WorldWideScience

Sample records for surface conventional methods

  1. Development of Al2O3 electrospun fibers prepared by conventional sintering method or plasma assisted surface calcination

    Science.gov (United States)

    Mudra, E.; Streckova, M.; Pavlinak, D.; Medvecka, V.; Kovacik, D.; Kovalcikova, A.; Zubko, P.; Girman, V.; Dankova, Z.; Koval, V.; Duzsa, J.

    2017-09-01

    In this paper, the electrospinning method was used for preparation of α-Al2O3 microfibers from PAN/Al(NO3)3 precursor solution. The precursor fibers were thermally treated by conventional method in furnace or low-temperature plasma induced surface sintering method in ambient air. The four different temperatures of PAN/Al(NO3)3 precursors were chosen for formation of α-Al2O3 phase by conventional sintering way according to the transition features observed in the TG/DSC analysis. In comparison, the low-temperature plasma treatment at atmospheric pressure was used as an alternative sintering method at the exposure times of 5, 10 and 30 min. FTIR analysis was used for evaluation of residual polymer after plasma induced calcination and for studying the mechanism of polymer degradation. The polycrystalline alumina fibers arranged with the nanoparticles was created continuously throughout the whole volume of the sample. On the other side the low temperature approach, high density of reactive species and high power density of plasma generated at atmospheric pressure by used plasma source allowed rapid removal of polymer in preference from the surface of fibers leading to the formation of composite ceramic/polymer fibers. This plasma induced sintering of PAN/Al(NO3)3 can have obvious importance in industrial applications where the ceramic character of surface with higher toughness of the fibers are required.

  2. Comparative evaluation of microshear bond strength of the caries-affected dentinal surface treated with conventional method and chemomechanical method (papain).

    Science.gov (United States)

    Chittem, Jyothi; Sajjan, Girija S; Varma, Kanumuri Madhu

    2015-01-01

    There is a growing interest in chemomechanical excavation (papain) in permanent molar teeth. There are several studies dealing with primary molar teeth. The aim of this study was to evaluate the influence of conventional method and Carie-care (chemomechanical method) on the microshear bond strength (μSBS) and the type of failure of an adhesive system to caries-affected dentin of permanent molar teeth. Twenty permanent molar teeth with carious lesions extending into the dentin were selected. Through the center of the carious lesion, teeth were sectioned mesiodistally and divided into two groups based on the method of caries excavation (conventional and chemomechanical method). The time required for the completion of excavation procedure was noted. Samples were again divided into two subgroups in each according to the method of restoration (Ketac N100 and Filtek Z350 composite). The bonded interface was subjected to μSBS testing in a universal testing machine. Fractured surfaces were examined under a stereomicroscope, and representative specimens were examined under scanning electron microscope for the type of failure. It was achieved with unpaired t-test and Kruskal-Wallis H-test at 5% level of significance. The μSBS values of Carie-care groups were similar to that of the conventional method. The μSBSs of resin composite were significantly (P caries excavation. A papain-based chemomechanical agent can be used safely as a method for caries removal when employing conventional adhesive systems.

  3. A comparison of methods used in mapping of Pleistocene-bedrock unconformity: Conventional manual versus surface modeling

    Energy Technology Data Exchange (ETDEWEB)

    Weibel, C.P.; Abert, C.C.; Kempton, J.P. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    Surface modeling software packages allow geologists to model and map topographic and stratigraphic horizons. These map products, however, often differ from maps prepared without computerized mapping. The authors mapping of the Pleistocene-bedrock unconformity in east-central Illinois (1:100,000-scale), which includes the Mahomet paleovalley, illustrates this situation and demonstrates how both mapping methods, manual and computer, contribute to a better understanding of the paleovalley. A conventional hand-drawn map was constructed over a number of years by manually plotting and contouring bedrock elevations, primarily from water well logs, onto various county and local topographic bases. A computer-generated map of the same area was completed as part of a recent project to map the bedrock geology. It was prepared by carefully selecting data, which included geographic coordinates, unique well identification numbers, and bedrock elevations. Primary data sources were hydrocarbon exploration and storage wells. Digitizing the hand-drawn map allowed the two maps to be overlaid and compared. Several significant geomorphic features appeared on one map and not the other because of the use of different databases and inconsistent selection of data used for the hand-drawn map. The hand-drawn map appears more realistic, i.e., like a modern surface, because the mappers used their knowledge of geomorphic concepts in drawing the contours. Most of the data selection for the computer-generated map was completed prior to plotting of the map and therefore is less susceptible to bias interpretations. The computer-generated map, however, is less topographically realistic in areas where data are sparse because the extrapolation methods used to define the surface do not recognize geologic processes or bedrock lithology.

  4. Three-dimensional reconstructions of solid surfaces using conventional microscopes.

    Science.gov (United States)

    Ficker, Tomáš; Martišek, Dalibor

    2016-01-01

    The three-dimensional digital replicas of solid surfaces are subject of interest of different branches of science and technology. The present paper in its introductory parts brings an overview of the various microscopic reconstructive techniques based on optical sectioning. The main attention is devoted to conventional reconstruction methods and especially to that one employing the Fourier transform. The three-dimensional replicas of this special reconstructive frequency method are compared graphically and numerically with the three-dimensional replicas of the confocal method. Based on the comparative study it has been concluded that the quality of the conventional replicas of surfaces possessing textures of intermediate height irregularities is acceptable and almost comparable with the quality of confocal replicas. This study is relevant both for identifying a convenient technique that provides good qualities of three-dimensional replicas and for selecting the hardware whose price is affordable even for small research groups studying rougher surface textures. © Wiley Periodicals, Inc.

  5. Efficacy of low-pressure foam cleaning compared to conventional cleaning methods in the removal of bacteria from surfaces associated with convenience food.

    Science.gov (United States)

    Lambrechts, A A; Human, I S; Doughari, J H; Lues, J F R

    2014-09-01

    Food borne illnesses and food poisoning are cause for concern globally. The diseases are often caused by food contamination with pathogenic bacteria due largely to poor sanitary habits or storage conditions. Prevalence of some bacteria on cleaned and sanitised food contact surfaces from eight convenience food plants in Gauteng (South Africa) was investigated with the view to evaluate the efficacy of the cleaning methods used with such food contact surfaces. The microbial load of eight convenience food manufacturing plants was determined by sampling stainless steel food contact surfaces after they had been cleaned and sanitised at the end of a day's shift. Samples were analysed for Total Plate Count (TPC), Escherichia coli, Salmonella species, Staphylococcus aureus and Listeria species. Results showed that 59 % of the total areas sampled for TPC failed to comply with the legal requirements for surfaces, according to the Foodstuffs, Cosmetics and Disinfectants Act ( 0.05) in terms of Listeria species isolates obtained from both cleaning methods. The LPF method proved to be the superior cleaning option for lowering TPC counts. Regardless of cleaning method used, pathogens continued to flourish on various surfaces, including dry stainless steel, posing a contamination hazard for a considerable period depending on the contamination level and type of pathogen. Intensive training for proper chemical usage and strict procedural compliance among workers for efficient cleaning procedures is recommended.

  6. Fuzzy logic control to be conventional method

    International Nuclear Information System (INIS)

    Eker, Ilyas; Torun, Yunis

    2006-01-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system

  7. Comparative evaluation of the three different surface treatments - conventional, laser and Nano technology methods in enhancing the surface characteristics of commercially pure titanium discs and their effects on cell adhesion: An in vitro study.

    Science.gov (United States)

    Vignesh; Nayar, Sanjna; Bhuminathan; Mahadevan; Santhosh, S

    2015-04-01

    The surface area of the titanium dental implant materials can be increased by surface treatments without altering their shape and form, thereby increasing the biologic properties of the biomaterial. A good biomaterial helps in early cell adhesion and cell signaling. In this study, the commercially pure titanium surfaces were prepared to enable machined surfaces to form a control material and to be compared with sandblasted and acid-etched surfaces, laser treated surfaces and titanium dioxide (20 nm) Nano-particle coated surfaces. The surface elements were characterized. The biocompatibility was evaluated by cell culture in vitro using L929 fibroblasts. The results suggested that the titanium dioxide Nano-particle coated surfaces had good osteoconductivity and can be used as a potential method for coating the biomaterial.

  8. Non-conventional laser surface hardening for axisymmetric components

    Science.gov (United States)

    Liverani, Erica; Battiato, Nadine; Ascari, Alessandro; Fortunato, Alessandro

    2014-02-01

    A new process, based on ring spot geometry, is presented for laser surface hardening of large cylindrical com-ponents. The proposed technique leads to a very hard, deep and uniform treated area along the entire work piece surface without introducing a tempered zone, making the process very attractive compared to conventional induction hardening that exhibits both low energy efficiency and poor flexibility. A complete physical model is presented for the process, together with a study of the influence of process parameters on the final outcome. The results of an extensive validation campaign, carried out following the AISI1040 standard, are also reported.

  9. Magnetic resonance dacryocystography: comparison between conventional surface coils and microscopic coils

    International Nuclear Information System (INIS)

    Abreu Junior, Luiz de; Wolosker, Angela Maria Borri; Borri, Maria Lucia; Galvao Filho, Mario de Melo; Hartmann, Luiz Guilherme de Carvalho; D'Ippolito, Giuseppe; Castro, Claudio Campi de

    2008-01-01

    Objective: Magnetic resonance imaging has been utilized in the evaluation of the lacrimal apparatus with some advantages over conventional dacryocystography. The present study was aimed at acquiring high resolution images utilizing microscopic coils for evaluating typical structures of the lacrimal apparatus as compared with the findings observed with conventional surface coils. Materials and methods: Five asymptomatic volunteers with no history of epiphora were submitted to high-field magnetic resonance imaging with microscopic and conventional surface coils, and STIR sequence after instillation of saline solution. The definition of normal anatomic structures of lacrimal apparatuses was compared utilizing conventional and microscopic surface coils. Based on a consensual scoring system, the mean values for each structure were calculated by two observers. Results: In 90% of cases, higher scores were attributed to images acquired with the microscopic coil. On average, a 1.17 point increase was observed in the scoring of anatomic structures imaged with the microscopic coil. Additionally, a subjective improvement was observed in the signal-to-noise ratio with the microscopic coil. Conclusion: Magnetic resonance dacryocystography with microscopic coils is the appropriate method for evaluating the lacrimal apparatus, providing images with better quality as compared with those acquired with conventional surface coils. (author)

  10. Conventional versus newer methods for detection of drug resistance ...

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Conventional versus newer methods for detection of drug resistance in tuberculosis. Classical microbiological methods are well established but are cumbersome and time consuming. Newer rapid methods for rapid detection of drug resistance - microbiological, ...

  11. Removal of uranium from drinking water by conventional treatment methods

    International Nuclear Information System (INIS)

    Sorg, T.J.

    1989-01-01

    The USEPA currently does not regulate uranium in drinking water but will be revising the radionuclide regulations during 1989 and will propose a maximum contaminant level for uranium. This paper presents treatment technology information on the effectiveness of conventional methods to removal uranium from drinking water. Treatment information based primarily on laboratory and pilot plant studies is presented on conventional coagulation/filtration, ion exchange, lime softening, and reverse osmosis. Ion-exchange treatment has been applied successfully on ground waters by small systems

  12. The Ultimate Pile Bearing Capacity from Conventional and Spectral Analysis of Surface Wave (SASW) Measurements

    Science.gov (United States)

    Faizah Bawadi, Nor; Anuar, Shamilah; Rahim, Mustaqqim A.; Mansor, A. Faizal

    2018-03-01

    A conventional and seismic method for determining the ultimate pile bearing capacity was proposed and compared. The Spectral Analysis of Surface Wave (SASW) method is one of the non-destructive seismic techniques that do not require drilling and sampling of soils, was used in the determination of shear wave velocity (Vs) and damping (D) profile of soil. The soil strength was found to be directly proportional to the Vs and its value has been successfully applied to obtain shallow bearing capacity empirically. A method is proposed in this study to determine the pile bearing capacity using Vs and D measurements for the design of pile and also as an alternative method to verify the bearing capacity from the other conventional methods of evaluation. The objectives of this study are to determine Vs and D profile through frequency response data from SASW measurements and to compare pile bearing capacities obtained from the method carried out and conventional methods. All SASW test arrays were conducted near the borehole and location of conventional pile load tests. In obtaining skin and end bearing pile resistance, the Hardin and Drnevich equation has been used with reference strains obtained from the method proposed by Abbiss. Back analysis results of pile bearing capacities from SASW were found to be 18981 kN and 4947 kN compared to 18014 kN and 4633 kN of IPLT with differences of 5% and 6% for Damansara and Kuala Lumpur test sites, respectively. The results of this study indicate that the seismic method proposed in this study has the potential to be used in estimating the pile bearing capacity.

  13. Conventional and molecular methods to detect bacterial pathogens in mussels.

    Science.gov (United States)

    Gugliandolo, C; Lentini, V; Spanò, A; Maugeri, T L

    2011-01-01

    To detect Aeromonas spp., Salmonella spp., Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus in mussels and water samples from a farming area, conventional and molecular methods were applied to enrichment cultures. The aerolysin gene (aero) of Aeromonas spp., the invasion plasmid antigen B (ipaB) gene of Salmonella spp., the enterotoxin secretion protein (epsM) gene of V. cholerae, the species-specific region of 16S rRNA gene of V. vulnificus, the 16S-23S rDNA (IGS) gene of V. parahaemolyticus and the pR72H fragment of V. parahaemolyticus were amplified by multiplex polymerase chain reaction (PCR) assays on DNA extracted from enrichment cultures. The haemolysin gene (tdh) of pathogenic V. parahaemolyticus was also amplified. Conventional culture method allowed the isolation of V. parahaemolyticus and V. vulnificus from water and mussels. The genes aero, epsM and 16S rRNA of V. vulnificus were occasionally detected in the enrichment cultures. In mussels, the ipaB and IGS genes were detected from June to September and from April to November, respectively. All genes, except aero, were amplified from mussels collected in September, when pathogenic V. parahaemolyticus (tdh+) strains were also isolated. Multiplex-PCR assays were more sensitive and faster than conventional procedures. The results emphasize the need of an accurate and rapid detection of bacterial pathogens in mussels to protect human health. © 2010 The Authors. Letters in Applied Microbiology © 2010 The Society for Applied Microbiology.

  14. Survey and assessment of conventional software verification and validation methods

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.; Mirsky, S.M.

    1993-04-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 134 methods so identified were classified according to their appropriateness for various phases of a developmental lifecycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  15. Clinical and histological patterns of dermatofibroma without gross skin surface change: A comparative study with conventional dermatofibroma

    Directory of Open Access Journals (Sweden)

    Woo Jin Lee

    2015-01-01

    Full Text Available Background : Dermatofibroma sometimes clinically presents as a nodular lesion without gross skin surface change. Clinicopathologic features of this variant of dermatofibroma have not been evaluated. Aims : To assess clinicopathologic features of dermatofibroma presenting as a subcutaneous nodule. Methods : This study reviewed the clinical and histological features of 42 cases of subcutaneous dermatofibromas and compared them with 95 cases of conventional dermatofibroma. Results : Dermatofibroma without gross skin surface change was associated with a shorter pre-diagnosis duration than conventional dermatofibroma. Increase in size during the pre-diagnosis period was significantly more frequent in the conventional type. In addition, these dermatofibromas were more likely than the conventional type to occur in the head and neck region. Although tumor depth was deeper than in the conventional type, less than half of the dermatofibromas without gross skin surface change were found histologically to be "subcutaneous" or "deep-penetrating dermatofibroma". Subcutaneous extension was more frequent in these dermatofibromas while focal stromal hyalinization and hemosiderin deposits were more common in the conventional type. Limitations: This study is a retrospective, single center design. Conclusion : The present study suggests that dermatofibroma without gross skin surface change is a variant type with distinct clinical and histological features that distinguish them from conventional dermatofibroma.

  16. Comparing 3D foot scanning with conventional measurement methods.

    Science.gov (United States)

    Lee, Yu-Chi; Lin, Gloria; Wang, Mao-Jiun J

    2014-01-01

    Foot dimension information on different user groups is important for footwear design and clinical applications. Foot dimension data collected using different measurement methods presents accuracy problems. This study compared the precision and accuracy of the 3D foot scanning method with conventional foot dimension measurement methods including the digital caliper, ink footprint and digital footprint. Six commonly used foot dimensions, i.e. foot length, ball of foot length, outside ball of foot length, foot breadth diagonal, foot breadth horizontal and heel breadth were measured from 130 males and females using four foot measurement methods. Two-way ANOVA was performed to evaluate the sex and method effect on the measured foot dimensions. In addition, the mean absolute difference values and intra-class correlation coefficients (ICCs) were used for precision and accuracy evaluation. The results were also compared with the ISO 20685 criteria. The participant's sex and the measurement method were found (p < 0.05) to exert significant effects on the measured six foot dimensions. The precision of the 3D scanning measurement method with mean absolute difference values between 0.73 to 1.50 mm showed the best performance among the four measurement methods. The 3D scanning measurements showed better measurement accuracy performance than the other methods (mean absolute difference was 0.6 to 4.3 mm), except for measuring outside ball of foot length and foot breadth horizontal. The ICCs for all six foot dimension measurements among the four measurement methods were within the 0.61 to 0.98 range. Overall, the 3D foot scanner is recommended for collecting foot anthropometric data because it has relatively higher precision, accuracy and robustness. This finding suggests that when comparing foot anthropometric data among different references, it is important to consider the differences caused by the different measurement methods.

  17. Conventional, molecular methods and biomarkers molecules in detection of septicemia

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Arabestani

    2015-01-01

    Full Text Available Sepsis is a leading cause of morbidity and mortality in hospitalized patients worldwide and based on studies, 30-40% of all cases of severe sepsis and septic shock results from the blood stream infections (BSIs. Identifying of the disease, performing laboratory tests, and consequently treatment are factors that required for optimum management of BSIs. In addition, applying precise and immediate identification of the etiologic agent is a prerequisite for specific antibiotic therapy of pathogen and thereby decreasing mortality rates. The diagnosis of sepsis is difficult because clinical signs of sepsis often overlap with other noninfectious cases of systemic inflammation. BSIs are usually diagnosed by performing a series of techniques such as blood cultures, polymerase chain reaction-based methods, and biomarkers of sepsis. Extremely time-consuming even to take up to several days is a major limitation of conventional methods. In addition, yielding false-negative results due to fastidious and slow-growing microorganisms and also in case of antibiotic pretreated samples are other limitations. In comparison, molecular methods are capable of examining a blood sample obtained from suspicious patient with BSI and gave the all required information to prescribing antimicrobial therapy for detected bacterial or fungal infections immediately. Because of an emergency of sepsis, new methods are being developed. In this review, we discussed about the most important sepsis diagnostic methods and numbered the advantage and disadvantage of the methods in detail.

  18. Root canal preparation in endodontics: conventional versus laser methods

    Science.gov (United States)

    Goodis, Harold E.; White, Joel M.; Marshall, Sally J.; Marshall, Grayson W.; Moskowitz, Emrey

    1992-06-01

    Conventional cleaning and shaping of root canal systems employs hand and/or rotary instrumentation to remove the contents of the canal and shape the canal to receive a filling material. With the advent of the Nd:YAG laser system another method of accomplishing proper cleaning and shaping is evaluated. Single rooted teeth were radiographed bucco- lingually and mesio-distally and were divided into 2 groups. The first group was accessed and the root canal systems cleaned and shaped with a step back technique utilizing hand files and gates glidden burs. At completion of the procedure the teeth were again radiographed at the same positions as those prior to the procedure. The teeth were split longitudinally and examined under scanning electron microscopy to assess cleaning. The second group of teeth were accessed, and cleaning and shaping was accomplished using the Nd:YAG laser in combination with hand files and rotary instruments. These teeth were subjected to the same analysis as those in the first group. The before and after radiographs of each group were subjected to image analysis to determine effectiveness of the two methods in shaping the canal systems. We will discuss the ability of Nd:YAG to clean and shape root canal spaces and remove smear layer and organic tissue remnants from those areas.

