Decay constants of subcritical system by diffusion theory for two groups

International Nuclear Information System (INIS)

Moura Neto, C. de.

1977-01-01

The effects of a neutronic pulse applied to a subcritical multiplicative medium are analysed on the basis of the diffusion theory for one and two groups. The decay constants of the system for various values of geometric buckling were determined from the experimental data. A natural uranium-light water lattice was pulsed employing a Texas Nuclear 9905 neutron generator. The least square method was employed in the data reduction procedures to determine the decay constants. The separation of the decay constants associated with thermal and epithermal fluxes is attempted through two groups formulation. (author)

Decay constants of a subcritical system by two-group diffusion theory

International Nuclear Information System (INIS)

Moura Neto, C. de.

1979-08-01

The effects of a neutronic pulse applied to a subcritical multiplicative medium are analyzed on the basis of the diffusion theory for one and two groups. The decay constants of the system were determined from the experimental data, for various values geometric buckling. A natural uranium light-water configuration was pulsed employing a Texas Nuclear 9905 neutron generator. The least square method was employed in the data reduction procedures to determine the decay constants. The separation of the decay constants associated with thermal and epithermal fluxes are verified through two groups formulation. (Author) [pt

The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

International Nuclear Information System (INIS)

Durakanoglu, S.

2004-01-01

Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

The influence of the surface atomic structure on surface diffusion

International Nuclear Information System (INIS)

Ghaleb, Dominique

1984-03-01

This work represents the first quantitative study of the influence of the surface atomic structure on surface diffusion (in the range: 0.2 Tf up 0.5 Tf; Tf: melting temperature of the substrate). The analysis of our results on a microscopic scale shows low formation and migration energies for adatoms; we can describe the diffusion on surfaces with a very simple model. On (110) surfaces at low temperature the diffusion is controlled by the exchange mechanism; at higher temperature direct jumps of adatoms along the channels contribute also to the diffusion process. (author) [fr

Transport and diffusion on crystalline surfaces under external forces

International Nuclear Information System (INIS)

Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

2005-01-01

We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

Spectral function and quark diffusion constant in non-critical holographic QCD

Energy Technology Data Exchange (ETDEWEB)

Bu Yanyan, E-mail: yybu@itp.ac.cn [Institute of Theoretical Physics, Academia Sinica, Beijing 100190 (China); Yang Jinmin, E-mail: jmyang@itp.ac.cn [Institute of Theoretical Physics, Academia Sinica, Beijing 100190 (China)

2012-02-11

Motivated by recent studies of intersecting D-brane systems in critical string theory and phenomenological AdS/QCD models, we present a detailed analysis for the vector and scalar fluctuations in a non-critical holographic QCD model in the high temperature phase, i.e., the chiral symmetric phase. This model is described by N{sub f} pairs of D4 and D4{sup Macron} probe branes in a non-critical AdS{sub 6} black hole background. Focusing on the hydrodynamic as well as the high frequency limit, we analytically obtain spectral functions for vector and scalar modes on the flavor probe. Then we extract the light quark diffusion constant for flavor current using three different methods and find that different methods give the same results. We also compute the heavy quark diffusion constant for comparison with the light quark case.

Theory and experiments on surface diffusion

Energy Technology Data Exchange (ETDEWEB)

Silvestri, W.L.

1998-11-01

The following topics were dealt with: adatom formation and self-diffusion on the Ni(100) surface, helium atom scattering measurements, surface-diffusion parameter measurements, embedded atom method calculations.

SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

Directory of Open Access Journals (Sweden)

M. R. Monazzam

2006-10-01

Full Text Available Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier was raised. Diffusion coefficients of a diffuser in different conditions at some receiver locations were predicted by using a 2D boundary element method. It was found that the diffusion coefficient of diffuser at the top of barrier is so small that the diffusivity of the structure is almost the same as rigid T-shape barrier. To find the barrier’s cap behavior, the total field above the top surface of profile barriers was also predicted. It was found that the lowest total energy is at the receiver side of the cap very close to the top surface,which could demonstrate the effect of top surface on absorbing the energy as wave transfers from source edge toward the receiver side of the cap. In this case the amount of minimum total energy depends on the frequency and the configuration of the top surface. A comparison between the reductions of total field at the source side of the cap with the improvements of barrier’s performance was also done. It was shown that the amount of decrease in total field compared to that of an absorbent barrier “Ref” is directly associated to the amount of improvement in the insertion loss made by the diffuser barrier compared to the “Ref” barrier in the wide area on the ground at the shadow zone. Finally it was concluded that the diffuser on the top of barrier does not act as a diffuser and a kind of similarity between the contribution of diffuser and absorbent material on the top of T-profile barrier is seen.

Single atom self-diffusion on nickel surfaces

International Nuclear Information System (INIS)

Tung, R.T.; Graham, W.R.

1980-01-01

Results of a field ion microscope study of single atom self-diffusion on Ni(311), (331), (110), (111) and (100) planes are presented, including detailed information on the self-diffusion parameters on (311), (331), and (110) surfaces, and activation energies for diffusion on the (111), and (100) surfaces. Evidence is presented for the existence of two types of adsorption site and surface site geometry for single nickel atoms on the (111) surface. The presence of adsorbed hydrogen on the (110), (311), and (331) surfaces is shown to lower the onset temperature for self-diffusion on these planes. (orig.)

Surface diffusion studies by optical diffraction techniques

International Nuclear Information System (INIS)

Xiao, X.D.

1992-11-01

The newly developed optical techniques have been combined with either second harmonic (SH) diffraction or linear diffraction off a monolayer adsorbate grating for surface diffusion measurement. Anisotropy of surface diffusion of CO on Ni(l10) was used as a demonstration for the second harmonic dim reaction method. The linear diffraction method, which possesses a much higher sensitivity than the SH diffraction method, was employed to study the effect of adsorbate-adsorbate interaction on CO diffusion on Ni(l10) surface. Results showed that only the short range direct CO-CO orbital overlapping interaction influences CO diffusion but not the long range dipole-dipole and CO-NI-CO interactions. Effects of impurities and defects on surface diffusion were further explored by using linear diffraction method on CO/Ni(110) system. It was found that a few percent S impurity can alter the CO diffusion barrier height to a much higher value through changing the Ni(110) surface. The point defects of Ni(l10) surface seem to speed up CO diffusion significantly. A mechanism with long jumps over multiple lattice distance initiated by CO filled vacancy is proposed to explain the observed defect effect

Pulsed neutron determination of anisotropic diffusion constants in multi-layered slabs

International Nuclear Information System (INIS)

Sri Ram, K.

1978-01-01

Anisotropic neutron diffusion parameters for graphite and plexiglas slab assemblies were calculated using one-dimensional discrete ordinates code ANISN, and also Case's eigenfunction expansion technique as suggested by Leonard. These calculated values were checked with the pulsed neutron experimental results as well as simple diffusion theory calculations of Spinrad. Relatively little experimental work has been done with heterogeneous assemblies which do not contain voids. The present comparison shows that the experimental results agree well with transport theory calculations. It appears from the results and inter-comparison of this work in simple geometries, that the pulsed neutron method can yield accurate experimental anisotropic diffusion constants, and can therefore be applied to more complicated geometries which may be difficult to calculate. (author)

Tracer surface diffusion on UO2

International Nuclear Information System (INIS)

Zhou, S.Y.; Olander, D.R.

1983-06-01

Surface diffusion on UO 2 was measured by the spreading of U-234 tracer on the surface of a duplex diffusion couple consisting of wafers of depleted and enriched UO 2 joined by a bond of uranium metal

Diffusion and surface alloying of gradient nanostructured metals

Directory of Open Access Journals (Sweden)

Zhenbo Wang

2017-03-01

Full Text Available Gradient nanostructures (GNSs have been optimized in recent years for desired performance. The diffusion behavior in GNS metals is crucial for understanding the diffusion mechanism and relative characteristics of different interfaces that provide fundamental understanding for advancing the traditional surface alloying processes. In this paper, atomic diffusion, reactive diffusion, and surface alloying processes are reviewed for various metals with a preformed GNS surface layer. We emphasize the promoted atomic diffusion and reactive diffusion in the GNS surface layer that are related to a higher interfacial energy state with respect to those in relaxed coarse-grained samples. Accordingly, different surface alloying processes, such as nitriding and chromizing, have been modified significantly, and some diffusion-related properties have been enhanced. Finally, the perspectives on current research in this field are discussed.

Inter-atomic force constants of BaF{sub 2} by diffuse neutron scattering measurement

Energy Technology Data Exchange (ETDEWEB)

Sakuma, Takashi, E-mail: sakuma@mx.ibaraki.ac.jp; Makhsun,; Sakai, Ryutaro [Institute of Applied Beam Science, Ibaraki University, Mito 310-8512 (Japan); Xianglian [College of Physics and Electronics Information, Inner Mongolia University for the Nationalities, Tongliao 028043 (China); Takahashi, Haruyuki [Institute of Applied Beam Science, Ibaraki University, Hitachi 316-8511 (Japan); Basar, Khairul [Faculty of Mathematics and Natural Sciences, Institut Teknologi Bandung, Bandung 40132 (Indonesia); Igawa, Naoki [Quantum Beam Science Directorate, Japan Atomic Energy Agency, Tokai 319-1195 (Japan); Danilkin, Sergey A. [Bragg Institute, Australian Nuclear Science and Technology Organisation, Kirrawee DC NSW 2232 (Australia)

2015-04-16

Diffuse neutron scattering measurement on BaF{sub 2} crystals was performed at 10 K and 295 K. Oscillatory form in the diffuse scattering intensity of BaF{sub 2} was observed at 295 K. The correlation effects among thermal displacements of F-F atoms were obtained from the analysis of oscillatory diffuse scattering intensity. The force constants among neighboring atoms in BaF{sub 2} were determined and compared to those in ionic crystals and semiconductors.

Surface modifications by field induced diffusion.

Directory of Open Access Journals (Sweden)

Martin Olsen

Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

Diffusion processes in bombardment-induced surface topography

International Nuclear Information System (INIS)

Robinson, R.S.

1984-01-01

A treatment is given of the problem of surface diffusion processes occurring during surface topography development, whenever a surface is simultaneously seeded with impurities and ion bombarded. The development of controllable topography and the importance of surface diffusion parameters, which can be obtained during these studies, are also analyzed. 101 refs.; 7 figs.; 2 tabs

Modifying glass surfaces via internal diffusion

DEFF Research Database (Denmark)

Smedskjaer, M.M.; Yue, Y.Z.; Deubener, J.

2010-01-01

leads to outward diffusion (OD) of divalent cations (primarily Mg2+), i.e., diffusion from the interior of the glass to the surface, and thereby, to formation of an oxide surface nano-layer. in contrast, when the glasses are heat-treated in H-2/N-2 gas containing 10 vol.% H-2, reduction of Fe3+ to Fe2...... on some properties such as hardness, chemical durability, and surface wettability....

Plasma diffusion in systems with disrupted magnetic surfaces

International Nuclear Information System (INIS)

Morozov, D.K.; Pogutse, O.P.

1982-01-01

Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

Reactive solid surface morphology variation via ionic diffusion.

Science.gov (United States)

Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

2012-08-14

In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

OpenAIRE

M. R. Monazzam

2006-01-01

Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

Darboux transformations for (1+2)-dimensional Fokker-Planck equations with constant diffusion matrix

International Nuclear Information System (INIS)

Schulze-Halberg, Axel

2012-01-01

We construct a Darboux transformation for (1+2)-dimensional Fokker-Planck equations with constant diffusion matrix. Our transformation is based on the two-dimensional supersymmetry formalism for the Schrödinger equation. The transformed Fokker-Planck equation and its solutions are obtained in explicit form.

Effect of strain on surface diffusion and nucleation

DEFF Research Database (Denmark)

Brune, Harald; Bromann, Karsten; Röder, Holger

1995-01-01

The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

A critical comparison of constant and pulsed flow systems exploiting gas diffusion.

Science.gov (United States)

Silva, Claudineia Rodrigues; Henriquez, Camelia; Frizzarin, Rejane Mara; Zagatto, Elias Ayres Guidetti; Cerda, Victor

2016-02-01

Considering the beneficial aspects arising from the implementation of pulsed flows in flow analysis, and the relevance of in-line gas diffusion as an analyte separation/concentration step, influence of flow pattern in flow systems with in-line gas diffusion was critically investigated. To this end, constant or pulsed flows delivered by syringe or solenoid pumps were exploited. For each flow pattern, two variants involving different interaction times of the donor with the acceptor streams were studied. In the first one, both the acceptor and donor streams were continuously flowing, whereas in the second one, the acceptor was stopped during the gas diffusion step. Four different volatile species (ammonia, ethanol, carbon dioxide and hydrogen sulfide) were selected as models. For the flow patterns and variants studied, the efficiencies of mass transport in the gas diffusion process were compared, and sensitivity, repeatability, sampling frequency and recorded peak shape were evaluated. Analysis of the results revealed that sensitivity is strongly dependent on the implemented variant, and that flow pattern is an important feature in flow systems with in-line gas diffusion. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparison of Green-Kubo and nonequilibrium calculations of the self-diffusion constant of a Lennard-Jones fluid

International Nuclear Information System (INIS)

Erpenbeck, J.J.

1987-01-01

We apply the so-called ''synthetic'' nonequilibrium molecular-dynamics method to the calculation of the self-diffusion constant of a Lennard-Jones fluid at a number density of 0.85/σ 3 and a temperature of 1.08 epsilon-c/k/sub B/ (where epsilon-c and σ are the energy and length parameters of the potential and k/sub B/ is the Boltzmann constant). By comparing with the Green-Kubo calculation for the same state of the system and for the same number of particles, N, we find the latter calculation to yield more precise values of the self-diffusion constant for a given number of molecular-dynamics time steps. Even at small values of the diffusion current, a nontrivial time is needed for the nonequilibrium calculation to reach the steady state. For larger values of the driving force, the steady-state flow appears to become unstable and evidence of a secondary flow pattern is presented. The presence of these instabilities acts as a limit to the range of the driving force for which the steady-state method can be applied. With increasing N the range of stable values of the diffusion current density decreases. For the Green-Kubo calculations, the N dependence of the self-diffusion constant is found to be anomalous for N = 108, with the 1/N dependence only exhibited for at least 500 particles. The nonequilibrium results, while approximately independent of N for 108 and 500 particles, are found to have a similar anomalous N dependence when we extend the calculations to 1372 particles, thereby bringing the Green-Kubo and nonequilibrium results into agreement in the large-system limit

Communication: Diffusion constant in supercooled water as the Widom line is crossed in no man's land

Science.gov (United States)

Ni, Yicun; Hestand, Nicholas J.; Skinner, J. L.

2018-05-01

According to the liquid-liquid critical point (LLCP) hypothesis, there are two distinct phases of supercooled liquid water, namely, high-density liquid and low-density liquid, separated by a coexistence line that terminates in an LLCP. If the LLCP is real, it is located within No Man's Land (NML), the region of the metastable phase diagram that is difficult to access using conventional experimental techniques due to rapid homogeneous nucleation to the crystal. However, a recent ingenious experiment has enabled measurement of the diffusion constant deep inside NML. In the current communication, these recent measurements are compared, with good agreement, to the diffusion constant of E3B3 water, a classical water model that explicitly includes three-body interactions. The behavior of the diffusion constant as the system crosses the Widom line (the extension of the liquid-liquid coexistence line into the one-phase region) is analyzed to derive information about the presence and location of the LLCP. Calculations over a wide range of temperatures and pressures show that the new experimental measurements are consistent with an LLCP having a critical pressure of over 0.6 kbar.

Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

International Nuclear Information System (INIS)

Goddard, P.J.

1989-01-01

The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

Detection analysis of surface hydroxyl active sites and simulation calculation of the surface dissociation constants of aqueous diatomite suspensions

Science.gov (United States)

Ma, Shu-Cui; Wang, Zhi-Gang; Zhang, Ji-Lin; Sun, De-Hui; Liu, Gui-Xia

2015-02-01

The surface properties of the diatomite were investigated using nitrogen adsorption/deadsorption isotherms, TG-DSC, FTIR, and XPS, and surface protonation-deprotonation behavior was determined by continuous acid-base potentiometric titration technique. The diatomite sample with porous honeycomb structure has a BET specific surface area of 10.21 m2/g and large numbers of surface hydroxyl functional groups (i.e. tbnd Si-OH, tbnd Fe-OH, and tbnd Al-OH). These surface hydroxyls can be protonated or deprotonated depending on the pH of the suspension. The experimental potentiometric data in two different ionic strength solutions (0.1 and 0.05 mol/L NaCl) were fitted using ProtoFit GUI V2.1 program by applying diffuse double layer model (DLM) with three amphoteric sites and minimizing the sum of squares between a dataset derivative function and a model derivative function. The optimized surface parameters (i.e. surface dissociation constants (log K1, log K2) and surface site concentrations (log C)) of the sample were obtained. Based on the optimized surface parameters, the surface species distribution was calculated using Program-free PHREEQC 3.1.2. Thus, this work reveals considerable new information about surface protonation-deprotonation processes and surface adsorptive behaviors of the diatomite, which helps us to effectively use the cheap and cheerful diatomite clay adsorbent.

Chemical diffusion on solid surfaces. Final report

International Nuclear Information System (INIS)

Hudson, J.B.

1980-12-01

The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

Diffuse neutron scattering signatures of rough films

International Nuclear Information System (INIS)

Pynn, R.; Lujan, M. Jr.

1992-01-01

Patterns of diffuse neutron scattering from thin films are calculated from a perturbation expansion based on the distorted-wave Born approximation. Diffuse fringes can be categorised into three types: those that occur at constant values of the incident or scattered neutron wavevectors, and those for which the neutron wavevector transfer perpendicular to the film is constant. The variation of intensity along these fringes can be used to deduce the spectrum of surface roughness for the film and the degree of correlation between the film's rough surfaces

Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

International Nuclear Information System (INIS)

Ma, Z.; Whitley, R.D.; Wang, N.H.L.

1996-01-01

A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

Phototransformation rate constants of PAHs associated with soot particles

International Nuclear Information System (INIS)

Kim, Daekyun; Young, Thomas M.; Anastasio, Cort

2013-01-01

Photodegradation is a key process governing the residence time and fate of polycyclic aromatic hydrocarbons (PAHs) in particles, both in the atmosphere and after deposition. We have measured photodegradation rate constants of PAHs in bulk deposits of soot particles illuminated with simulated sunlight. The photodegradation rate constants at the surface (k p 0 ), the effective diffusion coefficients (D eff ), and the light penetration depths (z 0.5 ) for PAHs on soot layers of variable thickness were determined by fitting experimental data with a model of coupled photolysis and diffusion. The overall disappearance rates of irradiated low molecular weight PAHs (with 2–3 rings) on soot particles were influenced by fast photodegradation and fast diffusion kinetics, while those of high molecular weight PAHs (with 4 or more rings) were apparently controlled by either the combination of slow photodegradation and slow diffusion kinetics or by very slow diffusion kinetics alone. The value of z 0.5 is more sensitive to the soot layer thickness than the k p 0 value. As the thickness of the soot layer increases, the z 0.5 values increase, but the k p 0 values are almost constant. The effective diffusion coefficients calculated from dark experiments are generally higher than those from the model fitting method for illumination experiments. Due to the correlation between k p 0 and z 0.5 in thinner layers, D eff should be estimated by an independent method for better accuracy. Despite some limitations of the model used in this study, the fitted parameters were useful for describing empirical results of photodegradation of soot-associated PAHs. - Highlights: ► PAHs on soot were evaluated by a model of coupled photolysis and diffusion. ► Photodegradation rate at the surface, diffusion coefficient, and light penetration path were determined. ► Low MW PAHs were influenced by fast photodegradation and fast diffusion. ► High MW PAHs were controlled either by slow

Friction and diffusion dynamics of adsorbates at surfaces

NARCIS (Netherlands)

Fusco, C.

2005-01-01

A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

Diffusion processes in bombardment-induced surface topography

International Nuclear Information System (INIS)

Robinson, R.S.

1984-01-01

The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

Is X-ray emissivity constant on magnetic flux surfaces?

International Nuclear Information System (INIS)

Granetz, R.S.; Borras, M.C.

1997-01-01

Knowledge of the elongations and shifts of internal magnetic flux surfaces can be used to determine the q profile in elongated tokamak plasmas. X-ray tomography is thought to be a reasonable technique for independently measuring internal flux surface shapes, because it is widely believed that X-ray emissivity should be constant on a magnetic flux surface. In the Alcator C-Mod tokamak, the X-ray tomography diagnostic system consists of four arrays of 38 chords each. A comparison of reconstructed X-ray contours with magnetic flux surfaces shows a small but consistent discrepancy in the radial profile of elongation. Numerous computational tests have been performed to verify these findings, including tests of the sensitivity to calibration and viewing geometry errors, the accuracy of the tomography reconstruction algorithms, and other subtler effects. We conclude that the discrepancy between the X-ray contours and the magnetic flux surfaces is real, leading to the conclusion that X-ray emissivity is not exactly constant on a flux surface. (orig.)

Diffusivity, solubility and thermodynamic modelling of diffusion growth of Ga"3"+-doped LiTaO_3 thin film for integrated optics

International Nuclear Information System (INIS)

Zhang, De-Long; Zhang, Qun; Zhang, Pei; Kang, Jian; Wong, Wing-Han; Yu, Dao-Yin

2016-01-01

Graphical abstract: Diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film was studied thermodynamically. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. The Ga"3"+ profile in the grown thin film was analyzed by secondary ion mass spectrometry. Form the measured Ga"3"+ profiles, some thermodynamic parameters were obtained. These include diffusivity, diffusion constant, chemical activation energy, solubility, solubility constant and enthalpy of solution. These parameters are crucial to design and growth of a Ga"3"+-doped LT thin film with desired Ga"3"+ profile for integrated optics application. A thermodynamic model is suggested for the growth and verified experimentally. - Highlights: • Diffusion growth of Ga"3"+-doped LiTaO_3 thin film were studied thermodynamically. • Diffusion constant is 1.41 · 10"−"6 m"2/s and activation energy is 237.2 kJ/mol. • Solubility constant is 22.9 · 10"2"6 ions/m"3 and enthalpy of solution is 28.9 kJ/mol. • Ga"3"+ dopant has small effect on LiTaO_3 refractive index. • Ga"3"+ growth can be described by a Fick-type equation with a constant diffusivity. - Abstract: A thermodynamic study was performed on diffusion growth of Ga"3"+-doped LiTaO_3(LT) thin film for integrated optics. Some Ga"3"+-doped LT thin films were grown on LT surface by in-diffusion of homogeneously coated Ga_2O_3 film at the temperature range of (1273 to 1473) K. After growth, the refractive indices at Ga"3"+-doped and un-doped surface parts were measured by prism coupling technique and Li composition there was evaluated from the measured refractive indices. The results show that Ga"3"+ dopant has small effect on the LT index. Li_2O out-diffusion is not measurable. The Ga"3"+ profile in the grown thin film was analysed by secondary ion mass spectrometry. It is found that the grown Ga"3"+ ions follow a complementary error function profile. A

A diffuse radar scattering model from Martian surface rocks

Science.gov (United States)

Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

1987-01-01

Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

Derivation of Inter-Atomic Force Constants of Cu2O from Diffuse Neutron Scattering Measurement

Directory of Open Access Journals (Sweden)

T. Makhsun

2013-04-01

Full Text Available Neutron scattering intensity from Cu2O compound has been measured at 10 K and 295 K with High Resolution Powder Diffractometer at JRR-3 JAEA. The oscillatory diffuse scattering related to correlations among thermal displacements of atoms was observed at 295 K. The correlation parameters were determined from the observed diffuse scattering intensity at 10 and 295 K. The force constants between the neighboring atoms in Cu2O were estimated from the correlation parameters and compared to those of Ag2O

A Congruence Theorem for Minimal Surfaces in $S^{5}$ with Constant Contact Angle

OpenAIRE

Montes, Rodrigo Ristow; Verderesi, Jose A.

2006-01-01

We provide a congruence theorem for minimal surfaces in $S^5$ with constant contact angle using Gauss-Codazzi-Ricci equations. More precisely, we prove that Gauss-Codazzi-Ricci equations for minimal surfaces in $S^5$ with constant contact angle satisfy an equation for the Laplacian of the holomorphic angle. Also, we will give a characterization of flat minimal surfaces in $S^5$ with constant contact angle.

Direct measurement of Cu surface self-diffusion on a checked surface

International Nuclear Information System (INIS)

Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

1976-01-01

A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

Laser-induced desorption determinations of surface diffusion on Rh(111)

International Nuclear Information System (INIS)

Seebauer, E.G.; Schmidt, L.D.

1987-01-01

Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

International Nuclear Information System (INIS)

Cousty, J.P.

1981-12-01

In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

Detection analysis of surface hydroxyl active sites and simulation calculation of the surface dissociation constants of aqueous diatomite suspensions

International Nuclear Information System (INIS)

Ma, Shu-Cui; Wang, Zhi-Gang; Zhang, Ji-Lin; Sun, De-Hui; Liu, Gui-Xia

2015-01-01

Highlights: • To examine surface hydroxyl functional groups of the calcined diatomite by TGA-DSC, FTIR, and XPS. • To calculate the optimized log K 1 , log K 2 and log C values and the surface species distribution of each surface reactive site using ProtoFit and PHREEQC, respectively. - Abstract: The surface properties of the diatomite were investigated using nitrogen adsorption/deadsorption isotherms, TG-DSC, FTIR, and XPS, and surface protonation–deprotonation behavior was determined by continuous acid–base potentiometric titration technique. The diatomite sample with porous honeycomb structure has a BET specific surface area of 10.21 m 2 /g and large numbers of surface hydroxyl functional groups (i.e. ≡Si-OH, ≡Fe-OH, and ≡Al-OH). These surface hydroxyls can be protonated or deprotonated depending on the pH of the suspension. The experimental potentiometric data in two different ionic strength solutions (0.1 and 0.05 mol/L NaCl) were fitted using ProtoFit GUI V2.1 program by applying diffuse double layer model (DLM) with three amphoteric sites and minimizing the sum of squares between a dataset derivative function and a model derivative function. The optimized surface parameters (i.e. surface dissociation constants (log K 1 , log K 2 ) and surface site concentrations (log C)) of the sample were obtained. Based on the optimized surface parameters, the surface species distribution was calculated using Program-free PHREEQC 3.1.2. Thus, this work reveals considerable new information about surface protonation–deprotonation processes and surface adsorptive behaviors of the diatomite, which helps us to effectively use the cheap and cheerful diatomite clay adsorbent

Detection analysis of surface hydroxyl active sites and simulation calculation of the surface dissociation constants of aqueous diatomite suspensions

Energy Technology Data Exchange (ETDEWEB)

Ma, Shu-Cui [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Key Laboratory of Applied Chemistry and Nanotechnology at Universities of Jilin Province, Changchun University of Science and Technology, Changchun 130022 (China); Wang, Zhi-Gang [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Zhang, Ji-Lin, E-mail: zjl@ciac.ac.cn [State Key Laboratory of Rare Earth Resource Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Sun, De-Hui [Changchun Institute Technology, Changchun 130012 (China); Liu, Gui-Xia, E-mail: liuguixia22@163.com [Key Laboratory of Applied Chemistry and Nanotechnology at Universities of Jilin Province, Changchun University of Science and Technology, Changchun 130022 (China)

2015-02-01

Highlights: • To examine surface hydroxyl functional groups of the calcined diatomite by TGA-DSC, FTIR, and XPS. • To calculate the optimized log K{sub 1}, log K{sub 2} and log C values and the surface species distribution of each surface reactive site using ProtoFit and PHREEQC, respectively. - Abstract: The surface properties of the diatomite were investigated using nitrogen adsorption/deadsorption isotherms, TG-DSC, FTIR, and XPS, and surface protonation–deprotonation behavior was determined by continuous acid–base potentiometric titration technique. The diatomite sample with porous honeycomb structure has a BET specific surface area of 10.21 m{sup 2}/g and large numbers of surface hydroxyl functional groups (i.e. ≡Si-OH, ≡Fe-OH, and ≡Al-OH). These surface hydroxyls can be protonated or deprotonated depending on the pH of the suspension. The experimental potentiometric data in two different ionic strength solutions (0.1 and 0.05 mol/L NaCl) were fitted using ProtoFit GUI V2.1 program by applying diffuse double layer model (DLM) with three amphoteric sites and minimizing the sum of squares between a dataset derivative function and a model derivative function. The optimized surface parameters (i.e. surface dissociation constants (log K{sub 1}, log K{sub 2}) and surface site concentrations (log C)) of the sample were obtained. Based on the optimized surface parameters, the surface species distribution was calculated using Program-free PHREEQC 3.1.2. Thus, this work reveals considerable new information about surface protonation–deprotonation processes and surface adsorptive behaviors of the diatomite, which helps us to effectively use the cheap and cheerful diatomite clay adsorbent.

