WorldWideScience

Sample records for surface diffusion constant

  1. Classically exact surface diffusion constants at arbitrary temperature

    International Nuclear Information System (INIS)

    Voter, A.F.; Cohen, J.M.

    1989-01-01

    An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

  2. Transport equivalent diffusion constants for reflector region in PWRs

    International Nuclear Information System (INIS)

    Tahara, Yoshihisa; Sekimoto, Hiroshi

    2002-01-01

    The diffusion-theory-based nodal method is widely used in PWR core designs for reason of its high computing speed in three-dimensional calculations. The baffle/reflector (B/R) constants used in nodal calculations are usually calculated based on a one-dimensional transport calculation. However, to achieve high accuracy of assembly power prediction, two-dimensional model is needed. For this reason, the method for calculating transport equivalent diffusion constants of reflector material was developed so that the neutron currents on the material boundaries could be calculated exactly in diffusion calculations. Two-dimensional B/R constants were calculated using the transport equivalent diffusion constants in the two-dimensional diffusion calculation whose geometry reflected the actual material configuration in the reflector region. The two-dimensional B/R constants enabled us to predict assembly power within an error of 1.5% at hot full power conditions. (author)

  3. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  4. A calculation of the surface recombination rate constant for hydrogen isotopes on metals

    International Nuclear Information System (INIS)

    Baskes, M.J.

    1980-01-01

    The surface recombination rate constant for hydrogen isotopes on a metal has been calculated using a simple model whose parameters may be determined by direct experimental measurements. Using the experimental values for hydrogen diffusivity, solubility, and sticking coefficient at zero surface coverage a reasonable prediction of the surface recombination constant may be made. The calculated recombination constant is in excellent agreement with experiment for bcc iron. A heuristic argument is developed which, along with the rate constant calculation, shows that surface recombination is important in those metals in which hydrogen has an exothermic heat of solution. (orig.)

  5. Tracer surface diffusion on UO2

    International Nuclear Information System (INIS)

    Zhou, S.Y.; Olander, D.R.

    1983-06-01

    Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

  6. Theory and experiments on surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Silvestri, W.L.

    1998-11-01

    The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

  7. Polymer diffusion in the interphase between surface and solution.

    Science.gov (United States)

    Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

    2018-05-22

    Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

  8. On the use of SERPENT Monte Carlo code to generate few group diffusion constants

    Energy Technology Data Exchange (ETDEWEB)

    Piovezan, Pamela, E-mail: pamela.piovezan@ctmsp.mar.mil.b [Centro Tecnologico da Marinha em Sao Paulo (CTMSP), Sao Paulo, SP (Brazil); Carluccio, Thiago; Domingos, Douglas Borges; Rossi, Pedro Russo; Mura, Luiz Felipe, E-mail: fermium@cietec.org.b, E-mail: thiagoc@ipen.b [Fermium Tecnologia Nuclear, Sao Paulo, SP (Brazil); Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    The accuracy of diffusion reactor codes strongly depends on the quality of the groups constants processing. For many years, the generation of such constants was based on 1-D infinity cell transport calculations. Some developments using collision probability or the method of characteristics allow, nowadays, 2-D assembly group constants calculations. However, these 1-D and 2-D codes how some limitations as , for example, on complex geometries and in the neighborhood of heavy absorbers. On the other hand, since Monte Carlos (MC) codes provide accurate neutro flux distributions, the possibility of using these solutions to provide group constants to full-core reactor diffusion simulators has been recently investigated, especially for the cases in which the geometry and reactor types are beyond the capability of the conventional deterministic lattice codes. The two greatest difficulties on the use of MC codes to group constant generation are the computational costs and the methodological incompatibility between analog MC particle transport simulation and deterministic transport methods based in several approximations. The SERPENT code is a 3-D continuous energy MC transport code with built-in burnup capability that was specially optimized to generate these group constants. In this work, we present the preliminary results of using the SERPENT MC code to generate 3-D two-group diffusion constants for a PWR like assembly. These constants were used in the CITATION diffusion code to investigate the effects of the MC group constants determination on the neutron multiplication factor diffusion estimate. (author)

  9. Slab-diffusion approximation from time-constant-like calculations

    International Nuclear Information System (INIS)

    Johnson, R.W.

    1976-12-01

    Two equations were derived which describe the quantity and any fluid diffused from a slab as a function of time. One equation is applicable to the initial stage of the process; the other to the final stage. Accuracy is 0.2 percent at the one point where both approximations apply and where accuracy of either approximation is the poorest. Characterizing other rate processes might be facilitated by the use of the concept of NOLOR (normal of the logarithm of the rate) and its time dependence

  10. Surface modifications by field induced diffusion.

    Directory of Open Access Journals (Sweden)

    Martin Olsen

    Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

  11. On the distribution of estimators of diffusion constants for Brownian motion

    International Nuclear Information System (INIS)

    Boyer, Denis; Dean, David S

    2011-01-01

    We discuss the distribution of various estimators for extracting the diffusion constant of single Brownian trajectories obtained by fitting the squared displacement of the trajectory. The analysis of the problem can be framed in terms of quadratic functionals of Brownian motion that correspond to the Euclidean path integral for simple Harmonic oscillators with time dependent frequencies. Explicit analytical results are given for the distribution of the diffusion constant estimator in a number of cases and our results are confirmed by numerical simulations.

  12. The influence of the surface atomic structure on surface diffusion

    International Nuclear Information System (INIS)

    Ghaleb, Dominique

    1984-03-01

    This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

  13. Modifying glass surfaces via internal diffusion

    DEFF Research Database (Denmark)

    Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

    2010-01-01

    leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

  14. Diffusion constant in hot and dense hadronic matter. A hadro-molecular-dynamic calculation

    International Nuclear Information System (INIS)

    Sasaki, N.; Miyamura, O.; Muroya, S.; Nonaka, C.

    2002-01-01

    We evaluate baryon/charge diffusion constant of dense and hot hadronic matter based on the molecular dynamical method by using a hadronic collision generator which describes nuclear collisions at energies 10 1-2 GeV/A and satisfies detailed balance at low temperatures (T ≤ 200 MeV). For the hot and dense hadronic matter of the temperature range, T = 100 - 200 MeV and baryon number density, n B =0.16 fm -3 - 0.32 fm -3 , charge diffusion constant D gradually increases from 0.5 fmc to 2 fmc with temperature and is almost independent of baryon number density. Based on the obtained diffusion constant we make simple discussions on the diffusion of charge fluctuation in ultrarelativistic nuclear collisions. (author)

  15. Surface diffusion studies by optical diffraction techniques

    International Nuclear Information System (INIS)

    Xiao, X.D.

    1992-11-01

    The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

  16. A first-passage scheme for determination of overall rate constants for non-diffusion-limited suspensions

    Science.gov (United States)

    Lu, Shih-Yuan; Yen, Yi-Ming

    2002-02-01

    A first-passage scheme is devised to determine the overall rate constant of suspensions under the non-diffusion-limited condition. The original first-passage scheme developed for diffusion-limited processes is modified to account for the finite incorporation rate at the inclusion surface by using a concept of the nonzero survival probability of the diffusing entity at entity-inclusion encounters. This nonzero survival probability is obtained from solving a relevant boundary value problem. The new first-passage scheme is validated by an excellent agreement between overall rate constant results from the present development and from an accurate boundary collocation calculation for the three common spherical arrays [J. Chem. Phys. 109, 4985 (1998)], namely simple cubic, body-centered cubic, and face-centered cubic arrays, for a wide range of P and f. Here, P is a dimensionless quantity characterizing the relative rate of diffusion versus surface incorporation, and f is the volume fraction of the inclusion. The scheme is further applied to random spherical suspensions and to investigate the effect of inclusion coagulation on overall rate constants. It is found that randomness in inclusion arrangement tends to lower the overall rate constant for f up to the near close-packing value of the regular arrays because of the inclusion screening effect. This screening effect turns stronger for regular arrays when f is near and above the close-packing value of the regular arrays, and consequently the overall rate constant of the random array exceeds that of the regular array. Inclusion coagulation too induces the inclusion screening effect, and leads to lower overall rate constants.

  17. Chemical diffusion on solid surfaces. Final report

    International Nuclear Information System (INIS)

    Hudson, J.B.

    1980-12-01

    The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

  18. From State Dependent Diffusion to Constant Diffusion in Stochastic Differential Equations by the Lamperti Transform

    DEFF Research Database (Denmark)

    Møller, Jan Kloppenborg; Madsen, Henrik

    the Lamperti transform. This note gives an example driven introduction to the Lamperti transform. The general applicability of the Lamperti transform is limited to univariate diffusion processes, but for a restricted class of multivariate diffusion processes Lamperti type transformations are available...

  19. Bag model with diffuse surface

    International Nuclear Information System (INIS)

    Phatak, S.C.

    1986-01-01

    The constraint of a sharp bag boundary in the bag model is relaxed in the present work. This has been achieved by replacing the square-well potential of the bag model by a smooth scalar potential and introducing a term similar to the bag pressure term. The constraint of the conservation of the energy-momentum tensor is used to obtain an expression for the added bag pressure term. The model is then used to determine the static properties of the nucleon. The calculation shows that the rms charge radius and the nucleon magnetic moment are larger than the corresponding bag model values. Also, the axial vector coupling constant and the πNN coupling constant are in better agreement with the experimental values

  20. Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

    DEFF Research Database (Denmark)

    Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

    2012-01-01

    This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

  1. Effective diffusion constant in a two-dimensional medium of charged point scatterers

    International Nuclear Information System (INIS)

    Dean, D S; Drummond, I T; Horgan, R R

    2004-01-01

    We obtain exact results for the effective diffusion constant of a two-dimensional Langevin tracer particle in the force field generated by charged point scatterers with quenched positions. We show that if the point scatterers have a screened Coulomb (Yukawa) potential and are uniformly and independently distributed then the effective diffusion constant obeys the Volgel-Fulcher-Tammann law where it vanishes. Exact results are also obtained for pure Coulomb scatterers frozen in an equilibrium configuration of the same temperature as that of the tracer

  2. Transport and diffusion on crystalline surfaces under external forces

    International Nuclear Information System (INIS)

    Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

    2005-01-01

    We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

  3. Diffusion of particles adsorbed on reconstructive surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

    2005-01-01

    Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

  4. Inter-atomic force constants of BaF{sub 2} by diffuse neutron scattering measurement

    Energy Technology Data Exchange (ETDEWEB)

    Sakuma, Takashi, E-mail: sakuma@mx.ibaraki.ac.jp; Makhsun,; Sakai, Ryutaro [Institute of Applied Beam Science, Ibaraki University, Mito 310-8512 (Japan); Xianglian [College of Physics and Electronics Information, Inner Mongolia University for the Nationalities, Tongliao 028043 (China); Takahashi, Haruyuki [Institute of Applied Beam Science, Ibaraki University, Hitachi 316-8511 (Japan); Basar, Khairul [Faculty of Mathematics and Natural Sciences, Institut Teknologi Bandung, Bandung 40132 (Indonesia); Igawa, Naoki [Quantum Beam Science Directorate, Japan Atomic Energy Agency, Tokai 319-1195 (Japan); Danilkin, Sergey A. [Bragg Institute, Australian Nuclear Science and Technology Organisation, Kirrawee DC NSW 2232 (Australia)

    2015-04-16

    Diffuse neutron scattering measurement on BaF{sub 2} crystals was performed at 10 K and 295 K. Oscillatory form in the diffuse scattering intensity of BaF{sub 2} was observed at 295 K. The correlation effects among thermal displacements of F-F atoms were obtained from the analysis of oscillatory diffuse scattering intensity. The force constants among neighboring atoms in BaF{sub 2} were determined and compared to those in ionic crystals and semiconductors.

  5. Is X-ray emissivity constant on magnetic flux surfaces?

    International Nuclear Information System (INIS)

    Granetz, R.S.; Borras, M.C.

    1997-01-01

    Knowledge of the elongations and shifts of internal magnetic flux surfaces can be used to determine the q profile in elongated tokamak plasmas. X-ray tomography is thought to be a reasonable technique for independently measuring internal flux surface shapes, because it is widely believed that X-ray emissivity should be constant on a magnetic flux surface. In the Alcator C-Mod tokamak, the X-ray tomography diagnostic system consists of four arrays of 38 chords each. A comparison of reconstructed X-ray contours with magnetic flux surfaces shows a small but consistent discrepancy in the radial profile of elongation. Numerous computational tests have been performed to verify these findings, including tests of the sensitivity to calibration and viewing geometry errors, the accuracy of the tomography reconstruction algorithms, and other subtler effects. We conclude that the discrepancy between the X-ray contours and the magnetic flux surfaces is real, leading to the conclusion that X-ray emissivity is not exactly constant on a flux surface. (orig.)

  6. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  7. Decay constants of subcritical system by diffusion theory for two groups

    International Nuclear Information System (INIS)

    Moura Neto, C. de.

    1977-01-01

    The effects of a neutronic pulse applied to a subcritical multiplicative medium are analysed on the basis of the diffusion theory for one and two groups. The decay constants of the system for various values of geometric buckling were determined from the experimental data. A natural uranium-light water lattice was pulsed employing a Texas Nuclear 9905 neutron generator. The least square method was employed in the data reduction procedures to determine the decay constants. The separation of the decay constants associated with thermal and epithermal fluxes is attempted through two groups formulation. (author)

  8. Decay constants of a subcritical system by two-group diffusion theory

    International Nuclear Information System (INIS)

    Moura Neto, C. de.

    1979-08-01

    The effects of a neutronic pulse applied to a subcritical multiplicative medium are analyzed on the basis of the diffusion theory for one and two groups. The decay constants of the system were determined from the experimental data, for various values geometric buckling. A natural uranium light-water configuration was pulsed employing a Texas Nuclear 9905 neutron generator. The least square method was employed in the data reduction procedures to determine the decay constants. The separation of the decay constants associated with thermal and epithermal fluxes are verified through two groups formulation. (Author) [pt

  9. Darboux transformations for (1+2)-dimensional Fokker-Planck equations with constant diffusion matrix

    International Nuclear Information System (INIS)

    Schulze-Halberg, Axel

    2012-01-01

    We construct a Darboux transformation for (1+2)-dimensional Fokker-Planck equations with constant diffusion matrix. Our transformation is based on the two-dimensional supersymmetry formalism for the Schrödinger equation. The transformed Fokker-Planck equation and its solutions are obtained in explicit form.

  10. Auto-correlation of velocity-fluctuations and frequency-dependent diffusion constant for hot electrons

    International Nuclear Information System (INIS)

    Roy, M.D.; Nag, B.R.

    1981-01-01

    A method has been developed for determining the auto-correlation functions of the fluctuations in the transverse and the parallel components of hot carrier-velocity in a semiconductor by Monte Carlo simulation. The functions for electrons in InSb are determined by this method for applied electric fields of 50 V/cm, 75 V/cm, and 100 V/cm. With increasing value of the time interval the transverse auto-correlation function fall nearly exponentially to zero, but the parallel function falls sharply to a negative peak, then rises to positive values and finally becomes zero. The interval beyond which the auto-correlation function is zero and the correlation time are also evaluated. The correlation time is found to be approximately 1.6 times the relaxation time calculated from the chord mobility. The effect of the flight sampling time on the value of variance of the displacement, is investigated in terms of the low frequency diffusion constants, determined from the variation of the correlation functions. It is found that the diffusion constants become independent of the sampling time if it is of the order of one hundred times the relaxation time. The frequency-dependent diffusion constants are calculated from the correlation functions. The transverse diffusion constant falls monotonically with frequency for all the field strengths studied. The parallel diffusion constant has similar variation for the lower fields (50 V/cm and 75 V/cm) but it has a peak at about 44 GHz for the field of 100 V/cm. (orig.)

  11. Derivation of Inter-Atomic Force Constants of Cu2O from Diffuse Neutron Scattering Measurement

    Directory of Open Access Journals (Sweden)

    T. Makhsun

    2013-04-01

    Full Text Available Neutron scattering intensity from Cu2O compound has been measured at 10 K and 295 K with High Resolution Powder Diffractometer at JRR-3 JAEA. The oscillatory diffuse scattering related to correlations among thermal displacements of atoms was observed at 295 K. The correlation parameters were determined from the observed diffuse scattering intensity at 10 and 295 K. The force constants between the neighboring atoms in Cu2O were estimated from the correlation parameters and compared to those of Ag2O

  12. Spectral function and quark diffusion constant in non-critical holographic QCD

    Energy Technology Data Exchange (ETDEWEB)

    Bu Yanyan, E-mail: yybu@itp.ac.cn [Institute of Theoretical Physics, Academia Sinica, Beijing 100190 (China); Yang Jinmin, E-mail: jmyang@itp.ac.cn [Institute of Theoretical Physics, Academia Sinica, Beijing 100190 (China)

    2012-02-11

    Motivated by recent studies of intersecting D-brane systems in critical string theory and phenomenological AdS/QCD models, we present a detailed analysis for the vector and scalar fluctuations in a non-critical holographic QCD model in the high temperature phase, i.e., the chiral symmetric phase. This model is described by N{sub f} pairs of D4 and D4{sup Macron} probe branes in a non-critical AdS{sub 6} black hole background. Focusing on the hydrodynamic as well as the high frequency limit, we analytically obtain spectral functions for vector and scalar modes on the flavor probe. Then we extract the light quark diffusion constant for flavor current using three different methods and find that different methods give the same results. We also compute the heavy quark diffusion constant for comparison with the light quark case.

  13. Communication: Diffusion constant in supercooled water as the Widom line is crossed in no man's land

    Science.gov (United States)

    Ni, Yicun; Hestand, Nicholas J.; Skinner, J. L.

    2018-05-01

    According to the liquid-liquid critical point (LLCP) hypothesis, there are two distinct phases of supercooled liquid water, namely, high-density liquid and low-density liquid, separated by a coexistence line that terminates in an LLCP. If the LLCP is real, it is located within No Man's Land (NML), the region of the metastable phase diagram that is difficult to access using conventional experimental techniques due to rapid homogeneous nucleation to the crystal. However, a recent ingenious experiment has enabled measurement of the diffusion constant deep inside NML. In the current communication, these recent measurements are compared, with good agreement, to the diffusion constant of E3B3 water, a classical water model that explicitly includes three-body interactions. The behavior of the diffusion constant as the system crosses the Widom line (the extension of the liquid-liquid coexistence line into the one-phase region) is analyzed to derive information about the presence and location of the LLCP. Calculations over a wide range of temperatures and pressures show that the new experimental measurements are consistent with an LLCP having a critical pressure of over 0.6 kbar.

  14. Pulsed neutron determination of anisotropic diffusion constants in multi-layered slabs

    International Nuclear Information System (INIS)

    Sri Ram, K.

    1978-01-01

    Anisotropic neutron diffusion parameters for graphite and plexiglas slab assemblies were calculated using one-dimensional discrete ordinates code ANISN, and also Case's eigenfunction expansion technique as suggested by Leonard. These calculated values were checked with the pulsed neutron experimental results as well as simple diffusion theory calculations of Spinrad. Relatively little experimental work has been done with heterogeneous assemblies which do not contain voids. The present comparison shows that the experimental results agree well with transport theory calculations. It appears from the results and inter-comparison of this work in simple geometries, that the pulsed neutron method can yield accurate experimental anisotropic diffusion constants, and can therefore be applied to more complicated geometries which may be difficult to calculate. (author)

  15. Diffusion of particles on a fluctuating surface

    Czech Academy of Sciences Publication Activity Database

    Tarasenko, Alexander; Jastrabík, Lubomír

    2011-01-01

    Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

  16. Detection analysis of surface hydroxyl active sites and simulation calculation of the surface dissociation constants of aqueous diatomite suspensions

    Science.gov (United States)

    Ma, Shu-Cui; Wang, Zhi-Gang; Zhang, Ji-Lin; Sun, De-Hui; Liu, Gui-Xia

    2015-02-01

    The surface properties of the diatomite were investigated using nitrogen adsorption/deadsorption isotherms, TG-DSC, FTIR, and XPS, and surface protonation-deprotonation behavior was determined by continuous acid-base potentiometric titration technique. The diatomite sample with porous honeycomb structure has a BET specific surface area of 10.21 m2/g and large numbers of surface hydroxyl functional groups (i.e. tbnd Si-OH, tbnd Fe-OH, and tbnd Al-OH). These surface hydroxyls can be protonated or deprotonated depending on the pH of the suspension. The experimental potentiometric data in two different ionic strength solutions (0.1 and 0.05 mol/L NaCl) were fitted using ProtoFit GUI V2.1 program by applying diffuse double layer model (DLM) with three amphoteric sites and minimizing the sum of squares between a dataset derivative function and a model derivative function. The optimized surface parameters (i.e. surface dissociation constants (log K1, log K2) and surface site concentrations (log C)) of the sample were obtained. Based on the optimized surface parameters, the surface species distribution was calculated using Program-free PHREEQC 3.1.2. Thus, this work reveals considerable new information about surface protonation-deprotonation processes and surface adsorptive behaviors of the diatomite, which helps us to effectively use the cheap and cheerful diatomite clay adsorbent.

  17. A critical comparison of constant and pulsed flow systems exploiting gas diffusion.

    Science.gov (United States)

    Silva, Claudineia Rodrigues; Henriquez, Camelia; Frizzarin, Rejane Mara; Zagatto, Elias Ayres Guidetti; Cerda, Victor

    2016-02-01

    Considering the beneficial aspects arising from the implementation of pulsed flows in flow analysis, and the relevance of in-line gas diffusion as an analyte separation/concentration step, influence of flow pattern in flow systems with in-line gas diffusion was critically investigated. To this end, constant or pulsed flows delivered by syringe or solenoid pumps were exploited. For each flow pattern, two variants involving different interaction times of the donor with the acceptor streams were studied. In the first one, both the acceptor and donor streams were continuously flowing, whereas in the second one, the acceptor was stopped during the gas diffusion step. Four different volatile species (ammonia, ethanol, carbon dioxide and hydrogen sulfide) were selected as models. For the flow patterns and variants studied, the efficiencies of mass transport in the gas diffusion process were compared, and sensitivity, repeatability, sampling frequency and recorded peak shape were evaluated. Analysis of the results revealed that sensitivity is strongly dependent on the implemented variant, and that flow pattern is an important feature in flow systems with in-line gas diffusion. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Investigation of ion diffusion towards plasmonic surfaces

    International Nuclear Information System (INIS)

    Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

    2013-01-01

    Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

  19. A model for diffuse and global irradiation on horizontal surface

    International Nuclear Information System (INIS)

    Jain, P.C.

    1984-01-01

    The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

  20. The concept of mass angular scattering power and its relation to the diffusion constant

    Energy Technology Data Exchange (ETDEWEB)

    Sandison, George A.; Papiez, Lech S. [School of Health Sciences, Purdue University, West Lafayette, IN (United States)

    1998-09-01

    An understanding of the scattering of high energy charged particle beams by tissue is required in radiotherapy since the particle trajectories determine the pattern of radiation dose deposition in patients. Numerical calculations of radiation dose often utilize energy dependent values of the angular scattering power. However, the physics literature is replete with confused interpretations of the concept of angular scattering power and its relation to the single scattering cross section for the medium or the diffusion constant in the diffusional limit. The purpose of this article is to clarify these notions.

  1. Detection analysis of surface hydroxyl active sites and simulation calculation of the surface dissociation constants of aqueous diatomite suspensions

    International Nuclear Information System (INIS)

    Ma, Shu-Cui; Wang, Zhi-Gang; Zhang, Ji-Lin; Sun, De-Hui; Liu, Gui-Xia

    2015-01-01

    Highlights: • To examine surface hydroxyl functional groups of the calcined diatomite by TGA-DSC, FTIR, and XPS. • To calculate the optimized log K 1 , log K 2 and log C values and the surface species distribution of each surface reactive site using ProtoFit and PHREEQC, respectively. - Abstract: The surface properties of the diatomite were investigated using nitrogen adsorption/deadsorption isotherms, TG-DSC, FTIR, and XPS, and surface protonation–deprotonation behavior was determined by continuous acid–base potentiometric titration technique. The diatomite sample with porous honeycomb structure has a BET specific surface area of 10.21 m 2 /g and large numbers of surface hydroxyl functional groups (i.e. ≡Si-OH, ≡Fe-OH, and ≡Al-OH). These surface hydroxyls can be protonated or deprotonated depending on the pH of the suspension. The experimental potentiometric data in two different ionic strength solutions (0.1 and 0.05 mol/L NaCl) were fitted using ProtoFit GUI V2.1 program by applying diffuse double layer model (DLM) with three amphoteric sites and minimizing the sum of squares between a dataset derivative function and a model derivative function. The optimized surface parameters (i.e. surface dissociation constants (log K 1 , log K 2 ) and surface site concentrations (log C)) of the sample were obtained. Based on the optimized surface parameters, the surface species distribution was calculated using Program-free PHREEQC 3.1.2. Thus, this work reveals considerable new information about surface protonation–deprotonation processes and surface adsorptive behaviors of the diatomite, which helps us to effectively use the cheap and cheerful diatomite clay adsorbent

  2. Detection analysis of surface hydroxyl active sites and simulation calculation of the surface dissociation constants of aqueous diatomite suspensions

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Shu-Cui [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Key Laboratory of Applied Chemistry and Nanotechnology at Universities of Jilin Province, Changchun University of Science and Technology, Changchun 130022 (China); Wang, Zhi-Gang [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Zhang, Ji-Lin, E-mail: zjl@ciac.ac.cn [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Sun, De-Hui [Changchun Institute Technology, Changchun 130012 (China); Liu, Gui-Xia, E-mail: liuguixia22@163.com [Key Laboratory of Applied Chemistry and Nanotechnology at Universities of Jilin Province, Changchun University of Science and Technology, Changchun 130022 (China)

    2015-02-01

    Highlights: • To examine surface hydroxyl functional groups of the calcined diatomite by TGA-DSC, FTIR, and XPS. • To calculate the optimized log K{sub 1}, log K{sub 2} and log C values and the surface species distribution of each surface reactive site using ProtoFit and PHREEQC, respectively. - Abstract: The surface properties of the diatomite were investigated using nitrogen adsorption/deadsorption isotherms, TG-DSC, FTIR, and XPS, and surface protonation–deprotonation behavior was determined by continuous acid–base potentiometric titration technique. The diatomite sample with porous honeycomb structure has a BET specific surface area of 10.21 m{sup 2}/g and large numbers of surface hydroxyl functional groups (i.e. ≡Si-OH, ≡Fe-OH, and ≡Al-OH). These surface hydroxyls can be protonated or deprotonated depending on the pH of the suspension. The experimental potentiometric data in two different ionic strength solutions (0.1 and 0.05 mol/L NaCl) were fitted using ProtoFit GUI V2.1 program by applying diffuse double layer model (DLM) with three amphoteric sites and minimizing the sum of squares between a dataset derivative function and a model derivative function. The optimized surface parameters (i.e. surface dissociation constants (log K{sub 1}, log K{sub 2}) and surface site concentrations (log C)) of the sample were obtained. Based on the optimized surface parameters, the surface species distribution was calculated using Program-free PHREEQC 3.1.2. Thus, this work reveals considerable new information about surface protonation–deprotonation processes and surface adsorptive behaviors of the diatomite, which helps us to effectively use the cheap and cheerful diatomite clay adsorbent.

  3. Plasma diffusion in systems with disrupted magnetic surfaces

    International Nuclear Information System (INIS)

    Morozov, D.K.; Pogutse, O.P.

    1982-01-01

    Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

  4. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

  5. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    OpenAIRE

    M. R. Monazzam

    2006-01-01

    Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

  6. Effect of strain on surface diffusion and nucleation

    DEFF Research Database (Denmark)

    Brune, Harald; Bromann, Karsten; Röder, Holger

    1995-01-01

    The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

  7. Diffusion and surface alloying of gradient nanostructured metals

    Directory of Open Access Journals (Sweden)

    Zhenbo Wang

    2017-03-01

    Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

  8. Single atom self-diffusion on nickel surfaces

    International Nuclear Information System (INIS)

    Tung, R.T.; Graham, W.R.

    1980-01-01

    Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

  9. Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

    Energy Technology Data Exchange (ETDEWEB)

    Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

    1976-08-01

    The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

  10. A Congruence Theorem for Minimal Surfaces in $S^{5}$ with Constant Contact Angle

    OpenAIRE

    Montes, Rodrigo Ristow; Verderesi, Jose A.

    2006-01-01

    We provide a congruence theorem for minimal surfaces in $S^5$ with constant contact angle using Gauss-Codazzi-Ricci equations. More precisely, we prove that Gauss-Codazzi-Ricci equations for minimal surfaces in $S^5$ with constant contact angle satisfy an equation for the Laplacian of the holomorphic angle. Also, we will give a characterization of flat minimal surfaces in $S^5$ with constant contact angle.

  11. Self-diffusion on copper surfaces

    DEFF Research Database (Denmark)

    Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

    1991-01-01

    The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

  12. Evaporation Kinetics of Polyol Droplets: Determination of Evaporation Coefficients and Diffusion Constants

    Science.gov (United States)

    Su, Yong-Yang; Marsh, Aleksandra; Haddrell, Allen E.; Li, Zhi-Ming; Reid, Jonathan P.

    2017-11-01

    In order to quantify the kinetics of mass transfer between the gas and condensed phases in aerosol, physicochemical properties of the gas and condensed phases and kinetic parameters (mass/thermal accommodation coefficients) are crucial for estimating mass fluxes over a wide size range from the free molecule to continuum regimes. In this study, we report measurements of the evaporation kinetics of droplets of 1-butanol, ethylene glycol (EG), diethylene glycol (DEG), and glycerol under well-controlled conditions (gas flow rates and temperature) using the previously developed cylindrical electrode electrodynamic balance technique. Measurements are compared with a model that captures the heat and mass transfer occurring at the evaporating droplet surface. The aim of these measurements is to clarify the discrepancy in the reported values of mass accommodation coefficient (αM, equals to evaporation coefficient based on microscopic reversibility) for 1-butanol, EG, and DEG and improve the accuracy of the value of the diffusion coefficient for glycerol in gaseous nitrogen. The uncertainties in the thermophysical and experimental parameters are carefully assessed, the literature values of the vapor pressures of these components are evaluated, and the plausible ranges of the evaporation coefficients for 1-butanol, EG, and DEG as well as uncertainty in diffusion coefficient for glycerol are reported. Results show that αM should be greater than 0.4, 0.2, and 0.4 for EG, DEG, and 1-butanol, respectively. The refined values are helpful for accurate prediction of the evaporation/condensation rates.

  13. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  14. Friction and diffusion dynamics of adsorbates at surfaces

    NARCIS (Netherlands)

    Fusco, C.

    2005-01-01

    A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

  15. NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

    DEFF Research Database (Denmark)

    Johannesson, Björn

    2008-01-01

    Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

  16. Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

    Directory of Open Access Journals (Sweden)

    Muhammad Qasim

    2013-01-01

    Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

  17. Determination of diffuse double layer protonation constants for hydrous ferric oxide (HFO): supporting evidence for the Dzombak and Morel compilation

    CSIR Research Space (South Africa)

    Pretorius, PJ

    1998-01-01

    Full Text Available of the experimental system suggests that titration points below pH 4 should not be used for the determination of protonation constants because of potential HFO dissolution. Surface protonation constant, PZC and binding site estimates agree excellently with currently...

  18. Comparison of Green-Kubo and nonequilibrium calculations of the self-diffusion constant of a Lennard-Jones fluid

    International Nuclear Information System (INIS)

    Erpenbeck, J.J.

    1987-01-01

    We apply the so-called ''synthetic'' nonequilibrium molecular-dynamics method to the calculation of the self-diffusion constant of a Lennard-Jones fluid at a number density of 0.85/σ 3 and a temperature of 1.08 epsilon-c/k/sub B/ (where epsilon-c and σ are the energy and length parameters of the potential and k/sub B/ is the Boltzmann constant). By comparing with the Green-Kubo calculation for the same state of the system and for the same number of particles, N, we find the latter calculation to yield more precise values of the self-diffusion constant for a given number of molecular-dynamics time steps. Even at small values of the diffusion current, a nontrivial time is needed for the nonequilibrium calculation to reach the steady state. For larger values of the driving force, the steady-state flow appears to become unstable and evidence of a secondary flow pattern is presented. The presence of these instabilities acts as a limit to the range of the driving force for which the steady-state method can be applied. With increasing N the range of stable values of the diffusion current density decreases. For the Green-Kubo calculations, the N dependence of the self-diffusion constant is found to be anomalous for N = 108, with the 1/N dependence only exhibited for at least 500 particles. The nonequilibrium results, while approximately independent of N for 108 and 500 particles, are found to have a similar anomalous N dependence when we extend the calculations to 1372 particles, thereby bringing the Green-Kubo and nonequilibrium results into agreement in the large-system limit

  19. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  20. Reactive solid surface morphology variation via ionic diffusion.

    Science.gov (United States)

    Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

    2012-08-14

    In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

  1. Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

    International Nuclear Information System (INIS)

    Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

    2009-01-01

    Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

  2. SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

    Directory of Open Access Journals (Sweden)

    M. R. Monazzam

    2006-10-01

    Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

  3. Recursion Formulae for Obtaining Surfaces with Constant Mean Curvature in R2,1

    International Nuclear Information System (INIS)

    Tian Yongbo; Nan Zhijie; Tian Chou

    2007-01-01

    Though the Baecklund transformation on time-like surfaces with constant mean curvature surfaces in R 2,1 has been obtained, it is not easy to obtain corresponding surfaces because the procedure of solving the related integrable system cannot be avoided when the Baecklund transformation is used. For sake of this, in this article, some special work is done to reform the Baecklund transformation to a recursion formula, by which we can construct time-like surfaces with constant mean curvature form known ones just by quadrature procedure.

  4. A systematic method for correlating measurements of channel powers with the lattice constants in the neutron diffusion equations

    International Nuclear Information System (INIS)

    Buckler, A.N.

    1978-10-01

    The report describes the theoretical basis of the methods that have been developed for correlating measurements of spatially distributed quantities taken on the reactor with the lattice constants in the diffusion equations. The method can be used with any thermal reactor system of current interest, but the first application is to provide a replacement for the SAMSON code for Winfrith SGHW studies, where the measurements of interest are channel powers. (author)

  5. Linear response theory of activated surface diffusion with interacting adsorbates

    Energy Technology Data Exchange (ETDEWEB)

    Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

    2010-05-12

    Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

  6. Physical interpretation and geometrical representation of constant curvature surfaces in Euclidean and pseudo-Euclidean spaces

    International Nuclear Information System (INIS)

    Catoni, Francesco; Cannata, Roberto; Zampetti, Paolo

    2005-08-01

    The Riemann and Lorentz constant curvature surfaces are investigated from an Euclidean point of view. The four surfaces (constant positive and constant negative curvatures with definite and non-definite fine elements) are represented as surfaces in a Riemannian or in a particular semi-Riemannian flat space and it is shown that the complex and the hyperbolic numbers allow to obtain the same equations for the corresponding Riemann and Lorentz surfaces, respectively. Moreover it is shown that the geodesics on the Lorentz surfaces states, from a physical point of view, a link between curvature and fields. This result is obtained just as a consequence of the space-time geometrical symmetry, without invoking the famous Einstein general relativity postulate [it

  7. Diffusion processes in bombardment-induced surface topography

    International Nuclear Information System (INIS)

    Robinson, R.S.

    1984-01-01

    The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

  8. A diffuse radar scattering model from Martian surface rocks

    Science.gov (United States)

    Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

    1987-01-01

    Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

  9. On the diffusion and self-trapping of surface dimers

    Science.gov (United States)

    Kappus, W.

    1982-03-01

    The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

  10. Nonthermal Effects of Photon Illumination on Surface Diffusion

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

    1998-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

  11. Diffusion of N adatoms on the Fe(100) surface

    DEFF Research Database (Denmark)

    Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

    2000-01-01

    The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

  12. Velocity auto-correlation and hot-electron diffusion constant in GaAs and InP

    International Nuclear Information System (INIS)

    Deb Roy, M.

    1982-01-01

    Auto-correlation functions of the fluctuations in the electron velocities transverse and parallel to the applied electric field are calculated by the Monte Carlo method for GaAs and InP at three different values of field strength which are around three times the threshold field for negative differential mobility in each case. From these the frequency-dependent diffusion coefficients transverse and parallel to the applied field and the figure of merit for noise performance when used in a microwave amplifying device are determined. The results indicate that the transverse auto-correlation function Csub(t)(s) falls nearly exponentially to zero with increasing interval s while the parallel function Csub(p)(s) falls sharply, attains a minimum and then rises towards zero. In each case a higher field gives a higher rate of fall and makes the correlation functions zero within a shorter interval. The transverses diffusion coefficient falls monotonically with the frequency but the parallel diffusion coefficient generally starts with a low value at low frequencies, rises to a maximum and then falls. InP, with a larger separation between the central and the satellite valleys, has a higher value of the low frequency transverse diffusion coefficient and a lower value of its parallel counterpart. The noise performance of microwave semiconductor amplifying devices depends mainly on the low frequency parallel diffusion constant and consequently devices made out of materials like InP with a large separation between valleys are likely to have better noise characteristics. (orig.)