  19. Evaluation of induced defetcs in AISI 304 a steel test pieces using conventional and non conventional ultrasonic inspection methods

    International Nuclear Information System (INIS)

    Rodriguez Prato, Edda C

    2006-01-01

    The use of patterns of reference in the evaluation of pieces by non destructive methods, particularly with ultrasonic techniques, is indispensable because the features of this pattern's defects can be correlated with those found in pieces that are in service. In the industry, stainless steels, particularly Type 340 austenitic steels, are widely used in some systems for their excellent mechanical properties in corrosive mediums. But these same pieces may have discontinuities and defects in the welded regions, that occur mainly during production and installation and are also due to subsequent operating conditions. Volumetric inspection techniques reveal the integrity of a material in its thickness and detect internal discontinuities that are not visible on the surface of the piece. Conventional and non conventional ultrasonic techniques are used most often now and among the non conventional techniques is Ultrasonic Spectroscopy [1-2]. Ultrasonic spectroscopy aims to determine the dependence of the properties and characteristics of the material under study with the frequency. These may be geometric in origin (thickness of layers, size, shape and direction of the discontinuity) or inherent (attenuation, dispersion, absorption). The dependence of the frequency is usually connected to some microscopic geometric properties, such as the grain size in polycrystalline materials. In the characterization and detection of discontinuities, the frequency spectrum of an ultrasonic pulse contains information about the shape, size and direction of a discontinuity [1-3]. Therefore, the ultrasonic spectral analysis is very important for the characterization of materials and contributes to the study and evaluation of the ultrasonic signals [4-6]. This study evaluates the behavior of the ultrasonic signals obtained from patterns of welded pieces of AISI 304 stainless steel by using conventional and non conventional methods of ultrasonic inspection. Welded test pieces of AISI 304

  20. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-03-01

    Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; digitized scannable vinylsiloxanether, VSES-D; and irreversible hydrocolloid, ALG) and 7 digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; Lava COS, LAV; Lava True Definition Scanner, T-Def; 3Shape Trios, TRI; and 3Shape Trios Color, TRC) techniques. Impressions were made 3 times each in 5 participants (N=15). The impressions were then compared within and between the test groups. The cast surfaces were measured point-to-point using the signed nearest neighbor method. Precision was calculated from the (90%-10%)/2 percentile value. The precision ranged from 12.3 μm (VSE) to 167.2 μm (ALG), with the highest precision in the VSE and VSES groups. The deviation pattern varied distinctly according to the impression method. Conventional impressions showed the highest accuracy across the complete dental arch in all groups, except for the ALG group. Conventional and digital impression methods differ significantly in the complete-arch accuracy. Digital impression systems had higher local deviations within the complete arch cast; however, they achieve equal and higher precision than some conventional impression materials. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  1. Comparative Analysis of Biodegradability of Biodiesel obtained by Conventional and Non-Conventional Methods

    OpenAIRE

    Nagaraja Y. P; Chandrashekhar Biradar

    2015-01-01

    Biodiesel is an alternative to conventional diesel fuel made from renewable resources. No engine modifications are required to use biodiesel in place of crude oil-based diesel. The use of biodiesel resulted in lower emissions of unburned hydrocarbons, carbon monoxide and particulate matter. Biodiesel also increased catalytic converter efficiency in reducing particulate emissions. Chemical characterization also revealed lower levels of some toxic and reactive hydrocarbo...

  2. Conventional and acoustic surface plasmons on noble metal surfaces: a time-dependent density functional theory study

    DEFF Research Database (Denmark)

    Yan, Jun; Jacobsen, Karsten W.; Thygesen, Kristian S.

    2012-01-01

    First-principles calculations of the conventional and acoustic surface plasmons (CSPs and ASPs) on the (111) surfaces of Cu, Ag, and Au are presented. The effect of s-d interband transitions on both types of plasmons is investigated by comparing results from the local density approximation...

  3. Bacterial adhesion on conventional and self-ligating metallic brackets after surface treatment with plasma-polymerized hexamethyldisiloxane

    Directory of Open Access Journals (Sweden)

    Rogerio Amaral Tupinambá

    Full Text Available ABSTRACT Introduction: Plasma-polymerized film deposition was created to modify metallic orthodontic brackets surface properties in order to inhibit bacterial adhesion. Methods: Hexamethyldisiloxane (HMDSO polymer films were deposited on conventional (n = 10 and self-ligating (n = 10 stainless steel orthodontic brackets using the Plasma-Enhanced Chemical Vapor Deposition (PECVD radio frequency technique. The samples were divided into two groups according to the kind of bracket and two subgroups after surface treatment. Scanning Electron Microscopy (SEM analysis was performed to assess the presence of bacterial adhesion over samples surfaces (slot and wings region and film layer integrity. Surface roughness was assessed by Confocal Interferometry (CI and surface wettability, by goniometry. For bacterial adhesion analysis, samples were exposed for 72 hours to a Streptococcus mutans solution for biofilm formation. The values obtained for surface roughness were analyzed using the Mann-Whitney test while biofilm adhesion were assessed by Kruskal-Wallis and SNK test. Results: Significant statistical differences (p 0.05. Conclusion: Plasma-polymerized film deposition was only effective on reducing surface roughness and bacterial adhesion in conventional brackets. It was also noted that conventional brackets showed lower biofilm adhesion than self-ligating brackets despite the absence of film.

  4. Bacterial adhesion on conventional and self-ligating metallic brackets after surface treatment with plasma-polymerized hexamethyldisiloxane

    Science.gov (United States)

    Tupinambá, Rogerio Amaral; Claro, Cristiane Aparecida de Assis; Pereira, Cristiane Aparecida; Nobrega, Celestino José Prudente; Claro, Ana Paula Rosifini Alves

    2017-01-01

    ABSTRACT Introduction: Plasma-polymerized film deposition was created to modify metallic orthodontic brackets surface properties in order to inhibit bacterial adhesion. Methods: Hexamethyldisiloxane (HMDSO) polymer films were deposited on conventional (n = 10) and self-ligating (n = 10) stainless steel orthodontic brackets using the Plasma-Enhanced Chemical Vapor Deposition (PECVD) radio frequency technique. The samples were divided into two groups according to the kind of bracket and two subgroups after surface treatment. Scanning Electron Microscopy (SEM) analysis was performed to assess the presence of bacterial adhesion over samples surfaces (slot and wings region) and film layer integrity. Surface roughness was assessed by Confocal Interferometry (CI) and surface wettability, by goniometry. For bacterial adhesion analysis, samples were exposed for 72 hours to a Streptococcus mutans solution for biofilm formation. The values obtained for surface roughness were analyzed using the Mann-Whitney test while biofilm adhesion were assessed by Kruskal-Wallis and SNK test. Results: Significant statistical differences (p 0.05). Conclusion: Plasma-polymerized film deposition was only effective on reducing surface roughness and bacterial adhesion in conventional brackets. It was also noted that conventional brackets showed lower biofilm adhesion than self-ligating brackets despite the absence of film. PMID:28902253

  5. Effects of surface treatments of conventional glass-ionomer on shear bond strength to giomer

    Science.gov (United States)

    Kimyai, Soodabeh; Mohammadi, Narmin; Oskoee, Parnian Alizadeh; Chaharom, Mohammad Esmaeel Ebrahimi; Bahari, Mahmood; Sadr, Alireza; Ahmadizenouz, Ghazaleh

    2012-01-01

    Background: An appropriate bond between glass-ionomer and the superficial resin materials is very important for the success of sandwich technique. The aim of the present in vitro study was to evaluate the effect of three surface treatments of conventional glass-ionomer on its shear bond strength to giomer. Materials and Methods: Sixty cylindrical specimens of a conventional glass-ionomer (GC Fuji II) were prepared and randomly divided into three groups (n = 20). The specimens in groups 1 and 2 were treated with total-etch adhesive resin (Single Bond) along with acid etching, and self-etch adhesive resin (FL-Bond II) on the set glass-ionomer, respectively. Specimens in group 3 were treated with self-etch adhesive resin (FL-Bond II) before initial setting of the glass-ionomer was complete. Then a giomer restorative (Beautifil II) was added to the specimens. Subsequent to thermocycling, the specimens were subjected to shear bond strength test. Failure modes were evaluated under a stereomicroscope. Data were analyzed by one-way analysis of variance and a post hoc Tukey test at a significance level of P glass-ionomer yielded the highest bond strength in the glass-ionomer/giomer sandwich technique. PMID:23559944

  6. [The conventional and the digital impression method for single-unit and multi-unit fixed dental prostheses

    NARCIS (Netherlands)

    Wiersema, E.J.; Kreulen, C.M.; Creugers, N.H.J.

    2013-01-01

    To manufacture single-unit and multi-unit fixed dental prostheses, an accurate cast is required. Casts can be obtained either by the conventional or the digital impression method. For both methods, dry tooth surfaces and a well exposed finish line of the tooth preparation are required. The

  7. Changing perspective on tissue processing - comparison of microwave histoprocessing method with the conventional method

    Directory of Open Access Journals (Sweden)

    G Shrestha

    2015-09-01

    Full Text Available Background: Histopathological examination of tissues requires sliver of formalin fixed tissue that has been chemically processed and then stained with Haematoxylin and Eosin. The time honored conventional method of tissue processing, which requires 12 to 13 hours for completion, is employed at majority of laboratories but is now seeing the

  8. Comparison surface characteristics and chemical composition of conventional metallic and Nickel-Free brackets

    Directory of Open Access Journals (Sweden)

    Ricardo Lima SHINTCOVSK

    2015-01-01

    Full Text Available This study aims at comparing conventional and nickel-free metal bracket surface characteristics with elemental composition by scanning electron microscopy (SEM, using energy dispersive spectroscopy (EDS. The sample consisted of 40 lower incisor brackets divided into four groups: ABZ = conventional brackets, Kirium Abzil 3M® (n = 10; RL = conventional brackets, Roth Light Morelli® (n = 10; NF = nickel-free brackets, Nickel-Free Morelli® (n = 10; and RM = nickel-free brackets, Roth Max Morelli® (n = 10. Qualitative evaluation of the bracket surface was performed using SEM, whereby surface features were described and compared. The elemental composition was analyzed by EDS. According to surface analysis,groups ABZ and RL showed a homogeneous surface, with better finishing, whereas the surfaces in groups NF and RM were rougher. The chemical components with the highest percentage were Fe, Cr and C. Groups NF and MR showed no nickel in their composition. In conclusion, the bracket surface of the ABZ and RL groups was more homogeneous, with grooves and pores, whereas the surfaces in groups NF and RM showed numerous flaws, cracks, pores and grooves. The chemical composition analysis confirmed that the nickel-free brackets had no Ni in their composition, as confirmed by the manufacturer’s specifications, and were therefore safe to use in patients with a medical history of allergy to this metal.

  9. A review on mathematical methods of conventional and Islamic derivatives

    Science.gov (United States)

    Hisham, Azie Farhani Badrol; Jaffar, Maheran Mohd

    2014-12-01

    Despite the impressive growth of risk management tools in financial institutions, Islamic finance remains miles away behind the conventional institutions. Islamic finance products need to comply with the syariah law and prohibitions, therefore they can use fewer of the available risk management tools compared to conventional. Derivatives have proven to be the effective hedging technique and instrument that broadly being used in the conventional institutions to manage their risks. However, derivatives are not generally accepted as the legitimate products in Islamic finance and they remain controversial issues among the Islamic scholars. This paper reviews the evolution of derivatives such as forwards, futures and options and then explores the mathematical models that being used to solve derivatives such as random walk model, asset pricing model that follows Brownian motion and Black-Scholes model. Other than that, this paper also critically discuss the perspective of derivatives from Islamic point of view. In conclusion, this paper delivers the traditional Islamic products such as salam, urbun and istijrar that can be used to create building blocks of Islamic derivatives.

  10. Comparative study of the geostatistical ore reserve estimation method over the conventional methods

    International Nuclear Information System (INIS)

    Kim, Y.C.; Knudsen, H.P.

    1975-01-01

    Part I contains a comprehensive treatment of the comparative study of the geostatistical ore reserve estimation method over the conventional methods. The conventional methods chosen for comparison were: (a) the polygon method, (b) the inverse of the distance squared method, and (c) a method similar to (b) but allowing different weights in different directions. Briefly, the overall result from this comparative study is in favor of the use of geostatistics in most cases because the method has lived up to its theoretical claims. A good exposition on the theory of geostatistics, the adopted study procedures, conclusions and recommended future research are given in Part I. Part II of this report contains the results of the second and the third study objectives, which are to assess the potential benefits that can be derived by the introduction of the geostatistical method to the current state-of-the-art in uranium reserve estimation method and to be instrumental in generating the acceptance of the new method by practitioners through illustrative examples, assuming its superiority and practicality. These are given in the form of illustrative examples on the use of geostatistics and the accompanying computer program user's guide

  11. Conventional and more recent methods of radiodiagnosis of mammary carcinoma

    International Nuclear Information System (INIS)

    Kutarna, A.; Klacko, J.; Malatin, O.; Glomba, J.; Celovsky, F.

    1988-01-01

    The methods are listed and briefly characterized. They are categorized by energy used and for some, future applications are given. X-ray methods are believed to be the most frequently used and deemed to remain so. (M.D.)

  12. Surface decontamination compositions and methods

    Science.gov (United States)

    Wright,; Karen, E [Idaho Falls, ID; Cooper, David C [Idaho Falls, ID; Peterman, Dean R [Idaho Falls, ID; Demmer, Ricky L [Idaho Falls, ID; Tripp, Julia L [Pocatello, ID; Hull, Laurence C [Idaho Falls, ID

    2011-03-29

    Clay-based compositions capable of absorbing contaminants from surfaces or objects having surface faces may be applied to a surface and later removed, the removed clay-based compositions absorbing at least a portion of the contaminant from the surface or object to which it was applied.

  13. Comparison of porcelain surface and flexural strength obtained by microwave and conventional oven glazing.

    Science.gov (United States)

    Prasad, Soni; Monaco, Edward A; Kim, Hyeongil; Davis, Elaine L; Brewer, Jane D

    2009-01-01

    Although the superior qualities of microwave technology are common knowledge in the industry, effects of microwave glazing of dental ceramics have not been investigated. The purpose of this study was to investigate the surface roughness and flexural strength achieved by glazing porcelain specimens in a conventional and microwave oven. Thirty specimens of each type of porcelain (Omega 900 and IPS d.Sign) were fabricated and sintered in a conventional oven. The specimens were further divided into 3 groups (n=10): hand polished (using diamond rotary ceramic polishers), microwave glazed, and conventional oven glazed. Each specimen was evaluated for surface roughness using a profilometer. The flexural strength of each specimen was measured using a universal testing machine. A 2-way ANOVA and Tukey HSD post hoc analysis were used to determine significant intergroup differences in surface roughness (alpha=.05). Flexural strength results were also analyzed using 2-way ANOVA, and the Weibull modulus was determined for each of the 6 groups. The surfaces of the specimens were subjectively evaluated for cracks and porosities using a scanning electron microscope (SEM). A significant difference in surface roughness was found among the surface treatments (P=.02). Follow-up tests showed a significant difference in surface roughness between oven-glazed and microwave-glazed treatments (P=.02). There was a significant difference in flexural strength between the 2 porcelains (Poven-glazed porcelain. Omega 900 had an overall higher flexural strength than IPS d.Sign. Weibull distributions of flexural strengths for Omega 900 oven-glazed and microwave-glazed specimens were similar. SEM analysis demonstrated a greater number of surface voids and imperfections in IPS d. Sign as compared to Omega 900.

  14. Tomographs based on non-conventional radiation sources and methods

    International Nuclear Information System (INIS)

    Barbuzza, R.; Fresno, M. del; Venere, Marcelo J.; Clausse, Alejandro; Moreno, C.

    2000-01-01

    Computer techniques for tomographic reconstruction of objects X-rayed with a compact plasma focus (PF) are presented. The implemented reconstruction algorithms are based on stochastic searching of solutions of Radon equation, using Genetic Algorithms and Monte Carlo methods. Numerical experiments using actual projections were performed concluding the feasibility of the application of both methods in tomographic reconstruction problem. (author)

  15. Recovery Rate of intestinal parasites using conventional methods in ...

    African Journals Online (AJOL)

    None of the methods could detect all the cases observed in the study alone, thus no single technique was satisfactory as none was equally applicable for trophozoites and cysts of protozoa, eggs or larvae of helminths. Brine flotation technique should be added to the routine diagnostic method (wet preparation), since it ...

  16. Preparation, characterization and catalytic properties of nickel aluminate nanoparticles: A comparison between conventional and microwave method

    Directory of Open Access Journals (Sweden)

    C. Ragupathi

    2017-01-01

    Full Text Available In the present work, synthesis of nickel aluminate using Opuntia dilenii haw as plant extract by a microwave combustion method (MCM and its comparison with the conventional combustion method (CCM is investigated. O. dilenii haw plant extract simplifies the process, provides an alternative process for a simple and an economical synthesis. The absence of surfactant has led to a simple, cheap and fast method of synthesis of NiAl2O4 nanoparticles. The as-synthesized NiAl2O4 nanoparticles were characterized by X-ray diffraction (XRD studies, Fourier transform infrared spectroscopy (FT-IR studies, high resolution scanning electron microscopy (HR-SEM, energy dispersive X-ray analysis (EDX, high resolution transmission electron microscopy (HR-TEM, diffuses reflectance spectroscopy (DRS, and Brunauer Emmett Teller (BET surface area analysis. The XRD results confirmed the formation of the cubic phase NiAl2O4. The formation of pure nickel aluminate phase was confirmed by FT-IR. The formation of NiAl2O4 nanoparticles was confirmed by HR-SEM and HR-TEM and their possible formation mechanisms were also proposed. MCM could produce NiAl2O4 with uniform size and well-defined shape with crystallinity. The optical property was determined by DRS. NiAl2O4 prepared by the microwave combustion method was found to possess a higher surface area, lower crystallite size than the NiAl2O4 nanoparticles prepared by the conventional combustion method, which in turn has led to the improved performance toward the selective oxidation of benzyl alcohol to benzaldehyde.

  17. A hybrid microfluidic-vacuum device for direct interfacing with conventional cell culture methods

    Directory of Open Access Journals (Sweden)

    Monuki Edwin S

    2007-09-01

    Full Text Available Abstract Background Microfluidics is an enabling technology with a number of advantages over traditional tissue culture methods when precise control of cellular microenvironment is required. However, there are a number of practical and technical limitations that impede wider implementation in routine biomedical research. Specialized equipment and protocols required for fabrication and setting up microfluidic experiments present hurdles for routine use by most biology laboratories. Results We have developed and validated a novel microfluidic device that can directly interface with conventional tissue culture methods to generate and maintain controlled soluble environments in a Petri dish. It incorporates separate sets of fluidic channels and vacuum networks on a single device that allows reversible application of microfluidic gradients onto wet cell culture surfaces. Stable, precise concentration gradients of soluble factors were generated using simple microfluidic channels that were attached to a perfusion system. We successfully demonstrated real-time optical live/dead cell imaging of neural stem cells exposed to a hydrogen peroxide gradient and chemotaxis of metastatic breast cancer cells in a growth factor gradient. Conclusion This paper describes the design and application of a versatile microfluidic device that can directly interface with conventional cell culture methods. This platform provides a simple yet versatile tool for incorporating the advantages of a microfluidic approach to biological assays without changing established tissue culture protocols.

  18. Strengthening and Rehabilitation Conventional Methods for Masonry Structures

    OpenAIRE

    Pleşu, Raluca; Ţăranu, George; Covatariu, Daniel; Grădinariu, Ionuţ-Dan

    2011-01-01

    The study and development of rehabilitation and strengthening methods for masonry structures is a permanent concern of civil engineers, because of the high proportion of existing structural masonry and their vulnerability to exceptional loads, especially from seismic action. This paper presents an overview of existing methodologies for strengthening and rehabilitation of masonry structures using traditional materials.

  19. Energy indices in irrigated wheat production under conservation and conventional tillage and planting methods

    Directory of Open Access Journals (Sweden)

    S. M Hosseini

    2016-04-01

    using a moldboard plow and secondary tillage operation was done using a disk harrow and land leveler. Seed bed was prepared in the reduced tillage method using a tine and disc cultivator which was able to complete the primary and secondary tillage operations simultaneously. Wheat seed was directly planted using direct planter without any seed bed preparation in the zero tillage method. Surface irrigation method was used to irrigate the plots and 11970 m3/ha water was consumed in each treatment. Input energies including direct energy (diesel and electricity and indirect energy (water, labor, seed, fertilizer, chemicals, and machinery were measured and calculated. Output energies (energy of grain and straw were measured in each treatment and the share of each input energy, energy ratio, net energy gain, and energy productivity were determined and compared. Collected data were analyzed using SAS software and Duncan’s multiple range tests was used to compare the treatments means. Results and Discussion: Results showed that tillage and planting methods had a significant effect on fuel and machinery energies; while, the total input energy, crop grain yield, and crop biologic yield were not affected by the tillage and planting methods (Table 4. Fertilizers and chemicals had the highest contribution in input energy of all treatments. Results also indicated that reduced tillage and seeding with Roto-seeder had the highest energy ratio (1.46 and the lowest energy ratio (1.40 was related to the conventional tillage methods (Fig.1. The highest net energy gain (47653 MJ was obtained from the reduced tillage and seeding with Roto-seeder; while, the lowest amount of net energy gain (41388 MJ was related to the conventional tillage and planting with Machine Barzegar grain drill (Fig.3. Results also showed that the reduced tillage and seeding with Roto-seeder had the highest energy productivity (0.115 kg MJ-1 and the conventional tillage treatments had the lowest energy productivity

  20. Conventional estimating method of earthquake response of mechanical appendage system

    International Nuclear Information System (INIS)

    Aoki, Shigeru; Suzuki, Kohei

    1981-01-01

    Generally, for the estimation of the earthquake response of appendage structure system installed in main structure system, the method of floor response analysis using the response spectra at the point of installing the appendage system has been used. On the other hand, the research on the estimation of the earthquake response of appendage system by the statistical procedure based on probability process theory has been reported. The development of a practical method for simply estimating the response is an important subject in aseismatic engineering. In this study, the method of estimating the earthquake response of appendage system in the general case that the natural frequencies of both structure systems were different was investigated. First, it was shown that floor response amplification factor was able to be estimated simply by giving the ratio of the natural frequencies of both structure systems, and its statistical property was clarified. Next, it was elucidated that the procedure of expressing acceleration, velocity and displacement responses with tri-axial response spectra simultaneously was able to be applied to the expression of FRAF. The applicability of this procedure to nonlinear system was examined. (Kako, I.)

