WorldWideScience

Sample records for surface diffusion effects

  1. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  2. Semiconductor surface diffusion: Nonthermal effects of photon illumination

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

    2000-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

  3. Nonthermal Effects of Photon Illumination on Surface Diffusion

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

    1998-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

  4. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  5. Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

    2008-01-01

    Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

  6. Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-02-01

    The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

  7. Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

    1976-08-01

    The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

  8. Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

    International Nuclear Information System (INIS)

    Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

    2014-01-01

    The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

  9. Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

    DEFF Research Database (Denmark)

    Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

    1999-01-01

    in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

  10. Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

    Science.gov (United States)

    Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

    2012-09-24

    We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

  11. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  12. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

    2013-12-14

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  13. Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

    International Nuclear Information System (INIS)

    Seddeek, M.A.; Abdelmeguid, M.S.

    2006-01-01

    The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

  14. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  15. Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2002-01-01

    We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

  16. Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2014-12-15

    Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

  17. Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

    International Nuclear Information System (INIS)

    Melkior, T.; Motellier, S.; Yahiaoui, S.

    2005-01-01

    Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

  18. Surface diffusion studies by optical diffraction techniques

    International Nuclear Information System (INIS)

    Xiao, X.D.

    1992-11-01

    The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

  19. The effect of step thickness on the surface diffusion of a Pt adatom

    International Nuclear Information System (INIS)

    Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

    2009-01-01

    The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

  20. Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

    Science.gov (United States)

    1992-11-01

    is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

  1. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  2. Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

    International Nuclear Information System (INIS)

    Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

    2012-01-01

    The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

  3. Tracer surface diffusion on UO2

    International Nuclear Information System (INIS)

    Zhou, S.Y.; Olander, D.R.

    1983-06-01

    Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

  4. Theory and experiments on surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Silvestri, W.L.

    1998-11-01

    The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

  5. Density profile evolution and nonequilibrium effects in partial and full spreading measurements of surface diffusion

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2001-01-01

    in D-C(theta) depend on the initial density gradient and the initial state from which the spreading starts. To this end, we carry out extensive Monte Carlo simulations for a lattice-gas model of the O/W(110) system. Studies of submonolayer spreading from an initially ordered p(2x1) phase at theta = 1....../2 reveal that the spreading and diffusion rates in directions parallel and perpendicular to rows of oxygen atoms are significantly different within the ordered phase. Aside from this effect, we find that the degree of ordering in the initial phase has a relatively small impact on the overall behavior of D...

  6. Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

    Science.gov (United States)

    O'Neill, Kelly C; Lee, Young Jin

    2018-05-01

    The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

  7. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

    2014-01-01

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

  8. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam

    2014-05-20

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

  9. Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

    International Nuclear Information System (INIS)

    Goddard, P.J.

    1989-01-01

    The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

  10. Effect of Vegetable Oils on the Surface Tension, Diffusion and Efficiency of Sethoxydim to Control Wild oat (Avena ludoviciana Durieu.

    Directory of Open Access Journals (Sweden)

    H. Hammami

    2017-08-01

    Full Text Available Introduction: During last century, population explosion has been pressing man to produce more supplies of food by consuming more energy in agroecosystems like applying chemical management strategies. herbicides have increasingly become a key component of weed management programs. In Iran, using herbicides led to increasing wheat yield about 20% and 22% in rainfed and irrigated farms respectively (20. Nonetheless, herbicides have also a negative impact on environment. A tool for reducing the herbicide usage which allows to decreasing their cost and side effects is the use of adjuvants. They increase the effectiveness of the post-emergence herbicides. Some adjuvants have toxic effects on living organisms such as Polyethoxylated tallowamine adjuvants that they are very toxic in fairy shrimp (Thamnocephalus platyurus (6. Vegetable oils are not phytotoxic and likely are degraded and metabolized quickly in the environment (8. Sethoxydim is an acetyl coenzyme A carboxylase (ACCase inhibitor that is considered to be a key enzyme in lipid biosynthesis. Similar to other foliar applied herbicides, it need to be associated with an adjuvant for more effective control. Vegetable oils can be developed characteristics of sethoxydim solution such as surface tension and spry drop diffusion. Therefore, the objective of this research is to determine the effect of vegetable oils on the surface tension, diffusion and efficiency of sethoxydim to control wild oat (Avena ludoviciana Durieu.. Materials and Metods: To evaluate the effect of vegetable oils on properties of sethoxydim solution, a series of experiments were separately conducted at Ferdowsi University of Mashhad and Khorasan Science and Technology Park in 2012. For evaluating the effect of vegetable oils on surface tension of distilled water and sethoxydim solution and the sethoxydim efficiency on wild oat control, three experiments were conducted as factorial based on completely randomized design. In other

  11. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  12. Effect of Reynolds number and saturation level on gas diffusion in and out of a superhydrophobic surface

    Science.gov (United States)

    Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus

    2017-12-01

    This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power

  13. The influence of the surface atomic structure on surface diffusion

    International Nuclear Information System (INIS)

    Ghaleb, Dominique

    1984-03-01

    This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

  14. Modifying glass surfaces via internal diffusion

    DEFF Research Database (Denmark)

    Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

    2010-01-01

    leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

  15. Polymer diffusion in the interphase between surface and solution.

    Science.gov (United States)

    Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

    2018-05-22

    Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

  16. Chemical diffusion on solid surfaces. Final report

    International Nuclear Information System (INIS)

    Hudson, J.B.

    1980-12-01

    The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

  17. Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

    Science.gov (United States)

    Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

    2005-09-01

    We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

  18. Diffusion of particles adsorbed on reconstructive surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

    2005-01-01

    Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

  19. Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

    Directory of Open Access Journals (Sweden)

    Louena Shtrepi

    2017-02-01

    Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

  20. Self-diffusion on copper surfaces

    DEFF Research Database (Denmark)

    Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

    1991-01-01

    The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

  1. The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

    2016-04-15

    We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

  2. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    Directory of Open Access Journals (Sweden)

    M. R. Monazzam

    2006-10-01

    Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

  3. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

  4. Diffusion of particles on a fluctuating surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko, Alexander; Jastrabík, Lubomír

    2011-01-01

    Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

  5. Investigation of ion diffusion towards plasmonic surfaces

    International Nuclear Information System (INIS)

    Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

    2013-01-01

    Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

  6. Diffusion effects in undulator radiation

    Directory of Open Access Journals (Sweden)

    Ilya Agapov

    2014-11-01

    Full Text Available Quantum diffusion effects in undulator radiation in semiclassical approximation are considered. Short-term effects on the electron beam motion are discussed and it is shown that approaches based on diffusion approximation with drift-diffusion coefficients derived from undulator or bending magnet radiation spectrum, and on Poisson statistics with radiation spectrum defined by the local beding field, all lead to similar results in terms of electron energy spread for cases of practical interest. An analytical estimate of the influence of quantum diffusion on the undulator radiation spectrum is derived.

  7. Plasma diffusion in systems with disrupted magnetic surfaces

    International Nuclear Information System (INIS)

    Morozov, D.K.; Pogutse, O.P.

    1982-01-01

    Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

  8. Surface sealing using self-assembled monolayers and its effect on metal diffusion in porous low-k dielectrics studied using monoenergetic positron beams

    International Nuclear Information System (INIS)

    Uedono, Akira; Armini, Silvia; Zhang, Yu; Kakizaki, Takeaki; Krause-Rehberg, Reinhard; Anwand, Wolfgang; Wagner, Andreas

    2016-01-01

    Graphical abstract: - Highlights: • Pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the low-k film. • For the sample without the SAM sealing process, metal atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. Almost all pore interiors were covered by those metals. • For the sample damaged by a plasma etch treatment before the SAM sealing process, self-assembled molecules diffused into the OSG film, and they were preferentially trapped by larger pores. - Abstract: Surface sealing effects on the diffusion of metal atoms in porous organosilicate glass (OSG) films were studied by monoenergetic positron beams. For a Cu(5 nm)/MnN(3 nm)/OSG(130 nm) sample fabricated with pore stuffing, C_4F_8 plasma etch, unstuffing, and a self-assembled monolayer (SAM) sealing process, it was found that pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the OSG film. For the sample without the SAM sealing process, metal (Cu and Mn) atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. As a result, almost all pore interiors were covered with those metals. For the sample damaged by an Ar/C_4F_8 plasma etch treatment before the SAM sealing process, SAMs diffused into the OSG film, and they were preferentially trapped by larger pores. The cubic pore side length in these pores containing self-assembled molecules was estimated to be 0.7 nm. Through this work, we have demonstrated that monoenergetic positron beams are a powerful tool for characterizing capped porous films and the trapping of atoms and molecules by pores.

  9. Atomic diffusion in laser surface modified AISI H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-07-01

    This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

  10. Surface modifications by field induced diffusion.

    Directory of Open Access Journals (Sweden)

    Martin Olsen

    Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

  11. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

  12. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    OpenAIRE

    M. R. Monazzam

    2006-01-01

    Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

  13. Diffusion and surface alloying of gradient nanostructured metals

    Directory of Open Access Journals (Sweden)

    Zhenbo Wang

    2017-03-01

    Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

  14. Single atom self-diffusion on nickel surfaces

    International Nuclear Information System (INIS)

    Tung, R.T.; Graham, W.R.

    1980-01-01

    Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

  15. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  16. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  17. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  18. Diffusion processes and memory effects

    International Nuclear Information System (INIS)

    Mokshin, Anatolii V; Yulmetyev, Renat M; Haenggi, Peter

    2005-01-01

    We report the results of the numerical estimation of statistical memory effects in diffusion for two various systems: Lennard-Jones fluids and the model of the Brownian particle in a one-dimensional harmonic lattice. We have found the relation between the diffusion coefficient and the non-Markovity parameter, which is linear for the Lennard-Jones systems in liquid state. The relation between the memory measure and the excess entropy is also discussed here

  19. Thermal diffusivity effect in opto-thermal skin measurements

    International Nuclear Information System (INIS)

    Xiao, P; Imhof, R E; Cui, Y; Ciortea, L I; Berg, E P

    2010-01-01

    We present our latest study on the thermal diffusivity effect in opto-thermal skin measurements. We discuss how thermal diffusivity affects the shape of opto-thermal signal, and how to measure thermal diffusivity in opto-thermal measurements of arbitrary sample surfaces. We also present a mathematical model for a thermally gradient material, and its corresponding opto-thermal signal. Finally, we show some of our latest experimental results of this thermal diffusivity effect study.

  20. Effect of TiO2 additive on the sintering of nuclear fuel (U,Pu)O2. Contribution of surface diffusion to plutonium distribution

    International Nuclear Information System (INIS)

    Bremier, Stephane

    1997-01-01

    This thesis has as objective the study of the effect of TiO 2 additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO 2 in the presence of TiO 2 has been established and the influence of the PuO 2 distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO 2 and UO 2 -PuO 2 . The results concerning the influence of TiO 2 upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO 2 alone or in the presence of TiO 2 are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO 2 -PuO 2 preparation upon the initial microstructure of the materials and the role played by the PuO 2 grains in sintering. The potentiality of surface diffusion as a means of PuO 2 spreading in the UO 2 is evaluated and correlated with the reduced capacity of sintering the UO 2 ceramics containing PuO 2 . The last chapter deals with the influence of TiO 2 on the development of microstructure in UO 2 -PuO 2 ceramics. While at temperatures below 1500 deg.C the TiO 2 additive affects the surface diffusion and so the plutonium distribution, at values T≥ 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO 2 , PuO 2 and titanium oxide. Thus the objective is the optimizing the temperature conditions, the oxygen potential as sintering gas and the additive

  1. Cleaning of diffusion bonding surface by argon ion bombardment treatment

    International Nuclear Information System (INIS)

    Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

    2003-01-01

    The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

  2. Depth Distribution Studies of Carbon in Steel Surfaces by Means of Charged Particle Activation Analysis with an Account of Heat and Diffusion Effects in the Sample

    International Nuclear Information System (INIS)

    Brune, D.; Lorenzen, J.; Witalis, E.

    1972-05-01

    Depth distribution studies of carbon in steel and iron were carried out in the concentration range 0.05-1 %, using proton activation analysis. Surface content studies were performed in the concentration range 0.01-1 % using deuteron activation analysis. The following reactions were utilized: 12 C(p,γ) 13 N and 12 C(d,n) 13 N Evaluations of depth distribution were based on resonances in the excitation function. The carbon content was determined with the aid of the positron emitter, 13 N, using either single-peak or coincidence measurements. The heat dissipation in the irradiated region of the samples was calculated, and the temperature rise was measured using thermocouples. The temperature distribution within the hot zone subjected to irradiation by charged particles, together with the temperature distribution around this zone, was studied in order to estimate any effect this might have on the carbon diffusion. A device for automatic sample exchange which is remotely controlled is described

  3. Surface diffusion and coverage effect of Li atom on graphene as studied by several density functional theory methods

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Zhi [Instituto de Ciencias Físicas, Universidad Nacional Autónoma de México, Av. Universidad 2001, Col. Chamilpa, 62210 Cuernavaca, Morelos (Mexico); Contreras-Torres, Flavio F., E-mail: flavioc@nucleares.unam.mx [Instituto de Ciencias Nucleares, Universidad Nacional Autónoma de México, Circuito Exterior, Ciudad Universitaria, 04510 México, DF (Mexico); Jalbout, Abraham F.; Ramírez-Treviño, Alberto [Instituto Tecnológico de Estudios Superiores de Cajeme, Ciudad Obregon, Sonora (Mexico)

    2013-11-15

    The adsorption of Li atom on graphene is examined using density functional theory methods. Three different adsorption sites are considered, including the on top of a carbon atom (OT), on top of a C-C bond (Bri), and on top of a hexagon (Hol), as well as Li adsorbed at different coverage. The Hol site is found to be the most stable, followed by the Bri and OT sites. The order of stabilization is independent of coverage. The localization of Li–graphene interaction at all sites has reverse order with stabilization. The localization will cause different repulsive interaction between Li atoms which is believed to take responsibility for the difference between the charge transfer order and adsorption energy order of Li adsorption at all possible sites. Repulsive interaction also causes the decreasing of adsorption energies of Li at Hol site with increasing coverage, but the corresponding influence is bigger at low coverage range (0.020–0.056 monolayers) than that at high coverage range (0.056–0.250 monolayers). The trend of charge transfer and dipole moment with increasing coverage is also in agreement with that of adsorption energy. It is also found that the distance of Li above graphene will increase with increasing coverage, but a so-called “zigzag” curve appears, which exhibits an oscillatory behavior as a function of increasing coverage. The diffusion of Li atom on graphene is also studied. Li atom migrates from a Hol site to a neighboring Hol site through the Bri site between them is found to be the minimum energy path. Within the studied coverage range, the diffusion barrier decreases with increasing coverage which can be ascribed to the phenomenon of different repulsion interactions when Li atom adsorbs at different sites. The increasing coverage amplified the phenomenon.

  4. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  5. Memory effects in turbulent diffusion

    International Nuclear Information System (INIS)

    Zagorodny, A.G.; Weiland, J.; Wilhelmsson, H.

    1993-01-01

    A non-Markovian approach is proposed for the derivation of the diffusion coefficient of saturated turbulence. A memory term accounting for nonlocal coherence effects is introduced in a new attempt to describe the transition between weak and strong turbulence. The result compares favourably with recent experiments as well as mode coupling simulations of fusion plasmas. (14 refs.)

  6. Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

    International Nuclear Information System (INIS)

    Hou, W C; Hong, Franklin Chau-Nan

    2009-01-01

    This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

  7. Creep effects in diffusion bonding of oxygen-free copper

    CERN Document Server

    Moilanen, Antti

    Diffusion is the transport of atoms or particles through the surrounding material. Various microstructural changes in metals are based on the diffusion phenomena. In solid metals the diffusion is closely related to crystallographic defects. In single-component metals the dominant mechanism of diffusion is the vacancy mechanism. Diffusion bonding is a direct technological application of diffusion. It is an advanced solidstate joining process in which the surfaces of two components are brought to contact with each other and heated under a pressing load in a controlled environment. During the process, the contact surfaces are bonded by atomic diffusion across the interface and as a result, one solid piece is formed. The condition of high temperature and low applied stress combined with relatively long process duration enables the creep effects to take place in bonded metals. Furthermore, creep causes unwanted permanent deformations in the bonded components. Some authors suggest that there could be a threshold fo...

  8. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  9. Depth Distribution Studies of Carbon in Steel Surfaces by Means of Charged Particle Activation Analysis with an Account of Heat and Diffusion Effects in the Sample

    Energy Technology Data Exchange (ETDEWEB)

    Brune, D; Lorenzen, J [AB Atomenergi, Nykoeping (Sweden); Witalis, E [Swedish National Defence Research Inst., Stockholm (Sweden)

    1972-05-15

    Depth distribution studies of carbon in steel and iron were carried out in the concentration range 0.05-1 %, using proton activation analysis. Surface content studies were performed in the concentration range 0.01-1 % using deuteron activation analysis. The following reactions were utilized: {sup 12}C(p,{gamma}){sup 13}N and {sup 12}C(d,n){sup 13}N Evaluations of depth distribution were based on resonances in the excitation function. The carbon content was determined with the aid of the positron emitter, {sup 13}N, using either single-peak or coincidence measurements. The heat dissipation in the irradiated region of the samples was calculated, and the temperature rise was measured using thermocouples. The temperature distribution within the hot zone subjected to irradiation by charged particles, together with the temperature distribution around this zone, was studied in order to estimate any effect this might have on the carbon diffusion. A device for automatic sample exchange which is remotely controlled is described.

  10. Reactive solid surface morphology variation via ionic diffusion.

    Science.gov (United States)

    Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

    2012-08-14

    In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

  11. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  12. A diffuse radar scattering model from Martian surface rocks

    Science.gov (United States)

    Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

    1987-01-01

    Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

  13. On the diffusion and self-trapping of surface dimers

    Science.gov (United States)

    Kappus, W.

    1982-03-01

    The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

  14. Diffusion of N adatoms on the Fe(100) surface

    DEFF Research Database (Denmark)

    Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

    2000-01-01

    The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

  15. Diffusion of zinc into an unpassivated surface of indium phosphide

    International Nuclear Information System (INIS)

    Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

    1989-01-01

    Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

  16. Collisional diffusion in a torus with imperfect magnetic surfaces

    International Nuclear Information System (INIS)

    White, R.B.

    1983-03-01

    A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

  17. II. Inhibited Diffusion Driven Surface Transmutations

    Science.gov (United States)

    Chubb, Talbot A.

    2006-02-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.

  18. II. Inhibited diffusion driven surface transmutations

    International Nuclear Information System (INIS)

    Cubb, Talbot A.

    2006-01-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  19. II. Inhibited diffusion driven surface transmutations

    Energy Technology Data Exchange (ETDEWEB)

    Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)

    2006-07-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  20. Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

    Science.gov (United States)

    Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

    2015-05-21

    Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

  1. The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

    Science.gov (United States)

    M. C. Sagis, Leonard

    2001-03-01

    In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

  2. Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

    DEFF Research Database (Denmark)

    Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

    2012-01-01

    This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

  3. Bulk-mediated surface diffusion: non-Markovian desorption dynamics

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

    2005-01-01

    Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

  4. Collective effects in diffuse ambiplasma

    International Nuclear Information System (INIS)

    Rogers, S.H.

    1981-01-01

    All laboratory evidence to date indicates that particles materialize from energy only in matter-antimatter pairs and, conversely, disappear only when such pairs annihilate. This observed law suggests that early in the Big Bang, when material and radiation were in equilibrium, the universe contained equal amounts of matter and antimatter. Since the earth, the solar system, and the neighboring stars, as implied by cosmic ray data, appear to be exclusively matter, their antimatter counterparts should by all rights exist elsewhere. Astronomical observations, however, have revealed no signs of antimatter on a large scale; in particular, the energetic gamma rays that would originate in the boundaries between matter and antimatter are not observed. The dilemma is resolved if the laboratory law is violated even minutely, a possibility that is now being tested by experiment. On the other hand, the dilemma disappears if the matter and antimatter exist in separate regions without, in effect, interacting. In this case there must be a repulsive force between the matter and antimatter that prevents them from mixing; in particular, such a force is crucial to the coexistence of large, diffuse regions akin to the galactic interstellar clouds. Predictions of the outcome of matter-antimatter contact are usually based entirely on binary collisions. This disseration explores the possibility that collective effects dominate interactions between diffuse matter and antimatter and give rise to the necessary repulsive force. Some years ago, a mechanism was proposed in which a thin, magnetized layer of ambiplasma kept matter and antimatter plasmas separated with the energy released in occasional annihilation

  5. Effects of diffusion and surface interactions on the line shape of electron paramagnetic resonances in the presence of a magnetic field gradient

    International Nuclear Information System (INIS)

    Schaden, M.; Zhao, K. F.; Wu, Z.

    2007-01-01

    In an evanescent wave magnetometer the Zeeman polarization is probed at micrometer to submicrometer distances from the cell surface. The electron paramagnetic resonance lines of an evanescent wave magnetometer in the presence of a magnetic field gradient exhibit edge enhancement seen previously in nuclear magnetic resonance lines. We present a theoretical model that describes quantitatively the shape of the magnetic resonance lines of an evanescent wave magnetometer under a wide range of experimental conditions. It accounts for diffusion broadening in the presence of a magnetic field gradient as well as interactions of spin polarized Rb atoms with the coated Pyrex glass surfaces. Depending on the field gradient, cell thickness, and buffer gas pressure, the resonance line may have the form of a single asymmetric peak or two peaks localized near the front and back surfaces in frequency space. The double-peaked response depends on average characteristics of the surface interactions. Its shape is sensitive to the dwell time, relaxation probability, and average phase shift of adsorbed spin polarized Rb atoms

  6. Convergence of surface diffusion parameters with model crystal size

    Science.gov (United States)

    Cohen, Jennifer M.; Voter, Arthur F.

    1994-07-01

    A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

  7. Palladium diffusion into bulk copper via the (100) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

    2009-08-05

    Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

  8. Plateau diffusion coefficient for arbitrary flux surface geometry

    International Nuclear Information System (INIS)

    Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

    1981-03-01

    A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

  9. Moessbauer effect and vacancy diffusion

    International Nuclear Information System (INIS)

    Gunther, L.

    1976-01-01

    A dynamical theory of vacancy diffusion which was motivated by the need to explain recent experimental results for the Moessbauer spectra of Fe in Cu, Fe in Au and Fe in Al is presented. Diffusion in these systems is dominated by the vacancy mechanism, which involves strong correlations between successive jumps. The theory developed by Singwi and Sjoelander for the Moessbauer spectrum of a diffusing nucleus is therefore not applicable. The inverse of the normalized Moessbauer spectrum evaluated at zero frequency is introduced as a useful means of comparing experimental with theoretical spectral widths

  10. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1988-09-01

    The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

  11. Dimer-flipping-assisted diffusion on a Si(001) surface

    International Nuclear Information System (INIS)

    Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

    2000-01-01

    The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

  12. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    Science.gov (United States)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  13. Effect of TiO{sub 2} additive on the sintering of nuclear fuel (U,Pu)O{sub 2}. Contribution of surface diffusion to plutonium distribution; Influence de l`ajout de TiO{sub 2} sur l`aptitude au frittage du combustible nucleaire (U,Pu)O{sub 2}. Contribution de la diffusion de surface a la repartition du plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Bremier, Stephane [CEA Centre d`Etudes de Cadarache, 13 - Saint-Paul-lez-Durance (France)

    1997-12-19

    This thesis has as objective the study of the effect of TiO{sub 2} additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO{sub 2} in the presence of TiO{sub 2} has been established and the influence of the PuO{sub 2} distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO{sub 2} and UO{sub 2}-PuO{sub 2}. The results concerning the influence of TiO{sub 2} upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO{sub 2} alone or in the presence of TiO{sub 2} are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO{sub 2}-PuO{sub 2} preparation upon the initial microstructure of the materials and the role played by the PuO{sub 2} grains in sintering. The potentiality of surface diffusion as a means of PuO{sub 2} spreading in the UO{sub 2} is evaluated and correlated with the reduced capacity of sintering the UO{sub 2} ceramics containing PuO{sub 2}. The last chapter deals with the influence of TiO{sub 2} on the development of microstructure in UO{sub 2}-PuO{sub 2} ceramics. While at temperatures below 1500 deg.C the TiO{sub 2} additive affects the surface diffusion and so the plutonium distribution, at values T{>=} 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO{sub 2}, PuO{sub 2} and titanium oxide. Thus the objective is

  14. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  15. Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

    International Nuclear Information System (INIS)

    Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

    2014-01-01

    We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

  16. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  17. Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

    International Nuclear Information System (INIS)

    Cousty, J.P.

    1981-12-01

    In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

  18. Novel exchange mechanisms in the surface diffusion of oxides

    International Nuclear Information System (INIS)

    Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

    2004-01-01

    We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

  19. Transport and diffusion on crystalline surfaces under external forces

    International Nuclear Information System (INIS)

    Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

    2005-01-01

    We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

  20. Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

    Energy Technology Data Exchange (ETDEWEB)

    Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

    2017-02-01

    Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

  1. Adapted diffusion processes for effective forging dies

    Science.gov (United States)

    Paschke, H.; Nienhaus, A.; Brunotte, K.; Petersen, T.; Siegmund, M.; Lippold, L.; Weber, M.; Mejauschek, M.; Landgraf, P.; Braeuer, G.; Behrens, B.-A.; Lampke, T.

    2018-05-01

    Hot forging is an effective production method producing safety relevant parts with excellent mechanical properties. The economic efficiency directly depends on the occurring wear of the tools, which limits service lifetime. Several approaches of the presenting research group aim at minimizing the wear caused by interacting mechanical and thermal loads by using enhanced nitriding technology. Thus, by modifying the surface zone layer it is possible to create a resistance against thermal softening provoking plastic deformation and pronounced abrasive wear. As a disadvantage, intensely nitrided surfaces may possibly include the risk of increased crack sensitivity and therefore feature the chipping of material at the treated surface. Recent projects (evaluated in several industrial applications) show the high technological potential of adapted treatments: A first approach evaluated localized treatments by preventing areas from nitrogen diffusion with applied pastes or other coverages. Now, further ideas are to use this principle to structure the surface with differently designed patterns generating smaller ductile zones beneath nitrided ones. The selection of suitable designs is subject to certain geo-metrical requirements though. The intention of this approach is to prevent the formation and propagation of cracks under thermal shock conditions. Analytical characterization methods for crack sensitivity of surface zone layers and an accurate system of testing rigs for thermal shock conditions verified the treatment concepts. Additionally, serial forging tests using adapted testing geometries and finally, tests in the industrial production field were performed. Besides stabilizing the service lifetime and decreasing specific wear mechanisms caused by thermal influences, the crack behavior was influenced positively. This leads to a higher efficiency of the industrial production process and enables higher output in forging campaigns of industrial partners.

  2. Calculating effective diffusivities in the limit of vanishing molecular diffusion

    International Nuclear Information System (INIS)

    Pavliotis, G.A.; Stuart, A.M.; Zygalakis, K.C.

    2009-01-01

    In this paper we study the problem of the numerical calculation (by Monte Carlo methods) of the effective diffusivity for a particle moving in a periodic divergent-free velocity field, in the limit of vanishing molecular diffusion. In this limit traditional numerical methods typically fail, since they do not represent accurately the geometry of the underlying deterministic dynamics. We propose a stochastic splitting method that takes into account the volume-preserving property of the equations of motion in the absence of noise, and when inertial effects can be neglected. An extension of the method is then proposed for the cases where the noise has a non-trivial time-correlation structure and when inertial effects cannot be neglected. The method of modified equations is used to explain failings of Euler-based methods. The new stochastic geometric integrators are shown to outperform standard Euler-based integrators. Various asymptotic limits of physical interest are investigated by means of numerical experiments, using the new integrators

  3. Boron Diffusion in Surface-Treated Framing Lumber

    Science.gov (United States)

    Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson

    2013-01-01

    The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...

  4. Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2013-01-01

    Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

  5. Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

    Science.gov (United States)

    Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

    Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

  6. Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

    Science.gov (United States)

    Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

    2017-06-01

    Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

  7. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  8. A model for diffuse and global irradiation on horizontal surface

    International Nuclear Information System (INIS)

    Jain, P.C.

    1984-01-01

    The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

  9. Airway surface irregularities promote particle diffusion in the human lung

    International Nuclear Information System (INIS)

    Martonen, T.; North Carolina Univ., Chapel Hill, NC; Zhang, Z.; Yang, Y.; Bottei, G.

    1995-01-01

    Current NCRP and ICRP particle deposition models employed in risk assessment analyses treat the airways of the human lung as smooth-walled tubes. However, the upper airways of the tracheobronchial (TB) tree are line with cartilaginous rings. Recent supercomputer simulations of in vivo conditions (cited herein), where cartilaginous ring morphologies were based upon fibre-optic bronchoscope examinations, have clearly demonstrated their profound effects upon fluid dynamics. A physiologically based analytical model of fluid dynamics is presented, focusing upon applications to particle diffusion within the TB tree. The new model is the first to describe particle motion while simultaneously simulating effects of wall irregularities, entrance conditions and tube curvatures. This study may explain the enhanced deposition by particle diffusion detected in replica case experiments and have salient implications for the clinically observed preferential distributions of bronchogenic carcinomas associated with inhaled radionuclides. (author)

  10. Inertial effects in diffusion-limited reactions

    International Nuclear Information System (INIS)

    Dorsaz, N; Foffi, G; De Michele, C; Piazza, F

    2010-01-01

    Diffusion-limited reactions are commonly found in biochemical processes such as enzyme catalysis, colloid and protein aggregation and binding between different macromolecules in cells. Usually, such reactions are modeled within the Smoluchowski framework by considering purely diffusive boundary problems. However, inertial effects are not always negligible in real biological or physical media on typical observation time frames. This is all the more so for non-bulk phenomena involving physical boundaries, that introduce additional time and space constraints. In this paper, we present and test a novel numerical scheme, based on event-driven Brownian dynamics, that allows us to explore a wide range of velocity relaxation times, from the purely diffusive case to the underdamped regime. We show that our algorithm perfectly reproduces the solution of the Fokker-Planck problem with absorbing boundary conditions in all the regimes considered and is thus a good tool for studying diffusion-guided reactions in complex biological environments.

  11. Direct measurement of Cu surface self-diffusion on a checked surface

    International Nuclear Information System (INIS)

    Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

    1976-01-01

    A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

  12. Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

    Directory of Open Access Journals (Sweden)

    María I. Vázquez

    2015-12-01

    Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

  13. Effective diffusion of confined active Brownian swimmers

    Science.gov (United States)

    Sandoval, Mario; Dagdug, Leonardo

    2014-11-01

    We find theoretically the effect of confinement and thermal fluctuations, on the diffusivity of a spherical active swimmer moving inside a two-dimensional narrow cavity of general shape. The explicit formulas for the effective diffusion coefficient of a swimmer moving inside two particular cavities are presented. We also compare our analytical results with Brownian Dynamics simulations and we obtain excellent agreement. L.D. thanks Consejo Nacional de Ciencia y Tecnologia (CONACyT) Mexico, for partial support by Grant No. 176452. M. S. thanks CONACyT and Programa de Mejoramiento de Profesorado (PROMEP) for partially funding this work under Grant No. 103.5/13/6732.

  14. Reaction effects in diffusive shock acceleration

    International Nuclear Information System (INIS)

    Drury, L.Oc.

    1984-01-01

    The effects of the reaction of accelerated particles back on the shock wave in the diffusive-shock-acceleration model of cosmic-ray generation are investigated theoretically. Effects examined include changes in the shock structure, modifications of the input and output spectra, scattering effects, and possible instabilities in the small-scale structure. It is pointed out that the latter two effects are applicable to any spatially localized acceleration mechanism. 14 references

  15. Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

    Science.gov (United States)

    Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

    2017-01-01

    Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

  16. Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

    International Nuclear Information System (INIS)

    Vree, C; Mayr, S G

    2010-01-01

    The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

  17. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  18. Effective Diffusion Coefficients in Coal Chars

    DEFF Research Database (Denmark)

    Johnsson, Jan Erik; Jensen, Anker

    2001-01-01

    Knowledge of effective diffusion coefficients in char particles is important when interpreting experimental reactivity measurements and modeling char combustion or NO and N2O reduction. In this work, NO and N2O reaction with a bituminous coal char was studied in a fixed-bed quartz glass reactor....... In the case of strong pore diffusion limitations, the error in the interpretation of experimental results using the mean pore radius could be a factor of 5 on the intrinsic rate constant. For an average coal char reacting with oxygen at 1300 K, this would be the case for particle sizes larger than about 50...

  19. Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

    International Nuclear Information System (INIS)

    Ma, Z.; Whitley, R.D.; Wang, N.H.L.

    1996-01-01

    A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

  20. Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

    2007-01-01

    Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

  1. Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

    Science.gov (United States)

    Skoch, Gary J.

    2002-01-01

    Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

  2. Effects of electrode properties and fabricated pressure on Li ion diffusion and diffusion-induced stresses in cylindrical Li-ion batteries

    International Nuclear Information System (INIS)

    Zhang, Tao; Guo, Zhansheng

    2014-01-01

    The effects of electrode properties and fabricated pressure on Li ion diffusion and diffusion-induced stress in a cylindrical Li-ion battery are studied. It is found that hydrostatic pressure or elastic modulus variation in the active layer have little effect on the distribution of Li ions for a higher diffusivity coefficient, but both can facilitate Li ion diffusion for a lower diffusivity coefficient. The elastic modulus variation has a significant effect on the distribution of stress and hydrostatic pressure can reduce the surface stress for the lower diffusivity coefficient. A higher charging rate causes a more transient response in the stress history, but a linear charging history is observed for slow charging rates. A higher charging rate would not inflict extra damage on the electrode for the higher diffusivity coefficient and the stress history becomes highly transient and charging rate dependent for the lower diffusivity coefficient. The effect of fabricated pressure can be neglected. (paper)

  3. Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

    Energy Technology Data Exchange (ETDEWEB)

    Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

    1988-03-31

    In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

  4. Effective diffusion in laminar convective flows

    International Nuclear Information System (INIS)

    Rosenbluth, M.N.; Berk, H.L.; Doxas, I.; Horton, W.

    1987-03-01

    The effective diffusion coefficient D* of a passive component, such as test particles, dye, temperature, magnetic flux, etc., is derived for motion in periodic two-dimensional incompressible convective flow with characteristic velocity v and size d in the presence of an intrinsic local diffusivity D. Asymptotic solutions for effective diffusivity D*(P) in the large P limit, with P ∼ vd/D, is shown to be of the form D* = cDP/sup 1/2/ with c being a coefficient that is determined analytically. The constant c depends on the geometry of the convective cell and on an average of the flow speed along the separatrix. The asymptotic method of evaluation applies to both free boundary and rough boundary flow patterns and it is shown that the method can be extended to more complicated patterns such as the flows generated by rotating cylinders, as in the problem considered by Nadim, Cox, and Brenner [J. Fluid Mech., 164: 185 (1986)]. The diffusivity D* is readily calculated for small P, but the evaluation for arbitrary P requires numerical methods. Monte Carlo particle simulation codes are used to evaluate D* at arbitrary P, and thereby describe the transition for D* between the large and small P limits

  5. A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

    Science.gov (United States)

    Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

    2014-02-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

  6. A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

    Science.gov (United States)

    Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

    2014-01-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

  7. The effect of radiation-thermal treatment on the physicochemical properties of the Ni-Mo/Al2O3 hydrotreatment catalyst. II. UV-Vis diffuse reflectance spectra of surface compounds after irradiation

    International Nuclear Information System (INIS)

    Solovetskii, Yu.I.; Miroshinichenko, I.I.; Lunin, V.V.

    1993-01-01

    Radiation-thermal damage of the surface and the active metal phases of hydrodesulfurization Ni-Mo/Al 2 O 3 catalysts by a fast electron beam of up to 2.0 MeV energy was studied. UV-Vis diffuse reflectance spectra of the industrial and model coked systems after radiation-thermal treatment were measured. 14 refs., 2 figs

  8. A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

    International Nuclear Information System (INIS)

    Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

    2016-01-01

    The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

  9. Au nanowire junction breakup through surface atom diffusion

    Science.gov (United States)

    Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

    2018-01-01

    Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

  10. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  11. The Diffusion Effect of MSW Recycling

    Directory of Open Access Journals (Sweden)

    Yi-Tui Chen

    2017-12-01

    Full Text Available The purpose of this paper is to compare the recycling performance for some waste fractions selected including food waste, bulk waste, paper, metal products, plastics/rubber and glass products and then to develop some directions for the future improvements. The priority of each waste fraction for recycling is also analyzed by using an importance-performance analysis. Traditionally, the recycling rate that is calculated by the ratio of waste recycled to waste collected is used as an indicator to measure recycling performance. Due to a large variation among waste fractions in municipal solid waste (MSW, the recycling rate cannot reflect the actual recycling performance. The ceiling of recycling rate for each waste fraction estimated from the diffusion models is incorporated into a model to calculate recycling performance. The results show that (1 the diffusion effect exists significantly for the recycling of most recyclables but no evidence is found to support the diffusion effect for the recycling of food waste and bulk waste; (2 the recycling performance of waste metal products ranks the top, compared to waste paper, waste glass and other waste fractions; (3 furthermore, an importance-performance analysis (IPA is employed to analyze the priority of recycling programs and thus this paper suggests that the recycling of food waste should be seen as the most priority item to recycle.