  13. Measurement of the Anisotropy of Diffusion Constant in Media with Empty Channels; Mesure de l'Anisotropie de la Constante de Diffusion dans des Milieux a Canaux Vides; Izmerenie anizotropii postoyannoj diffuzii v srede s pustymi kanalami; Medicion de la Anisotropia de la Constante de Difusion en Varios Sistemas con Canales Vacios

    Energy Technology Data Exchange (ETDEWEB)

    Copic, M.; Kalin, T.; Pregl, G.; Zerdin, F. [Nuclear Institute Jozef Stefan, Ljubljana, Yugoslavia (Slovenia)

    1964-04-15

    Using the pulsed-neutron source technique, the diffusion constant was measured in systems with empty channels. Plexiglas was used as the neutron diffusing material. From separate sets of measurements on rectangular blocks the diffusion constants parallel and perpendicular to channels were determined. The average value of the diffusion constant was also obtained experimentally from measurements on cubes. The difference between both diffusion constants, D{sub Double-Up-Tack} - D{sub Up-Tack }, agrees with theoretical predictions inside the limits of experimental errors, yet the average diffusion constant lies systematically below the predictions of Behrens' theory. (author) [French] En se servant de la methode de la source des neutrons puises, les auteurs ont mesure la constante de diffusion dans des systemes a canaux vides. Comme matiere diffusant les neutrons, ils ont utilise du plexiglas. A partir de series de mesures differentes faites sur des blocs rectangulaires, ils ont determine les constantes de diffusion parallele et perpendiculaire aux canaux. Ils ont egalement obtenu experimentalement la valeiir moyenne de la constante de diffusion a i'aide de mesures faites sur des cubes. La difference entre les deux constantes de diffusion, D{sub Double-Up-Tack} - D{sub Up-Tack }, concorde avec les previsions theoriques dans les limites des erreurs d'experience; cependant, la valeur moyenne de la constante de diffusion reste systematiquement inferieure aux previsions etablies par la theorie de Behrens. (author) [Spanish] Utilizando la tecnica de la fuente neutronica pulsada, los autores midieron la constante de difusion en varios sistemas con canales vacios. Como material difusor de neutrones emplearon polimetacrilato de metilo. Basandose en varias series de mediciones efectuadas en bloques rectangulares, los autores determinaron las constantes de difusion Inverted-Question-Mark n sentido paralelo y perpendicular a los canales. Obtuvieron experimentalmente el valor

  14. Diffusion of zinc into an unpassivated surface of indium phosphide

    International Nuclear Information System (INIS)

    Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

    1989-01-01

    Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

  15. The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

    International Nuclear Information System (INIS)

    Durakanoglu, S.

    2004-01-01

    Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

  16. Collisional diffusion in a torus with imperfect magnetic surfaces

    International Nuclear Information System (INIS)

    White, R.B.

    1983-03-01

    A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

  17. II. Inhibited Diffusion Driven Surface Transmutations

    Science.gov (United States)

    Chubb, Talbot A.

    2006-02-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.

  18. II. Inhibited diffusion driven surface transmutations

    International Nuclear Information System (INIS)

    Cubb, Talbot A.

    2006-01-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  19. II. Inhibited diffusion driven surface transmutations

    Energy Technology Data Exchange (ETDEWEB)

    Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)

    2006-07-01

    This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

  20. Perturbation theory for the effective diffusion constant in a medium of random scatterers

    International Nuclear Information System (INIS)

    Dean, D S; Drummond, I T; Horgan, R R; Lefevre, A

    2004-01-01

    We develop perturbation theory and physically motivated resummations of the perturbation theory for the problem of a tracer particle diffusing in a random medium. The random medium contains point scatterers of density ρ uniformly distributed throughout the material. The tracer is a Langevin particle subjected to the quenched random force generated by the scatterers. Via our perturbative analysis, we determine when the random potential can be approximated by a Gaussian random potential. We also develop a self-similar renormalization group approach based on thinning out the scatterers; this scheme is similar to that used with success for diffusion in Gaussian random potentials and agrees with known exact results. To assess the accuracy of this approximation scheme, its predictions are confronted with results obtained by numerical simulation

  1. Bulk-mediated surface diffusion: non-Markovian desorption dynamics

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

    2005-01-01

    Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

  2. The motion of a vortex on a closed surface of constant negative curvature.

    Science.gov (United States)

    Ragazzo, C Grotta

    2017-10-01

    The purpose of this work is to present an algorithm to determine the motion of a single hydrodynamic vortex on a closed surface of constant curvature and of genus greater than one. The algorithm is based on a relation between the Laplace-Beltrami Green function and the heat kernel. The algorithm is used to compute the motion of a vortex on the Bolza surface. This is the first determination of the orbits of a vortex on a closed surface of genus greater than one. The numerical results show that all the 46 vortex equilibria can be explicitly computed using the symmetries of the Bolza surface. Some of these equilibria allow for the construction of the first two examples of infinite vortex crystals on the hyperbolic disc. The following theorem is proved: 'a Weierstrass point of a hyperellitic surface of constant curvature is always a vortex equilibrium'.

  3. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    International Nuclear Information System (INIS)

    Olin, M.; Valkiainen, M.; Aalto, H.

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

  4. Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

    Energy Technology Data Exchange (ETDEWEB)

    Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

    1997-12-01

    This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

  5. Convergence of surface diffusion parameters with model crystal size

    Science.gov (United States)

    Cohen, Jennifer M.; Voter, Arthur F.

    1994-07-01

    A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

  6. Asymptotic stability of constant steady states for a 2×2 reaction–diffusion system arising in cancer modelling

    KAUST Repository

    Di Francesco, Marco

    2011-04-01

    The dependence of tumor on essential nutrients is known to be crucial for its evolution and has become one of the targets for medical therapies. Based on this fact a reaction-diffusion system with chemotaxis term and nutrient-based growth of tumors is presented. The formulation of the model considers also an influence of tumor and pharmacological factors on nutrient concentration. In the paper, convergence of solutions to constant, stationary states in the one-dimensional case for small perturbation of the equilibria is investigated. The nonlinear stability results are obtained by means of the classical symmetrization method and energy Sobolev estimates. © 2010 Elsevier Ltd.

  7. Asymptotic stability of constant steady states for a 2×2 reaction–diffusion system arising in cancer modelling

    KAUST Repository

    Di Francesco, Marco; Twarogowska, Monika

    2011-01-01

    The dependence of tumor on essential nutrients is known to be crucial for its evolution and has become one of the targets for medical therapies. Based on this fact a reaction-diffusion system with chemotaxis term and nutrient-based growth of tumors is presented. The formulation of the model considers also an influence of tumor and pharmacological factors on nutrient concentration. In the paper, convergence of solutions to constant, stationary states in the one-dimensional case for small perturbation of the equilibria is investigated. The nonlinear stability results are obtained by means of the classical symmetrization method and energy Sobolev estimates. © 2010 Elsevier Ltd.

  8. In vivo quantification of the unidirectional influx constant for Gd-DTPA diffusion across the myocardial capillaries with MR imaging

    DEFF Research Database (Denmark)

    Larsson, H B; Stubgaard, M; Søndergaard, Lise

    1994-01-01

    The authors present an in vivo method for measuring the unidirectional influx constant (Ki) for gadolinium diethylenetriaminepentaacetic acid (DTPA) diffusion across the capillary membrane in the human myocardium with magnetic resonance imaging. Ki is related to the extraction fraction (E......) and the perfusion (F) by the equation Ki = E.F.Ki was obtained by using the longitudinal relaxation rate (R1) as a measure of the myocardial concentration of Gd-DTPA in the mathematical model for transcapillary transport across capillary membranes. Myocardial enhancement after Gd-DTPA injection was followed...

  9. Atomic diffusion in laser surface modified AISI H13 steel

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2013-07-01

    This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

  10. Flowing afterglow: construction of an apparatus, measurement of rate constants, and consideration of the diffusive behavior of charges

    International Nuclear Information System (INIS)

    Matsuoka, Shingo; Nakamura, Hirone; Tamura, Takaaki; Fujii, Toshihiro.

    1984-01-01

    A flowing afterglow apparatus was constructed and the operation of the afterglow system including data analysis was tested by measuring the rate constants for the reactions N + + NO, N 2 + + NO, He + + N 2 , and SF 6 + e; the results were 5.8 x 10 -10 , 3.9 x 10 -10 , 1.20 x 10 -9 , and 2.1 x 10 -7 cm 3 s -1 respectively. In the measurements an extraction voltage for ion sampling was not applied to the nose cone in order not to introduce an electric field into the reaction region. A ''non-ambipolar'' model developed by us was used for the data analysis of the ion/molecule reactions. For the data analysis of the electron attachment, a typical curve fit mehtod to the product ion signal was used. However, no theoretical curves fit the experimental points. This disagreement is attributed to a change of the ion-sampling efficiency through the nose-cone aperture arising from a change of the electron-dominated plasma to a negative-ion-dominated plasma with an increasing flow rate of SF 6 . Nevertheless, the attachment rate could be determined by fitting the theoretical and experimantal curves in the limited region of the SF 6 flow rate where the negative-ion-dominated plasma is established at the sampling aperture. All the rate constants obtained here agree reasonably well with literature values. Next, errors in the positive ion/molecule reaction rate constants, which would occur if the diffusion coefficients of the ions and neutrals each have a + 10 % error were calculated for the flow model to be -0.4 and +1.2 % respectively, demonstrating that these parameters are not important in the analysis of data. This insensitivity explains why the nose-cone voltage applied in a typical flowing afterglow operation has not caused a significant error in the published rate constants although it disturbs the ion diffusive behavior. (author)

  11. Semiconductor surface diffusion: Nonthermal effects of photon illumination

    International Nuclear Information System (INIS)

    Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

    2000-01-01

    Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

  12. Palladium diffusion into bulk copper via the (100) surface

    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

    2009-08-05

    Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

  13. Plateau diffusion coefficient for arbitrary flux surface geometry

    International Nuclear Information System (INIS)

    Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

    1981-03-01

    A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

  14. Surface acoustic waves and elastic constants of InN epilayers determined by Brillouin scattering

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez-Rioboo, R.J.; Prieto, C. [Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, Madrid (Spain); Cusco, R.; Domenech-Amador, N.; Artus, L. [Institut Jaume Almera, Consell Superior d' Investigacions Cientifiques (CSIC), Lluis Sole i Sabaris s.n., Barcelona, Catalonia (Spain); Yamaguchi, T.; Nanishi, Y. [Faculty of Science and Engineering, Ritsumeikan University, Noji-Higashi, Kusatsu, Shiga (Japan)

    2012-06-15

    The surface acoustic wave velocity in InN has been experimentally determined by means of Brillouin scattering experiments on c - and m -face epilayers. From simulations based on the Green's function formalism we determine the shear elastic constants c{sub 66} and c{sub 44} and propose a complete set of elastic constants for wurtzite InN. The analysis of the sagittal and azimuthal dependence of the surface acoustic wave velocity indicates a slightly different elastic behavior of the m -face sample that basically affects the c{sub 44} elastic constant. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  15. Dimer-flipping-assisted diffusion on a Si(001) surface

    International Nuclear Information System (INIS)

    Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

    2000-01-01

    The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

  16. Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

    Science.gov (United States)

    Hatakeyama, S.; Horiuchi, W.; Kohama, A.

    2018-05-01

    The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

  17. Bonnesen-style inequality for the first eigenvalue on a complete surface of constant curvature

    Directory of Open Access Journals (Sweden)

    Niufa Fang

    2017-08-01

    Full Text Available Abstract By Cheeger’s isoperimetric constants, some lower bounds and upper bounds of λ 1 $\\lambda_{1}$ , the first eigenvalue on a complete surface of constant curvature, are given. Some Bonnesen-style inequalities and reverse Bonnesen-style inequalities for the first eigenvalue are obtained. Those Bonnesen-style inequalities obtained are stronger than the well-known Osserman’s results and the upper bound is stronger than Osserman’s results (Osserman in Proceedings of the International Congress of Mathematicians, Helsinki, 1978.

  18. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  19. Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

    International Nuclear Information System (INIS)

    Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

    2014-01-01

    We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

  20. Cholesterol enhances surface water diffusion of phospholipid bilayers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

    2014-12-14

    Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

  1. Surface Casimir densities and induced cosmological constant on parallel branes in AdS spacetime

    International Nuclear Information System (INIS)

    Saharian, Aram A.

    2004-01-01

    Vacuum expectation value of the surface energy-momentum tensor is evaluated for a massive scalar field with general curvature coupling parameter subject to Robin boundary conditions on two parallel branes located on (D+1)-dimensional anti-de Sitter bulk. The general case of different Robin coefficients on separate branes is considered. As a regularization procedure the generalized zeta function technique is used, in combination with contour integral representations. The surface energies on the branes are presented in the form of the sums of single brane and second brane-induced parts. For the geometry of a single brane both regions, on the left (L-region) and on the right (R-region), of the brane are considered. The surface densities for separate L- and R-regions contain pole and finite contributions. For an infinitely thin brane taking these regions together, in odd spatial dimensions the pole parts cancel and the total surface energy is finite. The parts in the surface densities generated by the presence of the second brane are finite for all nonzero values of the interbrane separation. It is shown that for large distances between the branes the induced surface densities give rise to an exponentially suppressed cosmological constant on the brane. In the Randall-Sundrum braneworld model, for the interbrane distances solving the hierarchy problem between the gravitational and electroweak mass scales, the cosmological constant generated on the visible brane is of the right order of magnitude with the value suggested by the cosmological observations

  2. Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

    International Nuclear Information System (INIS)

    Cousty, J.P.

    1981-12-01

    In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

  3. Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

    2007-02-21

    During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

  4. Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

    2008-01-01

    Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

  5. Novel exchange mechanisms in the surface diffusion of oxides

    International Nuclear Information System (INIS)

    Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

    2004-01-01

    We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

  6. Multiple scattering of electromagnetic waves in disordered magnetic media localization parameter, energy transport velocity and diffusion constant

    CERN Document Server

    Pinheiro, F A; Martínez, A S

    2001-01-01

    We review some of our recent results concerning the single and multiple electromagnetic scattering by magnetic spherical particles. For a single electromagnetic scattering we show that the magnetic contribution alters, when compared to nonmagnetic scattering, the behavior of the cross sections and mean cosine of the scattering angle (cos omega). For ferromagnetic particles, resonances may occur even in the small-particle limit when the particle radius is much smaller than the wavelength. The resonances increase the cross sections while (cos omega) is diminished , and even may become negative. Several quantities such the Ioffe-Regel parameter for localization are calculated for the multiple scattering regime. We show that magnetic scattering favors the observation of localization of electromagnetic waves in three dimensions. Further, this is also verified for dynamical experiments, where we show that the diffusion constant can be very small. Since the magnetic permeability of the scatterers can vary significan...

  7. A calculation of baryon diffusion constant in hot and dense hadronic matter based on an event generator URASiMA

    International Nuclear Information System (INIS)

    Sasaki, N.; Miyamura, O.; Nonaka, C.; Muroya, S.

    2000-01-01

    We evaluate thermodynamical quantities and transport coefficient of a dense and hot hadronic matter based on an event generator URASiMA (Ultra-Relativistic AA collision Simulator based on Multiple Scattering Algorithm). The statistical ensembles in equilibrium with fixed temperature and chemical potential are generated by imposing periodic boundary condition to the simulation of URASiMA, where energy density and baryon number density is conserved. Achievement of the thermal equilibrium and the chemical equilibrium are confirmed by the common value of slope parameter in the energy distributions and the saturation of the numbers of contained particles, respectively. By using the generated ensembles, we investigate the temperature dependence and the chemical potential dependence of the baryon diffusion constant of a dense and hot hadronic matter. (author)

  8. Failure Assessment for the High-Strength Pipelines with Constant-Depth Circumferential Surface Cracks

    OpenAIRE

    X. Liu; Z. X. Lu; Y. Chen; Y. L. Sui; L. H. Dai

    2018-01-01

    In the oil and gas transportation system over long distance, application of high-strength pipeline steels can efficiently reduce construction and operation cost by increasing operational pressure and reducing the pipe wall thickness. Failure assessment is an important issue in the design, construction, and maintenance of the pipelines. The small circumferential surface cracks with constant depth in the welded pipelines are of practical interest. This work provides an engineering estimation pr...

  9. Failure Assessment for the High-Strength Pipelines with Constant-Depth Circumferential Surface Cracks

    Directory of Open Access Journals (Sweden)

    X. Liu

    2018-01-01

    Full Text Available In the oil and gas transportation system over long distance, application of high-strength pipeline steels can efficiently reduce construction and operation cost by increasing operational pressure and reducing the pipe wall thickness. Failure assessment is an important issue in the design, construction, and maintenance of the pipelines. The small circumferential surface cracks with constant depth in the welded pipelines are of practical interest. This work provides an engineering estimation procedure based upon the GE/EPRI method to determine the J-integral for the thin-walled pipelines with small constant-depth circumferential surface cracks subject to tension and bending loads. The values of elastic influence functions for stress intensity factor and plastic influence functions for fully plastic J-integral estimation are derived in tabulated forms through a series of three-dimensional finite element calculations for different crack geometries and material properties. To check confidence of the J-estimation solution in practical application, J-integral values obtained from detailed finite element (FE analyses are compared with those estimated from the new influence functions. Excellent agreement of FE results with the proposed J-estimation solutions for both tension and bending loads indicates that the new solutions can be applied for accurate structural integrity assessment of high-strength pipelines with constant-depth circumferential surface cracks.

  10. Spin echoes of nuclear magnetization diffusing in a constant magnetic field gradient and in a restricted geometry

    International Nuclear Information System (INIS)

    Sen, P.N.; Andre, A.; Axelrod, S.

    1999-01-01

    We study the influence of restriction on Carr - Purcell - Meiboom - Gill spin echoes response of magnetization of spins diffusing in a bounded region in the presence of a constant magnetic field gradient. Depending on three main length scales: L S pore size, L G dephasing length and L D diffusion length during half-echo time, three main regimes of decay have been identified: free, localization and motionally averaging regime. In localization regime, the decay exponent depends on a fractional power (2/3) of the gradient, denoting a strong breakdown of the second cumulant or the Gaussian phase approximation (GPA). In the other two regimes, the exponent depends on the gradient squared, and the GPA holds. We find that the transition from the localization to the motionally averaging regime happens when the magnetic field gradients approach special values, corresponding to branch points of the eigenvalues. Transition from one regime to another as a function of echo number for a certain range of parameters is discussed. In this transition region, the signal shows large oscillations with echo number. For large n, asymptotic behavior sets in as a function of n for the decay exponent per echo. This is true for all values of the parameters L S , L G , and L D . copyright 1999 American Institute of Physics

  11. On the sensitivity of mesoscale models to surface-layer parameterization constants

    Science.gov (United States)

    Garratt, J. R.; Pielke, R. A.

    1989-09-01

    The Colorado State University standard mesoscale model is used to evaluate the sensitivity of one-dimensional (1D) and two-dimensional (2D) fields to differences in surface-layer parameterization “constants”. Such differences reflect the range in the published values of the von Karman constant, Monin-Obukhov stability functions and the temperature roughness length at the surface. The sensitivity of 1D boundary-layer structure, and 2D sea-breeze intensity, is generally less than that found in published comparisons related to turbulence closure schemes generally.

  12. CONCENTRATION DEPENDENCE OF STERN LAYER CAPACITANCES AND SURFACE EQUILIBRIUM CONSTANTS IN SILICA-BASED NANOFLUIDIC CHANNELS

    DEFF Research Database (Denmark)

    Andersen, Mathias Bækbo; Frey, J.; Bruus, Henrik

    2010-01-01

    Fundamental understanding of the unique physics at the solid-liquid interface in nanofluidic channels is essential for the advancement of basic scientific knowledge and the development of novel applications for pharmaceuticals, environmental health and safety, energy harvesting and biometrics [1......]. The current models used to describe surface phenomena in nanofluidics can differ by orders of magnitude from experimentally measured values [2]. To mitigate the discrepancies, we hypothesize that the Stern-layer capacitance Cs and the surface equilibrium constants pKa, vary with the composition of the solid...

  13. Surface-dependent chemical equilibrium constants and capacitances for bare and 3-cyanopropyldimethylchlorosilane coated silica nanochannels

    DEFF Research Database (Denmark)

    Andersen, Mathias Bækbo; Frey, Jared; Pennathur, Sumita

    2011-01-01

    , and pK+ are constant and independent of surface composition. Our theoretical model consists of three parts: (i) a chemical equilibrium model of the bare or coated wall, (ii) a chemical equilibrium model of the buffered bulk electrolyte, and (iii) a self-consistent Gouy–Chapman–Stern triple-layer model...... of the electrochemical double layer coupling these two equilibrium models. To validate our model, we used both pH-sensitive dye-based capillary filling experiments as well as electro-osmotic current-monitoring measurements. Using our model we predict the dependence of ζ potential, surface charge density, and capillary...

  14. Cleaning of diffusion bonding surface by argon ion bombardment treatment

    International Nuclear Information System (INIS)

    Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

    2003-01-01

    The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

  15. Singularities of spacelike constant mean curvature surfaces in Lorentz-Minkowski space

    DEFF Research Database (Denmark)

    Brander, David

    2011-01-01

    We study singularities of spacelike, constant (non-zero) mean curvature (CMC) surfaces in the Lorentz-Minkowski 3-space L-3. We show how to solve the singular Bjorling problem for such surfaces, which is stated as follows: given a real analytic null-curve f(0)(x), and a real analytic null vector...... field v(x) parallel to the tangent field of f(0), find a conformally parameterized (generalized) CMC H surface in L-3 which contains this curve as a singular set and such that the partial derivatives f(x) and f(y) are given by df(0)/dx and v along the curve. Within the class of generalized surfaces...

  16. Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

    Science.gov (United States)

    Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

    Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

  17. Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

    Science.gov (United States)

    Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

    2017-06-01

    Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

  18. Variation in Pockels constants of silicate glass-ceramics prepared by perfect surface crystallization

    Science.gov (United States)

    Takano, Kazuya; Takahashi, Yoshihiro; Miyazaki, Takamichi; Terakado, Nobuaki; Fujiwara, Takumi

    2018-01-01

    We investigated the Pockels effect in polycrystalline materials consisting of highly oriented polar fresnoite-type Sr2TiSi2O8 fabricated using perfectly surface-crystallized glass-ceramics (PSC-GCs). The chemical composition of the precursor glass was shown to significantly affect the crystallized texture, e.g., the crystal orientation and appearance of amorphous nanoparasites in the domains, resulting in variations in the Pockels constants. Single crystals exhibiting spontaneous polarization possessed large structural anisotropy, leading to a strong dependence of the nonlinear-optical properties on the direction of polarized light. This study suggests that variations in the Pockels constants (r13 and r33) and tuning of the r13/r33 ratio can be realized in PSC-GC materials.

  19. Surface Casimir densities and induced cosmological constant in higher dimensional braneworlds

    International Nuclear Information System (INIS)

    Saharian, Aram A.

    2006-01-01

    We investigate the vacuum expectation value of the surface energy-momentum tensor for a massive scalar field with general curvature coupling parameter obeying the Robin boundary conditions on two codimension one parallel branes in a (D+1)-dimensional background spacetime AdS D 1 +1 xΣ with a warped internal space Σ. These vacuum densities correspond to a gravitational source of the cosmological constant type for both subspaces of the branes. Using the generalized zeta function technique in combination with contour integral representations, the surface energies on the branes are presented in the form of the sum of single-brane and second-brane-induced parts. For the geometry of a single brane both regions, on the left and on the right of the brane, are considered. At the physical point the corresponding zeta functions contain pole and finite contributions. For an infinitely thin brane taking these regions together, in odd spatial dimensions the pole parts cancel and the total zeta function is finite. The renormalization procedure for the surface energies and the structure of the corresponding counterterms are discussed. The parts in the surface densities generated by the presence of the second brane are finite for all nonzero values of the interbrane separation and are investigated in various asymptotic regions of the parameters. In particular, it is shown that for large distances between the branes the induced surface densities give rise to an exponentially suppressed cosmological constant on the brane. The total energy of the vacuum including the bulk and boundary contributions is evaluated by the zeta function technique and the energy balance between separate parts is discussed

  20. Bayesian Estimation of the Active Concentration and Affinity Constants Using Surface Plasmon Resonance Technology.

    Directory of Open Access Journals (Sweden)

    Feng Feng

    Full Text Available Surface plasmon resonance (SPR has previously been employed to measure the active concentration of analyte in addition to the kinetic rate constants in molecular binding reactions. Those approaches, however, have a few restrictions. In this work, a Bayesian approach is developed to determine both active concentration and affinity constants using SPR technology. With the appropriate prior probabilities on the parameters and a derived likelihood function, a Markov Chain Monte Carlo (MCMC algorithm is applied to compute the posterior probability densities of both the active concentration and kinetic rate constants based on the collected SPR data. Compared with previous approaches, ours exploits information from the duration of the process in its entirety, including both association and dissociation phases, under partial mass transport conditions; do not depend on calibration data; multiple injections of analyte at varying flow rates are not necessary. Finally the method is validated by analyzing both simulated and experimental datasets. A software package implementing our approach is developed with a user-friendly interface and made freely available.

  1. Elastic-plastic finite element analyses for reducers with constant-depth internal circumferential surface cracks

    International Nuclear Information System (INIS)

    Wu, Szu-Ying; Tsai, Bor-Jiun; Chen, Jien-Jong

    2015-01-01

    In this study, a 3-D automatic elastic-plastic finite element mesh generator is established to accurately predict the J-integral value of an arbitrary reducer with a constant-depth internal circumferential surface crack under bending and axial force. The contact pairs are used on the crack surfaces to simulate the actual contact behaviors of the crack model under loadings. In order to verify the accuracy of the proposed elastic-plastic finite element model for a reducer with a surface crack, the cracked straight pipe models are generated according to a special modeling procedure for a flawed reducer. The J-integral values along the crack front of surface crack are calculated and compared with the straight pipe models which have been verified in the previous published studies. Based on the comparison of computed results, good agreements are obtained to show the accuracy of present numerical models. More confidence on using the 3-D elastic-plastic finite element analysis for reducers with internal circumferential surface cracks can be thus established in this work

  2. Effective conductivity, dielectric constant, and diffusion coefficient of digitized composite media via first-passage-time equations

    International Nuclear Information System (INIS)

    Torquato, S.; Kim, I.C.; Cule, D.

    1999-01-01

    We generalize the Brownian motion simulation method of Kim and Torquato [J. Appl. Phys. 68, 3892 (1990)] to compute the effective conductivity, dielectric constant and diffusion coefficient of digitized composite media. This is accomplished by first generalizing the first-passage-time equations to treat first-passage regions of arbitrary shape. We then develop the appropriate first-passage-time equations for digitized media: first-passage squares in two dimensions and first-passage cubes in three dimensions. A severe test case to prove the accuracy of the method is the two-phase periodic checkerboard in which conduction, for sufficiently large phase contrasts, is dominated by corners that join two conducting-phase pixels. Conventional numerical techniques (such as finite differences or elements) do not accurately capture the local fields here for reasonable grid resolution and hence lead to inaccurate estimates of the effective conductivity. By contrast, we show that our algorithm yields accurate estimates of the effective conductivity of the periodic checkerboard for widely different phase conductivities. Finally, we illustrate our method by computing the effective conductivity of the random checkerboard for a wide range of volume fractions and several phase contrast ratios. These results always lie within rigorous four-point bounds on the effective conductivity. copyright 1999 American Institute of Physics

  3. Surface hopping, transition state theory, and decoherence. II. Thermal rate constants and detailed balance

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Amber; Subotnik, Joseph E., E-mail: subotnik@sas.upenn.edu [Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104 (United States)

    2015-10-07

    We investigate a simple approach to compute a non-adiabatic thermal rate constant using the fewest switches surface hopping (FSSH) dynamics. We study the effects of both decoherence (using our augmented-FSSH (A-FSSH) algorithm) and forbidden hops over a large range of parameters, including high and low friction regimes, and weak and strong electronic coupling regimes. Furthermore, when possible, we benchmark our results against exact hierarchy equations of motion results, where we usually find a maximum error of roughly a factor of two (at reasonably large temperatures). In agreement with Hammes-Schiffer and Tully, we find that a merger of transition state theory and surface hopping can be both accurate and efficient when performed correctly. We further show that detailed balance is followed approximately by A-FSSH dynamics.

  4. Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

    International Nuclear Information System (INIS)

    Goddard, P.J.

    1989-01-01

    The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

  5. Direct measurement of Cu surface self-diffusion on a checked surface

    International Nuclear Information System (INIS)

    Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

    1976-01-01

    A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

  6. Surface-dependent chemical equilibrium constants and capacitances for bare and 3-cyanopropyldimethylchlorosilane coated silica nanochannels.

    Science.gov (United States)

    Andersen, Mathias Bækbo; Frey, Jared; Pennathur, Sumita; Bruus, Henrik

    2011-01-01

    We present a combined theoretical and experimental analysis of the solid-liquid interface of fused-silica nanofabricated channels with and without a hydrophilic 3-cyanopropyldimethylchlorosilane (cyanosilane) coating. We develop a model that relaxes the assumption that the surface parameters C(1), C(2), and pK(+) are constant and independent of surface composition. Our theoretical model consists of three parts: (i) a chemical equilibrium model of the bare or coated wall, (ii) a chemical equilibrium model of the buffered bulk electrolyte, and (iii) a self-consistent Gouy-Chapman-Stern triple-layer model of the electrochemical double layer coupling these two equilibrium models. To validate our model, we used both pH-sensitive dye-based capillary filling experiments as well as electro-osmotic current-monitoring measurements. Using our model we predict the dependence of ζ potential, surface charge density, and capillary filling length ratio on ionic strength for different surface compositions, which can be difficult to achieve otherwise. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

    International Nuclear Information System (INIS)

    Strubelj, Luka; Tiselj, Izrok

    2008-01-01

    Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

  8. Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

    Science.gov (United States)

    Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

    2017-01-01

    Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

  9. Bound state potential energy surface construction: ab initio zero-point energies and vibrationally averaged rotational constants.

    Science.gov (United States)

    Bettens, Ryan P A

    2003-01-15

    Collins' method of interpolating a potential energy surface (PES) from quantum chemical calculations for reactive systems (Jordan, M. J. T.; Thompson, K. C.; Collins, M. A. J. Chem. Phys. 1995, 102, 5647. Thompson, K. C.; Jordan, M. J. T.; Collins, M. A. J. Chem. Phys. 1998, 108, 8302. Bettens, R. P. A.; Collins, M. A. J. Chem. Phys. 1999, 111, 816) has been applied to a bound state problem. The interpolation method has been combined for the first time with quantum diffusion Monte Carlo calculations to obtain an accurate ground state zero-point energy, the vibrationally average rotational constants, and the vibrationally averaged internal coordinates. In particular, the system studied was fluoromethane using a composite method approximating the QCISD(T)/6-311++G(2df,2p) level of theory. The approach adopted in this work (a) is fully automated, (b) is fully ab initio, (c) includes all nine nuclear degrees of freedom, (d) requires no assumption of the functional form of the PES, (e) possesses the full symmetry of the system, (f) does not involve fitting any parameters of any kind, and (g) is generally applicable to any system amenable to quantum chemical calculations and Collins' interpolation method. The calculated zero-point energy agrees to within 0.2% of its current best estimate. A0 and B0 are within 0.9 and 0.3%, respectively, of experiment.

  10. Buoyancy effects laminar slot jet impinging on a surface with constant heat flux

    International Nuclear Information System (INIS)

    Shokouhmand, H.; Esfahanian, V.; Masoodi, R.

    2004-01-01

    The two-dimensional laminar air jet issuing from a nozzle of half which terminates at height above a flat plate normal to the jet is numerically on the flow and thermal structure of the region near impingement. The impinging surface is maintained at a constant heat flux condition. The full Navier-Stocks and energy equations are solved by a finite difference method to evaluate the velocity profiles and temperature distribution. The governing parameters and their ranges are: Reynolds number Re, 10-50, Grashof number Gr, 0-50, Richardson number Ri=Gr/ Re 2 , Non dimensional nozzle height H,2-3. Results of the free streamline, local friction factor and heat transfer coefficient are graphically presented. It is found that enhancement of the heat transfer rate is substantial for high Richardson number conditions. Although the laminar jet impingement for isothermal condition has been already studied, however the constant heat flux has not been studied enough. the present paper will analyze a low velocity air jet, Which can be used for cooling of a simulated electronics package

  11. A modified Poisson-Boltzmann surface excess calculation with a field dependent dielectric constant

    International Nuclear Information System (INIS)

    Gordillo, G.J.; Molina, F.V.; Posadas, D.

    1990-01-01

    The Unequal Radius Modified Gouy-Chapman (URMGC) was applied to mixtures of electrolytes. It was considered that the two anions, (1) and (2), have different radius, r 1 and r 2 , being r 2 smaller than r 1 . The dielectric constant was taken as a function of the electric field, using the theoretical Booth equation, or as a linear dependence varying between 6 and 78 when r 2 1 . The results show that the surface excess of anion 2 is much greater than the one predicted by Gouy-Chapman theory when the proportion of 2 increases in the mixture, while both the other anion and the cation show negative deviation. This effect is more evident in mixtures than in the case of single electrolytes, and has a maximum for a composition that depends on the chosen parameters for the model. (Author) [es

  12. Flame surface statistics of constant-pressure turbulent expanding premixed flames

    Science.gov (United States)

    Saha, Abhishek; Chaudhuri, Swetaprovo; Law, Chung K.

    2014-04-01

    In this paper we investigate the local flame surface statistics of constant-pressure turbulent expanding flames. First the statistics of local length ratio is experimentally determined from high-speed planar Mie scattering images of spherically expanding flames, with the length ratio on the measurement plane, at predefined equiangular sectors, defined as the ratio of the actual flame length to the length of a circular-arc of radius equal to the average radius of the flame. Assuming isotropic distribution of such flame segments we then convolute suitable forms of the length-ratio probability distribution functions (pdfs) to arrive at the corresponding area-ratio pdfs. It is found that both the length ratio and area ratio pdfs are near log-normally distributed and shows self-similar behavior with increasing radius. Near log-normality and rather intermittent behavior of the flame-length ratio suggests similarity with dissipation rate quantities which stimulates multifractal analysis.

  13. Quantum maps of geodesic flows on surfaces of constant negative curvature

    International Nuclear Information System (INIS)

    Bogomolny, E.B.; Carioli, M.

    1992-01-01

    The Selberg zeta function Z(s) yields an exact relationship between the periodic orbits of a fully chaotic Hamiltonian system (the geodesic flow on surfaces of constant negative curvature) and the corresponding quantum system (the spectrum of the Laplace-Beltrami operator on the same manifold). It was found that for certain manifolds Z(s) can be exactly rewritten as the Fredholm determinant det(1-T s ), where T s is the generalization of the Ruelle-Perron-Frobenius transfer operator. An alternative derivation of this result is presented, yielding a method to find not only the spectrum but also the eigenvalues of the Laplace-Beltrami operator in terms of eigenfunctions of T s . Various properties of the transfer operator are investigated both analytically and numerically. (author) 15 refs., 10 figs

  14. Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

    International Nuclear Information System (INIS)

    Ma, Z.; Whitley, R.D.; Wang, N.H.L.

    1996-01-01

    A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

  15. Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

    International Nuclear Information System (INIS)

    Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

    2007-01-01

    Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

  16. Bounds on area and charge for marginally trapped surfaces with a cosmological constant

    International Nuclear Information System (INIS)

    Simon, Walter

    2012-01-01

    We sharpen the known inequalities AΛ ≤ 4π(1 - g) (Hayward et al 1994 Phys. Rev. D 49 5080, Woolgar 1999 Class. Quantum Grav. 16 3005) and A ≤ 4πQ 2 (Dain et al 2012 Class. Quantum Grav. 29 035013) between the area A and the electric charge Q of a stable marginally outer-trapped surface (MOTS) of genus g in the presence of a cosmological constant Λ. In particular, instead of requiring stability we include the principal eigenvalue λ of the stability operator. For Λ* Λ+λ > 0, we obtain a lower and an upper bound for Λ*A in terms of Λ*Q 2 , as well as the upper bound Q≤1/(2√(Λ * )) for the charge, which reduces to Q≤1/(2√(Λ)) in the stable case λ ≥ 0. For Λ* < 0, there only remains a lower bound on A. In the spherically symmetric, static, stable case, one of our area inequalities is saturated iff the surface gravity vanishes. We also discuss implications of our inequalities for 'jumps' and mergers of charged MOTS. (fast track communication)

  17. Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

    Energy Technology Data Exchange (ETDEWEB)

    Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

    1988-03-31

    In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

  18. Holomorphic representation of constant mean curvature surfaces in Minkowski space: Consequences of non-compactness in loop group methods

    DEFF Research Database (Denmark)

    Brander, David; Rossman, Wayne; Schmitt, Nicholas

    2010-01-01

    We give an infinite dimensional generalized Weierstrass representation for spacelike constant mean curvature (CMC) surfaces in Minkowski 3-space $\\R^{2,1}$. The formulation is analogous to that given by Dorfmeister, Pedit and Wu for CMC surfaces in Euclidean space, replacing the group $SU_2$ with...

  19. Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

    DEFF Research Database (Denmark)

    Hjelt, T.; Vattulainen, Ilpo Tapio

    2000-01-01

    stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

  20. Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

    International Nuclear Information System (INIS)

    Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

    1979-01-01

    Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

  1. A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

    International Nuclear Information System (INIS)

    Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

    2016-01-01

    The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

  2. Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

    Science.gov (United States)

    Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

    2017-05-17

    A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

  3. Au nanowire junction breakup through surface atom diffusion

    Science.gov (United States)

    Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

    2018-01-01

    Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

  4. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  5. Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

    Science.gov (United States)

    Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

    2017-07-01

    Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

  6. Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

    International Nuclear Information System (INIS)

    Hou, W C; Hong, Franklin Chau-Nan

    2009-01-01

    This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

  7. The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

    DEFF Research Database (Denmark)

    Mejlbro, Leif

    1996-01-01

    Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

  8. Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

    Science.gov (United States)

    Chu, Khim Hoong

    2017-11-09

    Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

  9. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

    OpenAIRE

    Li, Xiaofan; Nie, Qing

    2009-01-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

  10. The one-dimensional normalised generalised equivalence theory (NGET) for generating equivalent diffusion theory group constants for PWR reflector regions

    International Nuclear Information System (INIS)

    Mueller, E.Z.

    1991-01-01

    An equivalent diffusion theory PWR reflector model is presented, which has as its basis Smith's generalisation of Koebke's Equivalent Theory. This method is an adaptation, in one-dimensional slab geometry, of the Generalised Equivalence Theory (GET). Since the method involves the renormalisation of the GET discontinuity factors at nodal interfaces, it is called the Normalised Generalised Equivalence Theory (NGET) method. The advantages of the NGET method for modelling the ex-core nodes of a PWR are summarized. 23 refs

  11. Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

    Science.gov (United States)

    Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

    2014-05-01

    Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

  12. Magnetoresistance of films and strips with the diffuse surface scattering

    International Nuclear Information System (INIS)

    Aronov, A.G.

