement with the analytic results. © 2012 American Institute of Physics.

On the morphological change of solids by vacancy diffusion under the effect of interfacial tensions and applied stresses

International Nuclear Information System (INIS)

Felsen, M.F.

1979-01-01

The morphological change of solids by diffusion under the effect of interfacial tensions and applied stresses is studied by voids annealing and diffusion creep at intermediate and elevated temperatures respectively. In all cases, it has been shown that the evolution kinetic is controlled by vacancy diffusion and that interfaces are ideal sinks. Furthermore, the influence of additional elements on the surface tension of a pure metal is determined for the first time with the voids annealing technique, assuming that the self diffusion coefficient of the metal is not affected by small amount of impurities. The diffusion creep theory is modified to include the interfacial tension effects in the boundary conditions of the diffusion problem which gives a zero creep stress expression very different to those yet published, but the creep equation retains its classical form. The above experiments were carried out using an original device which allows verification of the creep equation to a great precision and to study the range of stresses between Nabarro and Weertman creep. Finally, some creep tests realised on two-phase alloys show that the strain is induced by diffusion [fr

Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

Energy Technology Data Exchange (ETDEWEB)

Lawrenz, M.

2007-10-30

In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

The effects of surface treatments on rapid chloride permeability tests

KAUST Repository

Yoon, Seyoon

2012-08-01

Surface treatments are commonly applied to improve the chloride resistance of concrete structures exposed to saline environments. Information on chloride ingress to surface-treated concrete is mostly provided by application of the rapid chloride permeability test (RCPT); this test is short in duration and provides rapid results. This study presents a numerical formulation, based on the extended Nernst-Plank/Poisson (NPP) equation, to model the effect of the surface treatment on a sample tested by RCPT. Predictions of the model are compared to experimental measurements. The simulations show that the results from RCPT, in terms of ionic profiles and measurement of the electric field, are dependent on the effectiveness of surface treatments. During RCPT, highly effective surface treatments cause both cations and anions to flocculate at the interface between the surface treatment and the concrete, creating a local electric field. Our numerical model includes these phenomena and presents a methodology to obtain more accurate diffusivities of the surface-treated- concrete from RCPT. © 2012 Elsevier B.V. All rights reserved.

The effects of surface treatments on rapid chloride permeability tests

KAUST Repository

Yoon, Seyoon; Oh, Sang-gyun; Ha, Juyoung; Monteiro, Paulo M.

2012-01-01

Surface treatments are commonly applied to improve the chloride resistance of concrete structures exposed to saline environments. Information on chloride ingress to surface-treated concrete is mostly provided by application of the rapid chloride permeability test (RCPT); this test is short in duration and provides rapid results. This study presents a numerical formulation, based on the extended Nernst-Plank/Poisson (NPP) equation, to model the effect of the surface treatment on a sample tested by RCPT. Predictions of the model are compared to experimental measurements. The simulations show that the results from RCPT, in terms of ionic profiles and measurement of the electric field, are dependent on the effectiveness of surface treatments. During RCPT, highly effective surface treatments cause both cations and anions to flocculate at the interface between the surface treatment and the concrete, creating a local electric field. Our numerical model includes these phenomena and presents a methodology to obtain more accurate diffusivities of the surface-treated- concrete from RCPT. © 2012 Elsevier B.V. All rights reserved.

Effect of sodium diffused into Bridgman CuInSe{sub 2+x}

Energy Technology Data Exchange (ETDEWEB)

Park, Sunyoung, E-mail: sunyoung.park@mail.mcgill.ca; Champness, Clifford H.; Shih, Ishiang

2016-10-15

Highlights: For elemental Na diffused into Bridgman CuInSe2 samples: • Diffusion is deep and relatively fast, with a coefficient of 10{sup −10} to 10{sup −8} cm{sup 2}/s at 250 °C. • Creates clear n/p homojunctions in the chalcopyrite. • Creates, after subsequent air annealing, an XPS Se 3d peak at 59 eV for Na{sub 2}SeO{sub 3}. • Increases the XPS-determined [Se]/[Cu] concentration ratio at the sample surface. - Abstract: The study describes diffusion of elemental sodium into p-type samples of Bridgman-grown CuInSe{sub 2+x}, causing a change from p- to n-type behavior at the surface and deep into the material. This resulted in the creation of Na 1s and Se 3d XPS peaks at binding energies of 1071 and 54.5 eV respectively, where the latter has been attributed to CuInSe{sub 2} itself. Subsequent annealing of the samples in air gave rise to a second Se 3d peak at 59 eV, attributed to Na{sub 2}SeO{sub 3} by oxidation of Na{sub 2}Se. However, SeO{sub 2} also gives a peak at about the same binding energy. The presence of the diffused-in Na up to about 10% at the surface appears to promote the creation of a high ratio [Se]/[Cu] compound at the expense of the chalcopyrite at the sample surface. The diffused-in samples showed n/p homojunctions at depths of tens of microns for stoichiometric CuInSe{sub 2} and at smaller depths for CuInSe{sub 2.2}, with excess Se content. Estimates of the diffusion coefficient for Na into the Bridgman samples at 250 °C were in the range of 10{sup −10}–10{sup −8} cm{sup 2}/s.

Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

International Nuclear Information System (INIS)

Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

2016-01-01

We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

Science.gov (United States)

Li, Xiaofan; Nie, Qing

2009-07-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium-sulfur battery design.

Science.gov (United States)

Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

2016-04-05

Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.

Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium–sulfur battery design

Science.gov (United States)

Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

2016-01-01

Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216

Effective diffusion in laminar convective flows

International Nuclear Information System (INIS)

Rosenbluth, M.N.; Berk, H.L.; Doxas, I.; Horton, W.

1987-03-01

The effective diffusion coefficient D* of a passive component, such as test particles, dye, temperature, magnetic flux, etc., is derived for motion in periodic two-dimensional incompressible convective flow with characteristic velocity v and size d in the presence of an intrinsic local diffusivity D. Asymptotic solutions for effective diffusivity D*(P) in the large P limit, with P ∼ vd/D, is shown to be of the form D* = cDP/sup 1/2/ with c being a coefficient that is determined analytically. The constant c depends on the geometry of the convective cell and on an average of the flow speed along the separatrix. The asymptotic method of evaluation applies to both free boundary and rough boundary flow patterns and it is shown that the method can be extended to more complicated patterns such as the flows generated by rotating cylinders, as in the problem considered by Nadim, Cox, and Brenner [J. Fluid Mech., 164: 185 (1986)]. The diffusivity D* is readily calculated for small P, but the evaluation for arbitrary P requires numerical methods. Monte Carlo particle simulation codes are used to evaluate D* at arbitrary P, and thereby describe the transition for D* between the large and small P limits

First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

International Nuclear Information System (INIS)

Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

2014-01-01

First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

Magnon diffusion theory for the spin Seebeck effect in ferromagnetic and antiferromagnetic insulators

Science.gov (United States)

Rezende, Sergio M.; Azevedo, Antonio; Rodríguez-Suárez, Roberto L.

2018-05-01

In magnetic insulators, spin currents are carried by the elementary excitations of the magnetization: spin waves or magnons. In simple ferromagnetic insulators there is only one magnon mode, while in two-sublattice antiferromagnetic insulators (AFIs) there are two modes, which carry spin currents in opposite directions. Here we present a theory for the diffusive magnonic spin current generated in a magnetic insulator layer by a thermal gradient in the spin Seebeck effect. We show that the formulations describing magnonic perturbation using a position-dependent chemical potential and those using a magnon accumulation are completely equivalent. Then we develop a drift–diffusion formulation for magnonic spin transport treating the magnon accumulation governed by the Boltzmann transport and diffusion equations and considering the full boundary conditions at the surfaces and interfaces of an AFI/normal metal bilayer. The theory is applied to the ferrimagnetic yttrium iron garnet and to the AFIs MnF2 and NiO, providing good quantitative agreement with experimental data.

Adapted diffusion processes for effective forging dies

Science.gov (United States)

Paschke, H.; Nienhaus, A.; Brunotte, K.; Petersen, T.; Siegmund, M.; Lippold, L.; Weber, M.; Mejauschek, M.; Landgraf, P.; Braeuer, G.; Behrens, B.-A.; Lampke, T.

2018-05-01

Hot forging is an effective production method producing safety relevant parts with excellent mechanical properties. The economic efficiency directly depends on the occurring wear of the tools, which limits service lifetime. Several approaches of the presenting research group aim at minimizing the wear caused by interacting mechanical and thermal loads by using enhanced nitriding technology. Thus, by modifying the surface zone layer it is possible to create a resistance against thermal softening provoking plastic deformation and pronounced abrasive wear. As a disadvantage, intensely nitrided surfaces may possibly include the risk of increased crack sensitivity and therefore feature the chipping of material at the treated surface. Recent projects (evaluated in several industrial applications) show the high technological potential of adapted treatments: A first approach evaluated localized treatments by preventing areas from nitrogen diffusion with applied pastes or other coverages. Now, further ideas are to use this principle to structure the surface with differently designed patterns generating smaller ductile zones beneath nitrided ones. The selection of suitable designs is subject to certain geo-metrical requirements though. The intention of this approach is to prevent the formation and propagation of cracks under thermal shock conditions. Analytical characterization methods for crack sensitivity of surface zone layers and an accurate system of testing rigs for thermal shock conditions verified the treatment concepts. Additionally, serial forging tests using adapted testing geometries and finally, tests in the industrial production field were performed. Besides stabilizing the service lifetime and decreasing specific wear mechanisms caused by thermal influences, the crack behavior was influenced positively. This leads to a higher efficiency of the industrial production process and enables higher output in forging campaigns of industrial partners.

The Hot Horizontal-Branch Stars in NGC288 - Effects of Diffusion and Stratification on Their Atmospheric Parameters*

Science.gov (United States)

Moehler, S.; Dreizler, S.; LeBlanc, F.; Khalack, V.; Michaud, G.; Richer, J.; Sweigart, Allen V.; Grundahl, F.

2014-01-01

Context. NGC288 is a globular cluster with a well developed blue horizontal branch covering the so-called u-jump which indicates the onset of diffusion. It is therefore well suited to study the effects of diffusion in blue horizontal branch (HB) stars. Aims. We compare observed abundances to predictions from stellar evolution models calculated with diffusion and from stratified atmospheric models. We verify the effect of using stratified model spectra to derive atmospheric parameters. In addition we investigate the nature of the overluminous blue HB stars around the u-jump. Methods. We define a new photometric index sz from uvby measurements that is gravity sensitive between 8 000K and 12 000 K. Using medium-resolution spectra and Stroemgren photometry we determine atmospheric parameters (Teff, logg) and abundances for the blue HB stars. We use both homogeneous and stratified model spectra for our spectroscopic analyses. Results. The atmospheric parameters and masses of the hot HB stars in NGC288 show a behaviour seen also in other clusters for temperatures between 9 000K and 14 000 K. Outside this temperature range, however, they follow rather the results found for such stars in (omega)Cen. The abundances derived from our observations are for most elements (except He and P) within the abundance range expected from evolutionary models that include the effects of atomic diffusion and assume a surface mixed mass of 10(exp -7) M. The abundances predicted by stratified model atmospheres are generally significantly more extreme than observed, except for Mg. The use of stratified model spectra to determine effective temperatures, surface gravities and masses moves the hotter stars to a closer agreement with canonical evolutionary predictions. Conclusions. Our results show definite promise towards solving the long-standing issue of surface gravity and mass discrepancies for hot HB stars, but there is still much work needed to arrive at a self-consistent solution.

Inertial effects in diffusion-limited reactions

International Nuclear Information System (INIS)

Dorsaz, N; Foffi, G; De Michele, C; Piazza, F

2010-01-01

Diffusion-limited reactions are commonly found in biochemical processes such as enzyme catalysis, colloid and protein aggregation and binding between different macromolecules in cells. Usually, such reactions are modeled within the Smoluchowski framework by considering purely diffusive boundary problems. However, inertial effects are not always negligible in real biological or physical media on typical observation time frames. This is all the more so for non-bulk phenomena involving physical boundaries, that introduce additional time and space constraints. In this paper, we present and test a novel numerical scheme, based on event-driven Brownian dynamics, that allows us to explore a wide range of velocity relaxation times, from the purely diffusive case to the underdamped regime. We show that our algorithm perfectly reproduces the solution of the Fokker-Planck problem with absorbing boundary conditions in all the regimes considered and is thus a good tool for studying diffusion-guided reactions in complex biological environments.

Advection and diffusion in random media implications for sea surface temperature anomalies

CERN Document Server

Piterbarg, Leonid I

1997-01-01

The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

Diffusion and sorption of neptunium(V) in compacted montmorillonite: effects of carbonate and salinity

International Nuclear Information System (INIS)

Tachi, Y.; Yotsuji, K.; Suyama, T.; Seida, Y.; Yui, M.; Nakazawa, T.; Yamada, N.; Ochs, M.