  12. Communication: Memory effects and active Brownian diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Pulak K. [Department of Chemistry, Presidency University, Kolkata 700073 (India); Li, Yunyun, E-mail: yunyunli@tongji.edu.cn [Center for Phononics and Thermal Energy Science, Tongji University, Shanghai 200092 (China); Marchegiani, Giampiero [Dipartimento di Fisica, Università di Camerino, I-62032 Camerino (Italy); Marchesoni, Fabio [Center for Phononics and Thermal Energy Science, Tongji University, Shanghai 200092 (China); Dipartimento di Fisica, Università di Camerino, I-62032 Camerino (Italy)

    2015-12-07

    A self-propelled artificial microswimmer is often modeled as a ballistic Brownian particle moving with constant speed aligned along one of its axis, but changing direction due to random collisions with the environment. Similarly to thermal noise, its angular randomization is described as a memoryless stochastic process. Here, we speculate that finite-time correlations in the orientational dynamics can affect the swimmer’s diffusivity. To this purpose, we propose and solve two alternative models. In the first one, we simply assume that the environmental fluctuations governing the swimmer’s propulsion are exponentially correlated in time, whereas in the second one, we account for possible damped fluctuations of the propulsion velocity around the swimmer’s axis. The corresponding swimmer’s diffusion constants are predicted to get, respectively, enhanced or suppressed upon increasing the model memory time. Possible consequences of this effect on the interpretation of the experimental data are discussed.

  13. Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

    Science.gov (United States)

    Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

    2015-01-01

    We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

  14. Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

    Science.gov (United States)

    Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

    2017-07-01

    Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

  15. Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

    Science.gov (United States)

    Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

    2011-01-01

    Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

  16. Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

    Directory of Open Access Journals (Sweden)

    Ivan E Collier

    Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

  17. The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1996-01-01

    Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

  18. Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

    Science.gov (United States)

    Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

    2018-01-01

    Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

  19. Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

    Science.gov (United States)

    Chu, Khim Hoong

    2017-11-09

    Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

  20. Excluded-volume effects in the diffusion of hard spheres

    KAUST Repository

    Bruna, Maria; Chapman, S. Jonathan

    2012-01-01

    Excluded-volume effects can play an important role in determining transport properties in diffusion of particles. Here, the diffusion of finite-sized hard-core interacting particles in two or three dimensions is considered systematically using

  1. The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

    Science.gov (United States)

    Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

    2013-06-01

    In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

  2. 'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

    International Nuclear Information System (INIS)

    Livadiotis, George

    2007-01-01

    The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

  3. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

    OpenAIRE

    Li, Xiaofan; Nie, Qing

    2009-01-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  4. Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

    Directory of Open Access Journals (Sweden)

    N. Javid Rouzi

    2009-04-01

    Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

  5. Thermodynamics, diffusion and the Kirkendall effect in solids

    CERN Document Server

    Paul, Aloke; Vuorinen, Vesa; Divinski, Sergiy V

    2014-01-01

    Covering both basic and advanced thermodynamic and phase  principles,  as well as providing stability diagrams relevant for diffusion studies, Thermodynamics, Diffusion and the Kirkendall Effect in Solids maximizes reader insights into Fick’s laws of diffusion, atomic mechanisms, interdiffusion, intrinsic diffusion, tracer diffusion and the Kirkendall effect. Recent advances in the area of interdiffusion will be introduced, while the many practical examples and large number of illustrations given will serve to aid researches working in this area in learning the practical evaluation of various diffusion parameters from experimental results. With a unique approach to the two main focal points in solid state transformations, energetics (thermodynamics) and kinetics (interdiffusion) are extensively studied and their combined use in practise is discussed. Recent developments in the area of Kirkendall effect, grain boundary diffusion and multicomponent diffusion are also covered extensively. This book will appe...

  6. Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

    Science.gov (United States)

    Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

    2014-05-01

    Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

  7. Magnetoresistance of films and strips with the diffuse surface scattering

    International Nuclear Information System (INIS)

    Aronov, A.G.

    1993-08-01

    Magnetoresistance of films in a parallel magnetic field and strips in a perpendicular field is considered. The temperature and magnetic field dependencies of magnetoconductance depend on the time evolution of the correlator of phases. This correlator has different behavior as the function of time: the ergodic behavior at small magnetic fields is changed on the nonergodic one at large magnetic fields in spite of the diffusion electron motion due to a diffuse scattering on boundaries. This leads to unusual temperature and magnetic field dependencies of magnetoresistance. The ergodic hypothesis is not applicable to mesoscopical fluctuations at such a large quasiclassical field. (author). 6 refs, 5 figs

  8. Second generation diffusion model of interacting gravity waves on the surface of deep fluid

    Directory of Open Access Journals (Sweden)

    A. Pushkarev

    2004-01-01

    Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

  9. Laser-induced desorption determinations of surface diffusion on Rh(111)

    International Nuclear Information System (INIS)

    Seebauer, E.G.; Schmidt, L.D.

    1987-01-01

    Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

  10. Excluded-volume effects in the diffusion of hard spheres

    KAUST Repository

    Bruna, Maria

    2012-01-03

    Excluded-volume effects can play an important role in determining transport properties in diffusion of particles. Here, the diffusion of finite-sized hard-core interacting particles in two or three dimensions is considered systematically using the method of matched asymptotic expansions. The result is a nonlinear diffusion equation for the one-particle distribution function, with excluded-volume effects enhancing the overall collective diffusion rate. An expression for the effective (collective) diffusion coefficient is obtained. Stochastic simulations of the full particle system are shown to compare well with the solution of this equation for two examples. © 2012 American Physical Society.

  11. Symmetrical and overloaded effect of diffusion in information filtering

    Science.gov (United States)

    Zhu, Xuzhen; Tian, Hui; Chen, Guilin; Cai, Shimin

    2017-10-01

    In physical dynamics, mass diffusion theory has been applied to design effective information filtering models on bipartite network. In previous works, researchers unilaterally believe objects' similarities are determined by single directional mass diffusion from the collected object to the uncollected, meanwhile, inadvertently ignore adverse influence of diffusion overload. It in some extent veils the essence of diffusion in physical dynamics and hurts the recommendation accuracy and diversity. After delicate investigation, we argue that symmetrical diffusion effectively discloses essence of mass diffusion, and high diffusion overload should be published. Accordingly, in this paper, we propose an symmetrical and overload penalized diffusion based model (SOPD), which shows excellent performances in extensive experiments on benchmark datasets Movielens and Netflix.

  12. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  13. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Science.gov (United States)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  14. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-01-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  15. Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    2009-01-01

    form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

  16. Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

    Directory of Open Access Journals (Sweden)

    N. Tsukahara

    2012-01-01

    Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

  17. Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

    NARCIS (Netherlands)

    Schoots, Koen

    2007-01-01

    This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

  18. Pressure effect on grain boundary diffusion

    International Nuclear Information System (INIS)

    Smirnova, E.S.; Chuvil'deev, V.N.

    1997-01-01

    The influence of hydrostatic pressure on grain boundary diffusion and grain boundary migration in metallic materials is theoretically investigated. The model is suggested that permits describing changes in activation energy of grain boundary self-diffusion and diffusion permeability of grain boundaries under hydrostatic pressure. The model is based on the ideas about island-type structure of grain boundaries as well as linear relationship of variations in grain boundary free volume to hydrostatic pressure value. Comparison of theoretical data with experimental ones for a number of metals and alloys (α-Zr, Sn-Ge, Cu-In with Co, In, Al as diffusing elements) shows a qualitative agreement

  19. Scaling and diffusion of oil spills in the Ocean Surface

    Science.gov (United States)

    Tarquis, A. M.; Platonov, A.; Grau, J.; Sekula, E.

    2010-05-01

    The region of the Gulf of Lions at the northwestern Mediterranean Sea has been studied within a ten-year period from December 1996 until November 2006. More than 1000 synthetic aperture radar (SAR) images, which have been acquired by the Second European Remote Sensing Satellite (ERS 1/2) as well as from ENVISAT. We present statistical results of the structure of several features revealed by SAR such as oil spills and tensioactive slicks dynamic. We compare oil splils obtained from the projects Clean Seas,ENVA4/CT/0334, RC2003/005700, ESP2005/07551 and ESA/AO/IP2240. Since natural (caused by plankton, fish, etc.) slicks as well as man-made oil slicks dampen the small-scale surface waves, which are responsible for the radar backscattering from the ocean surface, both types of effects may be confused and give look/alike false oil spill detections. The early SAR images were processed at a resolution of 1 pixel=200m and were provided by the RApid Information Dissemination System (RAIDS) SAR processing facility in West Freugh, UK. Recent ENVISAT images directly from ESA allow a higher resolution of 1 pixel = 26 m, improving the detected turbulent scaling range. The occurrence of marine oil pollution as well as several dynamic features near Barcelona (frames 8-10, 19, 20; 200 SAR images)is itself a random multi-scale process. The use of different multifractal techniques, both using limits to the smallest and largest available scales, show that the scaling laws are very complex and depend strongly on intermittency of the assumed turbulent cascade, the shapes of the multifractal spectra functions are seen to deviate from an homogeneous multifractal and depend both on the initial conditions of the spill or slick, and on the transit time that the spill has been subjected to the local turbulence.

  20. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Chen Shuguang

    2010-01-01

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

  1. NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2008-01-01

    Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

  2. Diffuse emission and control of copper in urban surface runoff.

    Science.gov (United States)

    Boller, M A; Steiner, M

    2002-01-01

    Copper washed off from roofs and roads is considered to be a major contribution to diffuse copper pollution of urban environments. In order to guarantee sustainable protection of soils and water, the long-term strategy is to avoid or replace copper containing materials on roofs and fagades. Until achievement of this goal, a special adsorber system is suggested to control the diffuse copper fluxes by retention of copper by a mixture of granulated iron-hydroxide (GEH) and calcium carbonate. Since future stormwater runoff concepts are based on decentralised runoff infiltration into the underground, solutions are proposed which provide for copper retention in infiltration sites using GEH adsorption layers. The example of a large copper façade of which the runoff is treated in an adsorption trench reveals the first full-scale data on façade runoff and adsorber performance. During the first year of investigation average façade runoff concentrations in the range of 1-10 mg Cu/l are reduced by 96-99% in the adsorption ditch.

  3. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  4. INTRODUCTION: Surface Dynamics, Phonons, Adsorbate Vibrations and Diffusion

    Science.gov (United States)

    Bruch, L. W.

    2004-07-01

    understanding of the underlying factors determining the optical quality of GaInNAs, such as composition, growth and annealing conditions. We are still far from establishing an understanding of the band structure and its dependence on composition. Fundamental electronic interactions such as electron-electron and electron-phonon scattering, dependence of effective mass on composition, strain and orientation, quantum confinement effects, effects of localized nitrogen states on high field transport and on galvanometric properties, and mechanisms for light emission in these materials, are yet to be fully understood. Nature and formation mechanisms of grown-in and processing-induced defects that are important for material quality and device performance are still unknown. Such knowledge is required in order to design strategies to efficiently control and eliminate harmful defects. For many potential applications (such as solar cells, HBTs) it is essential to get more information on the transport properties of dilute nitride materials. The mobility of minority carriers is known to be low in GaInNAs and related material. The experimental values are far from reaching the theoretical ones, due to defects and impurities introduced in the material during the growth. The role of the material inhomogeneities on the lateral carrier transport also needs further investigation. From the device's point of view most attention to date has been focused on the GaInNAs/GaAs system, mainly because of its potential for optoelectronic devices covering the 1.3-1.55 µm data and telecommunications wavelength bands. As is now widely appreciated, these GaAs-compatible structures allow monolithic integration of AlGaAs-based distributed Bragg reflector mirrors (DBRs) for vertical cavity surface-emitting lasers with low temperature sensitivity and compatibility with AlOx-based confinement techniques. In terms of conventional edge-emitting lasers (EELs), the next step is to extend the wavelength range for cw room

  5. Absence of isotope effect of diffusion in a metallic glass

    International Nuclear Information System (INIS)

    Heesemann, A.; Raetzke, K.; Faupel, F.; Hoffmann, J.; Heinemann, K.

    1995-01-01

    The isotope effect E = d ln(D)/d ln (1/√m) of Co diffusion in structurally relaxed Co 86 Zr 14 and Co 81 Zr 19 glasses has been measured by means of a radiotracer technique. Within experimental accuracy no isotope effect was detected (E < 0.04). This suggests a highly cooperative diffusion mechanism. The connection between diffusion and collective low-frequency relaxations in glasses is discussed. (orig.)

  6. Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

    Science.gov (United States)

    Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

    2017-05-17

    A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

  7. Effects of repository environment on diffusion behavior of radionuclides in buffer materials

    International Nuclear Information System (INIS)

    Kozaki, Tamotsu; Sato, Seichi

    2004-03-01

    Compacted bentonite is considered as a candidate buffer material in the geological disposal of high-level radioactive waste. An important function of the compacted bentonite is to retard the transport of radionuclides from waste forms to the surrounding host rock after degradation of an overpack. Therefore, diffusion behavior of radionuclides in the compacted bentonite has been extensively studied by many researchers for the performance assessments of the geological disposal. However, diffusion mechanism of radionuclides in the bentonite cannot be fully understood, and most experimental data have been obtained at room temperature for the bentonite saturated with low salinity water, which would disagree often with real repository conditions. In this study, therefore, apparent diffusion coefficients were determined at various diffusion temperatures for chloride ions in Na-montmorillonite samples saturated with NaCl solution of high salinity. Activation energies for the apparent diffusion were also obtained from the temperature dependence of the diffusion coefficients at different salinity. As the salinity increased, the apparent diffusion coefficients of chloride ions in montmorillonite were found to increase slightly. On the other hand, the activation energies for the chloride diffusion were found to be almost constant (approximately 12 kJ mol -1 ) and less than that in free water (17.4 kJ mol -1 ). Effects of salinity on diffusion behavior of radionuclides in montmorillonite were discussed from the viewpoints of microstructure of montmorillonite and distribution of ions in the montmorillonite. As a result, the diffusion behavior of sodium ions could be explained by the changes of the predominant diffusion process among pore water diffusion, surface diffusion, and interlayer diffusion that could be caused by the increase of salinity. (author)

  8. Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

    International Nuclear Information System (INIS)

    Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

    2016-01-01

    Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

  9. Random diffusion and leverage effect in financial markets.

    Science.gov (United States)

    Perelló, Josep; Masoliver, Jaume

    2003-03-01

    We prove that Brownian market models with random diffusion coefficients provide an exact measure of the leverage effect [J-P. Bouchaud et al., Phys. Rev. Lett. 87, 228701 (2001)]. This empirical fact asserts that past returns are anticorrelated with future diffusion coefficient. Several models with random diffusion have been suggested but without a quantitative study of the leverage effect. Our analysis lets us to fully estimate all parameters involved and allows a deeper study of correlated random diffusion models that may have practical implications for many aspects of financial markets.

  10. Effects on atmospheric diffusion of meterological processes in coastal zones

    International Nuclear Information System (INIS)

    Raynor, G.S.

    1977-01-01

    Meteorological processes in coastal zones differ from those inland because of the surface discontinuity between land and water. The difference in heating between the two surfaces gives rise to sea or lake breeze circulations which can transport pollutants in nongradient directions and recirculate them over source areas. The step change in surface characteristics at the land-water interface also causes formation of internal boundary layers having different transport velocities and diffusion rates than unmodified air upwind or above the boundary. These features require a more extensive measurement program and more versatile diffusion models than at inland sites

  11. Surface modification of polyethylene by diffuse barrier discharge plasma

    Czech Academy of Sciences Publication Activity Database

    Novák, I.; Števiar, M.; Popelka, A.; Chodák, I.; Mosnáček, J.; Špírková, Milena; Janigová, I.; Kleinová, A.; Sedliačik, J.; Šlouf, Miroslav

    2013-01-01

    Roč. 53, č. 3 (2013), s. 516-523 ISSN 0032-3888 R&D Projects: GA AV ČR(CZ) IAAX08240901 Institutional research plan: CEZ:AV0Z40500505 Keywords : low-density polyethylene * plasma discharge * surface modification Subject RIV: JI - Composite Materials Impact factor: 1.441, year: 2013

  12. Nitrogen diffusion in near-surface range of ion doped molybdenum

    CERN Document Server

    Zamalin, E Y

    2001-01-01

    The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

  13. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  14. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

    DEFF Research Database (Denmark)

    Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

    2017-01-01

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

  15. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

    International Nuclear Information System (INIS)

    Durakanoglu, S.

    2004-01-01

    Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

  17. Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

    Science.gov (United States)

    Tränkle, B; Ruh, D; Rohrbach, A

    2016-03-14

    Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

  18. Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

    International Nuclear Information System (INIS)

    Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

    2010-01-01

    Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

  19. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  20. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  1. Effects of Defects on Hydrogen Diffusion in NbC

    Energy Technology Data Exchange (ETDEWEB)

    Salehinia, Iman, E-mail: isalehinia@niu.edu [Department of Mechanical Engineering, Northern Illinois University, DeKalb, IL 60115 (United States); Mastorakos, Ioannis [Department of Mechanical and Aeronautical Engineering, Clarkson University, Potsdam, NY 13699 (United States); Zbib, Hussein M. [School of Mechanical and Materials Engineering, Washington State University, Pullman, WA 99164 (United States)

    2017-04-15

    Highlights: • MD simulations are used to study the effects of defects on the H diffusion in NbC. • Buckingham potential is more accurate for diffusion of H atoms than LJ potential. • H diffusion coefficient (D) increases with carbon vacancy concentration. • H diffusion coefficient for 6 Å pore (radius = 6 Å) is as high as that for 20 Å pore. • For small pores, H diffusion coefficient drops notably at elevated temperatures. - Abstract: Exceptional mechanical and physical properties of transition metal carbides and nitrides make them good coating-material candidates for extreme corrosive environments such as oil and natural gas wells. However, existence of small pores, pinholes and columnar structures of these ceramics significantly affect their resistance to corrosion, as pore sites would accelerate the diffusion of corrosive media into the substrate. In this research, molecular dynamics atomistic simulations are employed to investigate the effects of the isolated vacancies and the columnar structure on the diffusion rate of H atoms in NbC single crystal at various temperatures. Diffusion coefficient (D) of H atoms in NbC increased with C vacancy concentration. At elevated temperatures, the trapping effect of Nb vacancies is less effective when C vacancies are also present, as H atoms gain enough energy to jump back and forth between the C vacancies. Atomistic simulations also showed a jump in diffusion coefficient for cylindrical pore size of larger than 3 Å radius. Furthermore, D increased monotonically with temperature up to 1000 K in the presence of cylindrical pores. Further increase in temperature resulted in a drop in the diffusion coefficient for small pores while the large pores only showed a lower increasing trend in diffusion coefficient with the temperature.

  2. Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhang

    2015-01-01

    Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

  3. Development of an atmospheric diffusion numerical model for a nuclear facility. Numerical calculation method incorporating building effects

    International Nuclear Information System (INIS)

    Sada, Koichi; Michioka, Takenobu; Ichikawa, Yoichi

    2002-01-01

    Because effluent gas is sometimes released from low positions, viz., near the ground surface and around buildings, the effects caused by buildings within the site area are not negligible for gas diffusion predictions. For these reasons, the effects caused by buildings for gas diffusion are considered under the terrain following calculation coordinate system in this report. Numerical calculation meshes on the ground surface are treated as the building with the adaptation of wall function techniques of turbulent quantities in the flow calculations using a turbulence closure model. The reflection conditions of released particles on building surfaces are taken into consideration in the diffusion calculation using the Lagrangian particle model. Obtained flow and diffusion calculation results are compared with those of wind tunnel experiments around the building. It was apparent that features observed in a wind tunnel, viz., the formation of cavity regions behind the building and the gas diffusion to the ground surface behind the building, are also obtained by numerical calculation. (author)

  4. Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Tang Jianfeng

    2011-01-01

    The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

  5. Effect of Ionic Diffusion on Extracellular Potentials in Neural Tissue.

    Directory of Open Access Journals (Sweden)

    Geir Halnes

    2016-11-01

    Full Text Available Recorded potentials in the extracellular space (ECS of the brain is a standard measure of population activity in neural tissue. Computational models that simulate the relationship between the ECS potential and its underlying neurophysiological processes are commonly used in the interpretation of such measurements. Standard methods, such as volume-conductor theory and current-source density theory, assume that diffusion has a negligible effect on the ECS potential, at least in the range of frequencies picked up by most recording systems. This assumption remains to be verified. We here present a hybrid simulation framework that accounts for diffusive effects on the ECS potential. The framework uses (1 the NEURON simulator to compute the activity and ionic output currents from multicompartmental neuron models, and (2 the electrodiffusive Kirchhoff-Nernst-Planck framework to simulate the resulting dynamics of the potential and ion concentrations in the ECS, accounting for the effect of electrical migration as well as diffusion. Using this framework, we explore the effect that ECS diffusion has on the electrical potential surrounding a small population of 10 pyramidal neurons. The neural model was tuned so that simulations over ∼100 seconds of biological time led to shifts in ECS concentrations by a few millimolars, similar to what has been seen in experiments. By comparing simulations where ECS diffusion was absent with simulations where ECS diffusion was included, we made the following key findings: (i ECS diffusion shifted the local potential by up to ∼0.2 mV. (ii The power spectral density (PSD of the diffusion-evoked potential shifts followed a 1/f2 power law. (iii Diffusion effects dominated the PSD of the ECS potential for frequencies up to several hertz. In scenarios with large, but physiologically realistic ECS concentration gradients, diffusion was thus found to affect the ECS potential well within the frequency range picked up in

  6. Probing the hydration water diffusion of macromolecular surfaces and interfaces

    International Nuclear Information System (INIS)

    Ortony, Julia H; Cheng, Chi-Yuan; Franck, John M; Pavlova, Anna; Hunt, Jasmine; Han, Songi; Kausik, Ravinath

    2011-01-01

    We probe the translational dynamics of the hydration water surrounding the macromolecular surfaces of selected polyelectrolytes, lipid vesicles and intrinsically disordered proteins with site specificity in aqueous solutions. These measurements are made possible by the recent development of a new instrumental and methodological approach based on Overhauser dynamic nuclear polarization (DNP)-enhanced nuclear magnetic resonance (NMR) spectroscopy. This technique selectively amplifies 1 H NMR signals of hydration water around a spin label that is attached to a molecular site of interest. The selective 1 H NMR amplification within molecular length scales of a spin label is achieved by utilizing short-distance range (∼r -3 ) magnetic dipolar interactions between the 1 H spin of water and the electron spin of a nitroxide radical-based label. Key features include the fact that only minute quantities (<10 μl) and dilute (≥100 μM) sample concentrations are needed. There is no size limit on the macromolecule or molecular assembly to be analyzed. Hydration water with translational correlation times between 10 and 800 ps is measured within ∼10 A distance of the spin label, encompassing the typical thickness of a hydration layer with three water molecules across. The hydration water moving within this time scale has significant implications, as this is what is modulated whenever macromolecules or molecular assemblies undergo interactions, binding or conformational changes. We demonstrate, with the examples of polymer complexation, protein aggregation and lipid-polymer interaction, that the measurements of interfacial hydration dynamics can sensitively and site specifically probe macromolecular interactions.

  7. Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

    Directory of Open Access Journals (Sweden)

    Saiful Islam

    2008-01-01

    Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

  8. Surface Effects in Magnetic Nanoparticles

    CERN Document Server

    Fiorani, Dino

    2005-01-01

    This volume is a collection of articles on different approaches to the investigation of surface effects on nanosized magnetic materials, with special emphasis on magnetic nanoparticles. The book aims to provide an overview of progress in the understanding of surface properties and surface driven effects in magnetic nanoparticles through recent results of different modeling, simulation, and experimental investigations.

  9. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  10. Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

    DEFF Research Database (Denmark)

    Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

    1996-01-01

    and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

  11. Explosive instabilities of reaction-diffusion equations including pinch effects

    International Nuclear Information System (INIS)

    Wilhelmsson, H.

    1992-01-01

    Particular solutions of reaction-diffusion equations for temperature are obtained for explosively unstable situations. As a result of the interplay between inertial, diffusion, pinch and source processes certain 'bell-shaped' distributions may grow explosively in time with preserved shape of the spatial distribution. The effect of the pinch, which requires a density inhomogeneity, is found to diminish the effect of diffusion, or inversely to support the inertial and source processes in creating the explosion. The results may be described in terms of elliptic integrals or. more simply, by means of expansions in the spatial coordinate. An application is the temperature evolution of a burning fusion plasma. (au) (18 refs.)

  12. Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

    2015-01-01

    Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

  13. Correlation effects in diffusion: a new approach

    International Nuclear Information System (INIS)

    Benoist, Pierre; Lafore, Pierre; Bocquet, J.-L.

    1975-11-01

    All the methods used up to now to solve the correlation problems are approximate: they do not allow the defect causing the migration to walk to infinity in the crystal. The new method of the present study enables to solve rigorously the correlation problems with the use of double Laplace-Fourier transforms. The method yields both: a compact formulation of all the problems previously treated by other investigators; a solution for problems still unresolved (influence of vacancy concentration on the correlation factor for self diffusion) or too much sophisticated to be treated by the previous methods (dissociated interstitial...) [fr

  14. Effects of Impeller-Diffuser Interaction on Centrifugal Compressor Performance

    Science.gov (United States)

    Tan, Choon S.

    2003-01-01

    This research program focuses on characterizing the effect of impeller-diffuser interactions in a centrifugal compressor stage on its performance using unsteady threedimensional Reynolds-averaged Navier-Stokes simulations. The computed results show that the interaction between the downstream diffuser pressure field and the impeller tip clearance flow can account for performance changes in the impeller. The magnitude of performance change due to this interaction was examined for an impeller with varying tip clearance followed by a vaned or vaneless diffuser. The impact of unsteady impeller-diffuser interaction, primarily through the impeller tip clearance flow, is reflected through a time-averaged change in impeller loss, blockage and slip. The results show that there exists a tip clearance where the beneficial effect of the impeller-diffuser interaction on the impeller performance is at a maximum. A flow feature that consists of tip flow back leakage was shown to occur at design speed for the centrifugal compressor stage. This flow phenomenon is described as tip flow that originates in one passage, flows downstream of the impeller trailing edge and then returns to upstream of the impeller trailing edge of a neighboring passage. Such a flow feature is a source of loss in the impeller. A hypothesis is put forth to show that changing the diffuser vane count and changing impeller-diffuser gap has an analogous effect on the impeller performance. The centrifugal compressor stage was analyzed using diffusers of different vane counts, producing an impeller performance trend similar to that when the impeller-diffuser gap was varied, thus supporting the hypothesis made. This has the implication that the effect impeller performance associated with changing the impeller-diffuser gap and changing diffuser vane count can be described by the non-dimensional ratio of impeller-diffuser gap to diffuser vane pitch. A procedure is proposed and developed for isolating impeller passage

  15. Effect of water film trickling down diffuser walls on the diffuser properties

    International Nuclear Information System (INIS)

    Hibs, M.

    1990-01-01

    The effect of the water film flowing along one of the horizontal walls of a 2D diffuser was studied, the system being regarded as a model of the annular diffuser at the outlet of a steam turbine flown through by wet steam. The aerodynamic properties of the channel examined were found dependent on whether the water film continues to adhere to the wall or loses stability and sprays into the channel space. The increase in losses in the channel so flown through is quite substantial - the losses can multiply exceed those on flown-by walls free from a water film. (author). 7 figs., 1 tab., 2 refs

  16. Study of a diffusion flamelet model, with preferential diffusion effects included

    NARCIS (Netherlands)

    Delhaye, S.; Somers, L.M.T.; Bongers, H.; Oijen, van J.A.; Goey, de L.P.H.; Dias, V.

    2005-01-01

    The non-premixed flamelet model of Peters [1] (model1), which does not include preferential diffusion effects is investigated. Two similar models are presented, but without the assumption of unity Lewis numbers. One of these models was derived by Peters & Pitsch [2] (model2), while the other one was

  17. Ultrathin, wafer-scale hexagonal boron nitride on dielectric surfaces by diffusion and segregation mechanism

    Science.gov (United States)

    Sonde, Sushant; Dolocan, Andrei; Lu, Ning; Corbet, Chris; Kim, Moon J.; Tutuc, Emanuel; Banerjee, Sanjay K.; Colombo, Luigi

    2017-06-01

    Chemical vapor deposition (CVD) of two-dimensional (2D) hexagonal boron nitride (h-BN) is at the center of numerous studies for its applications in novel electronic devices. However, a clear understanding of the growth mechanism is lacking for its wider industrial adoption on technologically relevant substrates such as SiO2. Here, we demonstrate a controllable growth method of thin, wafer scale h-BN films on arbitrary substrates. We also clarify the growth mechanism to be diffusion and surface segregation (D-SS) of boron (B) and nitrogen (N) in Ni and Co thin films on SiO2/Si substrates after exposure to diborane and ammonia precursors at high temperature. The segregation was found to be independent of the cooling rates employed in this report, and to our knowledge has not been found nor reported for 2D h-BN growth so far, and thus provides an important direction for controlled growth of h-BN. This unique segregation behavior is a result of a combined effect of high diffusivity, small film thickness and the inability to achieve extremely high cooling rates in CVD systems. The resulting D-SS h-BN films exhibit excellent electrical insulating behavior with an optical bandgap of about 5.8 eV. Moreover, graphene-on-h-BN field effect transistors using the as-grown D-SS h-BN films show a mobility of about 6000 cm2 V-1 s-1 at room temperature.

  18. Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

    International Nuclear Information System (INIS)

    Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

    2016-01-01

    A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

  19. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    Energy Technology Data Exchange (ETDEWEB)

    Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)

    2015-12-28

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.

  20. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    International Nuclear Information System (INIS)

    Mirigian, Stephen; Schweizer, Kenneth S.

    2015-01-01

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry

  1. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

    2010-05-03

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

  2. Microscale anechoic architecture: acoustic diffusers for ultra low power microparticle separation via traveling surface acoustic waves.

    Science.gov (United States)

    Behrens, Jan; Langelier, Sean; Rezk, Amgad R; Lindner, Gerhard; Yeo, Leslie Y; Friend, James R

    2015-01-07

    We present a versatile and very low-power traveling SAW microfluidic sorting device able to displace and separate particles of different diameter in aqueous suspension; the travelling wave propagates through the fluid bulk and diffuses via a Schröder diffuser, adapted from its typical use in concert hall acoustics to be the smallest such diffuser to be suitable for microfluidics. The effective operating power range is two to three orders of magnitude less than current SAW devices, uniquely eliminating the need for amplifiers, and by using traveling waves to impart forces directly upon suspended microparticles, they can be separated by size.

  3. The effect of laterite density on radon diffusion behavior.

    Science.gov (United States)

    Li, Yongmei; Tan, Wanyu; Tan, Kaixuan; Liu, Zehua; Fang, Qi; Lv, Junwen; Duan, Xianzhe; Liu, Zhenzhong; Guo, Yueyue

    2018-02-01

    Radon generated in porous media such as soils and rocks migrates into indoor and outdoor air mainly by diffusion, possessing significant hazards to human health. In order to reduce these hazards of radon, it is of great importance to study the diffusion behavior of radon. In this study, we systematically measured the radon diffusion coefficient of laterite with the density ranging from 0.917gcm -3 to 2.238gcm -3 , and studied the effect of laterite density on the radon diffusion. The results show that the radon diffusion coefficient of the laterite generally decreases with the increasing laterite density. In addition, three possible relationships between the radon diffusion coefficient and the laterite density are found out as follows: (1) the linear correlation with a slope of -4.48 × 10 -6 for laterite with density ranging from 0.917 to 1.095gcm -3 , (2) the exponential correlation for laterite with density from 1.095 to 1.63gcm -3 , (3) linear correlation with a slope of -3.1 × 10 -7 for laterite with density from 1.63 to 2.238gcm -3 . The complex relationship between the radon diffusion coefficient and density is caused by the change of porosity and tortuosity of the laterite. Therefore, we suggest that a suitable density should be adopted while using the laterite to effectively cover uranium tailings or economically produce building materials that can curb the radon exhalation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

    International Nuclear Information System (INIS)

    Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

    2014-01-01

    Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

  5. Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

    International Nuclear Information System (INIS)

    Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

    1979-01-01

    Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

  6. Diffusion behavior of anion in hardened low-heat portland cement paste containing fly ash. Dependence of effective diffusion coefficient on pore structure

    International Nuclear Information System (INIS)

    Chida, Taiji; Yoshida, Takahiro

    2012-01-01

    In the sub-surface disposal system, the closely packed concrete layer is expected the low diffusivity to retard the migration of radionuclides. Low-heat portland cement containing 30 wt% fly ash (FAC) is a candidate cement material for the construction of sub-surface repository because of its high dense structure and its resistance to cracking. Previously, we reported that FAC has lower diffusivity than Ordinary Portland Cement (OPC) for acetic acid and iodine. However, the mechanism for low diffusivity of FAC was not clear. In this study, the diffusion of multiple trace ions (chlorine, bromine and iodine) in hardened cement pastes was examined by through-diffusion experiments. The effective diffusion coefficients, D e , of the trace ions for hardened OPC cement pastes were on the order of 10 -12 m 2 s -1 for trace ions, and D e for hardened FAC cement pastes were on the order of 10 -13 m 2 s -1 for chlorine, 10 -14 m 2 s -1 for bromine and 10 -15 m 2 s -1 for iodine. Additionally, the pore size distribution and porosity of FAC changed to more closely packed structure for 13 months by the pozzolanic reaction, and the pore size distribution of FAC (mainly 3-10 nm) were an order of magnitude smaller than that of OPC. These results suggest that the low diffusivity of FAC is based on the continuous change in the pore structure and the nano-scale pore size retarding the migration of trace ions. (author)

  7. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  8. Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

    Directory of Open Access Journals (Sweden)

    Szajnar J.

    2014-10-01

    Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

  9. A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

    Energy Technology Data Exchange (ETDEWEB)

    Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

    1996-01-12

    The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

  10. Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

    International Nuclear Information System (INIS)

    Kim, Sung Hoon

    2001-01-01

    Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

  11. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.

    2012-01-26

    In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

    2017-11-07

    Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

  13. A dissolution-diffusion sliding model for soft rock grains with hydro-mechanical effect

    Directory of Open Access Journals (Sweden)

    Z. Liu

    2018-06-01

    Full Text Available The deformation and failure of soft rock affected by hydro-mechanical (HM effect are one of the most concerns in geotechnical engineering, which are basically attributed to the grain sliding of soft rock. This study tried to develop a dissolution-diffusion sliding model for the typical red bed soft rock in South China. Based on hydration film, mineral dissolution and diffusion theory, and geochemical thermodynamics, a dissolution-diffusion sliding model with the HM effect was established to account for the sliding rate. Combined with the digital image processing technology, the relationship between the grain size of soft rock and the amplitude of sliding surface was presented. An equation for the strain rate of soft rocks under steady state was also derived. The reliability of the dissolution-diffusion sliding model was verified by triaxial creep tests on the soft rock with the HM coupling effect and by the relationship between the inversion average disjoining pressure and the average thickness of the hydration film. The results showed that the sliding rate of the soft rock grains was affected significantly by the waviness of sliding surface, the shear stress, and the average thickness of hydration film. The average grain size is essential for controlling the steady-state creep rate of soft rock. This study provides a new idea for investigating the deformation and failure of soft rock with the HM effect. Keywords: Soft rock, Hydro-mechanical (HM effect, Mineral dissolution-diffusion, Grain sliding model

  14. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  15. Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

    Science.gov (United States)

    Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

    2004-07-05

    Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

  16. Applicability of the Fokker-Planck equation to the description of diffusion effects on nucleation

    Science.gov (United States)

    Sorokin, M. V.; Dubinko, V. I.; Borodin, V. A.

    2017-01-01

    The nucleation of islands in a supersaturated solution of surface adatoms is considered taking into account the possibility of diffusion profile formation in the island vicinity. It is shown that the treatment of diffusion-controlled cluster growth in terms of the Fokker-Planck equation is justified only provided certain restrictions are satisfied. First of all, the standard requirement that diffusion profiles of adatoms quickly adjust themselves to the actual island sizes (adiabatic principle) can be realized only for sufficiently high island concentration. The adiabatic principle is essential for the probabilities of adatom attachment to and detachment from island edges to be independent of the adatom diffusion profile establishment kinetics, justifying the island nucleation treatment as the Markovian stochastic process. Second, it is shown that the commonly used definition of the "diffusion" coefficient in the Fokker-Planck equation in terms of adatom attachment and detachment rates is justified only provided the attachment and detachment are statistically independent, which is generally not the case for the diffusion-limited growth of islands. We suggest a particular way to define the attachment and detachment rates that allows us to satisfy this requirement as well. When applied to the problem of surface island nucleation, our treatment predicts the steady-state nucleation barrier, which coincides with the conventional thermodynamic expression, even though no thermodynamic equilibrium is assumed and the adatom diffusion is treated explicitly. The effect of adatom diffusional profiles on the nucleation rate preexponential factor is also discussed. Monte Carlo simulation is employed to analyze the applicability domain of the Fokker-Planck equation and the diffusion effect beyond it. It is demonstrated that a diffusional cloud is slowing down the nucleation process for a given monomer interaction with the nucleus edge.

  17. Multidimensional and memory effects on diffusion of a particle

    International Nuclear Information System (INIS)

    Bao, Jing-Dong

    2001-01-01

    The diffusion of an overdamped Brownian particle in the two-dimensional (2D) channel bounded periodically by a parabola is studied, where the particle is subject to an additive white or colored noise. The diffusion rate constant D * of the particle is evaluated by the quasi-2D approximation and the effective potential approach, and the theoretical result is compared with the Langevin simulation. The properties of the diffusion rate constant are stressed for weak and strong noise cases. It is shown that, in an entropy channel, the value of D * in units of Q decreases with increasing intensity of the colored noise. In the presence of energetic barriers, a nonmonotonic behavior of the reduced diffusion rate constant D * Q -1 as a function of the noise intensity is shown

  18. Effective diffusion in time-periodic linear planar flow

    International Nuclear Information System (INIS)

    Indeikina, A.; Chang, H.