    1993-08-01

    Magnetoresistance of films in a parallel magnetic field and strips in a perpendicular field is considered. The temperature and magnetic field dependencies of magnetoconductance depend on the time evolution of the correlator of phases. This correlator has different behavior as the function of time: the ergodic behavior at small magnetic fields is changed on the nonergodic one at large magnetic fields in spite of the diffusion electron motion due to a diffuse scattering on boundaries. This leads to unusual temperature and magnetic field dependencies of magnetoresistance. The ergodic hypothesis is not applicable to mesoscopical fluctuations at such a large quasiclassical field. (author). 6 refs, 5 figs

  13. Laser-induced desorption determinations of surface diffusion on Rh(111)

    International Nuclear Information System (INIS)

    Seebauer, E.G.; Schmidt, L.D.

    1987-01-01

    Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

  14. Estimation of the Lagrangian structure function constant ¤C¤0 from surface-layer wind data

    DEFF Research Database (Denmark)

    Anfossi, D.; Degrazia, G.; Ferrero, E.

    2000-01-01

    Eulerian turbulence observations, made in the surface layer under unstable conditions (z/L > 0), by a sonic anemometer were used to estimate the Lagrangian structure function constant C(0). Two methods were considered. The first one makes use of a relationship, widely used in the Lagrangian...... stochastic dispersion models, relating C(0) to the turbulent kinetic energy dissipation rate epsilon, wind velocity variance and Lagrangian decorrelation time. The second one employs a novel equation, connecting C(0) to the constant of the second-order Eulerian structure function. Before estimating C(0...

  15. Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-02-01

    The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

  16. Boron Diffusion in Surface-Treated Framing Lumber

    Science.gov (United States)

    Patricia K. Lebow; Stan T. Lebow; Steven A. Halverson

    2013-01-01

    The extent of boron penetration in framing lumber treated by spray applications during construction is not well quantified. This study evaluated the effect of formulation and concentration on diffusion of boron in lumber specimens that were equilibrated in conditions that produced wood moisture contents of 18 to 21 percent. One set of specimens was pressure treated...

  17. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2016-08-15

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  18. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    Science.gov (United States)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-08-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  19. A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Ghaisas, S. V.

    2016-01-01

    In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

  20. Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    2009-01-01

    form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

  1. Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

    Directory of Open Access Journals (Sweden)

    N. Tsukahara

    2012-01-01

    Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

  2. Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

    NARCIS (Netherlands)

    Schoots, Koen

    2007-01-01

    This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

  3. INTRODUCTION: Surface Dynamics, Phonons, Adsorbate Vibrations and Diffusion

    Science.gov (United States)

    Bruch, L. W.

    2004-07-01

    Dilute nitrides have emerged from conventional III-V semiconductors such as GaAs or InP by the insertion of nitrogen into the group V sub-lattice, which has a profound influence on the electronic properties of these materials and allows widely extended band structure engineering. This is expected to lead to novel devices, e.g. for optical data transmission, solar cells, biophotonics or gas sensing, some of which are already making their way into the market. Unlike in all other cases, where a reduction in bandgap energy is achieved by inserting an element that increases the lattice constant, N accomplishes this and at the same time reduces the lattice constant. Thus smaller bandgaps can be achieved and the unusual role of N in the lattice also allows a tailoring of band alignments. Both of these effects have opened up a new dimension of bandgap engineering and the rapid progress in the field led to the demonstration of high quality 1300 nm lasers on GaAs and eventually to the realization of the first VCSELs that can be mass produced at low cost and emit at 1300 nm. This in turn will allow extending inexpensive data transmission through optical fibers from the present range of about 300 m to a distance of 10 to 20 km and at the same time increasing the data rate by about a factor of four. Thus it will enable metro-area data links, which are presently considered to be the bottleneck for large-scale optical communications. Furthermore, the fact that GaNP and related alloys can be grown lattice-matched on Si substrates has offered intriguing new possibilities of OEIC and integration of efficient III-V optoelectronic devices with the mainstream microelectronics based on Si. Despite their promising applications and the first encouraging experimental results, very little is known about the physical properties of such alloys. For instance the difficulty of incorporating nitrogen into GaInAs while maintaining good optical quality has provoked much work to establish an

  4. The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

    Science.gov (United States)

    M. C. Sagis, Leonard

    2001-03-01

    In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

  5. Airway surface irregularities promote particle diffusion in the human lung

    International Nuclear Information System (INIS)

    Martonen, T.; North Carolina Univ., Chapel Hill, NC; Zhang, Z.; Yang, Y.; Bottei, G.

    1995-01-01

    Current NCRP and ICRP particle deposition models employed in risk assessment analyses treat the airways of the human lung as smooth-walled tubes. However, the upper airways of the tracheobronchial (TB) tree are line with cartilaginous rings. Recent supercomputer simulations of in vivo conditions (cited herein), where cartilaginous ring morphologies were based upon fibre-optic bronchoscope examinations, have clearly demonstrated their profound effects upon fluid dynamics. A physiologically based analytical model of fluid dynamics is presented, focusing upon applications to particle diffusion within the TB tree. The new model is the first to describe particle motion while simultaneously simulating effects of wall irregularities, entrance conditions and tube curvatures. This study may explain the enhanced deposition by particle diffusion detected in replica case experiments and have salient implications for the clinically observed preferential distributions of bronchogenic carcinomas associated with inhaled radionuclides. (author)

  6. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Chen Shuguang

    2010-01-01

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

  7. Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

    Science.gov (United States)

    Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

    2004-07-05

    Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

  8. Effect of Surface Impulsive Thermal Loads on Fatigue Behavior of Constant Volume Propulsion Engine Combustor Materials

    National Research Council Canada - National Science Library

    Zhu, Dongming

    2004-01-01

    .... In this study, a simulated engine test rig has been established to evaluate thermal fatigue behavior of a candidate engine combustor material, Haynes 188, under superimposed CO2 laser surface impulsive thermal loads (30 to 100 Hz...

  9. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1988-09-01

    The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

  10. Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

    Science.gov (United States)

    Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

    2015-05-21

    Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

  11. Diffuse emission and control of copper in urban surface runoff.

    Science.gov (United States)

    Boller, M A; Steiner, M

    2002-01-01

    Copper washed off from roofs and roads is considered to be a major contribution to diffuse copper pollution of urban environments. In order to guarantee sustainable protection of soils and water, the long-term strategy is to avoid or replace copper containing materials on roofs and fagades. Until achievement of this goal, a special adsorber system is suggested to control the diffuse copper fluxes by retention of copper by a mixture of granulated iron-hydroxide (GEH) and calcium carbonate. Since future stormwater runoff concepts are based on decentralised runoff infiltration into the underground, solutions are proposed which provide for copper retention in infiltration sites using GEH adsorption layers. The example of a large copper façade of which the runoff is treated in an adsorption trench reveals the first full-scale data on façade runoff and adsorber performance. During the first year of investigation average façade runoff concentrations in the range of 1-10 mg Cu/l are reduced by 96-99% in the adsorption ditch.

  12. Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

    2016-05-15

    Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

  13. Protofit: A program for determining surface protonation constants from titration data

    Science.gov (United States)

    Turner, Benjamin F.; Fein, Jeremy B.

    2006-11-01

    Determining the surface protonation behavior of natural adsorbents is essential to understand how they interact with their environments. ProtoFit is a tool for analysis of acid-base titration data and optimization of surface protonation models. The program offers a number of useful features including: (1) enables visualization of adsorbent buffering behavior; (2) uses an optimization approach independent of starting titration conditions or initial surface charge; (3) does not require an initial surface charge to be defined or to be treated as an optimizable parameter; (4) includes an error analysis intrinsically as part of the computational methods; and (5) generates simulated titration curves for comparison with observation. ProtoFit will typically be run through ProtoFit-GUI, a graphical user interface providing user-friendly control of model optimization, simulation, and data visualization. ProtoFit calculates an adsorbent proton buffering value as a function of pH from raw titration data (including pH and volume of acid or base added). The data is reduced to a form where the protons required to change the pH of the solution are subtracted out, leaving protons exchanged between solution and surface per unit mass of adsorbent as a function of pH. The buffering intensity function Qads* is calculated as the instantaneous slope of this reduced titration curve. Parameters for a surface complexation model are obtained by minimizing the sum of squares between the modeled (i.e. simulated) buffering intensity curve and the experimental data. The variance in the slope estimate, intrinsically produced as part of the Qads* calculation, can be used to weight the sum of squares calculation between the measured buffering intensity and a simulated curve. Effects of analytical error on data visualization and model optimization are discussed. Examples are provided of using ProtoFit for data visualization, model optimization, and model evaluation.

  14. Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

    International Nuclear Information System (INIS)

    Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

    2016-01-01

    Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

  15. Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

    International Nuclear Information System (INIS)

    Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

    2014-01-01

    The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

  16. Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2002-01-01

    We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

  17. Surface modification of polyethylene by diffuse barrier discharge plasma

    Czech Academy of Sciences Publication Activity Database

    Novák, I.; Števiar, M.; Popelka, A.; Chodák, I.; Mosnáček, J.; Špírková, Milena; Janigová, I.; Kleinová, A.; Sedliačik, J.; Šlouf, Miroslav

    2013-01-01

    Roč. 53, č. 3 (2013), s. 516-523 ISSN 0032-3888 R&D Projects: GA AV ČR(CZ) IAAX08240901 Institutional research plan: CEZ:AV0Z40500505 Keywords : low-density polyethylene * plasma discharge * surface modification Subject RIV: JI - Composite Materials Impact factor: 1.441, year: 2013

  18. Nitrogen diffusion in near-surface range of ion doped molybdenum

    CERN Document Server

    Zamalin, E Y

    2001-01-01

    The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

  19. Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

    1996-11-01

    The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

  20. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

    DEFF Research Database (Denmark)

    Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

    2017-01-01

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

  1. Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

    Science.gov (United States)

    Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

    2018-02-01

    The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Creep of MDF panels under constant load and cyclic environmental conditions. Influence of surface coating

    OpenAIRE

    Fernández-Golfín Seco, J. I.; Díez Barra, M. Rafael

    1997-01-01

    Four different strategies of surface coating (based on 80 g m2 melamin impregnated papers) were used on 19 mm thick commercial MDF panels to assess its reological behaviour under cyclic humidity conditions (20ºC 30 % rh-20ºC 90 % rh). Three different levels of stress (20 %, 30 % and 40 %), based on the ultimate load in bending, were used. Tests were conducted by means of the three points load system. For the same stress level, the relative creep of MDF panels was higher than that in par...

  3. Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

    Science.gov (United States)

    Tränkle, B; Ruh, D; Rohrbach, A

    2016-03-14

    Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

  4. Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

    International Nuclear Information System (INIS)

    Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

    2010-01-01

    Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

  5. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

  6. Jump rates for surface diffusion of large molecules from first principles

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2015-04-21

    We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

  7. Scaling and diffusion of oil spills in the Ocean Surface

    Science.gov (United States)

    Tarquis, A. M.; Platonov, A.; Grau, J.; Sekula, E.

    2010-05-01

    The region of the Gulf of Lions at the northwestern Mediterranean Sea has been studied within a ten-year period from December 1996 until November 2006. More than 1000 synthetic aperture radar (SAR) images, which have been acquired by the Second European Remote Sensing Satellite (ERS 1/2) as well as from ENVISAT. We present statistical results of the structure of several features revealed by SAR such as oil spills and tensioactive slicks dynamic. We compare oil splils obtained from the projects Clean Seas,ENVA4/CT/0334, RC2003/005700, ESP2005/07551 and ESA/AO/IP2240. Since natural (caused by plankton, fish, etc.) slicks as well as man-made oil slicks dampen the small-scale surface waves, which are responsible for the radar backscattering from the ocean surface, both types of effects may be confused and give look/alike false oil spill detections. The early SAR images were processed at a resolution of 1 pixel=200m and were provided by the RApid Information Dissemination System (RAIDS) SAR processing facility in West Freugh, UK. Recent ENVISAT images directly from ESA allow a higher resolution of 1 pixel = 26 m, improving the detected turbulent scaling range. The occurrence of marine oil pollution as well as several dynamic features near Barcelona (frames 8-10, 19, 20; 200 SAR images)is itself a random multi-scale process. The use of different multifractal techniques, both using limits to the smallest and largest available scales, show that the scaling laws are very complex and depend strongly on intermittency of the assumed turbulent cascade, the shapes of the multifractal spectra functions are seen to deviate from an homogeneous multifractal and depend both on the initial conditions of the spill or slick, and on the transit time that the spill has been subjected to the local turbulence.

  8. The optical constants of the organic thin films in the case of xanthats adsorption at the surface of semiconductors minerals

    International Nuclear Information System (INIS)

    Todoran, Radu; Todoran, Daniela

    2008-01-01

    The paper present the determinations of some kinetic parameters that characterize the kinetics of the adsorption phenomenon of some organic xanthate molecule on the surface of some natural semiconductor mineral (galena, sphalerite) in order to understand the inward mechanism of this phenomenon. Among the methods of inquiry that allow kinetics determination in situ the optical ones were chosen relying on the change of the liquid-mineral semiconductor interface, and permitting continuous inquires without disturbing the inward development of the processes. Into the computation, we took into the consideration the physical values which feature the roughness of the solid surface, the diffusion into liquid media and the energetic non-homogeneities of the surface. The R s /R p =f(θ) characteristic helps us to establish the thickness of the adsorbed layer, as well as to determine the optical parameters of the thin film. the experimental results allow us to get some information on the mineral and mineral-solution of xanthate, as well allow us to get some information on the parameters which, in correlation with other proportions experimentally determined - could had as to estimations of the dynamic of the surface of a semiconductor solid body. (Author)

  9. Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

    International Nuclear Information System (INIS)

    Yang Jianyu; Hu Wangyu; Tang Jianfeng

    2011-01-01

    The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

  10. Probing the hydration water diffusion of macromolecular surfaces and interfaces

    International Nuclear Information System (INIS)

    Ortony, Julia H; Cheng, Chi-Yuan; Franck, John M; Pavlova, Anna; Hunt, Jasmine; Han, Songi; Kausik, Ravinath

    2011-01-01

    We probe the translational dynamics of the hydration water surrounding the macromolecular surfaces of selected polyelectrolytes, lipid vesicles and intrinsically disordered proteins with site specificity in aqueous solutions. These measurements are made possible by the recent development of a new instrumental and methodological approach based on Overhauser dynamic nuclear polarization (DNP)-enhanced nuclear magnetic resonance (NMR) spectroscopy. This technique selectively amplifies 1 H NMR signals of hydration water around a spin label that is attached to a molecular site of interest. The selective 1 H NMR amplification within molecular length scales of a spin label is achieved by utilizing short-distance range (∼r -3 ) magnetic dipolar interactions between the 1 H spin of water and the electron spin of a nitroxide radical-based label. Key features include the fact that only minute quantities (<10 μl) and dilute (≥100 μM) sample concentrations are needed. There is no size limit on the macromolecule or molecular assembly to be analyzed. Hydration water with translational correlation times between 10 and 800 ps is measured within ∼10 A distance of the spin label, encompassing the typical thickness of a hydration layer with three water molecules across. The hydration water moving within this time scale has significant implications, as this is what is modulated whenever macromolecules or molecular assemblies undergo interactions, binding or conformational changes. We demonstrate, with the examples of polymer complexation, protein aggregation and lipid-polymer interaction, that the measurements of interfacial hydration dynamics can sensitively and site specifically probe macromolecular interactions.

  11. Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

    Directory of Open Access Journals (Sweden)

    Saiful Islam

    2008-01-01

    Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

  12. Heat exchange and pressure drop of herring-bone fin surfaces. Experimental cell results at constant wall temperature; Echange de chaleur et perte de charge de surfaces a ailettes en chevrons. Resultats experimentaux en cellule a temperature de paroi constante

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1968-07-01

    The increase in the specific power of nuclear reactors of the gas-graphite type has necessitated the use of high performance exchange surfaces for canning the fuel (natural uranium). For this, experiments were carried out on cans fitted with herring-bone fins, at constant wall temperature; a flow of water at 100 deg. C passes inside the can which is cooled externally by a flow of CO{sub 2} at 15 bars pressure. This experimental set-up makes it possible to compare the aero-thermal performances of the different cans with an accuracy of 5 per cent. This report presents the results obtained in the form of a friction coefficient f{sub 0} and mean Margoulis number m{sub 0} as a function of the Reynolds number Re{sub 0}, this latter varying from 3 x 10{sup 5} to 9 x 10{sup 5}. (authors) [French] L'augmentation de la puissance specifique des reacteurs nucleaires de la filiere graphite-gaz a necessite l'utilisation de surfaces d'echange a hautes performances pour gainer le combustible (uranium naturel). Dans cette optique, des gaines munies d'ailettes disposees en chevron ont ete experimentees a temperature de paroi constante: un courant d'eau a 100 deg. C circule a l'interieur de la gaine qui est refroidie exterieurement par un ecoulement de CO{sub 2} sous une pression de 15 bars. Cette methode experimentale permet de situer les performances aerothermiques des gaines les unes par rapport aux autres a 5 pour cent pres. Ce rapport presente les resultats obtenus sous la forme d'un coefficient de frottement f{sub 0} et d'un nombre de Margoulis moyen m{sub 0} en fonction du nombre de Reynolds Re{sub 0}, ce dernier pouvant varier de 3. 10{sup 5} a 9. 10{sup 5}. (auteurs)

  13. Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

    Science.gov (United States)

    Zhan, Hanyu; Voelz, David G.

    2016-12-01

    The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

  14. Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

    DEFF Research Database (Denmark)

    Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

    1996-01-01

    and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

  15. Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

    Czech Academy of Sciences Publication Activity Database

    Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

    2015-01-01

    Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

  16. Circular mode: a new scanning probe microscopy method for investigating surface properties at constant and continuous scanning velocities.

    Science.gov (United States)

    Nasrallah, Hussein; Mazeran, Pierre-Emmanuel; Noël, Olivier

    2011-11-01

    In this paper, we introduce a novel scanning probe microscopy mode, called the circular mode, which offers expanded capabilities for surface investigations especially for measuring physical properties that require high scanning velocities and/or continuous displacement with no rest periods. To achieve these specific conditions, we have implemented a circular horizontal displacement of the probe relative to the sample plane. Thus the relative probe displacement follows a circular path rather than the conventional back and forth linear one. The circular mode offers advantages such as high and constant scanning velocities, the possibility to be combined with other classical operating modes, and a simpler calibration method of the actuators generating the relative displacement. As application examples of this mode, we report its ability to (1) investigate the influence of scanning velocity on adhesion forces, (2) measure easily and instantly the friction coefficient, and (3) generate wear tracks very rapidly for tribological investigations. © 2011 American Institute of Physics

  17. Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

    Directory of Open Access Journals (Sweden)

    María I. Vázquez

    2015-12-01

    Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

  18. The effect of step thickness on the surface diffusion of a Pt adatom

    International Nuclear Information System (INIS)

    Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

    2009-01-01

    The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

  19. Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

    Energy Technology Data Exchange (ETDEWEB)

    Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

    2010-05-03

    Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

  20. Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

    International Nuclear Information System (INIS)

    Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

    2014-01-01

    Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

  1. Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

    Science.gov (United States)

    Skoch, Gary J.

    2002-01-01

    Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

  2. Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

    Science.gov (United States)

    O'Neill, Kelly C; Lee, Young Jin

    2018-05-01

    The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

  3. Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

    Science.gov (United States)

    1992-11-01

    is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

  4. Coupling between diffusion and orientation of pentacene molecules on an organic surface.

    Science.gov (United States)

    Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

    2016-04-01

    The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

  5. Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

    Directory of Open Access Journals (Sweden)

    Szajnar J.

    2014-10-01

    Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

  6. A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

    Energy Technology Data Exchange (ETDEWEB)

    Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

    1996-01-12

    The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

  7. Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

    International Nuclear Information System (INIS)

    Kim, Sung Hoon

    2001-01-01

    Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

  8. Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

    International Nuclear Information System (INIS)

    Vree, C; Mayr, S G

    2010-01-01

    The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

  9. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.

    2012-01-26

    In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

    International Nuclear Information System (INIS)

    Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

    2005-01-01

    We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

  11. Oxidative Corrosion of the UO 2 (001) Surface by Nonclassical Diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

    2017-11-07

    Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

  12. A new approach to the problem of bulk-mediated surface diffusion.

    Science.gov (United States)

    Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

    2015-08-28

    This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

  13. Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

    Energy Technology Data Exchange (ETDEWEB)

    Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

    2017-02-01

    Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

  14. Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

    DEFF Research Database (Denmark)

    Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

    1999-01-01

    in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

  15. Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

    Science.gov (United States)

    Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

    2012-09-24

    We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

  16. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam

    2014-05-20

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

  17. Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

    Science.gov (United States)

    Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

    2016-04-01

    Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

  18. Non-rigid registration of breast surfaces using the laplace and diffusion equations

    Directory of Open Access Journals (Sweden)

    Ou Jao J

    2010-02-01

    Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

  19. Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

    DEFF Research Database (Denmark)

    Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

    2017-01-01

    ) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

  20. Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

    International Nuclear Information System (INIS)

    Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

    2012-01-01

    The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

  1. Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

    International Nuclear Information System (INIS)

    Ferrieri, R.A.; Wolf, A.P.

    1984-01-01

    A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

  2. Transient enhanced diffusion in preamorphized silicon: the role of the surface

    Science.gov (United States)

    Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

    1999-01-01

    Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

  3. Dynamics of an optically confined nanoparticle diffusing normal to a surface.

    Science.gov (United States)

    Schein, Perry; O'Dell, Dakota; Erickson, David

    2016-06-01

    Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

  4. Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

    Science.gov (United States)

    Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

    2011-01-01

    Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

  5. Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

    Directory of Open Access Journals (Sweden)

    Ivan E Collier

    Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

  6. Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

    OpenAIRE

    Bläckberg, Lisa

    2014-01-01

    This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

  7. Surface coatings as xenon diffusion barriers on plastic scintillators : Improving Nuclear-Test-Ban Treaty verification

    OpenAIRE

    Bläckberg, Lisa

    2011-01-01

    This thesis investigates the ability of transparent surface coatings to reduce xenon diffusion into plastic scintillators. The motivation for the work is improved radioxenon monitoring equipment, used with in the framework of the verification regime of the Comprehensive Nuclear-Test-Ban Treaty. A large part of the equipment used in this context incorporates plastic scintillators which are in direct contact with the radioactive gas to be detected. One problem with such setup is that radioxenon...

  8. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

    2013-12-14

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  9. An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

    Directory of Open Access Journals (Sweden)

    Yan-Zi Yu

    2015-01-01

    Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

  10. Simulating the Refractive Index Structure Constant ({C}_{n}^{2}) in the Surface Layer at Antarctica with a Mesoscale Model

    Science.gov (United States)

    Qing, Chun; Wu, Xiaoqing; Li, Xuebin; Tian, Qiguo; Liu, Dong; Rao, Ruizhong; Zhu, Wenyue

    2018-01-01

    In this paper, we introduce an approach wherein the Weather Research and Forecasting (WRF) model is coupled with the bulk aerodynamic method to estimate the surface layer refractive index structure constant (C n 2) above Taishan Station in Antarctica. First, we use the measured meteorological parameters to estimate C n 2 using the bulk aerodynamic method, and second, we use the WRF model output parameters to estimate C n 2 using the bulk aerodynamic method. Finally, the corresponding C n 2 values from the micro-thermometer are compared with the C n 2 values estimated using the WRF model coupled with the bulk aerodynamic method. We analyzed the statistical operators—the bias, root mean square error (RMSE), bias-corrected RMSE (σ), and correlation coefficient (R xy )—in a 20 day data set to assess how this approach performs. In addition, we employ contingency tables to investigate the estimation quality of this approach, which provides complementary key information with respect to the bias, RMSE, σ, and R xy . The quantitative results are encouraging and permit us to confirm the fine performance of this approach. The main conclusions of this study tell us that this approach provides a positive impact on optimizing the observing time in astronomical applications and provides complementary key information for potential astronomical sites.

  11. Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

    DEFF Research Database (Denmark)

    Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

    2015-01-01

    We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

  12. A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

    Science.gov (United States)

    Li, Xiaofan; Nie, Qing

    2009-07-01

    Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

  13. Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

    Energy Technology Data Exchange (ETDEWEB)

    Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

    2014-02-28

    A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

  14. Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

    International Nuclear Information System (INIS)

    El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

    2010-01-01

    The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

  15. Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

    Science.gov (United States)

    Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

    2018-01-01

    Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

  16. Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-08-15

    Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

  17. Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

    International Nuclear Information System (INIS)

    Seddeek, M.A.; Abdelmeguid, M.S.

    2006-01-01

    The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

  18. 'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

    International Nuclear Information System (INIS)

    Livadiotis, George

    2007-01-01

    The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

  19. Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

    Science.gov (United States)

    Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

    2015-01-01

    We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

  20. Surface Brillouin scattering measurement of the elastic constants of single crystal InAs{sub 0.91}Sb{sub 0.09}

    Energy Technology Data Exchange (ETDEWEB)

    Kotane, L M; Comins, J D; Every, A G [Materials Physics Research Institute, School of Physics, University of the Witwatersrand, Johannesburg, Wits 2050 (South Africa); Botha, J R, E-mail: Lesias.Kotane@wits.ac.z [Department of Physics, Nelson Mandela Metropolitan University, Port Elizabeth (South Africa)

    2011-01-01

    Surface Brillouin scattering of light has been used to measure the angular dependence of the Rayleigh surface acoustic wave (SAW), pseudo surface acoustic wave (PSAW) and longitudinal lateral wave (LLW) speeds in a (100)-oriented single crystal of the ternary semiconductor alloy InAs{sub 0.91}Sb{sub 0.09}. The wave speed measurements have been used to determine the room temperature values of the elastic constants C{sub 11}, C{sub 12} and C{sub 44} of the alloy. A simple and robust fitting procedure has been implemented for recovering the elastic constants, in which the merit function is constructed from explicit secular functions that determine the surface and lateral wave speeds in the [001] and [011] crystallographic directions. In the fitting, relatively larger weighting factors have been assigned to the SAW and PSAW data because of the greater precision with which the surface modes can be measured as compared with the lateral wave.

  1. Surface Brillouin scattering measurement of the elastic constants of single crystal InAs0.91Sb0.09

    International Nuclear Information System (INIS)

    Kotane, L M; Comins, J D; Every, A G; Botha, J R

    2011-01-01

    Surface Brillouin scattering of light has been used to measure the angular dependence of the Rayleigh surface acoustic wave (SAW), pseudo surface acoustic wave (PSAW) and longitudinal lateral wave (LLW) speeds in a (100)-oriented single crystal of the ternary semiconductor alloy InAs 0.91 Sb 0.09 . The wave speed measurements have been used to determine the room temperature values of the elastic constants C 11 , C 12 and C 44 of the alloy. A simple and robust fitting procedure has been implemented for recovering the elastic constants, in which the merit function is constructed from explicit secular functions that determine the surface and lateral wave speeds in the [001] and [011] crystallographic directions. In the fitting, relatively larger weighting factors have been assigned to the SAW and PSAW data because of the greater precision with which the surface modes can be measured as compared with the lateral wave.

  2. Advection and diffusion in random media implications for sea surface temperature anomalies

    CERN Document Server

    Piterbarg, Leonid I

    1997-01-01

    The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

  3. Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

    Energy Technology Data Exchange (ETDEWEB)

    Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

    2017-11-01

    In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

  4. The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

    Science.gov (United States)

    Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

    2013-06-01

    In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

  5. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    NARCIS (Netherlands)

    Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

  6. Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

    Science.gov (United States)

    Boisvert, Ghyslain

    Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

  7. Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

    Directory of Open Access Journals (Sweden)

    Sorenson Donna J

    2009-12-01

    Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

  8. Manipulating surface diffusion and elastic interactions to obtain quantum dot multilayer arrangements over different length scales

    Energy Technology Data Exchange (ETDEWEB)

    Placidi, E., E-mail: ernesto.placidi@ism.cnr.it; Arciprete, F. [Istituto di Struttura della Materia, CNR, Via del Fosso del Cavaliere 100, 00133 Rome (Italy); Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Latini, V.; Latini, S.; Patella, F. [Università di Roma “Tor Vergata”, Dipartimento di Fisica, via della Ricerca Scientifica 1, 00133 Rome (Italy); Magri, R. [Dipartimento di Scienze Fisiche, Informatiche e Matematiche (FIM), Università di Modena e Reggio Emilia, and Centro S3 CNR-Istituto Nanoscienze, Via Campi 213/A, 4100 Modena (Italy); Scuderi, M.; Nicotra, G. [CNR-IMM, Strada VIII, 5, 95121 Catania (Italy)

    2014-09-15

    An innovative multilayer growth of InAs quantum dots on GaAs(100) is demonstrated to lead to self-aggregation of correlated quantum dot chains over mesoscopic distances. The fundamental idea is that at critical growth conditions is possible to drive the dot nucleation only at precise locations corresponding to the local minima of the Indium chemical potential. Differently from the known dot multilayers, where nucleation of new dots on top of the buried ones is driven by the surface strain originating from the dots below, here the spatial correlations and nucleation of additional dots are mostly dictated by a self-engineering of the surface occurring during the growth, close to the critical conditions for dot formation under the fixed oblique direction of the incoming As flux, that drives the In surface diffusion.

  9. First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Wu, M H; Liu, X H; Gu, J F; Jin, Z H

    2013-01-01

    Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

  10. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    Energy Technology Data Exchange (ETDEWEB)

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

    2012-06-08

    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  11. Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

    KAUST Repository

    Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

    2014-01-01

    Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

  12. Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

    Directory of Open Access Journals (Sweden)

    N. Javid Rouzi

    2009-04-01

    Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

  13. Second generation diffusion model of interacting gravity waves on the surface of deep fluid

    Directory of Open Access Journals (Sweden)

    A. Pushkarev

    2004-01-01

    Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

  14. Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

    International Nuclear Information System (INIS)

    Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

    2011-01-01

    The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

  15. A desk study of surface diffusion and mass transport in clay

    International Nuclear Information System (INIS)

    Cook, A.J.

    1989-01-01

    Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

  16. A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

    Science.gov (United States)

    Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

    2014-02-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

  17. A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

    Science.gov (United States)

    Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

    2014-01-01

    Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

  18. Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

    Science.gov (United States)

    Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

    2014-08-21

    The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

  19. Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

    International Nuclear Information System (INIS)

    Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

    2013-01-01

    Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

  20. Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

    Science.gov (United States)

    Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

    2018-02-01

    Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

  1. Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

    Science.gov (United States)

    Cox, Trevor John

    Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

  2. Morphometric partitioning of the respiratory surface area and diffusion capacity of the gills and swim bladder in juvenile Amazonian air-breathing fish, Arapaima gigas.

    Science.gov (United States)

    Fernandes, Marisa Narciso; da Cruz, André Luis; da Costa, Oscar Tadeu Ferreira; Perry, Steven Franklin

    2012-09-01

    The gills and the respiratory swim bladders of juvenile specimens (mean body mass 100g) of the basal teleost Arapaima gigas (Cuvier 1829) were evaluated using stereological methods in vertical sections. The surface areas, harmonic mean barrier thicknesses and morphometric diffusing capacities for oxygen and carbon dioxide were estimated. The average respiratory surface area of the swim bladder (2173 cm² kg⁻¹) exceeded that of the gills (780 cm² kg⁻¹) by a factor of 2.79. Due to the extremely thin air-blood barrier in the swim bladder (harmonic mean 0.22 μm) and the much thicker water-blood barrier of the gills (9.61 μm), the morphometric diffusing capacity for oxygen and carbon dioxide was 88 times greater in the swim bladder than in the gills. These data clearly indicate the importance of the swim bladder, even in juvenile A. gigas that still engage in aquatic respiration. Because of the much greater diffusion constant of CO₂ than O₂ in water, the gills also remain important for CO₂ release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Modeling diffuse sources of surface water contamination with plant protection products

    Science.gov (United States)

    Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

    2015-04-01

    Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

  4. Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

    Energy Technology Data Exchange (ETDEWEB)

    Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

    2014-07-28

    Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

  5. Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

    International Nuclear Information System (INIS)

    Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

    2015-01-01

    Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

  6. Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

    International Nuclear Information System (INIS)

    Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

    2012-01-01

    The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

  7. Measurement of the strong coupling constant {alpha}{sub s} with hadronic jets in deep inelastic scattering; Mesure de la constante de couplage forte {alpha}{sub s} avec les jets hadroniques en diffusion inelastique profonde

    Energy Technology Data Exchange (ETDEWEB)

    Gouzevitch, Maxime

    2008-12-15

    In this analysis we have used the production of hard jets in neutral-current DIS for the extraction of the strong coupling constant {alpha}{sub s}. The jets have been selected in the NC DIS events at large momentum transvers 1505. Three jet observables normalized to the total NC DIS cross section have been used: Inclusive jet multiplicity as well as the production rates of 2-jet and 3-jet events. The prediction of the renormalization-group equation for the evolution of the strong coupling constant has been successfully tested for two orders of magnitude between Q=2 QeV to Q=122 GeV. The better precision on {alpha}{sub s}(m{sub Z}) has been obtained with the combination ob the three observables at Q{sup 2}>150 GeV{sup 2}: {alpha}{sub s}(m{sub Z})=0.1180{+-}0.0007(exp.){sub -0.0034}{sup +0.0050}(th.){+-}0.0017(pdf.).

  8. Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

    2014-12-15

    Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

  9. Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

    Science.gov (United States)

    Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

    2017-01-01

    The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

  10. Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

    Science.gov (United States)

    Kapranov, Sergey V.; Kouzaev, Guennadi A.

    2018-01-01

    Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

  11. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    International Nuclear Information System (INIS)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-01-01

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

  12. Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

    Energy Technology Data Exchange (ETDEWEB)

    R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

    2004-12-14

    FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

  13. Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

    International Nuclear Information System (INIS)

    Melkior, T.; Motellier, S.; Yahiaoui, S.

    2005-01-01

    Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

  14. Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

    International Nuclear Information System (INIS)

    Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

    2016-01-01

    We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

  15. Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

    Energy Technology Data Exchange (ETDEWEB)

    Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

    2013-09-30

    Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo2C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo2C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft2 at a feed pressure of only 20 psig. The highest H2/N2 selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo2C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo2C catalyst layers. We have fabricated a Mo2C/V composite membrane that in pure gas testing delivered a H2 flux of 238 SCFH/ft2 at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft2.psi. However, during testing of a Mo2C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft2.psi was obtained which was stable during the entire test, meeting the permeance associated with

  16. Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

    International Nuclear Information System (INIS)

    Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

    2002-01-01

    The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

  17. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 1 to 56. (A.L.B.)

  18. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    2000-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  19. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1998-01-01

    This paper is made of two tables. The first table describes the different particles (bosons and fermions) while the second one gives the nuclear constants of isotopes from the different elements with Z = 1 to 25. (J.S.)

  20. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  1. Diffusion Filters for Variational Data Assimilation of Sea Surface Temperature in an Intermediate Climate Model

    Directory of Open Access Journals (Sweden)

    Xuefeng Zhang

    2015-01-01

    Full Text Available Sequential, adaptive, and gradient diffusion filters are implemented into spatial multiscale three-dimensional variational data assimilation (3DVAR as alternative schemes to model background error covariance matrix for the commonly used correction scale method, recursive filter method, and sequential 3DVAR. The gradient diffusion filter (GDF is verified by a two-dimensional sea surface temperature (SST assimilation experiment. Compared to the existing DF, the new GDF scheme shows a superior performance in the assimilation experiment due to its success in extracting the spatial multiscale information. The GDF can retrieve successfully the longwave information over the whole analysis domain and the shortwave information over data-dense regions. After that, a perfect twin data assimilation experiment framework is designed to study the effect of the GDF on the state estimation based on an intermediate coupled model. In this framework, the assimilation model is subject to “biased” initial fields from the “truth” model. While the GDF reduces the model bias in general, it can enhance the accuracy of the state estimation in the region that the observations are removed, especially in the South Ocean. In addition, the higher forecast skill can be obtained through the better initial state fields produced by the GDF.

  2. Method of coating the interior surface of hollow objects with a diffusion coating

    Science.gov (United States)

    Knowles, Shawn D.; Senor, David J.; Forbes, Steven V.; Johnson, Roger N.; Hollenberg, Glenn W.

    2005-03-15

    A method for forming a diffusion coating on the interior of surface of a hollow object wherein a filament, extending through a hollow object and adjacent to the interior surface of the object, is provided, with a coating material, in a vacuum. An electrical current is then applied to the filament to resistively heat the filament to a temperature sufficient to transfer the coating material from the filament to the interior surface of the object. The filament is electrically isolated from the object while the filament is being resistively heated. Preferably, the filament is provided as a tungsten filament or molybdenum filament. Preferably, the coating materials are selected from the group consisting of Ag, Al, As, Au, Ba, Be, Bi, Ca, Cd, Co, Cr, Cu, Dy, Er, Eu, Fe, Ga, Ge, Hg, In, K, Li, Mg, Mn, Na, Ni P, Pb, Pd, Pr, S, Sb, Sc, Se, Si, Sn, Sr, Te, Tl, Y, Yb, Zn, and combinations thereof. The invention additionally allows for the formation of nitrides, hydrides, or carbides of all the possible coating materials, where such compounds exist, by providing a partial pressure of nitrogen, hydrogen, hydrocarbons, or combination thereof, within the vacuum.

  3. Mineral paragenesis on Mars: The roles of reactive surface area and diffusion.

    Science.gov (United States)

    Fairén, Alberto G; Gil-Lozano, Carolina; Uceda, Esther R; Losa-Adams, Elisabeth; Davila, Alfonso F; Gago-Duport, Luis

    2017-09-01

    Geochemical models of secondary mineral precipitation on Mars generally assume semiopen systems (open to the atmosphere but closed at the water-sediment interface) and equilibrium conditions. However, in natural multicomponent systems, the reactive surface area of primary minerals controls the dissolution rate and affects the precipitation sequences of secondary phases, and simultaneously, the transport of dissolved species may occur through the atmosphere-water and water-sediment interfaces. Here we present a suite of geochemical models designed to analyze the formation of secondary minerals in basaltic sediments on Mars, evaluating the role of (i) reactive surface areas and (ii) the transport of ions through a basalt sediment column. We consider fully open conditions, both to the atmosphere and to the sediment, and a kinetic approach for mineral dissolution and precipitation. Our models consider a geochemical scenario constituted by a basin (i.e., a shallow lake) where supersaturation is generated by evaporation/cooling and the starting point is a solution in equilibrium with basaltic sediments. Our results show that cation removal by diffusion, along with the input of atmospheric volatiles and the influence of the reactive surface area of primary minerals, plays a central role in the evolution of the secondary mineral sequences formed. We conclude that precipitation of evaporites finds more restrictions in basaltic sediments of small grain size than in basaltic sediments of greater grain size.