2010-01-01

Diffusion and sorption of radionuclides in compacted bentonite/montmorillonite are key processes in the safe geological disposal of radioactive waste. In this study, the effects of carbonate and salinity on neptunium(V) diffusion and sorption in compacted sodium montmorillonite were investigated by experimental and modeling approaches. Effective diffusion coefficients (D e ) and distribution coefficients (K d ) of 237 Np(V) in sodium montmorillonite compacted to a dry density of 800 kg m -3 were measured under four chemical conditions with different salinities (0.05/0.5 M NaCl) and carbonate concentrations (0.0.01 M NaHCO 3 ). D e values for carbonate-free conditions were of the order of 10 -10 -10 -11 m 2 s -1 and decreased as salinity increased, and those for carbonate conditions were of the order of 10 -11 -10 -12 m 2 s -1 and showed the opposite dependence. Diffusion-derived K d values for carbonate-free conditions were higher by one order of magnitude than those for carbonate conditions. Diffusion and sorption behaviors were interpreted based on mechanistic models by coupling thermodynamic aqueous speciation, thermodynamic sorption model (TSM) based on ion exchange, and surface complexation reactions, and a diffusion model based on electrical double layer (EDL) theory in homogeneous narrow pores. The model predicted the experimentally observed tendency of D e and K d qualitatively, as a result of the following mechanisms; 1) the dominant aqueous species are NpO 2 + and NpO 2 CO 3 - for carbonate-free and carbonate conditions, respectively, 2) the effects of cation excess and anion exclusion result in opposite tendencies of D e for salinity, 3) higher carbonate in solution inhibits sorption due to the formation of carbonate complexes. (orig.)

First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe(110) surface

International Nuclear Information System (INIS)

Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

2010-01-01

Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.

First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe110 surface.

Science.gov (United States)

Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

2010-09-29

Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.

Ion-exchange equilibria and diffusion in engineered backfill

International Nuclear Information System (INIS)

Soudek, A.; Jahnke, F.M.; Radke, C.J.

1984-01-01

Engineered backfill can add confidence to confinement times of high-level nuclear waste stored in geologic media. This paper discusses the design and operation of a unique radial-flow diffusion cell to determine ion migration rates in backfill material under realistic repository conditions. New experimental results were reported for diffusion of CsCl in a background of NaCl into compacted bentonite and bentonite/quartz mixtures. Representation of the measured diffusion rates by the traditional, homogeneous porous-medium model significantly underestimates cesium penetration distances into the backfill. Surface diffusion is suggested as an additional mechanism by which cations transport in swollen montmorillonite; the surface diffusion coefficients for cesium is determined to be approximately 10 -7 cm 2 /s. An electrostatic site-binding model is developed for ion-exchange equilibria on montmorillonite clay. The effect of pH, ionic strength, and specific adsorption are evaluated and compared favorably to new, experimental exchange isotherms measured on disaggregated clay. The electrostatic site-binding model permits a prediction of the influence of backfill compaction on K/sub d/ values. We find that for strongly adsorbing cations, compactions has little effect. However, anions exhibit significant Donnan exclusion with clay compaction. 40 references, 12 figures

Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

Energy Technology Data Exchange (ETDEWEB)

Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

2016-09-15

Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

Energy Technology Data Exchange (ETDEWEB)

Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

2013-09-30

Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo₂C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo₂C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft² at a feed pressure of only 20 psig. The highest H₂/N₂ selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo₂C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo₂C catalyst layers. We have fabricated a Mo₂C/V composite membrane that in pure gas testing delivered a H₂ flux of 238 SCFH/ft² at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft².psi. However, during testing of a Mo₂C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft².psi was obtained which was stable during the entire test, meeting the permeance associated with

Fem Simulation of Triple Diffusive Natural Convection Along Inclined Plate in Porous Medium: Prescribed Surface Heat, Solute and Nanoparticles Flux

Directory of Open Access Journals (Sweden)

Goyal M.

2017-12-01

Full Text Available In this paper, triple diffusive natural convection under Darcy flow over an inclined plate embedded in a porous medium saturated with a binary base fluid containing nanoparticles and two salts is studied. The model used for the nanofluid is the one which incorporates the effects of Brownian motion and thermophoresis. In addition, the thermal energy equations include regular diffusion and cross-diffusion terms. The vertical surface has the heat, mass and nanoparticle fluxes each prescribed as a power law function of the distance along the wall. The boundary layer equations are transformed into a set of ordinary differential equations with the help of group theory transformations. A wide range of parameter values are chosen to bring out the effect of buoyancy ratio, regular Lewis number and modified Dufour parameters of both salts and nanofluid parameters with varying angle of inclinations. The effects of parameters on the velocity, temperature, solutal and nanoparticles volume fraction profiles, as well as on the important parameters of heat and mass transfer, i.e., the reduced Nusselt, regular and nanofluid Sherwood numbers, are discussed. Such problems find application in extrusion of metals, polymers and ceramics, production of plastic films, insulation of wires and liquid packaging.

First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Wu, M H; Liu, X H; Gu, J F; Jin, Z H

2013-01-01

Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

Airway surface irregularities promote particle diffusion in the human lung

International Nuclear Information System (INIS)

Martonen, T.; North Carolina Univ., Chapel Hill, NC; Zhang, Z.; Yang, Y.; Bottei, G.

1995-01-01

Current NCRP and ICRP particle deposition models employed in risk assessment analyses treat the airways of the human lung as smooth-walled tubes. However, the upper airways of the tracheobronchial (TB) tree are line with cartilaginous rings. Recent supercomputer simulations of in vivo conditions (cited herein), where cartilaginous ring morphologies were based upon fibre-optic bronchoscope examinations, have clearly demonstrated their profound effects upon fluid dynamics. A physiologically based analytical model of fluid dynamics is presented, focusing upon applications to particle diffusion within the TB tree. The new model is the first to describe particle motion while simultaneously simulating effects of wall irregularities, entrance conditions and tube curvatures. This study may explain the enhanced deposition by particle diffusion detected in replica case experiments and have salient implications for the clinically observed preferential distributions of bronchogenic carcinomas associated with inhaled radionuclides. (author)

γ-irradiation effect on gas diffusion in polymer films. Part I : Hydrogen diffusion through mylar film

International Nuclear Information System (INIS)

Rao, K.A.; Pushpa, K.K.; Iyer, R.M.

1980-01-01

γ-irradiation of polymers results in further crosslinking in the polymer or breakdown of the polymer or a combination of both these phenomena depending on the type of polymer, the dose as well as the environment in which irradiation is carried out. The gas diffusion through polymer films is expected to vary depending on these changes. With a view to A evaluate the feasibility of effecting selective diffusion of specific gases and also to correlate the change in diffusion rates with the polymer characteristics these studies have been initiated. Hydrogen diffusion through mylar film γ-irradiated under varying conditions upto a dose of approximately 50 Mrads is reported in this paper. The results indicate negligible change in hydrogen diffusion rates on γ-irradiation. However, γ-irradiation induced crosslinking of acrylic acid on Mylar reduced the hydrogen diffusion rate. The hydrogen diffusion studies may also be useful in finding the glass transition temperature of polymer films as is apparent from the gas diffusion curves. (author)

Models of diffuse solar radiation

Energy Technology Data Exchange (ETDEWEB)

Boland, John; Ridley, Barbara [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Brown, Bruce [Department of Statistics and Applied Probability, National University of Singapore, Singapore 117546 (Singapore)

2008-04-15

For some locations both global and diffuse solar radiation are measured. However, for many locations, only global is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from trigonometry, we need to have diffuse on the horizontal available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse radiation on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia [Spencer JW. A comparison of methods for estimating hourly diffuse solar radiation from global solar radiation. Sol Energy 1982; 29(1): 19-32]. Boland et al. [Modelling the diffuse fraction of global solar radiation on a horizontal surface. Environmetrics 2001; 12: 103-16] developed a validated model for Australian conditions. We detail our recent advances in developing the theoretical framework for the approach reported therein, particularly the use of the logistic function instead of piecewise linear or simple nonlinear functions. Additionally, we have also constructed a method, using quadratic programming, for identifying values that are likely to be erroneous. This allows us to eliminate outliers in diffuse radiation values, the data most prone to errors in measurement. (author)

Determination of oxygen effective diffusivity in porous gas diffusion layer using a three-dimensional pore network model

International Nuclear Information System (INIS)

Wu Rui; Zhu Xun; Liao Qiang; Wang Hong; Ding Yudong; Li Jun; Ye Dingding

2010-01-01

In proton exchange membrane fuel cell (PEMFC) models, oxygen effective diffusivity is the most important parameter to characterize the oxygen transport in the gas diffusion layer (GDL). However, its determination is a challenge due to its complex dependency on GDL structure. In the present study, a three-dimensional network consisting of spherical pores and cylindrical throats is developed and used to investigate the effects of GDL structural parameters on oxygen effective diffusivity under the condition with/without water invasion process. Oxygen transport in the throat is described by Fick's law and water invasion process in the network is simulated using the invasion percolation with trapping algorithm. The simulation results reveal that oxygen effective diffusivity is slightly affected by network size but increases with decreasing the network heterogeneity and with increasing the pore connectivity. Impacts of network anisotropy on oxygen transport are also investigated in this paper. The anisotropic network is constructed by constricting the throats in the through-plane direction with a constriction factor. It is found that water invasion has a more severe negative influence on oxygen transport in an anisotropic network. Finally, two new correlations are introduced to determine the oxygen effective diffusivity for the Toray carbon paper GDLs.

Effects of high-dose hydrogen implantation on defect formation and dopant diffusion in silver implanted ZnO crystals

Energy Technology Data Exchange (ETDEWEB)

Yaqoob, Faisal [Department of Physics, State University of New York at Albany, Albany, New York 12222 (United States); Huang, Mengbing, E-mail: mhuang@sunypoly.edu [College of Nanoscale Science and Engineering, State University of New York Polytechnic Institute, Albany, New York 12203 (United States)

2016-07-28

This work reports on the effects of a deep high-dose hydrogen ion implant on damage accumulation, defect retention, and silver diffusion in silver implanted ZnO crystals. Single-crystal ZnO samples were implanted with Ag ions in a region ∼150 nm within the surface, and some of these samples were additionally implanted with hydrogen ions to a dose of 2 × 10{sup 16 }cm{sup −2}, close to the depth ∼250 nm. Rutherford backscattering/ion channeling measurements show that crystal damage caused by Ag ion implantation and the amount of defects retained in the near surface region following post-implantation annealing were found to diminish in the case with the H implantation. On the other hand, the additional H ion implantation resulted in a reduction of substitutional Ag atoms upon post-implantation annealing. Furthermore, the presence of H also modified the diffusion properties of Ag atoms in ZnO. We discuss these findings in the context of the effects of nano-cavities on formation and annihilation of point defects as well as on impurity diffusion and trapping in ZnO crystals.

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1989-01-01

Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-08-15

Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

Diffusive limits for linear transport equations

International Nuclear Information System (INIS)

Pomraning, G.C.

1992-01-01

The authors show that the Hibert and Chapman-Enskog asymptotic treatments that reduce the nonlinear Boltzmann equation to the Euler and Navier-Stokes fluid equations have analogs in linear transport theory. In this linear setting, these fluid limits are described by diffusion equations, involving familiar and less familiar diffusion coefficients. Because of the linearity extant, one can carry out explicitly the initial and boundary layer analyses required to obtain asymptotically consistent initial and boundary conditions for the diffusion equations. In particular, the effects of boundary curvature and boundary condition variation along the surface can be included in the boundary layer analysis. A brief review of heuristic (nonasymptotic) diffusion description derivations is also included in our discussion

Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

Science.gov (United States)

Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

2016-03-01

Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

Effective hydrogen diffusion coefficient for solidifying aluminium alloys

International Nuclear Information System (INIS)

Felberbaum, M.; Landry-Desy, E.; Weber, L.; Rappaz, M.

2011-01-01

An effective hydrogen diffusion coefficient has been calculated for two solidifying Al - 4.5 wt.% Cu and Al - 10 wt.% Cu alloys as a function of the volume fraction of solid. For this purpose, in situ X-ray tomography was performed on these alloys. For each volume fraction of solid between 0.6 and 0.9, a representative volume element of the microstructure was extracted. Solid and liquid voxels were assimilated to solid and liquid nodes in order to solve the hydrogen diffusion equation based on the chemical potential and using a finite volume formulation. An effective hydrogen diffusion coefficient based on the volume fraction of solid only could be deduced from the results of the numerical model at steady state. The results are compared with various effective medium theories.

Cerebral Effects of Targeted Temperature Management Methods Assessed by Diffusion-Weighted Magnetic Resonance Imaging

DEFF Research Database (Denmark)

Grejs, Anders Morten; Gjedsted, Jakob; Pedersen, Michael

2016-01-01

The aim of this randomized porcine study was to compare surface targeted temperature management (TTM) to endovascular TTM evaluated by cerebral diffusion-weighted magnetic resonance imaging (MRI): apparent diffusion coefficient (ADC), and by intracerebral/intramuscular microdialysis. It is well k...

An integrated field-effect microdevice for monitoring membrane transport in Xenopus laevis oocytes via lateral proton diffusion.

Directory of Open Access Journals (Sweden)

Daniel Felix Schaffhauser

Full Text Available An integrated microdevice for measuring proton-dependent membrane activity at the surface of Xenopus laevis oocytes is presented. By establishing a stable contact between the oocyte vitelline membrane and an ion-sensitive field-effect (ISFET sensor inside a microperfusion channel, changes in surface pH that are hypothesized to result from facilitated proton lateral diffusion along the membrane were detected. The solute diffusion barrier created between the sensor and the active membrane area allowed detection of surface proton concentration free from interference of solutes in bulk solution. The proposed sensor mechanism was verified by heterologously expressing membrane transport proteins and recording changes in surface pH during application of the specific substrates. Experiments conducted on two families of phosphate-sodium cotransporters (SLC20 & SLC34 demonstrated that it is possible to detect phosphate transport for both electrogenic and electroneutral isoforms and distinguish between transport of different phosphate species. Furthermore, the transport activity of the proton/amino acid cotransporter PAT1 assayed using conventional whole cell electrophysiology correlated well with changes in surface pH, confirming the ability of the system to detect activity proportional to expression level.

Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

Energy Technology Data Exchange (ETDEWEB)

Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

2014-07-28

Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

Ion diffusion in compacted bentonite

Energy Technology Data Exchange (ETDEWEB)

Lehikoinen, J. [VTT Chemical Technology, Espoo (Finland)

1999-03-01

In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K{sub d}, unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.) 45 refs.

Ion diffusion in compacted bentonite

International Nuclear Information System (INIS)

Lehikoinen, J.

1999-03-01

In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K d , unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.)

Ultrathin, wafer-scale hexagonal boron nitride on dielectric surfaces by diffusion and segregation mechanism

Science.gov (United States)

Sonde, Sushant; Dolocan, Andrei; Lu, Ning; Corbet, Chris; Kim, Moon J.; Tutuc, Emanuel; Banerjee, Sanjay K.; Colombo, Luigi

2017-06-01

Chemical vapor deposition (CVD) of two-dimensional (2D) hexagonal boron nitride (h-BN) is at the center of numerous studies for its applications in novel electronic devices. However, a clear understanding of the growth mechanism is lacking for its wider industrial adoption on technologically relevant substrates such as SiO2. Here, we demonstrate a controllable growth method of thin, wafer scale h-BN films on arbitrary substrates. We also clarify the growth mechanism to be diffusion and surface segregation (D-SS) of boron (B) and nitrogen (N) in Ni and Co thin films on SiO2/Si substrates after exposure to diborane and ammonia precursors at high temperature. The segregation was found to be independent of the cooling rates employed in this report, and to our knowledge has not been found nor reported for 2D h-BN growth so far, and thus provides an important direction for controlled growth of h-BN. This unique segregation behavior is a result of a combined effect of high diffusivity, small film thickness and the inability to achieve extremely high cooling rates in CVD systems. The resulting D-SS h-BN films exhibit excellent electrical insulating behavior with an optical bandgap of about 5.8 eV. Moreover, graphene-on-h-BN field effect transistors using the as-grown D-SS h-BN films show a mobility of about 6000 cm2 V-1 s-1 at room temperature.

Atmospheric diffusion of large clouds

Energy Technology Data Exchange (ETDEWEB)

Crawford, T. V. [Univ. of California, Lawrence Radiation Lab., Livermore, California (United States)

1967-07-01

Clouds of pollutants travel within a coordinate system that is fixed to the earth's surface, and they diffuse and grow within a coordinate system fixed to the cloud's center. This paper discusses an approach to predicting the cloud's properties, within the latter coordinate system, on space scales of a few hundred meters to a few hundred kilometers and for time periods of a few days. A numerical cloud diffusion model is presented which starts with a cloud placed arbitrarily within the troposphere. Similarity theories of atmospheric turbulence are used to predict the horizontal diffusivity as a function of initial cloud size, turbulent atmospheric dissipation, and time. Vertical diffusivity is input as a function of time and height. Therefore, diurnal variations of turbulent diffusion in the boundary layer and effects of temperature inversions, etc. can be modeled. Nondiffusive cloud depletion mechanisms, such as dry deposition, washout, and radioactive decay, are also a part of this numerical model. An effluent cloud, produced by a reactor run at the Nuclear Rocket Development Station, Nevada, is discussed in this paper. Measurements on this cloud, for a period of two days, are compared to calculations with the above numerical cloud diffusion model. In general, there is agreement. within a factor of two, for airborne concentrations, cloud horizontal area, surface air concentrations, and dry deposition as airborne concentration decreased by seven orders of magnitude during the two-day period. (author)

Effect of Ionic Diffusion on Extracellular Potentials in Neural Tissue.

Directory of Open Access Journals (Sweden)

Geir Halnes

2016-11-01

Full Text Available Recorded potentials in the extracellular space (ECS of the brain is a standard measure of population activity in neural tissue. Computational models that simulate the relationship between the ECS potential and its underlying neurophysiological processes are commonly used in the interpretation of such measurements. Standard methods, such as volume-conductor theory and current-source density theory, assume that diffusion has a negligible effect on the ECS potential, at least in the range of frequencies picked up by most recording systems. This assumption remains to be verified. We here present a hybrid simulation framework that accounts for diffusive effects on the ECS potential. The framework uses (1 the NEURON simulator to compute the activity and ionic output currents from multicompartmental neuron models, and (2 the electrodiffusive Kirchhoff-Nernst-Planck framework to simulate the resulting dynamics of the potential and ion concentrations in the ECS, accounting for the effect of electrical migration as well as diffusion. Using this framework, we explore the effect that ECS diffusion has on the electrical potential surrounding a small population of 10 pyramidal neurons. The neural model was tuned so that simulations over ∼100 seconds of biological time led to shifts in ECS concentrations by a few millimolars, similar to what has been seen in experiments. By comparing simulations where ECS diffusion was absent with simulations where ECS diffusion was included, we made the following key findings: (i ECS diffusion shifted the local potential by up to ∼0.2 mV. (ii The power spectral density (PSD of the diffusion-evoked potential shifts followed a 1/f2 power law. (iii Diffusion effects dominated the PSD of the ECS potential for frequencies up to several hertz. In scenarios with large, but physiologically realistic ECS concentration gradients, diffusion was thus found to affect the ECS potential well within the frequency range picked up in

Hardfacing of duplex stainless steel using melting and diffusion processes

Science.gov (United States)

Lailatul, H.; Maleque, M. A.

2017-03-01

Duplex stainless steel (DSS) is a material with high potential successes in many new applications such as rail car manufacturing, automotive and chemical industries. Although DSS is widely used in various industries, this material has faced wear and hardness problems which obstruct a wider capability of this material and causes problems in current application. Therefore, development of surface modification has been introduced to produce hard protective layer or coating on DSS. The main aim of this work is to brief review on hard surface layer formation on DSS using melting and diffusion processes. Melting technique using tungsten inert gas (TIG) torch and diffusion technique using gas nitriding are the effective process to meet this requirement. The processing route plays a significant role in developing the hard surface layer for any application with effective cost and environmental factors. The good understanding and careful selection of processing route to form products are very important factors to decide the suitable techniques for surface engineering treatment. In this paper, an attempt is also made to consolidate the important research works done on melting and diffusion techniques of DSS in the past. The advantages and disadvantages between melting and diffusion technique are presented for better understanding on the feasibility of hard surface formation on DSS. Finally, it can be concluded that this work will open an avenue for further research on the application of suitable process for hard surface formation on DSS.

Thermo-diffusion effect on free convection heat and mass transfer in a thermally linearly stratified non-darcy porous media

KAUST Repository

Murthy, P.V.S.N.

2011-12-26

Thermo-diffusion effect on free convection heat and mass transfer from a vertical surface embedded in a liquid saturated thermally stratified non - Darcy porous medium has been analyzed using a local non-similar procedure. The wall temperature and concentration are constant and the medium is linearly stratified in the vertical direction with respect to the thermal conditions. The fluid flow, temperature and concentration fields are affected by the complex interactions among the diffusion ratio Le, buoyancy ratio N, thermo-diffusion parameter Sr and stratification parameter ?. Non-linear interactions of all these parameters on the convective transport has been analyzed and variation of heat and mass transfer coefficients with thermo-diffusion parameter in the thermally stratified non-Darcy porous media is presented through computer generated plots.

Thermo-diffusion effect on free convection heat and mass transfer in a thermally linearly stratified non-darcy porous media

KAUST Repository

Murthy, P.V.S.N.; El-Amin, Mohamed

2011-01-01

Thermo-diffusion effect on free convection heat and mass transfer from a vertical surface embedded in a liquid saturated thermally stratified non - Darcy porous medium has been analyzed using a local non-similar procedure. The wall temperature and concentration are constant and the medium is linearly stratified in the vertical direction with respect to the thermal conditions. The fluid flow, temperature and concentration fields are affected by the complex interactions among the diffusion ratio Le, buoyancy ratio N, thermo-diffusion parameter Sr and stratification parameter ?. Non-linear interactions of all these parameters on the convective transport has been analyzed and variation of heat and mass transfer coefficients with thermo-diffusion parameter in the thermally stratified non-Darcy porous media is presented through computer generated plots.

Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

International Nuclear Information System (INIS)

Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

2010-01-01

Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

Evaluation of water, sucrose and minerals effective diffusivities during osmotic treatment of pork in sugar beet molasses

Directory of Open Access Journals (Sweden)

Nićetin Milica R.

2015-01-01

Full Text Available Effective diffusivities of water, sucrose and minerals in osmotic treatment of pork cubes (M. triceps brachii were calculated using Response Surface Methodology (RSM, with respect to temperature (20, 35 and 50oC and concentration of sugar beet molasses, (60, 70 and 80% w/w. The numerical solution of Fick's' law for unsteady-state mass transfer in a perfect cube configuration was used to calculate the effective diffusivities of water, sucrose and minerals (Na, K, Ca and Mg. Zugarramurdi and Lupin's model was used to predict the equilibrium condition, which was shown to be appropriate for water loss and solute uptake during osmotic treatment. Effective diffusivity of water was found to be in the range of 6.95×10-10 - 8.03×10-10 m2s-1, the sucrose effective diffusivity was between 6.39×10-10 and 8.25×10-10 m2s-1, while diffusivities for minerals were in the range 6.34×10-10 - 8.82×10-10 m2s-1, for Na, 6.27×10-10 - 7.43×10-10 m2s-1, for K, 6.44×10-10 - 8.94×10-10 m2s-1, for Ca and 3.47×10-10 - 5.66×10-10 m2s-1, for Mg. [Projekat Ministarstva nauke Republike Srbije, br. TR 31055

Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

International Nuclear Information System (INIS)

Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

2002-01-01

The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

Micromagnetic simulation of anisotropic grain boundary diffusion for sintered Nd-Fe-B magnets

Science.gov (United States)

Li, W.; Zhou, Q.; Zhao, L. Z.; Wang, Q. X.; Zhong, X. C.; Liu, Z. W.

2018-04-01

A systematic investigation on the anisotropic grain boundary diffusion in sintered Nd-Fe-B magnets is carried out by micromagnetic simulation. The results indicate that the critical reason for the anisotropic diffusion effect is not the difference in the amount of Dy diffused along different directions but the macroscopic demagnetizing field. The diffusion parallel to the easy axis from both pole surfaces of the magnet can increase the nucleation fields in the two major regions with large macroscopic demagnetizing fields, where the reverse domains can nucleate easily. As a consequence, the grain boundary diffusion along the directions parallel to the easy axis from two pole surfaces is more effective to improve the coercivity of the magnets than that along other directions. It is also found that, to enhance the coercivity, only a limited diffusion depth is required. The present result is in good agreement with the recent experimental findings.

Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

Science.gov (United States)

Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

2018-01-01

Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

A new model of tail diffusion of phosphorus and boron in silicon

International Nuclear Information System (INIS)

Morehead, F.F.; Lever, R.F.

1986-01-01

It is well known that high surface concentration phosphorus diffusion leads to deeply penetrating tails in its concentration profile. At 700 0 C the tail diffusivity exceeds that of low concentration phosphorus by a factor of a thousand. Less spectacular, but very significant tailing also affects boron, making the conventional models contained in commonly available process simulation programs quite inaccurate for boron diffusions with high surface concentrations. The authors show that the observed tailing can be accounted for by a model whose central assumption is the local equality of dopant and oppositely directed defect fluxes. As predicted by the model, the effect is greatest for normal processing at low temperatures for high surface concentrations. It is minimal for the high temperatures of rapid thermal annealing and unrelated to transient effects

The effect of recombination and attachment on meteor radar diffusion coefficient profiles

Science.gov (United States)

Lee, C. S.; Younger, J. P.; Reid, I. M.; Kim, Y. H.; Kim, J.-H.

2013-04-01

Estimates of the ambipolar diffusion coefficient producedusing meteor radar echo decay times display an increasing trend below 80-85 km, which is inconsistent with a diffusion-only theory of the evolution of meteor trails. Data from the 33 MHz meteor radar at King Sejong Station, Antarctica, have been compared with observations from the Aura Earth Observing System Microwave Limb Sounder satellite instrument. It has been found that the height at which the diffusion coefficient gradient reverses follows the height of a constant neutral atmospheric density surface. Numerical simulations of meteor trail diffusion including dissociative recombination with atmospheric ions and three-body attachment of free electrons to neutral molecules indicate that three-body attachment is responsible for the distortion of meteor radar diffusion coefficient profiles at heights below 90 km, including the gradient reversal below 80-85 km. Further investigation has revealed that meteor trails with low initial electron line density produce decay times more consistent with a diffusion-only model of meteor trail evolution.

Absence of isotope effect of diffusion in a metallic glass

International Nuclear Information System (INIS)

Heesemann, A.; Raetzke, K.; Faupel, F.; Hoffmann, J.; Heinemann, K.

1995-01-01

The isotope effect E = d ln(D)/d ln (1/√m) of Co diffusion in structurally relaxed Co 86 Zr 14 and Co 81 Zr 19 glasses has been measured by means of a radiotracer technique. Within experimental accuracy no isotope effect was detected (E < 0.04). This suggests a highly cooperative diffusion mechanism. The connection between diffusion and collective low-frequency relaxations in glasses is discussed. (orig.)

Diffusion of oxygen in nitrogen in the pores of graphite. Preliminary results on the effect of oxidation on diffusivity

Energy Technology Data Exchange (ETDEWEB)

Hewitt, G. F.; Sharratt, E. W.