    1993-01-01

    It is shown that when a point source of solute is inserted into a time-periodic, unbounded linear planar flow, the large-time, time-average transport of the solute can be described by classical anisotropic diffusion with constant effective diffusion tensors. For a given vorticity and forcing period, elongational flow is shown to be the most dispersive followed by simple shear and rotational flow. Large-time diffusivity along the major axis of the time-average concentration ellipse, whose alignment is predicted from the theory, is shown to increase with vorticity for all flows and decrease with increasing forcing frequency for elongational flow and simple shear. For the interesting case of rotational flow, there exist discrete resonant frequencies where the time-average major diffusivity reaches local maxima equal to the time-average steady flow case with zero forcing frequency

  19. Effect of organic matter on 125I diffusion in bentonite

    International Nuclear Information System (INIS)

    Tao Wu; Qing Zheng

    2015-01-01

    Through-diffusion method was conducted to investigate the diffusion behavior of 125 I in bentonite in present of organic matter, such as polyaminopolycarboxylate EDTA, oxalic acid, hydrazine and humic acid HA. The effective diffusion coefficient D e value and rock capacity factor α were (2.32.6) × 10 -11 m 2 /s and 0.040-0.052, respectively. The small difference showed that iodine was preferentially associated with silicoaluminate mineral as an inorganic form. In present of HA, the D a value of 125 I was almost two orders of magnitude higher than that of HA and humic substances HS. The D e and α derived from the experiments were used to simulate its diffusion in the designed bentonite obstacle of high-level radioactive waste repository and the results showed that 125 I can be transported from 30 to 50 cm thickness of bentonite to the far-field of repository in several years. (author)

  20. Diffusion of multiple species with excluded-volume effects

    KAUST Repository

    Bruna, Maria; Chapman, S. Jonathan

    2012-01-01

    Stochastic models of diffusion with excluded-volume effects are used to model many biological and physical systems at a discrete level. The average properties of the population may be described by a continuum model based on partial differential equations. In this paper we consider multiple interacting subpopulations/species and study how the inter-species competition emerges at the population level. Each individual is described as a finite-size hard core interacting particle undergoing Brownian motion. The link between the discrete stochastic equations of motion and the continuum model is considered systematically using the method of matched asymptotic expansions. The system for two species leads to a nonlinear cross-diffusion system for each subpopulation, which captures the enhancement of the effective diffusion rate due to excluded-volume interactions between particles of the same species, and the diminishment due to particles of the other species. This model can explain two alternative notions of the diffusion coefficient that are often confounded, namely collective diffusion and self-diffusion. Simulations of the discrete system show good agreement with the analytic results. © 2012 American Institute of Physics.

  1. Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

    Science.gov (United States)

    Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

    2016-04-01

    Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

  2. Diffusion of graphite. The effect of cylindrical canals

    International Nuclear Information System (INIS)

    Carle, R.; Clouet d'Orval, C.; Martelly, J.; Mazancourt, T. de; Sagot, M.; Lattes, R.; Teste du Bailler, A.

    1957-01-01

    Experiments on thermal neutron diffusion in the graphite used as moderator in the pile G1 have been carried out. The object of these experiments is to determine: - the intrinsic quality of this graphite, characterised by its diffusion length L or its Laplacian 1/L 2 - the effect of the canals, which modifies anisotropically the macroscopic diffusion equation and is characterized by two principal diffusion regions (or two principal Laplacian), valid respectively for the diffusion in the direction of the canals and in a perpendicular direction. In order to determine them two experiments are necessary, in which the second derivatives of the flux in relation to the space coordinates are very different. These experiments form the object of the first two parts. Part 1: Diffusion along the axis of a flux coming from the pile source, and limited radially by a quasi cylindrical screen of cadmium bars. This screen, or Faraday cage is designed to give to the thermal flux produced the same radius of extrapolation to zero as that of the pile source. The determination of L (with the graphite full) has been made under the same conditions. The measurements have been interpreted in two ways. The influence of the brackets holding the detectors is discussed. Part 2: Radial diffusion in the graphite surrounding the 'long' cylindrical pile. This is well described by a sum of Bessel functions. Part 3: Results (valid for d = 1.61 t = 17 deg. C). For the graphite without cavity L = 52.7 ± 0.4 cm. The effect of the canals on the diffusion area and its anisotropy are in excellent agreement with the theory of Behrens: L(parallel) = 64.6 cm and L(perpendicular) 62.2 cm. Appendix: Theory of the Faraday cage. (author) [fr

  3. Non-rigid registration of breast surfaces using the laplace and diffusion equations

    Directory of Open Access Journals (Sweden)

    Ou Jao J

    2010-02-01

    Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

  4. Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

    DEFF Research Database (Denmark)

    Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

    2017-01-01

    ) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

  5. Heat Diffusion in Gases, Including Effects of Chemical Reaction

    Science.gov (United States)

    Hansen, C. Frederick

    1960-01-01

    The diffusion of heat through gases is treated where the coefficients of thermal conductivity and diffusivity are functions of temperature. The diffusivity is taken proportional to the integral of thermal conductivity, where the gas is ideal, and is considered constant over the temperature interval in which a chemical reaction occurs. The heat diffusion equation is then solved numerically for a semi-infinite gas medium with constant initial and boundary conditions. These solutions are in a dimensionless form applicable to gases in general, and they are used, along with measured shock velocity and heat flux through a shock reflecting surface, to evaluate the integral of thermal conductivity for air up to 5000 degrees Kelvin. This integral has the properties of a heat flux potential and replaces temperature as the dependent variable for problems of heat diffusion in media with variable coefficients. Examples are given in which the heat flux at the stagnation region of blunt hypersonic bodies is expressed in terms of this potential.

  6. Collisional effects on diffusion scaling laws in electrostatic turbulence

    International Nuclear Information System (INIS)

    Vlad, M.; Spineanu, F.; Misguich, J.H.; Vlad, M.; Spineanu, F.; Balescu, R.

    1999-07-01

    The effect of particle collisions on the effective transport in an electrostatic plasma turbulence is analytically studied in the framework of test particle approach. We show that an amplification of the diffusion coefficient can be produced by the combined effect of collisions and trajectory trapping in the structure of the stochastic potential. The paper is organized as follows. The model and the system of equations are formulated in Sec. 2. A short description of the process of trajectory trapping around the extrema of the stochastic potential and of the de-correlation trajectory method is presented in Sec.3. The effect of particle collisions is treated in Sec. 4 where the running diffusion coefficient is determined. Sec. 5 contains the analyses of the results, and Sec. 6 a detailed study of the possible diffusion regimes. The conclusions are summarized in Sec. 7. (authors)

  7. Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

    International Nuclear Information System (INIS)

    Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

    2012-01-01

    The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

  8. Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

    International Nuclear Information System (INIS)

    Ferrieri, R.A.; Wolf, A.P.

    1984-01-01

    A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

  9. Transient enhanced diffusion in preamorphized silicon: the role of the surface

    Science.gov (United States)

    Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

    1999-01-01

    Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

  10. Dynamics of an optically confined nanoparticle diffusing normal to a surface.

    Science.gov (United States)

    Schein, Perry; O'Dell, Dakota; Erickson, David

    2016-06-01

    Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

  11. Preliminary study of diffusion effects in Fricke gel dosimeters

    Energy Technology Data Exchange (ETDEWEB)

    Quiroga, A. [Centro de Investigacion y Estudios de Matematica de Cordoba, Oficina 318 FaMAF - UNC, Ciudad Universitaria, 5000 Cordoba (Argentina); Vedelago, J. [Laboratorio de Investigaciones e Instrumentacion en Fisica Aplicada a la Medicina e Imagenes por Rayos X, Laboratorio 448 FaMAF - UNC, Ciudad Universitaria, 5000 Cordoba (Argentina); Valente, M., E-mail: aiquiroga@famaf.unc.edu [Instituto de Fisica Enrique Gaviola, Oficina 102 FaMAF - UNC, Av. Luis Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina)

    2014-08-15

    Diffusion of ferric ions in ferrous sulfate (Fricke) gels represents one of the main drawbacks of some radiation detectors, like Fricke gel dosimeters. In practice, this disadvantage can be overcome by prompt dosimeter analysis, constraining strongly the time between irradiation and analysis. Due to required integral accuracy levels, special dedicated protocols are implemented with the aim of minimizing signal blurring due to diffusion effects. This work presents dedicated analytic modelling and numerical calculations of diffusion coefficients in Fricke gel radiation sensitive material. Samples are optically analysed by means of visible light transmission measurements capturing images with a Ccd camera provided with a monochromatic 585 nm filter corresponding to the X O-infused Fricke solution absorbance peak. Dose distributions in Fricke gels are suitably delivered in order to assess specific initial conditions further studied by periodical sample image acquisitions. In a first analytic approach, experimental data are fit with linear models in order to achieve a value for the diffusion coefficient. The second approach to the problem consists on a group of computational algorithms based on inverse problem formulation, along with suitable 2D diffusion model capable of estimating diffusion coefficients by fitting the obtained algorithm numerical solutions with the corresponding experimental data. Comparisons are performed by introducing an appropriate functional in order to analyse both experimental and numerical values. Solutions to second order diffusion equation are calculated in the framework of a dedicated method that incorporates Finite Element Method. Moreover, optimised solutions can be attained by gradient type minimisation algorithms. Knowledge about diffusion coefficient for Fricke gel radiation detector might be helpful in accounting for effects regarding elapsed time between dosimeter irradiation and further analysis. Hence, corrections might be included

  12. Preliminary study of diffusion effects in Fricke gel dosimeters

    International Nuclear Information System (INIS)

    Quiroga, A.; Vedelago, J.; Valente, M.

    2014-08-01

    Diffusion of ferric ions in ferrous sulfate (Fricke) gels represents one of the main drawbacks of some radiation detectors, like Fricke gel dosimeters. In practice, this disadvantage can be overcome by prompt dosimeter analysis, constraining strongly the time between irradiation and analysis. Due to required integral accuracy levels, special dedicated protocols are implemented with the aim of minimizing signal blurring due to diffusion effects. This work presents dedicated analytic modelling and numerical calculations of diffusion coefficients in Fricke gel radiation sensitive material. Samples are optically analysed by means of visible light transmission measurements capturing images with a Ccd camera provided with a monochromatic 585 nm filter corresponding to the X O-infused Fricke solution absorbance peak. Dose distributions in Fricke gels are suitably delivered in order to assess specific initial conditions further studied by periodical sample image acquisitions. In a first analytic approach, experimental data are fit with linear models in order to achieve a value for the diffusion coefficient. The second approach to the problem consists on a group of computational algorithms based on inverse problem formulation, along with suitable 2D diffusion model capable of estimating diffusion coefficients by fitting the obtained algorithm numerical solutions with the corresponding experimental data. Comparisons are performed by introducing an appropriate functional in order to analyse both experimental and numerical values. Solutions to second order diffusion equation are calculated in the framework of a dedicated method that incorporates Finite Element Method. Moreover, optimised solutions can be attained by gradient type minimisation algorithms. Knowledge about diffusion coefficient for Fricke gel radiation detector might be helpful in accounting for effects regarding elapsed time between dosimeter irradiation and further analysis. Hence, corrections might be included

  13. Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

    OpenAIRE

    Bläckberg, Lisa

    2014-01-01

    This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

  14. Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

    OpenAIRE

    Bläckberg, Lisa

    2011-01-01

    This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

  15. Specular and diffuse object extraction from a LiDAR derived Digital Surface Model (DSM)

    International Nuclear Information System (INIS)

    Saraf, N M; Hamid, J R A; Kamaruddin, M H

    2014-01-01

    This paper intents to investigate the indifferent behaviour quantitatively of target objects of interest due to specular and diffuse reflectivity based on generated LiDAR DSM of the study site in Ampang, Kuala Lumpur. The LiDAR data to be used was initially checked for its reliability and accuracy. The point cloud LiDAR data was converted to raster to allow grid analysis of the next process of generating the DSM and DTM. Filtering and masking were made removing the features of interest (i.e. building and tree) and other unwanted above surface features. A normalised DSM and object segmentation approach were conducted on the trees and buildings separately. Error assessment and findings attained were highlighted and documented. The result of LiDAR verification certified that the data is reliable and useable. The RMSE obtained is within the tolerance value of horizontal and vertical accuracy (x, y, z) i.e. 0.159 m, 0.211 m 0.091 m respectively. Building extraction inclusive of roof top based on slope and contour analysis undertaken indicate the capability of the approach while single tree extraction through aspect analysis appears to preserve the accuracy of the extraction accordingly. The paper has evaluated the suitable methods of extracting non-ground features and the effective segmentation of the LiDAR data

  16. An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

    Directory of Open Access Journals (Sweden)

    Yan-Zi Yu

    2015-01-01

    Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

  17. Effect of turbulent collisions on diffusion in stationary plasma turbulence

    International Nuclear Information System (INIS)

    Xia, H.; Ishihara, O.

    1990-01-01

    Recently the velocity diffusion process was studied by the generalized Langevin equation derived by the projection operator method. The further study shows that the retarded frictional function plays an important role in suppressing particle diffusion in the velocity space in stronger turbulence as much as the resonance broadening effect. The retarded frictional effect, produced by the effective collisions due to the plasma turbulence is assumed to be a Gaussian, but non-Markovian and non-wide-sense stationary process. The relations between the proposed formulation and the extended resonance broadening theory is discussed. The authors also carry out test particle numerical experiment for Langmuir turbulence to test the theories. In a stronger turbulence a deviation of the diffusion rate from the one predicted by both the quasilinear and the extended resonance theories has been observed and is explained qualitatively by the present formulation

  18. Effective hydrogen diffusion coefficient for solidifying aluminium alloys

    International Nuclear Information System (INIS)

    Felberbaum, M.; Landry-Desy, E.; Weber, L.; Rappaz, M.

    2011-01-01

    An effective hydrogen diffusion coefficient has been calculated for two solidifying Al - 4.5 wt.% Cu and Al - 10 wt.% Cu alloys as a function of the volume fraction of solid. For this purpose, in situ X-ray tomography was performed on these alloys. For each volume fraction of solid between 0.6 and 0.9, a representative volume element of the microstructure was extracted. Solid and liquid voxels were assimilated to solid and liquid nodes in order to solve the hydrogen diffusion equation based on the chemical potential and using a finite volume formulation. An effective hydrogen diffusion coefficient based on the volume fraction of solid only could be deduced from the results of the numerical model at steady state. The results are compared with various effective medium theories.

  19. Study of Surface Wettability Change of Unconsolidated Sand Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy and Thermogravimetric Analysis.

    Science.gov (United States)

    Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V

    2018-04-01

    The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.

  20. Diffusion in the matrix of rocks from Olkiluoto. The effect of anion exclusion

    International Nuclear Information System (INIS)

    Valkiainen, M.; Aalto, H.; Olin, M.; Lindberg, A.; Siitari-Kauppi, M.

    1995-12-01

    Diffusion in the rock matrix is dependent on two basic factors: the effective diffusion conductivity of the rock and the rock-capacity factor. The aim of this ongoing research is to study both of these factors more closely by finding evidence and studying the significance of anion exclusion and surface diffusion. The material for the study was selected form the drill-core of the drill-hole OL-KR5 from Olkiluoto investigations site. Six rock-types were included in the study, three unaltered and three altered. The water-types selected can be divided to two groups: in one the ionic strength is varied, in the another the ionic type is varied. The diffusion measurements were carried out partly by the equilibration-leaching method, partly by the through-diffusion method. The measurements by the equilibration-leaching method were performed in the anaerobic cabinet and the through-diffusion measurement in laboratory room conditions. Radioactive isotopes 3 H, 35 S, 36 Cl and 22 Na were selected as tracers. This report contains results of the equilibration-leaching measurements and through- diffusion measurements using 3 H (HTO), 36 Cl (Cl-) and 35 S(SO 4 2- ) as tracers. The rock-types under study were also studied in the University of Helsinki, Department of Chemistry using polymethylmethacrylate labelled with 14 C revealing the pore structure. Also, results of specific surface area measurements made in BAM, Berlin are given. The comparison of results obtained by the gas diffusion method at the University of Jyvaeskylae to the results obtained by tritium are also appended. (12 refs., 20 figs., 10 tabs.)

  1. Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

    International Nuclear Information System (INIS)

    Strubelj, Luka; Tiselj, Izrok

    2008-01-01

    Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

  2. Diffusion of oxygen in nitrogen in the pores of graphite. Preliminary results on the effect of oxidation on diffusivity

    Energy Technology Data Exchange (ETDEWEB)

    Hewitt, G. F.; Sharratt, E. W.

    1962-10-15

    Preliminary results are reported from an experimental study of the effect of burnoff on the diffusivity of oxygen in nitrogen within the pores of graphite. It is found that the ratio of effective diffusivity to ''free gas'' diffusivity changes about four-fold in the range 0-9% total oxidation. The viscous permeability, B0, increases in almost the same proportion over the same range.

  3. Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

    DEFF Research Database (Denmark)

    Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

    2015-01-01

    We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

  4. Nuclear Quantum Effects in H(+) and OH(-) Diffusion along Confined Water Wires.

    Science.gov (United States)

    Rossi, Mariana; Ceriotti, Michele; Manolopoulos, David E

    2016-08-04

    The diffusion of protons and hydroxide ions along water wires provides an efficient mechanism for charge transport that is exploited by biological membrane channels and shows promise for technological applications such as fuel cells. However, what is lacking for a better control and design of these systems is a thorough theoretical understanding of the diffusion process at the atomic scale. Here we focus on two aspects of this process that are often disregarded because of their high computational cost: the use of first-principles potential energy surfaces and the treatment of the nuclei as quantum particles. We consider proton and hydroxide ions in finite water wires using density functional theory augmented with an apolar cylindrical confining potential. We employ machine learning techniques to identify the charged species, thus obtaining an agnostic definition that takes explicitly into account the delocalization of the charge in the Grotthus-like mechanism. We include nuclear quantum effects (NQEs) through the thermostated ring polymer molecular dynamics method and model finite system size effects by considering Langevin dynamics on the potential of mean force of the charged species, allowing us to extract the same "universal" diffusion coefficient from simulations with different wire sizes. In the classical case, diffusion coefficients depend significantly on the potential energy surface, in particular on how dispersion forces modulate water-water distances. NQEs, however, make the diffusion less sensitive to the underlying potential and geometry of the wire.

  5. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

    Science.gov (United States)

    Li, Xiaofan; Nie, Qing

    2009-07-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  6. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  7. Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

    Energy Technology Data Exchange (ETDEWEB)

    Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

    2014-02-28

    A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

  8. Diffusion Under Geometrical Constraint

    OpenAIRE

    Ogawa, Naohisa

    2014-01-01

    Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...

  9. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  10. Fem Simulation of Triple Diffusive Natural Convection Along Inclined Plate in Porous Medium: Prescribed Surface Heat, Solute and Nanoparticles Flux

    Directory of Open Access Journals (Sweden)

    Goyal M.

    2017-12-01

    Full Text Available In this paper, triple diffusive natural convection under Darcy flow over an inclined plate embedded in a porous medium saturated with a binary base fluid containing nanoparticles and two salts is studied. The model used for the nanofluid is the one which incorporates the effects of Brownian motion and thermophoresis. In addition, the thermal energy equations include regular diffusion and cross-diffusion terms. The vertical surface has the heat, mass and nanoparticle fluxes each prescribed as a power law function of the distance along the wall. The boundary layer equations are transformed into a set of ordinary differential equations with the help of group theory transformations. A wide range of parameter values are chosen to bring out the effect of buoyancy ratio, regular Lewis number and modified Dufour parameters of both salts and nanofluid parameters with varying angle of inclinations. The effects of parameters on the velocity, temperature, solutal and nanoparticles volume fraction profiles, as well as on the important parameters of heat and mass transfer, i.e., the reduced Nusselt, regular and nanofluid Sherwood numbers, are discussed. Such problems find application in extrusion of metals, polymers and ceramics, production of plastic films, insulation of wires and liquid packaging.

  11. Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-08-15

    Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

  12. Effects of microstructure of clay on diffusion behavior of radionuclides in buffer materials

    International Nuclear Information System (INIS)

    Ohashi, Hiroshi; Sato, Seichi; Kozaki, Tamotsu

    2001-03-01

    Diffusion behavior of radionuclides in compacted bentonite plays an important role in the performance assessment of bentonite buffer material in geological disposal of high-level radioactive waste. Microstructure of bentonite is considered to be one of the key parameters to affect on the diffusion behavior. In this study, therefore, two kinds of montmorillonite (major clay mineral of bentonite) with different particle sizes were prepared, and characterized with several methods. In addition, the apparent and effective diffusion coefficients of HTO, Cl - , and Cs + were determined using the montmorillonite samples with different particle sizes and dry densities. In the sample characterization, the specific surface areas of montmorillonite samples with different particle sizes were determined by the BET and the EGME methods, and the particle size distributions of each sample were analyzed by laser diffraction/scattering particle size analysis. Microstructure of the samples was also observed by scanning electron microscopy (SEM) and atomic force microscopy (AFM). The BET method gave a higher specific surface area of the fine grained sample than of the coarse sample, while the EGME method gave same values for both samples. The laser diffraction/scattering particle size analysis using ethanol as a dispersion medium gave different particle size distributions, but when the samples were dispersed in water with Na 6 (PO 3 ) 6 , the particle size distributions were similar. These findings indicate that the montmorillonite layers, which compose the montmorillonite particles, have the same size, even if the particle sizes of the samples are different. In the diffusion experiments, it was found that the apparent diffusion coefficients of HTO and Cl - for the fine grained sample were higher than for the coarse grained sample at two dry densities, 1.0 and 1.8 Mg m -3 , while the opposite particle size effect was observed for Cs + ions. These findings cannot be explained by changes

  13. On estimating the effective diffusive properties of hardened cement pastes

    International Nuclear Information System (INIS)

    Stora, E.; Bary, B.; Stora, E.; He, Qi-Chang

    2008-01-01

    The effective diffusion coefficients of hardened cement pastes can vary between a few orders of magnitude. The paper aims at building a homogenization model to estimate these macroscopic diffusivities and capture such strong variations. For this purpose, a three-scale description of the paste is proposed, relying mainly on the fact that the initial cement grains hydrate forming a complex microstructure with a multi-scale pore structure. In particular, porosity is found to be well connected at a fine scale. However, only a few homogenization schemes are shown to be adequate to account for such connectivity. Among them, the mixed composite spheres assemblage estimate (Stora, E., He, Q.-C., Bary, B.: J. Appl. Phys. 100(8), 084910, 2006a) seems to be the only one that always complies with rigorous bounds and is consequently employed to predict the effects of this fine porosity on the material effective diffusivities. The model proposed provides predictions in good agreement with experimental results and is consistent with the numerous measurements of critical pore diameters issued from mercury intrusion porosimetry tests. The evolution of the effective diffusivities of cement pastes subjected to leaching is also assessed by adopting a simplified scenario of the decalcification process. (authors)

  14. Thermal diffusion baro-effect in cluster gases

    International Nuclear Information System (INIS)

    Kurlapov, L.M.; Segeda, T.A.

    2003-01-01

    Thermal diffusion baro-effect as a difference of pressure under which action in the established process in the close device the particles flow of an irreversible nature is counterbalanced by current of gas is considered. For not ideal gases the settlement formula is received, in which no ideality is taken into account through the compressibility factor and also for cluster mixture. (author)

  15. Effect of diffusion on enzyme activity in a microreactor

    NARCIS (Netherlands)

    Swarts, J.W.; Kolfschoten, R.C.; Jansen, M.C.A.A.; Janssen, A.E.M.; Boom, R.M.

    2010-01-01

    To establish general rules for setting up an enzyme microreactor system, we studied the effect of diffusion on enzyme activity in a microreactor. As a model system we used the hydrolysis of ortho-nitrophenyl-ß-d-galactopyranoside by ß-galactosidase from Kluyveromyces lactis. We found that the

  16. Silver diffusion and isotope effect in silver rubidium iodide

    International Nuclear Information System (INIS)

    Arzigian, J.S.

    1980-01-01

    The diffusion coefficient of silver in RbAg 4 I 5 was measured in both superionic phases using radiotracer Ag-110m and serial sectioning with a low temperature sectioning apparatus. The activation energies for diffusion in alpha-RbAg 4 I 5 and beta-RbAg 4 I 5 , respectively, are 0.11 +- 0.01 eV and 0.20 +- 0.04 eV. An isotope effect for diffusion was also measured in both superionic phases. Ag-105 and Ag-110m radioisotopes were used with gamma spectroscopy and energy discrimination. The effect is small, with no significant temperature variation, with the value at 333 0 K being 0.12 +- 0.01. The second-order phase transition at 208 0 K has a small effect, if any, on the magnitude of the effect. The data suggest that a highly cooperative transport mechanism is responsible for the unusually high values of both the conductivity and diffusion coefficient. Although it is not possible to deduce the particular mechanism involved, theories inolving ionic polarons, or cooperative motion, such as crowdions or solitons, seem consistent with the observed results

  17. Advection and diffusion in random media implications for sea surface temperature anomalies

    CERN Document Server

    Piterbarg, Leonid I

    1997-01-01

    The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

  18. Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

    Energy Technology Data Exchange (ETDEWEB)

    Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

    2017-11-01

    In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

  19. AN EFFECTIVE RECOMMENDATIONS BY DIFFUSION ALGORITHM FOR WEB GRAPH MINING

    Directory of Open Access Journals (Sweden)

    S. Vasukipriya

    2013-04-01

    Full Text Available The information on the World Wide Web grows in an explosive rate. Societies are relying more on the Web for their miscellaneous needs of information. Recommendation systems are active information filtering systems that attempt to present the information items like movies, music, images, books recommendations, tags recommendations, query suggestions, etc., to the users. Various kinds of data bases are used for the recommendations; fundamentally these data bases can be molded in the form of many types of graphs. Aiming at provided that a general framework on effective DR (Recommendations by Diffusion algorithm for web graphs mining. First introduce a novel graph diffusion model based on heat diffusion. This method can be applied to both undirected graphs and directed graphs. Then it shows how to convert different Web data sources into correct graphs in our models.

  20. Numerical Diffusion Effect in Dynamic Simulation of Thermohydraulic Systems

    International Nuclear Information System (INIS)

    Zanocco, Pablo; Gimenez, Marcelo; Delmastro, Dario

    2003-01-01

    In this work, the behavior of the explicit - up-wind method is studied in two phase natural convection circuit, near the instabilities boundaries.The effect of the numerical diffusion of the scheme upon the system stability is evaluated by means of linearization by small perturbations.The results are compared with a non-diffusive method, in the frequency domain, that solves analytically the linearized equations around a steady state condition.Moreover, a conservation equation transport model using the method of characteristics is implemented and studied.This method is compared with the explicit - up-wind scheme and it is found that it significantly reduces numerical diffusion in the equations solution. Several advantages are visualized for particular cases

  1. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    NARCIS (Netherlands)

    Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

  2. Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

    Science.gov (United States)

    Boisvert, Ghyslain

    Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

  3. Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Sorenson Donna J

    2009-12-01

    Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

  4. Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

    Energy Technology Data Exchange (ETDEWEB)

    Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

    2014-09-15

    An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

  5. First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Wu, M H; Liu, X H; Gu, J F; Jin, Z H

    2013-01-01

    Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

  6. [Analyze nanofiltration separation rule of chlorogenic acid from low concentration ethanol by Donnan effect and solution-diffusion effect].

    Science.gov (United States)

    Li, Cun-Yu; Liu, Li-Cheng; Jin, Li-Yang; Li, Hong-Yang; Peng, Guo-Ping

    2017-07-01

    To separate chlorogenic acid from low concentration ethanol and explore the influence of Donnan effect and solution-diffusion effect on the nanofiltration separation rule. The experiment showed that solution pH and ethanol volume percent had influences on the separation of chlorogenic acid. Within the pH values from 3 to 7 for chlorogenic acid in 30% ethanol, the rejection rate of chlorogenic acid was changed by 70.27%. Through the response surface method for quadratic regression model, an interaction had been found in molecule weight cut-off, pH and ethanol volume percent. In fixed nanofiltration apparatus, the existence states of chlorogenic acid determinedits separation rules. With the increase of ethanol concentration, the free form chlorogenic acid was easily adsorbed, dissolved on membrane surface and then caused high transmittance due to the solution-diffusion effect. However, at the same time, due to the double effects of Donnan effect and solution-diffusion effect, the ionic state of chlorogenic acid was hard to be adsorbed in membrane surface and thus caused high rejection rate. The combination of Box-Behnken design and response surface analysis can well optimize the concentrate process by nanofiltration, and the results showed that nanofiltration had several big advantages over the traditional vacuum concentrate technology, meanwhile, and solved the problems of low efficiency and serious component lossesin the Chinese medicines separation process for low concentration organic solvent-water solution. Copyright© by the Chinese Pharmaceutical Association.

  7. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

    2012-06-08

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  8. Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Kaewploy Somsak

    2015-01-01

    Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

  9. Oxygen diffusion and oxygen effect in tumor tissue

    International Nuclear Information System (INIS)

    Eissa, H.M.; Hehn, G.

    1979-06-01

    The diffusion of oxygen in tumor cords of bronchus carcinoma of the lung have been studied with refined computer methods for solving the diffusion equation in axis symmetric tumor structures. In this tumor configuration we may find three different regions consisting of euoxic cells, hypoxic tumor cells and necrotic parts. In the case of oxygen supply from a capillary inside a cylinder of tumor tissue with radius 200 μm or in a tumor cord of radius 300 μm with oxygen supply by capillaries outside, we get a relation of well oxygenated cells to hypoxic cells approximately as 1:8 or as 1:1.1 respectively. Of course most of the tumor cords observed in histological slices have smaller diameters, so that an average of approximately 20% hypoxic cells can be assumed. Based on the work of Ardenne, the diffusion of oxygen and glucose in a tumor of type DS-carcinosarcom has been investigated in both intact tumor and tumor treated with ionizing radiation. We can show that a strong reoxygenation effect takes place in that the well supplied regions may increase in some tumor configurations up to a factor of four by volume. The biological consequences of the oxygen pressure determined in tumor cells are discussed in detail. The investigation of oxygen diffusion in the intercapillary tumor region should give a quantitative physical basis for considering the oxygen effect with the aim to explain the advantages of neutron therapy against conventional radiotherapy. (orig./MG) [de

  10. Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

    International Nuclear Information System (INIS)

    Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

    2011-01-01

    The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

  11. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1989-01-01

    Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

  12. Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

    Science.gov (United States)

    Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

    2014-08-21

    The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

  13. Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

    International Nuclear Information System (INIS)

    Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

    2009-01-01

    Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

  14. Effects of surface and interface scattering on anomalous Hall effect in Co/Pd multilayers

    KAUST Repository

    Guo, Zaibing; Mi, W. B.; Aboljadayel, Razan; Zhang, Bei; Zhang, Q.; Gonzalez Barba, Priscila; Manchon, Aurelien; Zhang, Xixiang

    2012-01-01

    . By scaling surface scattering contribution with ρAHs∼ργss, the exponent γ has been found to decrease with the increase of surface scattering resistivity, which could account for the thickness-dependent anomalous Hall effect. Interface diffusion induced

  15. Effects of carbon on phosphorus diffusion in SiGe:C and the implications on phosphorus diffusion mechanisms

    International Nuclear Information System (INIS)

    Lin, Yiheng; Xia, Guangrui; Yasuda, Hiroshi; Wise, Rick; Schiekofer, Manfred; Benna, Bernhard

    2014-01-01

    The use of carbon (C) in SiGe base layers is an important approach to control the base layer dopant phosphorus (P) diffusion and thus enhance PNP heterojunction bipolar transistor (HBT) performance. This work quantitatively investigated the carbon impacts on P diffusion in Si 0.82 Ge 0.18 :C and Si:C under rapid thermal anneal conditions. The carbon molar fraction is up to 0.32%. The results showed that the carbon retardation effect on P diffusion is less effective for Si 0.82 Ge 0.18 :C than for Si:C. In Si 0.82 Ge 0.18 :C, there is an optimum carbon content at around 0.05% to 0.1%, beyond which more carbon incorporation does not retard P diffusion any more. This behavior is different from the P diffusion behavior in Si:C and the B in Si:C and low Ge SiGe:C, which can be explained by the decreased interstitial-mediated diffusion fraction f I P, SiGe to 95% as Ge content increases to 18%. Empirical models were established to calculate the time-averaged point defect concentrations and effective diffusivities as a function of carbon and was shown to agree with previous studies on boron, phosphorus, arsenic and antimony diffusion with carbon.

  16. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    International Nuclear Information System (INIS)

    Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

  17. Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

    Science.gov (United States)

    Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

    2018-02-01

    Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

  18. Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

    Science.gov (United States)

    Cox, Trevor John

    Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

  19. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

    Energy Technology Data Exchange (ETDEWEB)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  20. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

    Science.gov (United States)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  1. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

  2. Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

    Energy Technology Data Exchange (ETDEWEB)

    Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

    2014-07-28

    Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

  3. Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

    International Nuclear Information System (INIS)

    Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

    2015-01-01

    Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

  4. The effects of heterogeneities on memory-dependent diffusion

    Science.gov (United States)

    Adib, Farhad; Neogi, P.

    1993-07-01

    Case II diffusion is often seen in glassy polymers, where the mass uptake in sorption is proportional to time t instead of sqrt{t}. A memory dependent diffusion is needed to explain such effects, where the relaxation function used to describe the memory effect has a characteristic time. The ratio of this time to the overall diffusion times is the diffusional Deborah number. Simple models show that case II results when the Deborah number is around one, that is, when the two time scales are comparable. Under investigation are the possible effects of the fact that the glassy polymers are heterogeneous over molecular scales. The averaging form given by DiMarzio and Sanchez has been used to obtain the averaged response. The calculated dynamics of sorption show that whereas case II is still observed, the long term tails change dramatically from the oscillatory to torpid, to chaotic, which are all observed in the experiments. The Deborah number defined here in a self-consistent manner collapses in those cases, but causes no other ill-effects.

  5. Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

    Science.gov (United States)

    Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

    2017-01-01

    The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

  6. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    International Nuclear Information System (INIS)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-01-01

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

  7. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    Energy Technology Data Exchange (ETDEWEB)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-12-14

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

  8. Rancho Seco building wake effects on atmospheric diffusion

    International Nuclear Information System (INIS)

    Start, G.E.; Cate, J.H.; Dickson, C.R.; Ricks, N.R.; Ackerman, G.R.; Sagendorf, J.F.

    1977-11-01

    A series of 23 paired gaseous tracer releases at the Rancho Seco Nuclear Power Station in 1975 was the third of several tests designed to investigate the diffusion characteristics of the atmosphere under conditions of low windspeed and temperature inversion. This test also evaluated the effects of flow around buildings upon dilution of pollutants. Gaseous tracers were laterally dispersed about six times more than the expected amounts from Pasquill--Gifford curves of sigma-y. Most of this increase could be related to observed variance of the horizontal wind direction (meandering). For ground-level releases the effective sigma-z values were 16 times greater than the corresponding values from the Pasquill--Gifford curves. Measured ground-level axial concentrations were about 75 times smaller than predicted by the Gaussian diffusion equation for a ground-level release when Pasquill--Gifford values of sigma-y and sigma-z were used

  9. Modeling Effectivity of Atmospheric Advection-Diffusion Processes

    International Nuclear Information System (INIS)

    Brojewski, R.

    1999-01-01

    Some methods of solving the advection-diffusion problems useful in the field of atmospheric physics are presented and analyzed in the paper. The most effective one ( from the point of view of computer applications) was chosen. This is the method of problem decomposition with respect to the directions followed by secondary decomposition of the problem with respect to the physical phenomena. Introducing some corrections to the classical numerical methods of solving the problems, a hybrid composed of the finite element method for the advection problems and the implicit method with averaging for the diffusion processes was achieved. This hybrid method and application of the corrections produces a very effective means for solving the problems of substance transportation in atmosphere. (author)

  10. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Aerodynamic effects in isotope separation by gaseous diffusion

    International Nuclear Information System (INIS)

    Bert, L.A.; Prosperetti, A.; Fiocchi, R.

    1978-01-01

    The turbulent flow of an isotopic mixture in a porous-walled pipe is considered in the presence of suction through the wall. A simple model is formulated for the evaluation of aerodynamic effects on the separation efficiency. The predictions of the model are found to compare very favourably with experiment. In the limit of small suction velocities, results obtained by other investigators for diffusion in a turbulent steam are recovered. (author)

  12. Effects of thermal vapor diffusion on seasonal dynamics of water in the unsaturated zone

    Science.gov (United States)

    Milly, Paul C.D.

    1996-01-01

    The response of water in the unsaturated zone to seasonal changes of temperature (T) is determined analytically using the theory of nonisothermal water transport in porous media, and the solutions are tested against field observations of moisture potential and bomb fallout isotopic (36Cl and 3H) concentrations. Seasonally varying land surface temperatures and the resulting subsurface temperature gradients induce thermal vapor diffusion. The annual mean vertical temperature gradient is close to zero; however, the annual mean thermal vapor flux is downward, because the temperature‐dependent vapor diffusion coefficient is larger, on average, during downward diffusion (occurring at high T) than during upward diffusion (low T). The annual mean thermal vapor flux is shown to decay exponentially with depth; the depth (about 1 m) at which it decays to e−1of its surface value is one half of the corresponding decay depth for the amplitude of seasonal temperature changes. This depth‐dependent annual mean flux is effectively a source of water, which must be balanced by a flux divergence associated with other transport processes. In a relatively humid environment the liquid fluxes greatly exceed the thermal vapor fluxes, so such a balance is readily achieved without measurable effect on the dynamics of water in the unsaturated zone. However, if the mean vertical water flux through the unsaturated zone is very small (theoretical prediction is supported by long‐term field measurements in the Chihuahuan Desert. The analysis also makes predictions, confirmed by the field observations, regarding the seasonal variations of matric potential at a given depth. The conceptual model of unsaturated zone water transport developed here implies the possibility of near‐surface trapping of any aqueous constituent introduced at the surface.