  4. A radiometric model of an earth radiation budget radiometer optical system with diffuse-specular surfaces

    Science.gov (United States)

    Luther, M. R.

    1981-01-01

    The Earth Radiation Budget Experiment (ERBE) is to fly on NASA's Earth Radiation Budget Satellite (ERBS) and on NOAA F and NOAA G. Large spatial scale earth energy budget data will be derived primarily from measurements made by the ERBE nonscanning instrument (ERBE-NS). A description is given of a mathematical model capable of simulating the radiometric response of any of the ERBE-NS earth viewing channels. The model uses a Monte Carlo method to accurately account for directional distributions of emission and reflection from optical surfaces which are neither strictly diffuse nor strictly specular. The model computes radiation exchange factors among optical system components, and determines the distribution in the optical system of energy from an outside source. Attention is also given to an approach for implementing the model and results obtained from the implementation.

  5. Are fundamental constants really constant

    International Nuclear Information System (INIS)

    Norman, E.B.

    1986-01-01

    Reasons for suspecting that fundamental constants might change with time are reviewed. Possible consequences of such variations are examined. The present status of experimental tests of these ideas is discussed

  6. Silicon as a virtual plasmonic material: Acquisition of its transient optical constants and the ultrafast surface plasmon-polariton excitation

    Energy Technology Data Exchange (ETDEWEB)

    Danilov, P. A.; Ionin, A. A.; Kudryashov, S. I., E-mail: sikudr@sci.lebedev.ru; Makarov, S. V.; Rudenko, A. A. [Lebedev Physical Institute (Russian Federation); Saltuganov, P. N. [Moscow Institute of Physics and Technology (State University) (Russian Federation); Seleznev, L. V.; Yurovskikh, V. I.; Zayarny, D. A. [Lebedev Physical Institute (Russian Federation); Apostolova, T. [Bulgarian Academy of Sciences, Institute for Nuclear Research and Nuclear Energetics (Bulgaria)

    2015-06-15

    Ultrafast intense photoexcitation of a silicon surface is complementarily studied experimentally and theoretically, with its prompt optical dielectric function obtained by means of time-resolved optical reflection microscopy and the underlying electron-hole plasma dynamics modeled numerically, using a quantum kinetic approach. The corresponding transient surface plasmon-polariton (SPP) dispersion curves of the photo-excited material were simulated as a function of the electron-hole plasma density, using the derived optical dielectric function model, and directly mapped at several laser photon energies, measuring spatial periods of the corresponding SPP-mediated surface relief nanogratings. The unusual spectral dynamics of the surface plasmon resonance, initially increasing with the increase in the electron-hole plasma density but damped at high interband absorption losses induced by the high-density electron-hole plasma through instantaneous bandgap renormalization, was envisioned through the multi-color mapping.

  7. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Energy Technology Data Exchange (ETDEWEB)

    Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

    2015-01-15

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  8. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    Science.gov (United States)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

  9. Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

    International Nuclear Information System (INIS)

    Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

    2015-01-01

    CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

  10. Mixed convection boundary-layer flow from a horizontal circular cylinder with a constant surface heat flux

    Energy Technology Data Exchange (ETDEWEB)

    Nazar, R.; Amin, N. [Department of Mathematics, Universiti Teknologi Malaysia, 81310 Johor Bahru, Johor (Malaysia); Pop, I. [Faculty of Mathematics, University of Cluj, R-3400 Cluj, CP 253 (Romania)

    2004-02-01

    The laminar mixed convection boundary-layer flow of a viscous and incompressible fluid past a horizontal circular cylinder, which is maintained at a constant heat flux and is placed in a stream flowing vertically upward has been theoretically studied in this paper. The solutions for the flow and heat transfer characteristics are evaluated numerically for different values of the mixed convection parameter {lambda} with the Prandtl number Pr = 1 and 7, respectively. It is found, as for the case of a heated or cooled cylinder, considered by Merkin [5], that assisting flow delays separation of the boundary-layer and can, if the assisting flow is strong enough, suppress it completely. The opposing flow, on the other side, brings the separation point nearer to the lower stagnation point and for sufficiently strong opposing flows there will not be a boundary-layer on the cylinder. (orig.)

  11. The effect of surfaces on AGR coolant chemistry: critical assessment of gas-phase rate constants relevant to ethane pyrolysis

    International Nuclear Information System (INIS)

    Gonzales, M.D.U.; Norfolk, D.J.

    1988-02-01

    Previous work has shown the ability of a chemical kinetic model, applied using the FACSIMILE computer code, to predict the thermal decomposition of ethane in a silica flow reactor. To optimise the performance of the model, the present report reviews the literature data on the twenty reactions which it incorporates. Critical assessment has shown some discrepancies in the previously used rate constants, especially those leading to ethyne formation. Table 2 of the report gives the kinetic data which, as a result of the present evaluation, are recommended for future work. Use of these data gives significantly improved agreement between the model and the experimental results, particularly for ethyne formation, which had previously been underestimated. (author)

  12. Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

    International Nuclear Information System (INIS)

    Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

    2016-01-01

    A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

  13. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    Energy Technology Data Exchange (ETDEWEB)

    Mirigian, Stephen, E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu, E-mail: smirigian@gmail.com [Departments of Materials Science and Chemistry, University of Illinois, Urbana, Illinois 61801 (United States)

    2015-12-28

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry.

  14. Theory of activated glassy relaxation, mobility gradients, surface diffusion, and vitrification in free standing thin films

    International Nuclear Information System (INIS)

    Mirigian, Stephen; Schweizer, Kenneth S.

    2015-01-01

    We have constructed a quantitative, force level, statistical mechanical theory for how confinement in free standing thin films introduces a spatial mobility gradient of the alpha relaxation time as a function of temperature, film thickness, and location in the film. The crucial idea is that relaxation speeds up due to the reduction of both near-surface barriers associated with the loss of neighbors in the local cage and the spatial cutoff and dynamical softening near the vapor interface of the spatially longer range collective elasticity cost for large amplitude hopping. These two effects are fundamentally coupled. Quantitative predictions are made for how an apparent glass temperature depends on the film thickness and experimental probe technique, the emergence of a two-step decay and mobile layers in time domain measurements, signatures of confinement in frequency-domain dielectric loss experiments, the dependence of film-averaged relaxation times and dynamic fragility on temperature and film thickness, surface diffusion, and the relationship between kinetic experiments and pseudo-thermodynamic measurements such as ellipsometry

  15. Ultrathin, wafer-scale hexagonal boron nitride on dielectric surfaces by diffusion and segregation mechanism

    Science.gov (United States)

    Sonde, Sushant; Dolocan, Andrei; Lu, Ning; Corbet, Chris; Kim, Moon J.; Tutuc, Emanuel; Banerjee, Sanjay K.; Colombo, Luigi

    2017-06-01

    Chemical vapor deposition (CVD) of two-dimensional (2D) hexagonal boron nitride (h-BN) is at the center of numerous studies for its applications in novel electronic devices. However, a clear understanding of the growth mechanism is lacking for its wider industrial adoption on technologically relevant substrates such as SiO2. Here, we demonstrate a controllable growth method of thin, wafer scale h-BN films on arbitrary substrates. We also clarify the growth mechanism to be diffusion and surface segregation (D-SS) of boron (B) and nitrogen (N) in Ni and Co thin films on SiO2/Si substrates after exposure to diborane and ammonia precursors at high temperature. The segregation was found to be independent of the cooling rates employed in this report, and to our knowledge has not been found nor reported for 2D h-BN growth so far, and thus provides an important direction for controlled growth of h-BN. This unique segregation behavior is a result of a combined effect of high diffusivity, small film thickness and the inability to achieve extremely high cooling rates in CVD systems. The resulting D-SS h-BN films exhibit excellent electrical insulating behavior with an optical bandgap of about 5.8 eV. Moreover, graphene-on-h-BN field effect transistors using the as-grown D-SS h-BN films show a mobility of about 6000 cm2 V-1 s-1 at room temperature.

  16. Surface displacements and energy release rates for constant stress drop slip zones in joined elastic quarter spaces

    Science.gov (United States)

    Rodgers, Michael J.; Wen, Shengmin; Keer, Leon M.

    2000-08-01

    A three-dimensional quasi-static model of faulting in an elastic half-space with a horizontal change of material properties (i.e., joined elastic quarter spaces) is considered. A boundary element method is used with a stress drop slip zone approach so that the fault surface relative displacements as well as the free surface displacements are approximated in elements over their respective domains. Stress intensity factors and free surface displacements are calculated for a variety of cases to show the phenomenological behavior of faulting in such a medium. These calculations showed that the behavior could be distinguished from a uniform half-space. Slip in a stiffer material increases, while slip in a softer material decreases the energy release rate and the free surface displacements. Also, the 1989 Kalapana earthquake was located on the basis of a series of forward searches using this method and leveling data. The located depth is 8 km, which is the closer to the seismically inferred depth than that determined from other models. Finally, the energy release rate, which can be used as a fracture criterion for fracture at this depth, is calculated to be 11.1×106 J m-2.

  17. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  18. Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

    International Nuclear Information System (INIS)

    Lou, D.C.; Solberg, J.K.; Borvik, T.

    2009-01-01

    This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

  19. Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO 2 (110)

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, Nir; Browning, Nigel D.

    2011-06-16

    Gold clusters on rutile TiO2 are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO2(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

  20. Low pressure tritium interaction with Inconel 625 and AISI 316 L stainless steel surfaces: an evaluation of the recombination and adsorption constants

    International Nuclear Information System (INIS)

    Perujo, A.; Douglas, K.; Serra, E.

    1996-01-01

    The surface constants for the recombination (σk 2 ) and adsorption (σk 1 ) of tritium in Inconel 625 and austenitic stainless steel AISI 316 L were determined from the measurement of tritium permeation through engineering components (bellows) typical of those used on large fusion devices which will operate with tritium. Experimental permeation measurements were performed over the temperature range 450-620 K and an interpretation of the data was attempted based on a surface-limited tritium release model. At the tritium partial pressure of 0.1 Pa present in a machine such as JET, the flow of tritium is strongly influenced by surface reactions. Furthermore, it is often assumed that oxide layers, acting as permeation barriers, are present on such components. However, for effectiveness, such barriers must be intact and this may not necessarily be the case for engineering components in which mechanical stresses can lead to oxide cracking. The recombination (σk 2 ) and adsorption (σk 1 ) constants of tritium were estimated for both stationary and continually flexing bellows. (orig.)

  1. Analysis of the dual phase lag bio-heat transfer equation with constant and time-dependent heat flux conditions on skin surface

    Directory of Open Access Journals (Sweden)

    Ziaei Poor Hamed

    2016-01-01

    Full Text Available This article focuses on temperature response of skin tissue due to time-dependent surface heat fluxes. Analytical solution is constructed for DPL bio-heat transfer equation with constant, periodic and pulse train heat flux conditions on skin surface. Separation of variables and Duhamel’s theorem for a skin tissue as a finite domain are employed. The transient temperature responses for constant and time-dependent boundary conditions are obtained and discussed. The results show that there is major discrepancy between the predicted temperature of parabolic (Pennes bio-heat transfer, hyperbolic (thermal wave and DPL bio-heat transfer models when high heat flux accidents on the skin surface with a short duration or propagation speed of thermal wave is finite. The results illustrate that the DPL model reduces to the hyperbolic model when τT approaches zero and the classic Fourier model when both thermal relaxations approach zero. However for τq = τT the DPL model anticipates different temperature distribution with that predicted by the Pennes model. Such discrepancy is due to the blood perfusion term in energy equation. It is in contrast to results from the literature for pure conduction material, where the DPL model approaches the Fourier heat conduction model when τq = τT . The burn injury is also investigated.

  2. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  3. INFLUENCE OF RESIDENCE-TIME DISTRIBUTION ON A SURFACE-RENEWAL MODEL OF CONSTANT-PRESSURE CROSS-FLOW MICROFILTRATION

    Directory of Open Access Journals (Sweden)

    W. Zhang

    2015-03-01

    Full Text Available Abstract This work examines the influence of the residence-time distribution (RTD of surface elements on a model of cross-flow microfiltration that has been proposed recently (Hasan et al., 2013. Along with the RTD from the previous work (Case 1, two other RTD functions (Cases 2 and 3 are used to develop theoretical expressions for the permeate-flux decline and cake buildup in the filter as a function of process time. The three different RTDs correspond to three different startup conditions of the filtration process. The analytical expressions for the permeate flux, each of which contains three basic parameters (membrane resistance, specific cake resistance and rate of surface renewal, are fitted to experimental permeate flow rate data in the microfiltration of fermentation broths in laboratory- and pilot-scale units. All three expressions for the permeate flux fit the experimental data fairly well with average root-mean-square errors of 4.6% for Cases 1 and 2, and 4.2% for Case 3, respectively, which points towards the constructive nature of the model - a common feature of theoretical models used in science and engineering.

  4. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, Rizwan M; Oral, Ebru; Muratoglu, Orhun K

    2014-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E

  5. Oxidation resistant peroxide cross-linked UHMWPE produced by blending and surface diffusion

    International Nuclear Information System (INIS)

    Gul, R. M.; Oral, E.; Muratoglu, O. K.

    2013-01-01

    Ultra-high molecular weight polyethylene (UHMWPE) has been widely used as acetabular cup in total hip replacement (THR) and tibial component in total knee replacement (TKR). Crosslinking of UHMWPE has been successful used to improve its wear performance leading to longer life of orthopedic implants. Crosslinking can be performed by radiation or organic peroxides. Peroxide crosslinking is a convenient process as it does not require specialized equipment and the level of crosslinking can be manipulated by changing the amount of peroxide added. However, there is concern about the long-term stability of these materials due to possible presence of by-products. Vitamin E has been successfully used to promote long-term oxidative stability of UHMWPE. In this study, UHMWPE has been crosslinked using organic peroxide in the presence of Vitamin E to produce an oxidation resistant peroxide crosslinked material. Crosslinking was performed both in bulk by mixing peroxide and resin, and only on the surface using diffusion of peroxides.The results show that UHMWPE can be crosslinked using organic peroxides in the presence of vitamin E by both methods. However, the level of crosslinking decreases with the increase in vitamin E content. The wear resistance increases with the increase in crosslink density, and oxidation resistance significantly increases due to the presence of vitamin E. (author)

  6. Specular and diffuse object extraction from a LiDAR derived Digital Surface Model (DSM)

    International Nuclear Information System (INIS)

    Saraf, N M; Hamid, J R A; Kamaruddin, M H

    2014-01-01

    This paper intents to investigate the indifferent behaviour quantitatively of target objects of interest due to specular and diffuse reflectivity based on generated LiDAR DSM of the study site in Ampang, Kuala Lumpur. The LiDAR data to be used was initially checked for its reliability and accuracy. The point cloud LiDAR data was converted to raster to allow grid analysis of the next process of generating the DSM and DTM. Filtering and masking were made removing the features of interest (i.e. building and tree) and other unwanted above surface features. A normalised DSM and object segmentation approach were conducted on the trees and buildings separately. Error assessment and findings attained were highlighted and documented. The result of LiDAR verification certified that the data is reliable and useable. The RMSE obtained is within the tolerance value of horizontal and vertical accuracy (x, y, z) i.e. 0.159 m, 0.211 m 0.091 m respectively. Building extraction inclusive of roof top based on slope and contour analysis undertaken indicate the capability of the approach while single tree extraction through aspect analysis appears to preserve the accuracy of the extraction accordingly. The paper has evaluated the suitable methods of extracting non-ground features and the effective segmentation of the LiDAR data

  7. Energy barriers for diffusion on heterogeneous stepped metal surfaces: Ag/Cu(110)

    International Nuclear Information System (INIS)

    Sbiaai, K.; Boughaleb, Y.; Mazroui, M.; Hajjaji, A.; Kara, A.

    2013-01-01

    In this paper we investigated the diffusion of Ag adatom by computing the energy barriers for many elementary diffusive processes which are likely to happen near to the step edge on Cu (110). The barriers are calculated by means of molecular dynamics simulation by using embedded atom potentials. The proximity to steps alters these barriers considerably, and very different results may be expected. In fact, our numerical calculations show that the diffusion via jump process along step edge is predominant for Ag/Cu(110) and the diffusion over the step occurs sometimes, but only via exchange mechanisms. The adatom diffusion across channels is difficult due to the high value of activation energy required (around 1 eV). Furthermore, we found the Ehrlich–Schwoebel barrier for diffusion around 120 meV in order to descend via exchange process and of the order of 170 meV via hopping mode. This aspect may have a strong influence on the growth character. In general our results suggest that, for our metal system, diffusion mechanism may be important for mass transport across the steps. Implications of these findings are discussed. - Highlights: • Study of adatom diffusion near the step edge • The diffusion along channel is enhanced through jump process. • Arrhenius law is satisfied for a wide range of temperature (310–600 K)

  8. Force Field Benchmark of Organic Liquids: Density, Enthalpy of Vaporization, Heat Capacities, Surface Tension, Isothermal Compressibility, Volumetric Expansion Coefficient, and Dielectric Constant.

    Science.gov (United States)

    Caleman, Carl; van Maaren, Paul J; Hong, Minyan; Hub, Jochen S; Costa, Luciano T; van der Spoel, David

    2012-01-10

    The chemical composition of small organic molecules is often very similar to amino acid side chains or the bases in nucleic acids, and hence there is no a priori reason why a molecular mechanics force field could not describe both organic liquids and biomolecules with a single parameter set. Here, we devise a benchmark for force fields in order to test the ability of existing force fields to reproduce some key properties of organic liquids, namely, the density, enthalpy of vaporization, the surface tension, the heat capacity at constant volume and pressure, the isothermal compressibility, the volumetric expansion coefficient, and the static dielectric constant. Well over 1200 experimental measurements were used for comparison to the simulations of 146 organic liquids. Novel polynomial interpolations of the dielectric constant (32 molecules), heat capacity at constant pressure (three molecules), and the isothermal compressibility (53 molecules) as a function of the temperature have been made, based on experimental data, in order to be able to compare simulation results to them. To compute the heat capacities, we applied the two phase thermodynamics method (Lin et al. J. Chem. Phys.2003, 119, 11792), which allows one to compute thermodynamic properties on the basis of the density of states as derived from the velocity autocorrelation function. The method is implemented in a new utility within the GROMACS molecular simulation package, named g_dos, and a detailed exposé of the underlying equations is presented. The purpose of this work is to establish the state of the art of two popular force fields, OPLS/AA (all-atom optimized potential for liquid simulation) and GAFF (generalized Amber force field), to find common bottlenecks, i.e., particularly difficult molecules, and to serve as a reference point for future force field development. To make for a fair playing field, all molecules were evaluated with the same parameter settings, such as thermostats and barostats

  9. First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

    International Nuclear Information System (INIS)

    Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

    2014-01-01

    First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

  10. Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

    Science.gov (United States)

    Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

    2018-05-01

    Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

  11. SFG analysis of the molecular structures at the surfaces and buried interfaces of PECVD ultralow-dielectric constant pSiCOH

    Science.gov (United States)

    Zhang, Xiaoxian; Myers, John N.; Huang, Huai; Shobha, Hosadurga; Chen, Zhan; Grill, Alfred

    2016-02-01

    PECVD deposited porous SiCOH with ultralow dielectric constant has been successfully integrated as the insulator in advanced interconnects to decrease the RC delay. The effects of NH3 plasma treatment and the effectiveness of the dielectric repair on molecular structures at the surface and buried interface of a pSiCOH film deposited on top of a SiCNH film on a Si wafer were fully characterized using sum frequency generation vibrational spectroscopy (SFG), supplemented by X-ray photoelectron spectroscopy. After exposure to NH3 plasma for 18 s, about 40% of the methyl groups were removed from the pSiCOH surface, and the average orientation of surface methyl groups tilted more towards the surface. The repair method used here effectively repaired the molecular structures at the pSiCOH surface but did not totally recover the entire plasma-damaged layer. Additionally, simulated SFG spectra with various average orientations of methyl groups at the SiCNH/pSiCOH buried interface were compared with the experimental SFG spectra collected using three different laser input angles to determine the molecular structural information at the SiCNH/pSiCOH buried interface after NH3 plasma treatment and repair. The molecular structures including the coverage and the average orientation of methyl groups at the buried interface were found to be unchanged by NH3 plasma treatment and repair.

  12. Force Field Benchmark of the TraPPE_UA for Polar Liquids: Density, Heat of Vaporization, Dielectric Constant, Surface Tension, Volumetric Expansion Coefficient, and Isothermal Compressibility.

    Science.gov (United States)

    Núñez-Rojas, Edgar; Aguilar-Pineda, Jorge Alberto; Pérez de la Luz, Alexander; de Jesús González, Edith Nadir; Alejandre, José

    2018-02-08

    The transferable potential for a phase equilibria force field in its united-atom version, TraPPE_UA, is evaluated for 41 polar liquids that include alcohols, thiols, ethers, sulfides, aldehydes, ketones, and esters to determine its ability to reproduce experimental properties that were not included in the parametrization procedure. The intermolecular force field parameters for pure components were fit to reproduce experimental boiling temperature, vapor-liquid coexisting densities, and critical point (temperature, density, and pressure) using Monte Carlo simulations in different ensembles. The properties calculated in this work are liquid density, heat of vaporization, dielectric constant, surface tension, volumetric expansion coefficient, and isothermal compressibility. Molecular dynamics simulations were performed in the gas and liquid phases, and also at the liquid-vapor interface. We found that relative error between calculated and experimental data is 1.2% for density, 6% for heat of vaporization, and 6.2% for surface tension, in good agreement with the experimental data. The dielectric constant is systematically underestimated, and the relative error is 37%. Evaluating the performance of the force field to reproduce the volumetric expansion coefficient and isothermal compressibility requires more experimental data.

  13. Diffuse neutron scattering signatures of rough films

    International Nuclear Information System (INIS)

    Pynn, R.; Lujan, M. Jr.

    1992-01-01

    Patterns of diffuse neutron scattering from thin films are calculated from a perturbation expansion based on the distorted-wave Born approximation. Diffuse fringes can be categorised into three types: those that occur at constant values of the incident or scattered neutron wavevectors, and those for which the neutron wavevector transfer perpendicular to the film is constant. The variation of intensity along these fringes can be used to deduce the spectrum of surface roughness for the film and the degree of correlation between the film's rough surfaces

  14. Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

    International Nuclear Information System (INIS)

    Luniakov, Yu V

    2013-01-01

    A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

  15. THE MECHANISM OF SURFACE DIFFUSION OF H AND D ATOMS ON AMORPHOUS SOLID WATER: EXISTENCE OF VARIOUS POTENTIAL SITES

    Energy Technology Data Exchange (ETDEWEB)

    Hama, Tetsuya; Kuwahata, Kazuaki; Watanabe, Naoki; Kouchi, Akira; Chigai, Takeshi [Institute of Low Temperature Science, Hokkaido University, Sapporo, Hokkaido 060-0819 (Japan); Kimura, Yuki [Department of Earth and Planetary Materials Science, Tohoku University, Sendai 980-8578 (Japan); Pirronello, Valerio, E-mail: hama@lowtem.hokudai.ac.jp [Dipartimento di Fisica e Astronomia, Universita' di Catania, I-95125 Catania, Sicily (Italy)

    2012-10-01

    To understand elementary processes leading to H{sub 2} formation, and the hydrogenation and deuteration reactions of adsorbed species on dust grains in dense clouds, we experimentally investigated the diffusion of atomic hydrogen and deuterium on amorphous solid water (ASW) at temperatures of 8-15 K. The present study extended our previous study for selective detections of H and D atoms, and of H{sub 2} (J = 0 and 1) and D{sub 2} (J = 0 and 1) molecules adsorbed on ASW using both photo-stimulated desorption and resonance-enhanced multiphoton ionization, to investigate potential sites on ASW for diffusion, recombination dynamics, and the diffusion mechanism of H and D atoms. Our results demonstrate that the ASW surface contains various potential sites that can be categorized into at least three groups: very shallow, middle-, and deep-potential sites, with diffusion activation energies of {<=}18, 22 (23 meV for D atoms), and {>=}30 meV, respectively. The present study pictured the outline of H{sub 2} formation on cosmic ice dust at low temperatures: H atoms landing on the dust will diffuse rapidly at the abundant shallow and middle sites on ASW, and finally become trapped at deep sites. The H atoms that arrive next recombine with such trapped H atoms to yield H{sub 2} molecules. The small isotopic difference between the diffusion of H and D atoms on ASW indicates that the diffusion mechanism can be explained by thermal hopping, at least at middle-potential sites.

  16. Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

    2009-09-15

    Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

  17. Microscale anechoic architecture: acoustic diffusers for ultra low power microparticle separation via traveling surface acoustic waves.

    Science.gov (United States)

    Behrens, Jan; Langelier, Sean; Rezk, Amgad R; Lindner, Gerhard; Yeo, Leslie Y; Friend, James R

    2015-01-07

    We present a versatile and very low-power traveling SAW microfluidic sorting device able to displace and separate particles of different diameter in aqueous suspension; the travelling wave propagates through the fluid bulk and diffuses via a Schröder diffuser, adapted from its typical use in concert hall acoustics to be the smallest such diffuser to be suitable for microfluidics. The effective operating power range is two to three orders of magnitude less than current SAW devices, uniquely eliminating the need for amplifiers, and by using traveling waves to impart forces directly upon suspended microparticles, they can be separated by size.

  18. Diffusion in one dimensional random medium and hyperbolic Brownian motion

    International Nuclear Information System (INIS)

    Comtet, A.; Monthus, C.; Paris-6 Univ., 75

    1995-03-01

    Classical diffusion in a random medium involves an exponential functional of Brownian motion. This functional also appears in the study of Brownian diffusion on a Riemann surface of constant negative curvature. This relationship is analyzed in detail and various distributions are studied using stochastic calculus and functional integration. (author) 17 refs

  19. Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

    Energy Technology Data Exchange (ETDEWEB)

    Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

    1990-04-01

    A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

  20. Diffusion and flow of water vapours in chromatographic Alumina gel

    International Nuclear Information System (INIS)

    Khan, M.; Shah, H. U.

    2005-01-01

    The kinetics of sorption of water vapours in chromatographic alumina gel was studied. Water vapours are adsorbed on the gel at temperature (15 degree C) at different constant relative pressure from 0.1-0.93 p/p. Rate constant, Effective diffusivities, Knudsen diffusivities and bulk diffusivities were determined through Fick type equation. Total pore volume is 0.498 cc g-1 and specific surface area comes to be 465 m2 g-1 as obtained by Gurvitsch rule and Kieselve's quantities respectively. An average pore radius (hydraulic) is 1.1x10/sub -7/ cm. The study of these quantities provide a strong basis for evaluating surface properties. (author)

  1. Record Charge Carrier Diffusion Length in Colloidal Quantum Dot Solids via Mutual Dot-To-Dot Surface Passivation.

    Science.gov (United States)

    Carey, Graham H; Levina, Larissa; Comin, Riccardo; Voznyy, Oleksandr; Sargent, Edward H

    2015-06-03

    Through a combination of chemical and mutual dot-to-dot surface passivation, high-quality colloidal quantum dot solids are fabricated. The joint passivation techniques lead to a record diffusion length for colloidal quantum dots of 230 ± 20 nm. The technique is applied to create thick photovoltaic devices that exhibit high current density without losing fill factor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Monte Carlo investigations on surface elastic energy of spin-crossover solids: Direct access to image pressure and the Eshelby constant

    Science.gov (United States)

    Boukheddaden, Kamel

    2013-10-01

    We present theoretical investigations on surface elastic energy in spin-crossover (SC) solids studied in the frame of a microscopic elastic model, coupling spin, and lattice deformations. Although surface energy plays a crucial role in driving the SC transition, specific quantitative investigations on its effect have been neglected in most of the recent theoretical works based on atomistic descriptions of the SC transitions, resolved by Monte Carlo or by molecular dynamics simulations. Here, we perform a quantitative study of the surface energy resulting from an inserted high-spin (HS) domain in a low-spin (LS) lattice. This situation may be produced experimentally in SC solids, at low temperature, through a photoexcitation by a single pulse laser shot. We demonstrate that the surface energy depends on the ratio between the local molecular volume misfit (between the LS and HS sites) δυ and the lattice volume V, such as Esurf˜δυ2/V for the HS atom at the center of lattice, while it is Esurf˜δυ2/L (L is the length of the lattice) in the case of the HS atom located on the edge of the lattice. We then derived the image pressure (negative in the case of embedded dilatation centers) through the work of the free surface atoms and evaluated the Eshelby constant, which was found equal to γ˜1.90, in very good agreement with the available data of literature. Energetic configuration diagrams in the homogeneous (HS and LS) and heterogeneous (coexistence of HS and LS) are calculated, from which estimations of the macroscopic bulk modulus were deduced.

  3. Large-volume constant-concentration sampling technique coupling with surface-enhanced Raman spectroscopy for rapid on-site gas analysis.

    Science.gov (United States)

    Zhang, Zhuomin; Zhan, Yisen; Huang, Yichun; Li, Gongke

    2017-08-05

    In this work, a portable large-volume constant-concentration (LVCC) sampling technique coupling with surface-enhanced Raman spectroscopy (SERS) was developed for the rapid on-site gas analysis based on suitable derivatization methods. LVCC sampling technique mainly consisted of a specially designed sampling cell including the rigid sample container and flexible sampling bag, and an absorption-derivatization module with a portable pump and a gas flowmeter. LVCC sampling technique allowed large, alterable and well-controlled sampling volume, which kept the concentration of gas target in headspace phase constant during the entire sampling process and made the sampling result more representative. Moreover, absorption and derivatization of gas target during LVCC sampling process were efficiently merged in one step using bromine-thiourea and OPA-NH 4 + strategy for ethylene and SO 2 respectively, which made LVCC sampling technique conveniently adapted to consequent SERS analysis. Finally, a new LVCC sampling-SERS method was developed and successfully applied for rapid analysis of trace ethylene and SO 2 from fruits. It was satisfied that trace ethylene and SO 2 from real fruit samples could be actually and accurately quantified by this method. The minor concentration fluctuations of ethylene and SO 2 during the entire LVCC sampling process were proved to be gas targets from real samples by SERS. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Estimating the surface layer refractive index structure constant over snow and sea ice using Monin-Obukhov similarity theory with a mesoscale atmospheric model.

    Science.gov (United States)

    Qing, Chun; Wu, Xiaoqing; Huang, Honghua; Tian, Qiguo; Zhu, Wenyue; Rao, Ruizhong; Li, Xuebin

    2016-09-05

    Since systematic direct measurements of refractive index structure constant ( Cn2) for many climates and seasons are not available, an indirect approach is developed in which Cn2 is estimated from the mesoscale atmospheric model outputs. In previous work, we have presented an approach that a state-of-the-art mesoscale atmospheric model called Weather Research and Forecasting (WRF) model coupled with Monin-Obukhov Similarity (MOS) theory which can be used to estimate surface layer Cn2 over the ocean. Here this paper is focused on surface layer Cn2 over snow and sea ice, which is the extending of estimating surface layer Cn2 utilizing WRF model for ground-based optical application requirements. This powerful approach is validated against the corresponding 9-day Cn2 data from a field campaign of the 30th Chinese National Antarctic Research Expedition (CHINARE). We employ several statistical operators to assess how this approach performs. Besides, we present an independent analysis of this approach performance using the contingency tables. Such a method permits us to provide supplementary key information with respect to statistical operators. These methods make our analysis more robust and permit us to confirm the excellent performances of this approach. The reasonably good agreement in trend and magnitude is found between estimated values and measurements overall, and the estimated Cn2 values are even better than the ones obtained by this approach over the ocean surface layer. The encouraging performance of this approach has a concrete practical implementation of ground-based optical applications over snow and sea ice.

  5. Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

    Science.gov (United States)

    Matrane, I.; Mazroui, M.; Sbiaai, K.

    2018-03-01

    We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

  6. Exciton diffusion length in some thermocleavable polythiophenes by the surface photovoltage method

    DEFF Research Database (Denmark)

    Tousek, J.; Touskova, J.; Remes, Z.

    2012-01-01

    property is that P3MHOCT can serve as a precursor which, after thermal annealing, converts into more rigid and insoluble P3CT and further thermal treatment produces native unsubstituted PT. Ellipsometric measurement yielded data on the thickness of the spin coated layers; absorption coefficients were...... be ascribed to the increase of the crystalline fraction. The highest diffusion length was found in P3CT polymer but its large resistivity represents a disadvantage in application in solar cells. Taking into account just these parameters, relatively low resistivity together with quite high diffusion length (13...

  7. Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

    International Nuclear Information System (INIS)

    Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

    1997-01-01

    The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

  8. Investigation of optical and magneto-optical constants and their surface-oxide-layer effects of single-crystalline GdCo2

    International Nuclear Information System (INIS)

    Lee, S.J.; Kim, K.J.; Canfield, P.C.; Lynch, D.W.

    2000-01-01

    We investigated the optical and magneto-optical properties of single-crystalline GdCo 2 by spectroscopic ellipsometry (SE) and magneto-optical Kerr spectrometry (MOKS). The diagonal component of the optical conductivity tensor of the compound was obtained by SE in the 1.5-5.5 eV region and the off-diagonal component by using the measured magneto-optical parameters (Kerr rotation and ellipticity) by MOKS and the SE data. The measured spectra were corrected for the surface oxide layer by employing a three-phase model treating the oxide layer as nonmagnetic with constant refractive index. The magnitude of the diagonal component becomes enhanced and the optical transition structures of the off-diagonal component become more pronounced by the oxide correction. The overall optical and magneto-optical data are discussed in terms of the calculated spin-polarized band structure and optical absorption of the compound and the effect of the surface oxide layer

  9. Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

    International Nuclear Information System (INIS)

    Posadillo, R.; Lopez Luque, R.

    2009-01-01

    The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

  10. Numerical modeling of turbulent jet diffusion flames in the atmospheric surface layer

    NARCIS (Netherlands)

    Hernández, J.; Crespo, A.; Duijm, N.J.

    1995-01-01

    The evolution of turbulent jet diffusion flames of natural gas in air is predicted using a finite-volume procedure for solving the flow equations. The model is three dimensional, elliptic and based on the conserved-scalar approach and the laminar flamelet concept. A laminar flamelet prescription for

  11. Diffusion Coefficient in the Zinc Coating Shaped on the Surface of Cast Iron and Steel Alloys

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2015-06-01

    Full Text Available The article presents the method to assess the diffusion coefficient D in the sub-layer of intermetallic phases formed during hot-dip galvanizing “Armco” iron and ductile cast iron EN-GJS-500-7. Hot-dip galvanizing is one of the most popular forms of long-term protection of Fe-C alloys against corrosion. The process for producing a protective layer of sufficient quality is closely related to diffusion of atoms of zinc and iron. The simulation consist in performed a hot-dip galvanizing in laboratory condition above Fe-C alloys, in the Department of Engineering of Cast Alloys and Composites. Galvanizing time ranged from 15 to 300 seconds. Then metallographic specimens were prepared, intermetallic layers were measured and diffusion coefficient (D were calculated. It was found that the diffusion coefficient obtained during hot-dip galvanizing “Armco” iron and zinc is about two orders of magnitude less than the coefficient obtained on ductile cast iron EN-GJS-500-7.

  12. Resist image quality control via acid diffusion constant and/or photodecomposable quencher concentration in the fabrication of 11 nm half-pitch line-and-space patterns using extreme-ultraviolet lithography

    Science.gov (United States)

    Kozawa, Takahiro; Santillan, Julius Joseph; Itani, Toshiro

    2018-05-01

    Extreme-ultraviolet (EUV) lithography will be applied to the high-volume production of semiconductor devices with 16 nm half-pitch resolution and is expected to be extended to that of devices with 11 nm half-pitch resolution. With the reduction in the feature sizes, the control of acid diffusion becomes a significant concern. In this study, the dependence of resist image quality on T PEB D acid and photodecomposable quencher concentration was investigated by the Monte Carlo method on the basis of the sensitization and reaction mechanisms of chemically amplified EUV resists. Here, T PEB and D acid are the postexposure baking (PEB) time and the acid diffusion constant, respectively. The resist image quality of 11 nm line-and-space patterns is discussed in terms of line edge roughness (LER) and stochastic defect generation. For the minimization of LER, it is necessary to design and control not only the photodecomposable quencher concentration but also T PEB D acid. In this case, D acid should be adjusted to be 0.3–1.5 nm2 s‑1 for a PEB time of 60 s with optimization of the balance among LER and stochastic pinching and bridging. Even if it is difficult to decrease D acid to the range of 0.3–1.5 nm2 s‑1, the image quality can still be controlled via only the photodecomposable quencher concentration, although LER and stochastic pinching and bridging are slightly increased. In this case, accurate control of the photodecomposable quencher concentration and the reduction in the initial standard deviation of the number of protected units are required.

  13. Is the surface oxygen exchange rate linked to bulk ion diffusivity in mixed conducting Ruddlesden-Popper phases?

    Science.gov (United States)

    Tomkiewicz, Alex C; Tamimi, Mazin A; Huq, Ashfia; McIntosh, Steven

    2015-01-01

    The possible link between oxygen surface exchange rate and bulk oxygen anion diffusivity in mixed ionic and electronic conducting oxides is a topic of great interest and debate. While a large body of experimental evidence and theoretical analyses support a link, observed differences between bulk and surface composition of these materials are hard to reconcile with this observation. This is further compounded by potential problems with simultaneous measurement of both parameters. Here we utilize separate techniques, in situ neutron diffraction and pulsed isotopic surface exchange, to examine bulk ion mobility and surface oxygen exchange rates of three Ruddlesden-Popper phases, general form A(n-1)A(2)'B(n)O(3n+1), A(n-1)A(2)'B(n)X(3n+1); LaSrCo(0.5)Fe(0.5)O(4-δ) (n = 1), La(0.3)Sr(2.7)CoFeO(7-δ) (n = 2) and LaSr3Co(1.5)Fe(1.5)O(10-δ) (n = 3). These measurements are complemented by surface composition determination via high sensitivity-low energy ion scattering. We observe a correlation between bulk ion mobility and surface exchange rate between materials. The surface exchange rates vary by more than one order of magnitude with high anion mobility in the bulk of an oxygen vacancy-rich n = 2 Ruddlesden-Popper material correlating with rapid oxygen exchange. This is in contrast with the similar surface exchange rates which we may expect due to similar surface compositions across all three samples. We conclude that experimental limitations lead to inherent convolution of surface and bulk rates, and that surface exchange steps are not likely to be rate limiting in oxygen incorporation.