Stochastic models for surface diffusion of molecules

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2014-07-28

We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

Diffusion and flow of water vapours in chromatographic Alumina gel

International Nuclear Information System (INIS)

Khan, M.; Shah, H. U.

2005-01-01

The kinetics of sorption of water vapours in chromatographic alumina gel was studied. Water vapours are adsorbed on the gel at temperature (15 degree C) at different constant relative pressure from 0.1-0.93 p/p. Rate constant, Effective diffusivities, Knudsen diffusivities and bulk diffusivities were determined through Fick type equation. Total pore volume is 0.498 cc g-1 and specific surface area comes to be 465 m2 g-1 as obtained by Gurvitsch rule and Kieselve's quantities respectively. An average pore radius (hydraulic) is 1.1x10/sub -7/ cm. The study of these quantities provide a strong basis for evaluating surface properties. (author)

Nonthermal Effects of Photon Illumination on Surface Diffusion

International Nuclear Information System (INIS)

Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

1998-01-01

Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

Linear response theory of activated surface diffusion with interacting adsorbates

Energy Technology Data Exchange (ETDEWEB)

Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

2010-05-12

Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

International Nuclear Information System (INIS)

Strubelj, Luka; Tiselj, Izrok

2008-01-01

Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

Radiation induced diffusion as a method to protect surface

International Nuclear Information System (INIS)

Baumvol, I.J.R.

1980-01-01

Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

Diffusion accessibility as a method for visualizing macromolecular surface geometry.

Science.gov (United States)

Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

2015-10-01

Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

Diffusion in crushed rock and in bentonite clay

International Nuclear Information System (INIS)

Olin, M.

1994-04-01

Diffusion theories for porous media with sorption are reviewed to serve as a basis for considering diffusion in simple systems like sand of crushed rock. A Fickian diffusion and linear sorption model is solved both by analytical Laplance transform and Green's function methods and by numerical methods, and then applied to small-scale experiments for Finnish low- and medium-level operating waste repositories. The main properties of bentonite are reviewed. The hydraulic conductivity of compacted bentonite is so low that the major transport mechanism is diffusion. A Fickian diffusion and linear sorption model is applied to bentonite. The main component of bentonite, montmorillonite, has a high ion-exchange capacity and thus, transport in bentonite consists of interactive chemical and diffusion phenomena. A chemical equilibrium model, CHEQ, is developed for ion-exchange reactions in bentonite water systems. CHEQ is applied to some bentonite experiments with success, especially for monovalent ions. The fitted log-binding constants for sodium exchange with potassium, magnesium, and calcium were 0.27, 1.50, and 2.10, respectively. A coupled chemical and diffusion model, CHEQDIFF, is developed to take account of diffusion in pore water, surface diffusion and ion-exchange reactions. The model is applied to the same experiments as CHEQ, and validation is partly successful. In the diffusion case, the above-mentioned values for binding constants are used. The apparent diffusion (both anions and cations) and surface diffusion (only for cations) constants used are 3.0*10 -11 m 2 /s and 6.0*10 -12 m 2 /s, respectively, but these values are questionable, as experimental results good enough for fitting are not available. (orig.). (74 refs., 27 figs., 12 tabs.)

Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

International Nuclear Information System (INIS)

Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

2014-01-01

We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

Diffusion profiles of fluorine in archaeological bones and teeth

International Nuclear Information System (INIS)

Nelson, P.H.

1984-06-01

Measurements of radial fluorine profiles in bone and teeth sections with a nuclear microprobe show that the distribution is due to diffusion of fluoride ions inward from any exposed surface. Assuming simple diffusion and constant environment, the profile shape depends only on the parameter Dt/a 2 (D=diffusion constant, t=time, a=radius of bone/teeth). Three computer programs have been written to allow visual comparison of data with theoretical diffusion curves. Use of these programs has shown that experimental profiles follow closely the predictions of simple diffusion theory. (Although the diffusion constant may depend on concentration and species to a lesser extent). A preliminary value of D (2.74 +- 0.4) x 10 - 4/ sq. mm/y was deduced from radiocarbon dated Moa bones (age 400-16,200 yr B.P.). Preliminary investigations indicate that the diffusion constant in tooth dentine is approximately the same as in bone. These results indicate that a dating method using the computer programs should be possible for bones ranging in age from a few years to perhaps millions of years and that dating teeth should also be possible

Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

International Nuclear Information System (INIS)

Hou, W C; Hong, Franklin Chau-Nan

2009-01-01

This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

Palladium diffusion into bulk copper via the (100) surface

Energy Technology Data Exchange (ETDEWEB)

Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

2009-08-05

Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

Recursion Formulae for Obtaining Surfaces with Constant Mean Curvature in R2,1

International Nuclear Information System (INIS)

Tian Yongbo; Nan Zhijie; Tian Chou

2007-01-01

Though the Baecklund transformation on time-like surfaces with constant mean curvature surfaces in R 2,1 has been obtained, it is not easy to obtain corresponding surfaces because the procedure of solving the related integrable system cannot be avoided when the Baecklund transformation is used. For sake of this, in this article, some special work is done to reform the Baecklund transformation to a recursion formula, by which we can construct time-like surfaces with constant mean curvature form known ones just by quadrature procedure.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

Energy Technology Data Exchange (ETDEWEB)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

2016-08-15

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

Science.gov (United States)

Naderi, Ebadollah; Ghaisas, S. V.

2016-08-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

International Nuclear Information System (INIS)

Naderi, Ebadollah; Ghaisas, S. V.

2016-01-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

Diffusion of particles adsorbed on reconstructive surface

Czech Academy of Sciences Publication Activity Database

Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

2005-01-01

Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

Velocity auto-correlation and hot-electron diffusion constant in GaAs and InP

International Nuclear Information System (INIS)

Deb Roy, M.

1982-01-01

Auto-correlation functions of the fluctuations in the electron velocities transverse and parallel to the applied electric field are calculated by the Monte Carlo method for GaAs and InP at three different values of field strength which are around three times the threshold field for negative differential mobility in each case. From these the frequency-dependent diffusion coefficients transverse and parallel to the applied field and the figure of merit for noise performance when used in a microwave amplifying device are determined. The results indicate that the transverse auto-correlation function Csub(t)(s) falls nearly exponentially to zero with increasing interval s while the parallel function Csub(p)(s) falls sharply, attains a minimum and then rises towards zero. In each case a higher field gives a higher rate of fall and makes the correlation functions zero within a shorter interval. The transverses diffusion coefficient falls monotonically with the frequency but the parallel diffusion coefficient generally starts with a low value at low frequencies, rises to a maximum and then falls. InP, with a larger separation between the central and the satellite valleys, has a higher value of the low frequency transverse diffusion coefficient and a lower value of its parallel counterpart. The noise performance of microwave semiconductor amplifying devices depends mainly on the low frequency parallel diffusion constant and consequently devices made out of materials like InP with a large separation between valleys are likely to have better noise characteristics. (orig.)

Semiconductor surface diffusion: Nonthermal effects of photon illumination

International Nuclear Information System (INIS)

Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

2000-01-01

Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

Science.gov (United States)

Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

2017-06-01

Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1988-09-01

The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

Atomic diffusion in laser surface modified AISI H13 steel

Science.gov (United States)

Aqida, S. N.; Brabazon, D.; Naher, S.

2013-07-01

This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

Physical interpretation and geometrical representation of constant curvature surfaces in Euclidean and pseudo-Euclidean spaces

International Nuclear Information System (INIS)

Catoni, Francesco; Cannata, Roberto; Zampetti, Paolo

2005-08-01

The Riemann and Lorentz constant curvature surfaces are investigated from an Euclidean point of view. The four surfaces (constant positive and constant negative curvatures with definite and non-definite fine elements) are represented as surfaces in a Riemannian or in a particular semi-Riemannian flat space and it is shown that the complex and the hyperbolic numbers allow to obtain the same equations for the corresponding Riemann and Lorentz surfaces, respectively. Moreover it is shown that the geodesics on the Lorentz surfaces states, from a physical point of view, a link between curvature and fields. This result is obtained just as a consequence of the space-time geometrical symmetry, without invoking the famous Einstein general relativity postulate [it

Hydrogen Diffusion and H{sub 2}S Corrosion in Steel

Energy Technology Data Exchange (ETDEWEB)

Haugstveit, Bjarte Erlend

2001-01-01

The electrochemical permeation technique introduced by Devanathan and Stachurski has been used to measure the effective diffusivity of hydrogen in steel in a H{sub 2}S-saturated aqueous environment. The linear polarization resistance (LPR) method has been used to measure the corrosion rate. The effective diffusion coefficient of hydrogen has been found to be in the range of 1*10-12 to 7*10-11, depending on the environmental conditions. The corrosion film was identified as mackinawite, and it affected the permeation process of hydrogen. The results supported the assumption that the diffusion process can be described by a three layer model and indicated that the model could be reduced to a two layer model in the cases of iron and steel. A model aimed to describe the reaction pathway of hydrogen through the surface film and into the steel is proposed. The corrosion film influenced the corrosion rate, and it was least protective against corrosion at pH 6.5. Corrosion rates were in the range of 0.2-1 mm/year. The corrosion rate was increased significantly at pH 3.5, but the effect of the surface film was stronger and overshadowed the pH effect at the higher pH values. Increased flow velocity also lead to increased corrosion rate, but this effect was less significant compared to the effect of pH and the surface film. DEG decreased the corrosion rate. The uncertainty in the diffusion measurements was mainly due to the assumption of a constant sub-surface concentration of atomic hydrogen, which was not fulfilled. A method less dependent on constant surface conditions would probably yield better estimates of the effective diffusivity. The uncertainty in the corrosion measurements was mainly due to the uncertainty in the value of the Stern-Geary constant. The qualitative assumptions based on the results in this thesis are assumed to be valid. A test section designed for this thesis was tested and was found successful in corrosion rate measurements, but proved to be

Bulk-mediated surface diffusion: non-Markovian desorption dynamics

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

2005-01-01

Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

Energy Technology Data Exchange (ETDEWEB)

Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

1988-03-31

In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

Diffusion of N adatoms on the Fe(100) surface

DEFF Research Database (Denmark)

Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

2000-01-01

The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

International Nuclear Information System (INIS)

Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

2016-01-01

Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

Diffusion in one dimensional random medium and hyperbolic Brownian motion

International Nuclear Information System (INIS)

Comtet, A.; Monthus, C.; Paris-6 Univ., 75

1995-03-01

Classical diffusion in a random medium involves an exponential functional of Brownian motion. This functional also appears in the study of Brownian diffusion on a Riemann surface of constant negative curvature. This relationship is analyzed in detail and various distributions are studied using stochastic calculus and functional integration. (author) 17 refs

The concept of mass angular scattering power and its relation to the diffusion constant

Energy Technology Data Exchange (ETDEWEB)

Sandison, George A.; Papiez, Lech S. [School of Health Sciences, Purdue University, West Lafayette, IN (United States)

1998-09-01

An understanding of the scattering of high energy charged particle beams by tissue is required in radiotherapy since the particle trajectories determine the pattern of radiation dose deposition in patients. Numerical calculations of radiation dose often utilize energy dependent values of the angular scattering power. However, the physics literature is replete with confused interpretations of the concept of angular scattering power and its relation to the single scattering cross section for the medium or the diffusion constant in the diffusional limit. The purpose of this article is to clarify these notions.

Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

Science.gov (United States)

Lee, Myoung-Jae; Jung, Young-Dae

2017-02-01

The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

Cholesterol enhances surface water diffusion of phospholipid bilayers

Energy Technology Data Exchange (ETDEWEB)

Cheng, Chi-Yuan; Kausik, Ravinath; Han, Songi, E-mail: songi@chem.ucsb.edu [Department of Chemistry and Biochemistry and Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Olijve, Luuk L. C. [Laboratory of Macromolecular and Organic Chemistry and Institute for Complex Molecular Systems, Eindhoven University of Technology, P.O. Box 513, 5600 MB, Eindhoven (Netherlands)

2014-12-14

Elucidating the physical effect of cholesterol (Chol) on biological membranes is necessary towards rationalizing their structural and functional role in cell membranes. One of the debated questions is the role of hydration water in Chol-embedding lipid membranes, for which only little direct experimental data are available. Here, we study the hydration dynamics in a series of Chol-rich and depleted bilayer systems using an approach termed {sup 1}H Overhauser dynamic nuclear polarization (ODNP) NMR relaxometry that enables the sensitive and selective determination of water diffusion within 5–10 Å of a nitroxide-based spin label, positioned off the surface of the polar headgroups or within the nonpolar core of lipid membranes. The Chol-rich membrane systems were prepared from mixtures of Chol, dipalmitoyl phosphatidylcholine and/or dioctadecyl phosphatidylcholine lipid that are known to form liquid-ordered, raft-like, domains. Our data reveal that the translational diffusion of local water on the surface and within the hydrocarbon volume of the bilayer is significantly altered, but in opposite directions: accelerated on the membrane surface and dramatically slowed in the bilayer interior with increasing Chol content. Electron paramagnetic resonance (EPR) lineshape analysis shows looser packing of lipid headgroups and concurrently tighter packing in the bilayer core with increasing Chol content, with the effects peaking at lipid compositions reported to form lipid rafts. The complementary capability of ODNP and EPR to site-specifically probe the hydration dynamics and lipid ordering in lipid membrane systems extends the current understanding of how Chol may regulate biological processes. One possible role of Chol is the facilitation of interactions between biological constituents and the lipid membrane through the weakening or disruption of strong hydrogen-bond networks of the surface hydration layers that otherwise exert stronger repulsive forces, as reflected in

A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

International Nuclear Information System (INIS)

Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

2016-01-01

The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

Modeling of Solar Radiation Management: A Comparison of Simulations Using Reduced Solar Constant and Stratospheric Sulphate Aerosols

Science.gov (United States)

Bala, G.; Kalidindi, S.; Modak, A.; Caldeira, K.

2014-12-01

Several climate modelling studies in the past have used reduction in solar constant to simulate the climatic effects of Solar Radiation Management (SRM) geoengineering. This is most likely valid only for space-based mirrors/reflectors but not for SRM methods that rely on stratospheric aerosols. In this study, we use a climate model to evaluate the differences in climate response to SRM by uniform solar constant reduction and stratospheric aerosols. The experiments are designed such that global mean warming from a doubling of atmospheric CO2 concentration (2xCO2) is nearly cancelled in each case. In such a scenario, the residual climate effects are similar when important surface and tropospheric climate variables such as temperature and precipitation are considered. However, there are significant differences in stratospheric temperature response and diffuse and direct radiation reaching the surface. A difference of 1K in the global mean stratospheric (61-9.8 hPa) temperature is simulated between the two SRM methods, with warming in the aerosol scheme and a slight cooling for sunshades. While the global mean surface diffuse radiation increases by ~23% and direct radiation decreases by about 9% in the case of aerosol SRM method, both direct and diffuse radiation decrease by similar fractional amounts (~1.0%) when solar constant is reduced. When CO2 fertilization effects from elevated CO2 concentration levels are removed, the contribution from shaded leaves to gross primary productivity (GPP) increases by 1.8 % in aerosol SRM because of increased diffuse light. However, this increase is almost offset by a 15.2% decline in sunlit contribution due to reduced direct light. Overall both the SRM simulations show similar decrease in GPP (~ 8%) and NPP (~3%) relative to 2xCO2, indicating the negligible effect of the fractional changes in direct/diffuse radiation on the overall plant productivity. Based on our modelling study, we conclude that the climate states produced by a

Thermal diffusion (1963); Diffusion thermique (1963)

Energy Technology Data Exchange (ETDEWEB)

Lemarechal, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1963-07-01

This report brings together the essential principles of thermal diffusion in the liquid and gaseous phases. The macroscopic and molecular aspects of the thermal diffusion constant are reviewed, as well as the various measurement method; the most important developments however concern the operation of the CLUSIUS and DICKEL thermo-gravitational column and its applications. (author) [French] Ce rapport rassemble les principes essentiels de la diffusion thermique en phase liquide et en phase gazeuse. Les aspects macroscopique et moleculaire de la constante de diffusion thermique sont passes en revue ainsi que ses differentes methodes de mesure; mais les developpements les plus importants concernent le fonctionnement de ls colonne thermogravitationnelle de CLUSIUS et DICKEL et ses applications. (auteur)

Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

Science.gov (United States)

Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

2017-07-01

Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

Classification Order of Surface-Confined Intermixing at Epitaxial Interface

Science.gov (United States)

Michailov, M.

The self-organization phenomena at epitaxial interface hold special attention in contemporary material science. Being relevant to the fundamental physical problem of competing, long-range and short-range atomic interactions in systems with reduced dimensionality, these phenomena have found exacting academic interest. They are also of great technological importance for their ability to bring spontaneous formation of regular nanoscale surface patterns and superlattices with exotic properties. The basic phenomenon involved in this process is surface diffusion. That is the motivation behind the present study which deals with important details of diffusion scenarios that control the fine atomic structure of epitaxial interface. Consisting surface imperfections (terraces, steps, kinks, and vacancies), the interface offers variety of barriers for surface diffusion. Therefore, the adatoms and clusters need a certain critical energy to overcome the corresponding diffusion barriers. In the most general case the critical energies can be attained by variation of the system temperature. Hence, their values define temperature limits of system energy gaps associated with different diffusion scenarios. This systematization imply classification order of surface alloying: blocked, incomplete, and complete. On that background, two diffusion problems, related to the atomic-scale surface morphology, will be discussed. The first problem deals with diffusion of atomic clusters on atomically smooth interface. On flat domains, far from terraces and steps, we analyzed the impact of size, shape, and cluster/substrate lattice misfit on the diffusion behavior of atomic clusters (islands). We found that the lattice constant of small clusters depends on the number N of building atoms at 1 < N ≤ 10. In heteroepitaxy, this effect of variable lattice constant originates from the enhanced charge transfer and the strong influence of the surface potential on cluster atomic arrangement. At constant

Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

Science.gov (United States)

Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

2017-05-17

A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

Science.gov (United States)

Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

2014-05-01

Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

Nuclear surface diffuseness revealed in nucleon-nucleus diffraction

Science.gov (United States)

Hatakeyama, S.; Horiuchi, W.; Kohama, A.

2018-05-01

The nuclear surface provides useful information on nuclear radius, nuclear structure, as well as properties of nuclear matter. We discuss the relationship between the nuclear surface diffuseness and elastic scattering differential cross section at the first diffraction peak of high-energy nucleon-nucleus scattering as an efficient tool in order to extract the nuclear surface information from limited experimental data involving short-lived unstable nuclei. The high-energy reaction is described by a reliable microscopic reaction theory, the Glauber model. Extending the idea of the black sphere model, we find one-to-one correspondence between the nuclear bulk structure information and proton-nucleus elastic scattering diffraction peak. This implies that we can extract both the nuclear radius and diffuseness simultaneously, using the position of the first diffraction peak and its magnitude of the elastic scattering differential cross section. We confirm the reliability of this approach by using realistic density distributions obtained by a mean-field model.

Heat Diffusion in Gases, Including Effects of Chemical Reaction

Science.gov (United States)

Hansen, C. Frederick

1960-01-01

The diffusion of heat through gases is treated where the coefficients of thermal conductivity and diffusivity are functions of temperature. The diffusivity is taken proportional to the integral of thermal conductivity, where the gas is ideal, and is considered constant over the temperature interval in which a chemical reaction occurs. The heat diffusion equation is then solved numerically for a semi-infinite gas medium with constant initial and boundary conditions. These solutions are in a dimensionless form applicable to gases in general, and they are used, along with measured shock velocity and heat flux through a shock reflecting surface, to evaluate the integral of thermal conductivity for air up to 5000 degrees Kelvin. This integral has the properties of a heat flux potential and replaces temperature as the dependent variable for problems of heat diffusion in media with variable coefficients. Examples are given in which the heat flux at the stagnation region of blunt hypersonic bodies is expressed in terms of this potential.

Surface electrical resistivity of insulators

International Nuclear Information System (INIS)

Senn, B. C.; Liesegang, J.

1996-01-01

A method is presented here for measuring surface charge decay, and theory has been developed so as to produce determinations of resistivity in the surface region of insulator films or wafers. This method incorporates the use of a coaxial cylindrical capacitor arrangement and an electrometer interfaced to a PC. The charge transport theory given here is based on Mott-Gurney diffusion, and allows easy interpretation of the experimental data, especially for the initial phase of surface charge decay. Resistivity measurements are presented for glass, mica, perspex and polyethylene, covering a range of 10 9 to 10 18 Ωm, as an illustration of the useful range of the instrument for static and antistatic materials, particularly in film or sheet form. Values for the surface charge diffusion constants of the materials are also presented. The charge transport theory has also been extended to allow the experimental and computational theoretical comparison of surface charge decay not only over the initial phase of charge decay, but also over longer times. The theoretical predictions show excellent agreement with experiment using the values for the diffusion constants referred to above

Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

Science.gov (United States)

Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

The motion of a vortex on a closed surface of constant negative curvature.

Science.gov (United States)

Ragazzo, C Grotta

2017-10-01

The purpose of this work is to present an algorithm to determine the motion of a single hydrodynamic vortex on a closed surface of constant curvature and of genus greater than one. The algorithm is based on a relation between the Laplace-Beltrami Green function and the heat kernel. The algorithm is used to compute the motion of a vortex on the Bolza surface. This is the first determination of the orbits of a vortex on a closed surface of genus greater than one. The numerical results show that all the 46 vortex equilibria can be explicitly computed using the symmetries of the Bolza surface. Some of these equilibria allow for the construction of the first two examples of infinite vortex crystals on the hyperbolic disc. The following theorem is proved: 'a Weierstrass point of a hyperellitic surface of constant curvature is always a vortex equilibrium'.

Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

Science.gov (United States)

Chu, Khim Hoong

2017-11-09

Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

Surface acoustic waves and elastic constants of InN epilayers determined by Brillouin scattering

Energy Technology Data Exchange (ETDEWEB)

Jimenez-Rioboo, R.J.; Prieto, C. [Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, Madrid (Spain); Cusco, R.; Domenech-Amador, N.; Artus, L. [Institut Jaume Almera, Consell Superior d' Investigacions Cientifiques (CSIC), Lluis Sole i Sabaris s.n., Barcelona, Catalonia (Spain); Yamaguchi, T.; Nanishi, Y. [Faculty of Science and Engineering, Ritsumeikan University, Noji-Higashi, Kusatsu, Shiga (Japan)

2012-06-15

The surface acoustic wave velocity in InN has been experimentally determined by means of Brillouin scattering experiments on c - and m -face epilayers. From simulations based on the Green's function formalism we determine the shear elastic constants c{sub 66} and c{sub 44} and propose a complete set of elastic constants for wurtzite InN. The analysis of the sagittal and azimuthal dependence of the surface acoustic wave velocity indicates a slightly different elastic behavior of the m -face sample that basically affects the c{sub 44} elastic constant. (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

International Nuclear Information System (INIS)

Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

2007-01-01

Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

Science.gov (United States)

Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

2004-07-05

Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

Jump rates for surface diffusion of large molecules from first principles

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2015-04-21

We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

DEFF Research Database (Denmark)

Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

2017-01-01

Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

International Nuclear Information System (INIS)

Ionescu, M.

1977-01-01

An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

Science.gov (United States)

Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

2015-05-21

Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

Surface transport mechanisms in molecular glasses probed by the exposure of nano-particles

Science.gov (United States)

Ruan, Shigang; Musumeci, Daniele; Zhang, Wei; Gujral, Ankit; Ediger, M. D.; Yu, Lian

2017-05-01

For a glass-forming liquid, the mechanism by which its surface contour evolves can change from bulk viscous flow at high temperatures to surface diffusion at low temperatures. We show that this mechanistic change can be conveniently detected by the exposure of nano-particles native in the material. Despite its high chemical purity, the often-studied molecular glass indomethacin contains low-concentration particles approximately 100 nm in size and 0.3% in volume fraction. Similar particles are present in polystyrene, another often-used model. In the surface-diffusion regime, particles are gradually exposed in regions vacated by host molecules, for example, the peak of a surface grating and the depletion zone near a surface crystal. In the viscous-flow regime, particle exposure is not observed. The surface contour around an exposed particle widens over time in a self-similar manner as 3 (Bt)1/4, where B is a surface mobility constant and the same constant obtained by surface grating decay. This work suggests that in a binary system composed of slow- and fast-diffusing molecules, slow-diffusing molecules can be stranded in surface regions vacated by fast-diffusing molecules, effectively leading to phase separation.

Coupling between diffusion and orientation of pentacene molecules on an organic surface.

Science.gov (United States)

Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

2016-04-01

The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

Investigation of ion diffusion towards plasmonic surfaces

International Nuclear Information System (INIS)

Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

2013-01-01

Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

On the diffusion and self-trapping of surface dimers

Science.gov (United States)

Kappus, W.