  13. Diffusion and sorption of neptunium(V) in compacted montmorillonite: effects of carbonate and salinity

    International Nuclear Information System (INIS)

    Tachi, Y.; Yotsuji, K.; Suyama, T.; Seida, Y.; Yui, M.; Nakazawa, T.; Yamada, N.; Ochs, M.

    2010-01-01

    Diffusion and sorption of radionuclides in compacted bentonite/montmorillonite are key processes in the safe geological disposal of radioactive waste. In this study, the effects of carbonate and salinity on neptunium(V) diffusion and sorption in compacted sodium montmorillonite were investigated by experimental and modeling approaches. Effective diffusion coefficients (D e ) and distribution coefficients (K d ) of 237 Np(V) in sodium montmorillonite compacted to a dry density of 800 kg m -3 were measured under four chemical conditions with different salinities (0.05/0.5 M NaCl) and carbonate concentrations (0.0.01 M NaHCO 3 ). D e values for carbonate-free conditions were of the order of 10 -10 -10 -11 m 2 s -1 and decreased as salinity increased, and those for carbonate conditions were of the order of 10 -11 -10 -12 m 2 s -1 and showed the opposite dependence. Diffusion-derived K d values for carbonate-free conditions were higher by one order of magnitude than those for carbonate conditions. Diffusion and sorption behaviors were interpreted based on mechanistic models by coupling thermodynamic aqueous speciation, thermodynamic sorption model (TSM) based on ion exchange, and surface complexation reactions, and a diffusion model based on electrical double layer (EDL) theory in homogeneous narrow pores. The model predicted the experimentally observed tendency of D e and K d qualitatively, as a result of the following mechanisms; 1) the dominant aqueous species are NpO 2 + and NpO 2 CO 3 - for carbonate-free and carbonate conditions, respectively, 2) the effects of cation excess and anion exclusion result in opposite tendencies of D e for salinity, 3) higher carbonate in solution inhibits sorption due to the formation of carbonate complexes. (orig.)

  14. γ-irradiation effect on gas diffusion in polymer films. Part I : Hydrogen diffusion through mylar film

    International Nuclear Information System (INIS)

    Rao, K.A.; Pushpa, K.K.; Iyer, R.M.

    1980-01-01

    γ-irradiation of polymers results in further crosslinking in the polymer or breakdown of the polymer or a combination of both these phenomena depending on the type of polymer, the dose as well as the environment in which irradiation is carried out. The gas diffusion through polymer films is expected to vary depending on these changes. With a view to A evaluate the feasibility of effecting selective diffusion of specific gases and also to correlate the change in diffusion rates with the polymer characteristics these studies have been initiated. Hydrogen diffusion through mylar film γ-irradiated under varying conditions upto a dose of approximately 50 Mrads is reported in this paper. The results indicate negligible change in hydrogen diffusion rates on γ-irradiation. However, γ-irradiation induced crosslinking of acrylic acid on Mylar reduced the hydrogen diffusion rate. The hydrogen diffusion studies may also be useful in finding the glass transition temperature of polymer films as is apparent from the gas diffusion curves. (author)

  15. Germania and Alumina Dopant Diffusion and Viscous Flow Effects at Preparation of Doped Optical Fibers

    Directory of Open Access Journals (Sweden)

    Jens Kobelke

    2017-01-01

    Full Text Available We report on germania and alumina dopant profile shift effects at preparation of compact optical fibers using packaging methods (Stack-and-Draw method, Rod-in-Tube (RiT technique. The sintering of package hollow volume by viscous flow results in a shift of the core-pitch ratio in all-solid microstructured fibers. The ratio is increased by about 5% in the case of a hexagonal package. The shift by diffusion effects of both dopants is simulated for typical slow speed drawing parameters. Thermodynamic approximations of surface dissociation of germania doped silica suggest the need of an adequate undoped silica barrier layer to prevent an undesired bubble formation at fiber drawing. In contrast, alumina doping does not estimate critical dissociation effects with vaporous aluminium oxide components. We report guide values of diffusion length of germania and alumina for the drawing process by kinetic approximation. The germania diffusion involves a small core enlargement, typically in the sub-micrometer scale. Though, the alumina diffusion enlarges it by a few micrometers. A drawn pure alumina preform core rod transforms to an amorphous aluminosilicate core with a molar alumina concentration of only about 50% and a non-gaussian concentration profile.

  16. Stable dissipative optical vortex clusters by inhomogeneous effective diffusion.

    Science.gov (United States)

    Li, Huishan; Lai, Shiquan; Qui, Yunli; Zhu, Xing; Xie, Jianing; Mihalache, Dumitru; He, Yingji

    2017-10-30

    We numerically show the generation of robust vortex clusters embedded in a two-dimensional beam propagating in a dissipative medium described by the generic cubic-quintic complex Ginzburg-Landau equation with an inhomogeneous effective diffusion term, which is asymmetrical in the two transverse directions and periodically modulated in the longitudinal direction. We show the generation of stable optical vortex clusters for different values of the winding number (topological charge) of the input optical beam. We have found that the number of individual vortex solitons that form the robust vortex cluster is equal to the winding number of the input beam. We have obtained the relationships between the amplitudes and oscillation periods of the inhomogeneous effective diffusion and the cubic gain and diffusion (viscosity) parameters, which depict the regions of existence and stability of vortex clusters. The obtained results offer a method to form robust vortex clusters embedded in two-dimensional optical beams, and we envisage potential applications in the area of structured light.

  17. Isotope effect of impurity diffusion of cadmium in silver

    International Nuclear Information System (INIS)

    Rockosch, H.J.; Herzig, C.

    1984-01-01

    The isotope effect of impurity diffusion of cadmium in silver single crystals was measured with the radioisotopes 115 Cd/ 109 Cd by gamma spectrometry. As a mean value E = 0.37 at T = 1060 K was obtained. The correlation factor f /SUB Cd/ = 0.41 is in disagreement with previous results of other investigators due to their unfavourable experimental approach. The present value of f /SUB Cd/ , however, is consistent with those of In and Sn in Ag. A comparison with the corresponding correlation factors in the copper solvent reveals a distinct influence of lattice perturbations because of the different atomic volumes of the solvents. Since the size effect is neglected in the electrostatic diffusion model, the agreement with this model is only qualitative. The frequency ratios for vacancy jumps were calculated. The free binding enthalpy of the vacancy-impurity complex was estimated to be Δg /SUB Cd/ = -0.064 eV. This value is smaller than those for In and Sn in Ag and complies with the relative diffusivities of these impurities in Ag

  18. Numerical analysis of anisotropic diffusion effect on ICF hydrodynamic instabilities

    Directory of Open Access Journals (Sweden)

    Olazabal-Loumé M.

    2013-11-01

    Full Text Available The effect of anisotropic diffusion on hydrodynamic instabilities in the context of Inertial Confinement Fusion (ICF flows is numerically assessed. This anisotropy occurs in indirect-drive when laminated ablators are used to modify the lateral transport [1,2]. In direct-drive, non-local transport mechanisms and magnetic fields may modify the lateral conduction [3]. In this work, numerical simulations obtained with the code PERLE [4], dedicated to linear stability analysis, are compared with previous theoretical results [5]. In these approaches, the diffusion anisotropy can be controlled by a characteristic coefficient which enables a comprehensive study. This work provides new results on the ablative Rayleigh-Taylor (RT, ablative Richtmyer-Meshkov (RM and Darrieus-Landau (DL instabilities.

  19. Subliminal mere exposure: specific, general, and diffuse effects.

    Science.gov (United States)

    Monahan, J L; Murphy, S T; Zajonc, R B

    2000-11-01

    The present research examined the possibility that repeated exposure may simultaneously produce specific and diffuse effects. In Study 1, participants were presented with 5-ms exposures of 25 stimuli each shown once (single-exposure condition) or with five repetitions of 5 stimuli (repeated-exposure condition). Participants in the repeated-exposure condition subsequently rated their own mood more positively than those in the single-exposure condition. Study 2 examined whether affect generated by subliminal repeated exposures transfers to unrelated stimuli. After a subliminal exposure phase, affective reactions to previously exposed stimuli, to new but similar stimuli, and to stimuli from a different category were obtained. Previously exposed stimuli were rated most positively and novel different stimuli least positively. All stimuli were rated more positively in the repeated-exposure condition than in the single-exposure condition. These findings suggest that affect generated by subliminal repeated exposure is sufficiently diffuse to influence ratings of unrelated stimuli and mood.

  20. Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

    International Nuclear Information System (INIS)

    Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

    2016-01-01

    We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

  1. Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

    Energy Technology Data Exchange (ETDEWEB)

    Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

    2013-09-30

    Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with

  2. Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

    International Nuclear Information System (INIS)

    Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

    2002-01-01

    The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

  3. First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

    International Nuclear Information System (INIS)

    Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

    2014-01-01

    We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

  4. Cross-diffusional effect in a telegraph reaction diffusion Lotka-Volterra two competitive system

    International Nuclear Information System (INIS)

    Abdusalam, H.A; Fahmy, E.S.

    2003-01-01

    It is known now that, telegraph equation is more suitable than ordinary diffusion equation in modelling reaction diffusion in several branches of sciences. Telegraph reaction diffusion Lotka-Volterra two competitive system is considered. We observed that this system can give rise to diffusive instability only in the presence of cross-diffusion. Local and global stability analysis in the cross-diffusional effect are studied by considering suitable Lyapunov functional

  5. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  6. Diffusion through Pig Gastric Mucin: Effect of Relative Humidity.

    Directory of Open Access Journals (Sweden)

    Anna Runnsjö

    Full Text Available Mucus covers the epithelium found in all intestinal tracts, where it serves as an important protecting barrier, and pharmaceutical drugs administrated by the oral, rectal, vaginal, ocular, or nasal route need to penetrate the mucus in order to reach their targets. Furthermore, the diffusion in mucus as well as the viscosity of mucus in the eyes, nose and throat can change depending on the relative humidity of the surrounding air. In this study we have investigated how diffusion through gels of mucin, the main protein in mucus, is affected by changes in ambient relative humidity (i.e. water activity. Already a small decrease in water activity was found to give rise to a significant decrease in penetration rate through the mucin gel of the antibacterial drug metronidazole. We also show that a decrease in water activity leads to decreased diffusion rate in the mucin gel for the fluorophore fluorescein. This study shows that it is possible to alter transport rates of molecules through mucus by changing the water activity in the gel. It furthermore illustrates the importance of considering effects of the water activity in the mucosa during development of potential pharmaceuticals.

  7. Method of coating the interior surface of hollow objects with a diffusion coating

    Science.gov (United States)

    Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.

    2005-03-15

    A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.

  8. Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

    Science.gov (United States)

    Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

    2017-09-01

    Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

  9. A radiometric model of an earth radiation budget radiometer optical system with diffuse-specular surfaces

    Science.gov (United States)

    Luther, M. R.

    1981-01-01

    The Earth Radiation Budget Experiment (ERBE) is to fly on NASA's Earth Radiation Budget Satellite (ERBS) and on NOAA F and NOAA G. Large spatial scale earth energy budget data will be derived primarily from measurements made by the ERBE nonscanning instrument (ERBE-NS). A description is given of a mathematical model capable of simulating the radiometric response of any of the ERBE-NS earth viewing channels. The model uses a Monte Carlo method to accurately account for directional distributions of emission and reflection from optical surfaces which are neither strictly diffuse nor strictly specular. The model computes radiation exchange factors among optical system components, and determines the distribution in the optical system of energy from an outside source. Attention is also given to an approach for implementing the model and results obtained from the implementation.

  10. Numerical model for atmospheric diffusion analysis and evaluation of effective dose for safety analysis

    International Nuclear Information System (INIS)

    Sada, Koichi; Michioka, Takenobu; Ichikawa, Yoichi; Komiyama, Sumito

    2009-01-01

    A numerical simulation method has been developed to predict atmospheric flow and stack gas diffusion, considering the buildings and complex terrain located near and relatively far from a stack, respectively. The turbulence closure technique was used for flow calculation, some calculation grids on the ground near a stack were treated as buildings, and stack gas diffusion was predicted using the Lagrangian particle model. The calculated flow and stack gas diffusion results were compared with those obtained by wind tunnel experiments under actual terrain containing buildings. Effective stack height was estimated by comparing the surface concentration along the plume axis with those under a flat-plate condition, and it was apparent that the effective stack heights estimated by calculations were almost the same as those obtained by the wind tunnel experiment. Then, the effective dose and relative concentration of stack gas were calculated using the effective stack heights obtained by a numerical model. Almost the same effective dose and relative concentration were obtained when compared with those using the effective stack height obtained by wind tunnel experiment. (author)

  11. Irradiation spectrum and ionization-induced diffusion effects in ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Zinkle, S.J. [Oak Ridge National Lab., TN (United States)

    1997-08-01

    There are two main components to the irradiation spectrum which need to be considered in radiation effects studies on nonmetals, namely the primary knock-on atom energy spectrum and ionizing radiation. The published low-temperature studies on Al{sub 2}O{sub 3} and MgO suggest that the defect production is nearly independent of the average primary knock-on atom energy, in sharp contrast to the situation for metals. On the other hand, ionizing radiation has been shown to exert a pronounced influence on the microstructural evolution of both semiconductors and insulators under certain conditions. Recent work on the microstructure of ion-irradiated ceramics is summarized, which provides evidence for significant ionization-induced diffusion. Polycrystalline samples of MgO, Al{sub 2}O{sub 3}, and MgAl{sub 2}O{sub 4} were irradiated with various ions ranging from 1 MeV H{sup +} to 4 MeV Zr{sup +} ions at temperatures between 25 and 650{degrees}C. Cross-section transmission electron microscopy was used to investigate the depth-dependent microstructural of the irradiated specimens. Dislocation loop nucleation was effectively suppressed in specimens irradiated with light ions, whereas the growth rate of dislocation loops was enhanced. The sensitivity to irradiation spectrum is attributed to ionization-induced diffusion. The interstitial migration energies in MgAl{sub 2}O{sub 4} and Al{sub 2}O{sub 3} are estimated to be {le}0.4 eV and {le}0.8 eV, respectively for irradiation conditions where ionization-induced diffusion effects are expected to be negligible.

  12. Effects of MR parameter changes on the quantification of diffusion anisotropy and apparent diffusion coefficient in diffusion tensor imaging: Evaluation using a diffusional anisotropic phantom

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang Joon; Choi, Choong Gon; Kim, Jeong Kon [Dept. of Radiology, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Yun, Sung Cheol [Dept. of Biostatistics, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Jeong, Ha Kyu [Dept. of Radiology, East-West Neomedical Center, Kyung Hee University College of Medicine, Seoul (Korea, Republic of); Kim, Eun Ju [Clinical Scientist, MR, Philips Healthcare, Seoul (Korea, Republic of)

    2015-04-15

    To validate the usefulness of a diffusional anisotropic capillary array phantom and to investigate the effects of diffusion tensor imaging (DTI) parameter changes on diffusion fractional anisotropy (FA) and apparent diffusion coefficient (ADC) using the phantom. Diffusion tensor imaging of a capillary array phantom was performed with imaging parameter changes, including voxel size, number of sensitivity encoding (SENSE) factor, echo time (TE), number of signal acquisitions, b-value, and number of diffusion gradient directions (NDGD), one-at-a-time in a stepwise-incremental fashion. We repeated the entire series of DTI scans thrice. The coefficients of variation (CoV) were evaluated for FA and ADC, and the correlation between each MR imaging parameter and the corresponding FA and ADC was evaluated using Spearman's correlation analysis. The capillary array phantom CoVs of FA and ADC were 7.1% and 2.4%, respectively. There were significant correlations between FA and SENSE factor, TE, b-value, and NDGD, as well as significant correlations between ADC and SENSE factor, TE, and b-value. A capillary array phantom enables repeated measurements of FA and ADC. Both FA and ADC can vary when certain parameters are changed during diffusion experiments. We suggest that the capillary array phantom can be used for quality control in longitudinal or multicenter clinical studies.

  13. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium-sulfur battery design.

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-04-05

    Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.

  14. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium–sulfur battery design

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-01-01

    Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216

  15. The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

    Directory of Open Access Journals (Sweden)

    K.A. Widi

    2016-09-01

    Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

  16. Turing instability for a competitor-competitor-mutualist model with nonlinear cross-diffusion effects

    International Nuclear Information System (INIS)

    Wen, Zijuan; Fu, Shengmao

    2016-01-01

    This paper deals with a strongly coupled reaction-diffusion system modeling a competitor-competitor-mutualist three-species model with diffusion, self-diffusion and nonlinear cross-diffusion and subject to Neumann boundary conditions. First, we establish the persistence of a corresponding reaction-diffusion system without self- and cross-diffusion. Second, the global asymptotic stability of the unique positive equilibrium for weakly coupled PDE system is established by using a comparison method. Moreover, under certain conditions about the intra- and inter-species effects, we prove that the uniform positive steady state is linearly unstable for the cross-diffusion system when one of the cross-diffusions is large enough. The results indicate that Turing instability can be driven solely from strong diffusion effect of the first species (or the second species or the third species) due to the pressure of the second species (or the first species).

  17. Determination of oxygen effective diffusivity in porous gas diffusion layer using a three-dimensional pore network model

    International Nuclear Information System (INIS)

    Wu Rui; Zhu Xun; Liao Qiang; Wang Hong; Ding Yudong; Li Jun; Ye Dingding

    2010-01-01

    In proton exchange membrane fuel cell (PEMFC) models, oxygen effective diffusivity is the most important parameter to characterize the oxygen transport in the gas diffusion layer (GDL). However, its determination is a challenge due to its complex dependency on GDL structure. In the present study, a three-dimensional network consisting of spherical pores and cylindrical throats is developed and used to investigate the effects of GDL structural parameters on oxygen effective diffusivity under the condition with/without water invasion process. Oxygen transport in the throat is described by Fick's law and water invasion process in the network is simulated using the invasion percolation with trapping algorithm. The simulation results reveal that oxygen effective diffusivity is slightly affected by network size but increases with decreasing the network heterogeneity and with increasing the pore connectivity. Impacts of network anisotropy on oxygen transport are also investigated in this paper. The anisotropic network is constructed by constricting the throats in the through-plane direction with a constriction factor. It is found that water invasion has a more severe negative influence on oxygen transport in an anisotropic network. Finally, two new correlations are introduced to determine the oxygen effective diffusivity for the Toray carbon paper GDLs.

  18. The effect of impeller–diffuser interactions on diffuser performance in a centrifugal compressor

    Directory of Open Access Journals (Sweden)

    Peng-Fei Zhao

    2016-01-01

    Full Text Available The unsteady phenomenon abounds in centrifugal compressors and significantly affects the compressor performance. In this paper, unsteady simulations are carried out to investigate the aerodynamic performance of a process-unshrouded centrifugal compressor and the unsteady mechanism in the vaned diffuser. The predicted stage performance and pressure fluctuations at some locations are in good agreement with experimental data. The predicted main pressure fluctuation frequency spectrums at the diffuser inlet and outlet are consistent with the measured results. The results indicate that at the inlet of the diffuser there are two pressure peaks in a passage cycle. The higher pressure peak relates to the impeller wake and the lower peak is connected with the vortex generated at the diffuser’s leading edge. With a decrease in the mass flow coefficient, the vortex core region becomes larger and the lower pressure peak becomes more pronounced. The change in circumferential flow angle at the diffuser inlet is mainly responsible for the unsteadiness in the diffuser flow field, which in turn affects the inlet incidence of the diffuser vane and the vane loading distributions.

  19. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2015-01-15

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  20. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Science.gov (United States)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  1. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

  2. On the morphological change of solids by vacancy diffusion under the effect of interfacial tensions and applied stresses

    International Nuclear Information System (INIS)

    Felsen, M.F.

    1979-01-01

    The morphological change of solids by diffusion under the effect of interfacial tensions and applied stresses is studied by voids annealing and diffusion creep at intermediate and elevated temperatures respectively. In all cases, it has been shown that the evolution kinetic is controlled by vacancy diffusion and that interfaces are ideal sinks. Furthermore, the influence of additional elements on the surface tension of a pure metal is determined for the first time with the voids annealing technique, assuming that the self diffusion coefficient of the metal is not affected by small amount of impurities. The diffusion creep theory is modified to include the interfacial tension effects in the boundary conditions of the diffusion problem which gives a zero creep stress expression very different to those yet published, but the creep equation retains its classical form. The above experiments were carried out using an original device which allows verification of the creep equation to a great precision and to study the range of stresses between Nabarro and Weertman creep. Finally, some creep tests realised on two-phase alloys show that the strain is induced by diffusion [fr

  3. Diffusion of graphite. The effect of cylindrical canals; Longueur de diffusion du graphite effet des canaux cylindriques

    Energy Technology Data Exchange (ETDEWEB)

    Carle, R; Clouet d' Orval, C; Martelly, J; Mazancourt, T de; Sagot, M; Lattes, R; Teste du Bailler, A [Commissariat a l' Energie Atomique, Dir. Industrielle, Saclay (France). Centre d' Etudes Nucleaires; Robert, C [Ecole Normale Superieure, 75 - Paris (France)

    1957-07-01

    Experiments on thermal neutron diffusion in the graphite used as moderator in the pile G1 have been carried out. The object of these experiments is to determine: - the intrinsic quality of this graphite, characterised by its diffusion length L or its Laplacian 1/L{sup 2} - the effect of the canals, which modifies anisotropically the macroscopic diffusion equation and is characterized by two principal diffusion regions (or two principal Laplacian), valid respectively for the diffusion in the direction of the canals and in a perpendicular direction. In order to determine them two experiments are necessary, in which the second derivatives of the flux in relation to the space coordinates are very different. These experiments form the object of the first two parts. Part 1: Diffusion along the axis of a flux coming from the pile source, and limited radially by a quasi cylindrical screen of cadmium bars. This screen, or Faraday cage is designed to give to the thermal flux produced the same radius of extrapolation to zero as that of the pile source. The determination of L (with the graphite full) has been made under the same conditions. The measurements have been interpreted in two ways. The influence of the brackets holding the detectors is discussed. Part 2: Radial diffusion in the graphite surrounding the 'long' cylindrical pile. This is well described by a sum of Bessel functions. Part 3: Results (valid for d = 1.61 t = 17 deg. C). For the graphite without cavity L = 52.7 {+-} 0.4 cm. The effect of the canals on the diffusion area and its anisotropy are in excellent agreement with the theory of Behrens: L(parallel) = 64.6 cm and L(perpendicular) 62.2 cm. Appendix: Theory of the Faraday cage. (author) [French] Des experiences de diffusion des neutrons thermiques dans le graphite constituant le moderateur de la pile G1 ont ete effectuees. Elles ont pour objet de determiner: - la qualite intrinseque de ce graphite, caracterisee par sa longueur de diffusion L ou son

  4. Enhancement of diffusers BSDF accuracy: spectral features effect

    NARCIS (Netherlands)

    Brug, H. van; Courrèges-Lacoste, G.B.; Otter, G.C.J.; Schaarsberg, J.G.; Delwart, S.; Del Bello, U.

    2006-01-01

    This paper reports the activities performed in the framework of the ESA contract 18432/04/NL/AR: Enhancement of diffusers BSDF Accuracy. This study was conducted to investigate properties of various diffusers. Diffusers are widely used in space instruments as part of the on-board absolute

  5. Diffusion in coastal and harbour zones, effects of Waves,Wind and Currents

    Science.gov (United States)

    Diez, M.; Redondo, J. M.

    2009-04-01

    As there are multiple processes at different scales that produce turbulent mixing in the ocean, thus giving a large variation of horizontal eddy diffusivities, we use a direct method to evaluate the influence of different ambient parameters such as wave height and wind on coastal dispersion. Measurements of the diffusivity are made by digital processing of images taken from from video recordings of the sea surface near the coast. The use of image analysis allows to estimate both spatial and temporal characteristics of wave fields, surface circulation and mixing in the surf zone, near Wave breakers and inside Harbours. The study of near-shore dispersion [1], with the added complexity of the interaction between wave fields, longshore currents, turbulence and beach morphology, needs detailed measurements of simple mixing processes to compare the respective influences of forcings at different scales. The measurements include simultaneous time series of waves, currents, wind velocities from the studied area. Cuantitative information from the video images is accomplished using the DigImage video processing system [3], and a frame grabber. The video may be controlled by the computer, allowing, remote control of the processing. Spectral analysis on the images has also used n order to estimate dominant wave periods as well as the dispersion relations of dominant instabilities. The measurements presented here consist mostly on the comarison of difussion coeficients measured by evaluating the spread of blobs of dye (milk) as well as by measuring the separation between different buoys released at the same time. We have used a techniques, developed by Bahia(1997), Diez(1998) and Bezerra(2000)[1-3] to study turbulent diffusion by means of digital processing of images taken from remote sensing and video recordings of the sea surface. The use of image analysis allows to measure variations of several decades in horizontal diffusivity values, the comparison of the diffusivities

  6. Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

    International Nuclear Information System (INIS)

    Lou, D.C.; Solberg, J.K.; Borvik, T.

    2009-01-01

    This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

  7. Diffusion-controlled reaction. V. Effect of concentration-dependent diffusion coefficient on reaction rate in graft polymerization

    International Nuclear Information System (INIS)

    Imre, K.; Odian, G.

    1979-01-01

    The effect of diffusion on radiation-initiated graft polymerization has been studied with emphasis on the single- and two-penetrant cases. When the physical properties of the penetrants are similar, the two-penetrant problems can be reduced to the single-penetrant problem by redefining the characteristic parameters of the system. The diffusion-free graft polymerization rate is assumed to be proportional to the upsilon power of the monomer concentration respectively, and, in which the proportionality constant a = k/sub p/R/sub i//sup w//k/sub t//sup z/, where k/sub p/ and k/sub t/ are the propagation and termination rate constants, respectively, and R/sub i/ is the initiation rate. The values of upsilon, w, and z depend on the particular reaction system. The results of earlier work were generalized by allowing a non-Fickian diffusion rate which predicts an essentially exponential dependence on the monomer concentration of the diffusion coefficient, D = D 0 [exp(deltaC/M)], where M is the saturation concentration. A reaction system is characterized by the three dimensionless parameters, upsilon, delta, and A = (L/2)[aM/sup (upsilon--1)//D 0 ]/sup 1/2/, where L is the polymer film thickness. Graft polymerization tends to become diffusion controlled as A increases. Larger values of delta and ν cause a reaction system to behave closer to the diffusion-free regime. Transition from diffusion-free to diffusion-controlled reaction involves changes in the dependence of the reaction rate on film thickness, initiation rate, and monomer concentration. Although the diffusion-free rate is w order in initiation rate, upsilon order in monomer, and independent of film thickness, the diffusion-controlled rate is w/2 order in initiator rate and inverse first-order in film thickness. Dependence of the diffusion-controlled rate on monomer is dependent in a complex manner on the diffusional characteristics of the reaction system. 11 figures, 4 tables

  8. Pattern formation in diffusive excitable systems under magnetic flow effects

    Science.gov (United States)

    Mvogo, Alain; Takembo, Clovis N.; Ekobena Fouda, H. P.; Kofané, Timoléon C.

    2017-07-01

    We study the spatiotemporal formation of patterns in a diffusive FitzHugh-Nagumo network where the effect of electromagnetic induction has been introduced in the standard mathematical model by using magnetic flux, and the modulation of magnetic flux on membrane potential is realized by using memristor coupling. We use the multi-scale expansion to show that the system equations can be reduced to a single differential-difference nonlinear equation. The linear stability analysis is performed and discussed with emphasis on the impact of magnetic flux. It is observed that the effect of memristor coupling importantly modifies the features of modulational instability. Our analytical results are supported by the numerical experiments, which reveal that the improved model can lead to nonlinear quasi-periodic spatiotemporal patterns with some features of synchronization. It is observed also the generation of pulses and rhythmics behaviors like breathing or swimming which are important in brain researches.

  9. Diffusion affected magnetic field effect in exciplex fluorescence

    International Nuclear Information System (INIS)

    Burshtein, Anatoly I.; Ivanov, Anatoly I.

    2014-01-01

    The fluorescence of the exciplex, 1 [D +δ A −δ ], formed at contact of photoexcited acceptor 1 A * with an electron donor 1 D, is known to be very sensitive to an external magnetic field, reducing the spin conversion efficiency in the resulting geminate radical ion pair, 1,3 [D + …A − ]. The relative increase of the exciplex fluorescence in the highest magnetic field compared to the lowest one, known as the magnetic field effect, crucially depends on the viscosity of the solvent. This phenomenon first studied experimentally is at first reproduced here theoretically. The magnetic field effect is shown to vanish in both limits of high and low solvent diffusivity reaching a maximum in between. It is also very sensitive to the solvent dielectric constant and to the exciplex and radical-ion pair conversion rates

  10. Diffusion affected magnetic field effect in exciplex fluorescence

    Energy Technology Data Exchange (ETDEWEB)

    Burshtein, Anatoly I. [Weizmann Institute of Science, Rehovot 76100 (Israel); Ivanov, Anatoly I., E-mail: Anatoly.Ivanov@volsu.ru [Volgograd State University, University Avenue, 100, Volgograd 400062 (Russian Federation)

    2014-07-14

    The fluorescence of the exciplex, {sup 1}[D{sup +δ}A{sup −δ}], formed at contact of photoexcited acceptor {sup 1}A{sup *} with an electron donor {sup 1}D, is known to be very sensitive to an external magnetic field, reducing the spin conversion efficiency in the resulting geminate radical ion pair, {sup 1,3}[D{sup +}…A{sup −}]. The relative increase of the exciplex fluorescence in the highest magnetic field compared to the lowest one, known as the magnetic field effect, crucially depends on the viscosity of the solvent. This phenomenon first studied experimentally is at first reproduced here theoretically. The magnetic field effect is shown to vanish in both limits of high and low solvent diffusivity reaching a maximum in between. It is also very sensitive to the solvent dielectric constant and to the exciplex and radical-ion pair conversion rates.

  11. Diffusion affected magnetic field effect in exciplex fluorescence

    Science.gov (United States)

    Burshtein, Anatoly I.; Ivanov, Anatoly I.

    2014-07-01

    The fluorescence of the exciplex, 1[D+δA-δ], formed at contact of photoexcited acceptor 1A* with an electron donor 1D, is known to be very sensitive to an external magnetic field, reducing the spin conversion efficiency in the resulting geminate radical ion pair, 1, 3[D+…A-]. The relative increase of the exciplex fluorescence in the highest magnetic field compared to the lowest one, known as the magnetic field effect, crucially depends on the viscosity of the solvent. This phenomenon first studied experimentally is at first reproduced here theoretically. The magnetic field effect is shown to vanish in both limits of high and low solvent diffusivity reaching a maximum in between. It is also very sensitive to the solvent dielectric constant and to the exciplex and radical-ion pair conversion rates.

  12. Quantum Butterfly Effect in Weakly Interacting Diffusive Metals

    Directory of Open Access Journals (Sweden)

    Aavishkar A. Patel

    2017-09-01

    Full Text Available We study scrambling, an avatar of chaos, in a weakly interacting metal in the presence of random potential disorder. It is well known that charge and heat spread via diffusion in such an interacting disordered metal. In contrast, we show within perturbation theory that chaos spreads in a ballistic fashion. The squared anticommutator of the electron-field operators inherits a light-cone-like growth, arising from an interplay of a growth (Lyapunov exponent that scales as the inelastic electron scattering rate and a diffusive piece due to the presence of disorder. In two spatial dimensions, the Lyapunov exponent is universally related at weak coupling to the sheet resistivity. We are able to define an effective temperature-dependent butterfly velocity, a speed limit for the propagation of quantum information that is much slower than microscopic velocities such as the Fermi velocity and that is qualitatively similar to that of a quantum critical system with a dynamical critical exponent z>1.

  13. Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, Nir; Browning, Nigel D.

    2011-06-16

    Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

  14. A Study on the Effect of the Boron Potential on the Mechanical Properties of the Borided Layers Obtained by Boron Diffusion at the Surface of AISI 316L Steel

    Directory of Open Access Journals (Sweden)

    E. Hernández-Sánchez

    2014-01-01

    Full Text Available The effect of the boron potential on the thickness and the mechanical properties of borided layers was evaluated. The boron potential was established by means of the available atoms of boron contained in a control volume inside a cylinder. The cylinders were manufactured from AISI 316L steel, and the boriding treatment was performed using the powder pack technique at a temperature of 1273 K over an exposure time of 6 h. Four different internal diameters of the cylinders were evaluated (3.17, 4.76, 6.35, and 7.93 mm. The mechanical properties were evaluated using the Berkovich instrumented indentation technique. The results showed a clear influence of the boron potential on the mechanical properties of the layers. The hardness of the layers was stablished in the range of 16.22 to 21.16 GPa. Young’s modulus values were stablished in the range of 255.96 to 341.37 GPa. Also the fracture toughness and brittleness of the layers reflected the influence of the boron potential supplied during the boriding process. Finally, the influence of the boron potential on the constant of parabolic growth (K was also established as a function of the inner diameter of the cylinders.

  15. Effects of temporal distribution of specular and diffuse reflections on perceived music quality

    Science.gov (United States)

    Smitthakorn, Pattra

    The purpose of this study was to investigate the effects of the temporal distribution of diffuse and specular reflections on the perceived acoustic qualities of music performance. Sets of impulse responses were designed with different temporal distributions of early acoustic energy (specular and diffuse reflections). Then, three types of anechoic sound sources---orchestral music, trumpet, and piano---were convolved with the designed impulse responses. The results from the listening tests revealed that different room environments were needed to acoustically support different source characteristics. The results show the following: (1) specular reflections arriving within 40 msec of the direct sound improved perceived "clarity" and "intimacy"; (2) specular reflections arriving between 40-80 msec after the direct sound improved perceived "clarity" for orchestral music; (3) specular reflections arriving later than 80 msec after the direct sound are not desirable; (4) large numbers of diffuse reflections arriving within 40 and 80 msec of the direct sound improved perceived "intimacy", "texture", and "overall impression" for all sound sources, heightened perceived "clarity" for trumpet and piano, and reduced perceived "glare" for trumpet; and (5) diffuse reflections arriving between 80-160 msec of the direct sound preserved perceived "reverberance" and reduced perceived "echoes" as opposed to specular reflections arriving in the same time period. The results of this study indicate that music performance halls should be designed to include diffuse reflections from surfaces within the 80 msec time period to achieve preferred texture, intimacy, clarity and overall impression and in the 160 msec time period to reduce echoes; specular reflections arriving within the 40 msec time period should be provided to enhance perceived clarity.

  16. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  17. Effect of Porosity and Concentration Polarization on Electrolyte Diffusive Transport Parameters through Ceramic Membranes with Similar Nanopore Size

    Directory of Open Access Journals (Sweden)

    Virginia Romero

    2014-08-01

    Full Text Available Diffusive transport through nanoporous alumina membranes (NPAMs produced by the two-step anodization method, with similar pore size but different porosity, is studied by analyzing membrane potential measured with NaCl solutions at different concentrations. Donnan exclusion of co-ions at the solution/membrane interface seem to exert a certain control on the diffusive transport of ions through NPAMs with low porosity, which might be reduced by coating the membrane surface with appropriated materials, as it is the case of SiO2. Our results also show the effect of concentration polarization at the membrane surface on ionic transport numbers (or diffusion coefficients for low-porosity and high electrolyte affinity membranes, which could mask values of those characteristic electrochemical parameters.

  18. Modification of kaolinite surfaces through mechanochemical activation with quartz: A diffuse reflectance infrared fourier transform and chemometrics study.

    Science.gov (United States)

    Carmody, Onuma; Frost, Ray L; Kristóf, János; Kokot, Serge; Kloprogge, J Theo; Makó, Eva

    2006-12-01

    Studies of kaolinite surfaces are of industrial importance. One useful method for studying the changes in kaolinite surface properties is to apply chemometric analyses to the kaolinite surface infrared spectra. A comparison is made between the mechanochemical activation of Kiralyhegy kaolinites with significant amounts of natural quartz and the mechanochemical activation of Zettlitz kaolinite with added quartz. Diffuse reflectance infrared Fourier transform (DRIFT) spectra were analyzed using principal component analysis (PCA) and multi-criteria decision making (MCDM) methods, the preference ranking organization method for enrichment evaluations (PROMETHEE) and geometrical analysis for interactive assistance (GAIA). The clear discrimination of the Kiralyhegy spectral objects on the two PC scores plots (400-800 and 800-2030 cm(-1)) indicated the dominance of quartz. Importantly, no ordering of any spectral objects appeared to be related to grinding time in the PC plots of these spectral regions. Thus, neither the kaolinite nor the quartz are systematically responsive to grinding time according to the spectral criteria investigated. The third spectral region (2600-3800 cm(-1), OH vibrations), showed apparent systematic ordering of the Kiralyhegy and, to a lesser extent, Zettlitz spectral objects with grinding time. This was attributed to the effect of the natural quartz on the delamination of kaolinite and the accompanying phenomena (i.e., formation of kaolinite spheres and water). The mechanochemical activation of kaolinite and quartz, through dry grinding, results in changes to the surface structure. Different grinding times were adopted to study the rate of destruction of the kaolinite and quartz structures. This relationship (i.e., grinding time) was classified using PROMETHEE and GAIA methodology.