  14. Large-volume constant-concentration sampling technique coupling with surface-enhanced Raman spectroscopy for rapid on-site gas analysis

    Science.gov (United States)

    Zhang, Zhuomin; Zhan, Yisen; Huang, Yichun; Li, Gongke

    2017-08-01

    In this work, a portable large-volume constant-concentration (LVCC) sampling technique coupling with surface-enhanced Raman spectroscopy (SERS) was developed for the rapid on-site gas analysis based on suitable derivatization methods. LVCC sampling technique mainly consisted of a specially designed sampling cell including the rigid sample container and flexible sampling bag, and an absorption-derivatization module with a portable pump and a gas flowmeter. LVCC sampling technique allowed large, alterable and well-controlled sampling volume, which kept the concentration of gas target in headspace phase constant during the entire sampling process and made the sampling result more representative. Moreover, absorption and derivatization of gas target during LVCC sampling process were efficiently merged in one step using bromine-thiourea and OPA-NH4+ strategy for ethylene and SO2 respectively, which made LVCC sampling technique conveniently adapted to consequent SERS analysis. Finally, a new LVCC sampling-SERS method was developed and successfully applied for rapid analysis of trace ethylene and SO2 from fruits. It was satisfied that trace ethylene and SO2 from real fruit samples could be actually and accurately quantified by this method. The minor concentration fluctuations of ethylene and SO2 during the entire LVCC sampling process were proved to be samples were achieved in range of 95.0-101% and 97.0-104% respectively. It is expected that portable LVCC sampling technique would pave the way for rapid on-site analysis of accurate concentrations of trace gas targets from real samples by SERS.

  15. Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

    KAUST Repository

    Chroneos, Alexander I.; Schwingenschlö gl, Udo; Dimoulas, Athanasios Dimoulas

    2012-01-01

    in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices

  16. Study of Surface Wettability Change of Unconsolidated Sand Using Diffuse Reflectance Infrared Fourier Transform Spectroscopy and Thermogravimetric Analysis.

    Science.gov (United States)

    Gómora-Herrera, Diana; Navarrete Bolaños, Juan; Lijanova, Irina V; Olivares-Xometl, Octavio; Likhanova, Natalya V

    2018-04-01

    The effects exerted by the adsorption of vapors of a non-polar compound (deuterated benzene) and a polar compound (water) on the surface of Ottawa sand and a sample of reservoir sand (Channel), which was previously impregnated with silicon oil or two kinds of surfactants, (2-hydroxyethyl) trimethylammonium oleate (HETAO) and (2-hydroxyethyl)trimethylammonium azelate (HETAA), were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) and thermogravimetric analysis (TGA). The surface chemistry of the sandstone rocks was elucidated by X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDX). Terminal surface groups such as hydroxyls can strongly adsorb molecules that interact with these surface groups (surfactants), resulting in a wettability change. The wettability change effect suffered by the surface after treating it with surfactants was possible to be detected by the DRIFTS technique, wherein it was observed that the surface became more hydrophobic after being treated with silicon oil and HETAO; the surface became more hydrophilic after treating it with HETAA.

  17. Phototransformation rate constants of PAHs associated with soot particles

    International Nuclear Information System (INIS)

    Kim, Daekyun; Young, Thomas M.; Anastasio, Cort

    2013-01-01

    Photodegradation is a key process governing the residence time and fate of polycyclic aromatic hydrocarbons (PAHs) in particles, both in the atmosphere and after deposition. We have measured photodegradation rate constants of PAHs in bulk deposits of soot particles illuminated with simulated sunlight. The photodegradation rate constants at the surface (k p 0 ), the effective diffusion coefficients (D eff ), and the light penetration depths (z 0.5 ) for PAHs on soot layers of variable thickness were determined by fitting experimental data with a model of coupled photolysis and diffusion. The overall disappearance rates of irradiated low molecular weight PAHs (with 2–3 rings) on soot particles were influenced by fast photodegradation and fast diffusion kinetics, while those of high molecular weight PAHs (with 4 or more rings) were apparently controlled by either the combination of slow photodegradation and slow diffusion kinetics or by very slow diffusion kinetics alone. The value of z 0.5 is more sensitive to the soot layer thickness than the k p 0 value. As the thickness of the soot layer increases, the z 0.5 values increase, but the k p 0 values are almost constant. The effective diffusion coefficients calculated from dark experiments are generally higher than those from the model fitting method for illumination experiments. Due to the correlation between k p 0 and z 0.5 in thinner layers, D eff should be estimated by an independent method for better accuracy. Despite some limitations of the model used in this study, the fitted parameters were useful for describing empirical results of photodegradation of soot-associated PAHs. - Highlights: ► PAHs on soot were evaluated by a model of coupled photolysis and diffusion. ► Photodegradation rate at the surface, diffusion coefficient, and light penetration path were determined. ► Low MW PAHs were influenced by fast photodegradation and fast diffusion. ► High MW PAHs were controlled either by slow

  18. Diffusion coefficients-surface and interfacial tensions - Particular study of some lauryl compounds

    International Nuclear Information System (INIS)

    Morel, Jean-Emile

    1969-01-01

    Two important results of the double lipophilic and hydrophilic character of some heavy organic compounds with a polar group at the end of the chain, were studied: - In a first part, molecular diffusion coefficients were measured in order to prove the micellar aggregation of tri-laurylammonium nitrate in some organic solutions; - In a second part, the tensioactivity of some lauryl compounds (lauric acid, lauric alcohol, mono-laurylamine, etc.), was studied. (author) [fr

  19. Reflection Matrix Method for Controlling Light After Reflection From a Diffuse Scattering Surface

    Science.gov (United States)

    2016-12-22

    of Philosophy Kenneth W. Burgi, BS, MS Major, USAF 22 December 2016 DISTRIBUTION STATEMENT A APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED. AFIT...refocusing light through thin films of a turbid medium. When coherent light is trans- mitted through a stationary diffuser (i.e. a turbid medium), a fine...resultant light scatter [14, 15, 21, 23]. Transmission matrices were measured with microscopic objectives and thin films of turbid media, resulting in

  20. Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

    Directory of Open Access Journals (Sweden)

    Kaewploy Somsak

    2015-01-01

    Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

  1. Diffusion of small Cu islands on the Ni(111) surface: A self-learning kinetic Monte Carlo study

    Science.gov (United States)

    Acharya, Shree Ram; Shah, Syed Islamuddin; Rahman, Talat S.

    2017-08-01

    We elucidate the diffusion kinetics of a heteroepitaxial system consisting of two-dimensional small (1-8 atoms) Cu islands on the Ni(111) surface at (100-600) K using the Self-Learning Kinetic Monte Carlo (SLKMC-II) method. Study of the statics of the system shows that compact CuN (3≤N≤8) clusters made up of triangular units on fcc occupancy sites are the energetically most stable structures of those clusters. Interestingly, we find a correlation between the height of the activation energy barrier (Ea) and the location of the transition state (TS). The Ea of processes for Cu islands on the Ni(111) surface are in general smaller than those of their counterpart Ni islands on the same surface. We find this difference to correlate with the relative strength of the lateral interaction of the island atoms in the two systems. While our database consists of hundreds of possible processes, we identify and discuss the energetics of those that are the most dominant, or are rate-limiting, or most contributory to the diffusion of the islands. Since the Ea of single- and multi-atom processes that convert compact island shapes into non-compact ones are larger (with a significantly smaller Ea for their reverse processes) than that for the collective (concerted) motion of the island, the later dominate in the system kinetics - except for the cases of the dimer, pentamer and octamer. Short-jump involving one atom, long jump dimer-shearing, and long-jump corner shearing (via a single-atom) are, respectively, the dominating processes in the diffusion of the dimer, pentamer and octamer. Furthermore single-atom corner-rounding are the rate-limiting processes for the pentamer and octamer islands. Comparison of the energetics of selected processes and lateral interactions obtained from semi-empirical interatomic potentials with those from density functional theory show minor quantitative differences and overall qualitative agreement.

  2. Surface-based reconstruction and diffusion MRI in the assessment of gray and white matter damage in multiple sclerosis

    Science.gov (United States)

    Caffini, Matteo; Bergsland, Niels; LaganÃ, Marcella; Tavazzi, Eleonora; Tortorella, Paola; Rovaris, Marco; Baselli, Giuseppe

    2014-03-01

    Despite advances in the application of nonconventional MRI techniques in furthering the understanding of multiple sclerosis pathogenic mechanisms, there are still many unanswered questions, such as the relationship between gray and white matter damage. We applied a combination of advanced surface-based reconstruction and diffusion tensor imaging techniques to address this issue. We found significant relationships between white matter tract integrity indices and corresponding cortical structures. Our results suggest a direct link between damage in white and gray matter and contribute to the notion of gray matter loss relating to clinical disability.

  3. Development of Surfaces Optically Suitable for Flat Solar Panels. [using a reflectometer which separately evaluates spectral and diffuse reflectivities of surfaces

    Science.gov (United States)

    1979-01-01

    A reflectometer which can separately evaluate the spectral and diffuse reflectivities of surfaces is described. A phase locked detection system for the reflectometer is also described. A selective coating on aluminum potentially useful for flat plate solar collector applications is presented. The coating is composed of strongly bound copper oxide (divalent) and is formed by an etching process performed on an aluminum alloy with high copper content. Fabrication costs are expected to be small due to the one stop fabrication process. A number of conclusions gathered from the literature as to the required optical properties of flat plate solar collectors are discussed.

  4. Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

    Energy Technology Data Exchange (ETDEWEB)

    Lawrenz, M.

    2007-10-30

    In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

  5. Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

    Science.gov (United States)

    Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

    2018-01-01

    Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

  6. The ion exchange properties and equilibrium constants of Li+, Na+ and K+ on zirconium phosphate highly dispersed on a cellulose acetate fibers surface

    Directory of Open Access Journals (Sweden)

    Borgo Claudemir Adriano

    2004-01-01

    Full Text Available Highly dispersed zirconium phosphate was prepared by reacting celullose acetate/ZrO2 (ZrO2 = 11 wt%, 1.0 mmol g-1 of zirconium atom per gram of the material with phosphoric acid. High power decoupling magic angle spinning (HPDEC-MAS 31P NMR and X-ray photoelectron spectroscopy data indicated that HPO4(2- is the species present on the membrane surface. The specific concentration of acidic centers, determined by ammonia gas adsorption, is 0.60 mmol g-1. The ion exchange capacities for Li+, Na+ and K+ ions were determined from ion exchange isotherms at 298 K and showed the following values (in mmol g-1: Li+= 0.05, Na+= 0.38 and K+= 0.57. Due to the strong cooperative effect, the H+/Na+ and H+/K+ ion exchange is of non ideal nature. These ion exchange equilibria were treated with the use of models of fixed tridentate centers, which consider the surface of the sorbent as polyfunctional sorption centers. Both the observed ion exchange capacities with respect to the alkaline metal ions and the equilibrium constants are discussed by taking into consideration the sequence of the ionic hydration radii for Li+, Na+ and K+. The matrix affinity for the ions decreases with increasing the cations hydration radii from K+ to Li+. The high values of the separation factors S Na+/Li+ and S K+/Li+ (up to several hundreds support the application of this material for the quantitative separation of Na+ and K+ from Li+ from a mixture containing these three ions.

  7. Off-lattice self-learning kinetic Monte Carlo: application to 2D cluster diffusion on the fcc(111) surface

    International Nuclear Information System (INIS)

    Kara, Abdelkader; Yildirim, Handan; Rahman, Talat S; Trushin, Oleg

    2009-01-01

    We report developments of the kinetic Monte Carlo (KMC) method with improved accuracy and increased versatility for the description of atomic diffusivity on metal surfaces. The on-lattice constraint built into our recently proposed self-learning KMC (SLKMC) (Trushin et al 2005 Phys. Rev. B 72 115401) is released, leaving atoms free to occupy 'off-lattice' positions to accommodate several processes responsible for small-cluster diffusion, periphery atom motion and heteroepitaxial growth. This technique combines the ideas embedded in the SLKMC method with a new pattern-recognition scheme fitted to an off-lattice model in which relative atomic positions are used to characterize and store configurations. Application of a combination of the 'drag' and the repulsive bias potential (RBP) methods for saddle point searches allows the treatment of concerted cluster, and multiple- and single-atom, motions on an equal footing. This tandem approach has helped reveal several new atomic mechanisms which contribute to cluster migration. We present applications of this off-lattice SLKMC to the diffusion of 2D islands of Cu (containing 2-30 atoms) on Cu and Ag(111), using the interatomic potential from the embedded-atom method. For the hetero-system Cu/Ag(111), this technique has uncovered mechanisms involving concerted motions such as shear, breathing and commensurate-incommensurate occupancies. Although the technique introduces complexities in storage and retrieval, it does not introduce noticeable extra computational cost.

  8. Fem Simulation of Triple Diffusive Natural Convection Along Inclined Plate in Porous Medium: Prescribed Surface Heat, Solute and Nanoparticles Flux

    Directory of Open Access Journals (Sweden)

    Goyal M.

    2017-12-01

    Full Text Available In this paper, triple diffusive natural convection under Darcy flow over an inclined plate embedded in a porous medium saturated with a binary base fluid containing nanoparticles and two salts is studied. The model used for the nanofluid is the one which incorporates the effects of Brownian motion and thermophoresis. In addition, the thermal energy equations include regular diffusion and cross-diffusion terms. The vertical surface has the heat, mass and nanoparticle fluxes each prescribed as a power law function of the distance along the wall. The boundary layer equations are transformed into a set of ordinary differential equations with the help of group theory transformations. A wide range of parameter values are chosen to bring out the effect of buoyancy ratio, regular Lewis number and modified Dufour parameters of both salts and nanofluid parameters with varying angle of inclinations. The effects of parameters on the velocity, temperature, solutal and nanoparticles volume fraction profiles, as well as on the important parameters of heat and mass transfer, i.e., the reduced Nusselt, regular and nanofluid Sherwood numbers, are discussed. Such problems find application in extrusion of metals, polymers and ceramics, production of plastic films, insulation of wires and liquid packaging.

  9. Photoluminescence studies of organic phosphor coated diffusing surface using blue inorganic light-emitting diode as excitation source

    International Nuclear Information System (INIS)

    Singh, Gyanendra; Mehta, Dalip Singh

    2013-01-01

    We report the studies on photoluminescence (PL) of organic phosphor coated on a diffusing surface using a blue inorganic light-emitting diode (LED) array as an excitation source. The organic phosphor composite coated diffuser was used to scatter the directional blue light from the LED array. Some of the blue light is absorbed by the organic phosphor composite and the phosphor molecules are excited and re-emit light at longer wavelengths due to the PL process. The output light consists of scattered blue light plus phosphor generated broadband yellow light, thus making white light. The diffuser was made up of a plastic substrate coated with an organic composite of small molecule fluorescent material zinc(II)bis(8-hydroxyquinoline) (Znq 2 ) doped with different percentages of electro-phosphorescent metal complex iridium(III)bis(2-methyldibenzo-[f, h] quinoxaline) (acetylacetonate) ([Ir(MDQ) 2 (acac)]). By means of changing the concentration and the thickness of the phosphor composite material the colour coordinates of white light were achieved. The CIE coordinates and correlated colour temperature were calculated for various thicknesses and phosphor composite concentrations and the results are reported. (paper)

  10. Materials and proportion's design of self-compacting mortar used for low diffusion layer in sub-surface radioactive waste disposal facility in Japan

    International Nuclear Information System (INIS)

    Niwase, Kazuhito; Sugihashi, Naoyuki; Tsuji, Yukikazu

    2010-01-01

    This paper describes the design procedure for the material selection and mix proportion of the self-compacting mortar used for low diffusion layer cementitious material in the sub-surface radioactive waste disposal facility in Japan. The low diffusion layer is required for reducing transportation by controlling diffusion of a radionuclide. Therefore the low diffusion, cracks control, and low leaching are the important matters in the mix design. The process to select mortar mix design of the low diffusion layer is explained in detail. Of 33 kinds mix proportions used in laboratory comparative testing, the combinations of low heat portland cement, fly ash, lime powder and expansive addition was provisionally set to the mix proportion of the self-compacting mortar used for low diffusion layer. (author)

  11. Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

    Science.gov (United States)

    Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

    2016-03-01

    Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

  12. Density profile evolution and nonequilibrium effects in partial and full spreading measurements of surface diffusion

    DEFF Research Database (Denmark)

    Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

    2001-01-01

    in D-C(theta) depend on the initial density gradient and the initial state from which the spreading starts. To this end, we carry out extensive Monte Carlo simulations for a lattice-gas model of the O/W(110) system. Studies of submonolayer spreading from an initially ordered p(2x1) phase at theta = 1....../2 reveal that the spreading and diffusion rates in directions parallel and perpendicular to rows of oxygen atoms are significantly different within the ordered phase. Aside from this effect, we find that the degree of ordering in the initial phase has a relatively small impact on the overall behavior of D...

  13. Carbon surface diffusion and SiC nanocluster self-ordering

    International Nuclear Information System (INIS)

    Pezoldt, J.; Trushin, Yu.V.; Kharlamov, V.S.; Schmidt, A.A.; Cimalla, V.; Ambacher, O.

    2006-01-01

    The process of the spatial ordering of SiC nanoclusters on the step edges on Si surfaces was studied by means of multi-scale computer simulation. The evolution of cluster arrays on an ideal flat surface and surfaces with terraces of various widths was performed by kinetic Monte Carlo (KMC) simulations based on quantitative studies of potential energy surfaces (PES) by molecular dynamics (MD). PES analysis revealed that certain types of steps act as strong trapping centres for both Si and C adatoms stimulating clusters nucleation. Spatial ordering of the SiC nanoclusters at the terrace edges can be achieved if the parameters of the growth process (substrate temperature, carbon flux) and substrate (steps direction and terrace widths) are adjusted to the surface morphology. Temperature ranges for growth regimes with and without formation of cluster chains were determined. Cluster size distributions and the dependence of optimal terrace width for self ordering on the deposition parameters were obtained

  14. Simultaneous Retrieval of Aerosol and Surface Optical Properties from Combined Airborne- and Ground-Based Direct and Diffuse Radiometric Measurements

    Science.gov (United States)

    Gatebe, C. K.; Dubovik, O.; King, M. D.; Sinyuk, A.

    2010-01-01

    This paper presents a new method for simultaneously retrieving aerosol and surface reflectance properties from combined airborne and ground-based direct and diffuse radiometric measurements. The method is based on the standard Aerosol Robotic Network (AERONET) method for retrieving aerosol size distribution, complex index of refraction, and single scattering albedo, but modified to retrieve aerosol properties in two layers, below and above the aircraft, and parameters on surface optical properties from combined datasets (Cloud Absorption Radiometer (CAR) and AERONET data). A key advantage of this method is the inversion of all available spectral and angular data at the same time, while accounting for the influence of noise in the inversion procedure using statistical optimization. The wide spectral (0.34-2.30 m) and angular range (180 ) of the CAR instrument, combined with observations from an AERONET sunphotometer, provide sufficient measurement constraints for characterizing aerosol and surface properties with minimal assumptions. The robustness of the method was tested on observations made during four different field campaigns: (a) the Southern African Regional Science Initiative 2000 over Mongu, Zambia, (b) the Intercontinental Transport Experiment-Phase B over Mexico City, Mexico (c) Cloud and Land Surface Interaction Campaign over the Atmospheric Radiation Measurement (ARM) Central Facility, Oklahoma, USA, and (d) the Arctic Research of the Composition of the Troposphere from Aircraft and Satellites (ARCTAS) over Elson Lagoon in Barrow, Alaska, USA. The four areas are dominated by different surface characteristics and aerosol types, and therefore provide good test cases for the new inversion method.

  15. Spectral Dependent Degradation of the Solar Diffuser on Suomi-NPP VIIRS Due to Surface Roughness-Induced Rayleigh Scattering

    Directory of Open Access Journals (Sweden)

    Xi Shao

    2016-03-01

    Full Text Available The Visible Infrared Imaging Radiometer Suite (VIIRS onboard Suomi National Polar Orbiting Partnership (SNPP uses a solar diffuser (SD as its radiometric calibrator for the reflective solar band calibration. The SD is made of Spectralon™ (one type of fluoropolymer and was chosen because of its controlled reflectance in the Visible/Near-Infrared/Shortwave-Infrared region and its near-Lambertian reflectance property. On-orbit changes in VIIRS SD reflectance as monitored by the Solar Diffuser Stability Monitor showed faster degradation of SD reflectance for 0.4 to 0.6 µm channels than the longer wavelength channels. Analysis of VIIRS SD reflectance data show that the spectral dependent degradation of SD reflectance in short wavelength can be explained with a SD Surface Roughness (length scale << wavelength based Rayleigh Scattering (SRRS model due to exposure to solar UV radiation and energetic particles. The characteristic length parameter of the SD surface roughness is derived from the long term reflectance data of the VIIRS SD and it changes at approximately the tens of nanometers level over the operational period of VIIRS. This estimated roughness length scale is consistent with the experimental result from radiation exposure of a fluoropolymer sample and validates the applicability of the Rayleigh scattering-based model. The model is also applicable to explaining the spectral dependent degradation of the SDs on other satellites. This novel approach allows us to better understand the physical processes of the SD degradation, and is complementary to previous mathematics based models.

  16. Cellular automaton simulation of the diffusive motion of bacteria and their adhesion to nanostructures on a solid surface.

    Science.gov (United States)

    Yamamoto, Takehiro; Emura, Chie; Oya, Masashi

    2016-12-01

    The growth of a biofilm begins with the adhesion of bacteria to a solid surface. Consequently, biofilm growth can be managed by the control of bacterial adhesion. Recent experimental studies have suggested that bacterial adhesion can be controlled by modifying a solid surface using nanostructures. Computational prediction and analysis of bacterial adhesion behavior are expected to be useful for the design of effective arrangements of nanostructures for controlling bacterial adhesion. The present study developed a cellular automaton (CA) model for bacterial adhesion simulation that could describe both the diffusive motion of bacteria and dependence of their adhesion patterns on the distance between nanostructures observed in experimental studies. The diffusive motion was analyzed by the moment scaling spectrum theory, and the present model was confirmed to describe subdiffusion behavior due to obstacles. Adhesion patterns observed in experimental studies can be successfully simulated by introducing CA rules to describe a mechanism by which bacteria tend to move to increase the area of contact with nanostructures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Effect of Reynolds number and saturation level on gas diffusion in and out of a superhydrophobic surface

    Science.gov (United States)

    Ling, Hangjian; Katz, Joseph; Fu, Matthew; Hultmark, Marcus

    2017-12-01

    This experimental study investigates the effects of ambient pressure and Reynolds number on the volume of a plastron in a superhydrophobic surface (SHS) due to compression and gas diffusion. The hierarchical SHS consists of nanotextured, ˜100 μm wide spanwise grooves. Microscopic observations measure the time evolution of interface height and contact angle. The water tunnel tests are performed both without flow as well as in transitional and turbulent boundary layers at several Reynolds numbers. Particle image velocimetry is used for estimating the wall shear stress and calculating the momentum thickness for the SHSs under Cassie-Baxter (CB) and Wenzel states as well as a smooth wall at the same conditions. Holographic microscopy is used for determining the wall shear stress directly for one of the CB cases. The mass diffusion rate is calculated from changes to the plastron volume when the liquid is under- or supersaturated. For stationary water, the mass diffusion is slow. With increasing pressure, the interface is initially pinned and then migrates into the groove with high advancing contact angle. Upon subsequent decrease in pressure, the interface migrates upward at a shallow angle and, after being pinned to the tip corner, becomes convex. With flow and exposure to undersaturated liquid, the diffusion-induced wetting also involves pinned and downward migration states, followed by shrinkage of the plastron until it decreases below the resolution limit. The corresponding changes to the velocity profile indicate a transition from slight drag reduction to significant drag increase. In supersaturated water starting at a Wenzel state, a bubble grows from one of the bottom corners until it reaches the other side of the groove. Subsequently, dewetting involves upward migration of the interface, pinning to the tip corners, and formation of a convex interface. The diffusion rate increases with the level of under- or supersaturation and with the Reynolds number. A power

  18. Surface morphology and molecular bonding of CaCO3 nanocrystallites by gas diffusion method

    Science.gov (United States)

    Sulimai, N. H.; Rani, Rozina Abdul; Khusaimi, Z.; Abdullah, S.; Salifairus, M. J.; Alrokayan, Salman; Khan, Haseeb; Rusop, M.

    2018-05-01

    Calcium carbonate with the chemical formula of (CaCO3) is the most abundant element in the world. Its usage on certain applications is largely affected by its properties. The best means to control its properties is through controlled preparation of CaCO3. This study uses diffusion method between the precursors Calcium Chloride and Ammonium Carbonate. Instead of using water, ethanol was used to prepare the salt. Reaction was done in room temperature (RT) for 6h-24h. Smallest average crystallite size measured by FESEM micrograph is 500nm produced by synthesis of CaCO3 reacted for 168 hours. From energy-dispersive X-ray spectrum also indicated the smallest particle size is by CaCO3 reacted for 168 hours. Changes was seen for element Ca at 3.7keV.

  19. Full-dimensional analytical potential energy surface describing the gas-phase Cl + C2H6 reaction and kinetics study of rate constants and kinetic isotope effects.

    Science.gov (United States)

    Rangel, Cipriano; Espinosa-Garcia, Joaquin

    2018-02-07

    Within the Born-Oppenheimer approximation a full-dimensional analytical potential energy surface, PES-2017, was developed for the gas-phase hydrogen abstraction reaction between the chlorine atom and ethane, which is a nine body system. This surface presents a valence-bond/molecular mechanics functional form dependent on 60 parameters and is fitted to high-level ab initio calculations. This reaction presents little exothermicity, -2.30 kcal mol -1 , with a low height barrier, 2.44 kcal mol -1 , and intermediate complexes in the entrance and exit channels. We found that the energetic description was strongly dependent on the ab initio level used and it presented a very flat topology in the entrance channel, which represents a theoretical challenge in the fitting process. In general, PES-2017 reproduces the ab initio information used as input, which is merely a test of self-consistency. As a first test of the quality of the PES-2017, a theoretical kinetics study was performed in the temperature range 200-1400 K using two approaches, i.e. the variational transition-state theory and quasi-classical trajectory calculations, with spin-orbit effects. The rate constants show reasonable agreement with experiments in the whole temperature range, with the largest differences at the lowest temperatures, and this behaviour agrees with previous theoretical studies, thus indicating the inherent difficulties in the theoretical simulation of the kinetics of the title reaction. Different sources of error were analysed, such as the limitations of the PES and theoretical methods, recrossing effects, and the tunnelling effect, which is negligible in this reaction, and the manner in which the spin-orbit effects were included in this non-relativistic study. We found that the variation of spin-orbit coupling along the reaction path, and the influence of the reactivity of the excited Cl( 2 P 1/2 ) state, have relative importance, but do not explain the whole discrepancy. Finally, the

  20. Plasma treatment of detonation and HPHT nanodiamonds in diffuse coplanar surface barrier discharge in H.sub.2./sub./N.sub.2./sub. flow

    Czech Academy of Sciences Publication Activity Database

    Jirásek, Vít; Čech, J.; Kozak, Halyna; Artemenko, Anna; Černák, M.; Kromka, Alexander

    2016-01-01

    Roč. 213, č. 10 (2016), s. 2680-2686 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA14-04790S Institutional support: RVO:68378271 Keywords : amination * diamond * diffuse coplanar surface barrier discharge * nanomaterials * surface functionalization Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.775, year: 2016

  1. Three-dimensional reconstruction of brain surface anatomy: technique comparison between flash and diffusion-weighted imaging

    International Nuclear Information System (INIS)

    Sun Jianzhong; Wang Zhikang; Gong Xiangyang

    2006-01-01

    Objective: To compare two methods 3D flash and diffusion-weighted images (DWI) in reconstructing the brain surface anatomy, and to evaluate their displaying ability, advantages, limitations and clinical application. Methods: Thrity normal cases were prospectively examined with 3D flash sequence and echo-planar DWI. Three-dimensional images were acquired with volume-rendering on workstation. Brain surface structures were evaluated and scored by a group of doctors. Results: Main structures of brain surface were clearly displayed on three-dimensional images based on 3D flash sequence. Average scores were all above 2.50. For images based on DWI, precentral gyrus, postcentral gyrus, superior parietal lobule, superior frontal gyrus, precentral sulcus, central sulcus, postcentral sulcus, intraparietal sulcus and superior frontal sulcus were best shown with average scores between 2.60-2.75, However, supramarginal gyrus, angular gyrus, middle frontal gyrus, inferior frontal gyrus, superior temporal gyrus, lateral sulcus, inferior frontal sulcus could not be well shown, with average scores between 1.67-2.48. Middle temporal gyrus, inferior temporal gyrus, superior temporal sulcus and inferior temporal sulcus can only get scores from 0.88 to 1.27. Scores of images based on 3D flash were much higher than that based on DWI with distinct differentiations, P values were all below 0.01. Conclusion: Three-dimensional images based on 3D flash can really display brain surface structures. It is very useful for anatomic researches. Three-dimensional reconstruction of brain surface based on DWI is a worthy technique to display brain surface anatomy, especially for frontal and parietal structures. (authors)

  2. Surface tension phenomena in the xylem sap of three diffuse porous temperate tree species

    Science.gov (United States)

    K. K. Christensen-Dalsgaard; M. T. Tyree; P. G. Mussone

    2011-01-01

    In plant physiology models involving bubble nucleation, expansion or elimination, it is typically assumed that the surface tension of xylem sap is equal to that of pure water, though this has never been tested. In this study we collected xylem sap from branches of the tree species Populus tremuloides, Betula papyrifera and Sorbus...

  3. Modification of the glass surface induced by redox reactions and internal diffusion processes

    DEFF Research Database (Denmark)

    Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

    In this paper we report a novel way to modify the glass surface in favor of some physical performances. The main step is to perform iso-thermal treatments on the selected silicate glasses containing transition metal at temperatures near the glass transition temperature for various durations under...

  4. Effect of Vegetable Oils on the Surface Tension, Diffusion and Efficiency of Sethoxydim to Control Wild oat (Avena ludoviciana Durieu.

    Directory of Open Access Journals (Sweden)

    H. Hammami

    2017-08-01

    Full Text Available Introduction: During last century, population explosion has been pressing man to produce more supplies of food by consuming more energy in agroecosystems like applying chemical management strategies. herbicides have increasingly become a key component of weed management programs. In Iran, using herbicides led to increasing wheat yield about 20% and 22% in rainfed and irrigated farms respectively (20. Nonetheless, herbicides have also a negative impact on environment. A tool for reducing the herbicide usage which allows to decreasing their cost and side effects is the use of adjuvants. They increase the effectiveness of the post-emergence herbicides. Some adjuvants have toxic effects on living organisms such as Polyethoxylated tallowamine adjuvants that they are very toxic in fairy shrimp (Thamnocephalus platyurus (6. Vegetable oils are not phytotoxic and likely are degraded and metabolized quickly in the environment (8. Sethoxydim is an acetyl coenzyme A carboxylase (ACCase inhibitor that is considered to be a key enzyme in lipid biosynthesis. Similar to other foliar applied herbicides, it need to be associated with an adjuvant for more effective control. Vegetable oils can be developed characteristics of sethoxydim solution such as surface tension and spry drop diffusion. Therefore, the objective of this research is to determine the effect of vegetable oils on the surface tension, diffusion and efficiency of sethoxydim to control wild oat (Avena ludoviciana Durieu.. Materials and Metods: To evaluate the effect of vegetable oils on properties of sethoxydim solution, a series of experiments were separately conducted at Ferdowsi University of Mashhad and Khorasan Science and Technology Park in 2012. For evaluating the effect of vegetable oils on surface tension of distilled water and sethoxydim solution and the sethoxydim efficiency on wild oat control, three experiments were conducted as factorial based on completely randomized design. In other

  5. First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

    International Nuclear Information System (INIS)

    Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

    2014-01-01

    Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

  6. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium-sulfur battery design.

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-04-05

    Lithium-sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides.

  7. Balancing surface adsorption and diffusion of lithium-polysulfides on nonconductive oxides for lithium–sulfur battery design

    Science.gov (United States)

    Tao, Xinyong; Wang, Jianguo; Liu, Chong; Wang, Haotian; Yao, Hongbin; Zheng, Guangyuan; Seh, Zhi Wei; Cai, Qiuxia; Li, Weiyang; Zhou, Guangmin; Zu, Chenxi; Cui, Yi

    2016-01-01

    Lithium–sulfur batteries have attracted attention due to their six-fold specific energy compared with conventional lithium-ion batteries. Dissolution of lithium polysulfides, volume expansion of sulfur and uncontrollable deposition of lithium sulfide are three of the main challenges for this technology. State-of-the-art sulfur cathodes based on metal-oxide nanostructures can suppress the shuttle-effect and enable controlled lithium sulfide deposition. However, a clear mechanistic understanding and corresponding selection criteria for the oxides are still lacking. Herein, various nonconductive metal-oxide nanoparticle-decorated carbon flakes are synthesized via a facile biotemplating method. The cathodes based on magnesium oxide, cerium oxide and lanthanum oxide show enhanced cycling performance. Adsorption experiments and theoretical calculations reveal that polysulfide capture by the oxides is via monolayered chemisorption. Moreover, we show that better surface diffusion leads to higher deposition efficiency of sulfide species on electrodes. Hence, oxide selection is proposed to balance optimization between sulfide-adsorption and diffusion on the oxides. PMID:27046216

  8. Mean field diffusion models for precipitation in crystalline GaAs including surface tension and bulk stresses

    Energy Technology Data Exchange (ETDEWEB)

    Dreyer, Wolfgang [Weierstrass-Institut fuer Angewandte Analysis und Stochastik (WIAS) im Forschungsverbund Berlin e.V. (Germany); Kimmerle, Sven-Joachim [Humboldt-Univ. Berlin (Germany). Dept. of Mathematics

    2009-07-01

    Based on a thermodynamically consistent model for precipitation in gallium arsenide crystals including surface tension and bulk stresses by Dreyer and Duderstadt, we propose different mathematical models to describe the size evolution of liquid droplets in a crystalline solid. The first class of models treats the diffusion-controlled regime of interface motion, while the second class is concerned with the interface-controlled regime of interface motion. Our models take care of conservation of mass and substance. We consider homogenised models, where different length scales of the experimental situation have been exploited in order to simplify the equations. These homogenised models generalise the well-known Lifshitz-Slyozov-Wagner model for Ostwald ripening. Mean field models capture the main properties of our system and are well adapted for numerics and further analysis. Numerical evidence suggests in which case which one of the two regimes might be appropriate to the experimental situation. (orig.)

  9. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  10. Modification of kaolinite surfaces through mechanochemical activation with quartz: A diffuse reflectance infrared fourier transform and chemometrics study.

    Science.gov (United States)

    Carmody, Onuma; Frost, Ray L; Kristóf, János; Kokot, Serge; Kloprogge, J Theo; Makó, Eva

    2006-12-01

    Studies of kaolinite surfaces are of industrial importance. One useful method for studying the changes in kaolinite surface properties is to apply chemometric analyses to the kaolinite surface infrared spectra. A comparison is made between the mechanochemical activation of Kiralyhegy kaolinites with significant amounts of natural quartz and the mechanochemical activation of Zettlitz kaolinite with added quartz. Diffuse reflectance infrared Fourier transform (DRIFT) spectra were analyzed using principal component analysis (PCA) and multi-criteria decision making (MCDM) methods, the preference ranking organization method for enrichment evaluations (PROMETHEE) and geometrical analysis for interactive assistance (GAIA). The clear discrimination of the Kiralyhegy spectral objects on the two PC scores plots (400-800 and 800-2030 cm(-1)) indicated the dominance of quartz. Importantly, no ordering of any spectral objects appeared to be related to grinding time in the PC plots of these spectral regions. Thus, neither the kaolinite nor the quartz are systematically responsive to grinding time according to the spectral criteria investigated. The third spectral region (2600-3800 cm(-1), OH vibrations), showed apparent systematic ordering of the Kiralyhegy and, to a lesser extent, Zettlitz spectral objects with grinding time. This was attributed to the effect of the natural quartz on the delamination of kaolinite and the accompanying phenomena (i.e., formation of kaolinite spheres and water). The mechanochemical activation of kaolinite and quartz, through dry grinding, results in changes to the surface structure. Different grinding times were adopted to study the rate of destruction of the kaolinite and quartz structures. This relationship (i.e., grinding time) was classified using PROMETHEE and GAIA methodology.

  11. Self-diffusion dynamics processes relevant to 2D homoepitaxy growth of Ni adatom on Ni(111) surface

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Fusheng [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Chen, Yifeng, E-mail: yefengc63@sina.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Wang, Yufei, E-mail: yejin802@126.com [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Liu, Zhulin; Hu, Zhongliang [College of Metallurgical Engineering, Hunan University of Technology, Zhuzhou 412007 (China); Yang, Xiyuan [Department of Physics, Hunan University of Arts and Science, Changde 415000 (China); Luo, Wenhua [Department of Physics and Electronic Information Science, Hunan Institute of Science and Technology, Yueyang 414006 (China)

    2014-07-01

    Using molecular dynamics and modified analytic embedded atom methods, the atomic self-diffusion dynamics behaviors relevant to 2D crystal growth on Ni(111) surface have been studied between 150 and 600 K. On perfect Ni(111) surface, the activation energy and prefactor are 0.058±0.001 eV and 4.2×10{sup −4} cm{sup 2}/s between 150 and 350 K, and 0.082±0.003 eV and 7.8×10{sup −4} cm{sup 2}/s from 400 to 600 K. Ni adatom just hops along the directions of close-packed steps on stepped Ni(111) surface, the corresponding activation energies and prefactors are 0.188±0.002 eV and (3.8–4.4)×10{sup −3} cm{sup 2}/s along the direction of A-type step, 0.140±0.001 eV and (1.1–1.2)×10{sup −3} cm{sup 2}/s along the direction of B-type step, and both fitting lines of Arrhenius law intersect at T{sub c}=420–440 K. Our results show that the atomic growth dynamics under nonequilibrium conditions is gradually dominated by the prefactor with increasing temperature. In addition, the shape-change of the 2D nanometer-size island has been discussed on stepped Ni(111) surface in different temperature range.