  1. Surface treatment and protection method for cadmium zinc telluride crystals

    Science.gov (United States)

    Wright, Gomez W.; James, Ralph B.; Burger, Arnold; Chinn, Douglas A.

    2003-01-01

    A method for treatment of the surface of a CdZnTe (CZT) crystal that provides a native dielectric coating to reduce surface leakage currents and thereby, improve the resolution of instruments incorporating detectors using CZT crystals. A two step process is disclosed, etching the surface of a CZT crystal with a solution of the conventional bromine/methanol etch treatment, and after attachment of electrical contacts, passivating the CZT crystal surface with a solution of 10 w/o NH.sub.4 F and 10 w/o H.sub.2 O.sub.2 in water.

  2. Surface Treatment And Protection Method For Cadium Zinc Telluride Crystals

    Science.gov (United States)

    Wright, Gomez W.; James, Ralph B.; Burger, Arnold; Chinn, Douglas A.

    2006-02-21

    A method for treatment of the surface of a CdZnTe (CZT) crystal that provides a native dielectric coating to reduce surface leakage currents and thereby, improve the resolution of instruments incorporating detectors using CZT crystals. A two step process is disclosed, etching the surface of a CZT crystal with a solution of the conventional bromine/methanol etch treatment, and after attachment of electrical contacts, passivating the CZT crystal surface with a solution of 10 w/o NH4F and 10 w/o H2O2 in water.

  3. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions.

    Science.gov (United States)

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-09-01

    Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. Impressions were obtained via two conventional (metal full-arch tray, CI, and triple tray, T-Tray) and seven digital impression systems (Lava True Definition Scanner, T-Def; Lava Chairside Oral Scanner, COS; Cadent iTero, ITE; 3Shape Trios, TRI; 3Shape Trios Color, TRC; CEREC Bluecam, Software 4.0, BC4.0; CEREC Bluecam, Software 4.2, BC4.2; and CEREC Omnicam, OC). Impressions were taken three times for each of five subjects (n = 15). The impressions were then superimposed within the test groups. Differences from model surfaces were measured using a normal surface distance method. Precision was calculated using the Perc90_10 value. The values for all test groups were statistically compared. The precision ranged from 18.8 (CI) to 58.5 μm (T-Tray), with the highest precision in the CI, T-Def, BC4.0, TRC, and TRI groups. The deviation pattern varied distinctly depending on the impression method. Impression systems with single-shot capture exhibited greater deviations at the tooth surface whereas high-frame rate impression systems differed more in gingival areas. Triple tray impressions displayed higher local deviation at the occlusal contact areas of upper and lower jaw. Digital quadrant impression methods achieve a level of precision, comparable to conventional impression techniques. However, there are significant differences in terms of absolute values and deviation pattern. With all tested digital impression systems, time efficient capturing of quadrant impressions is possible. The clinical precision of digital quadrant impression models is sufficient to cover a broad variety of

  4. A Critical Analysis of the Conventionally Employed Creep Lifing Methods

    Directory of Open Access Journals (Sweden)

    Zakaria Abdallah

    2014-04-01

    Full Text Available The deformation of structural alloys presents problems for power plants and aerospace applications due to the demand for elevated temperatures for higher efficiencies and reductions in greenhouse gas emissions. The materials used in such applications experience harsh environments which may lead to deformation and failure of critical components. To avoid such catastrophic failures and also increase efficiency, future designs must utilise novel/improved alloy systems with enhanced temperature capability. In recognising this issue, a detailed understanding of creep is essential for the success of these designs by ensuring components do not experience excessive deformation which may ultimately lead to failure. To achieve this, a variety of parametric methods have been developed to quantify creep and creep fracture in high temperature applications. This study reviews a number of well-known traditionally employed creep lifing methods with some more recent approaches also included. The first section of this paper focuses on predicting the long-term creep rupture properties which is an area of interest for the power generation sector. The second section looks at pre-defined strains and the re-production of full creep curves based on available data which is pertinent to the aerospace industry where components are replaced before failure.

  5. Gaharu oil processing: gaharu oil from conventional extraction method

    International Nuclear Information System (INIS)

    Mohd Fajri Osman; Mat Rasol Awang; Ahsanulkhaliqin Abd Wahab; Chow Saw Peng; Shyful Azizi Abd Rahman; Khairuddin Abdul Rahim

    2006-01-01

    Gaharu oil is extracted through water or steam distillation of gaharu wood powder. Gaharu oil can fetch prices ranging from RM 25,000 to RM 50,000 per kg, depending on the quality or grade of gaharu wood used to produce the oil. The oil is commonly exported to the Middle East and customarily used as a perfume base. This paper describes gaharu oil extraction technique from traditional method which is commonly practiced by gaharu entrepreneurs in Malaysia. Gaharu woods are initially chopped, dried and ground into powder form. The gaharu wood powder is then soaked in water for a week. After the soaking process, the fermented powder is distilled with water using a special distiller for 4 to 10 days depending on the quality of gaharu wood used in the extraction process. (Author)

  6. Different Results of Proximal Coronary Endarterectomy via Conventional Pull-Out Method

    OpenAIRE

    Başar Sareyyüpoğlu; Özgür Yıldırım; Kaan Kırali

    2012-01-01

    In these cases we overview two different results of coronary endarterectomy via conventional pull-out method. Performing proximal aggressive coronary endarterectomy by pull-out method can cause undesirable complication in the proximal coronary artery segment.

  7. Effect of antibacterial agents on the surface hardness of a conventional glass-ionomer cement

    Science.gov (United States)

    TÜZÜNER, Tamer; ULUSU, Tezer

    2012-01-01

    In atraumatic restorative treatment (ART), caries removal with hand excavation instruments is not as efficient as that with rotary burs in eliminating bacteria under the glass ionomer cements (GICs). Thus, different antibacterial agents have been used in recent studies to enhance the antibacterial properties of the GICs, without jeopardizing their basic physical properties. Objective The objective of this study was to evaluate the effect of antibacterial agents on the surface hardness of a conventional GIC (Fuji IX) using Vickers microhardness [Vickers hardness number (VHN)] test. Material and Methods Cetrimide (CT), cetylpyridinium chloride (CPC) and chlorhexidine (CHX) were added to the powder and benzalkonium chloride (BC) was added to the liquid of Fuji IX in concentrations of 1% and 2%, and served as the experimental groups. A control group containing no additive was also prepared. After the completion of setting reaction, VHN measurements were recorded at 1, 7, 15, 30, 60, and 90 days after storage in 37ºC distilled water. A one-way ANOVA was performed followed by a Dunnett t test and Tamhane T2 tests and also repeated measurements ANOVA was used for multiple comparisons in 95% confidence interval. Results VHN results showed significant differences between the control and the experimental groups at all time periods (phardness of set cements. Conclusions Despite the decreased microhardness values in all experimental groups compared to the controls after 7 up to 90 days, incorporating certain antibacterial agents into Fuji IX GIC showed tolerable microhardness alterations within the limitations of this in vitro study. PMID:22437677

  8. [The conventional and the digital impression method for single-unit and multi-unit fixed dental prostheses].

    Science.gov (United States)

    Wiersema, E J; Kreulen, C M; Creugers, N H J

    2013-01-01

    To manufacture single-unit and multi-unit fixed dental prostheses, an accurate cast is required. Casts can be obtained either by the conventional or the digital impression method. For both methods, dry tooth surfaces and a well exposed finish line of the tooth preparation are required. The conventional impression method requires an elastic impression material. Elastomers have a high detail accuracy, which can produce, in combination with a good fitting and rigid impression tray, an impression with reliable dimensional stability. Based on the number of different impression material consistencies used and the number ofphases of the impression procedure, several options of the conventional impression method can be distinguished. For the digital impression method, teeth or implants are scanned to produce a digital cast which can be used directly with the help of computer technology to produce single-unit or multi-unit fixed dental prostheses. The digital impression method has a number of advantages when compared to the conventional impression method, but is not applicable for all prosthetic cases.

  9. [Study on friction and wear properties of dental zirconia ceramics processed by microwave and conventional sintering methods].

    Science.gov (United States)

    Guoxin, Hu; Ying, Yang; Yuemei, Jiang; Wenjing, Xia

    2017-04-01

    This study evaluated the wear of an antagonist and friction and wear properties of dental zirconia ceramic that was subjected to microwave and conventional sintering methods. Ten specimens were fabricated from Lava brand zirconia and randomly assigned to microwave and conventional sintering groups. A profile tester for surface roughness was used to measure roughness of the specimens. Wear test was performed, and steatite ceramic was used as antagonist. Friction coefficient curves were recorded, and wear volume were calculated. Finally, optical microscope was used to observe the surface morphology of zirconia and steatite ceramics. Field emission scanning electron microscopy was used to observe the microstructure of zirconia. Wear volumes of microwave and conventionally sintered zirconia were (6.940±1.382)×10⁻², (7.952±1.815) ×10⁻² mm³, respectively. Moreover, wear volumes of antagonist after sintering by the considered methods were (14.189±4.745)×10⁻², (15.813±3.481)×10⁻² mm³, correspondingly. Statistically significant difference was not observed in the wear resistance of zirconia and wear volume of steatite ceramic upon exposure to two kinds of sintering methods. Optical microscopy showed that ploughed surfaces were apparent in zirconia. The wear surface of steatite ceramic against had craze, accompanied by plough. Scanning electron microscopy showed that zirconia was sintered compactly when subjected to both conventional sintering and microwave methods, whereas grains of zirconia sintered by microwave alone were smaller and more uniform. Two kinds of sintering methods are successfully used to produce dental zirconia ceramics with similar friction and wear properties.
.

  10. Conventional and improved cytotoxicity test methods of newly developed biodegradable magnesium alloys

    Science.gov (United States)

    Han, Hyung-Seop; Kim, Hee-Kyoung; Kim, Yu-Chan; Seok, Hyun-Kwang; Kim, Young-Yul

    2015-11-01

    Unique biodegradable property of magnesium has spawned countless studies to develop ideal biodegradable orthopedic implant materials in the last decade. However, due to the rapid pH change and extensive amount of hydrogen gas generated during biocorrosion, it is extremely difficult to determine the accurate cytotoxicity of newly developed magnesium alloys using the existing methods. Herein, we report a new method to accurately determine the cytotoxicity of magnesium alloys with varying corrosion rate while taking in-vivo condition into the consideration. For conventional method, extract quantities of each metal ion were determined using ICP-MS and the result showed that the cytotoxicity due to pH change caused by corrosion affected the cell viability rather than the intrinsic cytotoxicity of magnesium alloy. In physiological environment, pH is regulated and adjusted within normal pH (˜7.4) range by homeostasis. Two new methods using pH buffered extracts were proposed and performed to show that environmental buffering effect of pH, dilution of the extract, and the regulation of eluate surface area must be taken into consideration for accurate cytotoxicity measurement of biodegradable magnesium alloys.

  11. Accuracy of surface registration compared to conventional volumetric registration in patient positioning for head-and-neck radiotherapy: A simulation study using patient data

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Youngjun [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California 94305 and Center for Bionics, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Li, Ruijiang; Na, Yong Hum; Xing, Lei [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California 94305 (United States); Lee, Rena, E-mail: renalee@ewha.ac.kr [Department of Radiation Oncology, Ewha Womans University School of Medicine, Seoul 158-710 (Korea, Republic of)

    2014-12-15

    Purpose: 3D optical surface imaging has been applied to patient positioning in radiation therapy (RT). The optical patient positioning system is advantageous over conventional method using cone-beam computed tomography (CBCT) in that it is radiation free, frameless, and is capable of real-time monitoring. While the conventional radiographic method uses volumetric registration, the optical system uses surface matching for patient alignment. The relative accuracy of these two methods has not yet been sufficiently investigated. This study aims to investigate the theoretical accuracy of the surface registration based on a simulation study using patient data. Methods: This study compares the relative accuracy of surface and volumetric registration in head-and-neck RT. The authors examined 26 patient data sets, each consisting of planning CT data acquired before treatment and patient setup CBCT data acquired at the time of treatment. As input data of surface registration, patient’s skin surfaces were created by contouring patient skin from planning CT and treatment CBCT. Surface registration was performed using the iterative closest points algorithm by point–plane closest, which minimizes the normal distance between source points and target surfaces. Six degrees of freedom (three translations and three rotations) were used in both surface and volumetric registrations and the results were compared. The accuracy of each method was estimated by digital phantom tests. Results: Based on the results of 26 patients, the authors found that the average and maximum root-mean-square translation deviation between the surface and volumetric registrations were 2.7 and 5.2 mm, respectively. The residual error of the surface registration was calculated to have an average of 0.9 mm and a maximum of 1.7 mm. Conclusions: Surface registration may lead to results different from those of the conventional volumetric registration. Only limited accuracy can be achieved for patient

  12. CAM visual stimulation with conventional method of occlusion treatment in amblyopia: a randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Ali Reza Jafari

    2014-04-01

    Conclusion: Using of CAM visual stimulation along with conventional occlusion will further improve visual acuity and stereopsis in amblyopic children. These findings recommended the CAM visual stimulation as an accompanying and complementary method in amblyopia treatment.

  13. Surface severe plastic deformation of AISI 304 via conventional shot peening, severe shot peening and repeening

    Energy Technology Data Exchange (ETDEWEB)

    Unal, Okan, E-mail: unalokan78@gmail.com [Mechanical Engineering Department, Bartın University, Bartın 74100 (Turkey); Varol, Remzi [Mechanical Engineering Department, Suleyman Demirel University, Isparta 32200 (Turkey)

    2015-10-01

    Highlights: • CSP and SSP treatments transform austenite to metastable martensite structure. • Nanograin layer thickness after CSP and SSP is 8 μm and 22 μm, respectively. • Shot peening leads to carbon segregation from coarse to nano grain layer. • Repeening is an effective way to reduce surface roughness. - Abstract: Air blast conventional shot peening (CSP), severe shot peening (SSP) and repeening (RP) as a severe plastic deformation applications on AISI 304 austenitic stainless steel is addressed. Shot peened specimens are investigated based on optical, FESEM and digital microscope. The investigations present the austenite transformation to metastable martensite via mechanical twinning due to plastic deformation with high strain rates. It is found that SSP induces thicker nanograin layer with compared to CSP. In XRD studies, the austenite peaks broaden by means of severe shot peening and FWHM increase reveals the grain size reduction below 25 nm regimes on the surface. In EDAX line analysis of CSP specimen, carbon content increase has been detected from deformed layer through the nanocrystalline layer then the content reduces. The carbon segregation takes place due to the energy level distinction between dislocations and Fe−C bonds. 3d contour digital microscope studies and roughness investigations reveal that SSP has deleterious side effect on the surface roughness and surface flatness. However, RP is an effective way to reduce the surface roughness to reasonable values.

  14. METHODS TO DEVELOP A TOROIDAL SURFACE

    Directory of Open Access Journals (Sweden)

    DANAILA Ligia

    2017-05-01

    Full Text Available The paper work presents two practical methods to draw the development of a surface unable to be developed applying classical methods of Descriptive Geometry, the toroidal surface, frequently met in technical practice. The described methods are approximate ones; the development is obtained with the help of points. The accuracy of the methods is given by the number of points used when drawing. As for any other approximate method, when practically manufactured the development may need to be adjusted on site.

  15. Comparative study of Candida by conventional and CHROMagar method in non-denture and denture wearers by oral rinse technique

    Directory of Open Access Journals (Sweden)

    Shruti Nayak

    2012-01-01

    Full Text Available Introduction: Candidal species colonizes the oral cavities of healthy individuals without dentures and also of denture wearers. Soft liners and tissue conditioning materials have been found to support the growth of Candida albicans which may predispose to lesions. The most important and common candidal species are C. albicans, C. tropicalis, and C. glabrata. C albicans is usually isolated from both the fitting surface of the denture and the denture-bearing mucosa of the affected patients. The aim of this study was to isolate, quantify, and speciate candidal species in non-denture wearers (controls and denture wearers (study group by the oral rinse technique. Isolation was done using Sabouraud dextrose agar (SDA. Speciation was done using conventional methods like the germ tube test, carbohydrate fermentation test, urease test, as well as the CHROMagar method. Aims and Objective: 1 To assess the prevalence of Candida in non-denture wearers and in denture wearers by oral rinse technique, with isolation on SDA; 2 to speciate and quantify Candida in non-denture wearers and denture wearers by using conventional methods (germ tube test, carbohydrate fermentation test, urease test and the CHROMagar method; 3 to assess the influence of smoking and diabetes on candidal species among the denture wearers; and 4 to assess the sensitivity and specificity of SDA and CHRO Magar Materials and Methods: Salivary samples for Candida evaluation were collected from the subjects in sterile sample containers, using the oral rinse technique. Results: C glabrata was the most commonly found species among denture wearers and non-denture wearers both by conventional and CHROMagar methods. In males, C. albicans was the predominant species, whereas C. glabrata was the predominant species in females. Candidal colonization was higher in denture wearers compared to non-denture wearers, especially among females. The CHROMagar method was more rapid compared to conventional

  16. Microchannels Effective Method for the Extraction of Oleuropein Compared with Conventional Methods

    Directory of Open Access Journals (Sweden)

    Mahnaz Yasemi

    2017-01-01

    Full Text Available Different methods of oleuropein extraction from olive leaf were investigated, including maceration, soxhlet, ultrasonic-assisted extraction, and microchannel. In current research, a response surface methodology (RSM was used for prediction of the optimal values of parameters affecting the extraction of oleuropein through two methods of ultrasound and microchannel. Frequency (F, temperature (T, and power of ultrasound (P were the parameters which were studied in ultrasound method, but in microchannel system effects of pH and temperature (T, volumetric flow rate ratio of two phases (VR, and contact time (CT of two phases were optimized. UV detector device at 254 nm was used to recognize oleuropein through comparison of the retention time of the extracts with standard compound in chromatogram. The analysis of extracts was performed using HPLC. Optimum conditions for ultrasound were obtained as follows: F=80 kHz, T = 25°C, and P=100 w. Using these optimum conditions, the extraction of oleuropein was 81.29%. Amount of oleuropein extraction by microchannel method in optimum conditions was 96.29%, which was way more than other applied methods. Microchannel system as a continuous method has many advantages including low solvent consumption, being environment friendly, short time for extraction, and high efficiency.

  17. Increased recovery of touch DNA evidence using FTA paper compared to conventional collection methods.

    Science.gov (United States)

    Kirgiz, Irina A; Calloway, Cassandra

    2017-04-01

    21 samples (69%) and a partial profile was observed for nine samples (25%); STR analysis failed for two samples collected using tape (6%). In conclusion, we show that the FTA paper scraping method has the potential to collect higher DNA yields from touch DNA evidence deposited on non-porous surfaces often encountered in criminal cases compared to conventional methods. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  18. The clinical significance of computerized axial tomography (CAT) in consideration of conventional diagnostic methods

    International Nuclear Information System (INIS)

    Huenig, R.

    1976-01-01

    Regarding CAT of the intracranial region, the article informs on a) techniques of examination including the production of normal structures, b) the recognizable pathological changes, c) possibilities of enhancement, d) possibilities of course observation, e) limitations of the methods, as well as on f) risk/benefit aspects g) benefit/cost calculations as compared to conventional methods, and on h) the influence of CAT on the frequency of conventional methods of examination. Regarding CAT of the extracranial region, the information available up to the meeting is reported on. (orig./LH) [de

  19. Comparison between laser terahertz emission microscope and conventional methods for analysis of polycrystalline silicon solar cell

    Directory of Open Access Journals (Sweden)

    Hidetoshi Nakanishi

    2015-11-01

    Full Text Available A laser terahertz emission microscope (LTEM can be used for noncontact inspection to detect the waveforms of photoinduced terahertz emissions from material devices. In this study, we experimentally compared the performance of LTEM with conventional analysis methods, e.g., electroluminescence (EL, photoluminescence (PL, and laser beam induced current (LBIC, as an inspection method for solar cells. The results showed that LTEM was more sensitive to the characteristics of the depletion layer of the polycrystalline solar cell compared with EL, PL, and LBIC and that it could be used as a complementary tool to the conventional analysis methods for a solar cell.