  19. Effective diffusion coefficient of radon in concrete, theory and method for field measurements

    International Nuclear Information System (INIS)

    Culot, M.V.J.; Olson, H.G.; Schiager, K.J.

    1976-01-01

    A linear diffusion model serves as the basis for determination of an effective radon diffusion coefficient in concrete. The coefficient was needed to later allow quantitative prediction of radon accumulation within and behind concrete walls after application of an impervious radon barrier. A resolution of certain discrepancies noted in the literature in the use of an effective diffusion coefficient to model diffusion of a radioactive gas through a porous medium is suggested. An outline of factors expected to affect the concrete physical structure and the effective diffusion coefficient of radon through it is also presented. Finally, a field method for evaluating effective radon diffusion coefficients in concrete is proposed and results of measurements performed on a concrete foundation wall are compared with similar published values of gas diffusion coefficients in concrete. (author)

  20. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, Rizwan M; Oral, Ebru; Muratoglu, Orhun K

    2014-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E

  1. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, R. M.; Oral, E.; Muratoglu, O. K.

    2013-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E. (author)

  2. Bio-predictive tablet disintegration: effect of water diffusivity, fluid flow, food composition and test conditions.

    Science.gov (United States)

    Radwan, Asma; Wagner, Manfred; Amidon, Gordon L; Langguth, Peter

    2014-06-16

    Food intake may delay tablet disintegration. Current in vitro methods have little predictive potential to account for such effects. The effect of a variety of factors on the disintegration of immediate release tablets in the gastrointestinal tract has been identified. They include viscosity of the media, precipitation of food constituents on the surface of the tablet and reduction of water diffusivity in the media as well as changes in the hydrodynamics in the surrounding media of the solid dosage form. In order to improve the predictability of food affecting the disintegration of a dosage form, tablet disintegration in various types of a liquefied meal has been studied under static vs. dynamic (agitative) conditions. Viscosity, water diffusivity, osmolality and Reynolds numbers for the different media were characterized. A quantitative model is introduced which predicts the influence of the Reynolds number in the tablet disintegration apparatus on the disintegration time. Viscosity, water diffusivity and media flow velocity are shown to be important factors affecting dosage form disintegration. The results suggest the necessity of considering these parameters when designing a predictive model for simulating the in vivo conditions. Based on these experiments and knowledge on in vivo hydrodynamics in the GI tract, it is concluded that the disintegration tester under current pharmacopoeial conditions is operated in an unphysiological mode and no bioprediction may be derived. Recommendations regarding alternative mode of operation are made. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. A versatile optical profilometer based on conoscopic holography sensors for acquisition of specular and diffusive surfaces in artworks

    Science.gov (United States)

    Gaburro, Nicola; Marchioro, Giacomo; Daffara, Claudia

    2017-07-01

    Surface metrology of artworks requires the design of suitable devices for in-situ non-destructive measurement together with reliable procedures for an effective analysis of such non-engineered variegate objects. To advance the state-of-the-art it has been implemented a versatile optical micro-profilometry taking advantage of the adapt- ability of conoscopic holography sensors, able to operate with irregular shapes and composite materials (diffusive, specular, and polychrome) of artworks. The scanning technique is used to obtain wide field and high spatially resolved areal profilometry. The prototype has a modular scheme based on a set of conoscopic sensors, extending the typical design based on a scanning stage and a single probe with a limited bandwidth, thus allowing the collection of heights data from surface with different scales and materials with variegate optical response. The system was optimized by characterizing the quality of the measurement with the probes triggered in continuous scanning modality. The results obtained on examples of cultural heritage objects (2D paintings, 3D height-relief) and materials (pictorial, metallic) demonstrate the versatility of the implemented device.

  4. Cerebral Effects of Targeted Temperature Management Methods Assessed by Diffusion-Weighted Magnetic Resonance Imaging

    DEFF Research Database (Denmark)

    Grejs, Anders Morten; Gjedsted, Jakob; Pedersen, Michael

    2016-01-01

    The aim of this randomized porcine study was to compare surface targeted temperature management (TTM) to endovascular TTM evaluated by cerebral diffusion-weighted magnetic resonance imaging (MRI): apparent diffusion coefficient (ADC), and by intracerebral/intramuscular microdialysis. It is well k...

  5. Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)

    International Nuclear Information System (INIS)

    Sbiaai, K.; Boughaleb, Y.; Mazroui, M.; Hajjaji, A.; Kara, A.

    2013-01-01

    In this paper we investigated the diffusion of Ag adatom by computing the energy barriers for many elementary diffusive processes which are likely to happen near to the step edge on Cu (110). The barriers are calculated by means of molecular dynamics simulation by using embedded atom potentials. The proximity to steps alters these barriers considerably, and very different results may be expected. In fact, our numerical calculations show that the diffusion via jump process along step edge is predominant for Ag/Cu(110) and the diffusion over the step occurs sometimes, but only via exchange mechanisms. The adatom diffusion across channels is difficult due to the high value of activation energy required (around 1 eV). Furthermore, we found the Ehrlich–Schwoebel barrier for diffusion around 120 meV in order to descend via exchange process and of the order of 170 meV via hopping mode. This aspect may have a strong influence on the growth character. In general our results suggest that, for our metal system, diffusion mechanism may be important for mass transport across the steps. Implications of these findings are discussed. - Highlights: • Study of adatom diffusion near the step edge • The diffusion along channel is enhanced through jump process. • Arrhenius law is satisfied for a wide range of temperature (310–600 K)

  6. Charge diffusion and the butterfly effect in striped holographic matter

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, Andrew [Department of Physics, Harvard University,Cambridge, MA 02138 (United States); Department of Physics, Stanford University,Stanford, CA 94305 (United States); Steinberg, Julia [Department of Physics, Harvard University,Cambridge, MA 02138 (United States)

    2016-10-26

    Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.

  7. Charge diffusion and the butterfly effect in striped holographic matter

    International Nuclear Information System (INIS)

    Lucas, Andrew; Steinberg, Julia

    2016-01-01

    Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.

  8. First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

    International Nuclear Information System (INIS)

    Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

    2014-01-01

    First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

  9. Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

    Science.gov (United States)

    Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

    2018-05-01

    Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

  10. Modeling Periodic Impulsive Effects on Online TV Series Diffusion.

    Science.gov (United States)

    Fu, Peihua; Zhu, Anding; Fang, Qiwen; Wang, Xi

    Online broadcasting substantially affects the production, distribution, and profit of TV series. In addition, online word-of-mouth significantly affects the diffusion of TV series. Because on-demand streaming rates are the most important factor that influences the earnings of online video suppliers, streaming statistics and forecasting trends are valuable. In this paper, we investigate the effects of periodic impulsive stimulation and pre-launch promotion on on-demand streaming dynamics. We consider imbalanced audience feverish distribution using an impulsive susceptible-infected-removed(SIR)-like model. In addition, we perform a correlation analysis of online buzz volume based on Baidu Index data. We propose a PI-SIR model to evolve audience dynamics and translate them into on-demand streaming fluctuations, which can be observed and comprehended by online video suppliers. Six South Korean TV series datasets are used to test the model. We develop a coarse-to-fine two-step fitting scheme to estimate the model parameters, first by fitting inter-period accumulation and then by fitting inner-period feverish distribution. We find that audience members display similar viewing habits. That is, they seek new episodes every update day but fade away. This outcome means that impulsive intensity plays a crucial role in on-demand streaming diffusion. In addition, the initial audience size and online buzz are significant factors. On-demand streaming fluctuation is highly correlated with online buzz fluctuation. To stimulate audience attention and interpersonal diffusion, it is worthwhile to invest in promotion near update days. Strong pre-launch promotion is also a good marketing tool to improve overall performance. It is not advisable for online video providers to promote several popular TV series on the same update day. Inter-period accumulation is a feasible forecasting tool to predict the future trend of the on-demand streaming amount. The buzz in public social communities

  11. Modeling Periodic Impulsive Effects on Online TV Series Diffusion.

    Directory of Open Access Journals (Sweden)

    Peihua Fu

    Full Text Available Online broadcasting substantially affects the production, distribution, and profit of TV series. In addition, online word-of-mouth significantly affects the diffusion of TV series. Because on-demand streaming rates are the most important factor that influences the earnings of online video suppliers, streaming statistics and forecasting trends are valuable. In this paper, we investigate the effects of periodic impulsive stimulation and pre-launch promotion on on-demand streaming dynamics. We consider imbalanced audience feverish distribution using an impulsive susceptible-infected-removed(SIR-like model. In addition, we perform a correlation analysis of online buzz volume based on Baidu Index data.We propose a PI-SIR model to evolve audience dynamics and translate them into on-demand streaming fluctuations, which can be observed and comprehended by online video suppliers. Six South Korean TV series datasets are used to test the model. We develop a coarse-to-fine two-step fitting scheme to estimate the model parameters, first by fitting inter-period accumulation and then by fitting inner-period feverish distribution.We find that audience members display similar viewing habits. That is, they seek new episodes every update day but fade away. This outcome means that impulsive intensity plays a crucial role in on-demand streaming diffusion. In addition, the initial audience size and online buzz are significant factors. On-demand streaming fluctuation is highly correlated with online buzz fluctuation.To stimulate audience attention and interpersonal diffusion, it is worthwhile to invest in promotion near update days. Strong pre-launch promotion is also a good marketing tool to improve overall performance. It is not advisable for online video providers to promote several popular TV series on the same update day. Inter-period accumulation is a feasible forecasting tool to predict the future trend of the on-demand streaming amount. The buzz in public

  12. Modeling Periodic Impulsive Effects on Online TV Series Diffusion

    Science.gov (United States)

    Fang, Qiwen; Wang, Xi

    2016-01-01

    Background Online broadcasting substantially affects the production, distribution, and profit of TV series. In addition, online word-of-mouth significantly affects the diffusion of TV series. Because on-demand streaming rates are the most important factor that influences the earnings of online video suppliers, streaming statistics and forecasting trends are valuable. In this paper, we investigate the effects of periodic impulsive stimulation and pre-launch promotion on on-demand streaming dynamics. We consider imbalanced audience feverish distribution using an impulsive susceptible-infected-removed(SIR)-like model. In addition, we perform a correlation analysis of online buzz volume based on Baidu Index data. Methods We propose a PI-SIR model to evolve audience dynamics and translate them into on-demand streaming fluctuations, which can be observed and comprehended by online video suppliers. Six South Korean TV series datasets are used to test the model. We develop a coarse-to-fine two-step fitting scheme to estimate the model parameters, first by fitting inter-period accumulation and then by fitting inner-period feverish distribution. Results We find that audience members display similar viewing habits. That is, they seek new episodes every update day but fade away. This outcome means that impulsive intensity plays a crucial role in on-demand streaming diffusion. In addition, the initial audience size and online buzz are significant factors. On-demand streaming fluctuation is highly correlated with online buzz fluctuation. Conclusion To stimulate audience attention and interpersonal diffusion, it is worthwhile to invest in promotion near update days. Strong pre-launch promotion is also a good marketing tool to improve overall performance. It is not advisable for online video providers to promote several popular TV series on the same update day. Inter-period accumulation is a feasible forecasting tool to predict the future trend of the on-demand streaming amount

  13. Effect of substrate surface on electromigration-induced sliding at hetero-interfaces

    International Nuclear Information System (INIS)

    Kumar, Praveen; Dutta, Indranath

    2013-01-01

    Electromigration (EM)-induced interfacial sliding between a metal film and Si substrate occurs when (i) only few grains exist across the width of the film and (ii) diffusivity through the interfacial region is significantly greater than diffusivity through the film. Here, the effect of the substrate surface layer on the kinetics of EM-induced interfacial sliding is assessed using Si substrates coated with various thin film interlayers. The kinetics of interfacial sliding, and therefore the EM-driven mass flow rate, strongly depends on the type of the interlayer (and hence the substrate surface composition), such that strongly bonded interfaces with slower interfacial diffusivity produce slower sliding. (paper)

  14. Magnon diffusion theory for the spin Seebeck effect in ferromagnetic and antiferromagnetic insulators

    Science.gov (United States)

    Rezende, Sergio M.; Azevedo, Antonio; Rodríguez-Suárez, Roberto L.

    2018-05-01

    In magnetic insulators, spin currents are carried by the elementary excitations of the magnetization: spin waves or magnons. In simple ferromagnetic insulators there is only one magnon mode, while in two-sublattice antiferromagnetic insulators (AFIs) there are two modes, which carry spin currents in opposite directions. Here we present a theory for the diffusive magnonic spin current generated in a magnetic insulator layer by a thermal gradient in the spin Seebeck effect. We show that the formulations describing magnonic perturbation using a position-dependent chemical potential and those using a magnon accumulation are completely equivalent. Then we develop a drift–diffusion formulation for magnonic spin transport treating the magnon accumulation governed by the Boltzmann transport and diffusion equations and considering the full boundary conditions at the surfaces and interfaces of an AFI/normal metal bilayer. The theory is applied to the ferrimagnetic yttrium iron garnet and to the AFIs MnF2 and NiO, providing good quantitative agreement with experimental data.

  15. Interference effects with surface plasmons

    NARCIS (Netherlands)

    Kuzmin, Nikolay Victorovich

    2008-01-01

    A surface plasmon is a purely two-dimensional electromagnetic excitation bound to the interface between metal and dielectric and quickly decaying away from it. A surface plasmon is able to concentrate light on sub-wavelength scales – a feature that is attractive for nano-photonics and integrated

  16. Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

    International Nuclear Information System (INIS)

    Luniakov, Yu V

    2013-01-01

    A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

  17. THE MECHANISM OF SURFACE DIFFUSION OF H AND D ATOMS ON AMORPHOUS SOLID WATER: EXISTENCE OF VARIOUS POTENTIAL SITES

    Energy Technology Data Exchange (ETDEWEB)

    Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)

    2012-10-01

    To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.

  18. Triangularity effects on the collisional diffusion for elliptic tokamak plasma

    International Nuclear Information System (INIS)

    Martin, P.; Castro, E.

    2007-01-01

    In this conference the effect of ellipticity and triangularity will be analyzed for axisymmetric tokamak in the collisional regime. Analytic forms for the magnetic field cross sections are taken from those derived recently by other authors [1,2]. Analytical results can be obtained in elliptic plasmas with triangularity by using an special system of tokamak coordinates recently published [3-5]. Our results show that triangularities smaller than 0.6, increases confinement for ellipticities in the range 1.2 to 2. This behavior happens for negative and positive triangularities; however this effect is stronger for positive than for negative triangularities. The maximum diffusion velocity is not obtained for zero triangularity, but for small negative triangularities. Ellipticity is also very important in confinement, but the effect of triangularity seems to be more important. High electric inductive field increases confinement, though this field is difficult to modify once the tokamak has been built. The analytic form of the current produced by this field is like that of a weak Ware pinch with an additional factor, which weakens the effect by an order of magnitude. The dependence of the triangularity effect with the Shafranov shift is also analyzed. References 1. - L. L. Lao, S. P. Hirshman, and R. M. Wieland, Phys. Fluids 24, 1431 (1981) 2. - G. O. Ludwig, Plasma Physics Controlled Fusion 37, 633 (1995) 3. - P. Martin, Phys. Plasmas 7, 2915 (2000) 4. - P. Martin, M. G. Haines and E. Castro, Phys. Plasmas 12, 082506 (2005) 5. - P. Martin, E. Castro and M. G. Haines, Phys. Plasmas 12, 102505 (2005)

  19. MASS TRANSFER KINETICS AND EFFECTIVE DIFFUSIVITIES DURING COCOA ROASTING

    Directory of Open Access Journals (Sweden)

    Y. M. BAGHDADI

    2017-01-01

    Full Text Available The current studies investigated the effects of temperature and moisture addition on the mass transfer kinetics of cocoa nibs during roasting. Experiments were carried out by roasting 500 gm of cocoa nibs inside an air ventilated oven at three temperature levels (120°C, 140°C and 160°C under medium air flowrate for one hour. Two types of samples were prepared namely the raw and soaked nib samples. The soaked nib samples were prepared by soaking the raw nibs in 200 ml of water at room temperature for 5 and 10 hours. Mathematical modelling was carried out to model the mass transfer process using semi-empirical models. Modelling showed that both Page and two-term models were able to give close fitting between the experimental and predicted values. Effective diffusivity values were estimated in the order of magnitude of 10-5 m2/s for the mass transfer process. Results obtained from these studies fill the current knowledge gap on the mass transfer kinetics of cocoa roasting.

  20. Point defects and diffusion in alloys: correlation effects

    International Nuclear Information System (INIS)

    Barbe, Vincent

    2006-01-01

    Kinetic models in alloys aim at predicting the transport properties of a system starting from the microscopic jump frequencies of defects. Such properties are of prior importance in systems which stay out of equilibrium for a long time, as for example irradiated alloys in nuclear reactors. We hereby propose several developments of the recent self-consistent mean field (SCMF) kinetic theory, which deals particularly with the correlation effects due to the coupling of atomic and defect fluxes. They are taken into account through a non-equilibrium distribution function of the system, which is derived from the time evolution of small clusters (of two or more atoms or defects). We therefore introduce a set of 'dynamic' interactions called effective Hamiltonian. The SCMF theory is extended to treat high jump frequency ratios for the vacancy mechanism, as well as the transport through interstitial defects. We use in both cases an atomic model which accounts for the thermodynamic properties of the alloy, as e.g. the short-range order. Those models are eventually applied to predict the diffusion properties in two model alloys of nuclear interest: the concentrated Fe-Ni-Cr solid solution and the dilute Fe(P) alloy. We present adapted atomic models and compare our predictions to experimental data. (author)

  1. Suppressing magnetization exchange effects in stimulated-echo diffusion experiments.

    Science.gov (United States)

    Pagès, Guilhem; Dvinskikh, Sergey V; Furó, István

    2013-09-01

    Exchange of nuclear magnetization between spin pools, either by chemical exchange or by cross-relaxation or both, has a significant influence on the signal attenuation in stimulated-echo-type pulsed field gradient experiments. Hence, in such cases the obtained molecular self-diffusion coefficients can carry a large systematic error. We propose a modified stimulated echo pulse sequence that contains T2-filters during the z-magnetization store period. We demonstrate, using a common theoretical description for chemical exchange and cross-relaxation, that these filters suppress the effects of exchange on the diffusional decay in that frequent case where one of the participating spin pools is immobile and exhibits a short T2. We demonstrate the performance of this experiment in an agarose/water gel. We posit that this new experiment has advantages over other approaches hitherto used, such as that consisting of measuring separately the magnetization exchange rate, if suitable by Goldman-Shen type experiments, and then correcting for exchange effects within the framework of a two-site exchange model. We also propose experiments based on selective decoupling and applicable in systems with no large T2 difference between the different spin pools. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  2. The effects of surface treatments on rapid chloride permeability tests

    KAUST Repository

    Yoon, Seyoon

    2012-08-01

    Surface treatments are commonly applied to improve the chloride resistance of concrete structures exposed to saline environments. Information on chloride ingress to surface-treated concrete is mostly provided by application of the rapid chloride permeability test (RCPT); this test is short in duration and provides rapid results. This study presents a numerical formulation, based on the extended Nernst-Plank/Poisson (NPP) equation, to model the effect of the surface treatment on a sample tested by RCPT. Predictions of the model are compared to experimental measurements. The simulations show that the results from RCPT, in terms of ionic profiles and measurement of the electric field, are dependent on the effectiveness of surface treatments. During RCPT, highly effective surface treatments cause both cations and anions to flocculate at the interface between the surface treatment and the concrete, creating a local electric field. Our numerical model includes these phenomena and presents a methodology to obtain more accurate diffusivities of the surface-treated- concrete from RCPT. © 2012 Elsevier B.V. All rights reserved.

  3. The effects of surface treatments on rapid chloride permeability tests

    KAUST Repository

    Yoon, Seyoon; Oh, Sang-gyun; Ha, Juyoung; Monteiro, Paulo M.

    2012-01-01

    Surface treatments are commonly applied to improve the chloride resistance of concrete structures exposed to saline environments. Information on chloride ingress to surface-treated concrete is mostly provided by application of the rapid chloride permeability test (RCPT); this test is short in duration and provides rapid results. This study presents a numerical formulation, based on the extended Nernst-Plank/Poisson (NPP) equation, to model the effect of the surface treatment on a sample tested by RCPT. Predictions of the model are compared to experimental measurements. The simulations show that the results from RCPT, in terms of ionic profiles and measurement of the electric field, are dependent on the effectiveness of surface treatments. During RCPT, highly effective surface treatments cause both cations and anions to flocculate at the interface between the surface treatment and the concrete, creating a local electric field. Our numerical model includes these phenomena and presents a methodology to obtain more accurate diffusivities of the surface-treated- concrete from RCPT. © 2012 Elsevier B.V. All rights reserved.

  4. Diffusion and Kirkendall effect in plutonium-zirconium system; Diffusion et effet Kirkendall dans le systeme plutonium-zirconium

    Energy Technology Data Exchange (ETDEWEB)

    Remy, C [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

    1968-10-01

    Results are reported for the chemical diffusion in {epsilon}{beta} phase (bcc) over the range 10 - 70 atomic per cent plutonium. Concentration-penetration curves, obtained by using electron microprobe, have been analysed by Hall and Matano methods. Chemical diffusion coefficients, measured from 650 to 900 deg. C., increase with plutonium concentration and follow the Arrhenius law. Activation energies range from 18000 up to 44000 cal/mole for plutonium concentrations from 60 to 20 atomic per cent plutonium. Kirkendall effect has been observed by the shift of inert markers located originally at the Zr-PuZr interface. Analysis of intrinsic diffusion coefficients variation, flux of the two species and lattice velocity has been carried out by the incremental couples technique by using Darken and Heumann equations. It was found that D{sub Pu} > D{sub Zr}; the ratio D{sub Pu}/D{sub Zr} increases from 1 to 6 over the range 15 - 60 atomic per cent Pu. Activation energies for intrinsic diffusion coefficients vary between 25 and 50 Kcal/mole. (author) [French] Nous donnons des resultats sur la diffusion chimique en phase {epsilon}{beta} (cc) de 10 a 70 pour cent atomique en plutonium. Les courbes concentration-penetration, obtenues par microanalyse X ont ete depouillees par les methodes de HALL et de MATANO. Les coefficients de diffusion chimique mesures de 650 deg. C a 900 deg. C., augmentent avec la concentration en plutonium et suivent la loi d'ARRHENIUS. Les energies d'activation passent de 18000 a 44000 calories par mole pour des concentrations de 60 a 20 pour cent atomique en plutonium. L'existence d'un effet KIRKENDALL a ete mis en evidence par le deplacement de fils inertes places initialement dans le plan de soudure. L'analyse de la variation des coefficients de diffusion intrinseques, des flux des deux especes et de la vitesse du reseau a ete faite par la technique des couples incrementaux en utilisant les equations de DARKEN et de HEUMANN. On trouve D{sub Pu} > D

  5. Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-09-15

    Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

  6. Effects of extracellular potassium diffusion on electrically coupled neuron networks

    Science.gov (United States)

    Wu, Xing-Xing; Shuai, Jianwei

    2015-02-01

    Potassium accumulation and diffusion during neuronal epileptiform activity have been observed experimentally, and potassium lateral diffusion has been suggested to play an important role in nonsynaptic neuron networks. We adopt a hippocampal CA1 pyramidal neuron network in a zero-calcium condition to better understand the influence of extracellular potassium dynamics on the stimulus-induced activity. The potassium concentration in the interstitial space for each neuron is regulated by potassium currents, Na+-K+ pumps, glial buffering, and ion diffusion. In addition to potassium diffusion, nearby neurons are also coupled through gap junctions. Our results reveal that the latency of the first spike responding to stimulus monotonically decreases with increasing gap-junction conductance but is insensitive to potassium diffusive coupling. The duration of network oscillations shows a bell-like shape with increasing potassium diffusive coupling at weak gap-junction coupling. For modest electrical coupling, there is an optimal K+ diffusion strength, at which the flow of potassium ions among the network neurons appropriately modulates interstitial potassium concentrations in a degree that provides the most favorable environment for the generation and continuance of the action potential waves in the network.

  7. Effect of pressure on arsenic diffusion in germanium

    International Nuclear Information System (INIS)

    Mitha, S.; Theiss, S.D.; Aziz, M.J.; Schiferl, D.; Poker, D.B.

    1994-01-01

    We report preliminary results of a study of the activation volume for diffusion of arsenic in germanium. High-temperature high-pressure anneals were performed in a liquid argon pressure medium in a diamond anvil cell capable of reaching 5 GPa and 750 C,l which is externally heated for uniform and repeatable temperature profiles. Broadening of an ion-implanted arsenic profile was measured by Secondary Ion Mass Spectrometry. Hydrostatic pressure retards the diffusivity at 575 C, characterized by an activation volume that is +15% of the atomic volume of Ge. Implications for diffusion mechanisms are discussed

  8. Laser-induced pressure-wave and barocaloric effect during flash diffusivity measurements

    International Nuclear Information System (INIS)

    Wang, Hsin; Porter, Wallace D.; Dinwiddie, Ralph Barton

    2017-01-01

    We report laser-induced pressure-wave and barocaloric effect captured by an infrared detector during thermal diffusivity measurements. Very fast (< 1 ms) and negative transients during laser flash measurements were captured by the infrared detector on thin, high thermal conductivity samples. Standard thermal diffusivity analysis only focuses the longer time scale thermal transient measured from the back surface due to thermal conduction. These negative spikes are filtered out and ignored as noise or anomaly from instrument. This study confirmed that the initial negative signal was indeed a temperature drop induced by the laser pulse. The laser pulse induced instantaneous volume expansion and the associated cooling in the specimen can be explained by the barocaloric effect. The initial cooling (< 100 microsecond) is also known as thermoelastic effect in which a negative temperature change is generated when the material is elastically deformed by volume expansion. A subsequent temperature oscillation in the sample was observed and only lasted about one millisecond. The pressure-wave induced thermal signal was systematically studied and analyzed. In conclusion, the underlying physics of photon-mechanical-thermal energy conversions and the potential of using this signal to study barocaloric effects in solids are discussed.

  9. Spectral Analysis and Computation of Effective Diffusivities in Space-time Periodic Incompressible Flows

    Science.gov (United States)

    2015-11-01

    diffusive tracer fluxes, directed normal to the tracer gradient [64], are generally equivalent to antisymmetric components in the effective diffusivity...tensor D∗, while the symmetric part of D∗ represents irreversible diffusive effects [83, 87, 39] directed down the tracer gradient . The mixing of eddy...provides an operational calculus in Hilbert space which yields powerful integral representations involving the Stieltjes measures displayed in equation

  10. Effects of surface and interface scattering on anomalous Hall effect in Co/Pd multilayers

    KAUST Repository

    Guo, Zaibing

    2012-09-27

    In this paper, we report the results of surface and interface scattering on anomalous Hall effect in Co/Pd multilayers with perpendicular magnetic anisotropy. The surface scattering effect has been extracted from the total anomalous Hall effect. By scaling surface scattering contribution with ρAHs∼ργss, the exponent γ has been found to decrease with the increase of surface scattering resistivity, which could account for the thickness-dependent anomalous Hall effect. Interface diffusion induced by rapid thermal annealing modifies not only the magnetization and longitudinal resistivity but also the anomalous Hall effect; a large exponent γ ∼ 5.7 has been attributed to interface scattering-dominated anomalous Hall effect.

  11. Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

    Energy Technology Data Exchange (ETDEWEB)

    Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

    1990-04-01

    A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

  12. Effects of anisotropies in turbulent magnetic diffusion in mean-field solar dynamo models

    Energy Technology Data Exchange (ETDEWEB)

    Pipin, V. V. [Institute of Solar-Terrestrial Physics, Russian Academy of Sciences, Irkutsk 664033 (Russian Federation); Kosovichev, A. G. [Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305 (United States)

    2014-04-10

    We study how anisotropies of turbulent diffusion affect the evolution of large-scale magnetic fields and the dynamo process on the Sun. The effect of anisotropy is calculated in a mean-field magnetohydrodynamics framework assuming that triple correlations provide relaxation to the turbulent electromotive force (so-called the 'minimal τ-approximation'). We examine two types of mean-field dynamo models: the well-known benchmark flux-transport model and a distributed-dynamo model with a subsurface rotational shear layer. For both models, we investigate effects of the double- and triple-cell meridional circulation, recently suggested by helioseismology and numerical simulations. To characterize the anisotropy effects, we introduce a parameter of anisotropy as a ratio of the radial and horizontal intensities of turbulent mixing. It is found that the anisotropy affects the distribution of magnetic fields inside the convection zone. The concentration of the magnetic flux near the bottom and top boundaries of the convection zone is greater when the anisotropy is stronger. It is shown that the critical dynamo number and the dynamo period approach to constant values for large values of the anisotropy parameter. The anisotropy reduces the overlap of toroidal magnetic fields generated in subsequent dynamo cycles, in the time-latitude 'butterfly' diagram. If we assume that sunspots are formed in the vicinity of the subsurface shear layer, then the distributed dynamo model with the anisotropic diffusivity satisfies the observational constraints from helioseismology and is consistent with the value of effective turbulent diffusion estimated from the dynamics of surface magnetic fields.

  13. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe(110) surface

    International Nuclear Information System (INIS)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-01-01

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.

  14. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe110 surface.

    Science.gov (United States)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-09-29

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.

  15. Record Charge Carrier Diffusion Length in Colloidal Quantum Dot Solids via Mutual Dot-To-Dot Surface Passivation.

    Science.gov (United States)

    Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H

    2015-06-03

    Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Measurement of ageing effect on chloride diffusion coefficients in cementitious matrices

    International Nuclear Information System (INIS)

    Andrade, C.; Castellote, M.; D'Andrea, R.

    2011-01-01

    Most of the low-level nuclear waste disposal facilities are based in engineered multi barrier systems where reinforced concrete is one of the basic materials. The calculation of the time until steel reinforcement depassivation is a need due to the demand of prediction of the service life of concrete structures in radioactive repositories. In doing that, one of the main steps is the transport of chloride ions towards the reinforcement, as one of the most aggressive agents for the rebars in concrete is chloride ions. Ageing of concrete related to chloride penetration leads to significant decrease of the 'apparent diffusion' coefficient with time. If this effect is not considered, considerable bias can be introduced when predicting service life of reinforced concrete of repositories. Several effects have been addressed on their influence on the ageing of concrete, including the evolution with time of the concrete pore refinement, the binding of chlorides to the cement phases and to the changes of chloride 'surface concentration'. These effects have been studied in specimens made with different mixes trying to represent a wide range of mineral addition proportions. The analysis of their evolution with time has shown that the resistivity alone or the joint consideration of resistivity and binding capacity (C b /C f ), are appropriate parameters to appraise the diffusivity ageing. For practical reasons, an accelerated procedure is proposed in order to calculate ageing for short periods of time.

  17. Effective diffusion coefficients of /sup 3/H/sub 2/O in several porous materials

    Energy Technology Data Exchange (ETDEWEB)

    Terashima, Y [Kyoto Univ. (Japan). Faculty of Engineering; Kumaki, T

    1976-12-01

    Diffusion coefficients of radionuclides in some porous structural materials and porous components of earth stratum are important as the basis for the safety evaluation of the storage and disposal of radioactive wastes. In our previous works, the method of analysis and experiment using a permeative type diffusion cell for measurement of effective diffusion coefficient was established, and experimental results were reported. In this paper, effective diffusion coefficients of /sup 3/H/sub 2/O in mortar, concrete, brick, clay layer, and sand layer were measured, and characteristics of these pore structure were discussed on the basis of tourtusity factor.

  18. Effective diffusion coefficients of 3H2O in several porous materials

    International Nuclear Information System (INIS)

    Terashima, Yutaka; Kumaki, Toru.

    1976-01-01

    Diffusion coefficients of radionuclides in some porous structural materials and porous components of earth stratum are important as the basis for the safety evaluation of the storage and disposal of radioactive wastes. In our previous works, the method of analysis and experiment using a permeative type diffusion cell for measurement of effective diffusion coefficient was established, and experimental results were reported. In this paper, effective diffusion coefficients of 3 H 2 O in mortar, concrete, brick, clay layer, and sand layer were measured, and characteristics of these pore structure were discussed on the basis of tourtusity factor. (auth.)

  19. Multiple-effect diffusion solar still coupled with a vacuum-tube collector and heat pipe

    KAUST Repository

    Chong, Tze-Ling; Huang, Bin-Juine; Wu, Po-Hsien; Kao, Yeong-Chuan

    2014-01-01

    The present study develops a multiple-effect diffusion solar still (MEDS) with a bended-plate design in multiple-effect diffusion unit (MDU) to solve the peel-off problem of wick material. The MDU is coupled with a vacuum-tube solar collector

  20. Exploring the effect of diffuse reflection on indoor localization systems based on RSSI-VLC.

    Science.gov (United States)

    Mohammed, Nazmi A; Elkarim, Mohammed Abd

    2015-08-10

    This work explores and evaluates the effect of diffuse light reflection on the accuracy of indoor localization systems based on visible light communication (VLC) in a high reflectivity environment using a received signal strength indication (RSSI) technique. The effect of the essential receiver (Rx) and transmitter (Tx) parameters on the localization error with different transmitted LED power and wall reflectivity factors is investigated at the worst Rx coordinates for a directed/overall link. Since this work assumes harsh operating conditions (i.e., a multipath model, high reflectivity surfaces, worst Rx position), an error of ≥ 1.46 m is found. To achieve a localization error in the range of 30 cm under these conditions with moderate LED power (i.e., P = 0.45 W), low reflectivity walls (i.e., ρ = 0.1) should be used, which would enable a localization error of approximately 7 mm at the room's center.

  1. The effect of diffuse ceiling panel on the energy performance of thermally activated building construction

    DEFF Research Database (Denmark)

    Zhang, Chen; Heiselberg, Per Kvols; Pomianowski, Michal Zbigniew

    2016-01-01

    An integrated system combining diffuse ceiling ventilation with thermally activated building construction (TABS) was proposed recently. In this system, TABS is encapsulated by diffuse ceiling panel and cannot have directly heat exchange with the room. The aim of this study is to investigate...... the effect of diffuse ceiling panel on the energy performance of TABS in both heat and cooling mode. Experiments are carried out in a full-scale test facility with the integrated system, and the cases without diffuse ceiling are also measured as references. The results indicate that the diffuse ceiling has...... an opposite effect on the heating and cooling capacity of TABS. In addition, a numerical model is built and validated by the measured data. The validated model is further applied to conduct a paramedical study on the materials of the diffuse ceiling panel....

  2. Effect of voids-controlled vacancy supersaturations on B diffusion

    International Nuclear Information System (INIS)

    Marcelot, O.; Claverie, A.; Cristiano, F.; Cayrel, F.; Alquier, D.; Lerch, W.; Paul, S.; Rubin, L.; Jaouen, H.; Armand, C.

    2007-01-01

    We present here preliminary results on boron diffusion in presence of pre-formed voids of different characteristics. The voids were fabricated by helium implantation followed by annealing allowing the desorption of He prior to boron implantation. We show that under such conditions boron diffusion is always largely reduced and can even be suppressed in some cases. Boron diffusion suppression can be observed in samples not containing nanovoids in the boron-rich region. It is suggested that direct trapping of Si(int)s by the voids is not the mechanism responsible for the reduction of boron diffusion in such layers. Alternatively, our experimental results suggest that this reduction of diffusivity is more probably due to the competition between two Ostwald ripening phenomena taking place at the same time: in the boron-rich region, the competitive growth of extrinsic defects at the origin of TED and, in the void region, the Ostwald ripening of the voids which involves large supersaturations of Vs

  3. Effect of voids-controlled vacancy supersaturations on B diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Marcelot, O. [CEMES/CNRS, 29 rue Jeanne Marvig, 31055 Toulouse (France)]. E-mail: marcelot@cemes.fr; Claverie, A. [CEMES/CNRS, 29 rue Jeanne Marvig, 31055 Toulouse (France); Cristiano, F. [LAAS/CNRS, 7 av. du Col. Roche, 31077 Toulouse (France); Cayrel, F. [LMP, Universite de Tours, 16 rue Pierre et Marie Curie, BP 7155, 37071 Tours (France); Alquier, D. [LMP, Universite de Tours, 16 rue Pierre et Marie Curie, BP 7155, 37071 Tours (France); Lerch, W. [Mattson Thermal Products GmbH, Daimlerstr. 10, D-89160 Dornstadt (Germany); Paul, S. [Mattson Thermal Products GmbH, Daimlerstr. 10, D-89160 Dornstadt (Germany); Rubin, L. [Axcelis Technologies, 108 Cherry Hill Drive, Beverly MA 01915 (United States); Jaouen, H. [STMicroelectronics, 850 rue Jean Monnet, 38926 Crolles (France); Armand, C. [LNMO/INSA, Service analyseur ionique, 135 av. de Rangueil, 31077 Toulouse (France)

    2007-04-15

    We present here preliminary results on boron diffusion in presence of pre-formed voids of different characteristics. The voids were fabricated by helium implantation followed by annealing allowing the desorption of He prior to boron implantation. We show that under such conditions boron diffusion is always largely reduced and can even be suppressed in some cases. Boron diffusion suppression can be observed in samples not containing nanovoids in the boron-rich region. It is suggested that direct trapping of Si(int)s by the voids is not the mechanism responsible for the reduction of boron diffusion in such layers. Alternatively, our experimental results suggest that this reduction of diffusivity is more probably due to the competition between two Ostwald ripening phenomena taking place at the same time: in the boron-rich region, the competitive growth of extrinsic defects at the origin of TED and, in the void region, the Ostwald ripening of the voids which involves large supersaturations of Vs.