  12. Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

    Science.gov (United States)

    Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

    2005-09-01

    We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

  13. Diffusion in crushed rock and in bentonite clay

    International Nuclear Information System (INIS)

    Olin, M.

    1994-04-01

    Diffusion theories for porous media with sorption are reviewed to serve as a basis for considering diffusion in simple systems like sand of crushed rock. A Fickian diffusion and linear sorption model is solved both by analytical Laplance transform and Green's function methods and by numerical methods, and then applied to small-scale experiments for Finnish low- and medium-level operating waste repositories. The main properties of bentonite are reviewed. The hydraulic conductivity of compacted bentonite is so low that the major transport mechanism is diffusion. A Fickian diffusion and linear sorption model is applied to bentonite. The main component of bentonite, montmorillonite, has a high ion-exchange capacity and thus, transport in bentonite consists of interactive chemical and diffusion phenomena. A chemical equilibrium model, CHEQ, is developed for ion-exchange reactions in bentonite water systems. CHEQ is applied to some bentonite experiments with success, especially for monovalent ions. The fitted log-binding constants for sodium exchange with potassium, magnesium, and calcium were 0.27, 1.50, and 2.10, respectively. A coupled chemical and diffusion model, CHEQDIFF, is developed to take account of diffusion in pore water, surface diffusion and ion-exchange reactions. The model is applied to the same experiments as CHEQ, and validation is partly successful. In the diffusion case, the above-mentioned values for binding constants are used. The apparent diffusion (both anions and cations) and surface diffusion (only for cations) constants used are 3.0*10 -11 m 2 /s and 6.0*10 -12 m 2 /s, respectively, but these values are questionable, as experimental results good enough for fitting are not available. (orig.). (74 refs., 27 figs., 12 tabs.)

  14. Constant physics and characteristics of fundamental constant

    International Nuclear Information System (INIS)

    Tarrach, R.

    1998-01-01

    We present some evidence which supports a surprising physical interpretation of the fundamental constants. First, we relate two of them through the renormalization group. This leaves as many fundamental constants as base units. Second, we introduce and a dimensional system of units without fundamental constants. Third, and most important, we find, while interpreting the units of the a dimensional system, that is all cases accessible to experimentation the fundamental constants indicate either discretization at small values or boundedness at large values of the corresponding physical quantity. (Author) 12 refs

  15. A versatile optical profilometer based on conoscopic holography sensors for acquisition of specular and diffusive surfaces in artworks

    Science.gov (United States)

    Gaburro, Nicola; Marchioro, Giacomo; Daffara, Claudia

    2017-07-01

    Surface metrology of artworks requires the design of suitable devices for in-situ non-destructive measurement together with reliable procedures for an effective analysis of such non-engineered variegate objects. To advance the state-of-the-art it has been implemented a versatile optical micro-profilometry taking advantage of the adapt- ability of conoscopic holography sensors, able to operate with irregular shapes and composite materials (diffusive, specular, and polychrome) of artworks. The scanning technique is used to obtain wide field and high spatially resolved areal profilometry. The prototype has a modular scheme based on a set of conoscopic sensors, extending the typical design based on a scanning stage and a single probe with a limited bandwidth, thus allowing the collection of heights data from surface with different scales and materials with variegate optical response. The system was optimized by characterizing the quality of the measurement with the probes triggered in continuous scanning modality. The results obtained on examples of cultural heritage objects (2D paintings, 3D height-relief) and materials (pictorial, metallic) demonstrate the versatility of the implemented device.

  16. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

    Energy Technology Data Exchange (ETDEWEB)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  17. Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

    Science.gov (United States)

    Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

    2015-02-14

    Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

  18. Diffusion profiles of fluorine in archaeological bones and teeth

    International Nuclear Information System (INIS)

    Nelson, P.H.

    1984-06-01

    Measurements of radial fluorine profiles in bone and teeth sections with a nuclear microprobe show that the distribution is due to diffusion of fluoride ions inward from any exposed surface. Assuming simple diffusion and constant environment, the profile shape depends only on the parameter Dt/a 2 (D=diffusion constant, t=time, a=radius of bone/teeth). Three computer programs have been written to allow visual comparison of data with theoretical diffusion curves. Use of these programs has shown that experimental profiles follow closely the predictions of simple diffusion theory. (Although the diffusion constant may depend on concentration and species to a lesser extent). A preliminary value of D (2.74 +- 0.4) x 10 - 4/ sq. mm/y was deduced from radiocarbon dated Moa bones (age 400-16,200 yr B.P.). Preliminary investigations indicate that the diffusion constant in tooth dentine is approximately the same as in bone. These results indicate that a dating method using the computer programs should be possible for bones ranging in age from a few years to perhaps millions of years and that dating teeth should also be possible

  19. Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

    Directory of Open Access Journals (Sweden)

    Louena Shtrepi

    2017-02-01

    Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

  20. Moderate temperature-dependent surface and volume resistivity and low-frequency dielectric constant measurements of pure and multi-walled carbon nanotube (MWCNT) doped polyvinyl alcohol thin films

    Science.gov (United States)

    Edwards, Matthew; Guggilla, Padmaja; Reedy, Angela; Ijaz, Quratulann; Janen, Afef; Uba, Samuel; Curley, Michael

    2017-08-01

    Previously, we have reported measurements of temperature-dependent surface resistivity of pure and multi-walled carbon nanotube (MWNCT) doped amorphous Polyvinyl Alcohol (PVA) thin films. In the temperature range from 22 °C to 40 °C with humidity-controlled environment, we found the surface resistivity to decrease initially, but to rise steadily as the temperature continued to increase. Moreover, electric surface current density (Js) was measured on the surface of pure and MWCNT doped PVA thin films. In this regard, the surface current density and electric field relationship follow Ohm's law at low electric fields. Unlike Ohmic conduction in metals where free electrons exist, selected captive electrons are freed or provided from impurities and dopants to become conduction electrons from increased thermal vibration of constituent atoms in amorphous thin films. Additionally, a mechanism exists that seemingly decreases the surface resistivity at higher temperatures, suggesting a blocking effect for conducting electrons. Volume resistivity measurements also follow Ohm's law at low voltages (low electric fields), and they continue to decrease as temperatures increase in this temperature range, differing from surface resistivity behavior. Moreover, we report measurements of dielectric constant and dielectric loss as a function of temperature and frequency. Both the dielectric constant and dielectric loss were observed to be highest for MWCNT doped PVA compared to pure PVA and commercial paper, and with frequency and temperature for all samples.

  1. Anticipatory changes in control of swing foot and lower limb joints when walking onto a moving surface traveling at constant speed.

    Science.gov (United States)

    Hsu, Wei-Chun; Wang, Ting-Ming; Lu, Hsuan-Lun; Lu, Tung-Wu

    2015-01-01

    Adapting to a predictable moving surface such as an escalator is a crucial part of daily locomotor tasks in modern cities. However, the associated biomechanics have remained unexplored. In a gait laboratory, fifteen young adults walked from the ground onto a moving or a static surface while their kinematic and kinetic data were obtained for calculating foot and pelvis motions, as well as the angles and moments of the lower limb joints. Between-surface-condition comparisons were performed using a paired t-test (α = 0.05). The results showed that anticipatory locomotor adjustments occurred at least a stride before successfully walking onto the moving surface, including increasing step length and speed in the trailing step (p moving surface (p > 0.05), mainly through reduced extension of the trailing hip but increased pelvic anterior tilt and leading swing ankle plantarflexion (p moving surfaces such as escalators. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Cosmological Hubble constant and nuclear Hubble constant

    International Nuclear Information System (INIS)

    Horbuniev, Amelia; Besliu, Calin; Jipa, Alexandru

    2005-01-01

    The evolution of the Universe after the Big Bang and the evolution of the dense and highly excited nuclear matter formed by relativistic nuclear collisions are investigated and compared. Values of the Hubble constants for cosmological and nuclear processes are obtained. For nucleus-nucleus collisions at high energies the nuclear Hubble constant is obtained in the frame of different models involving the hydrodynamic flow of the nuclear matter. Significant difference in the values of the two Hubble constant - cosmological and nuclear - is observed

  3. First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

    International Nuclear Information System (INIS)

    Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

    2014-01-01

    We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

  4. SFG analysis of the molecular structures at the surfaces and buried interfaces of PECVD ultralow-dielectric constant pSiCOH: Reactive ion etching and dielectric recovery

    Science.gov (United States)

    Myers, John N.; Zhang, Xiaoxian; Huang, Huai; Shobha, Hosadurga; Grill, Alfred; Chen, Zhan

    2017-05-01

    Molecular structures at the surface and buried interface of an amorphous ultralow-k pSiCOH dielectric film were quantitatively characterized before and after reactive ion etching (RIE) and subsequent dielectric repair using sum frequency generation (SFG) vibrational spectroscopy and Auger electron spectroscopy. SFG results indicated that RIE treatment of the pSiCOH film resulted in a depletion of ˜66% of the surface methyl groups and changed the orientation of surface methyl groups from ˜47° to ˜40°. After a dielectric recovery process that followed the RIE treatment, the surface molecular structure was dominated by methyl groups with an orientation of ˜55° and the methyl surface coverage at the repaired surface was 271% relative to the pristine surface. Auger depth profiling indicated that the RIE treatment altered the top ˜25 nm of the film and that the dielectric recovery treatment repaired the top ˜9 nm of the film. Both SFG and Auger profiling results indicated that the buried SiCNH/pSiCOH interface was not affected by the RIE or the dielectric recovery process. Beyond characterizing low-k materials, the developed methodology is general and can be used to distinguish and characterize different molecular structures and elemental compositions at the surface, in the bulk, and at the buried interface of many different polymer or organic thin films.

  5. Past surface temperatures at the NorthGRIP drill site from the difference in firn diffusion of water isotopes

    DEFF Research Database (Denmark)

    Simonsen, Sebastian Bjerregaard; Johnsen, S. J.; Popp, T. J.

    2011-01-01

    A new ice core paleothermometer is introduced based on the temperature dependent diffusion of the stable water isotopes in the firn. A new parameter called differential diffusion length is defined as the difference between the diffusion length of the two stable water isotopologues 2H1H16O and 1H218......O. A model treatment of the diffusion process of the firn and the ice is presented along with a method of retrieving the diffusion signal from the ice core record of water isotopes using spectral methods. The model shows how the diffusion process is highly dependent on the inter-annual variations...... warmer than observed in other ice core based temperature reconstructions. The mechanisms behind this behaviour are not fully understood. The method shows the need of an expansion of high resolution stable water isotope datasets from ice cores. However, the new ice core paleothermometer presented here...

  6. Coverage dependent desorption dynamics of deuterium on Si(100) surfaces: interpretation with a diffusion-promoted desorption model.

    Science.gov (United States)

    Matsuno, T; Niida, T; Tsurumaki, H; Namiki, A

    2005-01-08

    We studied coverage dependence of time-of-flight (TOF) spectra of D2 molecules thermally desorbed from the D/Si(100) surface. The mean translational energies Et of desorbed D2 molecules were found to increase from 0.20+/-0.05 eV to 0.40+/-0.04 eV as the desorption coverage window was decreased from 1.0 ML> or =thetaD> or =0.9 ML to 0.2 ML> or =thetaD> or =0 ML, being consistent with the kinetics switch predicted in the interdimer mechanism. The measured TOF spectra were deconvoluted into 2H, 3H, and 4H components by a curve fitting method along the principle of detailed balance. As a result, it turned out that the desorption kinetics changes from the 4H to the 3H situation at high coverage above thetaD=0.9 ML, while the 2H desorption is dominant for a quite wide coverage region up to thetaD=0.8 ML. A dynamic desorption mechanism by which the desorption is promoted by D-atom diffusion to dangling bonds was proposed. 2005 American Institute of Physics.

  7. Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

    International Nuclear Information System (INIS)

    Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

    1985-06-01

    A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

  8. Thermal diffusion (1963)

    International Nuclear Information System (INIS)

    Lemarechal, A.

    1963-01-01

    This report brings together the essential principles of thermal diffusion in the liquid and gaseous phases. The macroscopic and molecular aspects of the thermal diffusion constant are reviewed, as well as the various measurement method; the most important developments however concern the operation of the CLUSIUS and DICKEL thermo-gravitational column and its applications. (author) [fr

  9. Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

    2016-09-15

    Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

  10. The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

    Directory of Open Access Journals (Sweden)

    K.A. Widi

    2016-09-01

    Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

  11. FORMATION CONSTANTS AND THERMODYNAMIC ...

    African Journals Online (AJOL)

    KEY WORDS: Metal complexes, Schiff base ligand, Formation constant, DFT calculation ... best values for the formation constants of the proposed equilibrium model by .... to its positive charge distribution and the ligand deformation geometry.

  12. Probing the surface swelling in ultra-thin supported polystyrene films during case II diffusion of n-hexane

    NARCIS (Netherlands)

    Ogieglo, Wojciech; Wormeester, Herbert; Wessling, Matthias; Benes, Nieck Edwin

    2013-01-01

    In situ time-resolved spectroscopic ellipsometry is used to study the dynamics of n-hexane diffusion into, and the corresponding induced swelling of, ultra-thin polystyrene films. The experimental conditions are carefully selected to facilitate the observation of anomalous Case II diffusion in the

  13. Ion exchange equilibrium constants

    CERN Document Server

    Marcus, Y

    2013-01-01

    Ion Exchange Equilibrium Constants focuses on the test-compilation of equilibrium constants for ion exchange reactions. The book first underscores the scope of the compilation, equilibrium constants, symbols used, and arrangement of the table. The manuscript then presents the table of equilibrium constants, including polystyrene sulfonate cation exchanger, polyacrylate cation exchanger, polymethacrylate cation exchanger, polysterene phosphate cation exchanger, and zirconium phosphate cation exchanger. The text highlights zirconium oxide anion exchanger, zeolite type 13Y cation exchanger, and

  14. Study of cadmium-humic interactions and determination of stability constants of cadmium-humate complexes from their diffusion coefficients obtained by scanned stripping voltammetry and dynamic light scattering techniques

    Digital Repository Service at National Institute of Oceanography (India)

    Chakraborty, P.

    for extracting other speciation parameters of the systems. This study revealed that Cd sup(2+) ion along with small dynamic Cd complexes was predominantly present in a Cd-HA system at pH 5 with high diffusion coefficients. HA molecules were in aggregated form...

  15. Thermal diffusion (1963); Diffusion thermique (1963)

    Energy Technology Data Exchange (ETDEWEB)

    Lemarechal, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1963-07-01

    This report brings together the essential principles of thermal diffusion in the liquid and gaseous phases. The macroscopic and molecular aspects of the thermal diffusion constant are reviewed, as well as the various measurement method; the most important developments however concern the operation of the CLUSIUS and DICKEL thermo-gravitational column and its applications. (author) [French] Ce rapport rassemble les principes essentiels de la diffusion thermique en phase liquide et en phase gazeuse. Les aspects macroscopique et moleculaire de la constante de diffusion thermique sont passes en revue ainsi que ses differentes methodes de mesure; mais les developpements les plus importants concernent le fonctionnement de ls colonne thermogravitationnelle de CLUSIUS et DICKEL et ses applications. (auteur)

  16. Electrochemical quantification of the thermodynamic equilibrium constant of the tenoxicam-β-cyclodextrin inclusion complex formed on the surface of a poly-β cyclodextrin-modified carbon paste electrode

    International Nuclear Information System (INIS)

    Guzmán-Hernández, D.S.; Palomar-Pardavé, M.; Rojas-Hernández, A.; Corona-Avendaño, S.; Romero-Romo, M.; Ramírez-Silva, M.T.

    2014-01-01

    Graphical abstract: - Highlights: • A carbon paste electrode (CPE) was modified with a β-CD polymer. • Tenoxicam oxidation on the CPE/poly-β-CD was adsorption controlled. • Influence of pH, scan rate, angular velocity and concentration was evaluated. • Fittings of i-E plots were done considering an irreversible surface reaction. • Electrochemical evaluation of the surface inclusion constant is presented. - Abstract: In this work it is shown that when a carbon paste electrode, CPE, is modified with a β-cyclodextrin polymer, the tenoxicam oxidation becomes an adsorption controlled process due to formation of a surface inclusion complex with the β-CD molecules comprising the surface of the polymer. It was found that such surface inclusion complex can be formed independently of the tenoxicam predominant species, Tenox’, in the aqueous solution namely: H 2 Tenox + , HTenox or Tenox − , depending on the solution pH. The electrochemical quantification of the thermodynamic constant of the equilibrium Tenox’ + β-CD (polymer) = Tenox’-β-CD (polymer) was estimated as log K incl. = 4.26 ± 0.01. Furthermore, from the analyses of the experimental voltammograms according with Laviron's equation for an irreversible surface reaction [E. Laviron, J. Electroanal. Chem. 52 (1974) 355-393] it is shown that the surface concentration, Γ R , of tenoxicam increases as its concentration in solution does, reaching a maximum value of 1.51 × 10 −10 mol cm −2 at 64 μM

  17. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    International Nuclear Information System (INIS)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-01-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal(100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN ~ N -β with β = 3/2. However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N < 9; (ii) slow nucleation-mediated diffusion with small β < 1 for “perfect” sizes N = N p = L 2 or L(L+1), for L = 3, 4,… having unique ground state shapes, for moderate sizes 9 ≤ N ≤ O(10 2 ); the same also applies for N = N p +3, N p + 4,… (iii) facile diffusion but with large β > 2 for N = Np + 1 and N p + 2 also for moderate sizes 9 ≤ N ≤ O(10 2 ); (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲ β < 3/2, reflecting the quasi-facetted structure of clusters, for larger N = O(10 2 ) to N = O(10 3 ); and (v) classic scaling with β = 3/2 for very large N = O(103) and above. The specified size ranges apply for typical model parameters. We focus on the moderate size regime where show that diffusivity cycles quasi-periodically from the slowest branch for N p + 3 (not Np) to the fastest branch for Np + 1. Behavior is quantified by Kinetic Monte Carlo simulation of an appropriate stochastic lattice-gas model. However, precise analysis must account for a strong enhancement of diffusivity for short time increments due to back-correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground state and low-lying excited state cluster configurations, and also of kink populations.

  18. Diffusion of two-dimensional epitaxial clusters on metal (100) surfaces: Facile versus nucleation-mediated behavior and their merging for larger sizes

    Science.gov (United States)

    Lai, King C.; Liu, Da-Jiang; Evans, James W.

    2017-12-01

    For diffusion of two-dimensional homoepitaxial clusters of N atoms on metal (100) surfaces mediated by edge atom hopping, macroscale continuum theory suggests that the diffusion coefficient scales like DN˜ N-β with β =3 /2 . However, we find quite different and diverse behavior in multiple size regimes. These include: (i) facile diffusion for small sizes N mediated diffusion with small β 2 for N =Np+1 and Np+2 also for moderate sizes 9 ≤N ≤O (102) ; (iv) merging of the above distinct branches and subsequent anomalous scaling with 1 ≲β analysis must account for a strong enhancement of diffusivity for short time increments due to back correlation in the cluster motion. Further understanding of this enhancement, of anomalous size scaling behavior, and of the merging of various branches, is facilitated by combinatorial analysis of the number of the ground-state and low-lying excited state cluster configurations, and also of kink populations.

  19. Diffusing diffusivity: Rotational diffusion in two and three dimensions

    Science.gov (United States)

    Jain, Rohit; Sebastian, K. L.

    2017-06-01

    We consider the problem of calculating the probability distribution function (pdf) of angular displacement for rotational diffusion in a crowded, rearranging medium. We use the diffusing diffusivity model and following our previous work on translational diffusion [R. Jain and K. L. Sebastian, J. Phys. Chem. B 120, 3988 (2016)], we show that the problem can be reduced to that of calculating the survival probability of a particle undergoing Brownian motion, in the presence of a sink. We use the approach to calculate the pdf for the rotational motion in two and three dimensions. We also propose new dimensionless, time dependent parameters, αr o t ,2 D and αr o t ,3 D, which can be used to analyze the experimental/simulation data to find the extent of deviation from the normal behavior, i.e., constant diffusivity, and obtain explicit analytical expressions for them, within our model.

  20. The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

    2016-04-15

    We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

  1. Mathematical modeling of synthesis gas fueled electrochemistry and transport including H2/CO co-oxidation and surface diffusion in solid oxide fuel cell

    Science.gov (United States)

    Bao, Cheng; Jiang, Zeyi; Zhang, Xinxin

    2015-10-01

    Fuel flexibility is a significant advantage of solid oxide fuel cell (SOFC). A comprehensive macroscopic framework is proposed for synthesis gas (syngas) fueled electrochemistry and transport in SOFC anode with two main novelties, i.e. analytical H2/CO electrochemical co-oxidation, and correction of gas species concentration at triple phase boundary considering competitive absorption and surface diffusion. Staring from analytical approximation of the decoupled charge and mass transfer, we present analytical solutions of two defined variables, i.e. hydrogen current fraction and enhancement factor. Giving explicit answer (rather than case-by-case numerical calculation) on how many percent of the current output contributed by H2 or CO and on how great the water gas shift reaction plays role on, this approach establishes at the first time an adaptive superposition mechanism of H2-fuel and CO-fuel electrochemistry for syngas fuel. Based on the diffusion equivalent circuit model, assuming series-connected resistances of surface diffusion and bulk diffusion, the model predicts well at high fuel utilization by keeping fixed porosity/tortuosity ratio. The model has been validated by experimental polarization behaviors in a wide range of operation on a button cell for H2-H2O-CO-CO2-N2 fuel systems. The framework could be helpful to narrow the gap between macro-scale and meso-scale SOFC modeling.

  2. Surface channeling

    International Nuclear Information System (INIS)

    Sizmann, R.; Varelas, C.

    1976-01-01

    There is experimental evidence that swift light ions incident at small angles towards single crystalline surfaces can lose an appreciable fraction of their kinetic energy during reflection. It is shown that these projectiles penetrate into the bulk surface region of the crystal. They can travel as channeled particles along long paths through the solid (surface channeling). The angular distribution and the depth history of the re-emerged projectiles are investigated by computer simulations. A considerable fraction of the penetrating projectiles re-emerges from the crystal with constant transverse energy if the angle of incidence is smaller than the critical angle for axial channeling. Analytical formulae are derived based on a diffusion model for surface channeling. A comparison with experimental data exhibits the relevance of the analytical solutions. (Auth.)

  3. Oxygen tracer diffusion and surface exchange kinetics in Ba0.5Sr0.5Co0.8Fe0.2O3-δ

    NARCIS (Netherlands)

    Berenov, A.; Atkinson, A.; Kilner, J.; Ananyev, M.; Eremin, V.; Porotnikova, N.; Farlenkov, A.; Kurumchin, E.; Bouwmeester, Henricus J.M.; Bucher, E.; Sitte, W.

    2014-01-01

    The oxygen tracer diffusion coefficient, Db⁎, and the oxygen tracer surface exchange coefficient, k, were measured in Ba0.5Sr0.5Co0.8Fe0.2O3 − δ (BSCF5582) over the temperature range of 310–800 °C and the oxygen partial pressure range of 1.3 × 10−3–0.21 bar. Several measurement techniques were used:

  4. Reactor group constants and benchmark test

    Energy Technology Data Exchange (ETDEWEB)

    Takano, Hideki [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-08-01

    The evaluated nuclear data files such as JENDL, ENDF/B-VI and JEF-2 are validated by analyzing critical mock-up experiments for various type reactors and assessing applicability for nuclear characteristics such as criticality, reaction rates, reactivities, etc. This is called Benchmark Testing. In the nuclear calculations, the diffusion and transport codes use the group constant library which is generated by processing the nuclear data files. In this paper, the calculation methods of the reactor group constants and benchmark test are described. Finally, a new group constants scheme is proposed. (author)

  5. Diffusion Under Geometrical Constraint

    OpenAIRE

    Ogawa, Naohisa

    2014-01-01

    Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...

  6. Coexistence and competition of surface diffusion and geometric shielding in the growth of 1D bismuth nanostructures and their ohmic contact

    International Nuclear Information System (INIS)

    Tian, Ye; Jiang, Lianjun; Zhang, Xuejun; Deng, Yangbao; Deng, Shuguang

    2014-01-01

    We study the physical-vapor-deposition of 1D bismuth nanostructures. Bi nanowire elongating along [012] and/or [110] direction as well as anisotropic Bi nano-columns are physical-vapor-deposited successfully. The coexistence and competition of surface diffusion and geometric shielding are critical to their formation as well as growth mode transition among them. Since physical-vapor-deposition is a vacuum process, we make use of it to fabricate the ohmic contact to prevent the damage to the bismuth nanostructures brought by the etching to their thick surface oxide layer. (paper)

  7. Effect of the carbon nanotube surface characteristics on the conductivity and dielectric constant of carbon nanotube/poly(vinylidene fluoride composites

    Directory of Open Access Journals (Sweden)

    Pereira João

    2011-01-01

    Full Text Available Abstract Commercial multi-walled carbon nanotubes (CNT were functionalized by oxidation with HNO3, to introduce oxygen-containing surface groups, and by thermal treatments at different temperatures for their selective removal. The obtained samples were characterized by adsorption of N2 at -196°C, temperature-programmed desorption and determination of pH at the point of zero charge. CNT/poly(vinylidene fluoride composites were prepared using the above CNT samples, with different filler fractions up to 1 wt%. It was found that oxidation reduced composite conductivity for a given concentration, shifted the percolation threshold to higher concentrations, and had no significant effect in the dielectric response.

  8. The Fine Structure Constant

    Indian Academy of Sciences (India)

    IAS Admin

    The article discusses the importance of the fine structure constant in quantum mechanics, along with the brief history of how it emerged. Al- though Sommerfelds idea of elliptical orbits has been replaced by wave mechanics, the fine struc- ture constant he introduced has remained as an important parameter in the field of ...

  9. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe(110) surface

    International Nuclear Information System (INIS)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-01-01

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.

  10. First-principles analysis of C2H2 molecule diffusion and its dissociation process on the ferromagnetic bcc-Fe110 surface.

    Science.gov (United States)

    Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko

    2010-09-29

    Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.

  11. Apparatus for diffusion separation

    International Nuclear Information System (INIS)

    Nierenberg, W.A.

    1976-01-01

    A diffuser separator apparatus is described which comprises a plurality of flow channels in a single stage. Each of said channels has an inlet port and an outlet port and a constant cross sectional area between said ports. At least a portion of the defining surface of each of said channels is a diffusion separation membrane, and each of said channels is a different cross sectional area. Means are provided for connecting said channels in series so that each successive channel of said series has a smaller cross sectional area than the previous channel of said series. Also provided are a source of gaseous mixture, individual means for flowing said gaseous mixture to the inlet port of each of said channels, gas receiving and analyzing means, individual means for flowing gas passing from each of said outlet ports and means for flowing gas passing through said membranes to said receiving and analyzing means, and individual means for connecting the outlet port of each channel with the inlet port of the channel having the next smaller cross sectional area

  12. CHEMICAL REACTIONS ON ADSORBING SURFACE: KINETIC LEVEL OF DESCRIPTION

    Directory of Open Access Journals (Sweden)

    P.P.Kostrobii

    2003-01-01

    Full Text Available Based on the effective Hubbard model we suggest a statistical description of reaction-diffusion processes for bimolecular chemical reactions of gas particles adsorbed on the metallic surface. The system of transport equations for description of particles diffusion as well as reactions is obtained. We carry out the analysis of the contributions of all physical processes to the formation of diffusion coefficients and chemical reactions constants.

  13. Diffusion of interstitial atoms in FCC metals after irradiation with 2 MeV electrons

    International Nuclear Information System (INIS)

    Kornmann, H.

    1980-01-01

    Selfdiffusion in nickel after electron irradiation has been restudied. The diffusion velocity near the surface and the diffusion constant in the interior of the crystal have been determined as a function of radiation flux and temperature. A special method for the measurement of diffusion has been improved, which is based on radioactive tracer atoms for indication and on ion etching for the removal of thin films. To improve additionally the accuracy of the technique tracer atoms are induced into the crystal by thermal diffusion and then irradiated with 2 MeV electrons. (orig./GSCH) [de

  14. Spatial-temporal evolution of self-organized loop-patterns on a water surface and a diffuse discharge in the gap

    Science.gov (United States)

    Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru

    2017-11-01

    Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.

  15. Cosmological constants and variations

    International Nuclear Information System (INIS)

    Barrow, John D

    2005-01-01

    We review properties of theories for the variation of the gravitation and fine structure 'constants'. We highlight some general features of the cosmological models that exist in these theories with reference to recent quasar data that is consistent with time-variation in the fine structure 'constant' since a redshift of 3.5. The behaviour of a simple class of varying alpha cosmologies is outlined in the light of all the observational constraints. We also discuss some of the consequences of varying 'constants' for oscillating universes and show by means of exact solutions that they appear to evolve monotonically in time even though the scale factor of the universe oscillates

  16. Shaping optimal zinc coating on the surface of high-quality ductile iron casting. Part II – Technological formula and value of diffusion coefficient

    Directory of Open Access Journals (Sweden)

    Kopyciński D.

    2017-03-01

    Full Text Available The completed research presented in the first part of the article has allowed linking the manufacturing technology of ductile iron castings with the process of hot dip galvanizing. On the basis of these data simulations were carried out to examine the behaviour of zinc diffusion coefficient D in the galvanized coating. The adopted model of zinc coating growth helped to explain the cases of excessive growth of the intermetallic phases in this type of coating. The paper analyzes covered the relationship between the roughness and phase composition of the top layer of product and the thickness and kinetics of zinc coating growth referred to individual sub-layers of the intermetallic phases.Roughness and phase composition in the surface layer of product were next related to the diffusion coefficient D examined in respective sublayers of the intermetallic phases.

  17. Self-diffusion on (100), (110), and (111) surfaces of Ni and Cu: A detailed study of prefactors and activation energies

    International Nuclear Information System (INIS)

    Ku'rpick, Ulrike

    2001-01-01

    We calculate activation barriers and prefactors for diffusion via hopping on (100), (110), and (111) surfaces of Ni and Cu. The calculations reveal that, when activation barriers decrease there is also a decrease in the prefactors such that the changes in both quantities partly compensate for each other with respect to the diffusivities. Thermodynamic functions which contribute to the prefactors are calculated from local vibrational density of states, showing that mainly entropy contributions control the prefactors. Our method allows one to trace the obtained values back to vibrational properties of the adatoms in both the minimum-energy and transition-state configurations, and enables a physical understanding of why prefactors have certain values

  18. Constant Width Planar Computation Characterizes ACC0

    DEFF Research Database (Denmark)

    Hansen, Kristoffer Arnsfelt

    2006-01-01

    We obtain a characterization of ACC0 in terms of a natural class of constant width circuits, namely in terms of constant width polynomial size planar circuits. This is shown via a characterization of the class of acyclic digraphs which can be embedded on a cylinder surface in such a way that all...

  19. Surface sealing using self-assembled monolayers and its effect on metal diffusion in porous low-k dielectrics studied using monoenergetic positron beams

    International Nuclear Information System (INIS)

    Uedono, Akira; Armini, Silvia; Zhang, Yu; Kakizaki, Takeaki; Krause-Rehberg, Reinhard; Anwand, Wolfgang; Wagner, Andreas

    2016-01-01

    Graphical abstract: - Highlights: • Pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the low-k film. • For the sample without the SAM sealing process, metal atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. Almost all pore interiors were covered by those metals. • For the sample damaged by a plasma etch treatment before the SAM sealing process, self-assembled molecules diffused into the OSG film, and they were preferentially trapped by larger pores. - Abstract: Surface sealing effects on the diffusion of metal atoms in porous organosilicate glass (OSG) films were studied by monoenergetic positron beams. For a Cu(5 nm)/MnN(3 nm)/OSG(130 nm) sample fabricated with pore stuffing, C_4F_8 plasma etch, unstuffing, and a self-assembled monolayer (SAM) sealing process, it was found that pores with cubic pore side lengths of 1.1 and 3.1 nm coexisted in the OSG film. For the sample without the SAM sealing process, metal (Cu and Mn) atoms diffused from the top Cu/MnN layer into the OSG film and were trapped by the pores. As a result, almost all pore interiors were covered with those metals. For the sample damaged by an Ar/C_4F_8 plasma etch treatment before the SAM sealing process, SAMs diffused into the OSG film, and they were preferentially trapped by larger pores. The cubic pore side length in these pores containing self-assembled molecules was estimated to be 0.7 nm. Through this work, we have demonstrated that monoenergetic positron beams are a powerful tool for characterizing capped porous films and the trapping of atoms and molecules by pores.

  20. Impact of the structural anisotropy of La{sub 2}NiO{sub 4+δ} on on high temperature surface modifications and diffusion of oxygen

    Energy Technology Data Exchange (ETDEWEB)

    Gauquelin, Nicolas

    2010-11-29

    La{sub 2}NiO{sub 4+δ} was first studied due to its structural similarities with the High Temperature superconductor La{sub 2}NiO{sub 4+δ} and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K{sub 2}NiF{sub 4} layered structure and accommodates highly mobile oxygen at its ground state and is therefore overstoichiometric. During this thesis, pure single crystals of La{sub 2}NiO{sub 4+δ} were successfully grown using the floating-zone method, subsequently characterized using neutron and Laue Backscattering diffraction and oriented pieces of single crystal with [100] and [001] orientation were prepared. The surface morphology behavior after long term exposure to high temperature in different atmospheres was observed using microscopy techniques because stability at high temperature is required for application purposes and it was discovered a structural change to nickel-rich phases at T>1173 K. The sensibility of the oxygen non-stoichiometry to cooling was studied and subsequently a new {sup 18}O-{sup 18}O exchange apparatus allowing quenching of the samples using liquid nitrogen was developed. Oxygen selfdiffusion was studied using SIMS in the range 673-873K in both [100] and [001] crystallographic directions. The effect of the disorientation of the sample surface on the determination of the slowest diffusion coefficient was discovered and revealed the very strong anisotropy (>5 orders of magnitude difference) between the different diffusion paths. Finally using HTXRD and oxygen release experiments, it was shown that oxygen diffusion from interstitial oxygen starts to be relevant at 550-600 K and a change of behavior is observed around 700 K, corresponding to a possible change in the diffusion mechanism from interstitial to interstitialcy.

  1. Impact of the structural anisotropy of La2NiO4+δ on on high temperature surface modifications and diffusion of oxygen

    International Nuclear Information System (INIS)

    Gauquelin, Nicolas

    2010-01-01

    La 2 NiO 4+δ was first studied due to its structural similarities with the High Temperature superconductor La 2 NiO 4+δ and more recently due to its promise as a cathode material in Solid Oxide Fuel Cells as well as an oxygen exchange membrane. It crystallizes in the K 2 NiF 4 layered structure and accommodates highly mobile oxygen at its ground state and is therefore overstoichiometric. During this thesis, pure single crystals of La 2 NiO 4+δ were successfully grown using the floating-zone method, subsequently characterized using neutron and Laue Backscattering diffraction and oriented pieces of single crystal with [100] and [001] orientation were prepared. The surface morphology behavior after long term exposure to high temperature in different atmospheres was observed using microscopy techniques because stability at high temperature is required for application purposes and it was discovered a structural change to nickel-rich phases at T>1173 K. The sensibility of the oxygen non-stoichiometry to cooling was studied and subsequently a new 18 O- 18 O exchange apparatus allowing quenching of the samples using liquid nitrogen was developed. Oxygen selfdiffusion was studied using SIMS in the range 673-873K in both [100] and [001] crystallographic directions. The effect of the disorientation of the sample surface on the determination of the slowest diffusion coefficient was discovered and revealed the very strong anisotropy (>5 orders of magnitude difference) between the different diffusion paths. Finally using HTXRD and oxygen release experiments, it was shown that oxygen diffusion from interstitial oxygen starts to be relevant at 550-600 K and a change of behavior is observed around 700 K, corresponding to a possible change in the diffusion mechanism from interstitial to interstitialcy.

  2. The cosmological constant problem

    International Nuclear Information System (INIS)

    Dolgov, A.D.

    1989-05-01

    A review of the cosmological term problem is presented. Baby universe model and the compensating field model are discussed. The importance of more accurate data on the Hubble constant and the Universe age is stressed. 18 refs

  3. The Importance Of Surface Topography For The Biological Properties Of Nitrided Diffusion Layers Produced On Ti6Al4V Titanium Alloy

    Directory of Open Access Journals (Sweden)

    Wierzchoń T.

    2015-09-01

    Full Text Available Diffusion nitrided layers produced on titanium and its alloys are widely studied in terms of their application for cardiac and bone implants. The influence of the structure, the phase composition, topography and surface morphology on their biological properties is being investigated. The article presents the results of a study of the topography (nanotopography of the surface of TiN+Ti2N+αTi(N nitrided layers produced in low-temperature plasma on Ti6Al4V titanium alloy and their influence on the adhesion of blood platelets and their aggregates. The TEM microstructure of the produced layers have been examined and it was demonstrated that the interaction between platelets and the surface of the titanium implants subjected to glow-discharge nitriding can be shaped via modification of the roughness parameters of the external layer of the TiN titanium nitride nanocrystalline zone.

  4. Migration of the guinea pig sperm membrane protein PH-20 from one localized surface domain to another does not occur by a simple diffusion-trapping mechanism.