  20. A Conceptual Design and Analysis Method for Conventional and Unconventional Airplanes

    NARCIS (Netherlands)

    Elmendorp, R.J.M.; Vos, R.; La Rocca, G.

    2014-01-01

    A design method is presented that has been implemented in a software program to investigate the merits of conventional and unconventional transport airplanes. Design and analysis methods are implemented in a design tool capable of creating a conceptual design based on a set of toplevel requirements.

  1. Comparison of Tibial Intramedullary Nailing Guided by Digital Technology Versus Conventional Method: A Prospective Study.

    Science.gov (United States)

    Liu, Lin; Xu, Xian; Li, Xu; Wu, Wei; Cai, Junfeng; Lu, Qingyou

    2017-06-12

    BACKGROUND This prospective study aimed to compare clinical effects of intramedullary nailing guided by digital and conventional technologies in treatment of tibial fractures. MATERIAL AND METHODS Thirty-two patients (mean age 43 years, 18 males and 14 females) who were treated for tibial fractures from October 2010 to October 2012 were enrolled. They were sequentially randomized to receive intramedullary nailing guided by either digital technology (digital group, n=16) or conventional technology (conventional group, n=16). The operation time, fluoroscopy times, fracture healing time, distance between the actual and planned insertion point, postoperative lower limb alignment, and functional recovery were recorded for all patients. RESULTS The mean operation time in the digital group was 43.1±6.2 min compared with 48.7±8.3 min for the conventional technology (P=0.039). The fluoroscopy times and distance between the actual and planned insertion point were significantly lower in the digital group than in the conventional group (both Pdigital technology. No difference was found in fracture healing time and good postoperative lower limb alignment between the digital and conventional groups (P=0.083 and P=0.310), as well as the effective rate (100% vs. 87.50%, P=0.144). CONCLUSIONS Intramedullary nailing guided by digital technology has many advantages in treatment of tibial fractures compared to conventional technology, including shorter operation time, reduced fluoroscopy times, and decreased distance between the actual and planned insertion point of the intramedullary nail.

  2. The efficacy of selective calculus ablation at 400 nm: comparison to conventional calculus removal methods

    Science.gov (United States)

    Schoenly, Joshua E.; Seka, Wolf; Romanos, Georgios; Rechmann, Peter

    A desired outcome of scaling and root planing is the complete removal of calculus and infected root tissue and preservation of healthy cementum for rapid healing of periodontal tissues. Conventional periodontal treatments for calculus removal, such as hand instrument scaling and ultrasonic scaling, often deeply scrape the surface of the underlying hard tissue and may leave behind a smear layer. Pulsed lasers emitting at violet wavelengths (specifically, 380 to 400 nm) are a potential alternative treatment since they can selectively ablate dental calculus without ablating pristine hard tissue (i.e., enamel, cementum, and dentin). In this study, light and scanning electron microscopy are used to compare and contrast the efficacy of in vitro calculus removal for several conventional periodontal treatments (hand instruments, ultrasonic scaler, and Er:YAG laser) to calculus removal with a frequency-doubled Ti:sapphire (λ = 400 nm). After calculus removal, enamel and cementum surfaces are investigated for calculus debris and damage to the underlying hard tissue surface. Compared to the smear layer, grooves, and unintentional hard tissue removal typically found using these conventional treatments, calculus removal using the 400-nm laser is complete and selective without any removal of pristine dental hard tissue. Based on these results, selective ablation from the 400-nm laser appears to produce a root surface that would be more suitable for successful healing of periodontal tissues.

  3. Methods of decontaminating surfaces and related compositions

    Science.gov (United States)

    Demmer, Ricky L.; Crosby, Daniel; Norton, Christopher J.

    2016-11-22

    A composition of matter includes water, at least one acid, at least one surfactant, at least one fluoride salt, and ammonium nitrate. A method of decontaminating a surface includes exposing a surface to such a composition and removing the composition from the surface. Other compositions of matter include water, a fatty alcohol ether sulfate, nitrilotriacetic acid, at least one of hydrochloric acid and nitric acid, sodium fluoride, potassium fluoride, ammonium nitrate, and gelatin.

  4. Monte Carlo method for random surfaces

    International Nuclear Information System (INIS)

    Berg, B.

    1985-01-01

    Previously two of the authors proposed a Monte Carlo method for sampling statistical ensembles of random walks and surfaces with a Boltzmann probabilistic weight. In the present paper we work out the details for several models of random surfaces, defined on d-dimensional hypercubic lattices. (orig.)

  5. In-vitro evaluation of the accuracy of conventional and digital methods of obtaining full-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Mehl, Albert

    2015-01-01

    To investigate the accuracy of conventional and digital impression methods used to obtain full-arch impressions by using an in-vitro reference model. Eight different conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; and irreversible hydrocolloid, ALG) and digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; and Lava COS, LAV) full-arch impressions were obtained from a reference model with a known morphology, using a highly accurate reference scanner. The impressions obtained were then compared with the original geometry of the reference model and within each test group. A point-to-point measurement of the surface of the model using the signed nearest neighbour method resulted in a mean (10%-90%)/2 percentile value for the difference between the impression and original model (trueness) as well as the difference between impressions within a test group (precision). Trueness values ranged from 11.5 μm (VSE) to 60.2 μm (POE), and precision ranged from 12.3 μm (VSE) to 66.7 μm (POE). Among the test groups, VSE, VSES, and CER showed the highest trueness and precision. The deviation pattern varied with the impression method. Conventional impressions showed high accuracy across the full dental arch in all groups, except POE and ALG. Conventional and digital impression methods show differences regarding full-arch accuracy. Digital impression systems reveal higher local deviations of the full-arch model. Digital intraoral impression systems do not show superior accuracy compared to highly accurate conventional impression techniques. However, they provide excellent clinical results within their indications applying the correct scanning technique.

  6. Why conventional detection methods fail in identifying the existence of contamination events.

    Science.gov (United States)

    Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han

    2016-04-15

    Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Biocrystallization as a method for distinguishing between organically and conventionally produced milk

    Directory of Open Access Journals (Sweden)

    Anka Popović-Vranješ

    2016-11-01

    Full Text Available Holistic methods, such as biocrystallization and capillary dynamolysis, can be used to confirm differences in chemical composition between organic and conventionally produced milk. The utilization of such methods is complementary to other quality assurance methods and demonstrates a complex aspect of food quality. In this study, biocrystallization was used as a method for distinguishing between organic and conventionally produced pasteurized milk, demonstrating how the differences in the dairy cow feeding regime can affect milk properties. The biocrystallization was performed by means of copper (II chloride dihydrate (CuCl2*2H2O. The biocrystallization patterns obtained from the conventional and organic milk samples were readily distinguished. A significant indication of differences was the emergence of degradation features in the biocrystallization patterns. While degradation features do not appear in organic milk, conventional milk showed clear indications of degradation, although the compound analysis of the two milks indicated no differences. From the morphological perspective, the biocrystallization patterns of organic milk have fared better according to all criteria. The results of the fatty acid analysis in milk from conventional and certified organic farms showed a greater content of beneficial fatty acids in organic milk: oleic (P<0.05, linoleic and linolenic (P<0.01. The analysis of animal feed indicated a higher content of cellulose, i.e. acid detergent fibers (ADF, and a lower content of neutral detergent fibers (NDF in the organic animal feed. It was concluded that the method of copper chloride biocrystallization can determine the differences between pasteurized conventional and organic milk, which is greatly important in assuring the consumers of the milk origin, since the organic chain implies the increased quality control of soil, animal feed, animals and final dairy products with added value.

  8. Efficacy of Conventional Laser Irradiation Versus a New Method for Gingival Depigmentation (Sieve Method): A Clinical Trial.

    Science.gov (United States)

    Houshmand, Behzad; Janbakhsh, Noushin; Khalilian, Fatemeh; Talebi Ardakani, Mohammad Reza

    2017-01-01

    Introduction: Diode laser irradiation has recently shown promising results for treatment of gingival pigmentation. This study sought to compare the efficacy of 2 diode laser irradiation protocols for treatment of gingival pigmentations, namely the conventional method and the sieve method. Methods: In this split-mouth clinical trial, 15 patients with gingival pigmentation were selected and their pigmentation intensity was determined using Dummett's oral pigmentation index (DOPI) in different dental regions. Diode laser (980 nm wavelength and 2 W power) was irradiated through a stipple pattern (sieve method) and conventionally in the other side of the mouth. Level of pain and satisfaction with the outcome (both patient and periodontist) were measured using a 0-10 visual analog scale (VAS) for both methods. Patients were followed up at 2 weeks, one month and 3 months. Pigmentation levels were compared using repeated measures of analysis of variance (ANOVA). The difference in level of pain and satisfaction between the 2 groups was analyzed by sample t test and general estimate equation model. Results: No significant differences were found regarding the reduction of pigmentation scores and pain and scores between the 2 groups. The difference in satisfaction with the results at the three time points was significant in both conventional and sieve methods in patients ( P = 0.001) and periodontists ( P = 0.015). Conclusion: Diode laser irradiation in both methods successfully eliminated gingival pigmentations. The sieve method was comparable to conventional technique, offering no additional advantage.

  9. Self-disinfecting Alginate vs Conventional Alginate: Effect on Surface Hardness of Gypsum Cast-An in vitro Study.

    Science.gov (United States)

    Madhavan, Ranjith; George, Navia; Thummala, Niharika R; Ravi, S V; Nagpal, Ajay

    2017-11-01

    For the construction of any dental prosthesis, accurate impressions are necessary. Hence, we undertook the present study to evaluate and compare the surface hardness of gypsum casts poured from impressions made using conventional alginate and self-disinfecting alginate. A total of 30 impressions of stainless steel die were made, out of which 15 impressions were made with conventional alginate and 15 were made with self-disinfecting alginate and poured using Type III dental stone. Thirty stone specimens were subjected for hardness testing. Data were analyzed using independent samples t-test to compare the mean surface hardness. Difference in surface hardness was statistically insignificant (p > 0.05). Surface hardness of gypsum casts poured using impressions made from self-disinfecting alginate and conventional alginates were comparable. Self-disinfecting alginates may be employed in clinical practice as safe and effective materials to overcome the infection control issues without compromising on the properties of the material.

  10. Surface physics theoretical models and experimental methods

    CERN Document Server

    Mamonova, Marina V; Prudnikova, I A

    2016-01-01

    The demands of production, such as thin films in microelectronics, rely on consideration of factors influencing the interaction of dissimilar materials that make contact with their surfaces. Bond formation between surface layers of dissimilar condensed solids-termed adhesion-depends on the nature of the contacting bodies. Thus, it is necessary to determine the characteristics of adhesion interaction of different materials from both applied and fundamental perspectives of surface phenomena. Given the difficulty in obtaining reliable experimental values of the adhesion strength of coatings, the theoretical approach to determining adhesion characteristics becomes more important. Surface Physics: Theoretical Models and Experimental Methods presents straightforward and efficient approaches and methods developed by the authors that enable the calculation of surface and adhesion characteristics for a wide range of materials: metals, alloys, semiconductors, and complex compounds. The authors compare results from the ...

  11. Evaluation of the micronutrient composition of plant foods produced by organic and conventional agricultural methods.

    Science.gov (United States)

    Hunter, Duncan; Foster, Meika; McArthur, Jennifer O; Ojha, Rachel; Petocz, Peter; Samman, Samir

    2011-07-01

    The aim of the present analysis was to evaluate the micronutrient content of plant foods produced by organic and conventional agricultural methods. Studies were identified from a search of electronic databases (1980-2007, inclusive) as well as manual searches. A total of 66 studies (describing 1440 micronutrient comparisons) were identified. Thirty-three studies (908 comparisons) satisfied the screening criteria which considered cultivar, harvesting, and soil conditions. In studies that satisfied the screening criteria, the absolute levels of micronutrients were higher in organic foods more often than in conventional foods (462 vs 364 comparisons, P=0.002), and the total micronutrient content, expressed as a percent difference, was higher in organic (+5.7%, Pfood groups was more frequently reported to be higher for organic vegetables and legumes compared to their conventional counterparts (vegetables, 267 vs 197, Porganic vegetables (+5.9%, Porganic agricultural methods on a broader range of nutrients and their potential impact on health.

  12. 10 CFR Appendix I to Subpart B of... - Uniform Test Method for Measuring the Energy Consumption of Conventional Ranges, Conventional...

    Science.gov (United States)

    2010-01-01

    ... with any temper that will give a czoefficient of thermal conductivity of 1073.3 to 1189.1 Btu-in/h-ft2... the test block and that the thermocouple junction makes good thermal contact with the aluminum block... food. 4.1.2.3Annual conventional oven self-cleaning energy. 4.1.2.3.1Annual primary energy consumption...

  13. Comparison between the conventional method and a portable device for determination of INR

    Directory of Open Access Journals (Sweden)

    André Camacho Oliveira Araújo

    2014-04-01

    Full Text Available CONTEXT: Anticoagulation with warfarin is considered the appropriate treatment for venous thromboembolism and other thrombotic pathologies. Regular INR control is required for dosage adjustment and therapeutic control. Use of portable monitoring systems optimizes management of these patients. OBJECTIVE: To compare INR measurements taken using the portable Coaguchek XS system in capillary blood with the standard laboratory method using venous blood. METHOD: Fifty-two samples each of venous and capillary blood were collected from nineteen patients on warfarin, who had been admitted to the Hospital da Beneficência Portuguesa de São Paulo, and analyzed using the conventional method and the Coaguchek XS system, respectively. RESULTS: Spearman's correlation coefficient ® for the overall performance of the two methods was 0.978 (p0.714. CONCLUSIONS: The Coaguchek XS system can be used to monitor prothrombin time in patients on oral anticoagulants, provided INR values greater than 3.5 are confirmed using the conventional laboratory method.

  14. Comparison of conventional Ziehl–Neelsen method of acid fast bacilli with modified bleach method in tuberculous lymphadenitis

    Directory of Open Access Journals (Sweden)

    Mani Krishna

    2017-01-01

    Full Text Available Introduction: Tuberculosis caused by Mycobacterium tuberculosis is a chronic infectious disease and a major health problem in developing countries, with lymphadenopathy being the most common presentation. Tuberculous lymphadenitis can be diagnosed on fine needle aspiration cytology of lymph node. Conventional Ziehl–Neelsen method for acid fast bacilli plays a key role in the diagnosis and monitoring of treatment for tuberculosis, however, with low sensitivity. Present study emphasizes the role of bleach concentration method in fine needle aspiration cytology of lymph nodes over conventional direct smear microscopy. Materials and Methods: The study included 75 patients with clinically suspected tuberculous lymphadenopathy who were referred to the Department of Pathology in a tertiary care hospital, Faridabad. Data regarding age, sex, duration and site of swelling, nature of aspirate, and cytomorphological diagnosis were documented for each patient. Results: Of the total 75 cases, 15 were positive both in conventional Ziehl–Neelsen method and bleach concentration method. By bleach concentration method, additional 34 cases showed positivity that were not revealed by conventional Ziehl–Neelsen method. Thus, a total 49 cases were positive for acid fast bacilli. Conclusion: There are problems in arriving at an absolute diagnosis in certain cases of tuberculous lymphadenitis when the aspirate shows polymorphous picture with occasional epithelioid cells and absence of typical Langhans giant cell or caseous necrosis. In the present study, acid fast bacilli positivity was established in 65.33% of the cases with the bleach method. Bleach method for detection of tubercle bacilli has a high case detection rate than that of the conventional Ziehl–Neelsen method.

  15. Removal of antibiotics from surface and distilled water in conventional water treatment processes

    Science.gov (United States)

    Adams, C.; Wang, Y.; Loftin, K.; Meyer, M.

    2002-01-01

    Conventional drinking water treatment processes were evaluated under typical water treatment plant conditions to determine their effectiveness in the removal of seven common antibiotics: carbadox, sulfachlorpyridazine, sulfadimethoxine, sulfamerazine, sulfamethazine, sulfathiazole, and trimethoprim. Experiments were conducted using synthetic solutions prepared by spiking both distilled/ deionized water and Missouri River water with the studied compounds. Sorption on Calgon WPH powdered activated carbon, reverse osmosis, and oxidation with chlorine and ozone under typical plant conditions were all shown to be effective in removing the studied antibiotics. Conversely, coagulation/flocculation/sedimentation with alum and iron salts, excess lime/soda ash softening, ultraviolet irradiation at disinfection dosages, and ion exchange were all relatively ineffective methods of antibiotic removal. This study shows that the studied antibiotics could be effectively removed using processes already in use many water treatment plants. Additional work is needed on by-product formation and the removal of other classes of antibiotics.

  16. Generalised empirical method for predicting surface subsidence

    International Nuclear Information System (INIS)

    Zhang, M.; Bhattacharyya, A.K.

    1994-01-01

    Based on a simplified strata parameter, i.e. the ratio of total thickness of the strong rock beds in an overburden to the overall thickness of the overburden, a Generalised Empirical Method (GEM) is described for predicting the maximum subsidence and the shape of a complete transverse subsidence profile due to a single completely extracted longwall panel. In the method, a nomogram for predicting the maximum surface subsidence is first developed from the data collected from subsidence measurements worldwide. Then, a method is developed for predicting the shapes of complete transfer subsidence profiles for a horizontal seam and ground surface and is verified by case studies. 13 refs., 9 figs., 2 tabs

  17. A facile method for simulating randomly rough membrane surface associated with interface behaviors

    Science.gov (United States)

    Qu, Xiaolu; Cai, Xiang; Zhang, Meijia; Lin, Hongjun; Leihong, Zhao; Liao, Bao-Qiang

    2018-01-01

    Modeling rough surfaces has emerged as a distinct discipline of considerable research interest in interface behaviors including membrane fouling. In this paper, a facile method was proposed to simulate rough membrane surface morphology. Natural membrane surface was found to be randomly rough, and its height distribution obeys Gaussian distribution. A new method which combines spectrum method, Gaussian distribution and Fourier transform technique was deduced. Simulation of the rough membrane surface showed high similarity in terms of statistical roughness and height distribution between the simulated surface and the real membrane surface, indicating feasibility of the new method. It was found that, correlation length (l) and the number of superposed ridges (N) are key parameters affecting the simulated membrane surface morphology. This new method has evident advantages over conventional modeling methods The proposed method for randomly rough membrane surface modeling could be potentially used to quantify the interfacial interactions between two rough surfaces, giving implications for membrane fouling mitigation.

  18. A new method to characterize dopant profiles in NMOSFETs using conventional transmission electron microscopy

    International Nuclear Information System (INIS)

    Kawamura, Kazuo; Ikeda, Kazuto; Terauchi, Masami

    2004-01-01

    We have developed a new method using conventional transmission electron microscopy (TEM) to obtain two dimensional dopant profiles in silicon and applied it to 40 nm-gate-length N + /p metal oxide semiconductor field effect transistors (MOSFETs). The results are consistent with those of selective-chemically etched samples observed by TEM. This method, using focused ion beam (FIB) sample preparation and conventional TEM, has the great advantage of simple sample preparation and high spatial resolution compared to other characterization methods, such as atomic capacitance microscopy, spreading resistance microscopy, and TEM combined with selective chemical etching. This indicates that this method can be applicable to the analysis of FETs at the 65 nm or smaller node

  19. Comparison between the Conventional Methods and PSO Based MPPT Algorithm for Photovoltaic Systems

    OpenAIRE

    Ramdan B. A. Koad; Ahmed. F. Zobaa

    2014-01-01

    Since the output characteristics of photovoltaic (PV) system depends on the ambient temperature, solar radiation and load impedance, its maximum power point (MPP) is not constant. Under each condition PV module has a point at which it can produce its MPP. Therefore, a maximum power point tracking (MPPT) method is needed to uphold the PV panel operating at its MPP. This paper presents comparative study between the conventional MPPT methods used in (PV) system: Perturb and Observe (P&O), Increm...

  20. Comparing Antibacterial and Antioxidant Activity of Annatto Dye Extracted by Conventional and Ultrasound-Assisted Methods

    OpenAIRE

    Mahmoud Yolmeh; Mohammad Bagher Habibi-Najafi; Shahrzad Shakouri; Fereshteh Hosseini

    2015-01-01

    Background: Annatto dye is used extensively in food industry that has antibacterial and antioxidant properties. Objectives: Aim of this paper was comparison of the antibacterial and antioxidant properties of annatto dye was extracted by conventional and ultrasound-assisted extraction (UAE) methods. Materials and Methods: In this experimental study minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of annatto dye against the bacteria were determined by ag...