1982-03-01

The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

Energy Technology Data Exchange (ETDEWEB)

Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

1996-11-01

The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

Singularities of spacelike constant mean curvature surfaces in Lorentz-Minkowski space

DEFF Research Database (Denmark)

Brander, David

2011-01-01

We study singularities of spacelike, constant (non-zero) mean curvature (CMC) surfaces in the Lorentz-Minkowski 3-space L-3. We show how to solve the singular Bjorling problem for such surfaces, which is stated as follows: given a real analytic null-curve f(0)(x), and a real analytic null vector...... field v(x) parallel to the tangent field of f(0), find a conformally parameterized (generalized) CMC H surface in L-3 which contains this curve as a singular set and such that the partial derivatives f(x) and f(y) are given by df(0)/dx and v along the curve. Within the class of generalized surfaces...

Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

DEFF Research Database (Denmark)

Hjelt, T.; Vattulainen, Ilpo Tapio

2000-01-01

stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

Convergence of surface diffusion parameters with model crystal size

Science.gov (United States)

Cohen, Jennifer M.; Voter, Arthur F.

1994-07-01

A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

Diffusion of particles on a fluctuating surface

Czech Academy of Sciences Publication Activity Database

Tarasenko, Alexander; Jastrabík, Lubomír

2011-01-01

Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

Collisional diffusion in a torus with imperfect magnetic surfaces

International Nuclear Information System (INIS)

White, R.B.

1983-03-01

A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

On the integrability of the generalized Fisher-type nonlinear diffusion equations

International Nuclear Information System (INIS)

Wang Dengshan; Zhang Zhifei

2009-01-01

In this paper, the geometric integrability and Lax integrability of the generalized Fisher-type nonlinear diffusion equations with modified diffusion in (1+1) and (2+1) dimensions are studied by the pseudo-spherical surface geometry method and prolongation technique. It is shown that the (1+1)-dimensional Fisher-type nonlinear diffusion equation is geometrically integrable in the sense of describing a pseudo-spherical surface of constant curvature -1 only for m = 2, and the generalized Fisher-type nonlinear diffusion equations in (1+1) and (2+1) dimensions are Lax integrable only for m = 2. This paper extends the results in Bindu et al 2001 (J. Phys. A: Math. Gen. 34 L689) and further provides the integrability information of (1+1)- and (2+1)-dimensional Fisher-type nonlinear diffusion equations for m = 2

Plateau diffusion coefficient for arbitrary flux surface geometry

International Nuclear Information System (INIS)

Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

1981-03-01

A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

A new approach to the problem of bulk-mediated surface diffusion.

Science.gov (United States)

Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

2015-08-28

This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

Morphometric partitioning of the respiratory surface area and diffusion capacity of the gills and swim bladder in juvenile Amazonian air-breathing fish, Arapaima gigas.

Science.gov (United States)

Fernandes, Marisa Narciso; da Cruz, André Luis; da Costa, Oscar Tadeu Ferreira; Perry, Steven Franklin

2012-09-01

The gills and the respiratory swim bladders of juvenile specimens (mean body mass 100g) of the basal teleost Arapaima gigas (Cuvier 1829) were evaluated using stereological methods in vertical sections. The surface areas, harmonic mean barrier thicknesses and morphometric diffusing capacities for oxygen and carbon dioxide were estimated. The average respiratory surface area of the swim bladder (2173 cm² kg⁻¹) exceeded that of the gills (780 cm² kg⁻¹) by a factor of 2.79. Due to the extremely thin air-blood barrier in the swim bladder (harmonic mean 0.22 μm) and the much thicker water-blood barrier of the gills (9.61 μm), the morphometric diffusing capacity for oxygen and carbon dioxide was 88 times greater in the swim bladder than in the gills. These data clearly indicate the importance of the swim bladder, even in juvenile A. gigas that still engage in aquatic respiration. Because of the much greater diffusion constant of CO₂ than O₂ in water, the gills also remain important for CO₂ release. Copyright © 2012 Elsevier Ltd. All rights reserved.

Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Tang Jianfeng

2011-01-01

The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

A systematic method for correlating measurements of channel powers with the lattice constants in the neutron diffusion equations

International Nuclear Information System (INIS)

Buckler, A.N.

1978-10-01

The report describes the theoretical basis of the methods that have been developed for correlating measurements of spatially distributed quantities taken on the reactor with the lattice constants in the diffusion equations. The method can be used with any thermal reactor system of current interest, but the first application is to provide a replacement for the SAMSON code for Winfrith SGHW studies, where the measurements of interest are channel powers. (author)

The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

Science.gov (United States)

M. C. Sagis, Leonard

2001-03-01

In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

Dimer-flipping-assisted diffusion on a Si(001) surface

International Nuclear Information System (INIS)

Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

2000-01-01

The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

Transient diffusion from a waste solid into fractured porous rock

International Nuclear Information System (INIS)

Ahn, J.; Chambre, P.L.; Pigford, T.H.

1988-01-01

Previous analytical studies of the advective transport of dissolved contaminants through fractured rock have emphasized the effect of molecular diffusion in the rock matrix in affecting the space-time-dependent concentration of the contaminant as it moves along the fracture. Matrix diffusion only in the direction normal to the fracture surface was assumed. Contaminant sources were constant-concentration surfaces of width equal to the fracture aperture and of finite or infinite extent in the transverse direction. Such studies illustrate the far-field transport features of fractured media. To predict the time-dependent mass transfer from a long waste cylinder surrounded by porous rock and intersected by a fracture, the present study includes diffusion from the waste surface directly into porous rock, as well as the more realistic geometry. Here the authors present numerical results from Chambre's analytical solution for the time-dependent mass transfer from the cylinder for the low-flow conditions wherein near-field mass transfer is expected to be controlled by molecular diffusion

Failure Assessment for the High-Strength Pipelines with Constant-Depth Circumferential Surface Cracks

Directory of Open Access Journals (Sweden)

X. Liu

2018-01-01

Full Text Available In the oil and gas transportation system over long distance, application of high-strength pipeline steels can efficiently reduce construction and operation cost by increasing operational pressure and reducing the pipe wall thickness. Failure assessment is an important issue in the design, construction, and maintenance of the pipelines. The small circumferential surface cracks with constant depth in the welded pipelines are of practical interest. This work provides an engineering estimation procedure based upon the GE/EPRI method to determine the J-integral for the thin-walled pipelines with small constant-depth circumferential surface cracks subject to tension and bending loads. The values of elastic influence functions for stress intensity factor and plastic influence functions for fully plastic J-integral estimation are derived in tabulated forms through a series of three-dimensional finite element calculations for different crack geometries and material properties. To check confidence of the J-estimation solution in practical application, J-integral values obtained from detailed finite element (FE analyses are compared with those estimated from the new influence functions. Excellent agreement of FE results with the proposed J-estimation solutions for both tension and bending loads indicates that the new solutions can be applied for accurate structural integrity assessment of high-strength pipelines with constant-depth circumferential surface cracks.

On the sensitivity of mesoscale models to surface-layer parameterization constants

Science.gov (United States)

Garratt, J. R.; Pielke, R. A.

1989-09-01

The Colorado State University standard mesoscale model is used to evaluate the sensitivity of one-dimensional (1D) and two-dimensional (2D) fields to differences in surface-layer parameterization “constants”. Such differences reflect the range in the published values of the von Karman constant, Monin-Obukhov stability functions and the temperature roughness length at the surface. The sensitivity of 1D boundary-layer structure, and 2D sea-breeze intensity, is generally less than that found in published comparisons related to turbulence closure schemes generally.

Nitrogen diffusion in near-surface range of ion doped molybdenum

CERN Document Server

Zamalin, E Y

2001-01-01

The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

KAUST Repository

Chroneos, Alexander I.

2012-01-26

In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Flowing afterglow: construction of an apparatus, measurement of rate constants, and consideration of the diffusive behavior of charges

International Nuclear Information System (INIS)

Matsuoka, Shingo; Nakamura, Hirone; Tamura, Takaaki; Fujii, Toshihiro.

1984-01-01

A flowing afterglow apparatus was constructed and the operation of the afterglow system including data analysis was tested by measuring the rate constants for the reactions N + + NO, N 2 + + NO, He + + N 2 , and SF 6 + e; the results were 5.8 x 10 -10 , 3.9 x 10 -10 , 1.20 x 10 -9 , and 2.1 x 10 -7 cm 3 s -1 respectively. In the measurements an extraction voltage for ion sampling was not applied to the nose cone in order not to introduce an electric field into the reaction region. A ''non-ambipolar'' model developed by us was used for the data analysis of the ion/molecule reactions. For the data analysis of the electron attachment, a typical curve fit mehtod to the product ion signal was used. However, no theoretical curves fit the experimental points. This disagreement is attributed to a change of the ion-sampling efficiency through the nose-cone aperture arising from a change of the electron-dominated plasma to a negative-ion-dominated plasma with an increasing flow rate of SF 6 . Nevertheless, the attachment rate could be determined by fitting the theoretical and experimantal curves in the limited region of the SF 6 flow rate where the negative-ion-dominated plasma is established at the sampling aperture. All the rate constants obtained here agree reasonably well with literature values. Next, errors in the positive ion/molecule reaction rate constants, which would occur if the diffusion coefficients of the ions and neutrals each have a + 10 % error were calculated for the flow model to be -0.4 and +1.2 % respectively, demonstrating that these parameters are not important in the analysis of data. This insensitivity explains why the nose-cone voltage applied in a typical flowing afterglow operation has not caused a significant error in the published rate constants although it disturbs the ion diffusive behavior. (author)

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

OpenAIRE

Li, Xiaofan; Nie, Qing

2009-01-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

Transient enhanced diffusion in preamorphized silicon: the role of the surface

Science.gov (United States)

Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

1999-01-01

Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

Diffusion of zinc into an unpassivated surface of indium phosphide

International Nuclear Information System (INIS)

Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

1989-01-01

Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

Surface Casimir densities and induced cosmological constant in higher dimensional braneworlds

International Nuclear Information System (INIS)

Saharian, Aram A.

2006-01-01

We investigate the vacuum expectation value of the surface energy-momentum tensor for a massive scalar field with general curvature coupling parameter obeying the Robin boundary conditions on two codimension one parallel branes in a (D+1)-dimensional background spacetime AdS D 1 +1 xΣ with a warped internal space Σ. These vacuum densities correspond to a gravitational source of the cosmological constant type for both subspaces of the branes. Using the generalized zeta function technique in combination with contour integral representations, the surface energies on the branes are presented in the form of the sum of single-brane and second-brane-induced parts. For the geometry of a single brane both regions, on the left and on the right of the brane, are considered. At the physical point the corresponding zeta functions contain pole and finite contributions. For an infinitely thin brane taking these regions together, in odd spatial dimensions the pole parts cancel and the total zeta function is finite. The renormalization procedure for the surface energies and the structure of the corresponding counterterms are discussed. The parts in the surface densities generated by the presence of the second brane are finite for all nonzero values of the interbrane separation and are investigated in various asymptotic regions of the parameters. In particular, it is shown that for large distances between the branes the induced surface densities give rise to an exponentially suppressed cosmological constant on the brane. The total energy of the vacuum including the bulk and boundary contributions is evaluated by the zeta function technique and the energy balance between separate parts is discussed

Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

DEFF Research Database (Denmark)

Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

2009-01-01

form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

Directory of Open Access Journals (Sweden)

Szajnar J.

2014-10-01

Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

KAUST Repository

Kailasanathan, Ranjith Kumar Abhinavam

2014-05-20

Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both temperature and soot measurements presented are line-of-sight averages. The results aid in understanding the kinetic and thermodynamic behavior of the soot formation and oxidation chemistry with changes in diluents, ultimately leading to possible methods of reducing soot emission from practical combustion hardware. The diluted fuel and coflow exit velocities (top-hat profiles) were matched at all pressures to minimize shear effects. In addition to the velocity-matched flow rates, the mass fluxes were held constant for all pressures. Addition of a diluent has a pronounced effect on both the soot surface temperature and volume fraction, with the helium diluted flame yielding the maximum and carbon dioxide diluted flame yielding minimum soot surface temperature and volume fraction. At low pressures, peak soot volume fraction exists at the tip of the flame, and with an increase in pressure, the location shifts lower to the wings of the flame. Due to the very high diffusivity of helium, significantly higher temperature and volume fraction are measured and explained. Carbon dioxide has the most dramatic soot suppression effect. By comparing the soot yield with previously measured soot precursor concentrations in the same flame, it is clear that the lower soot yield is a result of enhanced oxidation rates rather than a reduction in precursor formation. Copyright © 2014 Taylor & Francis Group, LLC.

From State Dependent Diffusion to Constant Diffusion in Stochastic Differential Equations by the Lamperti Transform

DEFF Research Database (Denmark)

Møller, Jan Kloppenborg; Madsen, Henrik

the Lamperti transform. This note gives an example driven introduction to the Lamperti transform. The general applicability of the Lamperti transform is limited to univariate diffusion processes, but for a restricted class of multivariate diffusion processes Lamperti type transformations are available...

Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

Science.gov (United States)

Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

2018-02-01

Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

Dynamics of an optically confined nanoparticle diffusing normal to a surface.

Science.gov (United States)

Schein, Perry; O'Dell, Dakota; Erickson, David

2016-06-01

Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

Energy Technology Data Exchange (ETDEWEB)

Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

2016-05-15

Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

Rate of riboflavin diffusion from intrastromal channels before corneal crosslinking.

Science.gov (United States)

McQuaid, Rebecca; Mrochen, Michael; Vohnsen, Brian

2016-03-01

To determine the diffusion of riboflavin from intrastromal channels through the effective diffusion coefficients compared with traditional axial diffusion with epithelium on or off. Advanced Optical Imaging Laboratory, University College Dublin, and Wellington Eye Clinic, Sandyford, Dublin, Ireland. Experimental study. The rate of diffusion in whole-mounted porcine eyes was monitored for a 30 minutes using an optical setup with a charge-coupled device camera and a bandpass filter (central wavelength 550 nm and 40 nm bandpass) to image the fluorescence under ultraviolet illumination (365 nm wavelength). For comparison, an isotropic corneal stroma with an annular channel was modeled numerically for different diffusion constants and boundary conditions. Numerical and experimental results were compared, allowing determination of the effective diffusion coefficient for each case. Experimental results for 6 different riboflavin solutions were in all cases found to be higher than for the common crosslinking (CXL) riboflavin protocol, where the diffusion constant is D0 = 6.5 × 10(-5) mm(2)/sec. For the intrastromal channel, 2 isotonic solutions containing riboflavin 0.1% correlated with a diffusion constant of 5D0 = 32.5 × 10(-5) mm(2)/sec. Hypotonic solutions and transepithelium had a higher diffusion coefficient approaching 10D0 = 65.0 × 10(-5) mm(2)/sec, which is an order-of-magnitude increase compared with the typical diffusion coefficient found in standard CXL. In this study, riboflavin had a faster stromal diffusion when injected into a corneal channel than when applied as drops to the anterior corneal surface. Further numerical modeling might allow optimization of the channel structure for any specific choice of riboflavin. Copyright © 2016 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

Determination of diffuse double layer protonation constants for hydrous ferric oxide (HFO): supporting evidence for the Dzombak and Morel compilation

CSIR Research Space (South Africa)

Pretorius, PJ

1998-01-01

Full Text Available of the experimental system suggests that titration points below pH 4 should not be used for the determination of protonation constants because of potential HFO dissolution. Surface protonation constant, PZC and binding site estimates agree excellently with currently...

Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

International Nuclear Information System (INIS)

Ferrieri, R.A.; Wolf, A.P.

1984-01-01

A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

Diffusional falsification of kinetic constants on Lineweaver-Burk plots.

Science.gov (United States)

Ghim, Y S; Chang, H N

1983-11-07

The effect of mass transfer resistances on the Lineweaver-Burk plots in immobilized enzyme systems has been investigated numerically and with analytical approximate solutions. While Hamilton, Gardner & Colton (1974) studied the effect of internal diffusion resistances in planar geometry, our study was extended to the combined effect of internal and external diffusion in cylindrical and spherical geometries as well. The variation of Lineweaver-Burk plots with respect to the geometries was minimized by modifying the Thiele modulus and the Biot number with the shape factor. Especially for a small Biot number all the three Lineweaver-Burk plots fell on a single line. As was discussed by Hamilton et al. (1974), the curvature of the line for large external diffusion resistances was small enough to be assumed linear, which was confirmed from the two approximate solutions for large and small substrate concentrations. Two methods for obtaining intrinsic kinetic constants were proposed: First, we obtained both maximum reaction rate and Michaelis constant by fitting experimental data to a straight line where external diffusion resistance was relatively large, and second, we obtained Michaelis constant from apparent Michaelis constant from the figure in case we knew maximum reaction rate a priori.

Understanding the apparent diffusivity of Sr-85 ion for MX-80 in different salinity condition at low dry density

International Nuclear Information System (INIS)

Ahmad Hasnulhadi Che Kamaruddin

2012-01-01

The apparent diffusivity of strontium-85 in the compacted MX-80 bentonite under different salinity conditions and dry densities was conducted were studied from the viewpoint of activation energy. Through in-diffusions experiments the effect of salinity on diffusion behavior of Sr-85 ions can also can be explained. As we know, Sr-90 is by product of the fission materials of nuclear wastes and should be manage properly. Sr-85 is radioactive isotope with the same chemical properties of Sr-90. Adsorption affects only non-steady-state diffusion while at the steady state (e.g., a constant concentration gradient between a constant source and a constant sink), there is no net uptake or release by adsorption, so adsorption has no effect on diffusion (Drever, James I., 1997). The changes in the basal spacing of bentonite as a function of salinity are needed to be observed by the X-ray diffraction method to understand the microstructure changes in diffusion pathways for Sr-85 in MX-80 bentonite. As we know, there could be three potential pathways for radionuclide diffusion in solution-saturated, compacted montmorillonite, i.e., pore water, external surfaces and the internal surface (interlayer spaces) of montmorillonite aggregates (Kozaki et al., 2008). So, it is important to understand the diffusion processes in term of apparent diffusivity of Sr-85 ions in different salinity concentration at low dry density of MX-80. Several parameters are needed in explaining the process such as dry density, activation energy, temperature dependence and concentration of the salinity solutions. (author)

The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

DEFF Research Database (Denmark)

Mejlbro, Leif

1996-01-01

Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

Science.gov (United States)

Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

2018-02-01

The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

Diffusion of interstitial atoms in FCC metals after irradiation with 2 MeV electrons

International Nuclear Information System (INIS)

Kornmann, H.

1980-01-01

Selfdiffusion in nickel after electron irradiation has been restudied. The diffusion velocity near the surface and the diffusion constant in the interior of the crystal have been determined as a function of radiation flux and temperature. A special method for the measurement of diffusion has been improved, which is based on radioactive tracer atoms for indication and on ion etching for the removal of thin films. To improve additionally the accuracy of the technique tracer atoms are induced into the crystal by thermal diffusion and then irradiated with 2 MeV electrons. (orig./GSCH) [de

Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

Directory of Open Access Journals (Sweden)

María I. Vázquez

2015-12-01

Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

Energy Technology Data Exchange (ETDEWEB)

Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

2017-02-01

Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

Science.gov (United States)

Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

2015-01-01

We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

CHEMICAL REACTIONS ON ADSORBING SURFACE: KINETIC LEVEL OF DESCRIPTION

Directory of Open Access Journals (Sweden)

P.P.Kostrobii

2003-01-01

Full Text Available Based on the effective Hubbard model we suggest a statistical description of reaction-diffusion processes for bimolecular chemical reactions of gas particles adsorbed on the metallic surface. The system of transport equations for description of particles diffusion as well as reactions is obtained. We carry out the analysis of the contributions of all physical processes to the formation of diffusion coefficients and chemical reactions constants.

A generalized diffusion model for growth of nanoparticles synthesized by colloidal methods.

Science.gov (United States)

Wen, Tianlong; Brush, Lucien N; Krishnan, Kannan M

2014-04-01

A nanoparticle growth model is developed to predict and guide the syntheses of monodisperse colloidal nanoparticles in the liquid phase. The model, without any a priori assumptions, is based on the Fick's law of diffusion, conservation of mass and the Gibbs-Thomson equation for crystal growth. In the limiting case, this model reduces to the same expression as the currently accepted model that requires the assumption of a diffusion layer around each nanoparticle. The present growth model bridges the two limiting cases of the previous model i.e. complete diffusion controlled and adsorption controlled growth of nanoparticles. Specifically, the results show that a monodispersion of nanoparticles can be obtained both with fast monomer diffusion and with surface reaction under conditions of small diffusivity to surface reaction constant ratio that results is growth 'focusing'. This comprehensive description of nanoparticle growth provides new insights and establishes the required conditions for fabricating monodisperse nanoparticles critical for a wide range of applications. Copyright © 2013 Elsevier Inc. All rights reserved.

Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

Science.gov (United States)

Zhan, Hanyu; Voelz, David G.

2016-12-01

The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

DEFF Research Database (Denmark)

Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

2015-01-01

We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

International Nuclear Information System (INIS)

Olin, M.; Valkiainen, M.; Aalto, H.

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

Energy Technology Data Exchange (ETDEWEB)

Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

The effect of step thickness on the surface diffusion of a Pt adatom

International Nuclear Information System (INIS)

Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

2009-01-01

The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

Bonnesen-style inequality for the first eigenvalue on a complete surface of constant curvature

Directory of Open Access Journals (Sweden)

Niufa Fang

2017-08-01

Full Text Available Abstract By Cheeger’s isoperimetric constants, some lower bounds and upper bounds of λ 1 $\\lambda_{1}$ , the first eigenvalue on a complete surface of constant curvature, are given. Some Bonnesen-style inequalities and reverse Bonnesen-style inequalities for the first eigenvalue are obtained. Those Bonnesen-style inequalities obtained are stronger than the well-known Osserman’s results and the upper bound is stronger than Osserman’s results (Osserman in Proceedings of the International Congress of Mathematicians, Helsinki, 1978.

Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

Energy Technology Data Exchange (ETDEWEB)

Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

2014-12-15

Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

Energy Technology Data Exchange (ETDEWEB)

Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

2012-06-08

Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

Science.gov (United States)

Skoch, Gary J.

2002-01-01

Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

Diffusing diffusivity: Rotational diffusion in two and three dimensions

Science.gov (United States)

Jain, Rohit; Sebastian, K. L.

2017-06-01

We consider the problem of calculating the probability distribution function (pdf) of angular displacement for rotational diffusion in a crowded, rearranging medium. We use the diffusing diffusivity model and following our previous work on translational diffusion [R. Jain and K. L. Sebastian, J. Phys. Chem. B 120, 3988 (2016)], we show that the problem can be reduced to that of calculating the survival probability of a particle undergoing Brownian motion, in the presence of a sink. We use the approach to calculate the pdf for the rotational motion in two and three dimensions. We also propose new dimensionless, time dependent parameters, αr o t ,2 D and αr o t ,3 D, which can be used to analyze the experimental/simulation data to find the extent of deviation from the normal behavior, i.e., constant diffusivity, and obtain explicit analytical expressions for them, within our model.

Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

Science.gov (United States)

Tränkle, B; Ruh, D; Rohrbach, A

2016-03-14

Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Chen Shuguang

2010-01-01

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

International Nuclear Information System (INIS)

Luniakov, Yu V

2013-01-01

A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

Surface Casimir densities and induced cosmological constant on parallel branes in AdS spacetime

International Nuclear Information System (INIS)

Saharian, Aram A.

2004-01-01

Vacuum expectation value of the surface energy-momentum tensor is evaluated for a massive scalar field with general curvature coupling parameter subject to Robin boundary conditions on two parallel branes located on (D+1)-dimensional anti-de Sitter bulk. The general case of different Robin coefficients on separate branes is considered. As a regularization procedure the generalized zeta function technique is used, in combination with contour integral representations. The surface energies on the branes are presented in the form of the sums of single brane and second brane-induced parts. For the geometry of a single brane both regions, on the left (L-region) and on the right (R-region), of the brane are considered. The surface densities for separate L- and R-regions contain pole and finite contributions. For an infinitely thin brane taking these regions together, in odd spatial dimensions the pole parts cancel and the total surface energy is finite. The parts in the surface densities generated by the presence of the second brane are finite for all nonzero values of the interbrane separation. It is shown that for large distances between the branes the induced surface densities give rise to an exponentially suppressed cosmological constant on the brane. In the Randall-Sundrum braneworld model, for the interbrane distances solving the hierarchy problem between the gravitational and electroweak mass scales, the cosmological constant generated on the visible brane is of the right order of magnitude with the value suggested by the cosmological observations

'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

International Nuclear Information System (INIS)

Livadiotis, George

2007-01-01

The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

International Nuclear Information System (INIS)

Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

2012-01-01

The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

2005-01-01

We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

Science.gov (United States)

Kapranov, Sergey V.; Kouzaev, Guennadi A.

2018-01-01

Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

In vivo quantification of the unidirectional influx constant for Gd-DTPA diffusion across the myocardial capillaries with MR imaging

DEFF Research Database (Denmark)

Larsson, H B; Stubgaard, M; Søndergaard, Lise

1994-01-01

The authors present an in vivo method for measuring the unidirectional influx constant (Ki) for gadolinium diethylenetriaminepentaacetic acid (DTPA) diffusion across the capillary membrane in the human myocardium with magnetic resonance imaging. Ki is related to the extraction fraction (E......) and the perfusion (F) by the equation Ki = E.F.Ki was obtained by using the longitudinal relaxation rate (R1) as a measure of the myocardial concentration of Gd-DTPA in the mathematical model for transcapillary transport across capillary membranes. Myocardial enhancement after Gd-DTPA injection was followed...

Diffusion-controlled interface kinetics-inclusive system-theoretic propagation models for molecular communication systems

Science.gov (United States)

Chude-Okonkwo, Uche A. K.; Malekian, Reza; Maharaj, B. T.

2015-12-01

Inspired by biological systems, molecular communication has been proposed as a new communication paradigm that uses biochemical signals to transfer information from one nano device to another over a short distance. The biochemical nature of the information transfer process implies that for molecular communication purposes, the development of molecular channel models should take into consideration diffusion phenomenon as well as the physical/biochemical kinetic possibilities of the process. The physical and biochemical kinetics arise at the interfaces between the diffusion channel and the transmitter/receiver units. These interfaces are herein termed molecular antennas. In this paper, we present the deterministic propagation model of the molecular communication between an immobilized nanotransmitter and nanoreceiver, where the emission and reception kinetics are taken into consideration. Specifically, we derived closed-form system-theoretic models and expressions for configurations that represent different communication systems based on the type of molecular antennas used. The antennas considered are the nanopores at the transmitter and the surface receptor proteins/enzymes at the receiver. The developed models are simulated to show the influence of parameters such as the receiver radius, surface receptor protein/enzyme concentration, and various reaction rate constants. Results show that the effective receiver surface area and the rate constants are important to the system's output performance. Assuming high rate of catalysis, the analysis of the frequency behavior of the developed propagation channels in the form of transfer functions shows significant difference introduce by the inclusion of the molecular antennas into the diffusion-only model. It is also shown that for t > > 0 and with the information molecules' concentration greater than the Michaelis-Menten kinetic constant of the systems, the inclusion of surface receptors proteins and enzymes in the models

Fractional Diffusion Equations and Anomalous Diffusion

Science.gov (United States)

Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

2018-01-01

Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

International Nuclear Information System (INIS)

Kim, Sung Hoon

2001-01-01

Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO ₂ (110)

Energy Technology Data Exchange (ETDEWEB)

Goldman, Nir; Browning, Nigel D.