1962-10-15

Preliminary results are reported from an experimental study of the effect of burnoff on the diffusivity of oxygen in nitrogen within the pores of graphite. It is found that the ratio of effective diffusivity to ''free gas'' diffusivity changes about four-fold in the range 0-9% total oxidation. The viscous permeability, B₀, increases in almost the same proportion over the same range.

Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

DEFF Research Database (Denmark)

Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

2017-01-01

) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

Diffusion of graphite. The effect of cylindrical canals

International Nuclear Information System (INIS)

Carle, R.; Clouet d'Orval, C.; Martelly, J.; Mazancourt, T. de; Sagot, M.; Lattes, R.; Teste du Bailler, A.

1957-01-01

Experiments on thermal neutron diffusion in the graphite used as moderator in the pile G1 have been carried out. The object of these experiments is to determine: - the intrinsic quality of this graphite, characterised by its diffusion length L or its Laplacian 1/L 2 - the effect of the canals, which modifies anisotropically the macroscopic diffusion equation and is characterized by two principal diffusion regions (or two principal Laplacian), valid respectively for the diffusion in the direction of the canals and in a perpendicular direction. In order to determine them two experiments are necessary, in which the second derivatives of the flux in relation to the space coordinates are very different. These experiments form the object of the first two parts. Part 1: Diffusion along the axis of a flux coming from the pile source, and limited radially by a quasi cylindrical screen of cadmium bars. This screen, or Faraday cage is designed to give to the thermal flux produced the same radius of extrapolation to zero as that of the pile source. The determination of L (with the graphite full) has been made under the same conditions. The measurements have been interpreted in two ways. The influence of the brackets holding the detectors is discussed. Part 2: Radial diffusion in the graphite surrounding the 'long' cylindrical pile. This is well described by a sum of Bessel functions. Part 3: Results (valid for d = 1.61 t = 17 deg. C). For the graphite without cavity L = 52.7 ± 0.4 cm. The effect of the canals on the diffusion area and its anisotropy are in excellent agreement with the theory of Behrens: L(parallel) = 64.6 cm and L(perpendicular) 62.2 cm. Appendix: Theory of the Faraday cage. (author) [fr

Excluded-volume effects in the diffusion of hard spheres

KAUST Repository

Bruna, Maria; Chapman, S. Jonathan

2012-01-01

Excluded-volume effects can play an important role in determining transport properties in diffusion of particles. Here, the diffusion of finite-sized hard-core interacting particles in two or three dimensions is considered systematically using

Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

International Nuclear Information System (INIS)

Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

2015-01-01

Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

Transient diffusion from a waste solid into fractured porous rock

International Nuclear Information System (INIS)

Ahn, J.; Chambre, P.L.; Pigford, T.H.

1988-01-01

Previous analytical studies of the advective transport of dissolved contaminants through fractured rock have emphasized the effect of molecular diffusion in the rock matrix in affecting the space-time-dependent concentration of the contaminant as it moves along the fracture. Matrix diffusion only in the direction normal to the fracture surface was assumed. Contaminant sources were constant-concentration surfaces of width equal to the fracture aperture and of finite or infinite extent in the transverse direction. Such studies illustrate the far-field transport features of fractured media. To predict the time-dependent mass transfer from a long waste cylinder surrounded by porous rock and intersected by a fracture, the present study includes diffusion from the waste surface directly into porous rock, as well as the more realistic geometry. Here the authors present numerical results from Chambre's analytical solution for the time-dependent mass transfer from the cylinder for the low-flow conditions wherein near-field mass transfer is expected to be controlled by molecular diffusion

Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

OpenAIRE

Bläckberg, Lisa

2014-01-01

This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

Reaction effects in diffusive shock acceleration

International Nuclear Information System (INIS)

Drury, L.Oc.

1984-01-01

The effects of the reaction of accelerated particles back on the shock wave in the diffusive-shock-acceleration model of cosmic-ray generation are investigated theoretically. Effects examined include changes in the shock structure, modifications of the input and output spectra, scattering effects, and possible instabilities in the small-scale structure. It is pointed out that the latter two effects are applicable to any spatially localized acceleration mechanism. 14 references

Diffusion and flow of water vapours in chromatographic Alumina gel

International Nuclear Information System (INIS)

Khan, M.; Shah, H. U.

2005-01-01

The kinetics of sorption of water vapours in chromatographic alumina gel was studied. Water vapours are adsorbed on the gel at temperature (15 degree C) at different constant relative pressure from 0.1-0.93 p/p. Rate constant, Effective diffusivities, Knudsen diffusivities and bulk diffusivities were determined through Fick type equation. Total pore volume is 0.498 cc g-1 and specific surface area comes to be 465 m2 g-1 as obtained by Gurvitsch rule and Kieselve's quantities respectively. An average pore radius (hydraulic) is 1.1x10/sub -7/ cm. The study of these quantities provide a strong basis for evaluating surface properties. (author)

A literature review of surface alteration layer effects on waste glass behavior

International Nuclear Information System (INIS)

Feng, X.; Cunnane, J.C.; Bates, J.K.

1993-01-01

When in contact with an aqueous solution, nuclear waste glass is subject to a chemical attack that results in progressive alteration. During tills alteration, constituent elements of the glass pass into the solution; elements initially in solution diffuse into, or are adsorbed onto, the solid; and new phases appear. This results in the formation of surface layers on the reacted glass. The glass corrosion and radionuclide release can be better understood by investigating these surface layer effects. In the past decade, there have been numerous studies regarding the effects of surface layers on glass reactions. This paper presents a systematic analysis and summary of the past knowledge regarding the effects of surface layers on glass-water interaction. This paper describes the major formation mechanisms of surface layers; reviews the role of surface layers in controlling mass transport and glass reaction affinity (through crystalline phases, an amorphous silica, a gel layer, or all the components in the glass); and discusses how the surface layers contribute to the retention of radionuclides during glass dissolution

Proximity effect and hot-electron diffusion in Ag/Al2O3/Al tunnel junctions

International Nuclear Information System (INIS)

Netel, H.; Jochum, J.; Labov, S.E.; Mears, C.A.; Frank, M.; Chow, D.; Lindeman, M.A.; Hiller, L.J.

1997-01-01

We have fabricated Ag/Al 2 O 3 /Al tunnel junctions on Si substrates using a new process. This process was developed to fabricate superconducting tunnel junctions (STJs) on the surface of a superconductor. These junctions allow us to study the proximity effect of a superconducting Al film on a normal metal trapping layer. In addition, these devices allow us to measure the hot-electron diffusion constant using a single junction. Lastly these devices will help us optimize the design and fabrication of tunnel junctions on the surface of high-Z, ultra-pure superconducting crystals. 5 refs., 8 figs

Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

International Nuclear Information System (INIS)

Posadillo, R.; Lopez Luque, R.

2009-01-01

The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

Density profile evolution and nonequilibrium effects in partial and full spreading measurements of surface diffusion

DEFF Research Database (Denmark)

Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

2001-01-01

in D-C(theta) depend on the initial density gradient and the initial state from which the spreading starts. To this end, we carry out extensive Monte Carlo simulations for a lattice-gas model of the O/W(110) system. Studies of submonolayer spreading from an initially ordered p(2x1) phase at theta = 1....../2 reveal that the spreading and diffusion rates in directions parallel and perpendicular to rows of oxygen atoms are significantly different within the ordered phase. Aside from this effect, we find that the degree of ordering in the initial phase has a relatively small impact on the overall behavior of D...

Effective diffusion of confined active Brownian swimmers

Science.gov (United States)

Sandoval, Mario; Dagdug, Leonardo

2014-11-01

We find theoretically the effect of confinement and thermal fluctuations, on the diffusivity of a spherical active swimmer moving inside a two-dimensional narrow cavity of general shape. The explicit formulas for the effective diffusion coefficient of a swimmer moving inside two particular cavities are presented. We also compare our analytical results with Brownian Dynamics simulations and we obtain excellent agreement. L.D. thanks Consejo Nacional de Ciencia y Tecnologia (CONACyT) Mexico, for partial support by Grant No. 176452. M. S. thanks CONACyT and Programa de Mejoramiento de Profesorado (PROMEP) for partially funding this work under Grant No. 103.5/13/6732.

Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-09-15

Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

Study of a diffusion flamelet model, with preferential diffusion effects included

NARCIS (Netherlands)

Delhaye, S.; Somers, L.M.T.; Bongers, H.; Oijen, van J.A.; Goey, de L.P.H.; Dias, V.

2005-01-01

The non-premixed flamelet model of Peters [1] (model1), which does not include preferential diffusion effects is investigated. Two similar models are presented, but without the assumption of unity Lewis numbers. One of these models was derived by Peters & Pitsch [2] (model2), while the other one was

Spiral multiple-effect diffusion solar still coupled with vacuum-tube collector and heat pipe

KAUST Repository

Huang, Bin-Juine

2015-04-01

© 2015 Elsevier B.V. A novel solar still with spiral-shape multiple-effect diffusion unit is developed in the present study. The test results of a 14-effect unit coupled with vacuum-tube solar collector (absorber area 1.08m2) show that the highest daily pure water production is 40.6kgd-1. The measured highest productivity based on the area of glass cover, solar absorber, and evaporating surface is 34.7, 40.6, and 7.96kgm-2d-1, respectively, which are much higher than the published results. The measured solar distillation efficiency is 2.0-3.5. The performance enhancement results mainly from the lateral diffusion process in the spiraled still cell. The vapor flow generated by heat input can flow freely and laterally through the spiral channel down to the end when solar heat input is high. Besides, the larger evaporating and condensing area at the outer cell may increase heat and mass transfer at the outer cell.

Effects of anisotropies in turbulent magnetic diffusion in mean-field solar dynamo models

Energy Technology Data Exchange (ETDEWEB)

Pipin, V. V. [Institute of Solar-Terrestrial Physics, Russian Academy of Sciences, Irkutsk 664033 (Russian Federation); Kosovichev, A. G. [Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305 (United States)

2014-04-10

We study how anisotropies of turbulent diffusion affect the evolution of large-scale magnetic fields and the dynamo process on the Sun. The effect of anisotropy is calculated in a mean-field magnetohydrodynamics framework assuming that triple correlations provide relaxation to the turbulent electromotive force (so-called the 'minimal τ-approximation'). We examine two types of mean-field dynamo models: the well-known benchmark flux-transport model and a distributed-dynamo model with a subsurface rotational shear layer. For both models, we investigate effects of the double- and triple-cell meridional circulation, recently suggested by helioseismology and numerical simulations. To characterize the anisotropy effects, we introduce a parameter of anisotropy as a ratio of the radial and horizontal intensities of turbulent mixing. It is found that the anisotropy affects the distribution of magnetic fields inside the convection zone. The concentration of the magnetic flux near the bottom and top boundaries of the convection zone is greater when the anisotropy is stronger. It is shown that the critical dynamo number and the dynamo period approach to constant values for large values of the anisotropy parameter. The anisotropy reduces the overlap of toroidal magnetic fields generated in subsequent dynamo cycles, in the time-latitude 'butterfly' diagram. If we assume that sunspots are formed in the vicinity of the subsurface shear layer, then the distributed dynamo model with the anisotropic diffusivity satisfies the observational constraints from helioseismology and is consistent with the value of effective turbulent diffusion estimated from the dynamics of surface magnetic fields.

Surface mobilities on solid materials

International Nuclear Information System (INIS)

Binh, V.T.

1983-01-01

This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)

The effects of heterogeneities on memory-dependent diffusion

Science.gov (United States)

Adib, Farhad; Neogi, P.

1993-07-01

Case II diffusion is often seen in glassy polymers, where the mass uptake in sorption is proportional to time t instead of sqrt{t}. A memory dependent diffusion is needed to explain such effects, where the relaxation function used to describe the memory effect has a characteristic time. The ratio of this time to the overall diffusion times is the diffusional Deborah number. Simple models show that case II results when the Deborah number is around one, that is, when the two time scales are comparable. Under investigation are the possible effects of the fact that the glassy polymers are heterogeneous over molecular scales. The averaging form given by DiMarzio and Sanchez has been used to obtain the averaged response. The calculated dynamics of sorption show that whereas case II is still observed, the long term tails change dramatically from the oscillatory to torpid, to chaotic, which are all observed in the experiments. The Deborah number defined here in a self-consistent manner collapses in those cases, but causes no other ill-effects.

Collisional effects on diffusion scaling laws in electrostatic turbulence

International Nuclear Information System (INIS)

Vlad, M.; Spineanu, F.; Misguich, J.H.; Vlad, M.; Spineanu, F.; Balescu, R.

1999-07-01

The effect of particle collisions on the effective transport in an electrostatic plasma turbulence is analytically studied in the framework of test particle approach. We show that an amplification of the diffusion coefficient can be produced by the combined effect of collisions and trajectory trapping in the structure of the stochastic potential. The paper is organized as follows. The model and the system of equations are formulated in Sec. 2. A short description of the process of trajectory trapping around the extrema of the stochastic potential and of the de-correlation trajectory method is presented in Sec.3. The effect of particle collisions is treated in Sec. 4 where the running diffusion coefficient is determined. Sec. 5 contains the analyses of the results, and Sec. 6 a detailed study of the possible diffusion regimes. The conclusions are summarized in Sec. 7. (authors)

Effects of diffusion and surface interactions on the line shape of electron paramagnetic resonances in the presence of a magnetic field gradient

International Nuclear Information System (INIS)

Schaden, M.; Zhao, K. F.; Wu, Z.