  1. Comparison of soil surface arthropod populations in conventional tillage, no-tillage and old field systems

    Energy Technology Data Exchange (ETDEWEB)

    Blumberg, A Y; Crossley, Jr, D A

    1980-08-01

    Soil surface arthropod populations in conventional tillage (CT) and no-tillage (NT) sorghum and adjacent old field (OF) were compared using pitfall trap captures. Total numbers of individuals and species, overall diversity (anti H), richness (D), evenness (J'), dominance (C) and similarity quotients (QS) between systems were calculated for each of seven 24 hour sampling periods throughout the season. Although each system was distinct (any two of the systems had less than 30 percent of their species in common), NT was most similar to OF and least similar to CT during a period of stress (drought) and after heading of the sorghum. Percentages of individuals and species represented by spiders were similar in NT and OF; percentages were substantially less in CT. Yields (biomass of sorghum) in CT and NT were not significantly different despite the generally predicted higher pest populations in NT. Results suggest that insecticide stress may lower the stability of NT systems, thus allowing an increase in pest species.

  2. Methods for assessing phosphorus overfeeding on organic and conventional dairy farms.

    Science.gov (United States)

    Nordqvist, M; Holtenius, K; Spörndly, R

    2014-02-01

    Phosphorus (P) losses from dairy farms can severely damage aquatic ecosystems, so it is important to have tools to assess overfeeding of P. This study screened P intake and faecal excretion of different P fractions in dairy cows on conventional and organic farms, compared the P feeding level of the herds against the recommendations and analysed different sampling and analysis methods for assessing the general status of P feeding on the farms. The organic (n=14) and conventional farms (n=15) were of comparable size and were located in southern Sweden. On each farm, feed intake was registered for 10 cows representing four different lactation stages and their P intake was calculated and related to current recommendations. Faecal samples taken from the same cows were analysed for total P (TP) and soluble P. Milk production data for the cows were obtained from the Swedish official milk recording scheme. TP was determined in one slurry sample per farm. More than 70% of the cows studied, representing both conventional and organic herds, consumed P in excess of the recommendations. Conventional herds had higher P content in the ration than organic herds, and lactating cows in conventional herds had higher faecal concentrations of total and soluble P than those in organic herds. However in dry cows, the P content of the ration and soluble P and TP in faeces did not differ between the two management systems. Soluble P was well correlated to TP in faeces, and both were good indicators of P overfeeding.

  3. The background field method and its equivalence to conventional formulations of quantum field theories

    International Nuclear Information System (INIS)

    Rebhan, A.

    1984-03-01

    It is shown that the formulation of the background field method put forward in papers by De Witt, G. t'Hoff, Abbott and Boulware is equivalent to conventional methods, leading in perturbation theory to the same S matrix. An advantage is that the gauges of the outer lines and the vertex functions respectively can be fixed independently. Simple Lee identities are obtained which considerably simplify the renormalization procedure. The Feynman rules are only slightly more complicated than in conventional methods. Because the simple Lee identities are valid separately for one particle irreducible graphs of the same inner structure, an additional checking possiblity for calculations is obtained. (Author, shortened and translated by G.Q.)

  4. Comparing the Effect of Concept Mapping and Conventional Methods on Nursing Students’ Practical Skill Score

    Science.gov (United States)

    Rasoul Zadeh, Nasrin; Sadeghi Gandomani, Hamidreza; Delaram, Masoumeh; Parsa Yekta, Zohre

    2015-01-01

    Background: Development of practical skills in the field of nursing education has remained a serious and considerable challenge in nursing education. Moreover, newly graduated nurses may have weak practical skills, which can be a threat to patients’ safety. Objectives: The present study was conducted to compare the effect of concept mapping and conventional methods on nursing students’ practical skills. Patients and Methods: This quasi-experimental study was conducted on 70 nursing students randomly assigned into two groups of 35 people. The intervention group was taught through concept mapping method, while the control group was taught using conventional method. A two-part instrument was used including a demographic information form and a checklist for direct observation of procedural skills. Descriptive statistics, chi-square, independent samples t-tests and paired t-test were used to analyze data. Results: Before education, no significant differences were observed between the two groups in the three skills of cleaning (P = 0.251), injection (P = 0.185) and sterilizing (P = 0.568). The students mean scores were significantly increased after the education and the difference between pre and post intervention of students mean scores were significant in the both groups (P Concept mapping was superior to conventional skill teaching methods. It is suggested to use concept mapping in teaching practical courses such as fundamentals of nursing. PMID:26576441

  5. Selecting the patients for morning report sessions: case-based vs. conventional method.

    Science.gov (United States)

    Rabiei, Mehdi; Saeidi, Masumeh; Kiani, Mohammad Ali; Amin, Sakineh Mohebi; Ahanchian, Hamid; Jafari, Seyed Ali; Kianifar, Hamidreza

    2015-08-01

    One of the most important issues in morning report sessions is the number of patients. The aim of this study was to investigate and compare the number of cases reported in the morning report sessions in terms of case-based and conventional methods from the perspective of pediatric residents of Mashhad University of Medical Sciences. The present study was conducted on 24 pediatric residents of Mashhad University of Medical Sciences in the academic year 2014-2015. In this survey, the residents replied to a 20-question researcher-made questionnaire that had been designed to measure the views of residents regarding the number of patients in the morning report sessions using case-based and conventional methods. The validity of the questionnaire was confirmed by experts' views and its reliability by calculating Cronbach's alpha coefficients. Data were analyzed by t-test analysis. The mean age of the residents was 30.852 ± 2.506, and 66.6% of them were female. The results showed that there was no significant relationship among the variables of academic year, gender, and residents' perspective to choosing the number of patients in the morning report sessions (P > 0.05). T-test analysis showed a significant relationship among the average scores of residents in the selection of the case-based method in comparison to the conventional method (P case-based morning report was preferred compared to the conventional method. This method makes residents pay more attention to the details of patients' issues and therefore helps them to better plan how to address patient problems and improve their differential diagnosis skills.

  6. Cocolonization of Pneumococcal Serotypes in Healthy Children Attending Day Care Centers: Molecular Versus Conventional Methods.

    Science.gov (United States)

    Hjálmarsdóttir, Martha Á; Gumundsdóttir, Pálína Fanney; Erlendsdóttir, Helga; Kristinsson, Karl G; Haraldsson, Gunnsteinn

    2016-05-01

    Pneumococci are common colonizer, especially of children, and cocolonization of different serotypes is an important factor for intraspecies genetic exchange. The aim of this study was to analyze pneumococcal carriage and serotype distribution in unvaccinated healthy children in Iceland and compare conventional culture methods and molecular methods using DNA extracted directly from the samples. Nasopharyngeal swabs were obtained from 514 children aged 2-6 year attending day care centers in Reykjavik in 2009. The swabs were selectively cultured for pneumococci and the isolates serotyped using latex agglutination. DNA was also extracted directly from the swabs and serotyped using a multiplex PCR panel designed to detect vaccine serotypes and the most commonly carried non-vaccine serotypes. Pneumococcal carriage was detected in 391 (76.1%) of the children using polymerase chain reaction (PCR) and in 371 (72.2%) using conventional methods. Cocolonization was detected in 92 (23.5%) of the carriers when PCR method was used and in 30 (8.1%) when conventional methods were used, detecting 500 and 401 strains, respectively (P < 0.0001). The most common serotypes were 23F, 19A, 6B, 6A and 19F, rates 13-8%. The number of isolates of serotypes included in the 10-valent and 13-valent vaccines and detected by PCR were 234 (58.4%) and 363 (90.5%), respectively and by conventional methods 186 (46.4%) and 293 (73.1%), respectively. Cocolonization was detected in a fourth of the children carrying pneumococci using DNA extracted directly from nasopharyngeal swabs. The rate of carriage was very high, but no serotype dominated, and the children were commonly colonized by vaccine serotypes, especially cocolonized children.

  7. Comparison of multimedia system and conventional method in patients’ selecting prosthetic treatment

    Directory of Open Access Journals (Sweden)

    Baghai R

    2010-12-01

    Full Text Available "nBackground and Aims: Selecting an appropriate treatment plan is one of the most critical aspects of dental treatments. The purpose of this study was to compare multimedia system and conventional method in patients' selecting prosthetic treatment and the time consumed."nMaterials and Methods: Ninety patients were randomly divided into three groups. Patients in group A, once were instructed using the conventional method of dental office and once multimedia system and time was measured in seconds from the beginning of the instruction till the patient had came to decision. The patients were asked about the satisfaction of the method used for them. In group B, patients were only instructed using the conventional method, whereas they were only exposed to soft ware in group C. The data were analyzed with Paired-T-test"n(in group A and T-test and Mann-Whitney test (in groups B and C."nResult: There was a significant difference between multimedia system and conventional method in group A and also between groups B and C (P<0.001. In group A and between groups B and C, patient's satisfaction about multimedia system was better. However, in comparison between groups B and C, multimedia system did not have a significant effect in treatment selection score (P=0.08."nConclusion: Using multimedia system is recommended due to its high ability in giving answers to a large number of patient's questions as well as in terms of marketing.

  8. Conservation Farming and Changing Climate: More Beneficial than Conventional Methods for Degraded Ugandan Soils

    Directory of Open Access Journals (Sweden)

    Drake N. Mubiru

    2017-06-01

    Full Text Available The extent of land affected by degradation in Uganda ranges from 20% in relatively flat and vegetation-covered areas to 90% in the eastern and southwestern highlands. Land degradation has adversely affected smallholder agro-ecosystems including direct damage and loss of critical ecosystem services such as agricultural land/soil and biodiversity. This study evaluated the extent of bare grounds in Nakasongola, one of the districts in the Cattle Corridor of Uganda and the yield responses of maize (Zea mays and common bean (Phaseolus vulgaris L. to different tillage methods in the district. Bare ground was determined by a supervised multi-band satellite image classification using the Maximum Likelihood Classifier (MLC. Field trials on maize and bean grain yield responses to tillage practices used a randomized complete block design with three replications, evaluating conventional farmer practice (CFP; permanent planting basins (PPB; and rip lines, with or without fertilizer in maize and bean rotations. Bare ground coverage in the Nakasongola District was 187 km2 (11% of the 1741 km2 of arable land due to extreme cases of soil compaction. All practices, whether conventional or the newly introduced conservation farming practices in combination with fertilizer increased bean and maize grain yields, albeit with minimal statistical significance in some cases. The newly introduced conservation farming tillage practices increased the bean grain yield relative to conventional practices by 41% in PPBs and 43% in rip lines. In maize, the newly introduced conservation farming tillage practices increased the grain yield by 78% on average, relative to conventional practices. Apparently, conservation farming tillage methods proved beneficial relative to conventional methods on degraded soils, with the short-term benefit of increasing land productivity leading to better harvests and food security.

  9. Effectiveness of Video Demonstration over Conventional Methods in Teaching Osteology in Anatomy.

    Science.gov (United States)

    Viswasom, Angela A; Jobby, Abraham

    2017-02-01

    Technology and its applications are the most happening things in the world. So, is it in the field of medical education. This study was an evaluation of whether the conventional methods can compete with the test of technology. A comparative study of traditional method of teaching osteology in human anatomy with an innovative visual aided method. The study was conducted on 94 students admitted to MBBS 2014 to 2015 batch of Travancore Medical College. The students were divided into two academically validated groups. They were taught using conventional and video demonstrational techniques in a systematic manner. Post evaluation tests were conducted. Analysis of the mark pattern revealed that the group taught using traditional method scored better when compared to the visual aided method. Feedback analysis showed that, the students were able to identify bony features better with clear visualisation and three dimensional view when taught using the video demonstration method. The students identified visual aided method as the more interesting one for learning which helped them in applying the knowledge gained. In most of the questions asked, the two methods of teaching were found to be comparable on the same scale. As the study ends, we discover that, no new technique can be substituted for time tested techniques of teaching and learning. The ideal method would be incorporating newer multimedia techniques into traditional classes.

  10. Interphase Chromosome Profiling: A Method for Conventional Banded Chromosome Analysis Using Interphase Nuclei.

    Science.gov (United States)

    Babu, Ramesh; Van Dyke, Daniel L; Dev, Vaithilingam G; Koduru, Prasad; Rao, Nagesh; Mitter, Navnit S; Liu, Mingya; Fuentes, Ernesto; Fuentes, Sarah; Papa, Stephen

    2018-02-01

    - Chromosome analysis on bone marrow or peripheral blood samples fails in a small proportion of attempts. A method that is more reliable, with similar or better resolution, would be a welcome addition to the armamentarium of the cytogenetics laboratory. - To develop a method similar to banded metaphase chromosome analysis that relies only on interphase nuclei. - To label multiple targets in an equidistant fashion along the entire length of each chromosome, including landmark subtelomere and centromere regions. Each label so generated by using cloned bacterial artificial chromosome probes is molecularly distinct with unique spectral characteristics, so the number and position of the labels can be tracked to identify chromosome abnormalities. - Interphase chromosome profiling (ICP) demonstrated results similar to conventional chromosome analysis and fluorescence in situ hybridization in 55 previously studied cases and obtained useful ICP chromosome analysis results on another 29 cases in which conventional methods failed. - ICP is a new and powerful method to karyotype peripheral blood and bone marrow aspirate preparations without reliance on metaphase chromosome preparations. It will be of particular value for cases with a failed conventional analysis or when a fast turnaround time is required.

  11. Comparing the Effect of Concept Mapping and Conventional Methods on Nursing Students' Practical Skill Score.

    Science.gov (United States)

    Rasoul Zadeh, Nasrin; Sadeghi Gandomani, Hamidreza; Delaram, Masoumeh; Parsa Yekta, Zohre

    2015-09-01

    Development of practical skills in the field of nursing education has remained a serious and considerable challenge in nursing education. Moreover, newly graduated nurses may have weak practical skills, which can be a threat to patients' safety. The present study was conducted to compare the effect of concept mapping and conventional methods on nursing students' practical skills. This quasi-experimental study was conducted on 70 nursing students randomly assigned into two groups of 35 people. The intervention group was taught through concept mapping method, while the control group was taught using conventional method. A two-part instrument was used including a demographic information form and a checklist for direct observation of procedural skills. Descriptive statistics, chi-square, independent samples t-tests and paired t-test were used to analyze data. Before education, no significant differences were observed between the two groups in the three skills of cleaning (P = 0.251), injection (P = 0.185) and sterilizing (P = 0.568). The students mean scores were significantly increased after the education and the difference between pre and post intervention of students mean scores were significant in the both groups (P Concept mapping was superior to conventional skill teaching methods. It is suggested to use concept mapping in teaching practical courses such as fundamentals of nursing.

  12. Adherence of Candida to complete denture surfaces in vitro: A comparison of conventional and CAD/CAM complete dentures.

    Science.gov (United States)

    Al-Fouzan, Afnan F; Al-Mejrad, Lamya A; Albarrag, Ahmed M

    2017-10-01

    The goal of this study was to compare the adhesion of Candida albicans to the surfaces of CAD/CAM and conventionally fabricated complete denture bases. Twenty discs of acrylic resin poly (methyl methacrylate) were fabricated with CAD/CAM and conventional procedures (heat-polymerized acrylic resin). The specimens were divided into two groups: 10 discs were fabricated using the CAD/CAM procedure (Wieland Digital Denture Ivoclar Vivadent), and 10 discs were fabricated using a conventional flasking and pressure-pack technique. Candida colonization was performed on all the specimens using four Candida albicans isolates. The difference in Candida albicans adhesion on the discs was evaluated. The number of adherent yeast cells was calculated by the colony-forming units (CFU) and by Fluorescence microscopy. There was a significant difference in the adhesion of Candida albicans to the complete denture bases created with CAD/CAM and the adhesion to those created with the conventional procedure. The CAD/CAM denture bases exhibited less adhesion of Candida albicans than did the denture bases created with the conventional procedure ( P CAD/CAM procedure for fabricating complete dentures showed promising potential for reducing the adherence of Candida to the denture base surface. Clinical Implications. Complete dentures made with the CAD/CAM procedure might decrease the incidence of denture stomatitis compared with conventional dentures.

  13. Evaluation of stream discharges measurement using radioisotope and conventional method at Sungai Weng catchment area, Kedah

    International Nuclear Information System (INIS)

    Nazrul Hizam Yusoff and Wan Zakaria Wan MuhdTahir

    2006-01-01

    A number of discharge measurements using radioisotope and current metering techniques at selected streams in Sg. Weng Experimental Catchment were conducted by MINT and JPS gauging teams starting from 2003-2005. This study aims to prepare stage-discharge relationships or rating curves of the selected streams during variable flow conditions. The rating curve of the stream is one of the important parameters and usually appraised in certain routine operations of hydrological studies. It may be used in the planning of water resources management and flood control scheme. The radioisotope method employed in this study involved the injection of short-lived radioisotope tracer, that is, technetium-99m ( 99m Tc having its half-life ∼ 6.023 hrs) which was supplied from a high activity technetium generator (55.5 Gbq). Measurement of stream discharges were concurrently undertaken by JPS staff using a current meter type 0TT-C2 mounted on a wading rod at selected gauging stations for comparison purposes. Methodologies from the two methods of discharge measurements, comparison of results and identifying the uncertainties (errors) in performing the measurement during low, medium and high turbulent flows were explained in this paper. Generally, the entire results of streamflow data (2003-2005) measured by both methods during low flows (Q 3 /s) exhibit almost comparable values to each other. However, for moderate flows (1.0 m 3 /s 3 /s), the different in gauging results are slightly higher using radioisotope method ( i.e. Q isotope > Q current meter and may goes up to 40%) , and during high turbulent flows (Q>6.0 m 3 /s) the radioisotope method presented more than 40% higher discharge values as compared to the measurement made by the conventional current-meter. Observation made on site anticipated that inaccurate gauging data measured by conventional means during high flow and turbulent conditions are expected. The average estimated measurement error associated with isotope method

  14. Evaluation of positional plagiocephaly: Conventional anthropometric measurement versus laser scanning method.

    Science.gov (United States)

    Nahles, Susanne; Klein, Martin; Yacoub, Anke; Neyer, Julia

    2018-01-01

    The incidence of plagiocephaly has increased in the 25 years since the "Back to Sleep" campaign in 1991 to prevent sudden infant death. Plagiocephaly is not considered to be a pathological condition. It is more of an esthetic impairment and could have potentially negative psychological or psychosocial consequences; therefore, treatment is recommended. The aim of this study is to compare conventional anthropometry and laser scanning - two different measurement methods - as diagnostic instruments for plagiocephaly. The present study also tests the measurement time of both methods and whether one method is easier on the patient than the other. A total of 44 children (21 girls, 23 boys) with a mean age of 8.8 months were involved in the present study. Of all patients, the following parameters were routinely evaluated using a standard protocol with the conventional anthropometric method and the scan method: head circumference, head length, head width, head diagonals, and distances ex-t. Furthermore, the time required to obtain measurements and the behavior of the children during measurement were documented. For statistical analysis, a t-test and a Wilcoxon test were used to analyze differences between the two methods. The results for head circumference showed a mean of 441.5 mm for the anthropometric measurements and 441.6 mm for the scan method, with no significant difference between the two methods. A significant difference was found regarding the head width, head length, diagonals, and distance ex-t. The measurement process using the scan method needed a mean of 579.6 s in contrast to the manual anthropometric method, which required a mean time of 180.5 s. In comparison with the conventional anthropometric method, measurements made with a 3D laser scanner yield inconsistent results. Moreover, the current state of technology of 3D cephalometry has no advantages compared with the conventional anthropometric method. Disadvantages worth mentioning appear to be the

  15. Comparison of Different Recruitment Methods for Sexual and Reproductive Health Research: Social Media-Based Versus Conventional Methods.