    Science.gov (United States)

    Cowan, A E; Myles, D G; Koppel, D E

    1991-03-01

    The redistribution of membrane proteins on the surface of cells is a prevalent feature of differentiation in a variety of cells. In most cases the mechanism responsible for such redistribution is poorly understood. Two potential mechanisms for the redistribution of surface proteins are: (1) passive diffusion coupled with trapping, and (2) active translocation. We have studied the process of membrane protein redistribution for the PH-20 protein of guinea pig sperm, a surface protein required for sperm binding to the egg zona pellucida (P. Primakoff, H. Hyatt, and D. G. Myles (1985). J. Cell Biol. 101, 2239-2244). PH-20 protein is localized to the posterior head plasma menbrane of the mature sperm cell. Following the exocytotic acrosome reaction, PH-20 protein moves into the newly incorporated inner acrosomal membrane (IAM), placing it in a position favorable for a role in binding sperm to the egg zona pellucida (D. G. Myles, and P. Primakoff (1984), J. Cell Biol. 99, 1634-1641). To analyze the mechanistic basis for this protein migration, we have used fluorescence microscopy and digital image processing to characterize PH-20 protein migration in individual cells. PH-20 protein was observed to move against a concentration gradient in the posterior head plasma membrane. This result argues strongly against a model of passive diffusion followed by trapping in the IAM, and instead suggests that an active process serves to concentrate PH-20 protein toward the boundary separating the posterior head and IAM regions. A transient gradient of PH-20 concentration observed in the IAM suggests that once PH-20 protein reaches the IAM, it is freely diffusing. Additionally, we observed that migration of PH-20 protein was calcium dependent.

  5. Insights into Surface Interactions between Metal Organic Frameworks and Gases during Transient Adsorption and Diffusion by In-Situ Small Angle X-ray Scattering

    Directory of Open Access Journals (Sweden)

    Ludovic F. Dumée

    2016-09-01

    Full Text Available The fabrication of molecular gas sieving materials with specific affinities for a single gas species and able to store large quantities of materials at a low or atmospheric pressure is desperately required to reduce the adverse effects of coal and oil usage in carbon capture. Fundamental understanding of the dynamic adsorption of gas, the diffusion mechanisms across thin film membranes, and the impact of interfaces play a vital role in developing these materials. In this work, single gas permeation tests across micro-porous membrane materials, based on metal organic framework crystals grown on the surface of carbon nanotubes (ZiF-8@CNT, were performed for the first time in-situ at the Australian Synchrotron on the small angle X-ray scattering beamline in order to reveal molecular sieving mechanisms and gas adsorption within the material. The results show that specific chemi-sorption of CO2 across the ZiF-8 crystal lattices affected the morphology and unit cell parameters, while the sieving of other noble or noble like gases across the ZiF-8@CNT membranes was found to largely follow Knudsen diffusion. This work demonstrates for the first time a novel and effective technique to assess molecular diffusion at the nano-scale across sub-nano-porous materials by probing molecular flexibility across crystal lattice and single cell units.

  6. A novel film-pore-surface diffusion model to explain the enhanced enzyme adsorption of corn stover pretreated by ultrafine grinding.

    Science.gov (United States)

    Zhang, Haiyan; Chen, Longjian; Lu, Minsheng; Li, Junbao; Han, Lujia

    2016-01-01

    Ultrafine grinding is an environmentally friendly pretreatment that can alter the degree of polymerization, the porosity and the specific surface area of lignocellulosic biomass and can, thus, enhance cellulose hydrolysis. Enzyme adsorption onto the substrate is a prerequisite for the enzymatic hydrolysis process. Therefore, it is necessary to investigate the enzyme adsorption properties of corn stover pretreated by ultrafine grinding. The ultrafine grinding pretreatment was executed on corn stover. The results showed that ultrafine grinding pretreatment can significantly decrease particle size [from 218.50 μm of sieve-based grinding corn stover (SGCS) to 17.45 μm of ultrafine grinding corn stover (UGCS)] and increase the specific surface area (SSA), pore volume (PV) and surface composition (SSA: from 1.71 m(2)/g of SGCS to 2.63 m(2)/g of UGCS, PV: from 0.009 cm(3)/g of SGCS to 0.024 m(3)/g of UGCS, cellulose surface area: from 168.69 m(2)/g of SGCS to 290.76 m(2)/g of UGCS, lignin surface area: from 91.46 m(2)/g of SGCS to 106.70 m(2)/g of UGCS). The structure and surface composition changes induced by ultrafine grinding increase the enzyme adsorption capacity from 2.83 mg/g substrate of SGCS to 5.61 mg/g substrate of UGCS. A film-pore-surface diffusion model was developed to simultaneously predict the enzyme adsorption kinetics of both the SGCS and UGCS. Satisfactory predictions could be made with the model based on high R (2) and low RMSE values (R (2) = 0.95 and RMSE = 0.16 mg/g for the UGCS, R (2) = 0.93 and RMSE = 0.09 mg/g for the SGCS). The model was further employed to analyze the rate-limiting steps in the enzyme adsorption process. Although both the external-film and internal-pore mass transfer are important for enzyme adsorption on the SGCS and UGCS, the UGCS has a lower internal-pore resistance compared to the SGCS. Ultrafine grinding pretreatment can enhance the enzyme adsorption onto corn stover by altering structure and

  7. Radiographic constant exposure technique

    DEFF Research Database (Denmark)

    Domanus, Joseph Czeslaw

    1985-01-01

    The constant exposure technique has been applied to assess various industrial radiographic systems. Different X-ray films and radiographic papers of two producers were compared. Special attention was given to fast film and paper used with fluorometallic screens. Radiographic image quality...... was tested by the use of ISO wire IQI's and ASTM penetrameters used on Al and Fe test plates. Relative speed and reduction of kilovoltage obtained with the constant exposure technique were calculated. The advantages of fast radiographic systems are pointed out...

  8. MHD heat and mass diffusion flow by natural convection past a surface embedded in a porous medium

    Directory of Open Access Journals (Sweden)

    Chaudhary R.C.

    2009-01-01

    Full Text Available This paper presents an analytical study of the transient hydromagnetic natural convection flow past a vertical plate embedded in a porous medium, taking account of the presence of mass diffusion and fluctuating temperature about time at the plate. The governing equations are solved in closed form by the Laplace-transform technique. The results are obtained for temperature, velocity, penetration distance, Nusselt number and skin-friction. The effects of various parameters are discussed on the flow variables and presented by graphs.

  9. Electro-oxidation of methanol diffused through proton exchange membrane on Pt surface: crossover rate of methanol

    International Nuclear Information System (INIS)

    Jung, Inhwa; Kim, Doyeon; Yun, Yongsik; Chung, Suengyoung; Lee, Jaeyoung; Tak, Yongsug

    2004-01-01

    Methanol crossover rate through proton exchange membrane (Nafion 117) was investigated with a newly designed electrochemical stripping cell. Nanosize Pt electrode was prepared by the electroless deposition. Distinct electrocatalytic oxidation behaviors of methanol inside membrane were similar to the methanol oxidation in aqueous electrolyte, except adsorption/desorption of hydrogen. The amount of methanol diffused through membrane was calculated from the charge of methanol oxidation during repetitive cyclic voltammetry (CV) and methanol crossover rate was estimated to be 0.69 nmol/s

  10. Diffusion in Coulomb crystals.

    Science.gov (United States)

    Hughto, J; Schneider, A S; Horowitz, C J; Berry, D K

    2011-07-01

    Diffusion in Coulomb crystals can be important for the structure of neutron star crusts. We determine diffusion constants D from molecular dynamics simulations. We find that D for Coulomb crystals with relatively soft-core 1/r interactions may be larger than D for Lennard-Jones or other solids with harder-core interactions. Diffusion, for simulations of nearly perfect body-centered-cubic lattices, involves the exchange of ions in ringlike configurations. Here ions "hop" in unison without the formation of long lived vacancies. Diffusion, for imperfect crystals, involves the motion of defects. Finally, we find that diffusion, for an amorphous system rapidly quenched from Coulomb parameter Γ=175 to Coulomb parameters up to Γ=1750, is fast enough that the system starts to crystalize during long simulation runs. These results strongly suggest that Coulomb solids in cold white dwarf stars, and the crust of neutron stars, will be crystalline and not amorphous.

  11. Does one-dimensional (1D) adatom and cluster diffusion of Pt on the Pt(110)-(1 x 2) surface lead to 1D ripening?

    International Nuclear Information System (INIS)

    Linderoth, T R; Horch, S; Petersen, L; Laegsgaard, E; Stensgaard, I; Besenbacher, F

    2005-01-01

    The technique of scanning tunnelling microscopy (STM) uniquely allows dynamic processes on surfaces to be followed directly in real space and at atomic resolution. Results for the 551225 surface diffusion of Pt adatoms and clusters on the anisotropic, missing row reconstructed Pt(110)-(1 x 2) surface are briefly reviewed. Mass transport in this system is entirely one-dimensional (1D) since, at low adatom coverage, atoms and clusters are confined to the missing row troughs. In this paper, we therefore address the question if Pt/Pt(110)-(1 x 2) is a 1D model system to study late stage growth phenomena such as island ripening? From STM measurements, we quantify the morphology changes resulting from annealing a surface configuration with small 1D Pt islands in the missing row troughs to temperatures in the interval 369-395 K. Interestingly, the resulting increase in island sizes (ripening) cannot be accounted for by the known island and adatom mobilities within a 1D model. An explanation is provided from dynamic, time-resolved 'STM-movies' that directly reveal two novel island-mediated mechanisms for inter-trough mass transport which cause the Pt/Pt(110)-(1 x 2) system not to be purely 1D at the higher surface coverage used in the annealing experiments

  12. Lagrangian and Eulerian diffusion study in the coastal surface layers. Progress report, July 1, 1979-June 30, 1980

    International Nuclear Information System (INIS)

    Carter, H.H.; Okubo, A.; Wilson, R.E.; Sanderson, B.; Pritchard, D.W.

    1980-07-01

    This research project addresses a fundamental problem in turbulence theory, the relation between Lagrangian and Eulerian statistics, by carrying out, analyzing, and interpreting a set of field experiments in the coastal waters off the south shore of Long Island. The study will not only provide information on the relation between the Lagrangian and Eulerian autocorrelations but also between the various experimental methods for quantitatively estimating turbulent diffusion. Two experiments, one in summer and one in winter, consisting of simultaneous measurements of dye diffusion, drogue dispersion, and Eulerian current velocities in a typical coastal locale were planned. In order to ensure a match between the Lagrangian (drogues, dye) scales of motion and the Eulerian (current meters) scales, however, a preliminary experiment, consisting of a 6 mooring current meter array and a short (approx. 3 hours) drogue experiment, was conducted during March 1980. Results of this preliminary experiment and their implications to the experimental program are discussed. The principal results were an improved design of our current meter array, and a wider variety of drogue experiments, i.e., multi-level, multi-scale, and continuous source simulation

  13. On the cosmical constant

    International Nuclear Information System (INIS)

    Chandra, R.

    1977-01-01

    On the grounds of the two correspondence limits, the Newtonian limit and the special theory limit of Einstein field equations, a modification of the cosmical constant has been proposed which gives realistic results in the case of a homogeneous universe. Also, according to this modification an explanation for the negative pressure in the steady-state model of the universe has been given. (author)

  14. Cosmological constant problem

    International Nuclear Information System (INIS)

    Weinberg, S.

    1989-01-01

    Cosmological constant problem is discussed. History of the problem is briefly considered. Five different approaches to solution of the problem are described: supersymmetry, supergravity, superstring; anthropic approach; mechamism of lagrangian alignment; modification of gravitation theory and quantum cosmology. It is noted that approach, based on quantum cosmology is the most promising one

  15. The Yamabe constant

    International Nuclear Information System (INIS)

    O Murchadha, N.

    1991-01-01

    The set of riemannian three-metrics with positive Yamabe constant defines the space of independent data for the gravitational field. The boundary of this set is investigated, and it is shown that metrics close to the boundary satisfy the positive-energy theorem. (Author) 18 refs

  16. The impact of changes in parameterizations of surface drag and vertical diffusion on the large-scale circulation in the Community Atmosphere Model (CAM5)

    Science.gov (United States)

    Lindvall, Jenny; Svensson, Gunilla; Caballero, Rodrigo

    2017-06-01

    Simulations with the Community Atmosphere Model version 5 (CAM5) are used to analyze the sensitivity of the large-scale circulation to changes in parameterizations of orographic surface drag and vertical diffusion. Many GCMs and NWP models use enhanced turbulent mixing in stable conditions to improve simulations, while CAM5 cuts off all turbulence at high stabilities and instead employs a strong orographic surface stress parameterization, known as turbulent mountain stress (TMS). TMS completely dominates the surface stress over land and reduces the near-surface wind speeds compared to simulations without TMS. It is found that TMS is generally beneficial for the large-scale circulation as it improves zonal wind speeds, Arctic sea level pressure and zonal anomalies of the 500-hPa stream function, compared to ERA-Interim. It also alleviates atmospheric blocking frequency biases in the Northern Hemisphere. Using a scheme that instead allows for a modest increase of turbulent diffusion at higher stabilities only in the planetary boundary layer (PBL) appears to in some aspects have a similar, although much smaller, beneficial effect as TMS. Enhanced mixing throughout the atmospheric column, however, degrades the CAM5 simulation. Evaluating the simulations in comparison with detailed measurements at two locations reveals that TMS is detrimental for the PBL at the flat grassland ARM Southern Great Plains site, giving too strong wind turning and too deep PBLs. At the Sodankylä forest site, the effect of TMS is smaller due to the larger local vegetation roughness. At both sites, all simulations substantially overestimate the boundary layer ageostrophic flow.

  17. Adsorption, Desorption, Surface Diffusion, Lattice Defect Formation, and Kink Incorporation Processes of Particles on Growth Interfaces of Colloidal Crystals with Attractive Interactions

    Directory of Open Access Journals (Sweden)

    Yoshihisa Suzuki

    2016-07-01

    Full Text Available Good model systems are required in order to understand crystal growth processes because, in many cases, precise incorporation processes of atoms or molecules cannot be visualized easily at the atomic or molecular level. Using a transmission-type optical microscope, we have successfully observed in situ adsorption, desorption, surface diffusion, lattice defect formation, and kink incorporation of particles on growth interfaces of colloidal crystals of polystyrene particles in aqueous sodium polyacrylate solutions. Precise surface transportation and kink incorporation processes of the particles into the colloidal crystals with attractive interactions were observed in situ at the particle level. In particular, contrary to the conventional expectations, the diffusion of particles along steps around a two-dimensional island of the growth interface was not the main route for kink incorporation. This is probably due to the number of bonds between adsorbed particles and particles in a crystal; the number exceeds the limit at which a particle easily exchanges its position to the adjacent one along the step. We also found novel desorption processes of particles from steps to terraces, attributing them to the assistance of attractive forces from additionally adsorbing particles to the particles on the steps.

  18. A Finite Difference Scheme for Double-Diffusive Unsteady Free Convection from a Curved Surface to a Saturated Porous Medium with a Non-Newtonian Fluid

    KAUST Repository

    El-Amin, Mohamed

    2011-05-14

    In this paper, a finite difference scheme is developed to solve the unsteady problem of combined heat and mass transfer from an isothermal curved surface to a porous medium saturated by a non-Newtonian fluid. The curved surface is kept at constant temperature and the power-law model is used to model the non-Newtonian fluid. The explicit finite difference method is used to solve simultaneously the equations of momentum, energy and concentration. The consistency of the explicit scheme is examined and the stability conditions are determined for each equation. Boundary layer and Boussinesq approximations have been incorporated. Numerical calculations are carried out for the various parameters entering into the problem. Velocity, temperature and concentration profiles are shown graphically. It is found that as time approaches infinity, the values of wall shear, heat transfer coefficient and concentration gradient at the wall, which are entered in tables, approach the steady state values.

  19. Surface diffusion and coverage effect of Li atom on graphene as studied by several density functional theory methods

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Zhi [Instituto de Ciencias Físicas, Universidad Nacional Autónoma de México, Av. Universidad 2001, Col. Chamilpa, 62210 Cuernavaca, Morelos (Mexico); Contreras-Torres, Flavio F., E-mail: flavioc@nucleares.unam.mx [Instituto de Ciencias Nucleares, Universidad Nacional Autónoma de México, Circuito Exterior, Ciudad Universitaria, 04510 México, DF (Mexico); Jalbout, Abraham F.; Ramírez-Treviño, Alberto [Instituto Tecnológico de Estudios Superiores de Cajeme, Ciudad Obregon, Sonora (Mexico)

    2013-11-15

    The adsorption of Li atom on graphene is examined using density functional theory methods. Three different adsorption sites are considered, including the on top of a carbon atom (OT), on top of a C-C bond (Bri), and on top of a hexagon (Hol), as well as Li adsorbed at different coverage. The Hol site is found to be the most stable, followed by the Bri and OT sites. The order of stabilization is independent of coverage. The localization of Li–graphene interaction at all sites has reverse order with stabilization. The localization will cause different repulsive interaction between Li atoms which is believed to take responsibility for the difference between the charge transfer order and adsorption energy order of Li adsorption at all possible sites. Repulsive interaction also causes the decreasing of adsorption energies of Li at Hol site with increasing coverage, but the corresponding influence is bigger at low coverage range (0.020–0.056 monolayers) than that at high coverage range (0.056–0.250 monolayers). The trend of charge transfer and dipole moment with increasing coverage is also in agreement with that of adsorption energy. It is also found that the distance of Li above graphene will increase with increasing coverage, but a so-called “zigzag” curve appears, which exhibits an oscillatory behavior as a function of increasing coverage. The diffusion of Li atom on graphene is also studied. Li atom migrates from a Hol site to a neighboring Hol site through the Bri site between them is found to be the minimum energy path. Within the studied coverage range, the diffusion barrier decreases with increasing coverage which can be ascribed to the phenomenon of different repulsion interactions when Li atom adsorbs at different sites. The increasing coverage amplified the phenomenon.

  20. Stability constants for silicate adsorbed to ferrihydrite

    DEFF Research Database (Denmark)

    Hansen, Hans Christian Bruun; Wetche, T.P.; Raulund-Rasmussen, Karsten

    1994-01-01

    Intrinsic surface acidity constants (K(a1)intr, K(a2)intr) and surface complexation constant for adsorption of orthosilicate onto synthetic ferrihydrite (K(Si) for the complex = FeOSi(OH)3) have been determined from acid/base titrations in 0.001-0.1 m NaClO4 electrolytes and silicate adsorption...... experiments in 0.01 m NaNO3 electrolyte (pH 3-6). The surface equilibrium constants were calculated according to the two-layer model by Dzombak & Morel (1990). Near equilibrium between protons/hydroxyls in solution and the ferrihydrite surface was obtained within minutes while equilibration with silicate...

  1. On the integrability of the generalized Fisher-type nonlinear diffusion equations

    International Nuclear Information System (INIS)

    Wang Dengshan; Zhang Zhifei

    2009-01-01

    In this paper, the geometric integrability and Lax integrability of the generalized Fisher-type nonlinear diffusion equations with modified diffusion in (1+1) and (2+1) dimensions are studied by the pseudo-spherical surface geometry method and prolongation technique. It is shown that the (1+1)-dimensional Fisher-type nonlinear diffusion equation is geometrically integrable in the sense of describing a pseudo-spherical surface of constant curvature -1 only for m = 2, and the generalized Fisher-type nonlinear diffusion equations in (1+1) and (2+1) dimensions are Lax integrable only for m = 2. This paper extends the results in Bindu et al 2001 (J. Phys. A: Math. Gen. 34 L689) and further provides the integrability information of (1+1)- and (2+1)-dimensional Fisher-type nonlinear diffusion equations for m = 2

  2. Surface-based vertexwise analysis of morphometry and microstructural integrity for white matter tracts in diffusion tensor imaging: With application to the corpus callosum in Alzheimer's disease.

    Science.gov (United States)

    Tang, Xiaoying; Qin, Yuanyuan; Zhu, Wenzhen; Miller, Michael I

    2017-04-01

    In this article, we present a unified statistical pipeline for analyzing the white matter (WM) tracts morphometry and microstructural integrity, both globally and locally within the same WM tract, from diffusion tensor imaging. Morphometry is quantified globally by the volumetric measurement and locally by the vertexwise surface areas. Meanwhile, microstructural integrity is quantified globally by the mean fractional anisotropy (FA) and trace values within the specific WM tract and locally by the FA and trace values defined at each vertex of its bounding surface. The proposed pipeline consists of four steps: (1) fully automated segmentation of WM tracts in a multi-contrast multi-atlas framework; (2) generation of the smooth surface representations for the WM tracts of interest; (3) common template surface generation on which the localized morphometric and microstructural statistics are defined and a variety of statistical analyses can be conducted; (4) multiple comparison correction to determine the significance of the statistical analysis results. Detailed herein, this pipeline has been applied to the corpus callosum in Alzheimer's disease (AD) with significantly decreased FA values and increased trace values, both globally and locally, being detected in patients with AD when compared to normal aging populations. A subdivision of the corpus callosum in both hemispheres revealed that the AD pathology primarily affects the body and splenium of the corpus callosum. Validation analyses and two multiple comparison correction strategies are provided. Hum Brain Mapp 38:1875-1893, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  3. Effects of diffusion and surface interactions on the line shape of electron paramagnetic resonances in the presence of a magnetic field gradient

    International Nuclear Information System (INIS)

    Schaden, M.; Zhao, K. F.; Wu, Z.

    2007-01-01

    In an evanescent wave magnetometer the Zeeman polarization is probed at micrometer to submicrometer distances from the cell surface. The electron paramagnetic resonance lines of an evanescent wave magnetometer in the presence of a magnetic field gradient exhibit edge enhancement seen previously in nuclear magnetic resonance lines. We present a theoretical model that describes quantitatively the shape of the magnetic resonance lines of an evanescent wave magnetometer under a wide range of experimental conditions. It accounts for diffusion broadening in the presence of a magnetic field gradient as well as interactions of spin polarized Rb atoms with the coated Pyrex glass surfaces. Depending on the field gradient, cell thickness, and buffer gas pressure, the resonance line may have the form of a single asymmetric peak or two peaks localized near the front and back surfaces in frequency space. The double-peaked response depends on average characteristics of the surface interactions. Its shape is sensitive to the dwell time, relaxation probability, and average phase shift of adsorbed spin polarized Rb atoms

  4. Production in constant evolution

    International Nuclear Information System (INIS)

    Lozano, T.

    2009-01-01

    The Cofrentes Nuclear Power Plant now has 25 years of operation behind it: a quarter century adding value and demonstrating the reasons why it is one of the most important energy producing facilities in the Spanish power market. Particularly noteworthy is the enterprising spirit of the plant, which has strived to continuously improve with the large number of modernization projects that it has undertaken over the past 25 years. The plant has constantly evolved thanks to the amount of investments made to improve safety and reliability and the perseverance to stay technologically up to date. Efficiency, training and teamwork have been key to the success of the plant over these 25 years of constant change and progress. (Author)

  5. Is the sun constant

    International Nuclear Information System (INIS)

    Blake, J.B.; Dearborn, D.S.P.

    1979-01-01

    Small fluctuations in the solar constant can occur on timescales much shorter than the Kelvin time. Changes in the ability of convection to transmit energy through the superadiabatic and transition regions of the convection zone cause structure adjustments which can occur on a time scale of days. The bulk of the convection zone reacts to maintain hydrostatic equilibrium (though not thermal equilibrium) and causes a luminosity change. While small radius variations will occur, most of the change will be seen in temperature

  6. Stabilized power constant alimentation

    International Nuclear Information System (INIS)

    Roussel, L.

    1968-06-01

    The study and realization of a stabilized power alimentation variable from 5 to 100 watts are described. In order to realize a constant power drift of Lithium compensated diodes, we have searched a 1 per cent precision of regulation and a response time minus than 1 sec. Recent components like Hall multiplicator and integrated amplifiers give this possibility and it is easy to use permutable circuits. (author) [fr

  7. Universe of constant

    Science.gov (United States)

    Yongquan, Han

    2016-10-01

    The ideal gas state equation is not applicable to ordinary gas, it should be applied to the Electromagnetic ``gas'' that is applied to the radiation, the radiation should be the ultimate state of matter changes or initial state, the universe is filled with radiation. That is, the ideal gas equation of state is suitable for the Singular point and the universe. Maybe someone consider that, there is no vessel can accommodate radiation, it is because the Ordinary container is too small to accommodate, if the radius of your container is the distance that Light through an hour, would you still think it can't accommodates radiation? Modern scientific determinate that the radius of the universe now is about 1027 m, assuming that the universe is a sphere whose volume is approximately: V = 4.19 × 1081 cubic meters, the temperature radiation of the universe (cosmic microwave background radiation temperature of the universe, should be the closest the average temperature of the universe) T = 3.15k, radiation pressure P = 5 × 10-6 N / m 2, according to the law of ideal gas state equation, PV / T = constant = 6 × 1075, the value of this constant is the universe, The singular point should also equal to the constant Author: hanyongquan

  8. Connecting Fundamental Constants

    International Nuclear Information System (INIS)

    Di Mario, D.

    2008-01-01

    A model for a black hole electron is built from three basic constants only: h, c and G. The result is a description of the electron with its mass and charge. The nature of this black hole seems to fit the properties of the Planck particle and new relationships among basic constants are possible. The time dilation factor in a black hole associated with a variable gravitational field would appear to us as a charge; on the other hand the Planck time is acting as a time gap drastically limiting what we are able to measure and its dimension will appear in some quantities. This is why the Planck time is numerically very close to the gravitational/electric force ratio in an electron: its difference, disregarding a π√(2) factor, is only 0.2%. This is not a coincidence, it is always the same particle and the small difference is between a rotating and a non-rotating particle. The determination of its rotational speed yields accurate numbers for many quantities, including the fine structure constant and the electron magnetic moment

  9. Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

    Directory of Open Access Journals (Sweden)

    Murat Kuscu

    Full Text Available We consider a microfluidic molecular communication (MC system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA. However, analytical models are key for the information and communication technology (ICT, as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

  10. Modeling convection-diffusion-reaction systems for microfluidic molecular communications with surface-based receivers in Internet of Bio-Nano Things.

    Science.gov (United States)

    Kuscu, Murat; Akan, Ozgur B

    2018-01-01

    We consider a microfluidic molecular communication (MC) system, where the concentration-encoded molecular messages are transported via fluid flow-induced convection and diffusion, and detected by a surface-based MC receiver with ligand receptors placed at the bottom of the microfluidic channel. The overall system is a convection-diffusion-reaction system that can only be solved by numerical methods, e.g., finite element analysis (FEA). However, analytical models are key for the information and communication technology (ICT), as they enable an optimisation framework to develop advanced communication techniques, such as optimum detection methods and reliable transmission schemes. In this direction, we develop an analytical model to approximate the expected time course of bound receptor concentration, i.e., the received signal used to decode the transmitted messages. The model obviates the need for computationally expensive numerical methods by capturing the nonlinearities caused by laminar flow resulting in parabolic velocity profile, and finite number of ligand receptors leading to receiver saturation. The model also captures the effects of reactive surface depletion layer resulting from the mass transport limitations and moving reaction boundary originated from the passage of finite-duration molecular concentration pulse over the receiver surface. Based on the proposed model, we derive closed form analytical expressions that approximate the received pulse width, pulse delay and pulse amplitude, which can be used to optimize the system from an ICT perspective. We evaluate the accuracy of the proposed model by comparing model-based analytical results to the numerical results obtained by solving the exact system model with COMSOL Multiphysics.

  11. The diffusion mechanism and convective transport in the formation of surface anomalies of RADON-222 generated at depth

    International Nuclear Information System (INIS)

    Pereira, E.B.; Hamza, V.M.

    1982-01-01

    A preliminar study on the importance of a thermally-activated convective transport of radon is made in order to explain radon anomalies at surface generated at great depth. It is theoretically shown that convective currents should be of the order of 10 μm/s or larger to explain such anomalies. The influence of surface temperature changes on the convective transport is also discussed. Seasonal changes in temperature typical of climates such as that of southern Brazil can develop thermal inversion layers at depths up to 20 metres. The optimum period of the year for the employment of surface emanometric techniques is during the second and the third months after the winter peak when the thermal inversion barriers are less intense. (Author) [pt

  12. Tailored Formation of N-Doped Nanoarchitectures by Diffusion-Controlled on-Surface (Cyclo)-Dehydrogenation of Heteroaromatics

    Czech Academy of Sciences Publication Activity Database

    Pinardi, A. L.; Otero-Irurueta, G.; Palacio, I.; Martinez, J. I.; Sánchez-Sánchez, C.; Tello, M.; Rogero, C.; Cossaro, A.; Preobrajenski, A.; Gomez-Lor, B.; Jančařík, Andrej; Stará, Irena G.; Starý, Ivo; Lopez, M. F.; Méndez, J.; Martin-Gago, J. A.

    2013-01-01

    Roč. 7, č. 4 (2013), s. 3676-3684 ISSN 1936-0851 R&D Projects: GA ČR(CZ) GAP207/10/2207 Institutional support: RVO:61388963 Keywords : surface-assisted dehydrogenation * dibenzo[5]helicene * N-doped nanographene * heteroaromatic polymer Subject RIV: CC - Organic Chemistry Impact factor: 12.033, year: 2013

  13. [Experimental studies on the diffusion of excitation on the right ventricular surface in the dog, during normal and stimulated beats].

    Science.gov (United States)

    Arisi, G; Macchi, E; Baruffi, S; Musso, E; Spaggiari, S; Stilli, D; Taccardi, B

    1982-01-01

    Previous work on the spread of excitation on the dog's ventricular surface enabled us to locate up to 30 breakthrough points (BKTPs) where excitation reaches the ventricular surface. In particular the equipotential contour maps enabled us to detect 3 to 5 BKTPs on the anterior right ventricular surface, near the a-v groove when a large part of ventricular surface was still at rest. With a view to investigating the mechanism underlying the early excitation of these basal regions, we stimulated the heart at several right ventricular BKTPs and in other points located at a distance from the BKTPs. The instantaneous equipotential maps showed that after stimulation most right ventricular BKTPs remained in the same position as observed the normal beats. The early appearance of epicardial wavefronts in the basal region and generally in other areas of the right ventricle was attributed to the rapid propagation of excitation waves through the Purkinje network, probably associated to a short transmural crossing time, due to a local thinness of the ventricular wall.

  14. Effect of TiO2 additive on the sintering of nuclear fuel (U,Pu)O2. Contribution of surface diffusion to plutonium distribution

    International Nuclear Information System (INIS)

    Bremier, Stephane

    1997-01-01

    This thesis has as objective the study of the effect of TiO 2 additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO 2 in the presence of TiO 2 has been established and the influence of the PuO 2 distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO 2 and UO 2 -PuO 2 . The results concerning the influence of TiO 2 upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO 2 alone or in the presence of TiO 2 are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO 2 -PuO 2 preparation upon the initial microstructure of the materials and the role played by the PuO 2 grains in sintering. The potentiality of surface diffusion as a means of PuO 2 spreading in the UO 2 is evaluated and correlated with the reduced capacity of sintering the UO 2 ceramics containing PuO 2 . The last chapter deals with the influence of TiO 2 on the development of microstructure in UO 2 -PuO 2 ceramics. While at temperatures below 1500 deg.C the TiO 2 additive affects the surface diffusion and so the plutonium distribution, at values T≥ 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO 2 , PuO 2 and titanium oxide. Thus the objective is the optimizing the temperature conditions, the oxygen potential as sintering gas and the additive

  15. A new top boundary condition for modeling surface diffusive exchange of a generic volatile tracer: theoretical analysis and application to soil evaporation

    Directory of Open Access Journals (Sweden)

    J. Y. Tang

    2013-02-01

    Full Text Available We describe a new top boundary condition (TBC for representing the air–soil diffusive exchange of a generic volatile tracer. This new TBC (1 accounts for the multi-phase flow of a generic tracer; (2 accounts for effects of soil temperature, pH, solubility, sorption, and desorption processes; (3 enables a smooth transition between wet and dry soil conditions; (4 is compatible with the conductance formulation for modeling air–water volatile tracer exchange; and (5 is applicable to site, regional, and global land models.

    Based on the new TBC, we developed new formulations for bare-soil resistance and corresponding soil evaporation efficiency. The new soil resistance is predicted as the reciprocal of the harmonic sum of two resistances: (1 gaseous and aqueous molecular diffusion and (2 liquid mass flow resulting from the hydraulic pressure gradient between the soil surface and center of the topsoil control volume. We compared the predicted soil evaporation efficiency with those from several field and laboratory soil evaporation measurements and found good agreement with the typically observed two-stage soil evaporation curves. Comparison with the soil evaporation efficiency equation of Lee and Pielke (1992; hereafter LP92 indicates that their equation can overestimate soil evaporation when the atmospheric resistance is low and underestimate soil evaporation when the soil is dry. Using a synthetic inversion experiment, we demonstrated that using inverted soil resistance data from field measurements to derive empirical soil resistance formulations resulted in large uncertainty because (1 the inverted soil resistance data are always severely impacted by measurement error and (2 the derived empirical equation is very sensitive to the number of data points and the assumed functional form of the resistance.

    We expect the application of our new TBC in land models will provide a consistent representation for the diffusive tracer

  16. Ab initio calculation of diffusion barriers for Cu adatom hopping on Cu(1 0 0) surface and evolution of atomic configurations

    Science.gov (United States)

    Zhang, Wei; Gan, Jie; Li, Qian; Gao, Kun; Sun, Jian; Xu, Ning; Ying, Zhifeng; Wu, Jiada

    2011-06-01

    The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.

  17. Ab initio calculation of diffusion barriers for Cu adatom hopping on Cu(1 0 0) surface and evolution of atomic configurations

    International Nuclear Information System (INIS)

    Zhang Wei; Gan Jie; Li Qian; Gao Kun; Sun Jian; Xu Ning; Ying Zhifeng; Wu Jiada

    2011-01-01

    The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.

  18. The Hubble Constant

    Directory of Open Access Journals (Sweden)

    Neal Jackson

    2015-09-01

    Full Text Available I review the current state of determinations of the Hubble constant, which gives the length scale of the Universe by relating the expansion velocity of objects to their distance. There are two broad categories of measurements. The first uses individual astrophysical objects which have some property that allows their intrinsic luminosity or size to be determined, or allows the determination of their distance by geometric means. The second category comprises the use of all-sky cosmic microwave background, or correlations between large samples of galaxies, to determine information about the geometry of the Universe and hence the Hubble constant, typically in a combination with other cosmological parameters. Many, but not all, object-based measurements give H_0 values of around 72–74 km s^–1 Mpc^–1, with typical errors of 2–3 km s^–1 Mpc^–1. This is in mild discrepancy with CMB-based measurements, in particular those from the Planck satellite, which give values of 67–68 km s^–1 Mpc^–1 and typical errors of 1–2 km s^–1 Mpc^–1. The size of the remaining systematics indicate that accuracy rather than precision is the remaining problem in a good determination of the Hubble constant. Whether a discrepancy exists, and whether new physics is needed to resolve it, depends on details of the systematics of the object-based methods, and also on the assumptions about other cosmological parameters and which datasets are combined in the case of the all-sky methods.

  19. The inconstant solar constant

    International Nuclear Information System (INIS)

    Willson, R.C.; Hudson, H.

    1984-01-01

    The Active Cavity Radiometer Irradiance Monitor (ACRIM) of the Solar Maximum Mission satellite measures the radiant power emitted by the sun in the direction of the earth and has worked flawlessly since 1980. The main motivation for ACRIM's use to measure the solar constant is the determination of the extent to which this quantity's variations affect earth weather and climate. Data from the solar minimum of 1986-1987 is eagerly anticipated, with a view to the possible presence of a solar cycle variation in addition to that caused directly by sunspots

  20. Radiation heat transfer of arbitrary axisymmetric bodies with specular and diffuse surfaces; Kyomen ranhanshamen wo motsu nin`i keijo jikutaishobuttai no hosha dennetsu

    Energy Technology Data Exchange (ETDEWEB)

    Maruyama, S.; Aihara, T. [Tohoku University, Sendai (Japan). Institute of Fluid Sceince

    1993-10-25

    A radiation light tracking method was used to derive shape factors of arbitrary axisymmetric bodies consisted of specular and diffuse surfaces or an annular face element as a composite surface of the former surfaces. This paper illustrates the summary of an analytical method to calculate radiation heat transfer amount of these bodies using the shape factors, and describes the following matters: The difference between the shape factor obtained by applying this method to the inner face of a cylindrical body and conventional analytical solution can be reduced by increasing the number of splits in outgoing light. The numerical solution from this method on radiation heat transfer amount in the particular body agrees well with the conventional analytical solution. Radiation heat transfer amount when the specular reflectivity was increased either increases or decreases depending on the face shape, not necessarily changing monotonously. The paper further describes briefly a composite heat transfer analysis applied to a silicon crystal growing equipment using the Czochralski method, the analysis combining a radiation heat transfer analysis that splits the equipment interior into 88 annular elements with a general purpose heat transfer analysis. 13 refs., 11 figs., 1 tab.

  1. Surface modification of gas diffusion layers by inorganic nanomaterials for performance enhancement of proton exchange membrane fuel cells at low RH conditions

    Energy Technology Data Exchange (ETDEWEB)

    Cindrella, L. [Fuel Cell Research Lab, Engineering Technology Department, Arizona State University, 7001 E Williams Field Rd., Mesa, AZ 85212 (United States); Department of Chemistry, National Institute of Technology, Tiruchirappalli, Tamil Nadu 620015 (India); Kannan, A.M. [Fuel Cell Research Lab, Engineering Technology Department, Arizona State University, 7001 E Williams Field Rd., Mesa, AZ 85212 (United States); Ahmad, R.; Thommes, M. [Quantachrome Instruments, 1900 Corporate Drive, Boynton Beach, FL 33426 (United States)

    2009-08-15

    Prompted by our earlier study that fumed silica on gas diffusion layer (GDL) favored a performance improvement of the single fuel cell at lower RH conditions, the present study has been carried out with inorganic oxides in the nanoscale such as TiO{sub 2}, Al{sub 2}O{sub 3}, commercially available mixed oxides, hydrophilic silica and aerosil silica. The structure of each of the oxide coating on the GDL surface has resulted in refinement with graded pore dimension as seen from the Hg porosimetry data. The fuel cell evaluation at various RH conditions (50-100%) revealed that the performance of all the inorganic oxides loaded GDL is very high compared to that of pristine GDL. The results confirm our earlier observation that inorganic oxides on GDL bring about structural refinement favorable for the transport of gases, and their water retaining capacity enable a high performance of the fuel cell even at low RH conditions. (author)

  2. Depth Distribution Studies of Carbon in Steel Surfaces by Means of Charged Particle Activation Analysis with an Account of Heat and Diffusion Effects in the Sample

    International Nuclear Information System (INIS)

    Brune, D.; Lorenzen, J.; Witalis, E.