2011-06-16

Gold clusters on rutile TiO₂ are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO₂(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

Reactor group constants and benchmark test

Energy Technology Data Exchange (ETDEWEB)

Takano, Hideki [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

2001-08-01

The evaluated nuclear data files such as JENDL, ENDF/B-VI and JEF-2 are validated by analyzing critical mock-up experiments for various type reactors and assessing applicability for nuclear characteristics such as criticality, reaction rates, reactivities, etc. This is called Benchmark Testing. In the nuclear calculations, the diffusion and transport codes use the group constant library which is generated by processing the nuclear data files. In this paper, the calculation methods of the reactor group constants and benchmark test are described. Finally, a new group constants scheme is proposed. (author)

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

International Nuclear Information System (INIS)

Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

Novel exchange mechanisms in the surface diffusion of oxides

International Nuclear Information System (INIS)

Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

2004-01-01

We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

Evaporation Kinetics of Polyol Droplets: Determination of Evaporation Coefficients and Diffusion Constants

Science.gov (United States)

Su, Yong-Yang; Marsh, Aleksandra; Haddrell, Allen E.; Li, Zhi-Ming; Reid, Jonathan P.

2017-11-01

In order to quantify the kinetics of mass transfer between the gas and condensed phases in aerosol, physicochemical properties of the gas and condensed phases and kinetic parameters (mass/thermal accommodation coefficients) are crucial for estimating mass fluxes over a wide size range from the free molecule to continuum regimes. In this study, we report measurements of the evaporation kinetics of droplets of 1-butanol, ethylene glycol (EG), diethylene glycol (DEG), and glycerol under well-controlled conditions (gas flow rates and temperature) using the previously developed cylindrical electrode electrodynamic balance technique. Measurements are compared with a model that captures the heat and mass transfer occurring at the evaporating droplet surface. The aim of these measurements is to clarify the discrepancy in the reported values of mass accommodation coefficient (αM, equals to evaporation coefficient based on microscopic reversibility) for 1-butanol, EG, and DEG and improve the accuracy of the value of the diffusion coefficient for glycerol in gaseous nitrogen. The uncertainties in the thermophysical and experimental parameters are carefully assessed, the literature values of the vapor pressures of these components are evaluated, and the plausible ranges of the evaporation coefficients for 1-butanol, EG, and DEG as well as uncertainty in diffusion coefficient for glycerol are reported. Results show that αM should be greater than 0.4, 0.2, and 0.4 for EG, DEG, and 1-butanol, respectively. The refined values are helpful for accurate prediction of the evaporation/condensation rates.

Surface Complexation Modeling in Variable Charge Soils: Prediction of Cadmium Adsorption

Directory of Open Access Journals (Sweden)

Giuliano Marchi

2015-10-01

Full Text Available ABSTRACT Intrinsic equilibrium constants for 22 representative Brazilian Oxisols were estimated from a cadmium adsorption experiment. Equilibrium constants were fitted to two surface complexation models: diffuse layer and constant capacitance. Intrinsic equilibrium constants were optimized by FITEQL and by hand calculation using Visual MINTEQ in sweep mode, and Excel spreadsheets. Data from both models were incorporated into Visual MINTEQ. Constants estimated by FITEQL and incorporated in Visual MINTEQ software failed to predict observed data accurately. However, FITEQL raw output data rendered good results when predicted values were directly compared with observed values, instead of incorporating the estimated constants into Visual MINTEQ. Intrinsic equilibrium constants optimized by hand calculation and incorporated in Visual MINTEQ reliably predicted Cd adsorption reactions on soil surfaces under changing environmental conditions.

Diffusion in Deterministic Interacting Lattice Systems

Science.gov (United States)

Medenjak, Marko; Klobas, Katja; Prosen, Tomaž

2017-09-01

We study reversible deterministic dynamics of classical charged particles on a lattice with hard-core interaction. It is rigorously shown that the system exhibits three types of transport phenomena, ranging from ballistic, through diffusive to insulating. By obtaining an exact expressions for the current time-autocorrelation function we are able to calculate the linear response transport coefficients, such as the diffusion constant and the Drude weight. Additionally, we calculate the long-time charge profile after an inhomogeneous quench and obtain diffusive profilewith the Green-Kubo diffusion constant. Exact analytical results are corroborated by Monte Carlo simulations.

Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

Science.gov (United States)

Ku, Bon Ki; Kulkarni, Pramod

2012-05-01

We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

Oxidative Corrosion of the UO ₂ (001) Surface by Nonclassical Diffusion

Energy Technology Data Exchange (ETDEWEB)

Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

2017-11-07

Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

Asymptotic stability of constant steady states for a 2×2 reaction–diffusion system arising in cancer modelling

KAUST Repository

Di Francesco, Marco; Twarogowska, Monika

2011-01-01

The dependence of tumor on essential nutrients is known to be crucial for its evolution and has become one of the targets for medical therapies. Based on this fact a reaction-diffusion system with chemotaxis term and nutrient-based growth of tumors is presented. The formulation of the model considers also an influence of tumor and pharmacological factors on nutrient concentration. In the paper, convergence of solutions to constant, stationary states in the one-dimensional case for small perturbation of the equilibria is investigated. The nonlinear stability results are obtained by means of the classical symmetrization method and energy Sobolev estimates. © 2010 Elsevier Ltd.

Asymptotic stability of constant steady states for a 2×2 reaction–diffusion system arising in cancer modelling

KAUST Repository

Di Francesco, Marco

2011-04-01

The dependence of tumor on essential nutrients is known to be crucial for its evolution and has become one of the targets for medical therapies. Based on this fact a reaction-diffusion system with chemotaxis term and nutrient-based growth of tumors is presented. The formulation of the model considers also an influence of tumor and pharmacological factors on nutrient concentration. In the paper, convergence of solutions to constant, stationary states in the one-dimensional case for small perturbation of the equilibria is investigated. The nonlinear stability results are obtained by means of the classical symmetrization method and energy Sobolev estimates. © 2010 Elsevier Ltd.

The limitation and modification of flux-limited diffusion theory

International Nuclear Information System (INIS)

Liu Chengan; Huang Wenkai

1986-01-01

The limitation of various typical flux-limited diffusion theory and advantages of asymptotic diffusion theory with time absorption constant are analyzed and compared. The conclusions are as following: Though the flux-limited problem in neutron diffusion theory are theoretically solved by derived flux-limited diffusion equation, it's going too far to limit flux due to the inappropriate assumption in deriving flux-limited diffusion equation. The asymptotic diffusion theory with time absorption constant has eliminated the above-mentioned limitation, and it is more accurate than flux-limited diffusion theory in describing neutron transport problem

Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

Science.gov (United States)

Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

2016-04-01

Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

Science.gov (United States)

O'Neill, Kelly C; Lee, Young Jin

2018-05-01

The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

Cleaning of diffusion bonding surface by argon ion bombardment treatment

International Nuclear Information System (INIS)

Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

2003-01-01

The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

International Nuclear Information System (INIS)

Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

2014-01-01

The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

Energy Technology Data Exchange (ETDEWEB)

Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

2010-05-03

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

Surface Brillouin scattering measurement of the elastic constants of single crystal InAs0.91Sb0.09

International Nuclear Information System (INIS)

Kotane, L M; Comins, J D; Every, A G; Botha, J R

2011-01-01

Surface Brillouin scattering of light has been used to measure the angular dependence of the Rayleigh surface acoustic wave (SAW), pseudo surface acoustic wave (PSAW) and longitudinal lateral wave (LLW) speeds in a (100)-oriented single crystal of the ternary semiconductor alloy InAs 0.91 Sb 0.09 . The wave speed measurements have been used to determine the room temperature values of the elastic constants C 11 , C 12 and C 44 of the alloy. A simple and robust fitting procedure has been implemented for recovering the elastic constants, in which the merit function is constructed from explicit secular functions that determine the surface and lateral wave speeds in the [001] and [011] crystallographic directions. In the fitting, relatively larger weighting factors have been assigned to the SAW and PSAW data because of the greater precision with which the surface modes can be measured as compared with the lateral wave.

Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

Directory of Open Access Journals (Sweden)

N. Tsukahara

2012-01-01

Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

Variation in Pockels constants of silicate glass-ceramics prepared by perfect surface crystallization

Science.gov (United States)

Takano, Kazuya; Takahashi, Yoshihiro; Miyazaki, Takamichi; Terakado, Nobuaki; Fujiwara, Takumi

2018-01-01

We investigated the Pockels effect in polycrystalline materials consisting of highly oriented polar fresnoite-type Sr2TiSi2O8 fabricated using perfectly surface-crystallized glass-ceramics (PSC-GCs). The chemical composition of the precursor glass was shown to significantly affect the crystallized texture, e.g., the crystal orientation and appearance of amorphous nanoparasites in the domains, resulting in variations in the Pockels constants. Single crystals exhibiting spontaneous polarization possessed large structural anisotropy, leading to a strong dependence of the nonlinear-optical properties on the direction of polarized light. This study suggests that variations in the Pockels constants (r13 and r33) and tuning of the r13/r33 ratio can be realized in PSC-GC materials.

Demonstration of non-Gaussian restricted diffusion in tumor cells using diffusion-time dependent diffusion weighted MR contrast

Directory of Open Access Journals (Sweden)

Tuva Roaldsdatter Hope

2016-08-01

Full Text Available The diffusion weighted imaging (DWI technique enables quantification of water mobility for probing microstructural properties of biological tissue, and has become an effective tool for collecting information about the underlying pathology of cancerous tissue. Measurements using multiple b-values have indicated a bi-exponential signal attenuation, ascribed to fast (high ADC and slow (low ADC diffusion components. In this empirical study, we investigate the properties of the diffusion time (∆ - dependent components of the diffusion-weighted (DW signal in a constant b-value experiment. A Xenograft GBM mouse was imaged using ∆ = 11 ms, 20 ms, 40 ms, 60 ms and b=500-4000 s/mm2 in intervals of 500s/mm2. Data was corrected for EPI distortions and the ∆-dependence on the DW signal was measured within three regions of interest (intermediate- and high-density tumor regions and normal appearing brain tissue regions (NAB. In this empirical study we verify the assumption that the slow decaying component of the DW-signal is non-Gaussian and dependent on ∆, consistent with restricted diffusion of the intracellular space. As the DW-signal as a function of ∆ is specific to restricted diffusion, manipulating ∆ at constant b-value (cb provides a complementary and direct approach for separating the restricted from the hindered diffusion component. Our results show that only tumor tissue signal of our data demonstrate ∆-dependence, based on a bi-exponential model with a restricted diffusion component, we successfully estimated the restricted ADC, signal volume fraction and cell size within each tumor ROI.

First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

2014-01-01

Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

Estimation of the Lagrangian structure function constant ¤C¤0 from surface-layer wind data

DEFF Research Database (Denmark)

Anfossi, D.; Degrazia, G.; Ferrero, E.

2000-01-01

Eulerian turbulence observations, made in the surface layer under unstable conditions (z/L > 0), by a sonic anemometer were used to estimate the Lagrangian structure function constant C(0). Two methods were considered. The first one makes use of a relationship, widely used in the Lagrangian...... stochastic dispersion models, relating C(0) to the turbulent kinetic energy dissipation rate epsilon, wind velocity variance and Lagrangian decorrelation time. The second one employs a novel equation, connecting C(0) to the constant of the second-order Eulerian structure function. Before estimating C(0...

Mechanism and kinetics of hydrated electron diffusion

International Nuclear Information System (INIS)

Tay, Kafui A.; Coudert, Francois-Xavier; Boutin, Anne

2008-01-01

Molecular dynamics simulations are used to study the mechanism and kinetics of hydrated electron diffusion. The electron center of mass is found to exhibit Brownian-type behavior with a diffusion coefficient considerably greater than that of the solvent. As previously postulated by both experimental and theoretical works, the instantaneous response of the electron to the librational motions of surrounding water molecules constitutes the principal mode of motion. The diffusive mechanism can be understood within the traditional framework of transfer diffusion processes, where the diffusive step is akin to the exchange of an extramolecular electron between neighboring water molecules. This is a second-order process with a computed rate constant of 5.0 ps -1 at 298 K. In agreement with experiment the electron diffusion exhibits Arrhenius behavior over the temperature range of 298-400 K. We compute an activation energy of 8.9 kJ mol -1 . Through analysis of Arrhenius plots and the application of a simple random walk model it is demonstrated that the computed rate constant for exchange of an excess electron is indeed the phenomenological rate constant associated with the diffusive process

Self-diffusion on copper surfaces

DEFF Research Database (Denmark)

Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

1991-01-01

The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

Czech Academy of Sciences Publication Activity Database

Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

2008-01-01

Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

Diffusion behavior in the films of Nb-Ti systems

International Nuclear Information System (INIS)

Yoshitake, Michiko; Yoshihara, Kazuhiro

1990-01-01

The diffusion behavior of substrate element into a deposited film was investigated. The observed systems were a Nb film/Ti substrate and a Ti film/Nb substrate. When the Nb film/Ti substrate was heated in a vacuum, Ti diffused very rapidly in the Nb film. The pre-exponential factor of the diffusion constant of Ti in the Nb film was 5.6x10 -2 m 2 s -1 , and the activation energy was 220 kJmol -1 . The observed activation energy is about 60% of that of Ti in the bulk Nb. On the other hand, when the Ti film/Nb substrate was heated in a vacuum, Nb did not diffuse so rapidly. Titanium diffused through the Nb film rapidly and was concentrated on the surface of the Nb film. The chemical state of the concentrated Ti was metallic, and neither titanium oxides nor titanium carbide was observed. Therefore, the driving force of the rapid diffusion of Ti in the Nb film is considered as the reduction of the surface energy of Nb film. The difference in the diffusion behavior between Ti through the Nb film and Nb through the Ti film is explained supposing that the segregation of Ti reduces the surface energy of the Nb film but the segregation of Nb does not reduce the surface energy of the Ti film. After heating of the Nb film/Ti substrate for a long time, a new phase was formed at the interface between the Nb film and the Ti substrate. The chemical composition of the new phase is about 50% of Ti and 50% of Nb. This phase has not been reported in the phase diagram of the bulk Ti-Nb system. The surface area of the Nb film is considered to be quite large, so the contribution of surface energy to the thermodynamic state of the Nb film cannot be neglected. Therefore, the chemical potential of the film is different from that of the bulk. Then, the new phase, which does not exist in the phase diagram of the bulk system, is formed by an interaction of the films. (author)

Non-rigid registration of breast surfaces using the laplace and diffusion equations

Directory of Open Access Journals (Sweden)

Ou Jao J

2010-02-01

Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

Surface Complexation Modeling in Variable Charge Soils: Charge Characterization by Potentiometric Titration

Directory of Open Access Journals (Sweden)

Giuliano Marchi

2015-10-01

Full Text Available ABSTRACT Intrinsic equilibrium constants of 17 representative Brazilian Oxisols were estimated from potentiometric titration measuring the adsorption of H+ and OH− on amphoteric surfaces in suspensions of varying ionic strength. Equilibrium constants were fitted to two surface complexation models: diffuse layer and constant capacitance. The former was fitted by calculating total site concentration from curve fitting estimates and pH-extrapolation of the intrinsic equilibrium constants to the PZNPC (hand calculation, considering one and two reactive sites, and by the FITEQL software. The latter was fitted only by FITEQL, with one reactive site. Soil chemical and physical properties were correlated to the intrinsic equilibrium constants. Both surface complexation models satisfactorily fit our experimental data, but for results at low ionic strength, optimization did not converge in FITEQL. Data were incorporated in Visual MINTEQ and they provide a modeling system that can predict protonation-dissociation reactions in the soil surface under changing environmental conditions.

Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

NARCIS (Netherlands)

Schoots, Koen

2007-01-01

This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

Science.gov (United States)

Cox, Trevor John

Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

Standard test method for accelerated leach test for diffusive releases from solidified waste and a computer program to model diffusive, fractional leaching from cylindrical waste forms

CERN Document Server

American Society for Testing and Materials. Philadelphia

2008-01-01

1.1 This test method provides procedures for measuring the leach rates of elements from a solidified matrix material, determining if the releases are controlled by mass diffusion, computing values of diffusion constants based on models, and verifying projected long-term diffusive releases. This test method is applicable to any material that does not degrade or deform during the test. 1.1.1 If mass diffusion is the dominant step in the leaching mechanism, then the results of this test can be used to calculate diffusion coefficients using mathematical diffusion models. A computer program developed for that purpose is available as a companion to this test method (Note 1). 1.1.2 It should be verified that leaching is controlled by diffusion by a means other than analysis of the leach test solution data. Analysis of concentration profiles of species of interest near the surface of the solid waste form after the test is recommended for this purpose. 1.1.3 Potential effects of partitioning on the test results can...

Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

DEFF Research Database (Denmark)

Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

2002-01-01

We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

Thermal diffusion (1963)

International Nuclear Information System (INIS)

Lemarechal, A.

1963-01-01

This report brings together the essential principles of thermal diffusion in the liquid and gaseous phases. The macroscopic and molecular aspects of the thermal diffusion constant are reviewed, as well as the various measurement method; the most important developments however concern the operation of the CLUSIUS and DICKEL thermo-gravitational column and its applications. (author) [fr

Charge diffusion and the butterfly effect in striped holographic matter

Energy Technology Data Exchange (ETDEWEB)

Lucas, Andrew [Department of Physics, Harvard University,Cambridge, MA 02138 (United States); Department of Physics, Stanford University,Stanford, CA 94305 (United States); Steinberg, Julia [Department of Physics, Harvard University,Cambridge, MA 02138 (United States)

2016-10-26

Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.

Charge diffusion and the butterfly effect in striped holographic matter

International Nuclear Information System (INIS)

Lucas, Andrew; Steinberg, Julia

2016-01-01

Recently, it has been proposed that the butterfly velocity — a speed at which quantum information propagates — may provide a fundamental bound on diffusion constants in dirty incoherent metals. We analytically compute the charge diffusion constant and the butterfly velocity in charge-neutral holographic matter with long wavelength “hydrodynamic' disorder in a single spatial direction. In this limit, we find that the butterfly velocity does not set a sharp lower bound for the charge diffusion constant.

Internal Diffusion-Controlled Enzyme Reaction: The Acetylcholinesterase Kinetics.

Science.gov (United States)

Lee, Sangyun; Kim, Ji-Hyun; Lee, Sangyoub

2012-02-14

Acetylcholinesterase is an enzyme with a very high turnover rate; it quenches the neurotransmitter, acetylcholine, at the synapse. We have investigated the kinetics of the enzyme reaction by calculating the diffusion rate of the substrate molecule along an active site channel inside the enzyme from atomic-level molecular dynamics simulations. In contrast to the previous works, we have found that the internal substrate diffusion is the determinant of the acetylcholinesterase kinetics in the low substrate concentration limit. Our estimate of the overall bimolecular reaction rate constant for the enzyme is in good agreement with the experimental data. In addition, the present calculation provides a reasonable explanation for the effects of the ionic strength of solution and the mutation of surface residues of the enzyme. The study suggests that internal diffusion of the substrate could be a key factor in understanding the kinetics of enzymes of similar characteristics.

Failure Assessment for the High-Strength Pipelines with Constant-Depth Circumferential Surface Cracks

OpenAIRE

X. Liu; Z. X. Lu; Y. Chen; Y. L. Sui; L. H. Dai

2018-01-01

In the oil and gas transportation system over long distance, application of high-strength pipeline steels can efficiently reduce construction and operation cost by increasing operational pressure and reducing the pipe wall thickness. Failure assessment is an important issue in the design, construction, and maintenance of the pipelines. The small circumferential surface cracks with constant depth in the welded pipelines are of practical interest. This work provides an engineering estimation pr...

Bound state potential energy surface construction: ab initio zero-point energies and vibrationally averaged rotational constants.

Science.gov (United States)

Bettens, Ryan P A

2003-01-15

Collins' method of interpolating a potential energy surface (PES) from quantum chemical calculations for reactive systems (Jordan, M. J. T.; Thompson, K. C.; Collins, M. A. J. Chem. Phys. 1995, 102, 5647. Thompson, K. C.; Jordan, M. J. T.; Collins, M. A. J. Chem. Phys. 1998, 108, 8302. Bettens, R. P. A.; Collins, M. A. J. Chem. Phys. 1999, 111, 816) has been applied to a bound state problem. The interpolation method has been combined for the first time with quantum diffusion Monte Carlo calculations to obtain an accurate ground state zero-point energy, the vibrationally average rotational constants, and the vibrationally averaged internal coordinates. In particular, the system studied was fluoromethane using a composite method approximating the QCISD(T)/6-311++G(2df,2p) level of theory. The approach adopted in this work (a) is fully automated, (b) is fully ab initio, (c) includes all nine nuclear degrees of freedom, (d) requires no assumption of the functional form of the PES, (e) possesses the full symmetry of the system, (f) does not involve fitting any parameters of any kind, and (g) is generally applicable to any system amenable to quantum chemical calculations and Collins' interpolation method. The calculated zero-point energy agrees to within 0.2% of its current best estimate. A0 and B0 are within 0.9 and 0.3%, respectively, of experiment.

Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

International Nuclear Information System (INIS)

Melkior, T.; Motellier, S.; Yahiaoui, S.

2005-01-01

Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

Directory of Open Access Journals (Sweden)

Yan-Zi Yu

2015-01-01

Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

Surface channeling

International Nuclear Information System (INIS)

Sizmann, R.; Varelas, C.

1976-01-01

There is experimental evidence that swift light ions incident at small angles towards single crystalline surfaces can lose an appreciable fraction of their kinetic energy during reflection. It is shown that these projectiles penetrate into the bulk surface region of the crystal. They can travel as channeled particles along long paths through the solid (surface channeling). The angular distribution and the depth history of the re-emerged projectiles are investigated by computer simulations. A considerable fraction of the penetrating projectiles re-emerges from the crystal with constant transverse energy if the angle of incidence is smaller than the critical angle for axial channeling. Analytical formulae are derived based on a diffusion model for surface channeling. A comparison with experimental data exhibits the relevance of the analytical solutions. (Auth.)

Dissolution model for a glass having an adherent insoluble surface layer

International Nuclear Information System (INIS)

Harvey, K.B.; Larocque, C.A.B.

1990-01-01

Waste form glasses that contain substantial quantities of iron, manganese, and aluminum oxides, such as the Savannah River SRL TDS-131 glass, form a thick, hydrated surface layer when placed in contact with water. The dissolution of such a glass has been modeled with the Savannah River Model. The authors showed previously that the equations of the Savannah River Model could be fitted to published experimental data if a time-dependent diffusion coefficient was assumed for species of diffusing through the surface layer. The Savannah River Model assumes that all of the material dissolved from the glass enters solution, whereas it was observed that substantial quantities of material were retained in the surface layer. An alternative model, presented contains a mass balance equation that allows material either to enter solution or to be retained in the surface layer. It is shown that the equations derived using this model can be fitted to the published experimental data assuming a constant diffusion coefficient for species diffusing through the surface layer

A thermal spike analysis of low energy ion activated surface processes

International Nuclear Information System (INIS)

Gilmore, G.M.; Haeri, A.; Sprague, J.A.

1989-01-01

This paper reports a thermal spike analysis utilized to predict the time evolution of energy propagation through a solid resulting from energetic particle impact. An analytical solution was developed that can predict the number of surface excitations such as desorption, diffusion or chemical reaction activated by an energetic particle. The analytical solution is limited to substrates at zero Kelvin and to materials with constant thermal diffusivities. These limitations were removed by developing a computer numerical integration of the propagation of the thermal spike through the solid and the subsequent activation of surface processes

The effect of recombination and attachment on meteor radar diffusion coefficient profiles

Science.gov (United States)

Lee, C. S.; Younger, J. P.; Reid, I. M.; Kim, Y. H.; Kim, J.-H.

2013-04-01

Estimates of the ambipolar diffusion coefficient producedusing meteor radar echo decay times display an increasing trend below 80-85 km, which is inconsistent with a diffusion-only theory of the evolution of meteor trails. Data from the 33 MHz meteor radar at King Sejong Station, Antarctica, have been compared with observations from the Aura Earth Observing System Microwave Limb Sounder satellite instrument. It has been found that the height at which the diffusion coefficient gradient reverses follows the height of a constant neutral atmospheric density surface. Numerical simulations of meteor trail diffusion including dissociative recombination with atmospheric ions and three-body attachment of free electrons to neutral molecules indicate that three-body attachment is responsible for the distortion of meteor radar diffusion coefficient profiles at heights below 90 km, including the gradient reversal below 80-85 km. Further investigation has revealed that meteor trails with low initial electron line density produce decay times more consistent with a diffusion-only model of meteor trail evolution.

Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

Directory of Open Access Journals (Sweden)

Ivan E Collier

Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

International Nuclear Information System (INIS)

Vree, C; Mayr, S G

2010-01-01

The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

Slab-diffusion approximation from time-constant-like calculations

International Nuclear Information System (INIS)

Johnson, R.W.

1976-12-01

Two equations were derived which describe the quantity and any fluid diffused from a slab as a function of time. One equation is applicable to the initial stage of the process; the other to the final stage. Accuracy is 0.2 percent at the one point where both approximations apply and where accuracy of either approximation is the poorest. Characterizing other rate processes might be facilitated by the use of the concept of NOLOR (normal of the logarithm of the rate) and its time dependence

DETERMINATION OF MOISTURE DIFFUSION COEFFICIENT OF LARCH BOARD WITH FINITE DIFFERENCE METHOD

Directory of Open Access Journals (Sweden)

Qiaofang Zhou

2011-04-01

Full Text Available This paper deals with the moisture diffusion coefficient of Dahurian Larch (Larix gmelinii Rupr. by use of the Finite Difference Method (FDM. To obtain moisture distributions the dimensional boards of Dahurian Larch were dried, from which test samples were cut and sliced evenly into 9 pieces in different drying periods, so that moisture distributions at different locations and times across the thickness of Dahurian Larch were obtained with a weighing method. With these experimental data, FDM was used to solve Fick’s one-dimensional unsteady-state diffusion equation, and the moisture diffusion coefficient across the thickness at specified time was obtained. Results indicated that the moisture diffusion coefficient decreased from the surface to the center of the Dahurian Larch wood, and it decreased with decreasing moisture content at constant wood temperature; as the wood temperature increased, the moisture diffusion coefficient increased, and the effect of the wood temperature on the moisture diffusion coefficient was more significant than that of moisture content. Moisture diffusion coefficients were different for the two experiments due to differing diffusivity of the specimens.