    Science.gov (United States)

    Motoki, Yoko; Miyagi, Etsuko; Taguri, Masataka; Asai-Sato, Mikiko; Enomoto, Takayuki; Wark, John Dennis; Garland, Suzanne Marie

    2017-03-10

    Prior research about the sexual and reproductive health of young women has relied mostly on self-reported survey studies. Thus, participant recruitment using Web-based methods can improve sexual and reproductive health research about cervical cancer prevention. In our prior study, we reported that Facebook is a promising way to reach young women for sexual and reproductive health research. However, it remains unknown whether Web-based or other conventional recruitment methods (ie, face-to-face or flyer distribution) yield comparable survey responses from similar participants. We conducted a survey to determine whether there was a difference in the sexual and reproductive health survey responses of young Japanese women based on recruitment methods: social media-based and conventional methods. From July 2012 to March 2013 (9 months), we invited women of ages 16-35 years in Kanagawa, Japan, to complete a Web-based questionnaire. They were recruited through either a social media-based (social networking site, SNS, group) or by conventional methods (conventional group). All participants enrolled were required to fill out and submit their responses through a Web-based questionnaire about their sexual and reproductive health for cervical cancer prevention. Of the 243 participants, 52.3% (127/243) were recruited by SNS, whereas 47.7% (116/243) were recruited by conventional methods. We found no differences between recruitment methods in responses to behaviors and attitudes to sexual and reproductive health survey, although more participants from the conventional group (15%, 14/95) chose not to answer the age of first intercourse compared with those from the SNS group (5.2%, 6/116; P=.03). No differences were found between recruitment methods in the responses of young Japanese women to a Web-based sexual and reproductive health survey. ©Yoko Motoki, Etsuko Miyagi, Masataka Taguri, Mikiko Asai-Sato, Takayuki Enomoto, John Dennis Wark, Suzanne Marie Garland. Originally

  16. Comparison of conventional and ultrasonic method for dyeing of spunbond polyester nonwoven fabric.

    Science.gov (United States)

    Altay, Pelin; Ӧzcan, Gülay; Tekçin, Meltem; Şahin, Gizem; Çelik, Semiha

    2018-04-01

    Nonwoven spunbonded polyester has wide applications for both household goods and home furnishings and their usage has continually been growing. Nowadays, coloration of nonwoven fabrics is performed using conventional methods. Conventional polyester dyeing is an energy-intensive process as the dyeing is carried out above 120 °C to obtain efficient diffusion of dye. Furthermore, these high temperatures may cause some harmful effects on delicate nonwoven structures. Ultrasound assisted textile dyeing is an alternative method of conventional dyeing of textile materials, providing energy saving by reduced process temperature and time, lower consumptions of auxiliaries with increased dyeing efficiency. This paper focuses on comparing the conventional (high temperature (HT) and carrier dyeing) and ultrasonic dyeing of nonwoven spunbonded polyester fabrics to investigate the effect of ultrasound energy on dyeing performance. Experimental results indicated that highest or comparable dyeing performance can be achieved with ultrasound dyeing at lower temperature (85 °C, 60 min.) without carrier as compared to carrier dyeing (100 °C, 60 min.) and HT dyeing (130 °C, 60 min.), providing an increase of dye depth depending on the dye concentration and basis weight of the fabric. It was evidently seen that highest basis weight of fabric (107 g/m 2 ) used in this study exhibited greater color yield for each dye concentrations (K/S value of 4.90 at 0.2% dye concentration) as compared to conventional ones. The effect of ultrasound energy on reductive washing and fastness properties were also evaluated. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. The use of design of experiments for the evaluation of the production of surface rich activated carbon from sewage sludge via microwave and conventional pyrolysis

    International Nuclear Information System (INIS)

    Simões dos Reis, Glaydson; Wilhelm, Michaela; Silva, Thamires Canuto de Almeida; Rezwan, Kurosch; Sampaio, Carlos Hoffmann; Lima, Eder Claudio; Guelli Ulson de Souza, Selene M.A.

    2016-01-01

    Highlights: • Using of DOE for preparation of AC by conventional and microwave pyrolysis. • The significant parameters in producing activated carbon were investigated. • Conventional pyrolysis AC had better textural development than microwave AC. • Temperature and holding time had significant influence on the S BET . • Reduction of production cost of activated carbon. - Abstract: Experimental design and response surface methodology were used for the preparation and comparison of activated carbon produced from sewage sludge by two types of pyrolysis: conventional furnace and microwave. The preparation method was performed following a full fractional factorial design (2 3 ), including pyrolysis temperature or power radiation, holding time and chemical activation agent, and specific surface area (S BET ) of prepared activated carbon. The influence of these factors on the S BET of obtained carbon was investigated using an analysis of variance. Samples made by conventional pyrolysis showed overall higher S BET values than samples synthesised by the microwave method. The optimum parameters for the preparation of activated carbon using the conventional pyrolysis have been identified as: pyrolysis temperature of 500 °C, holding time of 15 min, and a ratio of ZnCl 2 :sludge of 0.5. Microwave pyrolysis is found to be optimal when operating at 980 W for 12 min. Under these conditions, S BET values of 679 and 501 m 2 g −1 , respectively, have been obtained. The analysis of nitrogen adsorption/desorption isotherms revealed the presence of micro and mesopores in the activated carbon. The most important significant factor, according statistical analysis, in the variance in S BET for the conventional pyrolysis samples were the pyrolysis temperature and interaction between pyrolysis temperature, holding time and ratio of ZnCl 2 :sludge were the most important factors. The highest impact parameters for the microwave method were found for the interaction

  18. A new method to fabricate Fe-TiC composite using conventional sintering and steam hammer

    OpenAIRE

    LAHOUEL, Ali; BOUDEBANE, Saïd; IOST, Alain; MONTAGNE, Alex

    2017-01-01

    International audience; The aim of this research paper is to fabricate a Fe-TiC composite by a novel and simple manufacturing method. The latter is based on two cumulative processes; a conventional sintering (transient liquid phase sintering) and a hot forging with steam hammer respectively. The blinder phase of the studied simples is varied from carbon steel to high alloy steel using alloying additive powders. The obtained outcomes showed that after the sintering process, the relative densit...

  19. Confocal laser induced fluorescence with comparable spatial localization to the conventional method

    Science.gov (United States)

    Thompson, Derek S.; Henriquez, Miguel F.; Scime, Earl E.; Good, Timothy N.

    2017-10-01

    We present measurements of ion velocity distributions obtained by laser induced fluorescence (LIF) using a single viewport in an argon plasma. A patent pending design, which we refer to as the confocal fluorescence telescope, combines large objective lenses with a large central obscuration and a spatial filter to achieve high spatial localization along the laser injection direction. Models of the injection and collection optics of the two assemblies are used to provide a theoretical estimate of the spatial localization of the confocal arrangement, which is taken to be the full width at half maximum of the spatial optical response. The new design achieves approximately 1.4 mm localization at a focal length of 148.7 mm, improving on previously published designs by an order of magnitude and approaching the localization achieved by the conventional method. The confocal method, however, does so without requiring a pair of separated, perpendicular optical paths. The confocal technique therefore eases the two window access requirement of the conventional method, extending the application of LIF to experiments where conventional LIF measurements have been impossible or difficult, or where multiple viewports are scarce.

  20. Comparison of Concept Mapping and Conventional Teaching Methods on Critical Thinking Skills of Nursing Students

    Directory of Open Access Journals (Sweden)

    Masoumeh Delaram

    2017-06-01

    Full Text Available Background and Objective: Development of critical thinking and practical skills has remained a serious and considerable challenge throughout the nursing educational system in Iran. Conventional methods of teaching such as lectures as the dominant method used in higher education system is a passive style which ignores critical thinking. Therefore, the aim of this study was to compare the effect of instruction by Concept-Mapping and conventional Method on critical thinking skills of nursing students. Materials and Methods:This quasi-experimental study was carried out on 70 nursing students of Tehran Nursing and Midwifery schoolwho were selected through convenient sampling method, then were divided randomly into the two equal Experimental and Control groups. Educational content was presented in the form of Concept-Mapping in the Experimental group and Lecture,Demonstration and Practicalexercises in the control group. Data collection included a demographic information and California Critical Thinking Skills (form B questionnairewhich was completed at the beginning and at the end of the fourth week of Instructional period. Data were analyzed using SPSS software (V: 21, descriptive and analytical Statistics; at the significant level P<0.05. Results: Before the intervention, the mean of critical thinking skill score was 9.71±2.66 in concept mapping group and 9.64 ± 2.14 in conventional group and the difference was not significant (P=0.121, but after the intervention, a significant difference was found between the intervention and conventionalgroup (15.20±2.71 vs 10.25±2.06, P=0.003. Conclusion: Using Concept mapping strategy in the education of nursing students may lead to developing critical thinking skills as one of the important missions of higher education. So it is recommended to usethis method in clinical nursing education.

  1. Comparative performance of fractal based and conventional methods for dimensionality reduction of hyperspectral data

    Science.gov (United States)

    Mukherjee, Kriti; Bhattacharya, Atanu; Ghosh, Jayanta Kumar; Arora, Manoj K.

    2014-04-01

    Although hyperspectral images contain a wealth of information due to its fine spectral resolution, the information is often redundant. It is therefore expedient to reduce the dimensionality of the data without losing significant information content. The aim of this paper is to show that proposed fractal based dimensionality reduction applied on high dimensional hyperspectral data can be proved to be a better alternative compared to some other popular conventional methods when similar classification accuracy is desired at a reduced computational complexity. Amongst a number of methods of computing fractal dimension, three have been applied here. The experiments have been performed on two hyperspectral data sets acquired from AVIRIS sensor.

  2. A real time method of contaminant classification using conventional water quality sensors.

    Science.gov (United States)

    Liu, Shuming; Che, Han; Smith, Kate; Chang, Tian

    2015-05-01

    Early warning systems are often used to detect deliberate and accidental contamination events in a water source. After contamination detection, it is important to classify the type of contaminant quickly to provide support for implementation of remediation attempts. Conventional methods commonly rely on laboratory-based analysis or qualitative geometry analysis, which require long analysis time or suffer low true positive rate. This paper proposes a real time contaminant classification method, which discriminates contaminants based on quantitative analysis. The proposed method utilizes the Mahalanobis distance of feature vectors to classify the type of contaminant. The performance and robustness of the proposed method were evaluated using data from contaminant injection experiments and through an uncertainty analysis. An advantage of the proposed method is that it can classify the type of contaminant in minutes with no significant compromise on true positive rate. This will facilitate fast remediation response to contamination events in a water system. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. MAXILLARY INCISORS CHANGES DURING SPACE CLOSURE WITH CONVENTIONAL AND SKELETAL ANCHORAGE METHODS: A SYSTEMATIC REVIEW

    Directory of Open Access Journals (Sweden)

    Yasas Shri Nalaka JAYARATNE

    2017-12-01

    Full Text Available Purpose: The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. Materials and Methods: The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Results: Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. Conclusion: More RCT’s that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  4. Comparison of esophageal placement of Bravo capsule system under direct endoscopic guidance with conventional placement method

    Directory of Open Access Journals (Sweden)

    Aijaz A Sofi

    2010-10-01

    Full Text Available Aijaz A Sofi, Charles Filipiak, Thomas Sodeman, Usman Ahmad, Ali Nawras, Isam DaboulDepartment of Medicine, Division of Gastroenterology, University of Toledo Medical Center, Toledo, Ohio, USABackground: Conventional placement of a wireless esophageal pH monitoring device in the esophagus requires initial endoscopy to determine the distance to the gastroesophageal junction. Blind placement of the capsule by the Bravo delivery system is followed by repeat endoscopy to confirm placement. Alternatively, the capsule can be placed under direct vision during endoscopy. Currently there are no published data comparing the efficiency of one method over the other. The objective of this study was to compare the method of Bravo wireless pH deviceplacement under direct visualization with the conventional method.Methods: A retrospective study involving 58 patients (29 patients with indirect and 29 patients with direct visualization who had Bravo capsule placement. The physician endoscopy procedure notes, nurse’s notes, postprocedure notes, recovery notes, and pH monitoring results were reviewed. The safety of the procedures, length of the procedures, and patient tolerability were evaluated.Results: None of the 58 patients had early detachment of the device and had no immediate procedure-related complications. The overall incidence of complications in both the groups was similar. No failures due to the technique were noted in either group. Average amount of time taken for the procedure was similar in both groups.Conclusion: The technique of placing a Bravo pH device under direct visualization is as safe and effective as the conventional method. In addition, there is an added advantage of avoiding a second endoscopic intubation in the direct visualization technique.Keywords: Bravo capsule, technique, esophageal pH monitoring

  5. Genetic improvement of olive (Olea europaea L.) by conventional and in vitro biotechnology methods.

    Science.gov (United States)

    Rugini, E; Cristofori, V; Silvestri, C

    2016-01-01

    In olive (Olea europaea L.) traditional methods of genetic improvement have up to now produced limited results. Intensification of olive growing requires appropriate new cultivars for fully mechanized groves, but among the large number of the traditional varieties very few are suitable. High-density and super high-density hedge row orchards require genotypes with reduced size, reduced apical dominance, a semi-erect growth habit, easy to propagate, resistant to abiotic and biotic stresses, with reliably high productivity and quality of both fruits and oil. Innovative strategies supported by molecular and biotechnological techniques are required to speed up novel hybridisation methods. Among traditional approaches the Gene Pool Method seems a reasonable option, but it requires availability of widely diverse germplasm from both cultivated and wild genotypes, supported by a detailed knowledge of their genetic relationships. The practice of "gene therapy" for the most important existing cultivars, combined with conventional methods, could accelerate achievement of the main goals, but efforts to overcome some technical and ideological obstacles are needed. The present review describes the benefits that olive and its products may obtain from genetic improvement using state of the art of conventional and unconventional methods, and includes progress made in the field of in vitro techniques. The uses of both traditional and modern technologies are discussed with recommendations. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. New method to design stellarator coils without the winding surface

    Science.gov (United States)

    Zhu, Caoxiang; Hudson, Stuart R.; Song, Yuntao; Wan, Yuanxi

    2018-01-01

    Finding an easy-to-build coils set has been a critical issue for stellarator design for decades. Conventional approaches assume a toroidal ‘winding’ surface, but a poorly chosen winding surface can unnecessarily constrain the coil optimization algorithm, This article presents a new method to design coils for stellarators. Each discrete coil is represented as an arbitrary, closed, one-dimensional curve embedded in three-dimensional space. A target function to be minimized that includes both physical requirements and engineering constraints is constructed. The derivatives of the target function with respect to the parameters describing the coil geometries and currents are calculated analytically. A numerical code, named flexible optimized coils using space curves (FOCUS), has been developed. Applications to a simple stellarator configuration, W7-X and LHD vacuum fields are presented.

  7. Toxoplasmosis: The value of molecular methods in diagnosis compared to conventional methods

    Directory of Open Access Journals (Sweden)

    Zineb Tlamçani

    2013-06-01

    Full Text Available Toxoplasmosis is a parasitic infection due to Toxoplasma gondii an obligate intracellular protozoan parasite. It is considerateone of the most common parasite worldwide. The contamination of the parasite is generally occurred via consumptionof infected food or water or, undercooked contaminated meat. Toxoplasma gondii infection may lead to seriousillness when the organism is contracted while pregnancy or when it is reactivated in immune-suppressed persons.Diagnosis of toxoplasmosis in humans is elaborated using various techniques such as detection of anti-Toxoplasmaantibodies, mouse inoculation, histological revelation of tachyzoites in tissue sections or smears of body fluid, but thedetection of Toxoplasma gondii DNA by molecular methods has revolutionized prenatal diagnosis of congenital toxoplasmosisand in immunocompromised patients. In this paper we will discuss the parasite and different methods ofdiagnosis including the usefulness of molecular methods. J Microbiol Infect Dis 2013; 3(2: 93-99Key words: Toxoplamosis, Toxoplasma gondii, diagnosis

  8. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions

    OpenAIRE

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-01-01

    STATEMENT OF PROBLEM: Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. PURPOSE: The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. MATERIAL AND METHODS: Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsilox...

  9. Strategy for identification & characterization of Bartonella henselae with conventional & molecular methods

    Directory of Open Access Journals (Sweden)

    Kavita Diddi

    2013-01-01

    Full Text Available Background & objectives: Bartonella henselae is a fastidious gram-negative bacterium usually causing self limiting infections in immunocompetent individuals but often causes potentially life threatening infection, such as bacillary angiomatosis in immunocompromised patients. Both diagnosis of infections and research into molecular mechanisms of pathogenesis have been hindered by lack of appropriate and reliable diagnostic techniques. We undertook this study to standardize methods to characterize B. henselae in clinical samples to diagnose Bartonella infection correctly. Methods: B. henselae ATCC 49882 strain was procured from American type culture collection, USA. This strain was revived and maintained in the laboratory, and identification and characterization of this strain was done by conventional and molecular techniques, which included culture on various media, staining by different methods including electron microscopy, biochemical analysis by conventional methods and API, polymerase chain reaction (PCR for amplification of citrate synthase gene followed by restriction fragment length polymorphism (RFLP. Results: This organism was biochemically inert due to slow growth and generated unique identification code with API. The amplification of the citrate-synthase gene with primers yielded a 381 bp product followed by specific RFLP profile for B. henselae. Interpretation & conclusions: Bartonella is fastidious and fragile organism and should be handled carefully. Extra effort and careful observation are required to isolate and characterize this organism.

  10. Diagnosis of occlusal caries using laser fluorescence versus conventional methods in permanent posterior teeth: a clinical study.

    Science.gov (United States)

    Sinanoglu, Alper; Ozturk, Elif; Ozel, Emre

    2014-03-01

    The purpose of this in vivo study was to compare three different caries detection methods [laser fluorescence (LFE), visual examination (VE), and radiological examination (RE)] for the detection of occlusal caries in permanent posterior teeth. Early diagnosis of caries is critical in the management of dental caries. Two examiners assessed the occlusal surfaces of 217 teeth by visual, radiographic, and laser fluorescence (DIAGNOdent Pen) examination methods. After a 1 week interval, randomly selected patients were recalled. Each measurement was repeated by two examiners before the cases were selected for operative intervention to classify lesion depths. Statistical analysis of the data was performed using SPSS and Stata IC. The intra- and inter-examiner reliabilities and reproducibilities of the VE, RE, and LFE were calculated using Cohen's κ statistics. The sensitivities and specificities were plotted in receiver operating characteristic curves. The differences between LFE scores were analyzed using the nonparametric Mann-Whitney U and Wilcoxon tests (α=0.05). The VE method exhibited the highest sensitivity, accuracy, and κ values among the diagnostic groups in terms of inter-examiner agreement. With regard to the sensitivity, specificity, and likelihood ratios for the two examiners, significant differences were found between sensitivity and specificity for examiner 1, whereas no statistically significant differences were noted between sensitivity and specificity for examiner 2 for the LFE scores. The DIAGNOdent pen is useful for the detection of dentinal caries of occlusal surfaces in permanent posterior teeth. Combination with other diagnostic conventional methods may enhance the reliability of this tool.

  11. Maxillary incisors changes during space closure with conventional and skeletal anchorage methods: a systematic review.

    Science.gov (United States)

    Jayaratne, Yasas Shri Nalaka; Uribe, Flavio; Janakiraman, Nandakumar

    2017-01-01

    The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes) and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration) were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. More RCT's that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  12. Reinforcing the role of the conventional C-arm - a novel method for simplified distal interlocking

    Directory of Open Access Journals (Sweden)

    Windolf Markus

    2012-01-01

    Full Text Available Abstract Background The common practice for insertion of distal locking screws of intramedullary nails is a freehand technique under fluoroscopic control. The process is technically demanding, time-consuming and afflicted to considerable radiation exposure of the patient and the surgical personnel. A new concept is introduced utilizing information from within conventional radiographic images to help accurately guide the surgeon to place the interlocking bolt into the interlocking hole. The newly developed technique was compared to conventional freehand in an operating room (OR like setting on human cadaveric lower legs in terms of operating time and radiation exposure. Methods The proposed concept (guided freehand, generally based on the freehand gold standard, additionally guides the surgeon by means of visible landmarks projected into the C-arm image. A computer program plans the correct drilling trajectory by processing the lens-shaped hole projections of the interlocking holes from a single image. Holes can be drilled by visually aligning the drill to the planned trajectory. Besides a conventional C-arm, no additional tracking or navigation equipment is required. Ten fresh frozen human below-knee specimens were instrumented with an Expert Tibial Nail (Synthes GmbH, Switzerland. The implants were distally locked by performing the newly proposed technique as well as the conventional freehand technique on each specimen. An orthopedic resident surgeon inserted four distal screws per procedure. Operating time, number of images and radiation time were recorded and statistically compared between interlocking techniques using non-parametric tests. Results A 58% reduction in number of taken images per screw was found for the guided freehand technique (7.4 ± 3.4 (mean ± SD compared to the freehand technique (17.6 ± 10.3 (p p = 0.001. Operating time per screw (from first shot to screw tightened was on average 22% reduced by guided freehand (p = 0

  13. Evaluating gull diets: A comparison of conventional methods and stable isotope analysis

    Science.gov (United States)

    Weiser, Emily L.; Powell, Abby N.

    2011-01-01

    Samples such as regurgitated pellets and food remains have traditionally been used in studies of bird diets, but these can produce biased estimates depending on the digestibility of different foods. Stable isotope analysis has been developed as a method for assessing bird diets that is not biased by digestibility. These two methods may provide complementary or conflicting information on diets of birds, but are rarely compared directly. We analyzed carbon and nitrogen stable isotope ratios of feathers of Glaucous Gull (Larus hyperboreus) chicks from eight breeding colonies in northern Alaska, and used a Bayesian mixing model to generate a probability distribution for the contribution of each food group to diets. We compared these model results with probability distributions from conventional diet samples (pellets and food remains) from the same colonies and time periods. Relative to the stable isotope estimates, conventional analysis often overestimated the contributions of birds and small mammals to gull diets and often underestimated the contributions of fish and zooplankton. Both methods gave similar estimates for the contributions of scavenged caribou, miscellaneous marine foods, and garbage to diets. Pellets and food remains therefore may be useful for assessing the importance of garbage relative to certain other foods in diets of gulls and similar birds, but are clearly inappropriate for estimating the potential impact of gulls on birds, small mammals, or fish. However, conventional samples provide more species-level information than stable isotope analysis, so a combined approach would be most useful for diet analysis and assessing a predator's impact on particular prey groups.