  4. Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

    Science.gov (United States)

    Matrane, I.; Mazroui, M.; Sbiaai, K.

    2018-03-01

    We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

  5. Exciton diffusion length in some thermocleavable polythiophenes by the surface photovoltage method

    DEFF Research Database (Denmark)

    Tousek, J.; Touskova, J.; Remes, Z.

    2012-01-01

    property is that P3MHOCT can serve as a precursor which, after thermal annealing, converts into more rigid and insoluble P3CT and further thermal treatment produces native unsubstituted PT. Ellipsometric measurement yielded data on the thickness of the spin coated layers; absorption coefficients were...... be ascribed to the increase of the crystalline fraction. The highest diffusion length was found in P3CT polymer but its large resistivity represents a disadvantage in application in solar cells. Taking into account just these parameters, relatively low resistivity together with quite high diffusion length (13...

  6. Effect of Differential Diffusion in Two-Component Media

    Science.gov (United States)

    Ingel', L. Kh.

    2017-03-01

    Examples are presented of an exact solution of a nonstationary problem on the development of convection in a binary mixture (seawater) near an infinite vertical surface in which the buoyancy disturbances are determined both by the temperature and by the disturbances of the impurity (salt) concentration. Consideration is given to the development of convection in a homogeneous medium near an infinite vertical surface at whose boundary specification is made of constant (after ″switching on″ at the initial moment) heat fluxes and impurities or variations of these substances, i.e., problems with boundary conditions of 1st and 2nd kind are considered. The obtained analytical solutions demonstrate the possibility of a nontrivial effect associated with the difference in the values of the coefficients of transfer of two substances: the inflows of positive buoyancy may lead, contrary to intuitive notions, to the origination of descending motion of the medium rather than the ascending one. Clarification is provided for the physical meaning of such effects, which can be substantial, for example, in melting of sea ice.

  7. Spiral multiple-effect diffusion solar still coupled with vacuum-tube collector and heat pipe

    KAUST Repository

    Huang, Bin-Juine

    2015-04-01

    © 2015 Elsevier B.V. A novel solar still with spiral-shape multiple-effect diffusion unit is developed in the present study. The test results of a 14-effect unit coupled with vacuum-tube solar collector (absorber area 1.08m2) show that the highest daily pure water production is 40.6kgd-1. The measured highest productivity based on the area of glass cover, solar absorber, and evaporating surface is 34.7, 40.6, and 7.96kgm-2d-1, respectively, which are much higher than the published results. The measured solar distillation efficiency is 2.0-3.5. The performance enhancement results mainly from the lateral diffusion process in the spiraled still cell. The vapor flow generated by heat input can flow freely and laterally through the spiral channel down to the end when solar heat input is high. Besides, the larger evaporating and condensing area at the outer cell may increase heat and mass transfer at the outer cell.

  8. Multiple-effect diffusion solar still coupled with a vacuum-tube collector and heat pipe

    KAUST Repository

    Chong, Tze-Ling

    2014-08-01

    The present study develops a multiple-effect diffusion solar still (MEDS) with a bended-plate design in multiple-effect diffusion unit (MDU) to solve the peel-off problem of wick material. The MDU is coupled with a vacuum-tube solar collector to produce a high temperature gradient for high productivity. A heat pipe is used to transfer the solar heat to the MDU. A prototype MEDS-1L was built and tested outdoors. Four performance indexes are proposed for the performance evaluation of MEDS, including daily pure water production per unit area of glass cover, solar absorber, and evaporating surface (Mcov, Msol, Mevp, respectively), and solar distillation efficiency Rcov. The outdoor test results of MEDS-1L show that the solar collector supply temperature Th reaches 100°C at solar radiation 800Wm-2. The highest Mcov is 23.9kgm-2d-1 which is about 29% higher than the basin-type MEDS [11]. The highest value is 25.9kgm-2d-1 for Msol and 2.79kgm-2d-1 for Mevp. The measured Rcov is 1.5-2.44, higher than the basin-type MEDS (1.45-1.88). The Mcov, Msol, Mevp and Rcov of MEDS-1L are all higher than the theoretical calculation of a MEDS with a flat-plate solar collector coupled with a heat pipe (MEDS-FHP) [17].© 2014 Elsevier B.V.

  9. Chronic Effects of Boxing: Diffusion Tensor Imaging and Cognitive Findings.

    Science.gov (United States)

    Wilde, Elisabeth A; Hunter, Jill V; Li, Xiaoqi; Amador, Cristian; Hanten, Gerri; Newsome, Mary R; Wu, Trevor C; McCauley, Stephen R; Vogt, Gregory S; Chu, Zili David; Biekman, Brian; Levin, Harvey S

    2016-04-01

    We used magnetic resonance imaging (MRI) and diffusion tensor imaging (DTI) to evaluate the effects of boxing on brain structure and cognition in 10 boxers (8 retired, 2 active; mean age = 45.7 years; standard deviation [SD] = 9.71) and 9 participants (mean age = 43.44; SD = 9.11) in noncombative sports. Evans Index (maximum width of the anterior horns of the lateral ventricles/maximal width of the internal diameter of the skull) was significantly larger in the boxers (F = 4.52; p = 0.050; Cohen's f = 0.531). Word list recall was impaired in the boxers (F(1,14) = 10.70; p = 0.006; f = 0.84), whereas implicit memory measured by faster reaction time (RT) to a repeating sequence of numbers than to a random sequence was preserved (t = 2.52; p boxing had the most consistent, negative correlations with FA, ranging from -0.65 for the right ventral striatum to -0.92 for the right cerebral peduncle. Years of boxing was negatively related to the number of words consistently recalled over trials (r = -0.74; p = 0.02), delayed recall (r = -0.83; p = 0.003), and serial RT (r = 0.66; p = 0.05). We conclude that microstructural integrity of white matter tracts is related to declarative memory and response speed in boxers and to the extent of boxing exposure. Implications for chronic traumatic encephalopathy are discussed.

  10. Coupling effects of chemical stresses and external mechanical stresses on diffusion

    International Nuclear Information System (INIS)

    Xuan Fuzhen; Shao Shanshan; Wang Zhengdong; Tu Shantung

    2009-01-01

    Interaction between diffusion and stress fields has been investigated extensively in the past. However, most of the previous investigations were focused on the effect of chemical stress on diffusion due to the unbalanced mass transport. In this work, the coupling effects of external mechanical stress and chemical stress on diffusion are studied. A self-consistent diffusion equation including the chemical stress and external mechanical stress gradient is developed under the framework of the thermodynamic theory and Fick's law. For a thin plate subjected to unidirectional tensile stress fields, the external stress coupled diffusion equation is solved numerically with the help of the finite difference method for one-side and both-side charging processes. Results show that, for such two types of charging processes, the external stress gradient will accelerate the diffusion process and thus increase the value of concentration while reducing the magnitude of chemical stress when the direction of diffusion is identical to that of the stress gradient. In contrast, when the direction of diffusion is opposite to that of the stress gradient, the external stress gradient will obstruct the process of solute penetration by decreasing the value of concentration and increasing the magnitude of chemical stress. For both-side charging process, compared with that without the coupling effect of external stress, an asymmetric distribution of concentration is produced due to the asymmetric mechanical stress field feedback to diffusion.

  11. The EZ diffusion model provides a powerful test of simple empirical effects.

    Science.gov (United States)

    van Ravenzwaaij, Don; Donkin, Chris; Vandekerckhove, Joachim

    2017-04-01

    Over the last four decades, sequential accumulation models for choice response times have spread through cognitive psychology like wildfire. The most popular style of accumulator model is the diffusion model (Ratcliff Psychological Review, 85, 59-108, 1978), which has been shown to account for data from a wide range of paradigms, including perceptual discrimination, letter identification, lexical decision, recognition memory, and signal detection. Since its original inception, the model has become increasingly complex in order to account for subtle, but reliable, data patterns. The additional complexity of the diffusion model renders it a tool that is only for experts. In response, Wagenmakers et al. (Psychonomic Bulletin & Review, 14, 3-22, 2007) proposed that researchers could use a more basic version of the diffusion model, the EZ diffusion. Here, we simulate experimental effects on data generated from the full diffusion model and compare the power of the full diffusion model and EZ diffusion to detect those effects. We show that the EZ diffusion model, by virtue of its relative simplicity, will be sometimes better able to detect experimental effects than the data-generating full diffusion model.

  12. Interstitial diffusion in crystal and the Moessbauer effect

    International Nuclear Information System (INIS)

    Dzyublik, A.Ya.

    1976-01-01

    The role of different vibrational states of a crystal is taken into account in the model of interstitial uncorrelated jumps. The relation of the diffusion coefficient for an interstitial with probabilities of jumps is found. The cross section for resonant absorption of γ-quanta by a nucleus of a diffusing atom in a crystal is calculated. The existence of vibrational levels is shown to lead to less broadening and intensity of the Moessbauer line than those predicted by the simple model of jumps. The absorption line shape for atom jumping through octahedral sites in bcc lattice is investigated [ru

  13. Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

    International Nuclear Information System (INIS)

    Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

    1997-01-01

    The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

  14. Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

    International Nuclear Information System (INIS)

    Posadillo, R.; Lopez Luque, R.

    2009-01-01

    The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

  15. Numerical modeling of turbulent jet diffusion flames in the atmospheric surface layer

    NARCIS (Netherlands)

    Hernández, J.; Crespo, A.; Duijm, N.J.

    1995-01-01

    The evolution of turbulent jet diffusion flames of natural gas in air is predicted using a finite-volume procedure for solving the flow equations. The model is three dimensional, elliptic and based on the conserved-scalar approach and the laminar flamelet concept. A laminar flamelet prescription for

  16. Diffusion Coefficient in the Zinc Coating Shaped on the Surface of Cast Iron and Steel Alloys

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2015-06-01

    Full Text Available The article presents the method to assess the diffusion coefficient D in the sub-layer of intermetallic phases formed during hot-dip galvanizing “Armco” iron and ductile cast iron EN-GJS-500-7. Hot-dip galvanizing is one of the most popular forms of long-term protection of Fe-C alloys against corrosion. The process for producing a protective layer of sufficient quality is closely related to diffusion of atoms of zinc and iron. The simulation consist in performed a hot-dip galvanizing in laboratory condition above Fe-C alloys, in the Department of Engineering of Cast Alloys and Composites. Galvanizing time ranged from 15 to 300 seconds. Then metallographic specimens were prepared, intermetallic layers were measured and diffusion coefficient (D were calculated. It was found that the diffusion coefficient obtained during hot-dip galvanizing “Armco” iron and zinc is about two orders of magnitude less than the coefficient obtained on ductile cast iron EN-GJS-500-7.

  17. Scale dependence of the effective matrix diffusion coefficient: Evidence and preliminary interpretation

    International Nuclear Information System (INIS)

    Liu, Hui-Hai; Zhang, Yingqi; Molz, Fred J.

    2006-01-01

    The exchange of solute mass (through molecular diffusion) between fluid in fractures and fluid in the rock matrix is called matrix diffusion. Owing to the orders-of-magnitude slower flow velocity in the matrix compared to fractures, matrix diffusion can significantly retard solute transport in fractured rock, and therefore is an important process for a variety of problems, including remediation of subsurface contamination and geological disposal of nuclear waste. The effective matrix diffusion coefficient (molecular diffusion coefficient in free water multiplied by matrix tortuosity) is an important parameter for describing matrix diffusion, and in many cases largely determines overall solute transport behavior. While matrix diffusion coefficient values measured from small rock samples in the laboratory are generally used for modeling field-scale solute transport in fractured rock (Boving and Grathwohl, 2001), several research groups recently have independently found that effective matrix diffusion coefficients much larger than laboratory measurements are needed to match field-scale tracer-test data (Neretnieks, 2002; Becker and Shapiro, 2000; Shapiro, 2001; Liu et al., 2003, 2004a). In addition to the observed enhancement, Liu et al. (2004b), based on a relatively small number of field-test results, reported that the effective matrix diffusion coefficient might be scale dependent, and, like permeability and dispersivity, it seems to increases with test scale. This scale-dependence has important implications for large-scale solute transport in fractured rock. Although a number of mechanisms have been proposed to explain the enhancement of the effective matrix diffusion coefficient, the potential scale dependence and its mechanisms are not fully investigated at this stage. The major objective of this study is to again demonstrate (based on more data published in the literature than those used in Liu et al. [2004b]) the potential scale dependence of the effective

  18. Scale Dependence of the Effective Matrix Diffusion Coefficient : Evidence and Preliminary Interpretation

    International Nuclear Information System (INIS)

    H.H. Liu; Y. Zhang

    2006-01-01

    The exchange of solute mass (through molecular diffusion) between fluid in fractures and fluid in the rock matrix is called matrix diffusion. Owing to the orders-of-magnitude slower flow velocity in the matrix compared to fractures, matrix diffusion can significantly retard solute transport in fractured rock, and therefore is an important process for a variety of problems, including remediation of subsurface contamination and geological disposal of nuclear waste. The effective matrix diffusion coefficient (molecular diffusion coefficient in free water multiplied by matrix tortuosity) is an important parameter for describing matrix diffusion, and in many cases largely determines overall solute transport behavior. While matrix diffusion coefficient values measured from small rock samples in the laboratory are generally used for modeling field-scale solute transport in fractured rock (Boving and Grathwohl, 2001), several research groups recently have independently found that effective matrix diffusion coefficients much larger than laboratory measurements are needed to match field-scale tracer-test data (Neretnieks, 2002; Becker and Shapiro, 2000; Shapiro, 2001; Liu et al., 2003,2004a). In addition to the observed enhancement, Liu et al. (2004b), based on a relatively small number of field-test results, reported that the effective matrix diffusion coefficient might be scale dependent, and, like permeability and dispersivity, it seems to increases with test scale. This scale-dependence has important implications for large-scale solute transport in fractured rock. Although a number of mechanisms have been proposed to explain the enhancement of the effective matrix diffusion coefficient, the potential scale dependence and its mechanisms are not fully investigated at this stage. The major objective of this study is to again demonstrate (based on more data published in the literature than those used in Liu et al. [2004b]) the potential scale dependence of the effective

  19. Impact of the structural anisotropy of La{sub 2}NiO{sub 4+δ} on on high temperature surface modifications and diffusion of oxygen

    Energy Technology Data Exchange (ETDEWEB)

    Gauquelin, Nicolas

    2010-11-29

    La{sub 2}NiO{sub 4+δ} was first studied due to its structural similarities with the High Temperature superconductor La{sub 2}NiO{sub 4+δ} and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K{sub 2}NiF{sub 4} layered structure and accommodates highly mobile oxygen at its ground state and is therefore overstoichiometric. During this thesis, pure single crystals of La{sub 2}NiO{sub 4+δ} were successfully grown using the floating-zone method, subsequently characterized using neutron and Laue Backscattering diffraction and oriented pieces of single crystal with [100] and [001] orientation were prepared. The surface morphology behavior after long term exposure to high temperature in different atmospheres was observed using microscopy techniques because stability at high temperature is required for application purposes and it was discovered a structural change to nickel-rich phases at T>1173 K. The sensibility of the oxygen non-stoichiometry to cooling was studied and subsequently a new {sup 18}O-{sup 18}O exchange apparatus allowing quenching of the samples using liquid nitrogen was developed. Oxygen selfdiffusion was studied using SIMS in the range 673-873K in both [100] and [001] crystallographic directions. The effect of the disorientation of the sample surface on the determination of the slowest diffusion coefficient was discovered and revealed the very strong anisotropy (>5 orders of magnitude difference) between the different diffusion paths. Finally using HTXRD and oxygen release experiments, it was shown that oxygen diffusion from interstitial oxygen starts to be relevant at 550-600 K and a change of behavior is observed around 700 K, corresponding to a possible change in the diffusion mechanism from interstitial to interstitialcy.

  20. Impact of the structural anisotropy of La2NiO4+δ on on high temperature surface modifications and diffusion of oxygen

    International Nuclear Information System (INIS)

    Gauquelin, Nicolas

    2010-01-01

    La 2 NiO 4+δ was first studied due to its structural similarities with the High Temperature superconductor La 2 NiO 4+δ and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K 2 NiF 4 layered structure and accommodates highly mobile oxygen at its ground state and is therefore overstoichiometric. During this thesis, pure single crystals of La 2 NiO 4+δ were successfully grown using the floating-zone method, subsequently characterized using neutron and Laue Backscattering diffraction and oriented pieces of single crystal with [100] and [001] orientation were prepared. The surface morphology behavior after long term exposure to high temperature in different atmospheres was observed using microscopy techniques because stability at high temperature is required for application purposes and it was discovered a structural change to nickel-rich phases at T>1173 K. The sensibility of the oxygen non-stoichiometry to cooling was studied and subsequently a new 18 O- 18 O exchange apparatus allowing quenching of the samples using liquid nitrogen was developed. Oxygen selfdiffusion was studied using SIMS in the range 673-873K in both [100] and [001] crystallographic directions. The effect of the disorientation of the sample surface on the determination of the slowest diffusion coefficient was discovered and revealed the very strong anisotropy (>5 orders of magnitude difference) between the different diffusion paths. Finally using HTXRD and oxygen release experiments, it was shown that oxygen diffusion from interstitial oxygen starts to be relevant at 550-600 K and a change of behavior is observed around 700 K, corresponding to a possible change in the diffusion mechanism from interstitial to interstitialcy.

  1. Effective reaction rates in diffusion-limited phosphorylation-dephosphorylation cycles

    Science.gov (United States)

    Szymańska, Paulina; Kochańczyk, Marek; Miekisz, Jacek; Lipniacki, Tomasz

    2015-02-01

    We investigate the kinetics of the ubiquitous phosphorylation-dephosphorylation cycle on biological membranes by means of kinetic Monte Carlo simulations on the triangular lattice. We establish the dependence of effective macroscopic reaction rate coefficients as well as the steady-state phosphorylated substrate fraction on the diffusion coefficient and concentrations of opposing enzymes: kinases and phosphatases. In the limits of zero and infinite diffusion, the numerical results agree with analytical predictions; these two limits give the lower and the upper bound for the macroscopic rate coefficients, respectively. In the zero-diffusion limit, which is important in the analysis of dense systems, phosphorylation and dephosphorylation reactions can convert only these substrates which remain in contact with opposing enzymes. In the most studied regime of nonzero but small diffusion, a contribution linearly proportional to the diffusion coefficient appears in the reaction rate. In this regime, the presence of opposing enzymes creates inhomogeneities in the (de)phosphorylated substrate distributions: The spatial correlation function shows that enzymes are surrounded by clouds of converted substrates. This effect becomes important at low enzyme concentrations, substantially lowering effective reaction rates. Effective reaction rates decrease with decreasing diffusion and this dependence is more pronounced for the less-abundant enzyme. Consequently, the steady-state fraction of phosphorylated substrates can increase or decrease with diffusion, depending on relative concentrations of both enzymes. Additionally, steady states are controlled by molecular crowders which, mostly by lowering the effective diffusion of reactants, favor the more abundant enzyme.

  2. Insights into Surface Interactions between Metal Organic Frameworks and Gases during Transient Adsorption and Diffusion by In-Situ Small Angle X-ray Scattering

    Directory of Open Access Journals (Sweden)

    Ludovic F. Dumée

    2016-09-01

    Full Text Available The fabrication of molecular gas sieving materials with specific affinities for a single gas species and able to store large quantities of materials at a low or atmospheric pressure is desperately required to reduce the adverse effects of coal and oil usage in carbon capture. Fundamental understanding of the dynamic adsorption of gas, the diffusion mechanisms across thin film membranes, and the impact of interfaces play a vital role in developing these materials. In this work, single gas permeation tests across micro-porous membrane materials, based on metal organic framework crystals grown on the surface of carbon nanotubes (ZiF-8@CNT, were performed for the first time in-situ at the Australian Synchrotron on the small angle X-ray scattering beamline in order to reveal molecular sieving mechanisms and gas adsorption within the material. The results show that specific chemi-sorption of CO2 across the ZiF-8 crystal lattices affected the morphology and unit cell parameters, while the sieving of other noble or noble like gases across the ZiF-8@CNT membranes was found to largely follow Knudsen diffusion. This work demonstrates for the first time a novel and effective technique to assess molecular diffusion at the nano-scale across sub-nano-porous materials by probing molecular flexibility across crystal lattice and single cell units.

  3. Toxic potency and effects of diffuse air pollution

    NARCIS (Netherlands)

    Hamers, T.H.M.

    2002-01-01

    Diffuse air pollution consists of an omnipresent complex mixture of pollutants that is emitted from many widely dispersed sources as traffic, industries, households, energy plants, waste incinerators, and agriculture. It can be deposited in relatively remote areas as a result of

  4. External boundary effects on simultaneous diffusion and reaction processes

    International Nuclear Information System (INIS)

    Le Roux, M.N.; Wilhelmsson, H.

    1989-01-01

    External boundaries influence the spatial and temporal structure of evolution of dynamic systems governed by reaction-diffusion equations. Critical limits, i.e. thresholds for explosive growth or onset of diffusion dominated decay, are found to be caused by the presence of the boundary and to depend on: the position of the boundary, where the density is assumed to be zero at any instant of time: the mutual weights (coefficients) and powers of the nonlinear reaction and diffusion processes; and the initial spatial distribution. However, for particular relations between the nonlinear powers of the reaction and diffusion terms the critical limits do not depend on the initial conditions. The results are obtained by simulation experiment for one, two and three dimensions. Trends in the dynamic evolution of the system with an external boundary imposed are compared with the corresponding analytic results obtained for free boundary. Interesting applications are found in various areas, e.g. in the field of high temperature fusion plasma where the evolution of the temperature profile for the so-called H-mode (constant plasma density) is described

  5. Redox Couples with Unequal Diffusion Coefficients: Effect on Redox Cycling

    NARCIS (Netherlands)

    Mampallil Augustine, Dileep; Mathwig, Klaus; Kang, Shuo; Lemay, Serge Joseph Guy

    2013-01-01

    Redox cycling between two electrodes separated by a narrow gap allows dramatic amplification of the faradaic current. Unlike conventional electrochemistry at a single electrode, however, the mass-transport-limited current is controlled by the diffusion coefficient of both the reduced and oxidized

  6. Effect of Oxygen Enrichment in Propane Laminar Diffusion Flames under Microgravity and Earth Gravity Conditions

    Science.gov (United States)

    Bhatia, Pramod; Singh, Ravinder

    2017-06-01

    Diffusion flames are the most common type of flame which we see in our daily life such as candle flame and match-stick flame. Also, they are the most used flames in practical combustion system such as industrial burner (coal fired, gas fired or oil fired), diesel engines, gas turbines, and solid fuel rockets. In the present study, steady-state global chemistry calculations for 24 different flames were performed using an axisymmetric computational fluid dynamics code (UNICORN). Computation involved simulations of inverse and normal diffusion flames of propane in earth and microgravity condition with varying oxidizer compositions (21, 30, 50, 100 % O2, by mole, in N2). 2 cases were compared with the experimental result for validating the computational model. These flames were stabilized on a 5.5 mm diameter burner with 10 mm of burner length. The effect of oxygen enrichment and variation in gravity (earth gravity and microgravity) on shape and size of diffusion flames, flame temperature, flame velocity have been studied from the computational result obtained. Oxygen enrichment resulted in significant increase in flame temperature for both types of diffusion flames. Also, oxygen enrichment and gravity variation have significant effect on the flame configuration of normal diffusion flames in comparison with inverse diffusion flames. Microgravity normal diffusion flames are spherical in shape and much wider in comparison to earth gravity normal diffusion flames. In inverse diffusion flames, microgravity flames were wider than earth gravity flames. However, microgravity inverse flames were not spherical in shape.

  7. Understanding the anisotropic strain effects on lithium diffusion in graphite anodes: A first-principles study

    Science.gov (United States)

    Ji, Xiang; Wang, Yang; Zhang, Junqian

    2018-06-01

    The lithium diffusion in graphite anode, which is the most widely used commercial electrode material today, affects the charge/discharge performance of lithium-ion batteries. In this study, the anisotropic strain effects on lithium diffusion in graphite anodes are systematically investigated using first-principles calculations based on density functional theory (DFT) with van der Waals corrections. It is found that the effects of external applied strains along various directions of LixC6 (i.e., perpendicular or parallel to the basal planes of the graphite host) on lithium diffusivity are different. Along the direction perpendicular to the graphite planes, the tensile strain facilitates in-plane Li diffusion by reducing the energy barrier, and the compressive strain hinders in-plane Li diffusion by raising the energy barrier. In contrast, the in-plane biaxial tensile strain (parallel to the graphite planes) hinders in-plane Li diffusion, and the in-plane biaxial compressive strain facilitates in-plane Li diffusion. Furthermore, both in-plane and transverse shear strains slightly influence Li diffusion in graphite anodes. A discussion is presented to explain the anisotropic strain dependence of lithium diffusion. This research provides data for the continuum modelling of the electrodes in the lithium-ion batteries.

  8. Effects of curved midline and varying width on the description of the effective diffusivity of Brownian particles

    Science.gov (United States)

    Chávez, Yoshua; Chacón-Acosta, Guillermo; Dagdug, Leonardo

    2018-05-01

    Axial diffusion in channels and tubes of smoothly-varying geometry can be approximately described as one-dimensional diffusion in the entropy potential with a position-dependent effective diffusion coefficient, by means of the modified Fick–Jacobs equation. In this work, we derive analytical expressions for the position-dependent effective diffusivity for two-dimensional asymmetric varying-width channels, and for three-dimensional curved midline tubes, formed by straight walls. To this end, we use a recently developed theoretical framework using the Frenet–Serret moving frame as the coordinate system (2016 J. Chem. Phys. 145 074105). For narrow tubes and channels, an effective one-dimensional description reducing the diffusion equation to a Fick–Jacobs-like equation in general coordinates is used. From this last equation, one can calculate the effective diffusion coefficient applying Neumann boundary conditions.

  9. Effect of increasing diffusion gradient direction number on diffusion tensor imaging fiber tracking in the human brain

    International Nuclear Information System (INIS)

    Yao, Xu Fang; Liang, Bie Bei; Xia, Tian; Huang, Qin Ming; Zhuang, Song Lin; Yu, Tong Gang

    2015-01-01

    To assess the effects of varying the number of diffusion gradient directions (NDGDs) on diffusion tensor fiber tracking (FT) in human brain white matter using tract characteristics. Twelve normal volunteers underwent diffusion tensor imaging (DTI) scanning with NDGDs of 6, 11, 15, 21, and 31 orientations. Three fiber tract groups, including the splenium of the corpus callosum (CC), the entire CC, and the full brain tract, were reconstructed by deterministic DTI-FT. Tract architecture was first qualitatively evaluated by visual observation. Six quantitative tract characteristics, including the number of fibers (NF), average length (AL), fractional anisotropy (FA), relative anisotropy (RA), mean diffusivity (MD), and volume ratio (VR) were measured for the splenium of the CC at the tract branch level, for the entire CC at tract level, and for the full brain tract at the whole brain level. Visual results and those of NF, AL, FA, RA, MD, and VR were compared among the five different NDGDs. The DTI-FT with NDGD of 11, 15, 21, and 31 orientations gave better tracking results compared with NDGD of 6 after the visual evaluation. NF, FA, RA, MD, and VR values with NDGD of six were significantly greater (smallest p = 0.001 to largest p = 0.042) than those with four other NDGDs (11, 15, 21, or 31 orientations), whereas AL measured with NDGD of six was significantly smaller (smallest p = 0.001 to largest p = 0.041) than with four other NDGDs (11, 15, 21, or 31 orientations). No significant differences were observed in the results among the four NDGD groups of 11, 15, 21, and 31 directions (smallest p = 0.059 to largest p = 1.000). The main fiber tracts were detected with NDGD of six orientations; however, the use of larger NDGD (> or = 11 orientations) could provide improved tract characteristics at the expense of longer scanning time.

  10. Effect of increasing diffusion gradient direction number on diffusion tensor imaging fiber tracking in the human brain

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Xu Fang; Liang, Bie Bei; Xia, Tian; Huang, Qin Ming; Zhuang, Song Lin [School of Optical-Electrical and Computer Engineering, Shanghai Medical Instrument College, University of Shanghai for Science and Technology, Shanghai (China); Yu, Tong Gang [Dept. of Radiology, Huashan Hospital, Fudan University, Shanghai (China)

    2015-04-15

    To assess the effects of varying the number of diffusion gradient directions (NDGDs) on diffusion tensor fiber tracking (FT) in human brain white matter using tract characteristics. Twelve normal volunteers underwent diffusion tensor imaging (DTI) scanning with NDGDs of 6, 11, 15, 21, and 31 orientations. Three fiber tract groups, including the splenium of the corpus callosum (CC), the entire CC, and the full brain tract, were reconstructed by deterministic DTI-FT. Tract architecture was first qualitatively evaluated by visual observation. Six quantitative tract characteristics, including the number of fibers (NF), average length (AL), fractional anisotropy (FA), relative anisotropy (RA), mean diffusivity (MD), and volume ratio (VR) were measured for the splenium of the CC at the tract branch level, for the entire CC at tract level, and for the full brain tract at the whole brain level. Visual results and those of NF, AL, FA, RA, MD, and VR were compared among the five different NDGDs. The DTI-FT with NDGD of 11, 15, 21, and 31 orientations gave better tracking results compared with NDGD of 6 after the visual evaluation. NF, FA, RA, MD, and VR values with NDGD of six were significantly greater (smallest p = 0.001 to largest p = 0.042) than those with four other NDGDs (11, 15, 21, or 31 orientations), whereas AL measured with NDGD of six was significantly smaller (smallest p = 0.001 to largest p = 0.041) than with four other NDGDs (11, 15, 21, or 31 orientations). No significant differences were observed in the results among the four NDGD groups of 11, 15, 21, and 31 directions (smallest p = 0.059 to largest p = 1.000). The main fiber tracts were detected with NDGD of six orientations; however, the use of larger NDGD (> or = 11 orientations) could provide improved tract characteristics at the expense of longer scanning time.

  11. Is the surface oxygen exchange rate linked to bulk ion diffusivity in mixed conducting Ruddlesden-Popper phases?

    Science.gov (United States)

    Tomkiewicz, Alex C; Tamimi, Mazin A; Huq, Ashfia; McIntosh, Steven

    2015-01-01

    The possible link between oxygen surface exchange rate and bulk oxygen anion diffusivity in mixed ionic and electronic conducting oxides is a topic of great interest and debate. While a large body of experimental evidence and theoretical analyses support a link, observed differences between bulk and surface composition of these materials are hard to reconcile with this observation. This is further compounded by potential problems with simultaneous measurement of both parameters. Here we utilize separate techniques, in situ neutron diffraction and pulsed isotopic surface exchange, to examine bulk ion mobility and surface oxygen exchange rates of three Ruddlesden-Popper phases, general form A(n-1)A(2)'B(n)O(3n+1), A(n-1)A(2)'B(n)X(3n+1); LaSrCo(0.5)Fe(0.5)O(4-δ) (n = 1), La(0.3)Sr(2.7)CoFeO(7-δ) (n = 2) and LaSr3Co(1.5)Fe(1.5)O(10-δ) (n = 3). These measurements are complemented by surface composition determination via high sensitivity-low energy ion scattering. We observe a correlation between bulk ion mobility and surface exchange rate between materials. The surface exchange rates vary by more than one order of magnitude with high anion mobility in the bulk of an oxygen vacancy-rich n = 2 Ruddlesden-Popper material correlating with rapid oxygen exchange. This is in contrast with the similar surface exchange rates which we may expect due to similar surface compositions across all three samples. We conclude that experimental limitations lead to inherent convolution of surface and bulk rates, and that surface exchange steps are not likely to be rate limiting in oxygen incorporation.

  12. Effect of thermal tempering on microstructure and mechanical properties of Mg-AZ31/Al-6061 diffusion bonding

    Energy Technology Data Exchange (ETDEWEB)

    Jafarian, Mojtaba [Young Researchers and Elite Club, Science and Research Branch, Islamic Azad University, Tehran (Iran, Islamic Republic of); Rizi, Mohsen Saboktakin, E-mail: M.saboktakin@Pa.iut.ac.ir [Department of Materials Engineering, Isfahan University of Technology, Isfahan 8415683111 (Iran, Islamic Republic of); Department of Industrial Engineering, Lenjan Branch, Islamic Azad University, Isfahan (Iran, Islamic Republic of); Jafarian, Morteza [Young Researchers and Elite Club, Science and Research Branch, Islamic Azad University, Tehran (Iran, Islamic Republic of); Honarmand, Mehrdad [Department of Mechanical Engineering, Tiran Branch, Islamic Azad University, Isfahan (Iran, Islamic Republic of); Javadinejad, Hamid Reza; Ghaheri, Ali [Department of Materials Engineering, Isfahan University of Technology, Isfahan 8415683111 (Iran, Islamic Republic of); Department of Industrial Engineering, Lenjan Branch, Islamic Azad University, Isfahan (Iran, Islamic Republic of); Bahramipour, Mohammad Taghi [Materials Engineering Department, Hakim Sabzevari University, Sabzevar, 397 (Iran, Islamic Republic of); Ebrahimian, Marzieh [Department of Materials Engineering, Isfahan University of Technology, Isfahan 8415683111 (Iran, Islamic Republic of); Department of Industrial Engineering, Lenjan Branch, Islamic Azad University, Isfahan (Iran, Islamic Republic of)

    2016-06-01

    The objective of this study is to investigate the effect of the types thermal tempering of aluminum alloy on microstructure and mechanical properties of AZ31-O Mg and Al 6061-T6 diffusion bonding. Using Optical Microscope (OM) and Scanning Electron Microscopes (SEM) equipped with EDS analysis and line scan the interfaces of joints were evaluated. The XRD analysis was carried out to characterize phase constitution near the interface zone. The mechanical properties of joints were measured using Vickers micro-hardness and shear strength. According to the results in bonding of AZ31-Mg/Al-6061-O, in less plastic deformation in magnesium alloy, diffusion rate of most magnesium atoms occurred to aluminum alloy and formation of diffusion zone with minimum micro-hardness (140 HV) and maximum shear strength (32 MPa) compared to Al 6061-T6/Mg-AZ31 bonding. Evaluation of fracture surfaces indicates an occurrence of failure from the brittle intermetallic phases. - Highlights: • Diffusion bonding AZ31 to Al-6061withoutany interlayer was successful. • Thermal tempered aluminum alloy plays a vital role in the mechanical properties of joint. • Less thickness of reaction layers and micro-hardness in bonding annealed Al- 6061 layers to AZ31 was achieved. • Fracture surfaces indicated that the onset of fracture from intermetallic compounds resulted in fracture of the cleavage.

  13. Effect of thermal tempering on microstructure and mechanical properties of Mg-AZ31/Al-6061 diffusion bonding

    International Nuclear Information System (INIS)

    Jafarian, Mojtaba; Rizi, Mohsen Saboktakin; Jafarian, Morteza; Honarmand, Mehrdad; Javadinejad, Hamid Reza; Ghaheri, Ali; Bahramipour, Mohammad Taghi; Ebrahimian, Marzieh

    2016-01-01

    The objective of this study is to investigate the effect of the types thermal tempering of aluminum alloy on microstructure and mechanical properties of AZ31-O Mg and Al 6061-T6 diffusion bonding. Using Optical Microscope (OM) and Scanning Electron Microscopes (SEM) equipped with EDS analysis and line scan the interfaces of joints were evaluated. The XRD analysis was carried out to characterize phase constitution near the interface zone. The mechanical properties of joints were measured using Vickers micro-hardness and shear strength. According to the results in bonding of AZ31-Mg/Al-6061-O, in less plastic deformation in magnesium alloy, diffusion rate of most magnesium atoms occurred to aluminum alloy and formation of diffusion zone with minimum micro-hardness (140 HV) and maximum shear strength (32 MPa) compared to Al 6061-T6/Mg-AZ31 bonding. Evaluation of fracture surfaces indicates an occurrence of failure from the brittle intermetallic phases. - Highlights: • Diffusion bonding AZ31 to Al-6061withoutany interlayer was successful. • Thermal tempered aluminum alloy plays a vital role in the mechanical properties of joint. • Less thickness of reaction layers and micro-hardness in bonding annealed Al- 6061 layers to AZ31 was achieved. • Fracture surfaces indicated that the onset of fracture from intermetallic compounds resulted in fracture of the cleavage.

  14. Blackness coefficients, effective diffusion parameters, and control rod worths for thermal reactors - Methods

    Energy Technology Data Exchange (ETDEWEB)

    Bretscher, M M [Argonne National Laboratory, Argonne, IL 60439 (United States)

    1985-07-01

    Simple diffusion theory cannot be used to evaluate control rod worths in thermal neutron reactors because of the strongly absorbing character of the control material. However, reliable control rod worths can be obtained within the framework of diffusion theory if the control material is characterized by a set of mesh-dependent effective diffusion parameters. For thin slab absorbers the effective diffusion parameters can be expressed as functions of a suitably-defined pair of 'blackness coefficients'. Methods for calculating these blackness coefficients in the P1, P3, and P5 approximations, with and without scattering, are presented. For control elements whose geometry does not permit a thin slab treatment, other methods are needed for determining the effective diffusion parameters. One such method, based on reaction rate ratios, is discussed. (author)

  15. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.; Schwingenschlö gl, Udo; Dimoulas, Athanasios Dimoulas

    2012-01-01

    in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices

  16. Proximity effect and hot-electron diffusion in Ag/Al2O3/Al tunnel junctions

    International Nuclear Information System (INIS)

    Netel, H.; Jochum, J.; Labov, S.E.; Mears, C.A.; Frank, M.; Chow, D.; Lindeman, M.A.; Hiller, L.J.