2007-01-01

In an evanescent wave magnetometer the Zeeman polarization is probed at micrometer to submicrometer distances from the cell surface. The electron paramagnetic resonance lines of an evanescent wave magnetometer in the presence of a magnetic field gradient exhibit edge enhancement seen previously in nuclear magnetic resonance lines. We present a theoretical model that describes quantitatively the shape of the magnetic resonance lines of an evanescent wave magnetometer under a wide range of experimental conditions. It accounts for diffusion broadening in the presence of a magnetic field gradient as well as interactions of spin polarized Rb atoms with the coated Pyrex glass surfaces. Depending on the field gradient, cell thickness, and buffer gas pressure, the resonance line may have the form of a single asymmetric peak or two peaks localized near the front and back surfaces in frequency space. The double-peaked response depends on average characteristics of the surface interactions. Its shape is sensitive to the dwell time, relaxation probability, and average phase shift of adsorbed spin polarized Rb atoms

Effect of thermal tempering on microstructure and mechanical properties of Mg-AZ31/Al-6061 diffusion bonding

Energy Technology Data Exchange (ETDEWEB)

Jafarian, Mojtaba [Young Researchers and Elite Club, Science and Research Branch, Islamic Azad University, Tehran (Iran, Islamic Republic of); Rizi, Mohsen Saboktakin, E-mail: M.saboktakin@Pa.iut.ac.ir [Department of Materials Engineering, Isfahan University of Technology, Isfahan 8415683111 (Iran, Islamic Republic of); Department of Industrial Engineering, Lenjan Branch, Islamic Azad University, Isfahan (Iran, Islamic Republic of); Jafarian, Morteza [Young Researchers and Elite Club, Science and Research Branch, Islamic Azad University, Tehran (Iran, Islamic Republic of); Honarmand, Mehrdad [Department of Mechanical Engineering, Tiran Branch, Islamic Azad University, Isfahan (Iran, Islamic Republic of); Javadinejad, Hamid Reza; Ghaheri, Ali [Department of Materials Engineering, Isfahan University of Technology, Isfahan 8415683111 (Iran, Islamic Republic of); Department of Industrial Engineering, Lenjan Branch, Islamic Azad University, Isfahan (Iran, Islamic Republic of); Bahramipour, Mohammad Taghi [Materials Engineering Department, Hakim Sabzevari University, Sabzevar, 397 (Iran, Islamic Republic of); Ebrahimian, Marzieh [Department of Materials Engineering, Isfahan University of Technology, Isfahan 8415683111 (Iran, Islamic Republic of); Department of Industrial Engineering, Lenjan Branch, Islamic Azad University, Isfahan (Iran, Islamic Republic of)

2016-06-01

The objective of this study is to investigate the effect of the types thermal tempering of aluminum alloy on microstructure and mechanical properties of AZ31-O Mg and Al 6061-T6 diffusion bonding. Using Optical Microscope (OM) and Scanning Electron Microscopes (SEM) equipped with EDS analysis and line scan the interfaces of joints were evaluated. The XRD analysis was carried out to characterize phase constitution near the interface zone. The mechanical properties of joints were measured using Vickers micro-hardness and shear strength. According to the results in bonding of AZ31-Mg/Al-6061-O, in less plastic deformation in magnesium alloy, diffusion rate of most magnesium atoms occurred to aluminum alloy and formation of diffusion zone with minimum micro-hardness (140 HV) and maximum shear strength (32 MPa) compared to Al 6061-T6/Mg-AZ31 bonding. Evaluation of fracture surfaces indicates an occurrence of failure from the brittle intermetallic phases. - Highlights: • Diffusion bonding AZ31 to Al-6061withoutany interlayer was successful. • Thermal tempered aluminum alloy plays a vital role in the mechanical properties of joint. • Less thickness of reaction layers and micro-hardness in bonding annealed Al- 6061 layers to AZ31 was achieved. • Fracture surfaces indicated that the onset of fracture from intermetallic compounds resulted in fracture of the cleavage.

Effect of thermal tempering on microstructure and mechanical properties of Mg-AZ31/Al-6061 diffusion bonding

International Nuclear Information System (INIS)

Jafarian, Mojtaba; Rizi, Mohsen Saboktakin; Jafarian, Morteza; Honarmand, Mehrdad; Javadinejad, Hamid Reza; Ghaheri, Ali; Bahramipour, Mohammad Taghi; Ebrahimian, Marzieh

2016-01-01

The objective of this study is to investigate the effect of the types thermal tempering of aluminum alloy on microstructure and mechanical properties of AZ31-O Mg and Al 6061-T6 diffusion bonding. Using Optical Microscope (OM) and Scanning Electron Microscopes (SEM) equipped with EDS analysis and line scan the interfaces of joints were evaluated. The XRD analysis was carried out to characterize phase constitution near the interface zone. The mechanical properties of joints were measured using Vickers micro-hardness and shear strength. According to the results in bonding of AZ31-Mg/Al-6061-O, in less plastic deformation in magnesium alloy, diffusion rate of most magnesium atoms occurred to aluminum alloy and formation of diffusion zone with minimum micro-hardness (140 HV) and maximum shear strength (32 MPa) compared to Al 6061-T6/Mg-AZ31 bonding. Evaluation of fracture surfaces indicates an occurrence of failure from the brittle intermetallic phases. - Highlights: • Diffusion bonding AZ31 to Al-6061withoutany interlayer was successful. • Thermal tempered aluminum alloy plays a vital role in the mechanical properties of joint. • Less thickness of reaction layers and micro-hardness in bonding annealed Al- 6061 layers to AZ31 was achieved. • Fracture surfaces indicated that the onset of fracture from intermetallic compounds resulted in fracture of the cleavage.

Silver diffusion and isotope effect in silver rubidium iodide

International Nuclear Information System (INIS)

Arzigian, J.S.

1980-01-01

The diffusion coefficient of silver in RbAg 4 I 5 was measured in both superionic phases using radiotracer Ag-110m and serial sectioning with a low temperature sectioning apparatus. The activation energies for diffusion in alpha-RbAg 4 I 5 and beta-RbAg 4 I 5 , respectively, are 0.11 +- 0.01 eV and 0.20 +- 0.04 eV. An isotope effect for diffusion was also measured in both superionic phases. Ag-105 and Ag-110m radioisotopes were used with gamma spectroscopy and energy discrimination. The effect is small, with no significant temperature variation, with the value at 333 0 K being 0.12 +- 0.01. The second-order phase transition at 208 0 K has a small effect, if any, on the magnitude of the effect. The data suggest that a highly cooperative transport mechanism is responsible for the unusually high values of both the conductivity and diffusion coefficient. Although it is not possible to deduce the particular mechanism involved, theories inolving ionic polarons, or cooperative motion, such as crowdions or solitons, seem consistent with the observed results

Coupling effects of chemical stresses and external mechanical stresses on diffusion

International Nuclear Information System (INIS)

Xuan Fuzhen; Shao Shanshan; Wang Zhengdong; Tu Shantung

2009-01-01

Interaction between diffusion and stress fields has been investigated extensively in the past. However, most of the previous investigations were focused on the effect of chemical stress on diffusion due to the unbalanced mass transport. In this work, the coupling effects of external mechanical stress and chemical stress on diffusion are studied. A self-consistent diffusion equation including the chemical stress and external mechanical stress gradient is developed under the framework of the thermodynamic theory and Fick's law. For a thin plate subjected to unidirectional tensile stress fields, the external stress coupled diffusion equation is solved numerically with the help of the finite difference method for one-side and both-side charging processes. Results show that, for such two types of charging processes, the external stress gradient will accelerate the diffusion process and thus increase the value of concentration while reducing the magnitude of chemical stress when the direction of diffusion is identical to that of the stress gradient. In contrast, when the direction of diffusion is opposite to that of the stress gradient, the external stress gradient will obstruct the process of solute penetration by decreasing the value of concentration and increasing the magnitude of chemical stress. For both-side charging process, compared with that without the coupling effect of external stress, an asymmetric distribution of concentration is produced due to the asymmetric mechanical stress field feedback to diffusion.

Effect of Electropulsing-Assisted Ultrasonic Nanocrystalline Surface Modification on the Surface Mechanical Properties and Microstructure of Ti-6Al-4V Alloy

Science.gov (United States)

Ye, Yongda; Wang, Haibo; Tang, Guoyi; Song, Guolin

2018-05-01

The effect of electropulsing-assisted ultrasonic nanocrystalline surface modification (EP-UNSM) on surface mechanical properties and microstructure of Ti-6Al-4V alloy is investigated. Compared to conventional ultrasonic nanocrystalline surface modification (UNSM), EP-UNSM can effectively facilitate surface roughness and morphology, leading to excellent surface roughness (reduced from Ra 0.918 to Ra 0.028 μm by UNSM and Ra 0.019 μm by EP-UNSM) and smoother morphology with less cracks and defects. Surface friction coefficients are enhanced, resulting in lower and smoother friction coefficients. In addition, the surface-strengthened layer and ultra-refined grains are significantly enhanced with more severe plastic deformation and a greater surface hardness (a maximum hardness value of 407 HV and an effective depth of 550 μm, in comparison with the maximum hardness value of 364 HV and effective depth of 300 μm obtained by conventional UNSM). Remarkable enhancement of surface mechanical properties can be attributed to the refined gradient microstructure and the enhanced severe plastic deformation layer induced by coupling the effects of UNSM and electropulsing. The accelerated dislocation mobility and atom diffusion caused by the thermal and athermal effects of electropulsing treatment may be the primary intrinsic reasons for these improvements.

Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

Czech Academy of Sciences Publication Activity Database

Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

2015-01-01

Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

Explosive instabilities of reaction-diffusion equations including pinch effects

International Nuclear Information System (INIS)

Wilhelmsson, H.

1992-01-01

Particular solutions of reaction-diffusion equations for temperature are obtained for explosively unstable situations. As a result of the interplay between inertial, diffusion, pinch and source processes certain 'bell-shaped' distributions may grow explosively in time with preserved shape of the spatial distribution. The effect of the pinch, which requires a density inhomogeneity, is found to diminish the effect of diffusion, or inversely to support the inertial and source processes in creating the explosion. The results may be described in terms of elliptic integrals or. more simply, by means of expansions in the spatial coordinate. An application is the temperature evolution of a burning fusion plasma. (au) (18 refs.)

Effective diffusion coefficient of radon in concrete, theory and method for field measurements

International Nuclear Information System (INIS)

Culot, M.V.J.; Olson, H.G.; Schiager, K.J.

1976-01-01

A linear diffusion model serves as the basis for determination of an effective radon diffusion coefficient in concrete. The coefficient was needed to later allow quantitative prediction of radon accumulation within and behind concrete walls after application of an impervious radon barrier. A resolution of certain discrepancies noted in the literature in the use of an effective diffusion coefficient to model diffusion of a radioactive gas through a porous medium is suggested. An outline of factors expected to affect the concrete physical structure and the effective diffusion coefficient of radon through it is also presented. Finally, a field method for evaluating effective radon diffusion coefficients in concrete is proposed and results of measurements performed on a concrete foundation wall are compared with similar published values of gas diffusion coefficients in concrete. (author)

Active colloidal propulsion over a crystalline surface

Science.gov (United States)

Choudhury, Udit; Straube, Arthur V.; Fischer, Peer; Gibbs, John G.; Höfling, Felix

2017-12-01

We study both experimentally and theoretically the dynamics of chemically self-propelled Janus colloids moving atop a two-dimensional crystalline surface. The surface is a hexagonally close-packed monolayer of colloidal particles of the same size as the mobile one. The dynamics of the self-propelled colloid reflects the competition between hindered diffusion due to the periodic surface and enhanced diffusion due to active motion. Which contribution dominates depends on the propulsion strength, which can be systematically tuned by changing the concentration of a chemical fuel. The mean-square displacements (MSDs) obtained from the experiment exhibit enhanced diffusion at long lag times. Our experimental data are consistent with a Langevin model for the effectively two-dimensional translational motion of an active Brownian particle in a periodic potential, combining the confining effects of gravity and the crystalline surface with the free rotational diffusion of the colloid. Approximate analytical predictions are made for the MSD describing the crossover from free Brownian motion at short times to active diffusion at long times. The results are in semi-quantitative agreement with numerical results of a refined Langevin model that treats translational and rotational degrees of freedom on the same footing.

Self-diffusion in single crystalline silicon nanowires

Science.gov (United States)

Südkamp, T.; Hamdana, G.; Descoins, M.; Mangelinck, D.; Wasisto, H. S.; Peiner, E.; Bracht, H.

2018-04-01

Self-diffusion experiments in single crystalline isotopically controlled silicon nanowires with diameters of 70 and 400 nm at 850 and 1000 °C are reported. The isotope structures were first epitaxially grown on top of silicon substrate wafers. Nanowires were subsequently fabricated using a nanosphere lithography process in combination with inductively coupled plasma dry reactive ion etching. Three-dimensional profiling of the nanosized structure before and after diffusion annealing was performed by means of atom probe tomography (APT). Self-diffusion profiles obtained from APT analyses are accurately described by Fick's law for self-diffusion. Data obtained for silicon self-diffusion in nanowires are equal to the results reported for bulk silicon crystals, i.e., finite size effects and high surface-to-volume ratios do not significantly affect silicon self-diffusion. This shows that the properties of native point defects determined from self-diffusion in bulk crystals also hold for nanosized silicon structures with diameters down to 70 nm.