  14. Comparison of conventional serology and PCR methods for the routine diagnosis of Trypanosoma cruzi infection

    Directory of Open Access Journals (Sweden)

    Soraia Reda Gilber

    2013-06-01

    Full Text Available Introduction Trypanosoma cruzi, a flagellated protozoan, is the etiologic agent of Chagas disease, and it is estimated that approximately 5 million people in Brazil are infected with this parasite. This work aimed to compare the current diagnostic methods for Chagas disease, including conventional serological (IFAT and ELISA and molecular techniques (PCR, to introduce PCR as an auxiliary technique. Methods A total of 106 chagasic patients were evaluated: 88 from endemic areas of Parana, 6 from São Paulo, 3 from Minas Gerais, 3 from Rio Grande do Sul, 1 from Bahia and 5 from the Santa Catarina T. cruzi outbreak. The samples were analyzed by conventional serological methods (IFAT, ELISA, hemoculture and PCR to confirm Chagas disease. Results When IFAT was used to determine antibody levels, the sensitivity was 81.7% for patients with the cardiac form of the disease and 100% for the other clinical forms. In contrast, ELISA showed 84% sensitivity and 100% specificity. The use of serological and molecular techniques and their implications for the diagnosis of Chagas disease in non-endemics area are discussed. Conclusions PCR constitutes an excellent support methodology for the laboratory diagnosis of Chagas disease due to its high sensitivity and specificity.

  15. Analysis 'in vivo' of the employ of the Er:YAG laser and conventional method to remove carious tissue

    International Nuclear Information System (INIS)

    Ribeiro, Rafael Cardoso

    2002-01-01

    The aim of this study was to evaluate the removal of carious tissue employing the use of Er:YAG laser in comparison with the conventional burr rotary instrument. The wavelength of this laser is 2,64 μm and have a good absorption by the water and hydroxyapatite present in dental hard tissue. For this purpose were selected 24 molar teeth with occlusal carious, which were divided in random in two groups. For enamel, the laser energy used was in the interval from 250 mJ to 400 mJ, and the frequency range from 2 Hz to 4 Hz; for the dentine the energy laser range was from 150 mJ to 200 mJ and the laser frequency was in the range from 2 Hz to 6 Hz. For the evaluation of the results was used a questionaire to critical evaluation of the professional and another one to evaluation of the patient. The results have shown that the Er:YAG laser is able to remove carious enamel and dentin, without cause crunch or fracture and the irradiated surface was creasy. The patients reported greatest comfort when the cavity preparation was done with the Er:YAG laser than the conventional burr and all the patients treated reported prefer to future treatments the use of the Er:YAG laser. In conclusion, for the critical evaluation of the professional the treatment with the Er:YAG laser is a safe and effective method, and for the critical evaluation of the patient the treatment is one alternative more comfortable than the conventional method to remove caries. (author)

  16. Evaluation of the Effect of Corticotomy on Rate of Tooth Movement and Comparison with Conventional Method

    Directory of Open Access Journals (Sweden)

    B. Rahsepar

    2005-02-01

    Full Text Available Statement of Problem: Reduction of orthodontic therapy treatment time is considered an important goal inthe management of malocclusion in adult patients. Corticotomy- facilitated orthodontic treatment may beconsidered an intermediate therapy between orthognatic surgry and conventional orthodontics for reducing treatment time.Purpose: This study was undertaken to evaluate and compare the rate of tooth movement of upper canine following corticotomy with conventional method.Materials and Methods: Ten young adult patients, 17-25 years old was selected through sequential sampling procedure in orthodontics department of Shiraz Dental School. The patients exhibited different orthodontic problems and needed extraction of premolars. Following extraction of premolars and initial phase oforthodontic treatment, corticotomy were performed unilaterally on buccual and palatal sides of extraction areaas described by Takami. The other imoperated sides were used as control. After subsiding the resultant inflammation, the activated NiTi spring was used and measurement of the amount of tooth movement wereassessed by using Rugae as reference point. The panoramic radiographs were super imposed for evaluation of canines tipping. For analyzing the results, Kolmogorou- simirnov and t.tcst were used. Results: The rate of canine tooth movement was much greater in the corticotomy sides than the unoperated (control side (P=0.015. This was especially significant at the end of first week of tooth movement(P=0.000. Comparing the two sides, the amount of canine tipping was much lesser in corticotomy group than the control group (P=0.046. There was no significant difference concerning the anchorage loss between thetwo groups (P=0.410.Conclusion: Corticotomy procedure had a positive effect on the rate of tooth movement with less tipping of the canines comparing to conventional orthodontic treatment. To get more benefit from this procedure, it is recommended to select those

  17. Candida identification: a journey from conventional to molecular methods in medical mycology.

    Science.gov (United States)

    Alam, Mohammad Zubair; Alam, Qamre; Jiman-Fatani, Asif; Kamal, Mohammad Amjad; Abuzenadah, Adel M; Chaudhary, Adeel G; Akram, Mohammad; Haque, Absarul

    2014-05-01

    The incidence of Candida infections have increased substantially in recent years due to aggressive use of immunosuppressants among patients. Use of broad-spectrum antibiotics and intravascular catheters in the intensive care unit have also attributed with high risks of candidiasis among immunocompromised patients. Among Candida species, C. albicans accounts for the majority of superficial and systemic infections, usually associated with high morbidity and mortality often caused due to increase in antimicrobial resistance and restricted number of antifungal drugs. Therefore, early detection of candidemia and correct identification of Candida species are indispensable pre-requisites for appropriate therapeutic intervention. Since blood culture based methods lack sensitivity, and species-specific identification by conventional method is time-consuming and often leads to misdiagnosis within closely related species, hence, molecular methods may provide alternative for accurate and rapid identification of Candida species. Although, several molecular approaches have been developed for accurate identification of Candida species but the internal transcribed spacer 1 and 2 (ITS1 and ITS2) regions of the rRNA gene are being used extensively in a variety of formats. Of note, ITS sequencing and PCR-RFLP analysis of ITS region seems to be promising as a rapid, easy, and cost-effective method for identification of Candida species. Here, we review a number of existing techniques ranging from conventional to molecular approaches currently in use for the identification of Candida species. Further, advantages and limitations of these methods are also discussed with respect to their discriminatory power, reproducibility, and ease of performance.

  18. [Evaluation of the significance of molecular methods in the diagnosis of invasive fungal infections: comparison with conventional methods].

    Science.gov (United States)

    Susever, Serdar; Yeğenoğlu, Yıldız

    2011-04-01

    Direct microscopy and culture methods are still valuable standard conventional methods for the diagnosis of infections caused by true or opportunistic fungal pathogens, especially in high risk patients. However, some of the problems concerning the application and interpretation of those methods, indicate a need for more rapid, practical and reliable tests with high sensitivity and specificity. This study was conducted to compare the results obtained by molecular methods with the results of conventional methods performed simultaneously for the detection and identification of causative fungi in clinical samples. Clinical samples [24 bronchoalveolar lavage (BAL); 14 blood; 5 peritoneal, 4 pleural and 1 pericardial fluids; 1 cerebrospinal fluid (CSF), 1 urine] from 50 immunosuppressed patients were included in the study. All of the samples were cultivated on Sabouraud dextrose and brain-heart infusion agar media and incubated at 30°C and 37°C for 30 days. Samples other than blood were stained with 10-15% KOH + calcofluor white and examined by direct microscopy. Conventional identification of the isolates were performed by using basic morphological and biochemical characteristics. The isolation of fungal DNAs for polymerase chain reaction (PCR) was achieved by classical phenol-chloroform-isoamylalcohol procedure (9-10 hours) and commercial DNA extraction kit (6-7 hours) and general and species-specific primers (multiplex) from ITS1, ITS2, ITS3, ITS4, 5.8S rDNA and 28S rDNA regions were chosen for amplification. In PCR results, 550 base-paired (bp) bands obtained with universal primers were evaluated as fungal DNA positivity, and 273 bp, 320 bp, 423 bp, 357 bp, 136 bp and 385 bp bands with species-specific primers were evaluated as Candida albicans, Candida parapsilosis, Candida glabrata, Candida tropicalis, Cryptococcus neoformans and Aspergillus fumigatus positivities, respectively. Seventeen (34%) of the 50 samples yielded fungal growth on culture (C.albicans in 12

  19. Extraction and comparison of proteins from natural rubber latex by conventional and ionizing radiation methods

    International Nuclear Information System (INIS)

    Rogero, Sizue O.; Spencer, Patrick J.; Campos, Vania E.; Lusvarghi, Fabio M.; Higa, Olga Z.

    1997-01-01

    Several proteins in natural rubber latex (NRL) have been assigned to be significant allergens. It is known that proteins submitted to ionizing radiation suffer denaturation and immunochemical modification resulting in low antigenic reactivity. The aim of this study was to extract and compare water extractable proteins from NRL films vulcanized by conventional and by ionizing radiation methods. SDS-polyacrylamide gel electrophoresis (SDS--PAGE) and high pressure liquid chromatography (HPLC) showed a diffuse protein band of about 14 KDa, which we believe is rubber elongation factor (REF), in both eluates, but smaller in latex film vulcanized by ionizing radiation. REF has been suggested to be a major latex allergen. These data suggest that ionizing radiation vulcanization could be an useful method for the production of NRL goods with low antigenicity. (author). 8 refs., 2 figs., 1 tab

  20. Plasmonic nanostructures for surface enhanced spectroscopic methods.

    Science.gov (United States)

    Jahn, Martin; Patze, Sophie; Hidi, Izabella J; Knipper, Richard; Radu, Andreea I; Mühlig, Anna; Yüksel, Sezin; Peksa, Vlastimil; Weber, Karina; Mayerhöfer, Thomas; Cialla-May, Dana; Popp, Jürgen

    2016-02-07

    A comprehensive review of theoretical approaches to simulate plasmonic-active metallic nano-arrangements is given. Further, various fabrication methods based on bottom-up, self-organization and top-down techniques are introduced. Here, analytical approaches are discussed to investigate the optical properties of isotropic and non-magnetic spherical or spheroidal particles. Furthermore, numerical methods are introduced to research complex shaped structures. A huge variety of fabrication methods are reviewed, e.g. bottom-up preparation strategies for plasmonic nanostructures to generate metal colloids and core-shell particles as well as complex-shaped structures, self-organization as well as template-based methods and finally, top-down processes, e.g. electron beam lithography and its variants as well as nanoimprinting. The review article is aimed at beginners in the field of surface enhanced spectroscopy (SES) techniques and readers who have a general interest in theoretical modelling of plasmonic substrates for SES applications as well as in the fabrication of the desired structures based on methods of the current state of the art.

  1. Recent advances in conventional and contemporary methods for remediation of heavy metal-contaminated soils.

    Science.gov (United States)

    Sharma, Swati; Tiwari, Sakshi; Hasan, Abshar; Saxena, Varun; Pandey, Lalit M

    2018-04-01

    Remediation of heavy metal-contaminated soils has been drawing our attention toward it for quite some time now and a need for developing new methods toward reclamation has come up as the need of the hour. Conventional methods of heavy metal-contaminated soil remediation have been in use for decades and have shown great results, but they have their own setbacks. The chemical and physical techniques when used singularly generally generate by-products (toxic sludge or pollutants) and are not cost-effective, while the biological process is very slow and time-consuming. Hence to overcome them, an amalgamation of two or more techniques is being used. In view of the facts, new methods of biosorption, nanoremediation as well as microbial fuel cell techniques have been developed, which utilize the metabolic activities of microorganisms for bioremediation purpose. These are cost-effective and efficient methods of remediation, which are now becoming an integral part of all environmental and bioresource technology. In this contribution, we have highlighted various augmentations in physical, chemical, and biological methods for the remediation of heavy metal-contaminated soils, weighing up their pros and cons. Further, we have discussed the amalgamation of the above techniques such as physiochemical and physiobiological methods with recent literature for the removal of heavy metals from the contaminated soils. These combinations have showed synergetic effects with a many fold increase in removal efficiency of heavy metals along with economic feasibility.

  2. A comparative microbiological study to assess caries excavation by conventional rotary method and a chemo-mechanical method

    Directory of Open Access Journals (Sweden)

    Rajesh T Anegundi

    2012-01-01

    Full Text Available Aims: This study was aimed to determine the effectiveness of Papacαrie® for caries removal as compared to the conventional method with respect to microbial flora, time, the amount of tissue removal, child′s behavior, pain perception, and preference of treatment. Materials and Methods: Sixty primary molars of 30 children of age 4-9 years were selected randomly and divided into two groups of 30 teeth each: Group A treated by conventional method and group B with Papacαrie® method. Results: Comparatively, no statistical difference was seen in microbial growth, total bacterial count, and lactobacilli count in both the groups ( P = 0.36. The mean cavity entrance size with group A was 0.98133 mm and group B was 0.26083 mm ( P < 0.001. The mean preparation time for group A was 4.7 Mins (minutes and group B was 17.96 min s ( P < 0.001. Majority of kids of both group A and B scored 3 (Frankl Behavior Rating Scale before and after the treatment showing no statistical difference in their behavioral score ( P = 1. In group A 50% of children experienced no pain as compared to 86.7% in group B ( P = 0.01. There was no statistical difference in the preference of treatment ( P = 0.12. Conclusion: Thus, the Chemo mechanical caries removal method can be considered as an effective method to control pain and preserve sound tooth structure during caries excavation.

  3. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Je Hyun; Shim, Chang Ho [Dept. of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of); Kim, Sung Hyun [Nuclear Fuel Cycle Waste Treatment Research Division, Research Reactor Institute, Kyoto University, Osaka (Japan); Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo [Ionizing Radiation Center, Nuclear Fuel Cycle Waste Treatment Research Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho [Ionizing Radiation Center, Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2016-12-15

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers.

  4. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    International Nuclear Information System (INIS)

    Kim, Je Hyun; Shim, Chang Ho; Kim, Sung Hyun; Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo; Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho

    2016-01-01

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers

  5. Modified surface testing method for large convex aspheric surfaces based on diffraction optics.

    Science.gov (United States)

    Zhang, Haidong; Wang, Xiaokun; Xue, Donglin; Zhang, Xuejun

    2017-12-01

    Large convex aspheric optical elements have been widely applied in advanced optical systems, which have presented a challenging metrology problem. Conventional testing methods cannot satisfy the demand gradually with the change of definition of "large." A modified method is proposed in this paper, which utilizes a relatively small computer-generated hologram and an illumination lens with certain feasibility to measure the large convex aspherics. Two example systems are designed to demonstrate the applicability, and also, the sensitivity of this configuration is analyzed, which proves the accuracy of the configuration can be better than 6 nm with careful alignment and calibration of the illumination lens in advance. Design examples and analysis show that this configuration is applicable to measure the large convex aspheric surfaces.

  6. Measuring serotonin synthesis: from conventional methods to PET tracers and their (pre)clinical implications

    Energy Technology Data Exchange (ETDEWEB)

    Visser, Anniek K.D.; Waarde, Aren van; Willemsen, Antoon T.M. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); Bosker, Fokko J. [University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Luiten, Paul G.M. [University of Groningen, Center for Behavior and Neurosciences, Department of Molecular Neurobiology, Haren (Netherlands); Boer, Johan A. den [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Kema, Ido P. [University of Groningen, University Medical Center Groningen, Department of Laboratory Medicine, Groningen (Netherlands); Dierckx, Rudi A.J.O. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University Hospital Ghent, Department of Nuclear Medicine, Ghent (Belgium)

    2011-03-15

    The serotonergic system of the brain is complex, with an extensive innervation pattern covering all brain regions and endowed with at least 15 different receptors (each with their particular distribution patterns), specific reuptake mechanisms and synthetic processes. Many aspects of the functioning of the serotonergic system are still unclear, partially because of the difficulty of measuring physiological processes in the living brain. In this review we give an overview of the conventional methods of measuring serotonin synthesis and methods using positron emission tomography (PET) tracers, more specifically with respect to serotonergic function in affective disorders. Conventional methods are invasive and do not directly measure synthesis rates. Although they may give insight into turnover rates, a more direct measurement may be preferred. PET is a noninvasive technique which can trace metabolic processes, like serotonin synthesis. Tracers developed for this purpose are {alpha}-[{sup 11}C]methyltryptophan ([{sup 11}C]AMT) and 5-hydroxy-L-[{beta}-{sup 11}C]tryptophan ([{sup 11}C]5-HTP). Both tracers have advantages and disadvantages. [{sup 11}C]AMT can enter the kynurenine pathway under inflammatory conditions (and thus provide a false signal), but this tracer has been used in many studies leading to novel insights regarding antidepressant action. [{sup 11}C]5-HTP is difficult to produce, but trapping of this compound may better represent serotonin synthesis. AMT and 5-HTP kinetics are differently affected by tryptophan depletion and changes of mood. This may indicate that both tracers are associated with different enzymatic processes. In conclusion, PET with radiolabelled substrates for the serotonergic pathway is the only direct way to detect changes of serotonin synthesis in the living brain. (orig.)

  7. Surface water ponding on clayey soils managed by conventional and conservation tillage in boreal conditions

    Directory of Open Access Journals (Sweden)

    L. ALAKUKKU

    2008-12-01

    Full Text Available Surface water ponding and crop hampering due to soil wetness was monitored in order to evaluate the effects of conservation tillage practices and perennial grass cover on soil infiltrability for five years in situ in gently sloping clayey fields. Thirteen experimental areas, each having three experimental fields, were established in southern Finland. The fields belonged to: autumn mouldboard ploughing (AP, conservation tillage (CT and perennial grass in the crop rotation (PG. In the third year, direct drilled (DD fields were established in five areas. Excluding PG, mainly spring cereals were grown in the fields. Location and surface area of ponded water (in the spring and autumn as well as hampered crop growth (during June-July were determined in each field by using GPS devices and GIS programs. Surface water ponding or crop hampering occurred when the amount of rainfall was clearly greater than the long-term average. The mean of the relative area of the ponded surface water, indicating the risk of surface runoff, and hampered crop growth was larger in the CT fields than in the AP fields. The differences between means were, however, not statistically significant. Complementary soil physical measurements are required to investigate the reasons for the repeated surface water ponding.;

  8. Comparison of direct digital and conventional radiography for the detection of proximal surface caries in the mixed dentition.

    Science.gov (United States)

    Uprichard, K K; Potter, B J; Russell, C M; Schafer, T E; Adair, S; Weller, R N

    2000-01-01

    The aim of this study was to compare the performance of direct digital radiography and traditional dental radiography for the detection of proximal surface dental caries in the mixed dentition. 15 quadrants of extracted teeth, arranged from the primary canine to permanent first molar, were imaged using direct digital (Schick Technologies, Long Island City, NY, USA) and conventional films (D-speed and E-speed Plus; Eastman Kodak Co., Rochester, NY, USA). Five pediatric dentists viewed the images and scored the 270 proximal surfaces for presence of caries on a 5 point scale and extent of caries on a 4 point scale. The teeth were sectioned and viewed microscopically to determine the gold standard. Receiver operating characteristic (ROC) analysis and analysis of variance (ANOVA) were used to evaluate the viewer's performance for detecting proximal caries using the 3 different image receptor types. Experienced examiners were significantly more accurate in diagnosis of proximal surface caries using either D-speed or E-speed Plus films than they were using the direct digital receptor. The mean areas under the ROC curve (Az) for the viewers were 0.7595 for D-speed film, 0.7557 for E-speed Plus film, and 0.5928 for the direct digital receptor. The results also indicated that selected viewers' accuracy increased when viewing the direct digital images a second time. CCD based direct digital radiography was not as accurate as conventional film images for the purpose of diagnosing proximal surface caries in the mixed dentition. However, the results imply that with increased experience, direct digital images may be as accurate as conventional film based images for diagnosis.