Holomorphic representation of constant mean curvature surfaces in Minkowski space: Consequences of non-compactness in loop group methods

DEFF Research Database (Denmark)

Brander, David; Rossman, Wayne; Schmitt, Nicholas

2010-01-01

We give an infinite dimensional generalized Weierstrass representation for spacelike constant mean curvature (CMC) surfaces in Minkowski 3-space $\\R^{2,1}$. The formulation is analogous to that given by Dorfmeister, Pedit and Wu for CMC surfaces in Euclidean space, replacing the group $SU_2$ with...

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Energy Technology Data Exchange (ETDEWEB)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

2015-01-15

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Science.gov (United States)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

International Nuclear Information System (INIS)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

Science.gov (United States)

Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

2014-08-21

The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

Spin echoes of nuclear magnetization diffusing in a constant magnetic field gradient and in a restricted geometry

International Nuclear Information System (INIS)

Sen, P.N.; Andre, A.; Axelrod, S.

1999-01-01

We study the influence of restriction on Carr - Purcell - Meiboom - Gill spin echoes response of magnetization of spins diffusing in a bounded region in the presence of a constant magnetic field gradient. Depending on three main length scales: L S pore size, L G dephasing length and L D diffusion length during half-echo time, three main regimes of decay have been identified: free, localization and motionally averaging regime. In localization regime, the decay exponent depends on a fractional power (2/3) of the gradient, denoting a strong breakdown of the second cumulant or the Gaussian phase approximation (GPA). In the other two regimes, the exponent depends on the gradient squared, and the GPA holds. We find that the transition from the localization to the motionally averaging regime happens when the magnetic field gradients approach special values, corresponding to branch points of the eigenvalues. Transition from one regime to another as a function of echo number for a certain range of parameters is discussed. In this transition region, the signal shows large oscillations with echo number. For large n, asymptotic behavior sets in as a function of n for the decay exponent per echo. This is true for all values of the parameters L S , L G , and L D . copyright 1999 American Institute of Physics

Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

Science.gov (United States)

Boisvert, Ghyslain

Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

Science.gov (United States)

Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

2018-05-01

Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

Energy Technology Data Exchange (ETDEWEB)

Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

1996-01-12

The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

International Nuclear Information System (INIS)

Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

1976-01-01

Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

Larson-Miller Constant of Heat-Resistant Steel

Science.gov (United States)

Tamura, Manabu; Abe, Fujio; Shiba, Kiyoyuki; Sakasegawa, Hideo; Tanigawa, Hiroyasu

2013-06-01

Long-term rupture data for 79 types of heat-resistant steels including carbon steel, low-alloy steel, high-alloy steel, austenitic stainless steel, and superalloy were analyzed, and a constant for the Larson-Miller (LM) parameter was obtained in the current study for each material. The calculated LM constant, C, is approximately 20 for heat-resistant steels and alloys except for high-alloy martensitic steels with high creep resistance, for which C ≈ 30 . The apparent activation energy was also calculated, and the LM constant was found to be proportional to the apparent activation energy with a high correlation coefficient, which suggests that the LM constant is a material constant possessing intrinsic physical meaning. The contribution of the entropy change to the LM constant is not small, especially for several martensitic steels with large values of C. Deformation of such martensitic steels should accompany a large entropy change of 10 times the gas constant at least, besides the entropy change due to self-diffusion.

Stability constants for silicate adsorbed to ferrihydrite

DEFF Research Database (Denmark)

Hansen, Hans Christian Bruun; Wetche, T.P.; Raulund-Rasmussen, Karsten

1994-01-01

Intrinsic surface acidity constants (K(a1)intr, K(a2)intr) and surface complexation constant for adsorption of orthosilicate onto synthetic ferrihydrite (K(Si) for the complex = FeOSi(OH)3) have been determined from acid/base titrations in 0.001-0.1 m NaClO4 electrolytes and silicate adsorption...... experiments in 0.01 m NaNO3 electrolyte (pH 3-6). The surface equilibrium constants were calculated according to the two-layer model by Dzombak & Morel (1990). Near equilibrium between protons/hydroxyls in solution and the ferrihydrite surface was obtained within minutes while equilibration with silicate...

CONCENTRATION DEPENDENCE OF STERN LAYER CAPACITANCES AND SURFACE EQUILIBRIUM CONSTANTS IN SILICA-BASED NANOFLUIDIC CHANNELS

DEFF Research Database (Denmark)

Andersen, Mathias Bækbo; Frey, J.; Bruus, Henrik

2010-01-01

Fundamental understanding of the unique physics at the solid-liquid interface in nanofluidic channels is essential for the advancement of basic scientific knowledge and the development of novel applications for pharmaceuticals, environmental health and safety, energy harvesting and biometrics [1......]. The current models used to describe surface phenomena in nanofluidics can differ by orders of magnitude from experimentally measured values [2]. To mitigate the discrepancies, we hypothesize that the Stern-layer capacitance Cs and the surface equilibrium constants pKa, vary with the composition of the solid...

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

International Nuclear Information System (INIS)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-01-01

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

Energy Technology Data Exchange (ETDEWEB)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-12-14

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

DEFF Research Database (Denmark)

Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

1996-01-01

and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

Bayesian Estimation of the Active Concentration and Affinity Constants Using Surface Plasmon Resonance Technology.

Directory of Open Access Journals (Sweden)

Feng Feng

Full Text Available Surface plasmon resonance (SPR has previously been employed to measure the active concentration of analyte in addition to the kinetic rate constants in molecular binding reactions. Those approaches, however, have a few restrictions. In this work, a Bayesian approach is developed to determine both active concentration and affinity constants using SPR technology. With the appropriate prior probabilities on the parameters and a derived likelihood function, a Markov Chain Monte Carlo (MCMC algorithm is applied to compute the posterior probability densities of both the active concentration and kinetic rate constants based on the collected SPR data. Compared with previous approaches, ours exploits information from the duration of the process in its entirety, including both association and dissociation phases, under partial mass transport conditions; do not depend on calibration data; multiple injections of analyte at varying flow rates are not necessary. Finally the method is validated by analyzing both simulated and experimental datasets. A software package implementing our approach is developed with a user-friendly interface and made freely available.

Laser interferometric method for determining the carrier diffusion length in semiconductors

Energy Technology Data Exchange (ETDEWEB)

Manukhov, V. V. [Saint Petersburg State University (Russian Federation); Fedortsov, A. B.; Ivanov, A. S., E-mail: ivaleks58@gmail.com [Saint Petersburg Mining University (Russian Federation)

2015-09-15

A new laser interferometric method for measuring the carrier diffusion length in semiconductors is proposed. The method is based on the interference–absorption interaction of two laser radiations in a semiconductor. Injected radiation generates additional carriers in a semiconductor, which causes a change in the material’s optical constants and modulation of the probing radiation passed through the sample. When changing the distance between carrier generation and probing points, a decrease in the carrier concentration, which depends on the diffusion length, is recorded. The diffusion length is determined by comparing the experimental and theoretical dependences of the probe signal on the divergence of the injector and probe beams. The method is successfully tested on semiconductor samples with different thicknesses and surface states and can be used in scientific research and the electronics industry.

Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

Directory of Open Access Journals (Sweden)

Sorenson Donna J

2009-12-01

Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

Apparatus for diffusion separation

International Nuclear Information System (INIS)

Nierenberg, W.A.

1976-01-01

A diffuser separator apparatus is described which comprises a plurality of flow channels in a single stage. Each of said channels has an inlet port and an outlet port and a constant cross sectional area between said ports. At least a portion of the defining surface of each of said channels is a diffusion separation membrane, and each of said channels is a different cross sectional area. Means are provided for connecting said channels in series so that each successive channel of said series has a smaller cross sectional area than the previous channel of said series. Also provided are a source of gaseous mixture, individual means for flowing said gaseous mixture to the inlet port of each of said channels, gas receiving and analyzing means, individual means for flowing gas passing from each of said outlet ports and means for flowing gas passing through said membranes to said receiving and analyzing means, and individual means for connecting the outlet port of each channel with the inlet port of the channel having the next smaller cross sectional area

Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

Directory of Open Access Journals (Sweden)

Saiful Islam

2008-01-01

Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

Radionuclide transfer onto ground surface in surface water flow, 1

International Nuclear Information System (INIS)

Mukai, Masayuki; Takebe, Shinichi; Komiya, Tomokazu; Kamiyama, Hideo

1991-07-01

Radionuclides migration in ground surface water flow is considered to be one of the important path way in the scenario for environmental migration of radionuclides leaked from low level radioactive waste repository. Simulating the slightly sloped surface on which contaminated solution is flowing downward, testing for radionuclide migration on ground surface had been started. As it's first step, an experiment was carried out under the condition of restricted infiltration in order to elucidate the adsorption behavior of radionuclides onto the loamy soil surface in related with hydraulic conditions. Radionuclides concentration change in effluent solution with time and a concentration distribution of radionuclides adsorbed on the ground surface were obtained from several experimental conditions combining the rate and the duration time of the water flow. The radionuclides concentration in the effluent solution was nearly constant during each experimental period, and was reduced under the condition of lower flow rate. The surface distribution of radionuclides concentration showed two distinctive regions. The one was near the inlet vessel where the concentration was promptly reducing, and the other was following the former where the concentration was nearly constant. The characteristic surface distribution of radionuclides concentration can be explained by a two dimensional diffusion model with a first order adsorption reaction, based on the advection of flow rate distribution in perpendicular direction. (author)

Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

Science.gov (United States)

Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

2017-01-01

The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

Multidimensional and memory effects on diffusion of a particle

International Nuclear Information System (INIS)

Bao, Jing-Dong

2001-01-01

The diffusion of an overdamped Brownian particle in the two-dimensional (2D) channel bounded periodically by a parabola is studied, where the particle is subject to an additive white or colored noise. The diffusion rate constant D * of the particle is evaluated by the quasi-2D approximation and the effective potential approach, and the theoretical result is compared with the Langevin simulation. The properties of the diffusion rate constant are stressed for weak and strong noise cases. It is shown that, in an entropy channel, the value of D * in units of Q decreases with increasing intensity of the colored noise. In the presence of energetic barriers, a nonmonotonic behavior of the reduced diffusion rate constant D * Q -1 as a function of the noise intensity is shown

Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

Science.gov (United States)

Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

2011-01-01

Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

Science.gov (United States)

Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

2018-01-01

Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

Diffusion from cylindrical waste forms

International Nuclear Information System (INIS)

Thomas, G.F.

1985-05-01

The diffusion of a single component material from a finite cylindrical waste form, initially containing a uniform concentration of the material, is investigated. Under the condition that the cylinder is maintained in a well-stirred bath, expressions for the fractional inventory leached and the leach rate are derived with allowance for the possible permanent immobilization of the diffusant through its decay to a stable product and/or its irreversible reaction with the waste form matrix. The usefulness of the reported results in nuclear waste disposal applications is emphasized. The results reported herein are related to those previously derived at Oak Ridge National Laboratory by Bell and Nestor. A numerical scheme involving the partial decoupling of nested infinite summations and the use of rapidly converging rational approximants is recommended for the efficient implementation of the expressions derived to obtain reliable estimates of the bulk diffusion constant and the rate constant describing the diffusant-waste form interaction from laboratory data

Diffusion Parameters of BeO by the Pulsed Neutron Method

International Nuclear Information System (INIS)

Joshi, B.V.; Nargundkar, V.R.; Subbarao, K.

1965-01-01

The use of the pulsed neutron method for the precise determination of the diffusion parameters of moderators is described. The diffusion parameters of BeO have been obtained by this method. The neutron bursts were produced from a cascade accelerator by pulsing the ion source and using the Be (d, n) reaction. The detector was an enriched boron trifluoride proportional counter. It is shown that by a proper choice of the counter position arid length, and the source position, most of the space harmonics can be eliminated. Any constant background can be accounted for in the calculation of the decay constant. Very large bucklings were not used to avoid time harmonics. Any remaining harmonic content was rendered ineffective by the use of adequate time delay. The decay constant of the fundamental mode of the thermal neutron population was determined for several bucklings. Conditions to be satisfied for an accurate determination of the diffusion cooling constant C are discussed. The following values are obtained for BeO: λ 0 = absorption constant = 156.02 ± 4.37 s -1 D = diffusion coefficient = (1.3334 ± 0.0128) x 10 5 cm 2 /s C = diffusion cooling constant = (-4.8758 ± 0.5846) x 10 5 cm 4 /s. The effect of neglecting the contribution of the B 6 term on the determination of the diffusion parameters was estimated and is shown to be considerable. The reason for the longstanding discrepancy between the values of C obtained for the same moderator by different workers is attributed to this. (author) [fr

Multiple scattering of electromagnetic waves in disordered magnetic media localization parameter, energy transport velocity and diffusion constant

CERN Document Server

Pinheiro, F A; Martínez, A S

2001-01-01

We review some of our recent results concerning the single and multiple electromagnetic scattering by magnetic spherical particles. For a single electromagnetic scattering we show that the magnetic contribution alters, when compared to nonmagnetic scattering, the behavior of the cross sections and mean cosine of the scattering angle (cos omega). For ferromagnetic particles, resonances may occur even in the small-particle limit when the particle radius is much smaller than the wavelength. The resonances increase the cross sections while (cos omega) is diminished , and even may become negative. Several quantities such the Ioffe-Regel parameter for localization are calculated for the multiple scattering regime. We show that magnetic scattering favors the observation of localization of electromagnetic waves in three dimensions. Further, this is also verified for dynamical experiments, where we show that the diffusion constant can be very small. Since the magnetic permeability of the scatterers can vary significan...

Elastic-plastic finite element analyses for reducers with constant-depth internal circumferential surface cracks

International Nuclear Information System (INIS)

Wu, Szu-Ying; Tsai, Bor-Jiun; Chen, Jien-Jong

2015-01-01

In this study, a 3-D automatic elastic-plastic finite element mesh generator is established to accurately predict the J-integral value of an arbitrary reducer with a constant-depth internal circumferential surface crack under bending and axial force. The contact pairs are used on the crack surfaces to simulate the actual contact behaviors of the crack model under loadings. In order to verify the accuracy of the proposed elastic-plastic finite element model for a reducer with a surface crack, the cracked straight pipe models are generated according to a special modeling procedure for a flawed reducer. The J-integral values along the crack front of surface crack are calculated and compared with the straight pipe models which have been verified in the previous published studies. Based on the comparison of computed results, good agreements are obtained to show the accuracy of present numerical models. More confidence on using the 3-D elastic-plastic finite element analysis for reducers with internal circumferential surface cracks can be thus established in this work

Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

Science.gov (United States)

Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

2017-01-01

Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

The Dynamics of Controlled Flow Separation within a Diverter Duct Diffuser

Science.gov (United States)

Peterson, C. J.; Vukasinovic, B.; Glezer, A.

2016-11-01

The evolution and receptivity to fluidic actuation of the flow separation within a rectangular, constant-width, diffuser that is branched off of a primary channel is investigated experimentally at speeds up to M = 0.4. The coupling between the diffuser's adverse pressure gradient and the internal separation that constricts nearly half of the flow passage through the duct is controlled using a spanwise array of fluidic actuators on the surface upstream of the diffuser's inlet plane. The dynamics of the separating surface vorticity layer in the absence and presence of actuation are investigated using high-speed particle image velocimetry combined with surface pressure measurements and total pressure distributions at the primary channel's exit plane. It is shown that the actuation significantly alters the incipient dynamics of the separating vorticity layer as the characteristic cross stream scales of the boundary layer upstream of separation and of the ensuing vorticity concentrations within the separated flow increase progressively with actuation level. It is argued that the dissipative (high frequency) actuation alters the balance between large- and small-scale motions near separation by intensifying the large-scale motions and limiting the small-scale dynamics. Controlling separation within the diffuser duct also has a profound effect on the global flow. In the presence of actuation, the mass flow rate in the primary duct increases 10% while the fraction of the diverted mass flow rate in the diffuser increases by more than 45% at 0.7% actuation mass fraction. Supported by the Boeing Company.

A calculation of baryon diffusion constant in hot and dense hadronic matter based on an event generator URASiMA

International Nuclear Information System (INIS)

Sasaki, N.; Miyamura, O.; Nonaka, C.; Muroya, S.

2000-01-01

We evaluate thermodynamical quantities and transport coefficient of a dense and hot hadronic matter based on an event generator URASiMA (Ultra-Relativistic AA collision Simulator based on Multiple Scattering Algorithm). The statistical ensembles in equilibrium with fixed temperature and chemical potential are generated by imposing periodic boundary condition to the simulation of URASiMA, where energy density and baryon number density is conserved. Achievement of the thermal equilibrium and the chemical equilibrium are confirmed by the common value of slope parameter in the energy distributions and the saturation of the numbers of contained particles, respectively. By using the generated ensembles, we investigate the temperature dependence and the chemical potential dependence of the baryon diffusion constant of a dense and hot hadronic matter. (author)

Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

International Nuclear Information System (INIS)

Lou, D.C.; Solberg, J.K.; Borvik, T.

2009-01-01

This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

Surface Brillouin scattering measurement of the elastic constants of single crystal InAs{sub 0.91}Sb{sub 0.09}

Energy Technology Data Exchange (ETDEWEB)

Kotane, L M; Comins, J D; Every, A G [Materials Physics Research Institute, School of Physics, University of the Witwatersrand, Johannesburg, Wits 2050 (South Africa); Botha, J R, E-mail: Lesias.Kotane@wits.ac.z [Department of Physics, Nelson Mandela Metropolitan University, Port Elizabeth (South Africa)

2011-01-01

Surface Brillouin scattering of light has been used to measure the angular dependence of the Rayleigh surface acoustic wave (SAW), pseudo surface acoustic wave (PSAW) and longitudinal lateral wave (LLW) speeds in a (100)-oriented single crystal of the ternary semiconductor alloy InAs{sub 0.91}Sb{sub 0.09}. The wave speed measurements have been used to determine the room temperature values of the elastic constants C{sub 11}, C{sub 12} and C{sub 44} of the alloy. A simple and robust fitting procedure has been implemented for recovering the elastic constants, in which the merit function is constructed from explicit secular functions that determine the surface and lateral wave speeds in the [001] and [011] crystallographic directions. In the fitting, relatively larger weighting factors have been assigned to the SAW and PSAW data because of the greater precision with which the surface modes can be measured as compared with the lateral wave.

Growth morphologies of crystal surfaces

Science.gov (United States)

Xiao, Rong-Fu; Alexander, J. Iwan D.; Rosenberger, Franz

1991-03-01

We have expanded our earlier Monte Carlo model [Phys. Rev. A 38, 2447 (1988); J. Crystal Growth 100, 313 (1990)] to three dimensions and included reevaporation after accommodation and growth on dislocation-induced steps. We found again that, for a given set of growth parameters, the critical size, beyond which a crystal cannot retain its macroscopically faceted shape, scales linearly with the mean free path in the vapor. However, the three-dimensional (3D) the systems show increased shape stability compared to corresponding 2D cases. Extrapolation of the model results to mean-free-path conditions used in morphological stability experiments leads to order-of-magnitude agreement of the predicted critical size with experimental findings. The stability region for macroscopically smooth (faceted) surfaces in the parameter space of temperature and supersaturation depends on both the surface and bulk diffusion. While surface diffusion is seen to smooth the growth morphology on the scale of the surface diffusion length, bulk diffusion is always destabilizing. The atomic surface roughness increases with increase in growth temperature and supersaturation. That is, the tendency of surface kinetics anisotropies to stabilize the growth shape is reduced through thermal and kinetic roughening. It is also found that the solid-on-solid assumption, which can be advantageously used at low temperatures and supersaturations, is insufficient to describe the growth dynamics of atomically rough interfaces where bulk diffusion governs the process. For surfaces with an emerging screw dislocation, we find that the spiral growth mechanism dominates at low temperatures and supersaturations. The polygonization of a growth spiral decreases with increasing temperature or supersaturation. When the mean free path in the nutrient is comparable to the lattice constant, the combined effect of bulk and surface diffusion reduces the terrace width of a growth spiral in its center region. At elevated

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

NARCIS (Netherlands)

Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

Energy Technology Data Exchange (ETDEWEB)

Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

2013-12-14

The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

Surface-dependent chemical equilibrium constants and capacitances for bare and 3-cyanopropyldimethylchlorosilane coated silica nanochannels

DEFF Research Database (Denmark)

Andersen, Mathias Bækbo; Frey, Jared; Pennathur, Sumita

2011-01-01

, and pK+ are constant and independent of surface composition. Our theoretical model consists of three parts: (i) a chemical equilibrium model of the bare or coated wall, (ii) a chemical equilibrium model of the buffered bulk electrolyte, and (iii) a self-consistent Gouy–Chapman–Stern triple-layer model...... of the electrochemical double layer coupling these two equilibrium models. To validate our model, we used both pH-sensitive dye-based capillary filling experiments as well as electro-osmotic current-monitoring measurements. Using our model we predict the dependence of ζ potential, surface charge density, and capillary...

Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

International Nuclear Information System (INIS)

Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

2014-01-01

Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

DEFF Research Database (Denmark)

Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

1999-01-01

in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

Diffusion and saponification inside porous cellulose triacetate fibers.

Science.gov (United States)

Braun, Jennifer L; Kadla, John F

2005-01-01

Cellulose triacetate (CTA) fibers were partially hydrolyzed in 0.054 N solutions of NaOH/H(2)O and NaOMe/MeOH. The surface concentration of acetyl groups was determined using ATR-FTIR. Total acetyl content was determined by the alkaline hydrolysis method. Fiber cross-sections were stained with Congo red in order to examine the interface between reacted and unreacted material; these data were used to estimate the rate constant k and effective diffusivity D(B) for each reagent during the early stages of reaction by means of a volume-based unreacted core model. For NaOH/H(2)O, k = 0.37 L mol(-1) min(-1) and D(B) = 6.2 x 10(-7) cm(2)/sec; for NaOMe/MeOH, k = 4.0 L mol(-1) min(-1) and D(B) = 5.7 x 10(-6) cm(2)/sec. The NaOMe/MeOH reaction has a larger rate constant due to solvent effects and the greater nucleophilicity of MeO(-) as compared to OH(-); the reaction has a larger effective diffusivity because CTA swells more in MeOH than it does in water. Similarities between calculated concentration profiles for each case indicate that the relatively diffuse interface seen in fibers from the NaOMe/MeOH reaction results from factors not considered in the model; shrinkage of stained fiber cross-sections suggests that increased disruption of intermolecular forces may be the cause.

Modeling diffuse sources of surface water contamination with plant protection products

Science.gov (United States)

Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

2015-04-01

Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

Flame surface statistics of constant-pressure turbulent expanding premixed flames

Science.gov (United States)

Saha, Abhishek; Chaudhuri, Swetaprovo; Law, Chung K.

2014-04-01

In this paper we investigate the local flame surface statistics of constant-pressure turbulent expanding flames. First the statistics of local length ratio is experimentally determined from high-speed planar Mie scattering images of spherically expanding flames, with the length ratio on the measurement plane, at predefined equiangular sectors, defined as the ratio of the actual flame length to the length of a circular-arc of radius equal to the average radius of the flame. Assuming isotropic distribution of such flame segments we then convolute suitable forms of the length-ratio probability distribution functions (pdfs) to arrive at the corresponding area-ratio pdfs. It is found that both the length ratio and area ratio pdfs are near log-normally distributed and shows self-similar behavior with increasing radius. Near log-normality and rather intermittent behavior of the flame-length ratio suggests similarity with dissipation rate quantities which stimulates multifractal analysis.

A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

Science.gov (United States)

Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

2014-02-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

Contribution to the study of the diffusion of fission products in uranium; Contribution a l'etude de la diffusion des produits de fission dans l'uranium

Energy Technology Data Exchange (ETDEWEB)

Tournier, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1964-10-15

In this work we have developed a simple method for determining the diffusion constants and the solid-state solubilities of a metal which is volatile and only slightly soluble in second metal. This method has been applied to the behaviour of certain fission products in {gamma} uranium: strontium, barium, lanthanum, samarium and cerium. This work has made it possible to show the effect of the atomic radius of the solute on the diffusion constants. (author) [French] Dans ce travail nous avons mis au point une methode simple permettant de determiner les constantes de diffusion ainsi que les solubilites a l'etat solide d'un metal volatil et peu soluble dans un autre. Cette methode a ete appliquee au comportement de certains produits de fission dans l'uranium {gamma}: strontium, baryum, lanthane, samarium et cerium. Cette etude a permis de mettre en evidence le role du rayon atomique du solute sur les constantes de diffusion. (auteur)

First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

International Nuclear Information System (INIS)

Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

2014-01-01

We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

International Nuclear Information System (INIS)

Seddeek, M.A.; Abdelmeguid, M.S.

2006-01-01

The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

Influence of radon diffusion on the 210Pb distribution in sediments

International Nuclear Information System (INIS)

Imboden, D.M.; Stiller, M.

1982-01-01

A mathematical model is presented which describes the distribution of radon 222 in sediments having a constant or variable depth distribution of radium 226. The model is extended to the distribution of lead 210, taking into account the mobility of radon (the precursor of 210 Pb) within the sediment column. The 210 Pb model is compared, at constant radium activity, with the conventional approach which disregards the radon diffusion when estimating sedimentation rates by the 210 Pb method. The ratio between apparent and real sedimentation rate, s'/s, expressed as a function of three dimensionless parameters, demonstrates the importance of the radon diffusion effect. This effect is particularly important for sediments with small initial excess 210 Pb activity, small sedimentation rate, large radon diffusivity, or a combination of these factors. Applied to Lake Geneva, the sedimentation is estimated to be larger by 30--50% than the original value by Krishnaswami et al, (1971). In sediments which are mixed at the surface (physical mixing or bioturbation), the 210 PB activity in the mixed layer is diminished compared to that in the settling sediment material (Robbins et al., 1977), and radon diffusion makes the activity difference even larger, especially for low initial excess 210 Pb activity, small sedimentation rate, and large mixing intensity. This result may be of importance for the balance of 210 Pb in an aquatic system if the calculations are based on activities measured in the sediment

Application of multicomponent diffusion theory for description of impurities distribution in complex diffusive doping of semiconductors

International Nuclear Information System (INIS)

Uskov, V.A.; Kondrachenko, O.E.; Kondrachenko, L.A.

1977-01-01

A phenomenological theory of multicomponent diffusion involving interaction between the components is employed to analyze how the interaction between two admixtures affects their simultaneous or consequent diffusion into a semiconductor. The theory uses the equations of multicomponent dissusion under common conditions (constant diffusion coefficients and equilibrium distribution of vacancies). The experiments are described on In and Sb simultaneous diffusion into Ge. The diffusion is performed according to the routine gas phase technology with the use of radioactive isotopes In 114 and Sb 124 . It is shown that the introduction of an additional diffusion coefficient D 12 makes it possible to simply and precisely describe the distribution of interacting admixtures in complex diffusion alloying of semiconductors

Diffusion Influenced Adsorption Kinetics.