Effects of curved midline and varying width on the description of the effective diffusivity of Brownian particles

Science.gov (United States)

Chávez, Yoshua; Chacón-Acosta, Guillermo; Dagdug, Leonardo

2018-05-01

Axial diffusion in channels and tubes of smoothly-varying geometry can be approximately described as one-dimensional diffusion in the entropy potential with a position-dependent effective diffusion coefficient, by means of the modified Fick–Jacobs equation. In this work, we derive analytical expressions for the position-dependent effective diffusivity for two-dimensional asymmetric varying-width channels, and for three-dimensional curved midline tubes, formed by straight walls. To this end, we use a recently developed theoretical framework using the Frenet–Serret moving frame as the coordinate system (2016 J. Chem. Phys. 145 074105). For narrow tubes and channels, an effective one-dimensional description reducing the diffusion equation to a Fick–Jacobs-like equation in general coordinates is used. From this last equation, one can calculate the effective diffusion coefficient applying Neumann boundary conditions.

Effect of water film trickling down diffuser walls on the diffuser properties

International Nuclear Information System (INIS)

Hibs, M.

1990-01-01

The effect of the water film flowing along one of the horizontal walls of a 2D diffuser was studied, the system being regarded as a model of the annular diffuser at the outlet of a steam turbine flown through by wet steam. The aerodynamic properties of the channel examined were found dependent on whether the water film continues to adhere to the wall or loses stability and sprays into the channel space. The increase in losses in the channel so flown through is quite substantial - the losses can multiply exceed those on flown-by walls free from a water film. (author). 7 figs., 1 tab., 2 refs

Memory effects in turbulent diffusion

International Nuclear Information System (INIS)

Zagorodny, A.G.; Weiland, J.; Wilhelmsson, H.

1993-01-01

A non-Markovian approach is proposed for the derivation of the diffusion coefficient of saturated turbulence. A memory term accounting for nonlocal coherence effects is introduced in a new attempt to describe the transition between weak and strong turbulence. The result compares favourably with recent experiments as well as mode coupling simulations of fusion plasmas. (14 refs.)

Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

Energy Technology Data Exchange (ETDEWEB)

Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

2017-11-01

In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

Diffuse radiation models and monthly-average, daily, diffuse data for a wide latitude range

International Nuclear Information System (INIS)

Gopinathan, K.K.; Soler, A.

1995-01-01

Several years of measured data on global and diffuse radiation and sunshine duration for 40 widely spread locations in the latitude range 36° S to 60° N are used to develop and test models for estimating monthly-mean, daily, diffuse radiation on horizontal surfaces. Applicability of the clearness-index (K) and sunshine fraction (SSO) models for diffuse estimation and the effect of combining several variables into a single multilinear equation are tested. Correlations connecting the diffuse to global fraction (HdH) with K and SSO predict Hd values more accurately than their separate use. Among clearness-index and sunshine-fraction models, SSO models are found to have better accuracy if correlations are developed for wide latitude ranges. By including a term for declinations in the correlation, the accuracy of the estimated data can be marginally improved. The addition of latitude to the equation does not help to improve the accuracy further. (author)

The effect of laterite density on radon diffusion behavior.

Science.gov (United States)

Li, Yongmei; Tan, Wanyu; Tan, Kaixuan; Liu, Zehua; Fang, Qi; Lv, Junwen; Duan, Xianzhe; Liu, Zhenzhong; Guo, Yueyue

2018-02-01

Radon generated in porous media such as soils and rocks migrates into indoor and outdoor air mainly by diffusion, possessing significant hazards to human health. In order to reduce these hazards of radon, it is of great importance to study the diffusion behavior of radon. In this study, we systematically measured the radon diffusion coefficient of laterite with the density ranging from 0.917gcm -3 to 2.238gcm -3 , and studied the effect of laterite density on the radon diffusion. The results show that the radon diffusion coefficient of the laterite generally decreases with the increasing laterite density. In addition, three possible relationships between the radon diffusion coefficient and the laterite density are found out as follows: (1) the linear correlation with a slope of -4.48 × 10 -6 for laterite with density ranging from 0.917 to 1.095gcm -3 , (2) the exponential correlation for laterite with density from 1.095 to 1.63gcm -3 , (3) linear correlation with a slope of -3.1 × 10 -7 for laterite with density from 1.63 to 2.238gcm -3 . The complex relationship between the radon diffusion coefficient and density is caused by the change of porosity and tortuosity of the laterite. Therefore, we suggest that a suitable density should be adopted while using the laterite to effectively cover uranium tailings or economically produce building materials that can curb the radon exhalation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

Science.gov (United States)

Matrane, I.; Mazroui, M.; Sbiaai, K.

2018-03-01

We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

Effective Diffusion Coefficients in Coal Chars

DEFF Research Database (Denmark)

Johnsson, Jan Erik; Jensen, Anker

2001-01-01

Knowledge of effective diffusion coefficients in char particles is important when interpreting experimental reactivity measurements and modeling char combustion or NO and N2O reduction. In this work, NO and N2O reaction with a bituminous coal char was studied in a fixed-bed quartz glass reactor....... In the case of strong pore diffusion limitations, the error in the interpretation of experimental results using the mean pore radius could be a factor of 5 on the intrinsic rate constant. For an average coal char reacting with oxygen at 1300 K, this would be the case for particle sizes larger than about 50...

The EZ diffusion model provides a powerful test of simple empirical effects.

Science.gov (United States)

van Ravenzwaaij, Don; Donkin, Chris; Vandekerckhove, Joachim

2017-04-01

Over the last four decades, sequential accumulation models for choice response times have spread through cognitive psychology like wildfire. The most popular style of accumulator model is the diffusion model (Ratcliff Psychological Review, 85, 59-108, 1978), which has been shown to account for data from a wide range of paradigms, including perceptual discrimination, letter identification, lexical decision, recognition memory, and signal detection. Since its original inception, the model has become increasingly complex in order to account for subtle, but reliable, data patterns. The additional complexity of the diffusion model renders it a tool that is only for experts. In response, Wagenmakers et al. (Psychonomic Bulletin & Review, 14, 3-22, 2007) proposed that researchers could use a more basic version of the diffusion model, the EZ diffusion. Here, we simulate experimental effects on data generated from the full diffusion model and compare the power of the full diffusion model and EZ diffusion to detect those effects. We show that the EZ diffusion model, by virtue of its relative simplicity, will be sometimes better able to detect experimental effects than the data-generating full diffusion model.

Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

Directory of Open Access Journals (Sweden)

Xuefeng Zhang

2015-01-01

Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

Deuterium permeation and diffusion in high-purity beryllium

International Nuclear Information System (INIS)

Abramov, E.; Riehm, M.P.; Thompson, D.A.; Smeltzer, W.W.

1990-01-01

The permeation rate of deuterium through high-purity beryllium membranes was measured using the gas-driven permeation technique. The time-dependent and the steady-state deuterium flux data were analyzed and the effective diffusivities of the samples were determined. Using multilayer permeation theory the effects of surface oxide were eliminated and the diffusion coefficients of the bulk beryllium determined. The diffusion parameters obtained for the extra-grade beryllium samples (99.8%) are D 0 =6.7x10 -9 m 2 /s and E D =28.4 kJ/mol. For the high-grade beryllium samples (99%) the parameters are D 0 =8.0x10 -9 m 2 /s and E D =35.1 kJ/mol. (orig.)

Results on positron diffusion in Si

International Nuclear Information System (INIS)

Nielsen, B.; Lynn, K.G.; Vehanen, A.; Schultz, P.J.

1984-10-01

Positron diffusion in Si(100) and Si(111) has been measured using a variable energy positron beam. The diffusion related parameter, E 0 is found to be 4.2 +- 0.2 keV, significantly longer than previously reported values. The positron diffusion coefficient is estimated at D/sub +/ = 2.3 +- 0.4 cm 2 /sec, the uncertainty arising mainly from the characteristics of the assumed positron implantation profile. A drastic reduction in E 0 is found after heating the sample to 1300 0 K, showing that previously reported low values of E 0 are associated with the thermal history of the sample. A high sensitivity to defects introduced by low energy ion bombardment is found, and the defect recovery was followed during heat treatments. Reconstruction of the Si(111) surface into the so-called 7 x 7 structure had no detectable influence on the positron diffusion behavior. No changes in the positron diffusion was observed after covering the surface with atomic hydrogen. However the yield of positronium formation at the surface was enhanced, attributed to an increased density of states at the surface

Scale dependence of the effective matrix diffusion coefficient: Evidence and preliminary interpretation

International Nuclear Information System (INIS)

Liu, Hui-Hai; Zhang, Yingqi; Molz, Fred J.

2006-01-01

The exchange of solute mass (through molecular diffusion) between fluid in fractures and fluid in the rock matrix is called matrix diffusion. Owing to the orders-of-magnitude slower flow velocity in the matrix compared to fractures, matrix diffusion can significantly retard solute transport in fractured rock, and therefore is an important process for a variety of problems, including remediation of subsurface contamination and geological disposal of nuclear waste. The effective matrix diffusion coefficient (molecular diffusion coefficient in free water multiplied by matrix tortuosity) is an important parameter for describing matrix diffusion, and in many cases largely determines overall solute transport behavior. While matrix diffusion coefficient values measured from small rock samples in the laboratory are generally used for modeling field-scale solute transport in fractured rock (Boving and Grathwohl, 2001), several research groups recently have independently found that effective matrix diffusion coefficients much larger than laboratory measurements are needed to match field-scale tracer-test data (Neretnieks, 2002; Becker and Shapiro, 2000; Shapiro, 2001; Liu et al., 2003, 2004a). In addition to the observed enhancement, Liu et al. (2004b), based on a relatively small number of field-test results, reported that the effective matrix diffusion coefficient might be scale dependent, and, like permeability and dispersivity, it seems to increases with test scale. This scale-dependence has important implications for large-scale solute transport in fractured rock. Although a number of mechanisms have been proposed to explain the enhancement of the effective matrix diffusion coefficient, the potential scale dependence and its mechanisms are not fully investigated at this stage. The major objective of this study is to again demonstrate (based on more data published in the literature than those used in Liu et al. [2004b]) the potential scale dependence of the effective

Scale Dependence of the Effective Matrix Diffusion Coefficient : Evidence and Preliminary Interpretation

International Nuclear Information System (INIS)

H.H. Liu; Y. Zhang

2006-01-01

The exchange of solute mass (through molecular diffusion) between fluid in fractures and fluid in the rock matrix is called matrix diffusion. Owing to the orders-of-magnitude slower flow velocity in the matrix compared to fractures, matrix diffusion can significantly retard solute transport in fractured rock, and therefore is an important process for a variety of problems, including remediation of subsurface contamination and geological disposal of nuclear waste. The effective matrix diffusion coefficient (molecular diffusion coefficient in free water multiplied by matrix tortuosity) is an important parameter for describing matrix diffusion, and in many cases largely determines overall solute transport behavior. While matrix diffusion coefficient values measured from small rock samples in the laboratory are generally used for modeling field-scale solute transport in fractured rock (Boving and Grathwohl, 2001), several research groups recently have independently found that effective matrix diffusion coefficients much larger than laboratory measurements are needed to match field-scale tracer-test data (Neretnieks, 2002; Becker and Shapiro, 2000; Shapiro, 2001; Liu et al., 2003,2004a). In addition to the observed enhancement, Liu et al. (2004b), based on a relatively small number of field-test results, reported that the effective matrix diffusion coefficient might be scale dependent, and, like permeability and dispersivity, it seems to increases with test scale. This scale-dependence has important implications for large-scale solute transport in fractured rock. Although a number of mechanisms have been proposed to explain the enhancement of the effective matrix diffusion coefficient, the potential scale dependence and its mechanisms are not fully investigated at this stage. The major objective of this study is to again demonstrate (based on more data published in the literature than those used in Liu et al. [2004b]) the potential scale dependence of the effective

Ion beam effects on the surface and near-surface composition of TaSi2

International Nuclear Information System (INIS)

Valeri, S.; Di Bona, A.; Ottaviani, G.; Procop, M.

1991-01-01

Low-energy (0.7-4.5 keV) ion bombardment effects on polycrystalline TaSi 2 at sputter steady state and in various intermediate steps have been investigated, in the temperature range up to 550degC, to determine the time and temperature dependence of the altered layer formation. This in turn enables a better knowledge of the synergistic effects of the processes mentioned above. At low temperatures (T≤410degC) the surface is silicon depleted, and the depletion is even more severe in the subsurface region up to a depth of several tens of angstroems; silicon preferential sputtering and radiation-enhanced segregation assisted by the displacement mixing-induced motion of atoms are assumed to be responsible for this composition profile, while thermally activated diffusion processes become operative above 410degC, reducing progressively the concentration gradient between the surface and the subsurface zone. The composition at different depths has been determined from Auger peaks for different kinetic energies, by varying the take-off angle and finally by sputter profiling at low in energy the high energy processed surfaces. Quantitative analysis has been performed by XPS and AES by using the elemental standard method. (orig.)