    1972-05-01

    Depth distribution studies of carbon in steel and iron were carried out in the concentration range 0.05-1 %, using proton activation analysis. Surface content studies were performed in the concentration range 0.01-1 % using deuteron activation analysis. The following reactions were utilized: 12 C(p,γ) 13 N and 12 C(d,n) 13 N Evaluations of depth distribution were based on resonances in the excitation function. The carbon content was determined with the aid of the positron emitter, 13 N, using either single-peak or coincidence measurements. The heat dissipation in the irradiated region of the samples was calculated, and the temperature rise was measured using thermocouples. The temperature distribution within the hot zone subjected to irradiation by charged particles, together with the temperature distribution around this zone, was studied in order to estimate any effect this might have on the carbon diffusion. A device for automatic sample exchange which is remotely controlled is described

  3. New sensitive micro-measurements of dynamic surface tension and diffusion coefficients: Validated and tested for the adsorption of 1-Octanol at a microscopic air-water interface and its dissolution into water.

    Science.gov (United States)

    Kinoshita, Koji; Parra, Elisa; Needham, David

    2017-02-15

    Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain "dead time" at initial measurement. These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the "micropipette interfacial area-expansion method" was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion controlled molecular adsorption at the air-water interfaces. To validate the new technique, the diffusion coefficient of 1-Octanol in water was investigated with existing models: the Ward Tordai model for the long time adsorption regime (1-100s), and the Langmuir and Frumkin adsorption isotherm models for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2±0.8×10 -6 cm 2 /s, showed excellent agreement with the result from an alternative method, "single microdroplet catching method", to measure the diffusion coefficient from diffusion-controlled microdroplet dissolution, 7.3±0.1×10 -6 cm 2 /s. These new techniques for determining adsorption and diffusion coefficients can apply for a range of surface active molecules, especially the less-characterized ionic surfactants, and biological compounds such as lipids, peptides, and proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Rate of riboflavin diffusion from intrastromal channels before corneal crosslinking.

    Science.gov (United States)

    McQuaid, Rebecca; Mrochen, Michael; Vohnsen, Brian

    2016-03-01

    To determine the diffusion of riboflavin from intrastromal channels through the effective diffusion coefficients compared with traditional axial diffusion with epithelium on or off. Advanced Optical Imaging Laboratory, University College Dublin, and Wellington Eye Clinic, Sandyford, Dublin, Ireland. Experimental study. The rate of diffusion in whole-mounted porcine eyes was monitored for a 30 minutes using an optical setup with a charge-coupled device camera and a bandpass filter (central wavelength 550 nm and 40 nm bandpass) to image the fluorescence under ultraviolet illumination (365 nm wavelength). For comparison, an isotropic corneal stroma with an annular channel was modeled numerically for different diffusion constants and boundary conditions. Numerical and experimental results were compared, allowing determination of the effective diffusion coefficient for each case. Experimental results for 6 different riboflavin solutions were in all cases found to be higher than for the common crosslinking (CXL) riboflavin protocol, where the diffusion constant is D0 = 6.5 × 10(-5) mm(2)/sec. For the intrastromal channel, 2 isotonic solutions containing riboflavin 0.1% correlated with a diffusion constant of 5D0 = 32.5 × 10(-5) mm(2)/sec. Hypotonic solutions and transepithelium had a higher diffusion coefficient approaching 10D0 = 65.0 × 10(-5) mm(2)/sec, which is an order-of-magnitude increase compared with the typical diffusion coefficient found in standard CXL. In this study, riboflavin had a faster stromal diffusion when injected into a corneal channel than when applied as drops to the anterior corneal surface. Further numerical modeling might allow optimization of the channel structure for any specific choice of riboflavin. Copyright © 2016 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  5. Fractional diffusion equations and anomalous diffusion

    CERN Document Server

    Evangelista, Luiz Roberto

    2018-01-01

    Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.

  6. Evolution of the solar 'constant'

    Energy Technology Data Exchange (ETDEWEB)

    Newman, M J

    1980-06-01

    Variations in solar luminosity over geological time are discussed in light of the effect of the solar constant on the evolution of life on earth. Consideration is given to long-term (5 - 7% in a billion years) increases in luminosity due to the conversion of hydrogen into helium in the solar interior, temporary enhancements to solar luminosity due to the accretion of matter from the interstellar medium at intervals on the order of 100 million years, and small-amplitude rapid fluctuations of luminosity due to the stochastic nature of convection on the solar surface. It is noted that encounters with dense interstellar clouds could have had serious consequences for life on earth due to the peaking of the accretion-induced luminosity variation at short wavelengths.

  7. Premixed combustion under electric field in a constant volume chamber

    KAUST Repository

    Cha, Min Suk

    2012-12-01

    The effects of electric fields on outwardly propagating premixed flames in a constant volume chamber were experimentally investigated. An electric plug, subjected to high electrical voltages, was used to generate electric fields inside the chamber. To minimize directional ionic wind effects, alternating current with frequency of 1 kHz was employed. Lean and rich fuel/air mixtures for both methane and propane were tested to investigate various preferential diffusion conditions. As a result, electrically induced instability showing cracked structure on the flame surface could be observed. This cracked structure enhanced flame propagation speed for the initial period of combustion and led to reduction in flame initiation and overall combustion duration times. However, by analyzing pressure data, it was found that overall burning rates are not much affected from the electric field for the pressurized combustion period. The reduction of overall combustion time is less sensitive to equivalence ratio for methane/air mixtures, whereas the results demonstrate pronounced effects on a lean mixture for propane. The improvement of combustion characteristics in lean mixtures will be beneficial to the design of lean burn engines. Two hypothetical mechanisms to explain the electrically induced instability were proposed: 1) ionic wind initiated hydrodynamic instability and 2) thermodiffusive instability through the modification of transport property such as mass diffusivity. © 2012 IEEE.

  8. Premixed combustion under electric field in a constant volume chamber

    KAUST Repository

    Cha, Min; Lee, Yonggyu

    2012-01-01

    The effects of electric fields on outwardly propagating premixed flames in a constant volume chamber were experimentally investigated. An electric plug, subjected to high electrical voltages, was used to generate electric fields inside the chamber. To minimize directional ionic wind effects, alternating current with frequency of 1 kHz was employed. Lean and rich fuel/air mixtures for both methane and propane were tested to investigate various preferential diffusion conditions. As a result, electrically induced instability showing cracked structure on the flame surface could be observed. This cracked structure enhanced flame propagation speed for the initial period of combustion and led to reduction in flame initiation and overall combustion duration times. However, by analyzing pressure data, it was found that overall burning rates are not much affected from the electric field for the pressurized combustion period. The reduction of overall combustion time is less sensitive to equivalence ratio for methane/air mixtures, whereas the results demonstrate pronounced effects on a lean mixture for propane. The improvement of combustion characteristics in lean mixtures will be beneficial to the design of lean burn engines. Two hypothetical mechanisms to explain the electrically induced instability were proposed: 1) ionic wind initiated hydrodynamic instability and 2) thermodiffusive instability through the modification of transport property such as mass diffusivity. © 2012 IEEE.

  9. Heat Diffusion in Gases, Including Effects of Chemical Reaction

    Science.gov (United States)

    Hansen, C. Frederick

    1960-01-01

    The diffusion of heat through gases is treated where the coefficients of thermal conductivity and diffusivity are functions of temperature. The diffusivity is taken proportional to the integral of thermal conductivity, where the gas is ideal, and is considered constant over the temperature interval in which a chemical reaction occurs. The heat diffusion equation is then solved numerically for a semi-infinite gas medium with constant initial and boundary conditions. These solutions are in a dimensionless form applicable to gases in general, and they are used, along with measured shock velocity and heat flux through a shock reflecting surface, to evaluate the integral of thermal conductivity for air up to 5000 degrees Kelvin. This integral has the properties of a heat flux potential and replaces temperature as the dependent variable for problems of heat diffusion in media with variable coefficients. Examples are given in which the heat flux at the stagnation region of blunt hypersonic bodies is expressed in terms of this potential.

  10. Potential constants and centrifugal distortion constants of octahedral hexafluoride molecules

    Energy Technology Data Exchange (ETDEWEB)

    Manivannan, G [Government Thirumagal Mill' s Coll., Gudiyattam, Tamil Nadu (India)

    1981-04-01

    The kinetic constants method outlined by Thirugnanasambandham (1964) based on Wilson's (1955) group theory has been adapted in evaluating the potential constants for SF/sub 6/, SeF/sub 6/, WF/sub 6/, IrF/sub 6/, UF/sub 6/, NpF/sub 6/, and PuF/sub 6/ using the experimentally observed vibrational frequency data. These constants are used to calculate the centrifugal distortion constants for the first time.

  11. Surface electrical resistivity of insulators

    International Nuclear Information System (INIS)

    Senn, B. C.; Liesegang, J.

    1996-01-01

    A method is presented here for measuring surface charge decay, and theory has been developed so as to produce determinations of resistivity in the surface region of insulator films or wafers. This method incorporates the use of a coaxial cylindrical capacitor arrangement and an electrometer interfaced to a PC. The charge transport theory given here is based on Mott-Gurney diffusion, and allows easy interpretation of the experimental data, especially for the initial phase of surface charge decay. Resistivity measurements are presented for glass, mica, perspex and polyethylene, covering a range of 10 9 to 10 18 Ωm, as an illustration of the useful range of the instrument for static and antistatic materials, particularly in film or sheet form. Values for the surface charge diffusion constants of the materials are also presented. The charge transport theory has also been extended to allow the experimental and computational theoretical comparison of surface charge decay not only over the initial phase of charge decay, but also over longer times. The theoretical predictions show excellent agreement with experiment using the values for the diffusion constants referred to above

  12. Surface-Based fMRI-Driven Diffusion Tractography in the Presence of Significant Brain Pathology: A Study Linking Structure and Function in Cerebral Palsy

    Science.gov (United States)

    Cunnington, Ross; Boyd, Roslyn N.; Rose, Stephen E.

    2016-01-01

    Diffusion MRI (dMRI) tractography analyses are difficult to perform in the presence of brain pathology. Automated methods that rely on cortical parcellation for structural connectivity studies often fail, while manually defining regions is extremely time consuming and can introduce human error. Both methods also make assumptions about structure-function relationships that may not hold after cortical reorganisation. Seeding tractography with functional-MRI (fMRI) activation is an emerging method that reduces these confounds, but inherent smoothing of fMRI signal may result in the inclusion of irrelevant pathways. This paper describes a novel fMRI-seeded dMRI-analysis pipeline based on surface-meshes that reduces these issues and utilises machine-learning to generate task specific white matter pathways, minimising the requirement for manually-drawn ROIs. We directly compared this new strategy to a standard voxelwise fMRI-dMRI approach, by investigating correlations between clinical scores and dMRI metrics of thalamocortical and corticomotor tracts in 31 children with unilateral cerebral palsy. The surface-based approach successfully processed more participants (87%) than the voxel-based approach (65%), and provided significantly more-coherent tractography. Significant correlations between dMRI metrics and five clinical scores of function were found for the more superior regions of these tracts. These significant correlations were stronger and more frequently found with the surface-based method (15/20 investigated were significant; R2 = 0.43–0.73) than the voxelwise analysis (2 sig. correlations; 0.38 & 0.49). More restricted fMRI signal, better-constrained tractography, and the novel track-classification method all appeared to contribute toward these differences. PMID:27487011

  13. Communication: A new ab initio potential energy surface for HCl-H2O, diffusion Monte Carlo calculations of D0 and a delocalized zero-point wavefunction.

    Science.gov (United States)

    Mancini, John S; Bowman, Joel M

    2013-03-28

    We report a global, full-dimensional, ab initio potential energy surface describing the HCl-H2O dimer. The potential is constructed from a permutationally invariant fit, using Morse-like variables, to over 44,000 CCSD(T)-F12b∕aug-cc-pVTZ energies. The surface describes the complex and dissociated monomers with a total RMS fitting error of 24 cm(-1). The normal modes of the minima, low-energy saddle point and separated monomers, the double minimum isomerization pathway and electronic dissociation energy are accurately described by the surface. Rigorous quantum mechanical diffusion Monte Carlo (DMC) calculations are performed to determine the zero-point energy and wavefunction of the complex and the separated fragments. The calculated zero-point energies together with a De value calculated from CCSD(T) with a complete basis set extrapolation gives a D0 value of 1348 ± 3 cm(-1), in good agreement with the recent experimentally reported value of 1334 ± 10 cm(-1) [B. E. Casterline, A. K. Mollner, L. C. Ch'ng, and H. Reisler, J. Phys. Chem. A 114, 9774 (2010)]. Examination of the DMC wavefunction allows for confident characterization of the zero-point geometry to be dominant at the C(2v) double-well saddle point and not the C(s) global minimum. Additional support for the delocalized zero-point geometry is given by numerical solutions to the 1D Schrödinger equation along the imaginary-frequency out-of-plane bending mode, where the zero-point energy is calculated to be 52 cm(-1) above the isomerization barrier. The D0 of the fully deuterated isotopologue is calculated to be 1476 ± 3 cm(-1), which we hope will stand as a benchmark for future experimental work.

  14. A Memorandum Report: Physical Constants of MCE

    Science.gov (United States)

    2016-08-01

    the density and surface tension. In effect, this constant is a corrected molar volume = P = MS / = S / where P = Parachor M = molar volume ...3 3. Vapor Pressure of MCE Calculated from the Experimental Data by Method of Least Squares...values were obtained by averaging the determinations for each sample separately, and then averaging those values. **No average was calculated due to

  15. Modeling of Solar Radiation Management: A Comparison of Simulations Using Reduced Solar Constant and Stratospheric Sulphate Aerosols

    Science.gov (United States)

    Bala, G.; Kalidindi, S.; Modak, A.; Caldeira, K.

    2014-12-01

    Several climate modelling studies in the past have used reduction in solar constant to simulate the climatic effects of Solar Radiation Management (SRM) geoengineering. This is most likely valid only for space-based mirrors/reflectors but not for SRM methods that rely on stratospheric aerosols. In this study, we use a climate model to evaluate the differences in climate response to SRM by uniform solar constant reduction and stratospheric aerosols. The experiments are designed such that global mean warming from a doubling of atmospheric CO2 concentration (2xCO2) is nearly cancelled in each case. In such a scenario, the residual climate effects are similar when important surface and tropospheric climate variables such as temperature and precipitation are considered. However, there are significant differences in stratospheric temperature response and diffuse and direct radiation reaching the surface. A difference of 1K in the global mean stratospheric (61-9.8 hPa) temperature is simulated between the two SRM methods, with warming in the aerosol scheme and a slight cooling for sunshades. While the global mean surface diffuse radiation increases by ~23% and direct radiation decreases by about 9% in the case of aerosol SRM method, both direct and diffuse radiation decrease by similar fractional amounts (~1.0%) when solar constant is reduced. When CO2 fertilization effects from elevated CO2 concentration levels are removed, the contribution from shaded leaves to gross primary productivity (GPP) increases by 1.8 % in aerosol SRM because of increased diffuse light. However, this increase is almost offset by a 15.2% decline in sunlit contribution due to reduced direct light. Overall both the SRM simulations show similar decrease in GPP (~ 8%) and NPP (~3%) relative to 2xCO2, indicating the negligible effect of the fractional changes in direct/diffuse radiation on the overall plant productivity. Based on our modelling study, we conclude that the climate states produced by a

  16. Interface doping of conjugated organic films by means of diffusion of atomic components from the surfaces of semiconductors and of metal oxides.

    Science.gov (United States)

    Komolov, A S; Akhremtchik, S N; Lazneva, E F

    2011-08-15

    The paper reports the results on the interface formation of 5-10 nm thick conjugated layers of Cu-phthalocyanine (CuPc) with a number of solid surfaces: polycrystalline Au, (SiO(2))n-Si, ZnO(0 0 0 1), Si(1 0 0), Ge(1 1 1), CdS(0 0 0 1) and GaAs(1 0 0). The results were obtained using Auger electron spectroscopy (AES) and low-energy target current electron spectroscopy (TCS). The organic overlayers were thermally deposited in situ in UHV onto substrate surfaces. The island-like organic deposits were excluded from the analysis so that only uniform organic deposits were considered. In the cases of polycrystalline Au, Si(1 0 0) and Ge(1 1 1) substrates the AES peaks of the substrate material attenuated down to the zero noise level upon the increase of the CuPc film thickness of 8-10 nm. The peaks corresponding to oxygen atoms in the case of SiO(2) substrate, and to atoms from the ZnO, GaAs and CdS substrates were clearly registered in the AES spectra of the 8-10 nm thick CuPc deposits. The relative concentration of the substrate atomic components diffused into the film was different from their relative concentration at the pure substrate surface. The concentration of the substrate dopant atoms in the CuPc film was estimated as one atom per one CuPc molecule. Using the target current electron spectroscopy, it was shown that the substrate atoms admixed in the CuPc film account for the appearance of a new peak in the density of unoccupied electronic states. Formation of intermediate TCS spectra until the CuPc deposit reaches 2-3 nm was observed in the cases of GaAs(1 0 0), ZnO(0 0 0 1), Ge(1 1 1) surfaces. The intermediate spectra show a less pronounced peak structure different from the one typical for the CuPc films. It was suggested that the intermediate layer was formed by the CuPc molecules fully or partially decomposed due to the interaction with the relatively reactive semiconductor surfaces. Copyright © 2010 Elsevier B.V. All rights reserved.

  17. Beyond the Hubble Constant

    Science.gov (United States)

    1995-08-01

    about the distances to galaxies and thereby about the expansion rate of the Universe. A simple way to determine the distance to a remote galaxy is by measuring its redshift, calculate its velocity from the redshift and divide this by the Hubble constant, H0. For instance, the measured redshift of the parent galaxy of SN 1995K (0.478) yields a velocity of 116,000 km/sec, somewhat more than one-third of the speed of light (300,000 km/sec). From the universal expansion rate, described by the Hubble constant (H0 = 20 km/sec per million lightyears as found by some studies), this velocity would indicate a distance to the supernova and its parent galaxy of about 5,800 million lightyears. The explosion of the supernova would thus have taken place 5,800 million years ago, i.e. about 1,000 million years before the solar system was formed. However, such a simple calculation works only for relatively ``nearby'' objects, perhaps out to some hundred million lightyears. When we look much further into space, we also look far back in time and it is not excluded that the universal expansion rate, i.e. the Hubble constant, may have been different at earlier epochs. This means that unless we know the change of the Hubble constant with time, we cannot determine reliable distances of distant galaxies from their measured redshifts and velocities. At the same time, knowledge about such change or lack of the same will provide unique information about the time elapsed since the Universe began to expand (the ``Big Bang''), that is, the age of the Universe and also its ultimate fate. The Deceleration Parameter q0 Cosmologists are therefore eager to determine not only the current expansion rate (i.e., the Hubble constant, H0) but also its possible change with time (known as the deceleration parameter, q0). Although a highly accurate value of H0 has still not become available, increasing attention is now given to the observational determination of the second parameter, cf. also the Appendix at the

  18. Diffusivity, solubility and thermodynamic modelling of diffusion growth of Ga"3"+-doped LiTaO_3 thin film for integrated optics

    International Nuclear Information System (INIS)

    Zhang, De-Long; Zhang, Qun; Zhang, Pei; Kang, Jian; Wong, Wing-Han; Yu, Dao-Yin

    2016-01-01

    Graphical abstract: Diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film was studied thermodynamically. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. The Ga"3"+ profile in the grown thin film was analyzed by secondary ion mass spectrometry. Form the measured Ga"3"+ profiles, some thermodynamic parameters were obtained. These include diffusivity, diffusion constant, chemical activation energy, solubility, solubility constant and enthalpy of solution. These parameters are crucial to design and growth of a Ga"3"+-doped LT thin film with desired Ga"3"+ profile for integrated optics application. A thermodynamic model is suggested for the growth and verified experimentally. - Highlights: • Diffusion growth of Ga"3"+-doped LiTaO_3 thin film were studied thermodynamically. • Diffusion constant is 1.41 · 10"−"6 m"2/s and activation energy is 237.2 kJ/mol. • Solubility constant is 22.9 · 10"2"6 ions/m"3 and enthalpy of solution is 28.9 kJ/mol. • Ga"3"+ dopant has small effect on LiTaO_3 refractive index. • Ga"3"+ growth can be described by a Fick-type equation with a constant diffusivity. - Abstract: A thermodynamic study was performed on diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film for integrated optics. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. After growth, the refractive indices at Ga"3"+-doped and un-doped surface parts were measured by prism coupling technique and Li composition there was evaluated from the measured refractive indices. The results show that Ga"3"+ dopant has small effect on the LT index. Li_2O out-diffusion is not measurable. The Ga"3"+ profile in the grown thin film was analysed by secondary ion mass spectrometry. It is found that the grown Ga"3"+ ions follow a complementary error function profile. A

  19. Association constants of telluronium salts

    International Nuclear Information System (INIS)

    Kovach, N.A.; Rivkin, B.B.; Sadekov, T.D.; Shvajka, O.P.

    1996-01-01

    Association constants in acetonitrile of triphenyl telluronium salts, which are dilute electrolytes, are determined through the conductometry method. Satisfactory correlation dependence of constants of interion association and threshold molar electroconductivity on the Litvinenko-Popov constants for depositing groups is identified. 6 refs

  20. Anisotropic constant-roll inflation

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Asuka; Soda, Jiro [Kobe University, Department of Physics, Kobe (Japan)

    2018-01-15

    We study constant-roll inflation in the presence of a gauge field coupled to an inflaton. By imposing the constant anisotropy condition, we find new exact anisotropic constant-roll inflationary solutions which include anisotropic power-law inflation as a special case. We also numerically show that the new anisotropic solutions are attractors in the phase space. (orig.)

  1. Quintessence and the cosmological constant

    International Nuclear Information System (INIS)

    Doran, M.; Wetterich, C.

    2003-01-01

    Quintessence -- the energy density of a slowly evolving scalar field -- may constitute a dynamical form of the homogeneous dark energy in the universe. We review the basic idea in the light of the cosmological constant problem. Cosmological observations or a time variation of fundamental 'constants' can distinguish quintessence from a cosmological constant

  2. The effect of radiation-thermal treatment on the physicochemical properties of the Ni-Mo/Al2O3 hydrotreatment catalyst. II. UV-Vis diffuse reflectance spectra of surface compounds after irradiation

    International Nuclear Information System (INIS)

    Solovetskii, Yu.I.; Miroshinichenko, I.I.; Lunin, V.V.

    1993-01-01

    Radiation-thermal damage of the surface and the active metal phases of hydrodesulfurization Ni-Mo/Al 2 O 3 catalysts by a fast electron beam of up to 2.0 MeV energy was studied. UV-Vis diffuse reflectance spectra of the industrial and model coked systems after radiation-thermal treatment were measured. 14 refs., 2 figs

  3. Adsorption and diffusion of H and NH{sub x} as key steps of the NH{sub x} dehydrogenation reaction at the V{sub 2}O{sub 5} (010) surface

    Energy Technology Data Exchange (ETDEWEB)

    Gruber, Mathis; Hermann, Klaus [Fritz-Haber-Institut der MPG, und Sfb 546, Berlin (Germany)

    2009-07-01

    Various selective oxidation reactions as the selective catalytic reduction (SCR) of NO{sub x} or the ammoxidation of propane/propene to acrylonitrile are processed on vanadium based metal-oxide catalysts in the presence of ammonia. In the reactions the intermediates NH{sub 2}, NH{sub 3}, and NH{sub 4} are involved indicating that the adsorption and dehydrogenation of NH{sub x}, x < 4, are important steps. We have performed theoretical studies of corresponding reaction steps where the catalyst is simulated by a finite section of the V{sub 2}O{sub 5} (010) surface. The calculations apply density-functional theory combined with clusters modeling the adsorbate system. The substrate lowers corresponding dehydrogenation energies considerably compared with values for the gas phase reaction. However, the lowering is too small to make dehydrogenation of NH{sub 3} likely to happen. Our results on the role of oxygen vacancies for the dehydrogenation indicate that such surface defects become important for the reaction. Besides the energetics also the diffusion at the surface influences the reaction. A nudged elastic band (NEB) routine has been implemented to evaluate diffusion paths and barriers. Hydrogen diffusion on the surface will be discussed and additional examples for NH{sub x} diffusion will be shown. Based on these results possible reaction scenarios for the dehydrogenation reaction will be presented.

  4. Internal Diffusion-Controlled Enzyme Reaction: The Acetylcholinesterase Kinetics.

    Science.gov (United States)

    Lee, Sangyun; Kim, Ji-Hyun; Lee, Sangyoub

    2012-02-14

    Acetylcholinesterase is an enzyme with a very high turnover rate; it quenches the neurotransmitter, acetylcholine, at the synapse. We have investigated the kinetics of the enzyme reaction by calculating the diffusion rate of the substrate molecule along an active site channel inside the enzyme from atomic-level molecular dynamics simulations. In contrast to the previous works, we have found that the internal substrate diffusion is the determinant of the acetylcholinesterase kinetics in the low substrate concentration limit. Our estimate of the overall bimolecular reaction rate constant for the enzyme is in good agreement with the experimental data. In addition, the present calculation provides a reasonable explanation for the effects of the ionic strength of solution and the mutation of surface residues of the enzyme. The study suggests that internal diffusion of the substrate could be a key factor in understanding the kinetics of enzymes of similar characteristics.

  5. Apparatus for diffusion separation

    International Nuclear Information System (INIS)

    Nierenberg, W.A.; Pontius, R.B.

    1976-01-01

    The method of testing the separation efficiency of porous permeable membranes is described which comprises causing a stream of a gaseous mixture to flow into contact with one face of a finely porous permeable membrane under such conditions that a major fraction of the mixture diffuses through the membrane, maintaining a rectangular cross section of the gaseous stream so flowing past said membrane, continuously recirculating the gas that diffuses through said membrane and continuously withdrawing the gas that does not diffuse through said membrane and maintaining the volume of said recirculating gas constant by continuously introducing into said continuously recirculating gas stream a mass of gas equivalent to that which is continuously withdrawn from said gas stream and comparing the concentrations of the light component in the entering gas, the withdrawn gas and the recirculated gas in order to determine the efficiency of said membrane

  6. Effects of repository environment on diffusion behavior of radionuclides in buffer materials

    International Nuclear Information System (INIS)

    Kozaki, Tamotsu; Sato, Seichi

    2004-03-01

    Compacted bentonite is considered as a candidate buffer material in the geological disposal of high-level radioactive waste. An important function of the compacted bentonite is to retard the transport of radionuclides from waste forms to the surrounding host rock after degradation of an overpack. Therefore, diffusion behavior of radionuclides in the compacted bentonite has been extensively studied by many researchers for the performance assessments of the geological disposal. However, diffusion mechanism of radionuclides in the bentonite cannot be fully understood, and most experimental data have been obtained at room temperature for the bentonite saturated with low salinity water, which would disagree often with real repository conditions. In this study, therefore, apparent diffusion coefficients were determined at various diffusion temperatures for chloride ions in Na-montmorillonite samples saturated with NaCl solution of high salinity. Activation energies for the apparent diffusion were also obtained from the temperature dependence of the diffusion coefficients at different salinity. As the salinity increased, the apparent diffusion coefficients of chloride ions in montmorillonite were found to increase slightly. On the other hand, the activation energies for the chloride diffusion were found to be almost constant (approximately 12 kJ mol -1 ) and less than that in free water (17.4 kJ mol -1 ). Effects of salinity on diffusion behavior of radionuclides in montmorillonite were discussed from the viewpoints of microstructure of montmorillonite and distribution of ions in the montmorillonite. As a result, the diffusion behavior of sodium ions could be explained by the changes of the predominant diffusion process among pore water diffusion, surface diffusion, and interlayer diffusion that could be caused by the increase of salinity. (author)

  7. In vivo P-31 MR diffusion spectroscopy

    International Nuclear Information System (INIS)

    Moonen, C.T.W.; Vanzijl, P.C.M.; LeBihan, D.

    1988-01-01

    This paper discusses the Stejskal-Tanner diffusion spin-echo sequence modified for the in vivo diffusion spectroscopy. The apparent diffusion constant D α was measured as a function of the diffusion time. Contrary to the results in phantom samples, a strong dependency of the D α for phosphocreatine (PCr) in the rat muscle tissue on diffusion time was observed, clearly indicating restricted diffusion effects and allowing an approximation of the size of the restricted volume (8-13 μm). This size fits well with the known dimensions of a normal muscle cell

  8. The limitation and modification of flux-limited diffusion theory

    International Nuclear Information System (INIS)

    Liu Chengan; Huang Wenkai

    1986-01-01

    The limitation of various typical flux-limited diffusion theory and advantages of asymptotic diffusion theory with time absorption constant are analyzed and compared. The conclusions are as following: Though the flux-limited problem in neutron diffusion theory are theoretically solved by derived flux-limited diffusion equation, it's going too far to limit flux due to the inappropriate assumption in deriving flux-limited diffusion equation. The asymptotic diffusion theory with time absorption constant has eliminated the above-mentioned limitation, and it is more accurate than flux-limited diffusion theory in describing neutron transport problem

  9. Depth Distribution Studies of Carbon in Steel Surfaces by Means of Charged Particle Activation Analysis with an Account of Heat and Diffusion Effects in the Sample

    Energy Technology Data Exchange (ETDEWEB)

    Brune, D; Lorenzen, J [AB Atomenergi, Nykoeping (Sweden); Witalis, E [Swedish National Defence Research Inst., Stockholm (Sweden)

    1972-05-15

    Depth distribution studies of carbon in steel and iron were carried out in the concentration range 0.05-1 %, using proton activation analysis. Surface content studies were performed in the concentration range 0.01-1 % using deuteron activation analysis. The following reactions were utilized: {sup 12}C(p,{gamma}){sup 13}N and {sup 12}C(d,n){sup 13}N Evaluations of depth distribution were based on resonances in the excitation function. The carbon content was determined with the aid of the positron emitter, {sup 13}N, using either single-peak or coincidence measurements. The heat dissipation in the irradiated region of the samples was calculated, and the temperature rise was measured using thermocouples. The temperature distribution within the hot zone subjected to irradiation by charged particles, together with the temperature distribution around this zone, was studied in order to estimate any effect this might have on the carbon diffusion. A device for automatic sample exchange which is remotely controlled is described.

  10. Surface- vs Diffusion-Limited Mechanisms of Anion Exchange in CsPbBr3 Nanocrystal Cubes Revealed through Kinetic Studies.

    Science.gov (United States)

    Koscher, Brent A; Bronstein, Noah D; Olshansky, Jacob H; Bekenstein, Yehonadav; Alivisatos, A Paul

    2016-09-21

    Ion-exchange transformations allow access to nanocrystalline materials with compositions that are inaccessible via direct synthetic routes. However, additional mechanistic insight into the processes that govern these reactions is needed. We present evidence for the presence of two distinct mechanisms of exchange during anion exchange in CsPbX3 nanocrystals (NCs), ranging in size from 6.5 to 11.5 nm, for transformations from CsPbBr3 to CsPbCl3 or CsPbI3. These NCs exhibit bright luminescence throughout the exchange, allowing their optical properties to be observed in real time, in situ. The iodine exchange presents surface-reaction-limited exchanges allowing all anionic sites within the NC to appear chemically identical, whereas the chlorine exchange presents diffusion-limited exchanges proceeding through a more complicated exchange mechanism. Our results represent the first steps toward developing a microkinetic description of the anion exchange, with implications not only for understanding the lead halide perovskites but also for nanoscale ion exchange in general.

  11. Diffraction and diffusion in room acoustics

    DEFF Research Database (Denmark)

    Rindel, Jens Holger; Rasmussen, Birgit

    1996-01-01

    Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....

  12. Diffusion Influenced Adsorption Kinetics.

    Science.gov (United States)

    Miura, Toshiaki; Seki, Kazuhiko

    2015-08-27

    When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

  13. Diffusion from cylindrical waste forms

    International Nuclear Information System (INIS)

    Thomas, G.F.

    1985-05-01

    The diffusion of a single component material from a finite cylindrical waste form, initially containing a uniform concentration of the material, is investigated. Under the condition that the cylinder is maintained in a well-stirred bath, expressions for the fractional inventory leached and the leach rate are derived with allowance for the possible permanent immobilization of the diffusant through its decay to a stable product and/or its irreversible reaction with the waste form matrix. The usefulness of the reported results in nuclear waste disposal applications is emphasized. The results reported herein are related to those previously derived at Oak Ridge National Laboratory by Bell and Nestor. A numerical scheme involving the partial decoupling of nested infinite summations and the use of rapidly converging rational approximants is recommended for the efficient implementation of the expressions derived to obtain reliable estimates of the bulk diffusion constant and the rate constant describing the diffusant-waste form interaction from laboratory data

  14. Measuring methods of matrix diffusion

    International Nuclear Information System (INIS)

    Muurinen, A.; Valkiainen, M.

    1988-03-01

    In Finland the spent nuclear fuel is planned to be disposed of at large depths in crystalline bedrock. The radionuclides which are dissolved in the groundwater may be able to diffuse into the micropores of the porous rock matrix and thus be withdrawn from the flowing water in the fractures. This phenomenon is called matrix diffusion. A review over matrix diffusion is presented in the study. The main interest is directed to the diffusion of non-sorbing species. The review covers diffusion experiments and measurements of porosity, pore size, specific surface area and water permeability

  15. Effect of TiO{sub 2} additive on the sintering of nuclear fuel (U,Pu)O{sub 2}. Contribution of surface diffusion to plutonium distribution; Influence de l`ajout de TiO{sub 2} sur l`aptitude au frittage du combustible nucleaire (U,Pu)O{sub 2}. Contribution de la diffusion de surface a la repartition du plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Bremier, Stephane [CEA Centre d`Etudes de Cadarache, 13 - Saint-Paul-lez-Durance (France)

    1997-12-19

    This thesis has as objective the study of the effect of TiO{sub 2} additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO{sub 2} in the presence of TiO{sub 2} has been established and the influence of the PuO{sub 2} distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO{sub 2} and UO{sub 2}-PuO{sub 2}. The results concerning the influence of TiO{sub 2} upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO{sub 2} alone or in the presence of TiO{sub 2} are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO{sub 2}-PuO{sub 2} preparation upon the initial microstructure of the materials and the role played by the PuO{sub 2} grains in sintering. The potentiality of surface diffusion as a means of PuO{sub 2} spreading in the UO{sub 2} is evaluated and correlated with the reduced capacity of sintering the UO{sub 2} ceramics containing PuO{sub 2}. The last chapter deals with the influence of TiO{sub 2} on the development of microstructure in UO{sub 2}-PuO{sub 2} ceramics. While at temperatures below 1500 deg.C the TiO{sub 2} additive affects the surface diffusion and so the plutonium distribution, at values T{>=} 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO{sub 2}, PuO{sub 2} and titanium oxide. Thus the objective is

  16. Surface Complexation Modeling in Variable Charge Soils: Prediction of Cadmium Adsorption

    Directory of Open Access Journals (Sweden)

    Giuliano Marchi

    2015-10-01

    Full Text Available ABSTRACT Intrinsic equilibrium constants for 22 representative Brazilian Oxisols were estimated from a cadmium adsorption experiment. Equilibrium constants were fitted to two surface complexation models: diffuse layer and constant capacitance. Intrinsic equilibrium constants were optimized by FITEQL and by hand calculation using Visual MINTEQ in sweep mode, and Excel spreadsheets. Data from both models were incorporated into Visual MINTEQ. Constants estimated by FITEQL and incorporated in Visual MINTEQ software failed to predict observed data accurately. However, FITEQL raw output data rendered good results when predicted values were directly compared with observed values, instead of incorporating the estimated constants into Visual MINTEQ. Intrinsic equilibrium constants optimized by hand calculation and incorporated in Visual MINTEQ reliably predicted Cd adsorption reactions on soil surfaces under changing environmental conditions.

  17. Radon diffusion studies in air, gravel, sand, soil and water

    International Nuclear Information System (INIS)

    Singh, B.; Singh, S.; Virk, H.S.

    1993-01-01

    Radon isotopes are practically inert and have properties of gases under conditions of geological interest. During their brief lives their atoms are capable of moving from sites of their generation. Radon diffusion studies were carried out in air, gravel, sand, soil and water using silicon diffused junction electronic detector, Alphameter-400. Diffusion constant and diffusion length is calculated for all these materials. (author)

  18. Development of a methodology to generate materials constant for the FLARE-G computer code

    International Nuclear Information System (INIS)

    Martinez, A.S.; Rosier, C.J.; Schirru, R.; Silva, F.C. da; Thome Filho, Z.D.

    1983-01-01

    The methodology of calculation aiming to determine the parametrization constants of the multiplication factor and migration area is presented. These physical parameters are necessary in the solution of the diffusion equation with the nodal method, and they represent the adequated form of the macrogroup constants in the cell calculation. An automatic system was done to generate the parametrization constants. (E.G.) [pt

  19. Charge diffusion and the butterfly effect in striped holographic matter

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, Andrew [Department of Physics, Harvard University,Cambridge, MA 02138 (United States); Department of Physics, Stanford University,Stanford, CA 94305 (United States); Steinberg, Julia [Department of Physics, Harvard University,Cambridge, MA 02138 (United States)

    2016-10-26

    Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.

  20. Charge diffusion and the butterfly effect in striped holographic matter

    International Nuclear Information System (INIS)

    Lucas, Andrew; Steinberg, Julia

    2016-01-01

    Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.