Science.gov (United States)

Miura, Toshiaki; Seki, Kazuhiko

2015-08-27

When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

Quantum maps of geodesic flows on surfaces of constant negative curvature

International Nuclear Information System (INIS)

Bogomolny, E.B.; Carioli, M.

1992-01-01

The Selberg zeta function Z(s) yields an exact relationship between the periodic orbits of a fully chaotic Hamiltonian system (the geodesic flow on surfaces of constant negative curvature) and the corresponding quantum system (the spectrum of the Laplace-Beltrami operator on the same manifold). It was found that for certain manifolds Z(s) can be exactly rewritten as the Fredholm determinant det(1-T s ), where T s is the generalization of the Ruelle-Perron-Frobenius transfer operator. An alternative derivation of this result is presented, yielding a method to find not only the spectrum but also the eigenvalues of the Laplace-Beltrami operator in terms of eigenfunctions of T s . Various properties of the transfer operator are investigated both analytically and numerically. (author) 15 refs., 10 figs

Buoyancy effects laminar slot jet impinging on a surface with constant heat flux

International Nuclear Information System (INIS)

Shokouhmand, H.; Esfahanian, V.; Masoodi, R.

2004-01-01

The two-dimensional laminar air jet issuing from a nozzle of half which terminates at height above a flat plate normal to the jet is numerically on the flow and thermal structure of the region near impingement. The impinging surface is maintained at a constant heat flux condition. The full Navier-Stocks and energy equations are solved by a finite difference method to evaluate the velocity profiles and temperature distribution. The governing parameters and their ranges are: Reynolds number Re, 10-50, Grashof number Gr, 0-50, Richardson number Ri=Gr/ Re 2 , Non dimensional nozzle height H,2-3. Results of the free streamline, local friction factor and heat transfer coefficient are graphically presented. It is found that enhancement of the heat transfer rate is substantial for high Richardson number conditions. Although the laminar jet impingement for isothermal condition has been already studied, however the constant heat flux has not been studied enough. the present paper will analyze a low velocity air jet, Which can be used for cooling of a simulated electronics package

Modelling Ni diffusion in bentonite using different sorption models

International Nuclear Information System (INIS)

Pfingsten, W.; Baeyens, B.; Bradbury, M.

2010-01-01

different modelling approaches a) an analytical solution with constant Kd using a constant Ni(II) concentration level at x = 0 (e.g. at the canister surface) and zero Ni(II) initial background concentration in the bentonite, b) a numerical 'constant K d approach' taking into account the initial Ni(II) background concentration in the bentonite pore water, and c) a reactive transport approach using the code MCOTAC in one-dimensional spatial geometry with an incorporated mechanistic sorption model which includes surface proto-lysis, surface complexation and cation exchange reactions. Charge balance is explicitly formulated for the surface complexation reactions. Selectivity coefficients and surface complexation data for Ni(II) were taken from Bradbury and Baeyens (2005); the related Fe(II) data were obtained from the Linear Free Energy Relationship (LFER) contained in the same publication. The Ni(II) breakthrough in the bentonite was calculated for different Ni(II) concentration levels with and without considering competition with Fe(II) on exchange and surface complexation sites for different Fe(II) concentrations in the bentonite pore water. The comparison allows the following observations to be made: for trace Ni(II) concentrations, the numerical 'constant K d approach' yield similar results to the reactive transport approach. For higher Ni(II) concentrations, the calculated Ni(II) breakthroughs differ from each other: the reactive transport approach yields an earlier breakthrough than the numerical 'constant K d approach' for a Ni concentration level of 10 -5 M. However, for a Ni(II) concentration level of 10 -4 M, the reactive transport approach yield a later but steeper breakthrough, reaching the maximum Ni(II) concentration level earlier than the numerical 'constant K d approach'. Fe(II) competition reactions could only be taken into account using the reactive transport approach. The results yield a general dependency of the Ni

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Diffusion of neon in white dwarf stars.

Science.gov (United States)

Hughto, J; Schneider, A S; Horowitz, C J; Berry, D K

2010-12-01

Sedimentation of the neutron rich isotope 22Ne may be an important source of gravitational energy during the cooling of white dwarf stars. This depends on the diffusion constant for 22Ne in strongly coupled plasma mixtures. We calculate self-diffusion constants D(i) from molecular dynamics simulations of carbon, oxygen, and neon mixtures. We find that D(i) in a mixture does not differ greatly from earlier one component plasma results. For strong coupling (coulomb parameter Γ> few), D(i) has a modest dependence on the charge Z(i) of the ion species, D(i)∝Z(i)(-2/3). However, D(i) depends more strongly on Z(i) for weak coupling (smaller Γ). We conclude that the self-diffusion constant D(Ne) for 22Ne in carbon, oxygen, and neon plasma mixtures is accurately known so that uncertainties in D(Ne) should be unimportant for simulations of white dwarf cooling.

Numerical simulation of double-diffusive mixed convective flow in rectangular enclosure with insulated moving lid

Energy Technology Data Exchange (ETDEWEB)

Teamah, M.A. [Faculty of Engineering, Alexandria University, Mech. Eng. Dept, Alexandria (Egypt); El-Maghlany, W.M. [Faculty of Engineering, Suez Canal University, Ismailia (Egypt)

2010-09-15

The present study is concerned with the mixed convection in a rectangular lid-driven cavity under the combined buoyancy effects of thermal and mass diffusion. Double-diffusive convective flow in a rectangular enclosure with moving upper surface is studied numerically. Both upper and lower surfaces are being insulated and impermeable. Constant different temperatures and concentration are imposed along the vertical walls of the enclosure, steady state laminar regime is considered. The transport equations for continuity, momentum, energy and spices transfer are solved. The numerical results are reported for the effect of Richardson number, Lewis number, and buoyancy ratio on the iso-contours of stream line, temperature, and concentration. In addition, the predicted results for both local and average Nusselt and Sherwood numbers are presented and discussed for various parametric conditions. This study was done for 0.1 <= Le <= 50 and Prandtl number Pr = 0.7. Through out the study the Grashof number and aspect ratio are kept constant at 10{sup 4} and 2 respectively and -10 <= N <= 10, while Richardson number has been varied from 0.01 to 10 to simulate forced convection dominated flow, mixed convection and natural convection dominated flow. (authors)

Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

Energy Technology Data Exchange (ETDEWEB)

Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

2014-02-28

A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

Diffraction and diffusion in room acoustics

DEFF Research Database (Denmark)

Rindel, Jens Holger; Rasmussen, Birgit

1996-01-01

Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....

Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

International Nuclear Information System (INIS)

El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

2010-01-01

The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

Science.gov (United States)

1992-11-01

is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

Acoustic radiosity for computation of sound fields in diffuse environments

Science.gov (United States)

Muehleisen, Ralph T.; Beamer, C. Walter

2002-05-01

The use of image and ray tracing methods (and variations thereof) for the computation of sound fields in rooms is relatively well developed. In their regime of validity, both methods work well for prediction in rooms with small amounts of diffraction and mostly specular reflection at the walls. While extensions to the method to include diffuse reflections and diffraction have been made, they are limited at best. In the fields of illumination and computer graphics the ray tracing and image methods are joined by another method called luminous radiative transfer or radiosity. In radiosity, an energy balance between surfaces is computed assuming diffuse reflection at the reflective surfaces. Because the interaction between surfaces is constant, much of the computation required for sound field prediction with multiple or moving source and receiver positions can be reduced. In acoustics the radiosity method has had little attention because of the problems of diffraction and specular reflection. The utility of radiosity in acoustics and an approach to a useful development of the method for acoustics will be presented. The method looks especially useful for sound level prediction in industrial and office environments. [Work supported by NSF.

Surface-dependent chemical equilibrium constants and capacitances for bare and 3-cyanopropyldimethylchlorosilane coated silica nanochannels.

Science.gov (United States)

Andersen, Mathias Bækbo; Frey, Jared; Pennathur, Sumita; Bruus, Henrik

2011-01-01

We present a combined theoretical and experimental analysis of the solid-liquid interface of fused-silica nanofabricated channels with and without a hydrophilic 3-cyanopropyldimethylchlorosilane (cyanosilane) coating. We develop a model that relaxes the assumption that the surface parameters C(1), C(2), and pK(+) are constant and independent of surface composition. Our theoretical model consists of three parts: (i) a chemical equilibrium model of the bare or coated wall, (ii) a chemical equilibrium model of the buffered bulk electrolyte, and (iii) a self-consistent Gouy-Chapman-Stern triple-layer model of the electrochemical double layer coupling these two equilibrium models. To validate our model, we used both pH-sensitive dye-based capillary filling experiments as well as electro-osmotic current-monitoring measurements. Using our model we predict the dependence of ζ potential, surface charge density, and capillary filling length ratio on ionic strength for different surface compositions, which can be difficult to achieve otherwise. Copyright © 2010 Elsevier Inc. All rights reserved.

In vivo P-31 MR diffusion spectroscopy

International Nuclear Information System (INIS)

Moonen, C.T.W.; Vanzijl, P.C.M.; LeBihan, D.

1988-01-01

This paper discusses the Stejskal-Tanner diffusion spin-echo sequence modified for the in vivo diffusion spectroscopy. The apparent diffusion constant D α was measured as a function of the diffusion time. Contrary to the results in phantom samples, a strong dependency of the D α for phosphocreatine (PCr) in the rat muscle tissue on diffusion time was observed, clearly indicating restricted diffusion effects and allowing an approximation of the size of the restricted volume (8-13 μm). This size fits well with the known dimensions of a normal muscle cell

A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

Science.gov (United States)

Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

2014-01-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

Modeling experimental stable isotope results from CO2 adsorption and diffusion experiments

Science.gov (United States)

Larson, T. E.

2012-12-01

steadily increased and became constant after two pore volumes of CO2 flushed through the column. Carbon and oxygen isotope values of the front of the peak (first pore volume) are 2‰ and 5‰ lower than the injected CO2 values, respectively. These results are fit very well using a mass transfer model that only includes binary diffusion between CO2 and helium that account for isotope substitution in the reduced mass coefficient. In contrast to these diffusion-dominated systems, CO2 break through curves from the illite packed column show strong adsorption effects that include a +180‰ increase in the carbon isotope ratio at the front of the peak followed by a 20‰ decrease. Up to 20 pore volumes of CO2 were flushed through the column before the carbon and oxygen isotope values stabilized to their starting values. These adsorption effects cannot be modeled using mass isotope effects alone, and instead must include additional parameters such as volume effects. These results demonstrate the importance of understanding the isotopic effects of CO2 in different substrates, and potentially offers a tracer tool that can be used to quantify surface area, transport distance, and surface reactivity of CO2. Additional applications may include more affectively determining transfer rates of CO2 across low permeability zones.

Qualitative analysis on a cubic predator-prey system with diffusion

Directory of Open Access Journals (Sweden)

Qunyi Bie

2011-04-01

Full Text Available In this paper, we study a cubic predator-prey model with diffusion. We first establish the global stability of the trivial and nontrivial constant steady states for the reaction diffusion system, and then prove the existence and non-existence results concerning non-constant positive stationary solutions by using topological argument and the energy method, respectively.

Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

Energy Technology Data Exchange (ETDEWEB)

Lawrenz, M.

2007-10-30

In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

Electrical properties of Titan's surface from Cassini RADAR scatterometer measurements

Science.gov (United States)

Wye, Lauren C.; Zebker, Howard A.; Ostro, Steven J.; West, Richard D.; Gim, Yonggyu; Lorenz, Ralph D.; The Cassini Radar Team

2007-06-01

We report regional-scale low-resolution backscatter images of Titan's surface acquired by the Cassini RADAR scatterometer at a wavelength of 2.18-cm. We find that the average angular dependence of the backscatter from large regions and from specific surface features is consistent with a model composed of a quasi-specular Hagfors term plus a diffuse cosine component. A Gaussian quasi-specular term also fits the data, but less well than the Hagfors term. We derive values for the mean dielectric constant and root-mean-square (rms) slope of the surface from the quasi-specular term, which we ascribe to scattering from the surface interface only. The diffuse term accommodates contributions from volume scattering, multiple scattering, or wavelength-scale near-surface structure. The Hagfors model results imply a surface with regional mean dielectric constants between 1.9 and 3.6 and regional surface roughness that varies between 5.3° and 13.4° in rms-slope. Dielectric constants between 2 and 3 are expected for a surface composed of solid simple hydrocarbons, water ice, or a mixture of both. Smaller dielectric constants, between 1.6 and 1.9, are consistent with liquid hydrocarbons, while larger dielectric constants, near 4.5, may indicate the presence of water-ammonia ice [Lorenz, R.D., 1998. Icarus 136, 344-348] or organic heteropolymers [Thompson, W.R., Squyres, S.W., 1990. Icarus 86, 336-354]. We present backscatter images corrected for angular effects using the model residuals, which show strong features that correspond roughly to those in 0.94-μm ISS images. We model the localized backscatter from specific features to estimate dielectric constant and rms slope when the angular coverage is within the quasi-specular part of the backscatter curve. Only two apparent surface features are scanned with angular coverage sufficient for accurate modeling. Data from the bright albedo feature Quivira suggests a dielectric constant near 2.8 and rms slope near 10.1°. The dark

Revision of fast reactor group constant set JFS-3-J2

International Nuclear Information System (INIS)

Takano, Hideki; Kaneko, Kunio.

1989-10-01

To improve the fast reactor group constant set JFS-3-J2 to be applicable for high burnup reactor calculations, group constants for 155 fission product nuclides and the lumped group cross sections for four mother fission isotopes of U-235, U-238, Pu-239 and Pu-241 have been generated. Furthermore, the group constants for higher actinides such as Am and Cm have been produced on the basis of the JENDL-2 nuclear data, so as to be able to use for TRU-transmutation calculations. Benchmark test of this revised set has been performed by analysing the 21 fast critical experimental assemblies. Benchmark calculation system based on one-dimensional Sn-method has been developed to investigate the accuracy of one-dimensional diffusion calculations. Significant difference between the results obtained with the diffusion and transport calculations was observed for small cores and the assemblies with iron or nickel reflector. (author)

Surface hopping, transition state theory, and decoherence. II. Thermal rate constants and detailed balance

Energy Technology Data Exchange (ETDEWEB)

Jain, Amber; Subotnik, Joseph E., E-mail: subotnik@sas.upenn.edu [Department of Chemistry, University of Pennsylvania, 231 South 34th Street, Philadelphia, Pennsylvania 19104 (United States)

2015-10-07

We investigate a simple approach to compute a non-adiabatic thermal rate constant using the fewest switches surface hopping (FSSH) dynamics. We study the effects of both decoherence (using our augmented-FSSH (A-FSSH) algorithm) and forbidden hops over a large range of parameters, including high and low friction regimes, and weak and strong electronic coupling regimes. Furthermore, when possible, we benchmark our results against exact hierarchy equations of motion results, where we usually find a maximum error of roughly a factor of two (at reasonably large temperatures). In agreement with Hammes-Schiffer and Tully, we find that a merger of transition state theory and surface hopping can be both accurate and efficient when performed correctly. We further show that detailed balance is followed approximately by A-FSSH dynamics.

Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

International Nuclear Information System (INIS)

Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

2016-01-01

We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

Science.gov (United States)

Li, Xiaofan; Nie, Qing

2009-07-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

Bulk diffusion and solubility of silver and nickel in lead, lead-silver and lead-nickel solid solutions

International Nuclear Information System (INIS)

Amenzou-Badrour, H.; Moya, G.; Bernardini, J.

1988-01-01

The results of a study of solubility and bulk diffusion of /sup 110/Ag and /sup 63/Ni in lead, lead-silver and lead-nickel solid solutions in the temperature range 220 to 88 0 C are reported. Owing to the low solubility of silver and nickel in lead, Fick's solution corresponding to the boundary condition of a constant concentration of solute at the surface has been used. Depth profile concentration analysis suggests a fundamental difference between the diffusion mechanisms of silver and nickel. Since silver penetration profiles in pure lead give diffusion coefficients independent of the penetration depth and silver concentration, it is suggested that slight decreases of silver diffusivity in lead-silver solid solutions have no significance. This implies that the interstitial silver atoms do not associate significantly with each other to form Ag-Ag dimers. In contrast, different behaviors of /sup 63/Ni depth profile concentration in pure lead and saturated PbNi solid solutions agree with a Ni-Ni interaction leading to the formation of less mobile dimers near the surface in pure lead

First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

International Nuclear Information System (INIS)

Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

2014-01-01

First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

Binding constants of membrane-anchored receptors and ligands: A general theory corroborated by Monte Carlo simulations.

Science.gov (United States)

Xu, Guang-Kui; Hu, Jinglei; Lipowsky, Reinhard; Weikl, Thomas R

2015-12-28

Adhesion processes of biological membranes that enclose cells and cellular organelles are essential for immune responses, tissue formation, and signaling. These processes depend sensitively on the binding constant K2D of the membrane-anchored receptor and ligand proteins that mediate adhesion, which is difficult to measure in the "two-dimensional" (2D) membrane environment of the proteins. An important problem therefore is to relate K2D to the binding constant K3D of soluble variants of the receptors and ligands that lack the membrane anchors and are free to diffuse in three dimensions (3D). In this article, we present a general theory for the binding constants K2D and K3D of rather stiff proteins whose main degrees of freedom are translation and rotation, along membranes and around anchor points "in 2D," or unconstrained "in 3D." The theory generalizes previous results by describing how K2D depends both on the average separation and thermal nanoscale roughness of the apposing membranes, and on the length and anchoring flexibility of the receptors and ligands. Our theoretical results for the ratio K2D/K3D of the binding constants agree with detailed results from Monte Carlo simulations without any data fitting, which indicates that the theory captures the essential features of the "dimensionality reduction" due to membrane anchoring. In our Monte Carlo simulations, we consider a novel coarse-grained model of biomembrane adhesion in which the membranes are represented as discretized elastic surfaces, and the receptors and ligands as anchored molecules that diffuse continuously along the membranes and rotate at their anchor points.

Thermo-diffusion effect on free convection heat and mass transfer in a thermally linearly stratified non-darcy porous media

KAUST Repository

Murthy, P.V.S.N.

2011-12-26

Thermo-diffusion effect on free convection heat and mass transfer from a vertical surface embedded in a liquid saturated thermally stratified non - Darcy porous medium has been analyzed using a local non-similar procedure. The wall temperature and concentration are constant and the medium is linearly stratified in the vertical direction with respect to the thermal conditions. The fluid flow, temperature and concentration fields are affected by the complex interactions among the diffusion ratio Le, buoyancy ratio N, thermo-diffusion parameter Sr and stratification parameter ?. Non-linear interactions of all these parameters on the convective transport has been analyzed and variation of heat and mass transfer coefficients with thermo-diffusion parameter in the thermally stratified non-Darcy porous media is presented through computer generated plots.

Thermo-diffusion effect on free convection heat and mass transfer in a thermally linearly stratified non-darcy porous media

KAUST Repository

Murthy, P.V.S.N.; El-Amin, Mohamed

2011-01-01

Thermo-diffusion effect on free convection heat and mass transfer from a vertical surface embedded in a liquid saturated thermally stratified non - Darcy porous medium has been analyzed using a local non-similar procedure. The wall temperature and concentration are constant and the medium is linearly stratified in the vertical direction with respect to the thermal conditions. The fluid flow, temperature and concentration fields are affected by the complex interactions among the diffusion ratio Le, buoyancy ratio N, thermo-diffusion parameter Sr and stratification parameter ?. Non-linear interactions of all these parameters on the convective transport has been analyzed and variation of heat and mass transfer coefficients with thermo-diffusion parameter in the thermally stratified non-Darcy porous media is presented through computer generated plots.

An improved procedure for determining grain boundary diffusion coefficients from averaged concentration profiles

Science.gov (United States)

Gryaznov, D.; Fleig, J.; Maier, J.

2008-03-01

Whipple's solution of the problem of grain boundary diffusion and Le Claire's relation, which is often used to determine grain boundary diffusion coefficients, are examined for a broad range of ratios of grain boundary to bulk diffusivities Δ and diffusion times t. Different reasons leading to errors in determining the grain boundary diffusivity (DGB) when using Le Claire's relation are discussed. It is shown that nonlinearities of the diffusion profiles in lnCav-y6/5 plots and deviations from "Le Claire's constant" (-0.78) are the major error sources (Cav=averaged concentration, y =coordinate in diffusion direction). An improved relation (replacing Le Claire's constant) is suggested for analyzing diffusion profiles particularly suited for small diffusion lengths (short times) as often required in diffusion experiments on nanocrystalline materials.

Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

Directory of Open Access Journals (Sweden)

N. Javid Rouzi

2009-04-01

Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

Structured inverse modeling in parabolic diffusion processess

OpenAIRE

Schulz, Volker; Siebenborn, Martin; Welker, Kathrin

2014-01-01

Often, the unknown diffusivity in diffusive processes is structured by piecewise constant patches. This paper is devoted to efficient methods for the determination of such structured diffusion parameters by exploiting shape calculus. A novel shape gradient is derived in parabolic processes. Furthermore quasi-Newton techniques are used in order to accelerate shape gradient based iterations in shape space. Numerical investigations support the theoretical results.

Diffusion bonding

International Nuclear Information System (INIS)

Anderson, R.C.

1976-01-01

A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

Advection and diffusion in random media implications for sea surface temperature anomalies

CERN Document Server

Piterbarg, Leonid I

1997-01-01

The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

Numerical calculation of the tensor of diffusion in the nuclear reactor cells by Monte-Carlo method

International Nuclear Information System (INIS)

Gorodkov, S.S.; Kalugin, M.A.

2009-01-01

New algorithm based on the sequential application of the RMS path method has been proposed for the diffusion constants calculation. The offered algorithm conforms to the diffusion constants calculation in arbitrary segments of nuclear reactors without detail description of geometry, dependence of cross-sections from energy or neutron scattering anisotropy by kernel medium. The proposed algorithm is used for the diffusion constants calculation in uranium-graphite reactor sells

Self diffusion in isotopic fluid

International Nuclear Information System (INIS)

Tankeshwar, K.

1991-01-01

Expressions for the second and fourth frequency sum rules of the velocity auto-correlation function have been obtained for an isotopic fluid. These expressions and Mori memory function formalism have been used to study the influence of the particle mass and mole fraction on the self diffusion coefficient. Our results confirm the weak mass dependence of the self diffusion. The influence of the mole fraction of the light particles on the self diffusion constant has been found to increase for the larger particle mass. (author). 17 refs, 1 fig., 2 tabs

Explicit studies of the quantum theory of light interstitial diffusion

International Nuclear Information System (INIS)

Emin, D.; Baskes, M.I.; Wilson, W.D.

1978-01-01

The formalism associated with small-polaron diffusion in the high temperature semiclassical regime is generalized so as to transcend simplifications employed in developing the nonadiabatic theory. The diffusion constant is then calculated for simple models in which the metal atoms interact with each other and with the interstitial atom with two-body forces. Studies of these models not only confirm the necessity of generalizing the formalism but also yield diffusion constants whose magnitudes and temperature dependenes ar consistent with the general features of the existing data for the diffusion of hydrogen and its isotopes in bcc metals. The motion of a positive muon between interstitial positions of a metal is also investigated

Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

Energy Technology Data Exchange (ETDEWEB)

Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

2016-09-15

Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

Energy Technology Data Exchange (ETDEWEB)

Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

2013-09-30

Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo₂C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo₂C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft² at a feed pressure of only 20 psig. The highest H₂/N₂ selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo₂C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo₂C catalyst layers. We have fabricated a Mo₂C/V composite membrane that in pure gas testing delivered a H₂ flux of 238 SCFH/ft² at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft².psi. However, during testing of a Mo₂C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft².psi was obtained which was stable during the entire test, meeting the permeance associated with

First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Wu, M H; Liu, X H; Gu, J F; Jin, Z H

2013-01-01

Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

Models of diffuse solar radiation

Energy Technology Data Exchange (ETDEWEB)

Boland, John; Ridley, Barbara [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Brown, Bruce [Department of Statistics and Applied Probability, National University of Singapore, Singapore 117546 (Singapore)

2008-04-15

For some locations both global and diffuse solar radiation are measured. However, for many locations, only global is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from trigonometry, we need to have diffuse on the horizontal available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse radiation on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia [Spencer JW. A comparison of methods for estimating hourly diffuse solar radiation from global solar radiation. Sol Energy 1982; 29(1): 19-32]. Boland et al. [Modelling the diffuse fraction of global solar radiation on a horizontal surface. Environmetrics 2001; 12: 103-16] developed a validated model for Australian conditions. We detail our recent advances in developing the theoretical framework for the approach reported therein, particularly the use of the logistic function instead of piecewise linear or simple nonlinear functions. Additionally, we have also constructed a method, using quadratic programming, for identifying values that are likely to be erroneous. This allows us to eliminate outliers in diffuse radiation values, the data most prone to errors in measurement. (author)

Bag model with diffuse surface

International Nuclear Information System (INIS)

Phatak, S.C.

1986-01-01

The constraint of a sharp bag boundary in the bag model is relaxed in the present work. This has been achieved by replacing the square-well potential of the bag model by a smooth scalar potential and introducing a term similar to the bag pressure term. The constraint of the conservation of the energy-momentum tensor is used to obtain an expression for the added bag pressure term. The model is then used to determine the static properties of the nucleon. The calculation shows that the rms charge radius and the nucleon magnetic moment are larger than the corresponding bag model values. Also, the axial vector coupling constant and the πNN coupling constant are in better agreement with the experimental values

CROSS DIFFUSION AND NONLINEAR DIFFUSION PREVENTING BLOW UP IN THE KELLER–SEGEL MODEL

KAUST Repository

CARRILLO, JOSÉ ANTONIO

2012-12-01

A parabolic-parabolic (Patlak-)Keller-Segel model in up to three space dimensions with nonlinear cell diffusion and an additional nonlinear cross-diffusion term is analyzed. The main feature of this model is that there exists a new entropy functional, yielding gradient estimates for the cell density and chemical concentration. For arbitrarily small cross-diffusion coefficients and for suitable exponents of the nonlinear diffusion terms, the global-in-time existence of weak solutions is proved, thus preventing finite-time blow up of the cell density. The global existence result also holds for linear and fast diffusion of the cell density in a certain parameter range in three dimensions. Furthermore, we show L∞ bounds for the solutions to the parabolic-elliptic system. Sufficient conditions leading to the asymptotic stability of the constant steady state are given for a particular choice of the nonlinear diffusion exponents. Numerical experiments in two and three space dimensions illustrate the theoretical results. © 2012 World Scientific Publishing Company.