Radial thermal diffusivity of toroidal plasma affected by resonant magnetic perturbations

International Nuclear Information System (INIS)

Kanno, Ryutaro; Nunami, Masanori; Satake, Shinsuke; Takamaru, Hisanori; Okamoto, Masao

2012-04-01

We investigate how the radial thermal diffusivity of an axisymmetric toroidal plasma is modified by effect of resonant magnetic perturbations (RMPs), using a drift kinetic simulation code for calculating the thermal diffusivity in the perturbed region. The perturbed region is assumed to be generated on and around the resonance surfaces, and is wedged in between the regular closed magnetic surfaces. It has been found that the radial thermal diffusivity χ r in the perturbed region is represented as χ r = χ r (0) {1 + c r parallel 2 >}. Here r parallel 2 > 1/2 is the strength of the RMPs in the radial directions, means the flux surface average defined by the unperturbed (i.e., original) magnetic field, χ r (0) is the neoclassical thermal diffusivity, and c is a positive coefficient. In this paper, dependence of the coefficient c on parameters of the toroidal plasma is studied in results given by the δ f simulation code solving the drift kinetic equation under an assumption of zero electric field. We find that the dependence of c is given as c ∝ ω b /ν eff m in the low collisionality regime ν eff b , where ν eff is the effective collision frequency, ω b is the bounce frequency and m is the particle mass. In case of ν eff > ω b , the thermal diffusivity χ r evaluated by the simulations becomes close to the neoclassical thermal diffusivity χ r (0) . (author)

The effect of surface condition and cold work on the sulphidation resistance of 153MA at 700 C

Energy Technology Data Exchange (ETDEWEB)

Szakalos, P.; Hertzman, S.; Pettersson, R.F.A. [Swedish Inst. for Metals Research, Stockholm (Sweden); Ivarsson, B. [Avesta Sheffield AB, Avesta (Sweden)

2000-05-01

The normal grain sized 153MA-sample experienced an almost linear weight gain curve in the sulphidizing environment while modified materials, with a finer grain size or cold worked structure, displayed more parabolic behaviour and lower weight gains. These effects may be related to more effective Cr-diffusion in the modified samples with a higher Cr-grain boundary diffusion in the fine grain-sample and a higher Cr-bulk diffusion rate in the cold worked sample. The sand blasted sample performed exceedingly well with a thin protective oxide layer compared to the etched and ground samples which both suffered significant weight loss and spalling. The deformed surface structure on the sand blasted sample enhances the Cr-bulk diffusion thus promoting a protective Cr-rich oxide formation. (orig.)

The Diffusion Effect of MSW Recycling

Directory of Open Access Journals (Sweden)

Yi-Tui Chen

2017-12-01

Full Text Available The purpose of this paper is to compare the recycling performance for some waste fractions selected including food waste, bulk waste, paper, metal products, plastics/rubber and glass products and then to develop some directions for the future improvements. The priority of each waste fraction for recycling is also analyzed by using an importance-performance analysis. Traditionally, the recycling rate that is calculated by the ratio of waste recycled to waste collected is used as an indicator to measure recycling performance. Due to a large variation among waste fractions in municipal solid waste (MSW, the recycling rate cannot reflect the actual recycling performance. The ceiling of recycling rate for each waste fraction estimated from the diffusion models is incorporated into a model to calculate recycling performance. The results show that (1 the diffusion effect exists significantly for the recycling of most recyclables but no evidence is found to support the diffusion effect for the recycling of food waste and bulk waste; (2 the recycling performance of waste metal products ranks the top, compared to waste paper, waste glass and other waste fractions; (3 furthermore, an importance-performance analysis (IPA is employed to analyze the priority of recycling programs and thus this paper suggests that the recycling of food waste should be seen as the most priority item to recycle.

Effective diffusion in time-periodic linear planar flow

International Nuclear Information System (INIS)

Indeikina, A.; Chang, H.

1993-01-01

It is shown that when a point source of solute is inserted into a time-periodic, unbounded linear planar flow, the large-time, time-average transport of the solute can be described by classical anisotropic diffusion with constant effective diffusion tensors. For a given vorticity and forcing period, elongational flow is shown to be the most dispersive followed by simple shear and rotational flow. Large-time diffusivity along the major axis of the time-average concentration ellipse, whose alignment is predicted from the theory, is shown to increase with vorticity for all flows and decrease with increasing forcing frequency for elongational flow and simple shear. For the interesting case of rotational flow, there exist discrete resonant frequencies where the time-average major diffusivity reaches local maxima equal to the time-average steady flow case with zero forcing frequency

Water diffusion in clays with added organic surfactants

International Nuclear Information System (INIS)

Pineda-Pinon, J; Mendoza-Lopez, M L; Manzano-RamIrez, A; Perez-Robles, J F; Vega-Duran, J T

2007-01-01

Tensoactive agents may decrease water absorption in clay products like adobes. They modify the characteristics of the surface of clay particles. Characterization of water diffusion through the pores of modified clays is important to apply appropriate surface modifiers and to improve their performance. We established a simple model for water diffusion in test samples of defined dimensions to estimate real physical parameters and their effect on water absorption. Adsorption mechanisms are examined based on experimental results. The fitting of the experimental data to the model provides a deep understanding of water adsorption in chemically modified clays. A better agreement between the model and the experimental data is achieved for complex molecules

Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

International Nuclear Information System (INIS)

Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

1985-06-01

A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

Evaporation rates and surface profiles on heterogeneous surfaces with mass transfer and surface reaction

Energy Technology Data Exchange (ETDEWEB)

Flytzani-Stephanopoulos, M; Schmidt, L D

1979-01-01

Simple models incorporating surface reaction and diffusion of volatile products through a boundary layer are developed to calculate effective rates of evaporation and local surface profiles on surfaces having active and inactive regions. The coupling between surface heterogeneities with respect to a particular reaction and external mass transfer may provide a mechanism for the surface rearrangement and metal loss encountered in several catalytic systems of practical interest. Calculated transport rates for the volatilization of platinum in oxidizing environments and the rearrangement of this metal during the ammonia oxidation reaction agree well with published experimental data.

Simple computation of reaction–diffusion processes on point clouds

KAUST Repository

Macdonald, Colin B.

2013-05-20

The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.

Simple computation of reaction–diffusion processes on point clouds

KAUST Repository

Macdonald, Colin B.; Merriman, Barry; Ruuth, Steven J.

2013-01-01

The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.

Modeling Effectivity of Atmospheric Advection-Diffusion Processes

International Nuclear Information System (INIS)

Brojewski, R.

1999-01-01

Some methods of solving the advection-diffusion problems useful in the field of atmospheric physics are presented and analyzed in the paper. The most effective one ( from the point of view of computer applications) was chosen. This is the method of problem decomposition with respect to the directions followed by secondary decomposition of the problem with respect to the physical phenomena. Introducing some corrections to the classical numerical methods of solving the problems, a hybrid composed of the finite element method for the advection problems and the implicit method with averaging for the diffusion processes was achieved. This hybrid method and application of the corrections produces a very effective means for solving the problems of substance transportation in atmosphere. (author)

Diffusion in crystalline rocks of some sorbing and nonsorbing species

International Nuclear Information System (INIS)

Skagius, K.; Neretnieks, I.

1983-01-01

Laboratory experiments to determine the sorption and the rate of diffusion of cesium and strontium in pieces of granite have been performed. The effective diffusivity, D sub (p) x E sub (p) was found to be 1 - 2 x 10 - 12 m 2 /s for both cesium and strontium. The diffusion of non-sorbing species in granites and other rock materials have been studied in laboratory scale. The non-sorbing species were iodide, tritiated water, Cr-EDTA and Uranine. In granites the effective diffusivities were determined to be 0.7-1.3 x 10 - 13 m 2 /s for iodide and 1.3 - 1.8 x 10 - 13 m 2 /s for tritiated water. Electrical resistivity measurements in salt water saturated rock cores have been performed. The resistivity is measured in the saturated core and in the salt solution with which the core has been saturated. The ratio between these two resistivities has a direct relation to the ratio of the effective diffusivity for a component in the rock material and the diffusivity in free water for the same component. The results from the electrical resistivity measurements and the experiments with diffusion of non-sorbing species are in fair agreement. The effective diffusivity for cesium and strontium (sorbing species) are, however, more than ten times higher than expected from the results of diffusion of non-sorbing species and the electrical resistivity measurements. This is interpreted as an effect of surface diffusion. (Authors)

Measurement of ageing effect on chloride diffusion coefficients in cementitious matrices

International Nuclear Information System (INIS)

Andrade, C.; Castellote, M.; D'Andrea, R.

2011-01-01

Most of the low-level nuclear waste disposal facilities are based in engineered multi barrier systems where reinforced concrete is one of the basic materials. The calculation of the time until steel reinforcement depassivation is a need due to the demand of prediction of the service life of concrete structures in radioactive repositories. In doing that, one of the main steps is the transport of chloride ions towards the reinforcement, as one of the most aggressive agents for the rebars in concrete is chloride ions. Ageing of concrete related to chloride penetration leads to significant decrease of the 'apparent diffusion' coefficient with time. If this effect is not considered, considerable bias can be introduced when predicting service life of reinforced concrete of repositories. Several effects have been addressed on their influence on the ageing of concrete, including the evolution with time of the concrete pore refinement, the binding of chlorides to the cement phases and to the changes of chloride 'surface concentration'. These effects have been studied in specimens made with different mixes trying to represent a wide range of mineral addition proportions. The analysis of their evolution with time has shown that the resistivity alone or the joint consideration of resistivity and binding capacity (C b /C f ), are appropriate parameters to appraise the diffusivity ageing. For practical reasons, an accelerated procedure is proposed in order to calculate ageing for short periods of time.

Stress in film/substrate system due to diffusion and thermal misfit effects

International Nuclear Information System (INIS)

Shao Shanshan; Xuan Fuzhen; Wang Zhengdong; Tu Shantung

2009-01-01

The stress in film/substrate systems has been analysed taking into consideration the coupling effects of diffusion and thermal misfit within the framework of Fick's second law. The solution of diffusion-induced stress in a film/substrate system involving the thermal misfit stress feedback is developed. The effects of modulus ratios, diffusivity ratios, thickness ratios of the substrate and the film and the partial molar volume of the diffusing component on the stress distribution in the film/substrate system are then discussed with the help of the finite difference method. Results indicate that the stresses in the film/substrate system vary with diffusion time. Diffusion enhances the magnitudes of film stress when the thermal misfit stress is compressive in the film. Furthermore, the absolute values of stress in the film increase with the increasing modulus ratios of the substrate and film, while they reduce with the increasing partial molar volume of the diffusing component and the diffusivity ratio of the substrate and the film.

Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

Directory of Open Access Journals (Sweden)

Murat Kuscu

Full Text Available We consider a microfluidic molecular communication (MC system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA. However, analytical models are key for the information and communication technology (ICT, as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

Science.gov (United States)

Kuscu, Murat; Akan, Ozgur B

2018-01-01

We consider a microfluidic molecular communication (MC) system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA). However, analytical models are key for the information and communication technology (ICT), as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

Deuterium permeation and diffusion in high purity beryllium

International Nuclear Information System (INIS)

Abramov, E.

1990-05-01

The permeation rate of deuterium through high-purity beryllium membranes was measured using the gas-driven permeation technique. The time-dependent and the steady-state deuterium flux data were analyzed and the effective diffusivities of the samples were determined. A multilayer permeation theory was used in order to eliminate the surface oxide effects and the diffusion coefficients of the bulk beryllium were determined. The diffusion parameters obtained for the extra-grade beryllium samples (99.8%) are D 0 = 6.7 x 10 -9 [m 2 /s] and E D = 28.4 [KJ/mol]; and for the high-grade beryllium samples (99%) the parameters are D 0 = 8.0 x 10 -9 [m 2 /s] and E D = 35.1 [KJ/mol

Adsorption and diffusion of dilute gases in microporous graphite pellets in relation to their macroscopic structure

International Nuclear Information System (INIS)

Savvakis, C.; Tsimillis, K.; Petropoulos, J.H.

1982-01-01

The adsorption and gas-phase or surface diffusion properties of a series of microporous pellets made by the compaction of very fine graphite powder are reported. The overall degree of compaction of the powder was very nearly the same in all cases, but the mode of compaction was varied. The resulting variation in the macroscopic structural inhomogeneity of the pellets (examined in some detail in a parallel study) has been shown to affect both adsorption and diffusion properties. The effect on adsorption properties was modest but definite and can be accounted for by the dependence of the extent of adsorption on pore size. On the other hand, the experimental gas-phase and surface diffusion coefficients were strongly dependent on macroscopic structure. The dependence of the surface diffusion coefficient was particularly marked and is of special interest: such effects have not, so far, been taken into account in interpretations of experimental data, although they can be predicted theoretically. Previous analyses of the structure dependence of experimental gas-phase and surface diffusion coefficients are thus subject to revision in the light of the present conclusions. (author)

Oxygen diffusion in nanocrystalline yttria-stabilized zirconia: the effect of grain boundaries.

Science.gov (United States)

De Souza, Roger A; Pietrowski, Martha J; Anselmi-Tamburini, Umberto; Kim, Sangtae; Munir, Zuhair A; Martin, Manfred

2008-04-21

The transport of oxygen in dense samples of yttria-stabilized zirconia (YSZ), of average grain size d approximately 50 nm, has been studied by means of 18O/16O exchange annealing and secondary ion mass spectrometry (SIMS). Oxygen diffusion coefficients (D*) and oxygen surface exchange coefficients (k*) were measured for temperatures 673diffusion along grain boundaries. Rather, the analysis indicates that grain boundaries hinder oxygen transport.