    1997-01-01

    We have fabricated Ag/Al 2 O 3 /Al tunnel junctions on Si substrates using a new process. This process was developed to fabricate superconducting tunnel junctions (STJs) on the surface of a superconductor. These junctions allow us to study the proximity effect of a superconducting Al film on a normal metal trapping layer. In addition, these devices allow us to measure the hot-electron diffusion constant using a single junction. Lastly these devices will help us optimize the design and fabrication of tunnel junctions on the surface of high-Z, ultra-pure superconducting crystals. 5 refs., 8 figs

  17. Assessment of the numerical diffusion effect in the advection of a passive tracer in BOLCHEM

    International Nuclear Information System (INIS)

    D'Isidoro, M.; Tiesi, A.

    2005-01-01

    The effects of the numerical scheme implemented in the advection equation of BOLCHEM have been quantified with reference to the diffusion of a passive tracer. An equivalent horizontal diffusion coefficient has been measured and is found to be dependent on wind field and resolution

  18. The Hot Horizontal-Branch Stars in NGC288 - Effects of Diffusion and Stratification on Their Atmospheric Parameters*

    Science.gov (United States)

    Moehler, S.; Dreizler, S.; LeBlanc, F.; Khalack, V.; Michaud, G.; Richer, J.; Sweigart, Allen V.; Grundahl, F.

    2014-01-01

    Context. NGC288 is a globular cluster with a well developed blue horizontal branch covering the so-called u-jump which indicates the onset of diffusion. It is therefore well suited to study the effects of diffusion in blue horizontal branch (HB) stars. Aims. We compare observed abundances to predictions from stellar evolution models calculated with diffusion and from stratified atmospheric models. We verify the effect of using stratified model spectra to derive atmospheric parameters. In addition we investigate the nature of the overluminous blue HB stars around the u-jump. Methods. We define a new photometric index sz from uvby measurements that is gravity sensitive between 8 000K and 12 000 K. Using medium-resolution spectra and Stroemgren photometry we determine atmospheric parameters (Teff, logg) and abundances for the blue HB stars. We use both homogeneous and stratified model spectra for our spectroscopic analyses. Results. The atmospheric parameters and masses of the hot HB stars in NGC288 show a behaviour seen also in other clusters for temperatures between 9 000K and 14 000 K. Outside this temperature range, however, they follow rather the results found for such stars in (omega)Cen. The abundances derived from our observations are for most elements (except He and P) within the abundance range expected from evolutionary models that include the effects of atomic diffusion and assume a surface mixed mass of 10(exp -7) M. The abundances predicted by stratified model atmospheres are generally significantly more extreme than observed, except for Mg. The use of stratified model spectra to determine effective temperatures, surface gravities and masses moves the hotter stars to a closer agreement with canonical evolutionary predictions. Conclusions. Our results show definite promise towards solving the long-standing issue of surface gravity and mass discrepancies for hot HB stars, but there is still much work needed to arrive at a self-consistent solution.

  19. Fractional diffusion equations and anomalous diffusion

    CERN Document Server

    Evangelista, Luiz Roberto

    2018-01-01

    Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.

  20. Effects of rational surface density on resistive g turbulence

    International Nuclear Information System (INIS)

    Beklemishev, A.D.; Sugama, H.; Horton, W.

    1993-01-01

    The Beklemishev-Horton theory states that the anomalous transport coefficient is proportional to the density of rational surfaces provided that the interaction between the modes localized around different rational surfaces is weak compared with modes of the same helicity. The authors examine the effects of the density of states ρ using resistive g turbulence in 2D (single-helicity) and 3D (multi-helicity) simulations. They find that the modes with different helicities do not equipartition the available energy, but rather the coalescence or inverse cascade effect is strong so that a few low order mode rational surfaces receive most of the energy. The quasilinear flattening at the surfaces is a strong effect and they use bifurcation theory to derive that the effective diffusivity increases as χ eff = χ 0 ρ/(1 - Cρ) where C is a constant determined by interaction integrals. For a sufficiently high density of states Cρ ≤ 1, the higher order nonlinear interaction must be taken into account

  1. Diffusion coefficients-surface and interfacial tensions - Particular study of some lauryl compounds

    International Nuclear Information System (INIS)

    Morel, Jean-Emile

    1969-01-01

    Two important results of the double lipophilic and hydrophilic character of some heavy organic compounds with a polar group at the end of the chain, were studied: - In a first part, molecular diffusion coefficients were measured in order to prove the micellar aggregation of tri-laurylammonium nitrate in some organic solutions; - In a second part, the tensioactivity of some lauryl compounds (lauric acid, lauric alcohol, mono-laurylamine, etc.), was studied. (author) [fr

  2. Reflection Matrix Method for Controlling Light After Reflection From a Diffuse Scattering Surface

    Science.gov (United States)

    2016-12-22

    of Philosophy Kenneth W. Burgi, BS, MS Major, USAF 22 December 2016 DISTRIBUTION STATEMENT A APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AFIT...refocusing light through thin films of a turbid medium. When coherent light is trans- mitted through a stationary diffuser (i.e. a turbid medium), a fine...resultant light scatter [14, 15, 21, 23]. Transmission matrices were measured with microscopic objectives and thin films of turbid media, resulting in

  3. The effects of diffusion in hot subdwarf progenitors from the common envelope channel

    Science.gov (United States)

    Byrne, Conor M.; Jeffery, C. Simon; Tout, Christopher A.; Hu, Haili

    2018-04-01

    Diffusion of elements in the atmosphere and envelope of a star can drastically alter its surface composition, leading to extreme chemical peculiarities. We consider the case of hot subdwarfs, where surface helium abundances range from practically zero to almost 100 percent. Since hot subdwarfs can form via a number of different evolution channels, a key question concerns how the formation mechanism is connected to the present surface chemistry. A sequence of extreme horizontal branch star models was generated by producing post-common envelope stars from red giants. Evolution was computed with MESA from envelope ejection up to core-helium ignition. Surface abundances were calculated at the zero-age horizontal branch for models with and without diffusion. A number of simulations also included radiative levitation. The goal was to study surface chemistry during evolution from cool giant to hot subdwarf and determine when the characteristic subdwarf surface is established. Only stars leaving the giant branch close to core-helium ignition become hydrogen-rich subdwarfs at the zero-age horizontal branch. Diffusion, including radiative levitation, depletes the initial surface helium in all cases. All subdwarf models rapidly become more depleted than observations allow. Surface abundances of other elements follow observed trends in general, but not in detail. Additional physics is required.

  4. Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study

    Science.gov (United States)

    Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.

    2017-08-01

    We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.

  5. The dilution effect on the extinction of wall diffusion flame

    Directory of Open Access Journals (Sweden)

    Ghiti Nadjib

    2014-12-01

    Full Text Available The dynamic process of the interaction between a turbulent jet diffusion methane flame and a lateral wall was experimentally studied. The evolution of the flame temperature field with the Nitrogen dilution of the methane jet flame was examined. The interaction between the diffusion flame and the lateral wall was investigated for different distance between the wall and the central axes of the jet flame. The dilution is found to play the central role in the flame extinction process. The flame response as the lateral wall approaches from infinity and the increasing of the dilution rate make the flame extinction more rapid than the flame without dilution, when the nitrogen dilution rate increase the flame temperature decrease.

  6. The effect of thickness in the through-diffusion experiment

    International Nuclear Information System (INIS)

    Lehikoinen, J.; Uusheimo, K.; Valkiainen, M.

    1994-01-01

    The publication contains an experimental study of diffusion in the water filled pores of rock samples. The samples studied are rapakivi granite from Loviisa, southern Finland. The drill-core sample was sectioned perpendicularly with diamond saw and three cylinder formed samples were obtained. The nominal thicknesses (heights of the cylinders) are 2, 4 and 6 cm. For the diffusion measurement the sample holders were pressed between two chambers. One of the chambers was filled with 0.0044 molar sodium chloride solution spiked with tracers. Another chamber was filled with inactive solution. Tritium (HTO) considered to be water equivalent tracer and anionic 36 Cl were used as tracers. (9 refs., 19 figs., 2 tabs.)

  7. Non-kinematic Flux-transport Dynamos Including the Effects of Diffusivity Quenching

    Energy Technology Data Exchange (ETDEWEB)

    Ichimura, Chiaki; Yokoyama, Takaaki [Department of Earth and Planetary Science, The University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan)

    2017-04-10

    Turbulent magnetic diffusivity is quenched when strong magnetic fields suppress turbulent motion in a phenomenon known as diffusivity quenching. Diffusivity quenching can provide a mechanism for amplifying magnetic field and influencing global velocity fields through Lorentz force feedback. To investigate this effect, we conducted mean field flux-transport dynamo simulations that included the effects of diffusivity quenching in a non-kinematic regime. We found that toroidal magnetic field strength is amplified by up to approximately 1.5 times in the convection zone as a result of diffusivity quenching. This amplification is much weaker than that in kinematic cases as a result of Lorentz force feedback on the system’s differential rotation. While amplified toroidal fields lead to the suppression of equatorward meridional flow locally near the base of the convection zone, large-scale equatorward transport of magnetic flux via meridional flow, which is the essential process of the flux-transport dynamo, is sustainable in our calculations.

  8. Convection-diffusion effects in marathon race dynamics

    Science.gov (United States)

    Rodriguez, E.; Espinosa-Paredes, G.; Alvarez-Ramirez, J.

    2014-01-01

    In the face of the recent terrorist attack event on the 2013 Boston Marathon, the increasing participation of recreational runners in large marathon races has imposed important logistical and safety issues for organizers and city authorities. An accurate understanding of the dynamics of the marathon pack along the race course can provide important insights for improving safety and performance of these events. On the other hand, marathon races can be seen as a model of pedestrian movement under confined conditions. This work used data of the 2011 Chicago Marathon event for modeling the dynamics of the marathon pack from the corral zone to the finish line. By considering the marathon pack as a set of particles moving along the race course, the dynamics are modeled as a convection-diffusion partial differential equation with position-dependent mean velocity and diffusion coefficient. A least-squares problem is posed and solved with optimization techniques for fitting field data from the 2011 Chicago Marathon. It was obtained that the mean pack velocity decreases while the diffusion coefficient increases with distance. This means that the dispersion rate of the initially compact marathon pack increases as the marathon race evolves along the race course.

  9. On matrix diffusion: formulations, solution methods and qualitative effects

    Science.gov (United States)

    Carrera, Jesús; Sánchez-Vila, Xavier; Benet, Inmaculada; Medina, Agustín; Galarza, Germán; Guimerà, Jordi

    Matrix diffusion has become widely recognized as an important transport mechanism. Unfortunately, accounting for matrix diffusion complicates solute-transport simulations. This problem has led to simplified formulations, partly motivated by the solution method. As a result, some confusion has been generated about how to properly pose the problem. One of the objectives of this work is to find some unity among existing formulations and solution methods. In doing so, some asymptotic properties of matrix diffusion are derived. Specifically, early-time behavior (short tests) depends only on φm2RmDm / Lm2, whereas late-time behavior (long tracer tests) depends only on φmRm, and not on matrix diffusion coefficient or block size and shape. The latter is always true for mean arrival time. These properties help in: (a) analyzing the qualitative behavior of matrix diffusion; (b) explaining one paradox of solute transport through fractured rocks (the apparent dependence of porosity on travel time); (c) discriminating between matrix diffusion and other problems (such as kinetic sorption or heterogeneity); and (d) describing identifiability problems and ways to overcome them. RésuméLa diffusion matricielle est un phénomène reconnu maintenant comme un mécanisme de transport important. Malheureusement, la prise en compte de la diffusion matricielle complique la simulation du transport de soluté. Ce problème a conduit à des formulations simplifiées, en partie à cause de la méthode de résolution. Il s'en est suivi une certaine confusion sur la façon de poser correctement le problème. L'un des objectifs de ce travail est de trouver une certaine unité parmi les formulations et les méthodes de résolution. C'est ainsi que certaines propriétés asymptotiques de la diffusion matricielle ont été dérivées. En particulier, le comportement à l'origine (expériences de traçage courtes) dépend uniquement du terme φm2RmDm / Lm2, alors que le comportement à long terme

  10. Surface-based reconstruction and diffusion MRI in the assessment of gray and white matter damage in multiple sclerosis

    Science.gov (United States)

    Caffini, Matteo; Bergsland, Niels; LaganÃ, Marcella; Tavazzi, Eleonora; Tortorella, Paola; Rovaris, Marco; Baselli, Giuseppe

    2014-03-01

    Despite advances in the application of nonconventional MRI techniques in furthering the understanding of multiple sclerosis pathogenic mechanisms, there are still many unanswered questions, such as the relationship between gray and white matter damage. We applied a combination of advanced surface-based reconstruction and diffusion tensor imaging techniques to address this issue. We found significant relationships between white matter tract integrity indices and corresponding cortical structures. Our results suggest a direct link between damage in white and gray matter and contribute to the notion of gray matter loss relating to clinical disability.

  11. Development of Surfaces Optically Suitable for Flat Solar Panels. [using a reflectometer which separately evaluates spectral and diffuse reflectivities of surfaces

    Science.gov (United States)

    1979-01-01

    A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.

  12. Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

    International Nuclear Information System (INIS)

    Kutovyi, V.A.; Komir, A.I.

    2013-01-01

    The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

  13. Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Lawrenz, M.

    2007-10-30

    In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

  14. Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

    Science.gov (United States)

    Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

    2018-01-01

    Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

  15. Off-lattice self-learning kinetic Monte Carlo: application to 2D cluster diffusion on the fcc(111) surface

    International Nuclear Information System (INIS)

    Kara, Abdelkader; Yildirim, Handan; Rahman, Talat S; Trushin, Oleg

    2009-01-01

    We report developments of the kinetic Monte Carlo (KMC) method with improved accuracy and increased versatility for the description of atomic diffusivity on metal surfaces. The on-lattice constraint built into our recently proposed self-learning KMC (SLKMC) (Trushin et al 2005 Phys. Rev. B 72 115401) is released, leaving atoms free to occupy 'off-lattice' positions to accommodate several processes responsible for small-cluster diffusion, periphery atom motion and heteroepitaxial growth. This technique combines the ideas embedded in the SLKMC method with a new pattern-recognition scheme fitted to an off-lattice model in which relative atomic positions are used to characterize and store configurations. Application of a combination of the 'drag' and the repulsive bias potential (RBP) methods for saddle point searches allows the treatment of concerted cluster, and multiple- and single-atom, motions on an equal footing. This tandem approach has helped reveal several new atomic mechanisms which contribute to cluster migration. We present applications of this off-lattice SLKMC to the diffusion of 2D islands of Cu (containing 2-30 atoms) on Cu and Ag(111), using the interatomic potential from the embedded-atom method. For the hetero-system Cu/Ag(111), this technique has uncovered mechanisms involving concerted motions such as shear, breathing and commensurate-incommensurate occupancies. Although the technique introduces complexities in storage and retrieval, it does not introduce noticeable extra computational cost.

  16. Photoluminescence studies of organic phosphor coated diffusing surface using blue inorganic light-emitting diode as excitation source

    International Nuclear Information System (INIS)

    Singh, Gyanendra; Mehta, Dalip Singh

    2013-01-01

    We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)

  17. Materials and proportion's design of self-compacting mortar used for low diffusion layer in sub-surface radioactive waste disposal facility in Japan

    International Nuclear Information System (INIS)

    Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu

    2010-01-01

    This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)

  18. Stress in film/substrate system due to diffusion and thermal misfit effects

    International Nuclear Information System (INIS)

    Shao Shanshan; Xuan Fuzhen; Wang Zhengdong; Tu Shantung

    2009-01-01

    The stress in film/substrate systems has been analysed taking into consideration the coupling effects of diffusion and thermal misfit within the framework of Fick's second law. The solution of diffusion-induced stress in a film/substrate system involving the thermal misfit stress feedback is developed. The effects of modulus ratios, diffusivity ratios, thickness ratios of the substrate and the film and the partial molar volume of the diffusing component on the stress distribution in the film/substrate system are then discussed with the help of the finite difference method. Results indicate that the stresses in the film/substrate system vary with diffusion time. Diffusion enhances the magnitudes of film stress when the thermal misfit stress is compressive in the film. Furthermore, the absolute values of stress in the film increase with the increasing modulus ratios of the substrate and film, while they reduce with the increasing partial molar volume of the diffusing component and the diffusivity ratio of the substrate and the film.

  19. Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

    Science.gov (United States)

    Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

    2016-03-01

    Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

  20. Analysis of effective diffusivity of cement based materials by multi-scale modelling

    International Nuclear Information System (INIS)

    Dridi, Wissem

    2013-01-01

    This paper presents a simplified composite model, which considers the contribution of each phase participating to the transport within OPC pastes and concretes. At the micrometer scale, the phases considered hereafter are capillary porosity (macro-porosity) and the Low Density and the High Density C-S-H both containing gel pores (nano-porosity). Predicted values of tritiated water (HTO) diffusivity in OPC pastes with various (w/c) ratios are confronted to experimental results with a good agreement. The approach is then extended to mortars and concretes scale where microstructure is described by a three phase composite sphere assemblage. Here, elementary phase distribution is assumed to change as a function of distance from aggregate surface. Model results about HTO diffusivities of mortars and concretes are presented with some experimental values. The competition between the more diffusing ITZ zone and the less diffusing bulk matrix is investigated from a sensitive analysis. The dominance of the ITZ control is confirmed. (authors)

  1. Surface effects of underground nuclear explosions

    Energy Technology Data Exchange (ETDEWEB)

    Allen, B.M.; Drellack, S.L. Jr.; Townsend, M.J.

    1997-06-01

    The effects of nuclear explosions have been observed and studied since the first nuclear test (code named Trinity) on July 16, 1945. Since that first detonation, 1,053 nuclear tests have been conducted by the US, most of which were sited underground at the Nevada Test Site (NTS). The effects of underground nuclear explosions (UNEs) on their surroundings have long been the object of much interest and study, especially for containment, engineering, and treaty verification purposes. One aspect of these explosion-induced phenomena is the disruption or alteration of the near-surface environment, also known as surface effects. This report was prepared at the request of the Los Alamos National Laboratory (LANL), to bring together, correlate, and preserve information and techniques used in the recognition and documentation of surface effects of UNEs. This report has several main sections, including pertinent background information (Section 2.0), descriptions of the different types of surface effects (Section 3.0), discussion of their application and limitations (Section 4.0), an extensive bibliography and glossary (Section 6.0 and Appendix A), and procedures used to document geologic surface effects at the NTS (Appendix C). Because a majority of US surface-effects experience is from the NTS, an overview of pertinent NTS-specific information also is provided in Appendix B. It is not within the scope of this report to explore new relationships among test parameters, physiographic setting, and the types or degree of manifestation of surface effects, but rather to compile, summarize, and capture surface-effects observations and interpretations, as well as documentation procedures and the rationale behind them.

  2. Spin Hall effect by surface roughness

    KAUST Repository

    Zhou, Lingjun; Grigoryan, Vahram L.; Maekawa, Sadamichi; Wang, Xuhui; Xiao, Jiang

    2015-01-01

    induced by surface roughness subscribes only to the side-jump contribution but not the skew scattering. The paradigm proposed in this paper provides the second, not if only, alternative to generate a sizable spin Hall effect.

  3. The impact of changes in parameterizations of surface drag and vertical diffusion on the large-scale circulation in the Community Atmosphere Model (CAM5)

    Science.gov (United States)

    Lindvall, Jenny; Svensson, Gunilla; Caballero, Rodrigo

    2017-06-01

    Simulations with the Community Atmosphere Model version 5 (CAM5) are used to analyze the sensitivity of the large-scale circulation to changes in parameterizations of orographic surface drag and vertical diffusion. Many GCMs and NWP models use enhanced turbulent mixing in stable conditions to improve simulations, while CAM5 cuts off all turbulence at high stabilities and instead employs a strong orographic surface stress parameterization, known as turbulent mountain stress (TMS). TMS completely dominates the surface stress over land and reduces the near-surface wind speeds compared to simulations without TMS. It is found that TMS is generally beneficial for the large-scale circulation as it improves zonal wind speeds, Arctic sea level pressure and zonal anomalies of the 500-hPa stream function, compared to ERA-Interim. It also alleviates atmospheric blocking frequency biases in the Northern Hemisphere. Using a scheme that instead allows for a modest increase of turbulent diffusion at higher stabilities only in the planetary boundary layer (PBL) appears to in some aspects have a similar, although much smaller, beneficial effect as TMS. Enhanced mixing throughout the atmospheric column, however, degrades the CAM5 simulation. Evaluating the simulations in comparison with detailed measurements at two locations reveals that TMS is detrimental for the PBL at the flat grassland ARM Southern Great Plains site, giving too strong wind turning and too deep PBLs. At the Sodankylä forest site, the effect of TMS is smaller due to the larger local vegetation roughness. At both sites, all simulations substantially overestimate the boundary layer ageostrophic flow.

  4. Diffusion Influenced Adsorption Kinetics.

    Science.gov (United States)

    Miura, Toshiaki; Seki, Kazuhiko

    2015-08-27

    When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

  5. Carbon surface diffusion and SiC nanocluster self-ordering

    International Nuclear Information System (INIS)

    Pezoldt, J.; Trushin, Yu.V.; Kharlamov, V.S.; Schmidt, A.A.; Cimalla, V.; Ambacher, O.

    2006-01-01

    The process of the spatial ordering of SiC nanoclusters on the step edges on Si surfaces was studied by means of multi-scale computer simulation. The evolution of cluster arrays on an ideal flat surface and surfaces with terraces of various widths was performed by kinetic Monte Carlo (KMC) simulations based on quantitative studies of potential energy surfaces (PES) by molecular dynamics (MD). PES analysis revealed that certain types of steps act as strong trapping centres for both Si and C adatoms stimulating clusters nucleation. Spatial ordering of the SiC nanoclusters at the terrace edges can be achieved if the parameters of the growth process (substrate temperature, carbon flux) and substrate (steps direction and terrace widths) are adjusted to the surface morphology. Temperature ranges for growth regimes with and without formation of cluster chains were determined. Cluster size distributions and the dependence of optimal terrace width for self ordering on the deposition parameters were obtained

  6. Effect of Low Frequency Burner Vibrations on the Characteristics of Jet Diffusion Flames

    Directory of Open Access Journals (Sweden)

    C. Kanthasamy

    2012-03-01

    Full Text Available Mechanical vibrations introduced in diffusion flame burners significantly affect the flame characteristics. In this experimental study, the effects of axial vibrations on the characteristics of laminar diffusion flames are investigated systematically. The effect of the frequency and amplitude of the vibrations on the flame height oscillations and flame stability is brought out. The amplitude of flame height oscillations is found to increase with increase in both frequency and amplitude of burner vibrations. Vibrations are shown to enhance stability of diffusion flames. Although flame lifts-off sooner with vibrations, stability of the flame increases.

  7. Strain rate effect on sooting characteristics in laminar counterflow diffusion flames

    KAUST Repository

    Wang, Yu; Chung, Suk-Ho

    2016-01-01

    The effects of strain rate, oxygen enrichment and fuel type on the sooting characteristics of counterflow diffusion flames were studied. The sooting structures and relative PAH concentrations were measured with laser diagnostics. Detailed soot

  8. Simultaneous Retrieval of Aerosol and Surface Optical Properties from Combined Airborne- and Ground-Based Direct and Diffuse Radiometric Measurements

    Science.gov (United States)

    Gatebe, C. K.; Dubovik, O.; King, M. D.; Sinyuk, A.

    2010-01-01

    This paper presents a new method for simultaneously retrieving aerosol and surface reflectance properties from combined airborne and ground-based direct and diffuse radiometric measurements. The method is based on the standard Aerosol Robotic Network (AERONET) method for retrieving aerosol size distribution, complex index of refraction, and single scattering albedo, but modified to retrieve aerosol properties in two layers, below and above the aircraft, and parameters on surface optical properties from combined datasets (Cloud Absorption Radiometer (CAR) and AERONET data). A key advantage of this method is the inversion of all available spectral and angular data at the same time, while accounting for the influence of noise in the inversion procedure using statistical optimization. The wide spectral (0.34-2.30 m) and angular range (180 ) of the CAR instrument, combined with observations from an AERONET sunphotometer, provide sufficient measurement constraints for characterizing aerosol and surface properties with minimal assumptions. The robustness of the method was tested on observations made during four different field campaigns: (a) the Southern African Regional Science Initiative 2000 over Mongu, Zambia, (b) the Intercontinental Transport Experiment-Phase B over Mexico City, Mexico (c) Cloud and Land Surface Interaction Campaign over the Atmospheric Radiation Measurement (ARM) Central Facility, Oklahoma, USA, and (d) the Arctic Research of the Composition of the Troposphere from Aircraft and Satellites (ARCTAS) over Elson Lagoon in Barrow, Alaska, USA. The four areas are dominated by different surface characteristics and aerosol types, and therefore provide good test cases for the new inversion method.

  9. On the effective diffusivity of gases in PEM fuel cell electrodes

    International Nuclear Information System (INIS)

    Karan, K.; Pharoah, J.G.

    2004-01-01

    'Full text:' Gas diffusion layer of polymer electrolyte membrane fuel cells (PEMFCs) play a critically important and multiple role as reactant gas distributor, medium for electron and water transport. The most commonly used GDL material is either carbon cloth or carbon paper. Scanning electron microscopic analysis reveals that the GDL microstructure resembles the structure of randomly laid out fibres. Almost all publications on PEMFC models have treated diffusive transport of chemical species through the porous gas diffusion layer (GDL) using correlations originally derived for isotropic granular porous media. Unfortunately, the GDL microstructure does not resemble such a structure. This paper questions the validity of effective diffusivity models used in PEMFC literature and shows that the choice of diffusivity model has significant impact on the prediction of local species fluxes and composition, and consequently on local current densities. (author)

  10. Temperature effects on diffusion coefficient for 6-gingerol and 6-shogaol in subcritical water extraction

    Science.gov (United States)

    Ilia Anisa, Nor; Azian, Noor; Sharizan, Mohd; Iwai, Yoshio

    2014-04-01

    6-gingerol and 6-shogaol are the main constituents as anti-inflammatory or bioactive compounds from zingiber officinale Roscoe. These bioactive compounds have been proven for inflammatory disease, antioxidatives and anticancer. The effect of temperature on diffusion coefficient for 6-gingerol and 6-shogaol were studied in subcritical water extraction. The diffusion coefficient was determined by Fick's second law. By neglecting external mass transfer and solid particle in spherical form, a linear portion of Ln (1-(Ct/Co)) versus time was plotted in determining the diffusion coefficient. 6-gingerol obtained the higher yield at 130°C with diffusion coefficient of 8.582x10-11 m2/s whilst for 6-shogaol, the higher yield and diffusion coefficient at 170°C and 19.417 × 10-11 m2/s.

  11. Temperature effects on diffusion coefficient for 6-gingerol and 6-shogaol in subcritical water extraction

    International Nuclear Information System (INIS)

    Anisa, Nor Ilia; Azian, Noor; Sharizan, Mohd; Iwai, Yoshio

    2014-01-01

    6-gingerol and 6-shogaol are the main constituents as anti-inflammatory or bioactive compounds from zingiber officinale Roscoe. These bioactive compounds have been proven for inflammatory disease, antioxidatives and anticancer. The effect of temperature on diffusion coefficient for 6-gingerol and 6-shogaol were studied in subcritical water extraction. The diffusion coefficient was determined by Fick's second law. By neglecting external mass transfer and solid particle in spherical form, a linear portion of Ln (1-(Ct/Co)) versus time was plotted in determining the diffusion coefficient. 6-gingerol obtained the higher yield at 130°C with diffusion coefficient of 8.582x10 −11 m 2 /s whilst for 6-shogaol, the higher yield and diffusion coefficient at 170°C and 19.417 × 10 −11 m 2 /s.

  12. Spin Hall effect by surface roughness

    KAUST Repository

    Zhou, Lingjun

    2015-01-08

    The spin Hall and its inverse effects, driven by the spin orbit interaction, provide an interconversion mechanism between spin and charge currents. Since the spin Hall effect generates and manipulates spin current electrically, to achieve a large effect is becoming an important topic in both academia and industries. So far, materials with heavy elements carrying a strong spin orbit interaction, provide the only option. We propose here a new mechanism, using the surface roughness in ultrathin films, to enhance the spin Hall effect without heavy elements. Our analysis based on Cu and Al thin films suggests that surface roughness is capable of driving a spin Hall angle that is comparable to that in bulk Au. We also demonstrate that the spin Hall effect induced by surface roughness subscribes only to the side-jump contribution but not the skew scattering. The paradigm proposed in this paper provides the second, not if only, alternative to generate a sizable spin Hall effect.

  13. An integrated field-effect microdevice for monitoring membrane transport in Xenopus laevis oocytes via lateral proton diffusion.

    Directory of Open Access Journals (Sweden)

    Daniel Felix Schaffhauser

    Full Text Available An integrated microdevice for measuring proton-dependent membrane activity at the surface of Xenopus laevis oocytes is presented. By establishing a stable contact between the oocyte vitelline membrane and an ion-sensitive field-effect (ISFET sensor inside a microperfusion channel, changes in surface pH that are hypothesized to result from facilitated proton lateral diffusion along the membrane were detected. The solute diffusion barrier created between the sensor and the active membrane area allowed detection of surface proton concentration free from interference of solutes in bulk solution. The proposed sensor mechanism was verified by heterologously expressing membrane transport proteins and recording changes in surface pH during application of the specific substrates. Experiments conducted on two families of phosphate-sodium cotransporters (SLC20 & SLC34 demonstrated that it is possible to detect phosphate transport for both electrogenic and electroneutral isoforms and distinguish between transport of different phosphate species. Furthermore, the transport activity of the proton/amino acid cotransporter PAT1 assayed using conventional whole cell electrophysiology correlated well with changes in surface pH, confirming the ability of the system to detect activity proportional to expression level.

  14. Evaluation of water, sucrose and minerals effective diffusivities during osmotic treatment of pork in sugar beet molasses

    Directory of Open Access Journals (Sweden)

    Nićetin Milica R.

    2015-01-01

    Full Text Available Effective diffusivities of water, sucrose and minerals in osmotic treatment of pork cubes (M. triceps brachii were calculated using Response Surface Methodology (RSM, with respect to temperature (20, 35 and 50oC and concentration of sugar beet molasses, (60, 70 and 80% w/w. The numerical solution of Fick's' law for unsteady-state mass transfer in a perfect cube configuration was used to calculate the effective diffusivities of water, sucrose and minerals (Na, K, Ca and Mg. Zugarramurdi and Lupin's model was used to predict the equilibrium condition, which was shown to be appropriate for water loss and solute uptake during osmotic treatment. Effective diffusivity of water was found to be in the range of 6.95×10-10 - 8.03×10-10 m2s-1, the sucrose effective diffusivity was between 6.39×10-10 and 8.25×10-10 m2s-1, while diffusivities for minerals were in the range 6.34×10-10 - 8.82×10-10 m2s-1, for Na, 6.27×10-10 - 7.43×10-10 m2s-1, for K, 6.44×10-10 - 8.94×10-10 m2s-1, for Ca and 3.47×10-10 - 5.66×10-10 m2s-1, for Mg. [Projekat Ministarstva nauke Republike Srbije, br. TR 31055

  15. Effects of variable thermal diffusivity on the structure of convection

    Science.gov (United States)

    Shcheritsa, O. V.; Getling, A. V.; Mazhorova, O. S.

    2018-03-01

    The structure of multiscale convection in a thermally stratified plane horizontal fluid layer is investigated by means of numerical simulations. The thermal diffusivity is assumed to produce a thin boundary sublayer convectively much more unstable than the bulk of the layer. The simulated flow is a superposition of cellular structures with three different characteristic scales. In contrast to the largest convection cells, the smaller ones are localised in the upper portion of the layer. The smallest cells are advected by the larger-scale convective flows. The simulated flow pattern qualitatively resembles that observed on the Sun.

  16. Effects of differential mobility on biased diffusion of two species

    International Nuclear Information System (INIS)

    Hipolito, R S; Zia, R K P; Schmittmann, B

    2003-01-01

    Using simulations and a simple mean-field theory, we investigate jamming transitions in a two-species lattice gas under non-equilibrium steady-state conditions. The two types of particles diffuse with different mobilities on a square lattice, subject to an excluded volume constraint and biased in opposite directions. Varying filling fraction, differential mobility and drive, we map out the phase diagram, identifying first order and continuous transitions between a free-flowing disordered and a spatially inhomogeneous jammed phase. Ordered structures are observed to drift, with a characteristic velocity, in the direction of the more mobile species

  17. Spectral Dependent Degradation of the Solar Diffuser on Suomi-NPP VIIRS Due to Surface Roughness-Induced Rayleigh Scattering

    Directory of Open Access Journals (Sweden)

    Xi Shao

    2016-03-01

    Full Text Available The Visible Infrared Imaging Radiometer Suite (VIIRS onboard Suomi National Polar Orbiting Partnership (SNPP uses a solar diffuser (SD as its radiometric calibrator for the reflective solar band calibration. The SD is made of Spectralon™ (one type of fluoropolymer and was chosen because of its controlled reflectance in the Visible/Near-Infrared/Shortwave-Infrared region and its near-Lambertian reflectance property. On-orbit changes in VIIRS SD reflectance as monitored by the Solar Diffuser Stability Monitor showed faster degradation of SD reflectance for 0.4 to 0.6 µm channels than the longer wavelength channels. Analysis of VIIRS SD reflectance data show that the spectral dependent degradation of SD reflectance in short wavelength can be explained with a SD Surface Roughness (length scale << wavelength based Rayleigh Scattering (SRRS model due to exposure to solar UV radiation and energetic particles. The characteristic length parameter of the SD surface roughness is derived from the long term reflectance data of the VIIRS SD and it changes at approximately the tens of nanometers level over the operational period of VIIRS. This estimated roughness length scale is consistent with the experimental result from radiation exposure of a fluoropolymer sample and validates the applicability of the Rayleigh scattering-based model. The model is also applicable to explaining the spectral dependent degradation of the SDs on other satellites. This novel approach allows us to better understand the physical processes of the SD degradation, and is complementary to previous mathematics based models.

  18. Effects of high-dose hydrogen implantation on defect formation and dopant diffusion in silver implanted ZnO crystals

    Energy Technology Data Exchange (ETDEWEB)

    Yaqoob, Faisal [Department of Physics, State University of New York at Albany, Albany, New York 12222 (United States); Huang, Mengbing, E-mail: mhuang@sunypoly.edu [College of Nanoscale Science and Engineering, State University of New York Polytechnic Institute, Albany, New York 12203 (United States)

    2016-07-28

    This work reports on the effects of a deep high-dose hydrogen ion implant on damage accumulation, defect retention, and silver diffusion in silver implanted ZnO crystals. Single-crystal ZnO samples were implanted with Ag ions in a region ∼150 nm within the surface, and some of these samples were additionally implanted with hydrogen ions to a dose of 2 × 10{sup 16 }cm{sup −2}, close to the depth ∼250 nm. Rutherford backscattering/ion channeling measurements show that crystal damage caused by Ag ion implantation and the amount of defects retained in the near surface region following post-implantation annealing were found to diminish in the case with the H implantation. On the other hand, the additional H ion implantation resulted in a reduction of substitutional Ag atoms upon post-implantation annealing. Furthermore, the presence of H also modified the diffusion properties of Ag atoms in ZnO. We discuss these findings in the context of the effects of nano-cavities on formation and annihilation of point defects as well as on impurity diffusion and trapping in ZnO crystals.

  19. Effects of ion sputtering on semiconductor surfaces

    International Nuclear Information System (INIS)

    McGuire, G.E.

    1978-01-01

    Ion beam sputtering has been combined with Auger spectroscopy to study the effects of ion beams on semiconductor surfaces. Observations on the mass dependence of ion selective sputtering of two component systems are presented. The effects of ion implantation are explained in terms of atomic dilution. Experimental data are presented that illustrate the super-position of selective sputtering and implantation effects on the surface composition. Sample reduction from electron and ion beam interaction is illustrated. Apparent sample changes which one might observe from the effects of residual gas contamination and electric fields are also discussed. (Auth.)

  20. FIELD-SCALE EFFECTIVE MATRIX DIFFUSION COEFFICIENT FOR FRACTURED ROCK: RESULTS FROM LITERATURE SURVEY

    International Nuclear Information System (INIS)

    Zhou, Q.; Hui-Hai Liu; Molz, F.J.; Zhang, Y.; Bodvarsson, G.S.

    2005-01-01

    Matrix diffusion is an important mechanism for solute transport in fractured rock. We recently conducted a literature survey on the effective matrix diffusion coefficient, D m e , a key parameter for describing matrix diffusion processes at the field scale. Forty field tracer tests at 15 fractured geologic sites were surveyed and selected for the study, based on data availability and quality. Field-scale D m e values were calculated, either directly using data reported in the literature or by reanalyzing the corresponding field tracer tests. Surveyed data indicate that the effective-matrix-diffusion-coefficient factor F D (defined as the ratio of D m e to the lab-scale matrix diffusion coefficient [D m ] of the same tracer) is generally larger than one, indicating that the effective matrix diffusion coefficient in the field is comparatively larger than the matrix diffusion coefficient at the rock-core scale. This larger value can be attributed to the many mass-transfer processes at different scales in naturally heterogeneous, fractured rock systems. Furthermore, we observed a moderate trend toward systematic increase in the F D value with observation scale, indicating that the effective matrix diffusion coefficient is likely to be statistically scale dependent. The F D value ranges from 1 to 10,000 for observation scales from 5 to 2,000 m. At a given scale, the F D value varies by two orders of magnitude, reflecting the influence of differing degrees of fractured rock heterogeneity at different sites. In addition, the surveyed data indicate that field-scale longitudinal dispersivity generally increases with observation scale, which is consistent with previous studies. The scale-dependent field-scale matrix diffusion coefficient (and dispersivity) may have significant implications for assessing long-term, large-scale radionuclide and contaminant transport events in fractured rock, both for nuclear waste disposal and contaminant remediation

  1. Influence of a diffuse distribution of nucleon density on the effective moments of inertia of fissioning nuclei

    International Nuclear Information System (INIS)

    Adeev, G.; Trunova, T.