Development of a methodology to generate materials constant for the FLARE-G computer code

International Nuclear Information System (INIS)

Martinez, A.S.; Rosier, C.J.; Schirru, R.; Silva, F.C. da; Thome Filho, Z.D.

1983-01-01

The methodology of calculation aiming to determine the parametrization constants of the multiplication factor and migration area is presented. These physical parameters are necessary in the solution of the diffusion equation with the nodal method, and they represent the adequated form of the macrogroup constants in the cell calculation. An automatic system was done to generate the parametrization constants. (E.G.) [pt

Evaporation kinetics of sessile water droplets on micropillared superhydrophobic surfaces.

Science.gov (United States)

Xu, Wei; Leeladhar, Rajesh; Kang, Yong Tae; Choi, Chang-Hwan

2013-05-21

Evaporation modes and kinetics of sessile droplets of water on micropillared superhydrophobic surfaces are experimentally investigated. The results show that a constant contact radius (CCR) mode and a constant contact angle (CCA) mode are two dominating evaporation modes during droplet evaporation on the superhydrophobic surfaces. With the decrease in the solid fraction of the superhydrophobic surfaces, the duration of a CCR mode is reduced and that of a CCA mode is increased. Compared to Rowan's kinetic model, which is based on the vapor diffusion across the droplet boundary, the change in a contact angle in a CCR (pinned) mode shows a remarkable deviation, decreasing at a slower rate on the superhydrophobic surfaces with less-solid fractions. In a CCA (receding) mode, the change in a contact radius agrees well with the theoretical expectation, and the receding speed is slower on the superhydrophobic surfaces with lower solid fractions. The discrepancy between experimental results and Rowan's model is attributed to the initial large contact angle of a droplet on superhydrophobic surfaces. The droplet geometry with a large contact angle results in a narrow wedge region of air along the contact boundary, where the liquid-vapor diffusion is significantly restricted. Such an effect becomes minor as the evaporation proceeds with the decrease in a contact angle. In both the CCR and CCA modes, the evaporative mass transfer shows the linear relationship between mass(2/3) and evaporation time. However, the evaporation rate is slower on the superhydrophobic surfaces, which is more significant on the surfaces with lower solid fractions. As a result, the superhydrophobic surfaces slow down the drying process of a sessile droplet on them.

Neutron density decay constant in a non-multiplying lattice of finite size; Constante de decroissance de la densite neutronique dans un reseau non-multiplicateur de dimensions finies

Energy Technology Data Exchange (ETDEWEB)

Deniz, V C [Commissariat a l' Energie Atomique, Cadarache (France). Centre d' Etudes Nucleaires

1965-07-01

This report presents a general theory, using the integral transport method, for obtaining the neutron density decay constant in a finite non-multiplying lattice. The theory is applied to obtain the expression for the diffusion coefficient. The case of a homogeneous medium with 1/v absorption and of finite size in all directions is treated in detail, assuming an isotropic scattering law. The decay constant is obtained up to the B{sup 6} term. The expressions for the diffusion coefficient and for the diffusion cooling coefficient are the same as those obtained for a slab geometry by Nelkin, using the expansion in spherical harmonics of the Fourier transform in the spatial variable. Furthermore, explicit forms are obtained for the flux and the current. It is shown that the deviation of the actual flux from a Maxwellian is the flux generated in the medium, extended to infinity and deprived of its absorbing power, by various sources, each of which has a zero integral over all velocities. The study of the current permits the generalization of Fick's law. An independent integral method, valid for homogeneous media, is also presented. (author) [French] Ce rapport presente une theorie generale, par methode integrale du transport, pour determiner la constante de decroissance de la densite neutronique dans un reseau non-multiplicateur de dimensions finies. La theorie est appliquee pour obtenir l'expression du coefficient de diffusion. Le cas d'un milieu homogene avec absorption en 1/v et de dimensions finies dans toutes les directions est etudie en detail, en admettant une loi de choc isotrope. La constante de decroissance est obtenue jusqu'au terme en B{sup 6}. Les expressions pour le coefficient de diffusion et pour le coefficient de refroidissement par diffusion sont les memes que celles obtenues pour une geometrie 'plaque' par NELKIN qui utilise le developpement en harmoniques spheriques de la transformee de Fourier dans la variable d'espace. De plus, on obtient les

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1989-01-01

Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-08-15

Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

Effect of uniaxial strain on adatom diffusion across {l_brace}1 1 1{r_brace}-faceted step

Energy Technology Data Exchange (ETDEWEB)

Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.cn [Department of Maths and Physics, Hunan Institute of Engineering, Donghu Street, Xiangtan 411104 (China); Hu Wangyu, E-mail: Wangyuhu2001@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Tang Jianfeng [Department of Applied Physics, Hunan Agricultural University, Changsha 410128 (China)

2011-02-01

Diffusion of Pt adatom across the strained {l_brace}1 1 1{r_brace}-faceted step is studied by embedded atom method along with nudged elastic band method. For adatom on the flat (1 1 1) surface, the anisotropic diffusion behavior is found as the uniaxial strain is imposed. For the strained {l_brace}1 1 1{r_brace}-faceted step, our results show that the maximum energy barrier for adatom crossing step edge remains approximately constant as the strain varied from -1.0% to 1.0%, and there is a rise as the larger uniaxial strain is applied. The calculated energy barrier for adatom diffusion along the step edge increases with increasing tensile strain, and the slope of the straight line is small.

Surface Nuclear Magnetic Resonance Imaging of Large Systems

International Nuclear Information System (INIS)

Weichman, P.B.; Lavely, E.M.; Ritzwoller, M.H.

1999-01-01

The general theory of surface NMR imaging of large electromagnetically active systems is considered, motivated by geophysical applications. A general imaging equation is derived for the NMR voltage response, valid for arbitrary transmitter and receiver loop geometry and arbitrary conductivity structure of the sample. When the conductivity grows to the point where the electromagnetic skin depth becomes comparable to the sample size, significant diffusive retardation effects occur that strongly affect the signal. Accounting for these now allows more accurate imaging than previously possible. It is shown that the time constant T 1 may in principle be inferred directly from the diffusive tail of the signal. copyright 1999 The American Physical Society

Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

Science.gov (United States)

Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

2016-03-01

Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

Random-walk diffusion and drying of porous materials

Science.gov (United States)

Mehrafarin, M.; Faghihi, M.

2001-12-01

Based on random-walk diffusion, a microscopic model for drying is proposed to explain the characteristic features of the drying-rate curve of porous materials. The constant drying-rate period is considered as a normal diffusion process. The transition to the falling-rate regime is attributed to the fractal nature of porous materials which results in crossover to anomalous diffusion.

Diffusion in Coulomb crystals.

Science.gov (United States)

Hughto, J; Schneider, A S; Horowitz, C J; Berry, D K

2011-07-01

Diffusion in Coulomb crystals can be important for the structure of neutron star crusts. We determine diffusion constants D from molecular dynamics simulations. We find that D for Coulomb crystals with relatively soft-core 1/r interactions may be larger than D for Lennard-Jones or other solids with harder-core interactions. Diffusion, for simulations of nearly perfect body-centered-cubic lattices, involves the exchange of ions in ringlike configurations. Here ions "hop" in unison without the formation of long lived vacancies. Diffusion, for imperfect crystals, involves the motion of defects. Finally, we find that diffusion, for an amorphous system rapidly quenched from Coulomb parameter Γ=175 to Coulomb parameters up to Γ=1750, is fast enough that the system starts to crystalize during long simulation runs. These results strongly suggest that Coulomb solids in cold white dwarf stars, and the crust of neutron stars, will be crystalline and not amorphous.

Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

Energy Technology Data Exchange (ETDEWEB)

Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

2014-07-28

Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

Determination of spatially dependent diffusion parameters in bovine bone using Kalman filter.

Science.gov (United States)

Shokry, Abdallah; Ståhle, Per; Svensson, Ingrid

2015-11-07

Although many studies have been made for homogenous constant diffusion, bone is an inhomogeneous material. It has been suggested that bone porosity decreases from the inner boundaries to the outer boundaries of the long bones. The diffusivity of substances in the bone matrix is believed to increase as the bone porosity increases. In this study, an experimental set up is used where bovine bone samples, saturated with potassium chloride (KCl), were put into distilled water and the conductivity of the water was followed. Chloride ions in the bone samples escaped out in the water through diffusion and the increase of the conductivity was measured. A one-dimensional, spatially dependent mathematical model describing the diffusion process is used. The diffusion parameters in the model are determined using a Kalman filter technique. The parameters for spatially dependent at endosteal and periosteal surfaces are found to be (12.8 ± 4.7) × 10(-11) and (5 ± 3.5) × 10(-11)m(2)/s respectively. The mathematical model function using the obtained diffusion parameters fits very well with the experimental data with mean square error varies from 0.06 × 10(-6) to 0.183 × 10(-6) (μS/m)(2). Copyright © 2015 Elsevier Ltd. All rights reserved.

Positron and positronium annihilation in low-dielectric-constant films studied by a pulsed positron beam

International Nuclear Information System (INIS)

Suzuki, R.; Ohdaira, T.; Kobayashi, Y.; Ito, K.; Yu, R.S.; Shioya, Y.; Ichikawa, H.; Hosomi, H.; Ishikiriyama, K.; Shirataki, H.; Matsuno, S.; Xu, J.

2004-01-01

Positron and positronium annihilation in porous low-dielectric-constant (low-k) films deposited by plasma-enhanced chemical vapor deposition (PECVD) and spin-on dielectric (SOD) have been investigated by means of positron annihilation lifetime spectroscopy (PALS) and age-momentum correlation (AMOC) spectroscopy with a pulsed slow positron beam. The ortho-positronium (o-Ps) lifetime strongly depends on the deposition condition. In general, PECVD low-k films have shorter o-Ps lifetimes than SOD low-k films, indicating PECVD low-k films have smaller pores. Since o-Ps diffusion and escaping from the surface occurs in most of porous SOD films, three-gamma annihilation measurement is important. To investigate o-Ps behavior in SOD films, we have carried out two-dimensional (2D) PALS measurement, which measures annihilation time and pulse-height of the scintillation detector simultaneously. Monte-Carlo simulation of the o-Ps diffusion and escaping in porous films has been carried out to simulate the 2D-PALS results. (orig.)

Effective conductivity, dielectric constant, and diffusion coefficient of digitized composite media via first-passage-time equations

International Nuclear Information System (INIS)

Torquato, S.; Kim, I.C.; Cule, D.

1999-01-01

We generalize the Brownian motion simulation method of Kim and Torquato [J. Appl. Phys. 68, 3892 (1990)] to compute the effective conductivity, dielectric constant and diffusion coefficient of digitized composite media. This is accomplished by first generalizing the first-passage-time equations to treat first-passage regions of arbitrary shape. We then develop the appropriate first-passage-time equations for digitized media: first-passage squares in two dimensions and first-passage cubes in three dimensions. A severe test case to prove the accuracy of the method is the two-phase periodic checkerboard in which conduction, for sufficiently large phase contrasts, is dominated by corners that join two conducting-phase pixels. Conventional numerical techniques (such as finite differences or elements) do not accurately capture the local fields here for reasonable grid resolution and hence lead to inaccurate estimates of the effective conductivity. By contrast, we show that our algorithm yields accurate estimates of the effective conductivity of the periodic checkerboard for widely different phase conductivities. Finally, we illustrate our method by computing the effective conductivity of the random checkerboard for a wide range of volume fractions and several phase contrast ratios. These results always lie within rigorous four-point bounds on the effective conductivity. copyright 1999 American Institute of Physics

Efficient estimation of diffusion during dendritic solidification

Science.gov (United States)

Yeum, K. S.; Poirier, D. R.; Laxmanan, V.

1989-01-01

A very efficient finite difference method has been developed to estimate the solute redistribution during solidification with diffusion in the solid. This method is validated by comparing the computed results with the results of an analytical solution derived by Kobayashi (1988) for the assumptions of a constant diffusion coefficient, a constant equilibrium partition ratio, and a parabolic rate of the advancement of the solid/liquid interface. The flexibility of the method is demonstrated by applying it to the dendritic solidification of a Pb-15 wt pct Sn alloy, for which the equilibrium partition ratio and diffusion coefficient vary substantially during solidification. The fraction eutectic at the end of solidification is also obtained by estimating the fraction solid, in greater resolution, where the concentration of solute in the interdendritic liquid reaches the eutectic composition of the alloy.

Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

International Nuclear Information System (INIS)

Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

2010-01-01

Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

Proximity effect and hot-electron diffusion in Ag/Al2O3/Al tunnel junctions

International Nuclear Information System (INIS)

Netel, H.; Jochum, J.; Labov, S.E.; Mears, C.A.; Frank, M.; Chow, D.; Lindeman, M.A.; Hiller, L.J.

1997-01-01

We have fabricated Ag/Al 2 O 3 /Al tunnel junctions on Si substrates using a new process. This process was developed to fabricate superconducting tunnel junctions (STJs) on the surface of a superconductor. These junctions allow us to study the proximity effect of a superconducting Al film on a normal metal trapping layer. In addition, these devices allow us to measure the hot-electron diffusion constant using a single junction. Lastly these devices will help us optimize the design and fabrication of tunnel junctions on the surface of high-Z, ultra-pure superconducting crystals. 5 refs., 8 figs

On uniqueness in diffuse optical tomography

International Nuclear Information System (INIS)

Harrach, Bastian

2009-01-01

A prominent result of Arridge and Lionheart (1998 Opt. Lett. 23 882–4) demonstrates that it is in general not possible to simultaneously recover both the diffusion (aka scattering) and the absorption coefficient in steady-state (dc) diffusion-based optical tomography. In this work we show that it suffices to restrict ourselves to piecewise constant diffusion and piecewise analytic absorption coefficients to regain uniqueness. Under this condition both parameters can simultaneously be determined from complete measurement data on an arbitrarily small part of the boundary

Influence of kinetics on the determination of the surface reactivity of oxide suspensions by acid-base titration.

Science.gov (United States)

Duc, M; Adekola, F; Lefèvre, G; Fédoroff, M

2006-11-01

The effect of acid-base titration protocol and speed on pH measurement and surface charge calculation was studied on suspensions of gamma-alumina, hematite, goethite, and silica, whose size and porosity have been well characterized. The titration protocol has an important effect on surface charge calculation as well as on acid-base constants obtained by fitting of the titration curves. Variations of pH versus time after addition of acid or base to the suspension were interpreted as diffusion processes. Resulting apparent diffusion coefficients depend on the nature of the oxide and on its porosity.

Position-Dependent Dynamics Explain Pore-Averaged Diffusion in Strongly Attractive Adsorptive Systems.

Science.gov (United States)

Krekelberg, William P; Siderius, Daniel W; Shen, Vincent K; Truskett, Thomas M; Errington, Jeffrey R

2017-12-12

Using molecular simulations, we investigate the relationship between the pore-averaged and position-dependent self-diffusivity of a fluid adsorbed in a strongly attractive pore as a function of loading. Previous work (Krekelberg, W. P.; Siderius, D. W.; Shen, V. K.; Truskett, T. M.; Errington, J. R. Connection between thermodynamics and dynamics of simple fluids in highly attractive pores. Langmuir 2013, 29, 14527-14535, doi: 10.1021/la4037327) established that pore-averaged self-diffusivity in the multilayer adsorption regime, where the fluid exhibits a dense film at the pore surface and a lower density interior pore region, is nearly constant as a function of loading. Here we show that this puzzling behavior can be understood in terms of how loading affects the fraction of particles that reside in the film and interior pore regions as well as their distinct dynamics. Specifically, the insensitivity of pore-averaged diffusivity to loading arises from the approximate cancellation of two factors: an increase in the fraction of particles in the higher diffusivity interior pore region with loading and a corresponding decrease in the particle diffusivity in that region. We also find that the position-dependent self-diffusivities scale with the position-dependent density. We present a model for predicting the pore-average self-diffusivity based on the position-dependent self-diffusivity, which captures the unusual characteristics of pore-averaged self-diffusivity in strongly attractive pores over several orders of magnitude.

Diffusion-controlled reaction. V. Effect of concentration-dependent diffusion coefficient on reaction rate in graft polymerization

International Nuclear Information System (INIS)

Imre, K.; Odian, G.

1979-01-01

The effect of diffusion on radiation-initiated graft polymerization has been studied with emphasis on the single- and two-penetrant cases. When the physical properties of the penetrants are similar, the two-penetrant problems can be reduced to the single-penetrant problem by redefining the characteristic parameters of the system. The diffusion-free graft polymerization rate is assumed to be proportional to the upsilon power of the monomer concentration respectively, and, in which the proportionality constant a = k/sub p/R/sub i//sup w//k/sub t//sup z/, where k/sub p/ and k/sub t/ are the propagation and termination rate constants, respectively, and R/sub i/ is the initiation rate. The values of upsilon, w, and z depend on the particular reaction system. The results of earlier work were generalized by allowing a non-Fickian diffusion rate which predicts an essentially exponential dependence on the monomer concentration of the diffusion coefficient, D = D 0 [exp(deltaC/M)], where M is the saturation concentration. A reaction system is characterized by the three dimensionless parameters, upsilon, delta, and A = (L/2)[aM/sup (upsilon--1)//D 0 ]/sup 1/2/, where L is the polymer film thickness. Graft polymerization tends to become diffusion controlled as A increases. Larger values of delta and ν cause a reaction system to behave closer to the diffusion-free regime. Transition from diffusion-free to diffusion-controlled reaction involves changes in the dependence of the reaction rate on film thickness, initiation rate, and monomer concentration. Although the diffusion-free rate is w order in initiation rate, upsilon order in monomer, and independent of film thickness, the diffusion-controlled rate is w/2 order in initiator rate and inverse first-order in film thickness. Dependence of the diffusion-controlled rate on monomer is dependent in a complex manner on the diffusional characteristics of the reaction system. 11 figures, 4 tables

Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

International Nuclear Information System (INIS)

Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

2002-01-01

The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

Science.gov (United States)

Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

2018-01-01

Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

Modeling and experiments for the time-dependent diffusion coefficient during methane desorption from coal

Science.gov (United States)

Cheng-Wu, Li; Hong-Lai, Xue; Cheng, Guan; Wen-biao, Liu

2018-04-01

Statistical analysis shows that in the coal matrix, the diffusion coefficient for methane is time-varying, and its integral satisfies the formula μt κ /(1 + β κ ). Therefore, a so-called dynamic diffusion coefficient model (DDC model) is developed. To verify the suitability and accuracy of the DDC model, a series of gas diffusion experiments were conducted using coal particles of different sizes. The results show that the experimental data can be accurately described by the DDC and bidisperse models, but the fit to the DDC model is slightly better. For all coal samples, as time increases, the effective diffusion coefficient first shows a sudden drop, followed by a gradual decrease before stabilizing at longer times. The effective diffusion coefficient has a negative relationship with the size of the coal particle. Finally, the relationship between the constants of the DDC model and the effective diffusion coefficient is discussed. The constant α (μ/R 2 ) denotes the effective coefficient at the initial time, and the constants κ and β control the attenuation characteristic of the effective diffusion coefficient.

Production of atmospheric pressure diffuse nanosecond pulsed dielectric barrier discharge using the array needles-plate electrode in air

International Nuclear Information System (INIS)

Yang Dezheng; Wang Wenchun; Jia Li; Nie Dongxia; Shi Hengchao

2011-01-01

In this paper, a bidirectional high pulse voltage with 20 ns rising time is employed to generate an atmospheric pressure diffuse dielectric barrier discharge using the array needles-plate electrode configuration. Both double needle and multiple needle electrode configurations nanosecond pulsed dielectric barrier discharges are investigated. It is found that a diffuse discharge plasma with low gas temperature can be obtained, and the plasma volume increases with the increase of the pulse peak voltage, but remains almost constant with the increase of the pulse repetition rate. In addition to showing the potential application on a topographically nonuniform surface treatment of the discharge, the multiple needle-plate electrode configuration with different needle-plate electrode gaps are also employed to generate diffuse discharge plasma.

Radon diffusion studies in air, gravel, sand, soil and water

International Nuclear Information System (INIS)

Singh, B.; Singh, S.; Virk, H.S.

1993-01-01

Radon isotopes are practically inert and have properties of gases under conditions of geological interest. During their brief lives their atoms are capable of moving from sites of their generation. Radon diffusion studies were carried out in air, gravel, sand, soil and water using silicon diffused junction electronic detector, Alphameter-400. Diffusion constant and diffusion length is calculated for all these materials. (author)

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

Energy Technology Data Exchange (ETDEWEB)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

Science.gov (United States)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Effects of repository environment on diffusion behavior of radionuclides in buffer materials

International Nuclear Information System (INIS)

Kozaki, Tamotsu; Sato, Seichi

2004-03-01

Compacted bentonite is considered as a candidate buffer material in the geological disposal of high-level radioactive waste. An important function of the compacted bentonite is to retard the transport of radionuclides from waste forms to the surrounding host rock after degradation of an overpack. Therefore, diffusion behavior of radionuclides in the compacted bentonite has been extensively studied by many researchers for the performance assessments of the geological disposal. However, diffusion mechanism of radionuclides in the bentonite cannot be fully understood, and most experimental data have been obtained at room temperature for the bentonite saturated with low salinity water, which would disagree often with real repository conditions. In this study, therefore, apparent diffusion coefficients were determined at various diffusion temperatures for chloride ions in Na-montmorillonite samples saturated with NaCl solution of high salinity. Activation energies for the apparent diffusion were also obtained from the temperature dependence of the diffusion coefficients at different salinity. As the salinity increased, the apparent diffusion coefficients of chloride ions in montmorillonite were found to increase slightly. On the other hand, the activation energies for the chloride diffusion were found to be almost constant (approximately 12 kJ mol -1 ) and less than that in free water (17.4 kJ mol -1 ). Effects of salinity on diffusion behavior of radionuclides in montmorillonite were discussed from the viewpoints of microstructure of montmorillonite and distribution of ions in the montmorillonite. As a result, the diffusion behavior of sodium ions could be explained by the changes of the predominant diffusion process among pore water diffusion, surface diffusion, and interlayer diffusion that could be caused by the increase of salinity. (author)

Verification of atmospheric diffusion models with data of atmospheric diffusion experiments

International Nuclear Information System (INIS)

Hato, Shinji; Homma, Toshimitsu

2009-02-01

The atmospheric diffusion experiments were implemented by Japan Atomic Energy Research Institute (JAERI) around Mount Tsukuba in 1989 and 1990, and the tracer gas concentration were monitored. In this study, the Gauss Plume Model and RAMS/HYPACT that are meteorological forecast code and atmospheric diffusion code with detailed physical law are made a comparison between monitored concentration. In conclusion, the Gauss Plume Model is better than RAM/HYPACT even complex topography if the estimation is around tens of kilometer form release point and the change in weather is constant for short time. This reason is difference of wind between RAMS and observation. (author)

Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

DEFF Research Database (Denmark)

Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

2017-01-01

) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

Dissipative particle dynamics of diffusion-NMR requires high Schmidt-numbers

Energy Technology Data Exchange (ETDEWEB)

Azhar, Mueed; Greiner, Andreas [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Korvink, Jan G., E-mail: jan.korvink@kit.edu, E-mail: david.kauzlaric@imtek.uni-freiburg.de [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Department of Microstructure Technology, Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, Eggenstein-Leopoldshafen (Germany); Kauzlarić, David, E-mail: jan.korvink@kit.edu, E-mail: david.kauzlaric@imtek.uni-freiburg.de [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Freiburg Institute for Advanced Studies, University of Freiburg, Albertstr. 19, 79104 Freiburg (Germany)

2016-06-28

We present an efficient mesoscale model to simulate the diffusion measurement with nuclear magnetic resonance (NMR). On the level of mesoscopic thermal motion of fluid particles, we couple the Bloch equations with dissipative particle dynamics (DPD). Thereby we establish a physically consistent scaling relation between the diffusion constant measured for DPD-particles and the diffusion constant of a real fluid. The latter is based on a splitting into a centre-of-mass contribution represented by DPD, and an internal contribution which is not resolved in the DPD-level of description. As a consequence, simulating the centre-of-mass contribution with DPD requires high Schmidt numbers. After a verification for fundamental pulse sequences, we apply the NMR-DPD method to NMR diffusion measurements of anisotropic fluids, and of fluids restricted by walls of microfluidic channels. For the latter, the free diffusion and the localisation regime are considered.

Charged BTZ-like black hole solutions and the diffusivity-butterfly velocity relation

Science.gov (United States)

Ge, Xian-Hui; Sin, Sang-Jin; Tian, Yu; Wu, Shao-Feng; Wu, Shang-Yu

2018-01-01

We show that there exists a class of charged BTZ-like black hole solutions in Lifshitz spacetime with a hyperscaling violating factor. The charged BTZ black hole is characterized by a charge-dependent logarithmic term in the metric function. As concrete examples, we give five such charged BTZ-like black hole solutions and the standard charged BTZ metric can be regarded as a special instance of them. In order to check the recent proposed universal relations between diffusivity and the butterfly velocity, we first compute the diffusion constants of the standard charged BTZ black holes and then extend our calculation to arbitrary dimension d, exponents z and θ. Remarkably, the case d = θ and z = 2 is a very special in that the charge diffusion D c is a constant and the energy diffusion D e might be ill-defined, but v B 2 τ diverges. We also compute the diffusion constants for the case that the DC conductivity is finite but in the absence of momentum relaxation.

Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

Science.gov (United States)

Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

2012-09-24

We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

Entropy as a measure of diffusion

International Nuclear Information System (INIS)

Aghamohammadi, Amir; Fatollahi, Amir H.; Khorrami, Mohammad; Shariati, Ahmad

2013-01-01

The time variation of entropy, as an alternative to the variance, is proposed as a measure of the diffusion rate. It is shown that for linear and time-translationally invariant systems having a large-time limit for the density, at large times the entropy tends exponentially to a constant. For systems with no stationary density, at large times the entropy is logarithmic with a coefficient specifying the speed of the diffusion. As an example, the large-time behaviors of the entropy and the variance are compared for various types of fractional-derivative diffusions.

Entropy as a measure of diffusion

Energy Technology Data Exchange (ETDEWEB)

Aghamohammadi, Amir, E-mail: mohamadi@alzahra.ac.ir; Fatollahi, Amir H., E-mail: fath@alzahra.ac.ir; Khorrami, Mohammad, E-mail: mamwad@mailaps.org; Shariati, Ahmad, E-mail: shariati@mailaps.org

2013-10-15

The time variation of entropy, as an alternative to the variance, is proposed as a measure of the diffusion rate. It is shown that for linear and time-translationally invariant systems having a large-time limit for the density, at large times the entropy tends exponentially to a constant. For systems with no stationary density, at large times the entropy is logarithmic with a coefficient specifying the speed of the diffusion. As an example, the large-time behaviors of the entropy and the variance are compared for various types of fractional-derivative diffusions.

Electrolyte diffusion in compacted montmorillonite engineered barriers

International Nuclear Information System (INIS)

Jahnke, F.M.; Radke, C.J.