Diffusivity, solubility and thermodynamic modelling of diffusion growth of Ga"3"+-doped LiTaO_3 thin film for integrated optics

International Nuclear Information System (INIS)

Zhang, De-Long; Zhang, Qun; Zhang, Pei; Kang, Jian; Wong, Wing-Han; Yu, Dao-Yin

2016-01-01

Graphical abstract: Diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film was studied thermodynamically. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. The Ga"3"+ profile in the grown thin film was analyzed by secondary ion mass spectrometry. Form the measured Ga"3"+ profiles, some thermodynamic parameters were obtained. These include diffusivity, diffusion constant, chemical activation energy, solubility, solubility constant and enthalpy of solution. These parameters are crucial to design and growth of a Ga"3"+-doped LT thin film with desired Ga"3"+ profile for integrated optics application. A thermodynamic model is suggested for the growth and verified experimentally. - Highlights: • Diffusion growth of Ga"3"+-doped LiTaO_3 thin film were studied thermodynamically. • Diffusion constant is 1.41 · 10"−"6 m"2/s and activation energy is 237.2 kJ/mol. • Solubility constant is 22.9 · 10"2"6 ions/m"3 and enthalpy of solution is 28.9 kJ/mol. • Ga"3"+ dopant has small effect on LiTaO_3 refractive index. • Ga"3"+ growth can be described by a Fick-type equation with a constant diffusivity. - Abstract: A thermodynamic study was performed on diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film for integrated optics. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. After growth, the refractive indices at Ga"3"+-doped and un-doped surface parts were measured by prism coupling technique and Li composition there was evaluated from the measured refractive indices. The results show that Ga"3"+ dopant has small effect on the LT index. Li_2O out-diffusion is not measurable. The Ga"3"+ profile in the grown thin film was analysed by secondary ion mass spectrometry. It is found that the grown Ga"3"+ ions follow a complementary error function profile. A

Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

Energy Technology Data Exchange (ETDEWEB)

Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)

2015-12-28

We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.

Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

International Nuclear Information System (INIS)

Mirigian, Stephen; Schweizer, Kenneth S.

2015-01-01

We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry

Ion beam effects on the surface and near-surface composition of TaSi sub 2

Energy Technology Data Exchange (ETDEWEB)

Valeri, S.; Di Bona, A.; Ottaviani, G. (Dipt. di Fisica, Univ. di Modena (Italy)); Procop, M. (Zentralinstitut fuer Elektronenphysik, Berlin (Germany))

1991-07-01

Low-energy (0.7-4.5 keV) ion bombardment effects on polycrystalline TaSi{sub 2} at sputter steady state and in various intermediate steps have been investigated, in the temperature range up to 550degC, to determine the time and temperature dependence of the altered layer formation. This in turn enables a better knowledge of the synergistic effects of the processes mentioned above. At low temperatures (T{<=}410degC) the surface is silicon depleted, and the depletion is even more severe in the subsurface region up to a depth of several tens of angstroems; silicon preferential sputtering and radiation-enhanced segregation assisted by the displacement mixing-induced motion of atoms are assumed to be responsible for this composition profile, while thermally activated diffusion processes become operative above 410degC, reducing progressively the concentration gradient between the surface and the subsurface zone. The composition at different depths has been determined from Auger peaks for different kinetic energies, by varying the take-off angle and finally by sputter profiling at low in energy the high energy processed surfaces. Quantitative analysis has been performed by XPS and AES by using the elemental standard method. (orig.).

Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

Energy Technology Data Exchange (ETDEWEB)

Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

1990-04-01

A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

Surface nanocrystallization by surface mechanical attrition treatment and its effect on structure and properties of plasma nitrided AISI 321 stainless steel

Energy Technology Data Exchange (ETDEWEB)

Lin Yimin [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, 18 Middle Tianshui Road, Lanzhou 730000 (China) and Graduate School of the Chinese Academy of Sciences, Beijing 100039 (China)]. E-mail: linyimin_2001@yahoo.com.cn; Lu Jian [LASMIS, University of Technology of Troyes, 10000 Troyes (France); Wang Liping [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, 18 Middle Tianshui Road, Lanzhou 730000 (China); Graduate School of the Chinese Academy of Sciences, Beijing 100039 (China); Xu Tao [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, 18 Middle Tianshui Road, Lanzhou 730000 (China); Xue Qunji [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, 18 Middle Tianshui Road, Lanzhou 730000 (China)]. E-mail: qjxue@ns.lzb.ac.cn

2006-12-15

A plastic deformation surface layer with nanocrystalline grains was produced on AISI 321 austenitic stainless steel by means of surface mechanical attrition treatment (SMAT). Low-temperature nitriding of SMAT and un-SMAT AISI 321 stainless steel was carried out in pulsed-DC glow discharge. The effect of SMAT pretreatment on the microstructure and properties of the stainless steel were investigated using X-ray diffraction, scanning electron microscopy, transmission electron microscopy, Vickers hardness tester and UMT-2MT tribometer. The results show that the plasma nitriding of AISI 321 steel can be enhanced considerably by means of SMAT process before nitriding, and a much thicker nitrogen diffusion layer with higher hardness was obtained for the SMAT samples when compared with un-SMAT samples. In addition, the wear resistance and load capacity of the nitrided layers on the SMAT samples was much higher than that of the un-SMAT samples due to the thicker S phase case and the gradient nitrogen diffusion layer.

Effect of argon ion sputtering of surface on hydrogen permeation through vanadium

International Nuclear Information System (INIS)

Yamawaki, Michio; Namba, Takashi; Yoneoka, Toshiaki; Kanno, Masayoshi; Shida, Koji.

1983-01-01

In order to measure the hydrogen permeation rate through V with atomically cleaned surface, an Ar ion sputtering apparatus has been installed in the hydrogen permeability measuring system. The permeation rate of the initial specimen was found to be increased by about one order of magnitude after Ar ion sputtering of its upstream side surface. Repeating of such a sputter-cleaning was not so much effective in increasing the steady state permeation rate as the initial sputtering was, but it accelerated the transient response rate by a factor of 2 or 3. The transient response rate was also accelerated by the increase of hydrogen pressure, but this effect tended to be diminished by the sputter-cleaning of specimen surface. The surface impurity layer on the downstream side of specimen was also inferred to act as a diffusion barrier affecting the steady state permeation rate. The present value of activation energy for hydrogen permeation through V at temperatures below 873K was the smallest one ever obtained, showing that the surface effect was minimized in the present study on account of the surface sputter-cleaning in addition to the ultra high vacuum system. (author)

Effects of temporal distribution of specular and diffuse reflections on perceived music quality

Science.gov (United States)

Smitthakorn, Pattra

The purpose of this study was to investigate the effects of the temporal distribution of diffuse and specular reflections on the perceived acoustic qualities of music performance. Sets of impulse responses were designed with different temporal distributions of early acoustic energy (specular and diffuse reflections). Then, three types of anechoic sound sources---orchestral music, trumpet, and piano---were convolved with the designed impulse responses. The results from the listening tests revealed that different room environments were needed to acoustically support different source characteristics. The results show the following: (1) specular reflections arriving within 40 msec of the direct sound improved perceived "clarity" and "intimacy"; (2) specular reflections arriving between 40-80 msec after the direct sound improved perceived "clarity" for orchestral music; (3) specular reflections arriving later than 80 msec after the direct sound are not desirable; (4) large numbers of diffuse reflections arriving within 40 and 80 msec of the direct sound improved perceived "intimacy", "texture", and "overall impression" for all sound sources, heightened perceived "clarity" for trumpet and piano, and reduced perceived "glare" for trumpet; and (5) diffuse reflections arriving between 80-160 msec of the direct sound preserved perceived "reverberance" and reduced perceived "echoes" as opposed to specular reflections arriving in the same time period. The results of this study indicate that music performance halls should be designed to include diffuse reflections from surfaces within the 80 msec time period to achieve preferred texture, intimacy, clarity and overall impression and in the 160 msec time period to reduce echoes; specular reflections arriving within the 40 msec time period should be provided to enhance perceived clarity.

Effect of TiO{sub 2} additive on the sintering of nuclear fuel (U,Pu)O{sub 2}. Contribution of surface diffusion to plutonium distribution; Influence de l`ajout de TiO{sub 2} sur l`aptitude au frittage du combustible nucleaire (U,Pu)O{sub 2}. Contribution de la diffusion de surface a la repartition du plutonium

Energy Technology Data Exchange (ETDEWEB)

Bremier, Stephane [CEA Centre d`Etudes de Cadarache, 13 - Saint-Paul-lez-Durance (France)

1997-12-19

This thesis has as objective the study of the effect of TiO{sub 2} additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO{sub 2} in the presence of TiO{sub 2} has been established and the influence of the PuO{sub 2} distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO{sub 2} and UO{sub 2}-PuO{sub 2}. The results concerning the influence of TiO{sub 2} upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO{sub 2} alone or in the presence of TiO{sub 2} are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO{sub 2}-PuO{sub 2} preparation upon the initial microstructure of the materials and the role played by the PuO{sub 2} grains in sintering. The potentiality of surface diffusion as a means of PuO{sub 2} spreading in the UO{sub 2} is evaluated and correlated with the reduced capacity of sintering the UO{sub 2} ceramics containing PuO{sub 2}. The last chapter deals with the influence of TiO{sub 2} on the development of microstructure in UO{sub 2}-PuO{sub 2} ceramics. While at temperatures below 1500 deg.C the TiO{sub 2} additive affects the surface diffusion and so the plutonium distribution, at values T{>=} 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO{sub 2}, PuO{sub 2} and titanium oxide. Thus the objective is

Preliminary study of diffusion effects in Fricke gel dosimeters

International Nuclear Information System (INIS)

Quiroga, A.; Vedelago, J.; Valente, M.

2014-08-01

Diffusion of ferric ions in ferrous sulfate (Fricke) gels represents one of the main drawbacks of some radiation detectors, like Fricke gel dosimeters. In practice, this disadvantage can be overcome by prompt dosimeter analysis, constraining strongly the time between irradiation and analysis. Due to required integral accuracy levels, special dedicated protocols are implemented with the aim of minimizing signal blurring due to diffusion effects. This work presents dedicated analytic modelling and numerical calculations of diffusion coefficients in Fricke gel radiation sensitive material. Samples are optically analysed by means of visible light transmission measurements capturing images with a Ccd camera provided with a monochromatic 585 nm filter corresponding to the X O-infused Fricke solution absorbance peak. Dose distributions in Fricke gels are suitably delivered in order to assess specific initial conditions further studied by periodical sample image acquisitions. In a first analytic approach, experimental data are fit with linear models in order to achieve a value for the diffusion coefficient. The second approach to the problem consists on a group of computational algorithms based on inverse problem formulation, along with suitable 2D diffusion model capable of estimating diffusion coefficients by fitting the obtained algorithm numerical solutions with the corresponding experimental data. Comparisons are performed by introducing an appropriate functional in order to analyse both experimental and numerical values. Solutions to second order diffusion equation are calculated in the framework of a dedicated method that incorporates Finite Element Method. Moreover, optimised solutions can be attained by gradient type minimisation algorithms. Knowledge about diffusion coefficient for Fricke gel radiation detector might be helpful in accounting for effects regarding elapsed time between dosimeter irradiation and further analysis. Hence, corrections might be included

The impact of changes in parameterizations of surface drag and vertical diffusion on the large-scale circulation in the Community Atmosphere Model (CAM5)

Science.gov (United States)

Lindvall, Jenny; Svensson, Gunilla; Caballero, Rodrigo

2017-06-01

Simulations with the Community Atmosphere Model version 5 (CAM5) are used to analyze the sensitivity of the large-scale circulation to changes in parameterizations of orographic surface drag and vertical diffusion. Many GCMs and NWP models use enhanced turbulent mixing in stable conditions to improve simulations, while CAM5 cuts off all turbulence at high stabilities and instead employs a strong orographic surface stress parameterization, known as turbulent mountain stress (TMS). TMS completely dominates the surface stress over land and reduces the near-surface wind speeds compared to simulations without TMS. It is found that TMS is generally beneficial for the large-scale circulation as it improves zonal wind speeds, Arctic sea level pressure and zonal anomalies of the 500-hPa stream function, compared to ERA-Interim. It also alleviates atmospheric blocking frequency biases in the Northern Hemisphere. Using a scheme that instead allows for a modest increase of turbulent diffusion at higher stabilities only in the planetary boundary layer (PBL) appears to in some aspects have a similar, although much smaller, beneficial effect as TMS. Enhanced mixing throughout the atmospheric column, however, degrades the CAM5 simulation. Evaluating the simulations in comparison with detailed measurements at two locations reveals that TMS is detrimental for the PBL at the flat grassland ARM Southern Great Plains site, giving too strong wind turning and too deep PBLs. At the Sodankylä forest site, the effect of TMS is smaller due to the larger local vegetation roughness. At both sites, all simulations substantially overestimate the boundary layer ageostrophic flow.

Fringe pattern denoising using coherence-enhancing diffusion.

Science.gov (United States)

Wang, Haixia; Kemao, Qian; Gao, Wenjing; Lin, Feng; Seah, Hock Soon

2009-04-15

Electronic speckle pattern interferometry is one of the methods measuring the displacement on object surfaces in which fringe patterns need to be evaluated. Noise is one of the key problems affecting further processing and reducing measurement quality. We propose an application of coherence-enhancing diffusion to fringe-pattern denoising. It smoothes a fringe pattern along directions both parallel and perpendicular to fringe orientation with suitable diffusion speeds to more effectively reduce noise and improve fringe-pattern quality. It is a generalized work of Tang's et al.'s [Opt. Lett.33, 2179 (2008)] model that only smoothes a fringe pattern along fringe orientation. Since our model diffuses a fringe pattern with an additional direction, it is able to denoise low-density fringes as well as improve denoising effectiveness for high-density fringes. Theoretical analysis as well as simulation and experimental verifications are addressed.

Diffusion-controlled reaction. V. Effect of concentration-dependent diffusion coefficient on reaction rate in graft polymerization