    1982-01-01

    The effective moments of inertia of pre-actinide nuclei with 73< or =Z< or =85 are calculated in the droplet model. In contrast to studies carried out previously, the influence of the diffuseness of the nuclear surface and the nonuniformity of the distribution of nucleon density was taken into account both in calculation of the saddle-point configurations and directly in calculation of the effective moments of inertia of the fissioning nuclei. The results are compared with the moments of inertia calculated in the liquid-drop model and with experimental data

  2. Ion beam effects on the surface and near-surface composition of TaSi2

    International Nuclear Information System (INIS)

    Valeri, S.; Di Bona, A.; Ottaviani, G.; Procop, M.

    1991-01-01

    Low-energy (0.7-4.5 keV) ion bombardment effects on polycrystalline TaSi 2 at sputter steady state and in various intermediate steps have been investigated, in the temperature range up to 550degC, to determine the time and temperature dependence of the altered layer formation. This in turn enables a better knowledge of the synergistic effects of the processes mentioned above. At low temperatures (T≤410degC) the surface is silicon depleted, and the depletion is even more severe in the subsurface region up to a depth of several tens of angstroems; silicon preferential sputtering and radiation-enhanced segregation assisted by the displacement mixing-induced motion of atoms are assumed to be responsible for this composition profile, while thermally activated diffusion processes become operative above 410degC, reducing progressively the concentration gradient between the surface and the subsurface zone. The composition at different depths has been determined from Auger peaks for different kinetic energies, by varying the take-off angle and finally by sputter profiling at low in energy the high energy processed surfaces. Quantitative analysis has been performed by XPS and AES by using the elemental standard method. (orig.)

  3. Effect of users' opinion evolution on information diffusion in online social networks

    Science.gov (United States)

    Zhu, Hengmin; Kong, Yuehan; Wei, Jing; Ma, Jing

    2018-02-01

    The process of topic propagation always interweaves information diffusion and opinion evolution, but most previous works studied the models of information diffusion and opinion evolution separately, and seldom focused on their interaction of each other. To shed light on the effect of users' opinion evolution on information diffusion in online social networks, we proposed a model which incorporates opinion evolution into the process of topic propagation. Several real topics propagating on Sina Microblog were collected to analyze individuals' propagation intentions, and different propagation intentions were considered in the model. The topic propagation was simulated to explore the impact of different opinion distributions and intervention with opposite opinion on information diffusion. Results show that the topic with one-sided opinions can spread faster and more widely, and intervention with opposite opinion is an effective measure to guide the topic propagation. The earlier to intervene, the more effectively the topic propagation would be guided.

  4. Numerical analyses on the effect of capillary condensation on gas diffusivities in porous media

    Science.gov (United States)

    Yoshimoto, Yuta; Hori, Takuma; Kinefuchi, Ikuya; Takagi, Shu

    2017-11-01

    We investigate the effect of capillary condensation on gas diffusivities in porous media composed of randomly packed spheres with moderate wettability. Lattice density functional theory simulations successfully reproduce realistic adsorption/desorption isotherms and provide fluid density distributions inside the porous media. We find that capillary condensations lead to the occlusion of narrow pores because they preferentially occur at confined spaces surrounded by the solid walls. Consequently, the characteristic lengths of the partially wet structures are larger than those of the corresponding dry structures with the same porosities. Subsequent gas diffusion simulations exploiting the mean-square displacement method indicate that while effective diffusion coefficients significantly decrease in the presence of partially condensed liquids, they are larger than those in the dry structures with the same porosities. Most importantly, we find that the porosity-to-tortuosity ratio, which is a crucial parameter that determines the effective diffusion coefficient, can be reasonably related to the porosity even for the partially wet porous media.

  5. Effects of radial diffuser hydraulic design on a double-suction centrifugal pump

    Science.gov (United States)

    Hou, H. C.; Zhang, Y. X.; Xu, C.; Zhang, J. Y.; Li, Z. L.

    2016-05-01

    In order to study effects of radial diffuser on hydraulic performance of crude oil pump, the steady CFD numerical method is applied and one large double-suction oil pump running in long-distance pipeline is considered. The research focuses on analysing the influence of its diffuser vane profile on hydraulic performance of oil pump. The four different types of cylindrical vane have been designed by in-house codes mainly including double arcs (DA), triple arcs (TA), equiangular spiral line (ES) and linear variable angle spiral line (LVS). During design process diffuser vane angles at inlet and outlet are tentatively given within a certain range and then the wrapping angle of the four types of diffuser vanes can be calculated automatically. Under the given inlet and outlet angles, the linear variable angle spiral line profile has the biggest wrapping angle and profile length which is good to delay channel diffusion but bring more friction hydraulic loss. Finally the vane camber line is thickened at the certain uniform thickness distribution and the 3D diffuser models are generated. The whole flow passage of oil pump with different types of diffusers under various flow rate conditions are numerically simulated based on RNG k-ɛ turbulent model and SIMPLEC algorithm. The numerical results show that different types of diffusers can bring about great difference on the hydraulic performance of oil pump, of which the ES profile diffuser with its proper setting angle shows the best hydraulic performance and its inner flow field is improved obviously. Compared with the head data from model sample, all designed diffusers can make a certain improvement on head characteristic. At the large flow rate conditions the hydraulic efficiency increases obviously and the best efficiency point shift to the large flow rate range. The ES profile diffuser embodies the better advantages on pump performance which can be explained theoretically that the diffuser actually acts as a diffusion

  6. Surface morphology and molecular bonding of CaCO3 nanocrystallites by gas diffusion method

    Science.gov (United States)

    Sulimai, N. H.; Rani, Rozina Abdul; Khusaimi, Z.; Abdullah, S.; Salifairus, M. J.; Alrokayan, Salman; Khan, Haseeb; Rusop, M.

    2018-05-01

    Calcium carbonate with the chemical formula of (CaCO3) is the most abundant element in the world. Its usage on certain applications is largely affected by its properties. The best means to control its properties is through controlled preparation of CaCO3. This study uses diffusion method between the precursors Calcium Chloride and Ammonium Carbonate. Instead of using water, ethanol was used to prepare the salt. Reaction was done in room temperature (RT) for 6h-24h. Smallest average crystallite size measured by FESEM micrograph is 500nm produced by synthesis of CaCO3 reacted for 168 hours. From energy-dispersive X-ray spectrum also indicated the smallest particle size is by CaCO3 reacted for 168 hours. Changes was seen for element Ca at 3.7keV.

  7. Analytical Model for Diffusive Evaporation of Sessile Droplets Coupled with Interfacial Cooling Effect.

    Science.gov (United States)

    Nguyen, Tuan A H; Biggs, Simon R; Nguyen, Anh V

    2018-05-30

    Current analytical models for sessile droplet evaporation do not consider the nonuniform temperature field within the droplet and can overpredict the evaporation by 20%. This deviation can be attributed to a significant temperature drop due to the release of the latent heat of evaporation along the air-liquid interface. We report, for the first time, an analytical solution of the sessile droplet evaporation coupled with this interfacial cooling effect. The two-way coupling model of the quasi-steady thermal diffusion within the droplet and the quasi-steady diffusion-controlled droplet evaporation is conveniently solved in the toroidal coordinate system by applying the method of separation of variables. Our new analytical model for the coupled vapor concentration and temperature fields is in the closed form and is applicable for a full range of spherical-cap shape droplets of different contact angles and types of fluids. Our analytical results are uniquely quantified by a dimensionless evaporative cooling number E o whose magnitude is determined only by the thermophysical properties of the liquid and the atmosphere. Accordingly, the larger the magnitude of E o , the more significant the effect of the evaporative cooling, which results in stronger suppression on the evaporation rate. The classical isothermal model is recovered if the temperature gradient along the air-liquid interface is negligible ( E o = 0). For substrates with very high thermal conductivities (isothermal substrates), our analytical model predicts a reversal of temperature gradient along the droplet-free surface at a contact angle of 119°. Our findings pose interesting challenges but also guidance for experimental investigations.

  8. Effects of surfaces on resistor percolation.

    Science.gov (United States)

    Stenull, O; Janssen, H K; Oerding, K

    2001-05-01

    We study the effects of surfaces on resistor percolation at the instance of a semi-infinite geometry. Particularly we are interested in the average resistance between two connected ports located on the surface. Based on general grounds as symmetries and relevance we introduce a field theoretic Hamiltonian for semi-infinite random resistor networks. We show that the surface contributes to the average resistance only in terms of corrections to scaling. These corrections are governed by surface resistance exponents. We carry out renormalization-group improved perturbation calculations for the special and the ordinary transition. We calculate the surface resistance exponents phiS and phiS(infinity) for the special and the ordinary transition, respectively, to one-loop order.

  9. The effect of thickness in the through-diffusion experiment. Final report

    International Nuclear Information System (INIS)

    Valkiainen, M.; Aalto, H.; Lehikoinen, J.; Uusheimo, K.

    1996-01-01

    The report contains an experimental study of diffusion in the water-filled pores of rock samples. The samples studied are rapakivi granite from Loviisa, southern Finland. The drill-core sample was sectioned perpendicularly with a diamond saw and three cylindrical samples were obtained. The nominal thicknesses (heights of the cylinders) are 2, 4 and 6 cm. For the diffusion measurement the sample holders were pressed between two chambers. One of the chambers was filled with 0.0044 molar sodium chloride solution spiked with tracers. Another chamber was filled with inactive solution. Tritium (HTO) considered to be a water equivalent tracer and anionic 36 Cl - were used as tracers. The through diffusion was monitored about 1000 days after which time the diffusion cells were emptied and the sample holders dismantled. The samples were sectioned into 1 cm slices and the tracers were leached from the slices. The porosities of the slices were determined by the weighing method. The rock-capacity factors could be determined from the leaching results obtained. It was seen that the porosity values were in accordance with the rock capacity factors obtained with HTO. An anion exclusion can be seen comparing the results obtained with HTO and 36 Cl - . The concentration profile through even the thickest sample had reached a constant slope and the rate of diffusion was practically at a steady state. An anion exclusion effect was also seen in the effective diffusion coefficients. The effect of thickness on diffusion shows that the connectivity of the pores decreases in the thickness range 2-4 cm studied. The decrease as reflected in the diffusion coefficient was not dramatic and it can be said that especially for studying chemical interactions during diffusion, the thickness of 2 cm is adequate. (orig.) (12 refs.)

  10. The effect of recombination and attachment on meteor radar diffusion coefficient profiles

    Science.gov (United States)

    Lee, C. S.; Younger, J. P.; Reid, I. M.; Kim, Y. H.; Kim, J.-H.

    2013-04-01

    Estimates of the ambipolar diffusion coefficient producedusing meteor radar echo decay times display an increasing trend below 80-85 km, which is inconsistent with a diffusion-only theory of the evolution of meteor trails. Data from the 33 MHz meteor radar at King Sejong Station, Antarctica, have been compared with observations from the Aura Earth Observing System Microwave Limb Sounder satellite instrument. It has been found that the height at which the diffusion coefficient gradient reverses follows the height of a constant neutral atmospheric density surface. Numerical simulations of meteor trail diffusion including dissociative recombination with atmospheric ions and three-body attachment of free electrons to neutral molecules indicate that three-body attachment is responsible for the distortion of meteor radar diffusion coefficient profiles at heights below 90 km, including the gradient reversal below 80-85 km. Further investigation has revealed that meteor trails with low initial electron line density produce decay times more consistent with a diffusion-only model of meteor trail evolution.

  11. Surface treatment systems for concrete in marine environment: Effect of concrete cover thickness

    Directory of Open Access Journals (Sweden)

    Marcelo Henrique Farias de Medeiros

    Full Text Available Abstract There are some ways to extend the service life of a reinforced concrete structure. This paper focuses on the extension of the service life by treating the surface of reinforced concrete, specifically on the effect of the concrete cover thickness on the surface treatment system efficacy. Thus, chloride migration tests were performed and diffusion chloride coefficients were calculated. The service life of each case (treated or non-treated concrete was estimated using these data and Fick's second law of diffusion. Results indicated that the thicker the concrete cover is, the greater the efficacy of the concrete surface treatment system will be. The dissemination of this information is important, since it is almost intuitive to think that the effect of a surface treatment system depends only on itself and this study shows the opposite.

  12. Surface effects in controlled thermonuclear fusion

    International Nuclear Information System (INIS)

    Kaminsky, M.

    1975-08-01

    During the operation of large size plasma facilities and future controlled thermonuclear fusion reactors the surfaces of such major components as container walls, beam limiters, diverter walls and beam-dump walls of the injector region will be exposed to particle and photon bombardment from primary plasma radiations and from secondary radiations. Such radiations can cause, for example, physical and chemical sputtering, blistering, particle- and photon-impact induced desorption, secondary electron and x-ray emission, backscattering, nuclear reactions, photo-decomposition of surface compounds, photocatalysis, and vaporization. Such effects in turn can (a) seriously damage and erode the bombarded surface and (b) release major quantities of impurities which will contaminate the plasma. The effects of some of the major surface phenomena on the operation of plasma facilities and future fusion reactors are discussed

  13. Vibration of Piezoelectric Nanowires Including Surface Effects

    Directory of Open Access Journals (Sweden)

    R. Ansari

    2014-04-01

    Full Text Available In this paper, surface and piezoelectric effects on the vibration behavior of nanowires (NWs are investigated by using a Timoshenko beam model. The electric field equations and the governing equations of motion for the piezoelectric NWs are derived with the consideration of surface effects. By the exact solution of the governing equations, an expression for the natural frequencies of NWs with simply-supported boundary conditions is obtained. The effects of piezoelectricity and surface effects on the vibrational behavior of Timoshenko NWs are graphically illustrated. A comparison is also made between the predictions of Timoshenko beam model and those of its Euler-Bernoulli counterpart. Additionally, the present results are validated through comparison with the available data in the literature.

  14. Use of x-ray absorption imaging to evaluate the effects of heterogeneity on matrix diffusion

    International Nuclear Information System (INIS)

    Altman, S.J.; Tidwell, V.C.; McKenna, S.A.; Meigs, L.C.

    1998-01-01

    An understanding of matrix diffusion is important in assessing potential nuclear waste repositories in geologic media, as it is a potentially significant process in retarding the transport of contaminant species. Recent work done in evaluating the Waste Isolation Pilot Plant (WIPP) in southeastern New Mexico has brought up two issues that complicate the incorporation of diffusion in Performance Assessment calculations. First, interpretations of single-well tracer test data suggest that the tracer was diffusing at multiple rates. Second, the estimated relevant rate(s) of diffusion are dependent on the time and length scales of the problem. To match the observed tracer test data, a model with a distribution of diffusion coefficients was required. This has led to the proposal of applying a model with multiple rates of diffusion, the multirate model, to Performance Assessment calculations for the WIPP. A series of laboratory- scale experiments have been designed for the purpose of evaluating heterogeneity and scaling properties of diffusion rates and to test the multirate model. X-ray absorption imaging was used to visualize and quantify the effects of matrix heterogeneity on the diffusion characteristics for four different centimeter-scale samples of dolomite. The samples were obtained from the Culebra dolomite at the WIPP site. Significant variations in diffusion rates were observed over relatively small length and time (months) scales for the preliminary laboratory experiments. A strong correlation between diffusion rate and porosity was also observed in each of the samples. Two sets of experiments are planned for 1998. The first set of experiments is similar to those described above. For these experiments, fourteen samples exhibiting a broader range of physical characteristics are being tested. The second set of experiments will visualize the combined effect of advection in a fracture and diffusion into adjacent matrix materials. Tracer solution will flow through

  15. Evaluation on therapeutic effect of de-compressive craniectomies for patients with diffuse brain swelling

    International Nuclear Information System (INIS)

    Xiao Sanchao; Zhang Changrong; Zuo Yi; Zhou Xiaowei; Li Jian

    2000-01-01

    Objective: To evaluate the therapeutic effect of de-compressive craniectomies in acute traumatic patients with diffuse brain swelling. Methods: 23 patients with acute posttraumatic diffuse brain swelling admitted and confirmed by X-CT were randomly treated by surgical de-compressive craniectomies (operative group). Their treated results were compared with those of another 11 patients treated conservatively (non-operative group) at the same period. Results: The mortality rate was similar in both operative and nonoperative groups. Conclusion: The de-compressive craniectomy operation has no value and not valid for treatment of acute posttraumatic diffuse brain swelling

  16. Diffusion in plasma: The Hall effect, compositional waves, and chemical spots

    Energy Technology Data Exchange (ETDEWEB)

    Urpin, V., E-mail: Vadim.urpin@uv.es [Ioffe Institute of Physics and Technology (Russian Federation)

    2017-03-15

    Diffusion caused by a combined influence of the electric current and Hall effect is considered, and it is argued that such diffusion can form inhomogeneities of a chemical composition in plasma. The considered mechanism can be responsible for the formation of element spots in laboratory and astrophysical plasmas. This current-driven diffusion can be accompanied by propagation of a particular type of waves in which the impurity number density oscillates alone. These compositional waves exist if the magnetic pressure in plasma is much greater than the gas pressure.

  17. Advances in surface treatments: Technology, applications, effects

    International Nuclear Information System (INIS)

    Niku-Lari, A.

    1987-01-01

    An international handbook has been produced to include all aspects of residual stresses, including the theoretical background, effects of residual stresses, measurement and calculation and quantitative assessment of residual stress effects. Techniques for altering residual stresses, particularly surface treatments, are discussed. Up to date information on the state of the art is presented. (UK)

  18. Surface and interface effects in VLSI

    CERN Document Server

    Einspruch, Norman G

    1985-01-01

    VLSI Electronics Microstructure Science, Volume 10: Surface and Interface Effects in VLSI provides the advances made in the science of semiconductor surface and interface as they relate to electronics. This volume aims to provide a better understanding and control of surface and interface related properties. The book begins with an introductory chapter on the intimate link between interfaces and devices. The book is then divided into two parts. The first part covers the chemical and geometric structures of prototypical VLSI interfaces. Subjects detailed include, the technologically most import

  19. Chlorine Diffusion in Uranium Dioxide: Thermal Effects versus Radiation Enhanced Effects

    International Nuclear Information System (INIS)

    Pipon, Yves; Moncoffre, Nathalie; Bererd, Nicolas; Jaffrezic, Henri; Toulhoat, Nelly; Barthe, Marie France; Desgardin, Pierre; Raimbault, Louis; Scheidegger, Andre M.; Carlot, Gaelle

    2007-01-01

    Chlorine is present as an impurity in the UO 2 nuclear fuel. 35 Cl is activated into 36 Cl by thermal neutron capture. In case of interim storage or deep geological disposal of the spent fuel, this isotope is known to be able to contribute significantly to the instant release fraction because of its mobile behavior and its long half life (around 300000 years). It is therefore important to understand its migration behavior within the fuel rod. During reactor operation, chlorine diffusion can be due to thermally activated processes or can be favoured by irradiation defects induced by fission fragments or alpha decay. In order to decouple both phenomena, we performed two distinct experiments to study the effects of thermal annealing on the behaviour of chlorine on one hand and the effects of the irradiation with fission products on the other hand. During in reactor processes, part of the 36 Cl may be displaced from its original position, due to recoil or to collisions with fission products. In order to study the behavior of the displaced chlorine, 37 Cl has been implanted into sintered depleted UO 2 pellets (mean grain size around 18 μm). The spatial distribution of the implanted and pristine chlorine has been analyzed by SIMS before and after treatment. Thermal annealing of 37 Cl implanted UO 2 pellets (implantation fluence of 10 13 ions.cm -2 ) show that it is mobile from temperatures as low as 1273 K (E a =4.3 eV). The irradiation with fission products (Iodine, E=63.5 MeV) performed at 300 and 510 K, shows that the diffusion of chlorine is enhanced and that a thermally activated contribution is preserved (E a =0.1 eV). The diffusion coefficients measured at 1473 K and under fission product irradiation at 510 K are similar (D = 3.10 -14 cm 2 .s -1 ). Considering in first approximation that the diffusion length L can be expressed as a function of the diffusion coefficient D and time t by : L=(Dt)1/2, the diffusion distance after 3 years is L=17 μm. It results that

  20. Effect of impact surface in equestrian falls

    OpenAIRE

    Clark, J. Michio; Post, Andrew; Connor, Thomas A.; Hoshizaki, Thomas Blaine; Gilchrist, M. D.

    2016-01-01

    This study examines the effect of impact surface on head kinematic response and maximum principal strain (MPS) for equestrian falls. A helmeted Hybrid III headform was dropped unrestrained onto three impact surfaces of different stiffness (steel, turf and sand) and three locations. Peak resultant linear acceleration, rotational acceleration and duration of the impact events were measured. A finite element brain model was used to calculate MPS. The results revealed that drops onto steel produc...

  1. Plasma treatment of detonation and HPHT nanodiamonds in diffuse coplanar surface barrier discharge in H.sub.2./sub./N.sub.2./sub. flow

    Czech Academy of Sciences Publication Activity Database

    Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander

    2016-01-01

    Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016

  2. Influence of blocking effect and energetic disorder on diffusion in one-dimensional lattice

    International Nuclear Information System (INIS)

    Mai Thi Lan; Nguyen Van Hong; Nguyen Thu Nhan; Hoang Van Hue

    2014-01-01

    The diffusion in one-dimensional disordered lattice with Gaussian distribution of site and transition energies has been studied by mean of kinetic Monte-Carlo simulation. We focus on investigating the influence of energetic disorders and diffusive particle density on diffusivity. In single-particle case, we used both analytical method and kinetic Monte-Carlo simulation to calculate the quantities that relate to diffusive behavior in disordered systems such as the mean time between two consecutive jumps, correlation factor and diffusion coefficient. The calculation shows a good agreement between analytical and simulation results for all disordered lattice types. In many - particle case, the blocking effect results in decreasing correlation factor F and average time τ jump between two consecutive jumps. With increasing the number of particles, the diffusion coefficient D M decreases for site-energy and transition-energy disordered lattices due to the F-effect affect affects stronger than τ-effect. Furthermore, the blocking effect almost is temperature independent for both lattices. (author)

  3. Diffusivities of an Al-Fe-Ni melt and their effects on the microstructure during solidification

    International Nuclear Information System (INIS)

    Zhang Lijun; Du Yong; Steinbach, Ingo; Chen Qing; Huang Baiyun

    2010-01-01

    A systematical investigation of the diffusivities in an Al-Fe-Ni melt was presented. Based on the experimental and theoretical data about diffusivities, the temperature- and composition-dependent atomic mobilities were evaluated for the elements in Al-Ni, Al-Fe, Fe-Ni and Al-Fe-Ni melts via an effective approach. Most of the reported diffusivities can be reproduced well by the obtained atomic mobilities. In particular, for the first time the ternary diffusivity of the liquid in a ternary system is described in conjunction with the established atomic mobilities. The effect of the atomic mobilities in a liquid on microstructure and microsegregation during solidification was demonstrated with one Al-Ni binary alloy. The simulation results indicate that accurate databases of mobilities in the liquid phase are much needed for the quantitative simulation of microstructural evolution during solidification by using various approaches, including DICTRA and the phase-field method.

  4. "Conjugate channeling" effect in dislocation core diffusion: carbon transport in dislocated BCC iron.

    Science.gov (United States)

    Ishii, Akio; Li, Ju; Ogata, Shigenobu

    2013-01-01

    Dislocation pipe diffusion seems to be a well-established phenomenon. Here we demonstrate an unexpected effect, that the migration of interstitials such as carbon in iron may be accelerated not in the dislocation line direction ξ, but in a conjugate diffusion direction. This accelerated random walk arises from a simple crystallographic channeling effect. c is a function of the Burgers vector b, but not ξ, thus a dislocation loop possesses the same everywhere. Using molecular dynamics and accelerated dynamics simulations, we further show that such dislocation-core-coupled carbon diffusion in iron has temperature-dependent activation enthalpy like a fragile glass. The 71° mixed dislocation is the only case in which we see straightforward pipe diffusion that does not depend on dislocation mobility.

  5. Experimental evidence of an effective medium seen by diffuse light in turbid colloids

    International Nuclear Information System (INIS)

    Contreras-Tello, H; Garcia-Valenzuela, A

    2011-01-01

    The propagation of diffuse light in turbid media is usually modeled with radiative transfer theory. When diffuse light travelling in a turbid colloid is reflected and transmitted at a flat interface where there is a refractive index mismatch, it is not clear whether one should assume the incident diffuse-light is travelling in a medium with a refractive index equal to that of the background medium (usually referred to as the matrix) or if one should assume it travels in an effective medium. Most authors simply avoid this issue and most often use the refractive index of the matrix. While this might be a good approximation for dilute turbid media one may suspect that for highly scattering materials it may not be the case. In this work we investigate experimentally this issue. Our experimental results provide clear evidence that diffuse light inside the turbid colloid travels in an effective medium and not in the matrix.

  6. Three-dimensional reconstruction of brain surface anatomy: technique comparison between flash and diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Sun Jianzhong; Wang Zhikang; Gong Xiangyang

    2006-01-01

    Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)

  7. Oxygen diffusion in nanocrystalline yttria-stabilized zirconia: the effect of grain boundaries.

    Science.gov (United States)

    De Souza, Roger A; Pietrowski, Martha J; Anselmi-Tamburini, Umberto; Kim, Sangtae; Munir, Zuhair A; Martin, Manfred

    2008-04-21

    The transport of oxygen in dense samples of yttria-stabilized zirconia (YSZ), of average grain size d approximately 50 nm, has been studied by means of 18O/16O exchange annealing and secondary ion mass spectrometry (SIMS). Oxygen diffusion coefficients (D*) and oxygen surface exchange coefficients (k*) were measured for temperatures 673diffusion along grain boundaries. Rather, the analysis indicates that grain boundaries hinder oxygen transport.

  8. Surface tension phenomena in the xylem sap of three diffuse porous temperate tree species

    Science.gov (United States)

    K. K. Christensen-Dalsgaard; M. T. Tyree; P. G. Mussone

    2011-01-01

    In plant physiology models involving bubble nucleation, expansion or elimination, it is typically assumed that the surface tension of xylem sap is equal to that of pure water, though this has never been tested. In this study we collected xylem sap from branches of the tree species Populus tremuloides, Betula papyrifera and Sorbus...

  9. Modification of the glass surface induced by redox reactions and internal diffusion processes

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    In this paper we report a novel way to modify the glass surface in favor of some physical performances. The main step is to perform iso-thermal treatments on the selected silicate glasses containing transition metal at temperatures near the glass transition temperature for various durations under...

  10. Opposing effects of humidity on rhodochrosite surface oxidation.

    Science.gov (United States)

    Na, Chongzheng; Tang, Yuanzhi; Wang, Haitao; Martin, Scot T

    2015-03-03

    Rhodochrosite (MnCO3) is a model mineral representing carbonate aerosol particles containing redox-active elements that can influence particle surface reconstruction in humid air, thereby affecting the heterogeneous transformation of important atmospheric constituents such as nitric oxides, sulfur dioxides, and organic acids. Using in situ atomic force microscopy, we show that the surface reconstruction of rhodochrosite in humid oxygen leads to the formation and growth of oxide nanostructures. The oxidative reconstruction consists of two consecutive processes with distinctive time scales, including a long waiting period corresponding to slow nucleation and a rapid expansion phase corresponding to fast growth. By varying the relative humidity from 55 to 78%, we further show that increasing humidity has opposing effects on the two processes, accelerating nucleation from 2.8(±0.2) × 10(-3) to 3.0(±0.2) × 10(-2) h(-1) but decelerating growth from 7.5(±0.3) × 10(-3) to 3.1(±0.1) × 10(-3) μm(2) h(-1). Through quantitative analysis, we propose that nanostructure nucleation is controlled by rhodochrosite surface dissolution, similar to the dissolution-precipitation mechanism proposed for carbonate mineral surface reconstruction in aqueous solution. To explain nanostructure growth in humid oxygen, a new Cabrera-Mott mechanism involving electron tunneling and solid-state diffusion is proposed.

  11. Effects of diffuse light in cultivation of roses; Effecten van diffuus licht in de rozenteelt

    Energy Technology Data Exchange (ETDEWEB)

    Schapendonk, A. [Plant-Dynamics, Englaan 8, 6703 EW Wageningen (Netherlands); Rappoldt, K. [EcoCurves, Kamperfoelieweg 17, 9753 ER Haren (Netherlands)

    2011-09-15

    An overview is given of the effects of diffuse glass and the rose production and the interactions with light, CO2 and Relative Humidity. Diffuse glass prevents peaks in the horizontal distribution of light and increases the average use of light [Dutch] Een overzicht wordt gegeven van de effecten van diffuus glas op de opbrengst van roos en de interacties met licht, CO2, en RV. Diffuus glas voorkomt pieken in de horizontale lichtverdeling en verhoogt de gemiddelde lichtbenutting.

  12. The effect of radionuclides and their carriers on diffusion coefficient of radionuclides in local rocks

    International Nuclear Information System (INIS)

    Othman, I.; Takriti, S.

    1995-07-01

    The diffusion coefficient of sup 9 sup 0 Sr and sup 1 sup 3 sup 7 Cs has been calculated for different local rocks in stationary and dynamic state. The effect of pH radioisotope solution dependence in shown by diffusion coefficient in some rocks. The results show that the cement and dolomite have the best quality of radioisotope retention which do not allow them to pollute the environment. (author). 6 refs., 2 tabs., 13 figs

  13. Chloride diffusivity in hardened cement paste from microscale analyses and accounting for binding effects

    OpenAIRE

    Carrara, P; De Lorenzis, L; Bentz, D P

    2016-01-01

    The diffusion of chloride ions in hardened cement paste (HCP) under steady-state conditions and accounting for the highly heterogeneous nature of the material is investigated. The HCP microstructures are obtained through segmentation of X-ray images of real samples as well as from simulations using the cement hydration model CEMHYD3D. Moreover, the physical and chemical interactions between chloride ions and HCP phases (binding), along with their effects on the diffusive process, are explicit...

  14. Effects of a conducting E layer on classical F region cross-field plasma diffusion

    International Nuclear Information System (INIS)

    Vickrey, J.F.; Kelley, M.C.

    1982-01-01

    The rate of cross-field plasma diffusion in the F region ionosphere is significantly increased when the magnetic field lines thread a highly conducting E region below. This reduces the lifetime of small-scale F region electron density irregularities in the polar ionosphere where the presence of a highly conducting E region is comonplace. A simple mmodel is developed to describe the effects of a conducting E layer on classical F region plasma diffusion. In the absence of an E region, the difference in ion and electron diffusion rates leads to a charge separation and, hence, to an electrostatic field that retards ion diffusion. When the highly conducting magnetic field lines are tied to a conducting E region, however, electrons can flow along B to reduce the ambipolar diffusion electric field, and ions can proceed perpendicular to B at a rate approaching their own (higher) diffusion velocity. It is shown that the enhanced total diffusion rate that results depends strongly on the height of the F layer and on the ratio of the E to F region Pedersen conductivities

  15. A novel rumor diffusion model considering the effect of truth in online social media

    Science.gov (United States)

    Sun, Ling; Liu, Yun; Zeng, Qing-An; Xiong, Fei

    2015-12-01

    In this paper, we propose a model to investigate how truth affects rumor diffusion in online social media. Our model reveals a relation between rumor and truth — namely, when a rumor is diffusing, the truth about the rumor also diffuses with it. Two patterns of the agents used to identify rumor, self-identification and passive learning are taken into account. Combining theoretical proof and simulation analysis, we find that the threshold value of rumor diffusion is negatively correlated to the connectivity between nodes in the network and the probability β of agents knowing truth. Increasing β can reduce the maximum density of the rumor spreaders and slow down the generation speed of new rumor spreaders. On the other hand, we conclude that the best rumor diffusion strategy must balance the probability of forwarding rumor and the probability of agents losing interest in the rumor. High spread rate λ of rumor would lead to a surge in truth dissemination which will greatly limit the diffusion of rumor. Furthermore, in the case of unknown λ, increasing β can effectively reduce the maximum proportion of agents who do not know the truth, but cannot narrow the rumor diffusion range in a certain interval of β.

  16. Ab-initio approach to the effect of Fe on the diffusion in hcp Zr

    International Nuclear Information System (INIS)

    Perez, Rodolfo Ariel; Weissmann, Mariana

    2008-01-01

    The role of Fe in the hcp Zr diffusion process is analyzed, given its ultra-fast diffusion (up to nine orders of magnitude higher than the self-diffusion in the temperature range 779-1128 K) and the enhancement observed in the self and substitutional diffusion induced by its unavoidable presence as impurity. Ab-initio calculations using SIESTA and WIEN2K codes were performed in order to find the actual Fe minimum energy configuration within the hcp Zr matrix and its interaction with vacancies. Several off-centre quasi-interstitial positions with energies similar to substitutional Fe were encountered. The comparison with diffusion coefficient measurements and Moessbauer experiments allows us to discard the substitutional position of the Fe atom as well as to affirm that its presence creates a considerable lattice distortion together with an increment in the number of vacancies. The above effects could be responsible for the enhancement in the self and substitutional diffusion, whereas the large amount of quasi-interstitial positions for Fe could be, at least partially, responsible for the ultra-fast Fe diffusion

  17. Volatile diffusion in silicate melts and its effects on melt inclusions

    Directory of Open Access Journals (Sweden)

    P. Scarlato

    2005-06-01

    Full Text Available A compendium of diffusion measurements and their Arrhenius equations for water, carbon dioxide, sulfur, fluorine, and chlorine in silicate melts similar in composition to natural igneous rocks is presented. Water diffusion in silicic melts is well studied and understood, however little data exists for melts of intermediate to basic compositions. The data demonstrate that both the water concentration and the anhydrous melt composition affect the diffusion coefficient of water. Carbon dioxide diffusion appears only weakly dependent, at most, on the volatilefree melt composition and no effect of carbon dioxide concentration has been observed, although few experiments have been performed. Based upon one study, the addition of water to rhyolitic melts increases carbon dioxide diffusion by orders of magnitude to values similar to that of 6 wt% water. Sulfur diffusion in intermediate to silicic melts depends upon the anhydrous melt composition and the water concentration. In water-bearing silicic melts sulfur diffuses 2 to 3 orders of magnitude slower than water. Chlorine diffusion is affected by both water concentration and anhydrous melt composition; its values are typically between those of water and sulfur. Information on fluorine diffusion is rare, but the volatile-free melt composition exerts a strong control on its diffusion. At the present time the diffusion of water, carbon dioxide, sulfur and chlorine can be estimated in silicic melts at magmatic temperatures. The diffusion of water and carbon dioxide in basic to intermediate melts is only known at a limited set of temperatures and compositions. The diffusion data for rhyolitic melts at 800°C together with a standard model for the enrichment of incompatible elements in front of growing crystals demonstrate that rapid crystal growth, greater than 10-10 ms-1, can significantly increase the volatile concentrations at the crystal-melt interface and that any of that melt trapped

  18. First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

    2014-01-01

    Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

  19. Biofilm Surface Density Determines Biocide Effectiveness

    Directory of Open Access Journals (Sweden)

    Sara Bas

    2017-12-01

    Full Text Available High resistance of biofilms for chemical challenges is a serious industrial and medical problem. In this work a gradient of surface covered with biofilm has been produced and correlated to the effectiveness of different commercially available oxidative biocides. The results for thin Escherichia coli biofilms grown in rich media supplemented with glucose or lactose on glass or poly methyl methacrylate surfaces indicate that the effectiveness of hydrogen peroxide or chlorine dioxide and quaternary ammonium compounds is inversely proportional to the fraction of the surface covered with the biofilm. In areas where biofilm covered more than 90% of the available surface the biocide treatment was inefficient after 60 min of incubation. The combined effect of oxidant and surfactant increased the effectiveness of the biocide. On the other hand, the increased biofilm viscoelasticity reduced biocide effectiveness. The results emphasize differential biocide effectiveness depending on the fraction of the attached bacterial cells. The results suggest that biofilm biocide resistance is an acquired property that increases with biofilm maturation. The more dense sessile structures present lower log reductions compared to less dense ones.

  20. Thermo-diffusion effect on free convection heat and mass transfer in a thermally linearly stratified non-darcy porous media

    KAUST Repository

    Murthy, P.V.S.N.

    2011-12-26

    Thermo-diffusion effect on free convection heat and mass transfer from a vertical surface embedded in a liquid saturated thermally stratified non - Darcy porous medium has been analyzed using a local non-similar procedure. The wall temperature and concentration are constant and the medium is linearly stratified in the vertical direction with respect to the thermal conditions. The fluid flow, temperature and concentration fields are affected by the complex interactions among the diffusion ratio Le, buoyancy ratio N, thermo-diffusion parameter Sr and stratification parameter ?. Non-linear interactions of all these parameters on the convective transport has been analyzed and variation of heat and mass transfer coefficients with thermo-diffusion parameter in the thermally stratified non-Darcy porous media is presented through computer generated plots.