1985-09-01

The bentonite-based engineered barrier or packing is a proposed component of several designs conceived to dispose of high-level nuclear waste in geologic repositories. Once radionuclides escape the waste package, they must first diffuse through the highly impermeable clay-rich barrier before they reach the host repository. To determine the effectiveness of the packing as a sorption barrier in the transient release period and as a mass-transfer barrier in the steady release period over the geologic time scales involved in nuclear waste disposal, a fundamental understanding of the diffusion of electrolytes in compacted clays is required. We present, and compare with laboratory data, a model quantifying the diffusion rates of cationic cesium and uncharged tritium in compacted montmorillonite clay. Neutral tritium characterizes the geometry (i.e., tortuosity) of the particulate gel. After accounting for cation exchange, we find that surface diffusion is the dominant mechanism of cation transport, with an approximate surface diffusion coefficient of 2 x 10 -6 cm 2 /s for cesium. This value increases slightly with increasing background ionic strength. The implications of this work for the packing as a migration barrier are twofold. During the transient release period, K/sub d/ values are of little importance in retarding ion migration. This is because sorption also gives rise to a surface diffusion path, and it is surface diffusion which controls the diffusion rate of highly sorbing cations in compacted montmorillonite. During the steady release period, the presence of surface diffusion leads to a flux through the packing which is greatly enhanced. In either case, if surface diffusion is neglected, the appropriate diffusion coefficient of ions in compacted packing will be in considerable error relative to current design recommendations. 11 refs., 4 figs., 1 tab

Fractional diffusion equations and anomalous diffusion

CERN Document Server

Evangelista, Luiz Roberto

2018-01-01

Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.

Soret-driven double diffusive magneto-convection in couple stress liquid

Directory of Open Access Journals (Sweden)

Mishra P.

2012-07-01

Full Text Available The stability analysis of Soret driven double diffusive convection for electrically conducting couple stress liquid is investigated theoretically. The couple stress liquid is confined between two horizontal surfaces and a constant vertical magnetic field is applied across the surfaces. Linear stability analysis is used to investigate the effect of various parameters on the onset of convection. Effect of magnetic field on the onset of convection is presented by means of Chandrasekhar number. The problem is analyzed as a function of Chandrasekhar number (Q, positive and negative Soret parameter (S r and couple stress parameter (C, mainly. The results show that the Q, both positive and negative Sr and C delay the onset of convection. The effect of other parameters is also discussed in paper and shown by graphs.

Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

International Nuclear Information System (INIS)

Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

2015-01-01

Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

Thermal diffusion of hydrogen in zircaloy-2 containing hydrogen beyond terminal solid solubility

International Nuclear Information System (INIS)

Maki, Hideo; Sato, Masao.

1975-01-01

The thermal diffusion of hydrogen is one of causes of uneven hydride precipitation in zircaloy fuel cladding tubes that are used in water reactors. In the diffusion model of hydrogen in zircaloy, the effects of the hydride on the diffusibility of hydrogen has been regarded as negligibly small in comparison with that of hydrogen dissolved in the matrix. Contrary to the indications given by this model, phenomena are often encountered that cannot be explained unless hydride platelets have considerable ostensible diffusibility in zircaloy. In order to determine quantitatively the diffusion characteristics of hydrogen in zircaloy, a thermal diffusion experiment was performed with zircaloy-2 fuel cladding tubes containing hydrogen beyond the terminal solid solubility. In this experiment, a temperature difference of 20 0 --30 0 C was applied between the inside and outside surfaces of the specimen in a thermal simulator. To explain the experimental results, a modified diffusion model is presented, in which the effects of stress are introduced into Markowitz's model with the diffusion of hydrogen in the hydride taken into account. The diffusion equation derived from this model can be written in a form that ostensibly represents direct diffusion of hydride in zircaloy. The apparent diffusion characteristics of the hydride at around 300 0 C are Dsub(p)=2.3x10 5 exp(-32,000/RT), (where R:gas constant, T:temperature) and the apparent heat of transport Qsub(p) =-60,000 cal/mol. The modified diffusion model well explains the experimental results in such respects as reaches a steady state after several hours. (auth.)

Surface Coatings as Xenon Diffusion Barriers for Improved Detection of Clandestine Nuclear Explosions

OpenAIRE

Bläckberg, Lisa

2014-01-01

This thesis investigates surface coatings as xenon diffusion barriers on plastic scintillators. The motivation for the work is improved radioxenon detection systems, used within the verification regime of the Comprehensive Nuclear-Test-Ban Treaty (CTBT). One type of radioxenon detection systems used in this context is the Swedish SAUNA system. This system uses a cylindrical plastic scintillator cell to measure the beta decay from radioxenon isotopes. The detector cell also acts as a container...

Desorption kinetics of ciprofloxacin in municipal biosolids determined by diffusion gradient in thin films.

Science.gov (United States)

D'Angelo, E; Starnes, D

2016-12-01

Ciprofloxacin (CIP) is a commonly-prescribed antibiotic that is largely excreted by the body, and is often found at elevated concentrations in treated sewage sludge (biosolids) at municipal wastewater treatment plants. When biosolids are applied to soils, they could release CIP to surface runoff, which could adversely affect growth of aquatic organisms that inhabit receiving water bodies. The hazard risk largely depends on the amount of antibiotic in the solid phase that can be released to solution (labile CIP), its diffusion coefficient, and sorption/desorption exchange rates in biosolids particles. In this study, these processes were evaluated in a Class A Exceptional Quality Biosolids using a diffusion gradient in thin films (DGT) sampler that continuously removed CIP from solution, which induced desorption and diffusion in biosolids. Mass accumulation of antibiotic in the sampler over time was fit by a diffusion transport and exchange model available in the software tool 2D-DIFS to derive the distribution coefficient of labile CIP (K dl ) and sorption/desorption rate constants in the biosolids. The K dl was 13 mL g -1 , which equated to 16% of total CIP in the labile pool. Although the proportion of labile CIP was considerable, release rates to solution were constrained by slow desorption kinetics (desorption rate constant = 4 × 10 -6 s -1 ) and diffusion rate (effective diffusion coefficient = 6 × 10 -9  cm 2  s -1 . Studies are needed to investigate how changes in temperature, water content, pH and other physical and chemical characteristics can influence antibiotic release kinetics and availability and mobility in biosolid-amended soils. Copyright © 2016 Elsevier Ltd. All rights reserved.

Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

International Nuclear Information System (INIS)

Posadillo, R.; Lopez Luque, R.

2009-01-01

The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

KAUST Repository

Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

2014-01-01

Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-09-15

Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

Tritium release from lithium ceramics at constant temperature

International Nuclear Information System (INIS)

Verrall, R.A.; Miller, J.M.

1992-02-01

Analytic methods for post-irradiation annealing tests to measure tritium release from lithium ceramics at constant temperature are examined. Modifications to the Bertone (1) relations for distinguishing diffusion-controlled release from desorption-controlled release are shown. The methods are applied to tests on sintered LiA10 2 ; first-order desorption is shown to control tritium release for these tests

Surface mobilities on solid materials

International Nuclear Information System (INIS)

Binh, V.T.

1983-01-01

This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)

Bounds on area and charge for marginally trapped surfaces with a cosmological constant

International Nuclear Information System (INIS)

Simon, Walter

2012-01-01

We sharpen the known inequalities AΛ ≤ 4π(1 - g) (Hayward et al 1994 Phys. Rev. D 49 5080, Woolgar 1999 Class. Quantum Grav. 16 3005) and A ≤ 4πQ 2 (Dain et al 2012 Class. Quantum Grav. 29 035013) between the area A and the electric charge Q of a stable marginally outer-trapped surface (MOTS) of genus g in the presence of a cosmological constant Λ. In particular, instead of requiring stability we include the principal eigenvalue λ of the stability operator. For Λ* Λ+λ > 0, we obtain a lower and an upper bound for Λ*A in terms of Λ*Q 2 , as well as the upper bound Q≤1/(2√(Λ * )) for the charge, which reduces to Q≤1/(2√(Λ)) in the stable case λ ≥ 0. For Λ* < 0, there only remains a lower bound on A. In the spherically symmetric, static, stable case, one of our area inequalities is saturated iff the surface gravity vanishes. We also discuss implications of our inequalities for 'jumps' and mergers of charged MOTS. (fast track communication)

Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

Czech Academy of Sciences Publication Activity Database

Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

2015-01-01

Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

Mixed convection of magnetohydrodynamic nanofluids inside microtubes at constant wall temperature

Energy Technology Data Exchange (ETDEWEB)

Moshizi, S.A. [Young Researchers and Elite Club, Neyshabur Branch, Islamic Azad University, Neyshabur (Iran, Islamic Republic of); Zamani, M. [Young Researchers and Elite Club, Gonabad Branch, Islamic Azad University, Gonabad (Iran, Islamic Republic of); Hosseini, S.J. [Department of Mechanical Engineering, School of Engineering, University of Tehran, Tehran (Iran, Islamic Republic of); Malvandi, A., E-mail: amirmalvandi@aut.ac.ir [Department of Mechanical Engineering, Neyshabur Branch, Islamic Azad University, Neyshabur (Iran, Islamic Republic of)

2017-05-15

Laminar fully developed mixed convection of magnetohydrodynamic nanofluids inside microtubes at a constant wall temperature (CWT) under the effects of a variable directional magnetic field is investigated numerically. Nanoparticles are assumed to have slip velocities relative to the base fluid owing to thermophoretic diffusion (temperature gradient driven force) and Brownian diffusion (concentration gradient driven force). The no-slip boundary condition is avoided at the fluid-solid mixture to assess the non-equilibrium region at the fluid-solid interface. A scale analysis is performed to estimate the relative significance of the pertaining parameters that should be included in the governing equations. After the effects of pertinent parameters on the pressure loss and heat transfer enhancement were considered, the figure of merit (FoM) is employed to evaluate and optimize the thermal performance of heat exchange equipment. The results indicate the optimum thermal performance is obtained when the thermophoresis overwhelms the Brownian diffusion, which is for larger nanoparticles. This enhancement boosts when the buoyancy force increases. In addition, increasing the magnetic field strength and slippage at the fluid-solid interface enhances the thermal performance. - Highlights: • Thermally fully developed flow of nanofluid in circular microchannels at constant wall temperature. • Effect of nanoparticle migration on fluid flow and heat transfer characteristics. • Investigating the Figure of merit of thermal performance. • Performance of system grows when the thermophoresis overwhelms the Brownian diffusion.

Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

Energy Technology Data Exchange (ETDEWEB)

Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

2017-11-01

In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

Science.gov (United States)

Matrane, I.; Mazroui, M.; Sbiaai, K.

2018-03-01

We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

IRON REDOX EQUILIBRIUM AND DIFFUSIVITY IN MIXED ALKALI-ALKALINE EARTH-SILICA GLASS MELTS

Directory of Open Access Journals (Sweden)

KI-DONG KIM

2011-03-01

Full Text Available Dependence of redox behavior and diffusivity of iron on temperature and composition was studied in mixed alkali-alkaline earth-silica glass melts by means of square wave voltammetry (SWV. The voltammograms showed that irrespective of K2O/(Na2O+K2O the peak potential due to Fe3+/Fe2+ moved toward negative direction with temperature decrease and the peak current showed a strong dependence on frequency at constant temperature. Iron diffusion coefficient versus melt viscosity showed a good linearity. The compositional dependence showed that the peak potential shifted to the positive direction with increase of K2O but a typical mixed alkali effect occurred in iron diffusion either at constant temperature or at constant viscosity.

Propagation of intense laser radiation through a diffusion flame of burning oil

Science.gov (United States)

Gvozdev, S. V.; Glova, A. F.; Dubrovskii, V. Yu; Durmanov, S. T.; Krasyukov, A. G.; Lysikov, A. Yu; Smirnov, G. V.; Pleshkov, V. M.

2015-06-01

We report the results of measuring the absorption coefficient of radiation from a cw ytterbium fibre single-mode laser with the power up to 1.5 kW by a diffusion flame of oil, burning in the atmosphere air at normal pressure on a free surface. For the constant length (30 mm) and width (30 mm) of the flame and the distance 10 mm between the laser beam axis and the oil surface the dependence of the absorption coefficient, averaged over the flame length, on the mean radiation intensity (varied from 4.5 × 103 to 1.2 × 106 W cm-2) entering the flame is obtained. The qualitative explanation of nonmonotonic behaviour of the absorption coefficient versus the intensity is presented.

Diffusion in ceramics

CERN Document Server

Pelleg, Joshua

2016-01-01

This textbook provides an introduction to changes that occur in solids such as ceramics, mainly at high temperatures, which are diffusion controlled, as well as presenting research data. Such changes are related to the kinetics of various reactions such as precipitation, oxidation and phase transformations, but are also related to some mechanical changes, such as creep. The book is composed of two parts, beginning with a look at the basics of diffusion according to Fick's Laws. Solutions of Fick’s second law for constant D, diffusion in grain boundaries and dislocations are presented along with a look at the atomistic approach for the random motion of atoms. In the second part, the author discusses diffusion in several technologically important ceramics. The ceramics selected are monolithic single phase ones, including: A12O3, SiC, MgO, ZrO2 and Si3N4. Of these, three refer to oxide ceramics (alumina, magnesia and zirconia). Carbide based ceramics are represented by the technologically very important Si-ca...

CFD simulation of simultaneous monotonic cooling and surface heat transfer coefficient

International Nuclear Information System (INIS)

Mihálka, Peter; Matiašovský, Peter

2016-01-01

The monotonic heating regime method for determination of thermal diffusivity is based on the analysis of an unsteady-state (stabilised) thermal process characterised by an independence of the space-time temperature distribution on initial conditions. At the first kind of the monotonic regime a sample of simple geometry is heated / cooled at constant ambient temperature. The determination of thermal diffusivity requires the determination rate of a temperature change and simultaneous determination of the first eigenvalue. According to a characteristic equation the first eigenvalue is a function of the Biot number defined by a surface heat transfer coefficient and thermal conductivity of an analysed material. Knowing the surface heat transfer coefficient and the first eigenvalue the thermal conductivity can be determined. The surface heat transport coefficient during the monotonic regime can be determined by the continuous measurement of long-wave radiation heat flow and the photoelectric measurement of the air refractive index gradient in a boundary layer. CFD simulation of the cooling process was carried out to analyse local convective and radiative heat transfer coefficients more in detail. Influence of ambient air flow was analysed. The obtained eigenvalues and corresponding surface heat transfer coefficient values enable to determine thermal conductivity of the analysed specimen together with its thermal diffusivity during a monotonic heating regime.

Results on positron diffusion in Si

International Nuclear Information System (INIS)

Nielsen, B.; Lynn, K.G.; Vehanen, A.; Schultz, P.J.

1984-10-01

Positron diffusion in Si(100) and Si(111) has been measured using a variable energy positron beam. The diffusion related parameter, E 0 is found to be 4.2 +- 0.2 keV, significantly longer than previously reported values. The positron diffusion coefficient is estimated at D/sub +/ = 2.3 +- 0.4 cm 2 /sec, the uncertainty arising mainly from the characteristics of the assumed positron implantation profile. A drastic reduction in E 0 is found after heating the sample to 1300 0 K, showing that previously reported low values of E 0 are associated with the thermal history of the sample. A high sensitivity to defects introduced by low energy ion bombardment is found, and the defect recovery was followed during heat treatments. Reconstruction of the Si(111) surface into the so-called 7 x 7 structure had no detectable influence on the positron diffusion behavior. No changes in the positron diffusion was observed after covering the surface with atomic hydrogen. However the yield of positronium formation at the surface was enhanced, attributed to an increased density of states at the surface

Constant Width Planar Computation Characterizes ACC0

DEFF Research Database (Denmark)

Hansen, Kristoffer Arnsfelt

2006-01-01

We obtain a characterization of ACC0 in terms of a natural class of constant width circuits, namely in terms of constant width polynomial size planar circuits. This is shown via a characterization of the class of acyclic digraphs which can be embedded on a cylinder surface in such a way that all...

Perturbation theory for the effective diffusion constant in a medium of random scatterers

International Nuclear Information System (INIS)

Dean, D S; Drummond, I T; Horgan, R R; Lefevre, A

2004-01-01

We develop perturbation theory and physically motivated resummations of the perturbation theory for the problem of a tracer particle diffusing in a random medium. The random medium contains point scatterers of density ρ uniformly distributed throughout the material. The tracer is a Langevin particle subjected to the quenched random force generated by the scatterers. Via our perturbative analysis, we determine when the random potential can be approximated by a Gaussian random potential. We also develop a self-similar renormalization group approach based on thinning out the scatterers; this scheme is similar to that used with success for diffusion in Gaussian random potentials and agrees with known exact results. To assess the accuracy of this approximation scheme, its predictions are confronted with results obtained by numerical simulation

Radon diffusion studies in some building materials using solid state nuclear track detectors

CERN Document Server

Singh, S; Singh, B; Singh, J

1999-01-01

LR-115 plastic track detector has been used to study radon diffusion through some building materials, viz. cement, soil, marble chips, sand and lime as well as air. Diffusion constant and diffusion length is calculated for all these materials.

Premixed combustion under electric field in a constant volume chamber

KAUST Repository

Cha, Min Suk

2012-12-01

The effects of electric fields on outwardly propagating premixed flames in a constant volume chamber were experimentally investigated. An electric plug, subjected to high electrical voltages, was used to generate electric fields inside the chamber. To minimize directional ionic wind effects, alternating current with frequency of 1 kHz was employed. Lean and rich fuel/air mixtures for both methane and propane were tested to investigate various preferential diffusion conditions. As a result, electrically induced instability showing cracked structure on the flame surface could be observed. This cracked structure enhanced flame propagation speed for the initial period of combustion and led to reduction in flame initiation and overall combustion duration times. However, by analyzing pressure data, it was found that overall burning rates are not much affected from the electric field for the pressurized combustion period. The reduction of overall combustion time is less sensitive to equivalence ratio for methane/air mixtures, whereas the results demonstrate pronounced effects on a lean mixture for propane. The improvement of combustion characteristics in lean mixtures will be beneficial to the design of lean burn engines. Two hypothetical mechanisms to explain the electrically induced instability were proposed: 1) ionic wind initiated hydrodynamic instability and 2) thermodiffusive instability through the modification of transport property such as mass diffusivity. © 2012 IEEE.

Premixed combustion under electric field in a constant volume chamber

KAUST Repository

Cha, Min; Lee, Yonggyu

2012-01-01

The effects of electric fields on outwardly propagating premixed flames in a constant volume chamber were experimentally investigated. An electric plug, subjected to high electrical voltages, was used to generate electric fields inside the chamber. To minimize directional ionic wind effects, alternating current with frequency of 1 kHz was employed. Lean and rich fuel/air mixtures for both methane and propane were tested to investigate various preferential diffusion conditions. As a result, electrically induced instability showing cracked structure on the flame surface could be observed. This cracked structure enhanced flame propagation speed for the initial period of combustion and led to reduction in flame initiation and overall combustion duration times. However, by analyzing pressure data, it was found that overall burning rates are not much affected from the electric field for the pressurized combustion period. The reduction of overall combustion time is less sensitive to equivalence ratio for methane/air mixtures, whereas the results demonstrate pronounced effects on a lean mixture for propane. The improvement of combustion characteristics in lean mixtures will be beneficial to the design of lean burn engines. Two hypothetical mechanisms to explain the electrically induced instability were proposed: 1) ionic wind initiated hydrodynamic instability and 2) thermodiffusive instability through the modification of transport property such as mass diffusivity. © 2012 IEEE.

Analytical Solutions of Ionic Diffusion and Heat Conduction in Multilayered Porous Media

Directory of Open Access Journals (Sweden)

Yu Bai

2015-01-01

Full Text Available Ionic diffusion and heat conduction in a multiple layered porous medium have many important engineering applications. One of the examples is the chloride ions from deicers penetrating into concrete structures such as bridge decks. Different overlays can be placed on top of concrete surface to slowdown the chloride penetration. In this paper, the chloride ion diffusion equations were established for concrete structures with multiple layers of protective system. By using Laplace transformation, an analytical solution was developed first for chloride concentration profiles in two-layered system and then extended to multiple layered systems with nonconstant boundary conditions, including the constant boundary and linear boundary conditions. Because ionic diffusion in saturated media and heat conduction are governed by the same form of partial differential equations with different materials parameters, the analytical solution was further extended to handle heat conduction in a multiple layered system under nonconstant boundary conditions. The numerical results were compared with available test data. The basic trends of the analytical solution and the test data agreed quite well.

Layered Cu-based electrode for high-dielectric constant oxide thin film-based devices

International Nuclear Information System (INIS)

Fan, W.; Saha, S.; Carlisle, J.A.; Auciello, O.; Chang, R.P.H.; Ramesh, R.

2003-01-01

Ti-Al/Cu/Ta multilayered electrodes were fabricated on SiO 2 /Si substrates by ion beam sputtering deposition, to overcome the problems of Cu diffusion and oxidation encountered during the high dielectric constant (κ) materials integration. The Cu and Ta layers remained intact through the annealing in oxygen environment up to 600 deg. C. The thin oxide layer, formed on the Ti-Al surface, effectively prevented the oxygen penetration toward underneath layers. Complex oxide (Ba x Sr 1-x )TiO 3 (BST) thin films were grown on the layered Ti-Al/Cu/Ta electrodes using rf magnetron sputtering. The deposited BST films exhibited relatively high permittivity (150), low dielectric loss (0.007) at zero bias, and low leakage current -8 A/cm 2 at 100 kV/cm

Diffusion in the plutonium zirconium system; Diffusion dans le systeme plutonium zirconium

Energy Technology Data Exchange (ETDEWEB)

Lauthier, J C [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

1967-01-15

Research on the compound PuZr{sub 2}: It cannot be obtained by a direct synthesis. We suppose that its formation is due to an oxygen amount which enhances diffusion processes by a contribution of bound extrinsic vacancies. This investigation which concerned a great range of alloys (from 15 to 50 at per cent Pu) has led us to point out the nature of the isothermal transformation. It takes place at 615 deg. + 5 deg. C and is of the peritectoid type. Pu {epsilon} (bcc) + Zr {alpha} (hex) {r_reversible} Pu {delta} (f. cc) Diffusion in hexagonal phase: Diffusion coefficients have been determined from couples made of Pu Zr dilute alloys (1.15 and 0.115 at per cent Pu) and of pure zirconium; these couples have been annealed between 700 and 840 deg. C from 1000 to 3000 hours. The curves C = f(x) were plotted by X ray microanalysis and a autoradiography. They have been analysed assuming that the diffusion coefficient was constant. Our results are the following: D Zr Pu (1.15 % = 11.1 exp (-65000/RT) and D Zr Pu (0.115 %) 0.1 exp (-54000/RT). (author) [French] Recherche du compose PuZr2: II ne peut etre obtenu par synthese directe. Nous pensons que sa formation est liee a la presence d'oxygene, qui, par son apport de lacunes extrinseques accelere les processus de diffusion. Cette etude qui a porte sur toute une serie d'alliages (de 15 a 50 pour cent atomique de Pu), nous a permis de preciser la nafure de la transformation isotherme. Elle situe a 615 deg. + 5 deg. C et est du type peritectoide. Pu {epsilon} (c.c.) + Zr {alpha} (h.c.) {r_reversible} Pu {delta} (c.f.c.) Diffusion en phase {alpha} hexagonale: Les coefficients de diffusion chimique ont ete determines a partir de couples constitues d'alliages PuZr dilues (1,15 pour cent et 0,115 pour cent atomique de Pu) et de zirconium pur. Ces couples ont ete recuits entre 700 et 840 deg. C durant des temps de 1000 a 3000 heures. Les courbes C = f(x) ont ete tracees par microanalyse X et autoradiographie {alpha}. Elles ont ete

Measurements of cesium and strontium diffusion in biotite gneiss

International Nuclear Information System (INIS)

Skagius, K.; Neretnieks, I.

1988-01-01

A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interactions between the nuclides in the ground water and the rock material, such as sorption. To calculate the retardation, it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result shows that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurement of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel

Diffusion measurements of cesium and strontium in biotite gneiss

International Nuclear Information System (INIS)

Skagius, K.; Neretnieks, I.

1985-01-01

A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interaction between the nuclides in the groundwater and the rock material, such as sorption. To calculate the retardation it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result show that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurements of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel. (author)

The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

Directory of Open Access Journals (Sweden)

K.A. Widi

2016-09-01

Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

Self-diffusion in zirconium-α. A calculation

International Nuclear Information System (INIS)

Monti, A.M.

1991-01-01

After controversial discussions about normal and abnormal nature of self-diffusion in phase α in zirconium, the work of Horvath and co-authors has demonstrated the existence of an important negative curvature in the Arrhenius graph. Different reasons have been proposed to explain such unusual behaviour. Such interpretations of experimental results indicate that different effects and mechanisms could be masking thermal diffusion process by vacancy mechanism. The present work aims to determine the diffusion constants corresponding to a vacancy mechanism from computer simulation of this process. (Author) [es

Sustained Administration of Hormones Exploiting Nanoconfined Diffusion through Nanochannel Membranes

Directory of Open Access Journals (Sweden)

Thomas Geninatti

2015-08-01

Full Text Available Implantable devices may provide a superior means for hormone delivery through maintaining serum levels within target therapeutic windows. Zero-order administration has been shown to reach an equilibrium with metabolic clearance, resulting in a constant serum concentration and bioavailability of released hormones. By exploiting surface-to-molecule interaction within nanochannel membranes, it is possible to achieve a long-term, constant diffusive release of agents from implantable reservoirs. In this study, we sought to demonstrate the controlled release of model hormones from a novel nanochannel system. We investigated the delivery of hormones through our nanochannel membrane over a period of 40 days. Levothyroxine, osteocalcin and testosterone were selected as representative hormones based on their different molecular properties and structures. The release mechanisms and transport behaviors of these hormones within 3, 5 and 40 nm channels were characterized. Results further supported the suitability of the nanochannels for sustained administration from implantable platforms.

Carrier illumination measurement of dopant lateral diffusion

International Nuclear Information System (INIS)

Budiarto, E.; Segovia, M.; Borden, P.; Felch, S.

2005-01-01

This paper describes the application of the carrier illumination technique to non-destructively measure the lateral diffusion of implanted dopants after annealing. Experiments to validate the feasibility of this method employed test structures with a constant line width of 300 nm and varying undoped spaces of 100-5000 nm. The test patterns were implanted with a p-type dopant and annealed in a 3 x 3 matrix. For each implant condition, the measured lateral diffusion was found to increase with annealing temperature, as expected. More interestingly, the lateral diffusion was not observed to relate to the vertical diffusion by a fixed proportionality factor, as is usually assumed. The ratio of lateral to vertical diffusion varies with annealing temperature, with a trend that depends on the implant condition

The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

Science.gov (United States)

Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

2013-06-01

In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1