  9. SURFACE LAYER ACCRETION IN CONVENTIONAL AND TRANSITIONAL DISKS DRIVEN BY FAR-ULTRAVIOLET IONIZATION

    International Nuclear Information System (INIS)

    Perez-Becker, Daniel; Chiang, Eugene

    2011-01-01

    Whether protoplanetary disks accrete at observationally significant rates by the magnetorotational instability (MRI) depends on how well ionized they are. Disk surface layers ionized by stellar X-rays are susceptible to charge neutralization by small condensates, ranging from ∼0.01 μm sized grains to angstrom-sized polycyclic aromatic hydrocarbons (PAHs). Ion densities in X-ray-irradiated surfaces are so low that ambipolar diffusion weakens the MRI. Here we show that ionization by stellar far-ultraviolet (FUV) radiation enables full-blown MRI turbulence in disk surface layers. Far-UV ionization of atomic carbon and sulfur produces a plasma so dense that it is immune to ion recombination on grains and PAHs. The FUV-ionized layer, of thickness 0.01-0.1 g cm -2 , behaves in the ideal magnetohydrodynamic limit and can accrete at observationally significant rates at radii ∼> 1-10 AU. Surface layer accretion driven by FUV ionization can reproduce the trend of increasing accretion rate with increasing hole size seen in transitional disks. At radii ∼<1-10 AU, FUV-ionized surface layers cannot sustain the accretion rates generated at larger distance, and unless turbulent mixing of plasma can thicken the MRI-active layer, an additional means of transport is needed. In the case of transitional disks, it could be provided by planets.

  10. Synthesis of novel chalcone derivatives by conventional and microwave irradiation methods and their pharmacological activities

    Directory of Open Access Journals (Sweden)

    Mohammed Rayees Ahmad

    2016-09-01

    Full Text Available Chalcones are abundant in edible plants and are considered to be the precursors of flavonoids and isoflavonoids. Chalcones belong to an important class of flavonoids, which may be prepared by Claisen–Schmidt condensation. They possess a wide range of biological activities and industrial applications. The cytotoxicity against tumour cell lines may be the result of disruption of the cell cycle, inhibition of angiogenesis, interference with p53-MDM2 interaction, mitochondrial uncoupling or induction of apoptosis. Chalcones are synthesized by conventional and microwave assisted synthesis methods. By microwave assisted synthesis, a considerable increase in the reaction rate has been observed and that too, with better yields. The compounds have been screened for cytotoxic activity and antioxidant activity.

  11. System Response Analysis and Model Order Reduction, Using Conventional Method, Bond Graph Technique and Genetic Programming

    Directory of Open Access Journals (Sweden)

    Lubna Moin

    2009-04-01

    Full Text Available This research paper basically explores and compares the different modeling and analysis techniques and than it also explores the model order reduction approach and significance. The traditional modeling and simulation techniques for dynamic systems are generally adequate for single-domain systems only, but the Bond Graph technique provides new strategies for reliable solutions of multi-domain system. They are also used for analyzing linear and non linear dynamic production system, artificial intelligence, image processing, robotics and industrial automation. This paper describes a unique technique of generating the Genetic design from the tree structured transfer function obtained from Bond Graph. This research work combines bond graphs for model representation with Genetic programming for exploring different ideas on design space tree structured transfer function result from replacing typical bond graph element with their impedance equivalent specifying impedance lows for Bond Graph multiport. This tree structured form thus obtained from Bond Graph is applied for generating the Genetic Tree. Application studies will identify key issues and importance for advancing this approach towards becoming on effective and efficient design tool for synthesizing design for Electrical system. In the first phase, the system is modeled using Bond Graph technique. Its system response and transfer function with conventional and Bond Graph method is analyzed and then a approach towards model order reduction is observed. The suggested algorithm and other known modern model order reduction techniques are applied to a 11th order high pass filter [1], with different approach. The model order reduction technique developed in this paper has least reduction errors and secondly the final model retains structural information. The system response and the stability analysis of the system transfer function taken by conventional and by Bond Graph method is compared and

  12. A rapid ultrasound particle agglutination method for HIV antibody detection: Comparison with conventional rapid HIV tests.

    Science.gov (United States)

    Bystryak, Simon; Ossina, Natalya

    2017-11-01

    We present the results of the feasibility and preliminary studies on analytical performance of a rapid test for detection of human immunodeficiency virus (HIV) antibodies in human serum or plasma that is an important advance in detecting HIV infection. Current methods for rapid testing of antibodies against HIV are qualitative and exhibit poor sensitivity (limit of detection). In this paper, we describe an ultrasound particle agglutination (UPA) method that leads to a significant increase of the sensitivity of conventional latex agglutination tests for HIV antibody detection in human serum or plasma. The UPA method is based on the use of: 1) a dual mode ultrasound, wherein a first single-frequency mode is used to accelerate the latex agglutination process, and then a second swept-frequency mode of sonication is used to disintegrate non-specifically bound aggregates; and 2) a numerical assessment of results of the agglutination process. The numerical assessment is carried out by optical detection and analysis of moving patterns in the resonator cell during the swept-frequency mode. The single-step UPA method is rapid and more sensitive than the three commercial rapid HIV test kits analyzed in the study: analytical sensitivity of the new UPA method was found to be 510-, 115-, and 80-fold higher than that for Capillus™, Multispot™ and Uni-Gold™ Recombigen HIV antibody rapid test kits, respectively. The newly developed UPA method opens up additional possibilities for detection of a number of clinically significant markers in point-of-care settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Comparison of digital radiography and apex locator with the conventional method in root length determination of primary teeth

    Directory of Open Access Journals (Sweden)

    I E Neena

    2011-01-01

    Full Text Available Aim: The purpose of this study was to compare the Working length in primary teeth endodontics using intra oral digital radiovisiography and apex locator with conventional method for accuracy. Materials and Methods: This in vivo study was conducted on 30 primary teeth which were indicated for pulpectomy in the patients of the age group of 5-11 years All experimental teeth had adequate remaining tooth structure for rubber dam isolation and radiographicaly visible canals. Endodontic treatment was required due to irreversible pulpitis or pulp necrosis. A standardized intraoral periapical radiograph of the tooth was taken using conventional method by paralleling technique. The distance between the source and the tooth, tooth and the films were standardized using X-ray positioning device. During the pulpectomy procedure, the working length was determined by digital radiograph and apex locator. The measurements were then compared with the conventional method of root canal measurement technique for accuracy Result: From the results obtained we can conclude that Working length determined in primary molars using digital radiography and Apex locator did not show any significant difference in the mean working length measurements when compared with the conventional radiographic method. Conclusions: Apex locator is comparable to conventional radiograph in determining the working length without radiation in the primary teeth. Intraoral digital radiography is the safest method in determining the working length with significant reduction in radiation exposure.Hence, both the techniques can be safely used as alternatives to conventional radiographic methods in determining working length in primary teeth.

  14. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    Directory of Open Access Journals (Sweden)

    A Pourkhalili

    2012-05-01

    Full Text Available Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying and roasting methods according to the cooking routine and tradition in Iranian society, in terms of temperature and time. Proximate compositions (moisture, lipid, ash and protein in the raw and cooked meat were determined using the standard methods of analysis. Moreover, weight loss was measured after each treatment. Lipid oxidation parameters such as peroxide value, conjugated diene and TBARS indices were measured in the raw and cooked samples. Evaluation of lipid oxidation parameters showed that peroxide value was significantly decreased in all cooked samples. In contrast, conjugated diene value was significantly increased in the fried and grilled samples (p

  15. Correlation and agreement of a digital and conventional method to measure arch parameters.

    Science.gov (United States)

    Nawi, Nes; Mohamed, Alizae Marny; Marizan Nor, Murshida; Ashar, Nor Atika

    2018-01-01

    The aim of the present study was to determine the overall reliability and validity of arch parameters measured digitally compared to conventional measurement. A sample of 111 plaster study models of Down syndrome (DS) patients were digitized using a blue light three-dimensional (3D) scanner. Digital and manual measurements of defined parameters were performed using Geomagic analysis software (Geomagic Studio 2014 software, 3D Systems, Rock Hill, SC, USA) on digital models and with a digital calliper (Tuten, Germany) on plaster study models. Both measurements were repeated twice to validate the intraexaminer reliability based on intraclass correlation coefficients (ICCs) using the independent t test and Pearson's correlation, respectively. The Bland-Altman method of analysis was used to evaluate the agreement of the measurement between the digital and plaster models. No statistically significant differences (p > 0.05) were found between the manual and digital methods when measuring the arch width, arch length, and space analysis. In addition, all parameters showed a significant correlation coefficient (r ≥ 0.972; p space analysis (95-99%) were also distinguished using the Bland-Altman method. These results demonstrate that 3D blue light scanning and measurement software are able to precisely produce 3D digital model and measure arch width, arch length, and space analysis. The 3D digital model is valid to be used in various clinical applications.

  16. Description of filamentous bacteria present in industrial activated sludge WWTPs by conventional and molecular methods.

    Science.gov (United States)

    Levantesi, C; Rossetti, S; Beimfohr, C; Thelen, K; Krooneman, J; van der Waarde, J; Tandoi, V

    2006-01-01

    Conventional cultivation methods and molecular approaches were utilised to describe the filamentous bacterial population of industrial activated sludge WWTPs. In total 43 strains were isolated by micromanipulation and were affiliated with 12 different species, comprising two new species and a new genus. In particular, a new species of Microthrix, a new genus of a filamentous Alphaproteobacteria morphologically similar to Nostocoida limicola, and a new filamentous species closely related to the opportunistic pathogen Propionibacterium propionicum were obtained. Despite the high number of isolates, the cultivation approach was unable to describe the filamentous bacteria most common in industrial WWTP. A culture-independent approach, termed the cell sorting/RT-PCR method, was therefore applied to identify fastidious or non-culturable filamentous microrganisms from different industrial plants. By this method the relevant filaments were micromanipulated and their 16S rDNA genes were amplified by RT-PCR. This approach was highly efficient. In total 31 16S rRNA sequences were obtained and 16 of them were used for the design of new specific oligonucleotide probes that highlighted dominant filaments in industrial activated sludge plants.

  17. Conventional and molecular methods used in the detection and subtyping of Yersinia enterocolitica in food.

    Science.gov (United States)

    Petsios, Stefanos; Fredriksson-Ahomaa, Maria; Sakkas, Hercules; Papadopoulou, Chrissanthy

    2016-11-21

    Yersinia enterocolitica is an important foodborne pathogen, but the prevalence in food is underestimated due to drawbacks in the detection methods. Problems arise from the low concentration of pathogenic strains present in food samples, similarities with other Enterobacteriaceae and Y. enterocolitica-like species and the heterogeneity of Y. enterocolitica as it comprises both pathogenic and non-pathogenic isolates. New rapid, cost-effective and more sensitive culture media and molecular techniques have been developed to overcome the drawbacks of conventional culture methods. Recent molecular subtyping methods have been applied to Y. enterocolitica strains to track infection sources and to investigate phylogenetic relationships between different Yersinia strains. Further application of modern subtyping tools such as WGS in a variety of bioserotypes, and comparison with other members of the genus will help to better understanding of the virulence determinants of pathogenic Y. enterocolitica, its mechanisms to cope in the host environments, and can contribute to the development of more specific detection and typing strategies.

  18. Comparing a new hydroexpression technique with conventional forceps method for SMILE lenticule removal.

    Science.gov (United States)

    Ng, Alex L K; Cheng, George P M; Woo, Victor C P; Jhanji, Vishal; Chan, Tommy C Y

    2017-11-09

    We described a modified 'hydroexpression' technique for the lenticule removal during small-incision lenticule extraction (SMILE) surgery and compared the results with conventional forceps method. This was a retrospective, comparative study of 50 patients who underwent SMILE surgery by the same surgeon. We compared the 1-week and 3-months postoperative results after SMILE using the hydroexpression technique with the conventional forceps technique. Main outcome measures included uncorrected distance visual acuity, corrected distance visual acuity, refractive accuracy, safety index and efficacy index. The baseline characteristics were comparable between both groups. At postoperative 1 week, the safety index in forceps and hydroexpression group was 0.93±0.11 and 0.97±0.10, respectively (P=0.246). At 3 months, they were 1.00±0.06 and 0.99±0.09 (P=0.850). For efficacy indices, at 1 week they were 0.84±0.17 and 0.91±0.17 (P=0.158). At 3 months, they were 0.92±0.13 and 0.94±0.19 (P=0.624). All eyes aimed for a plano target. 96% in forceps group and 90% in hydroexpression group were within ±0.50 dioptre (D) in spherical equivalent refraction (SEQ) correction at postoperative 3 months (P=0.567). The mean errors of SEQ correction were -0.10±0.21 D in forceps group and -0.08±0.30 D in hydroexpression group (P=0.705). Hydroexpression was simple and safe and had early results comparable to the conventional forceps technique. This technique was particularly useful for cases with more adhesions between lenticule and anterior cap, thin lenticule cases and for the inexperienced SMILE surgeons. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  19. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A. [Science Applications International Corp., McLean, VA (United States)

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods` power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V&V (determined by ratings of a system`s complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole.

  20. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    International Nuclear Information System (INIS)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A.

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole

  1. Method for surface treatment by electron beams

    International Nuclear Information System (INIS)

    Panzer, S.; Doehler, H.; Bartel, R.; Ardenne, T. von.

    1985-01-01

    The invention has been aimed at simplifying the technology and saving energy in modifying surfaces with the aid of electron beams. The described beam-object geometry allows to abandon additional heat treatments. It can be used for surface hardening

  2. Comparison of digital radiography and apex locator with the conventional method in root length determination of primary teeth.

    Science.gov (United States)

    Neena, I E; Ananthraj, A; Praveen, P; Karthik, V; Rani, P

    2011-01-01

    The purpose of this study was to compare the Working length in primary teeth endodontics using intra oral digital radiovisiography and apex locator with conventional method for accuracy. This in vivo study was conducted on 30 primary teeth which were indicated for pulpectomy in the patients of the age group of 5-11 years All experimental teeth had adequate remaining tooth structure for rubber dam isolation and radiographicaly visible canals. Endodontic treatment was required due to irreversible pulpitis or pulp necrosis. A standardized intraoral periapical radiograph of the tooth was taken using conventional method by paralleling technique. The distance between the source and the tooth, tooth and the films were standardized using X-ray positioning device. During the pulpectomy procedure, the working length was determined by digital radiograph and apex locator. The measurements were then compared with the conventional method of root canal measurement technique for accuracy. From the results obtained we can conclude that Working length determined in primary molars using digital radiography and Apex locator did not show any significant difference in the mean working length measurements when compared with the conventional radiographic method. Apex locator is comparable to conventional radiograph in determining the working length without radiation in the primary teeth. Intraoral digital radiography is the safest method in determining the working length with significant reduction in radiation exposure.Hence, both the techniques can be safely used as alternatives to conventional radiographic methods in determining working length in primary teeth.

  3. Ranking and similarity of conventional, microwave and ultrasound element sequential extraction methods.

    Science.gov (United States)

    Relić, Dubravka; Héberger, Károly; Sakan, Sanja; Škrbić, Biljana; Popović, Aleksandar; Đorđević, Dragana

    2018-05-01

    This study aims to compare three extraction techniques of four sequential element extraction steps from soil and sediment samples that were taken from the location of the Pančevo petrochemical industry (Serbia). Elements were extracted using three different techniques: conventional, microwave and ultrasound extraction. A novel procedure - sum of the ranking differences (SRD) - was able to rank the techniques and elements, to see whether this method is a suitable tool to reveal the similarities and dissimilarities in element extraction techniques, provided that a proper ranking reference is available. The concentrations of the following elements Al, Ba, Ca, Cd, Co, Cr, Cu, Fe, K, Mg, Mn, Na, Ni, Pb, Si, Sn, Sr, V and Zn were determined through ICP OES. The different efficiencies and recovery values of element concentrations using each of the three extraction techniques were examined by the CRM BCR-701. By using SRD, we obtained a better separation between the different extraction techniques and steps when we rank their differences among the samples while lower separation was obtained according to analysed elements. Appling this method for ordering the elements could be useful for three purposes: (i) to find possible associations among the elements; (ii) to find possible elements that have outlier concentrations or (iii) detect differences in geochemical origin or behaviour of elements. Cross-validation of the SRD values in combination with cluster and principal component analysis revealed the same groups of extraction steps and techniques. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Application of Neural Networks to Wind tunnel Data Response Surface Methods

    Science.gov (United States)

    Lo, Ching F.; Zhao, J. L.; DeLoach, Richard

    2000-01-01

    The integration of nonlinear neural network methods with conventional linear regression techniques is demonstrated for representative wind tunnel force balance data modeling. This work was motivated by a desire to formulate precision intervals for response surfaces produced by neural networks. Applications are demonstrated for representative wind tunnel data acquired at NASA Langley Research Center and the Arnold Engineering Development Center in Tullahoma, TN.

  5. An Appropriate Cutoff Value for Determining the Colonization of Helicobacter pylori by the Pyrosequencing Method: Comparison with Conventional Methods.

    Science.gov (United States)

    Kim, Jaeyeon; Kim, Nayoung; Jo, Hyun Jin; Park, Ji Hyun; Nam, Ryoung Hee; Seok, Yeong-Jae; Kim, Yeon-Ran; Kim, Joo Sung; Kim, Jung Mogg; Kim, Jung Min; Lee, Dong Ho; Jung, Hyun Chae

    2015-10-01

    Sequencing of 16S ribosomal RNA (rRNA) gene has improved the characterization of microbial communities. It enabled the detection of low abundance gastric Helicobacter pylori sequences even in subjects that were found to be H. pylori negative with conventional methods. The objective of this study was to obtain a cutoff value for H. pylori colonization in gastric mucosa samples by pyrosequencing method. Gastric mucosal biopsies were taken from 63 subjects whose H. pylori status was determined by a combination of serology, rapid urease test, culture, and histology. Microbial DNA from mucosal samples was amplified by PCR using universal bacterial primers. 16S rDNA amplicons were pyrosequenced. ROC curve analysis was performed to determine the cutoff value for H. pylori colonization by pyrosequencing. In addition, temporal changes in the stomach microbiota were observed in eight initially H. pylori-positive and eight H. pylori-negative subjects at a single time point 1-8 years later. Of the 63 subjects, the presence of H. pylori sequences was detected in all (28/28) conventionally H. pylori-positive samples and in 60% (21/35) of H. pylori-negative samples. The average percent of H. pylori reads in each sample was 0.67 ± 1.09% in the H. pylori-negative group. Cutoff value for clinically positive H. pylori status was approximately 1.22% based on ROC curve analysis (AUC = 0.957; p Helicobacter pylori was successfully eradicated in five of seven treated H. pylori-positive subjects (71.4%), and the percentage of H. pylori reads in these five subjects dropped from 1.3-95.18% to 0-0.16% after eradication. These results suggest that the cutoff value of H. pylori sequence percentage for H. pylori colonization by pyrosequencing could be set at approximately 1%. It might be helpful to analyze gastric microbiota related to H. pylori sequence status. © 2015 John Wiley & Sons Ltd.

  6. Incidence of Heterotopic Ossification after Surface and Conventional Total Hip Arthroplasty: A Comparative Study Using Anterolateral Approach and Indomethacin Prophylaxis

    Directory of Open Access Journals (Sweden)

    Dario Regis

    2013-01-01

    Full Text Available The incidence and severity of heterotopic ossification (HO in two homogeneous groups of patients that received surface replacement arthroplasty (SRA and conventional total hip arthroplasty (THA were evaluated retrospectively. Thirty-nine patients undergoing 42 hip resurfacing procedures and 41 primary cementless THAs through an anterolateral approach received a 10-day course of 150 mg/die of indomethacin postoperatively. The median surgical time was 190 minutes and 156 minutes, respectively (. At a minimum 1-year followup, the development of HO was assessed on standard X-ray using Brooker grading. Ectopic bone formation was detected in five cases (11.9%, two Brooker grade I and three grade II in the SRA group and in 14 hips (34.1%, 12 grade I and two grade II treated with conventional THA, but the difference was not significant (. No clinically relevant periprosthetic ossification (Brooker III or IV occurred in both groups. Although the difference was not statistically significant, the incidence of HO after SRA was lower than conventional THA. More extensive soft tissue trauma, bone debris, and longer operative time in hip resurfacing are not likely to be absolute risk factors for HO. Further investigations including larger patient populations are needed to confirm these findings.

  7. Measurement of the body surface temperature by the method of laser photothermal radiometry

    International Nuclear Information System (INIS)

    Skvortsov, L A; Kirillov, V M

    2003-01-01

    The specific features of contactless measurements of the body surface temperature by the method of repetitively pulsed laser photothermal radiometry are considered and the requirements to the parameters of the laser and measurement scheme are formulated. The sensitivity of the method is estimated. The advantages of laser photothermal radiometry over the conventional passive radiometric method are discussed. (laser applications and other topics in quantum electronics)

  8. A rigorous assessment of tree height measurements obtained using airborne LIDAR and conventional field methods.

    Science.gov (United States)

    Hans-Erik Andersen; Stephen E. Reutebuch; Robert J. McGaughey

    2006-01-01

    Tree height is an important variable in forest inventory programs but is typically time-consuming and costly to measure in the field using conventional techniques. Airborne light detection and ranging (LIDAR) provides individual tree height measurements that are highly correlated with field-derived measurements, but the imprecision of conventional field techniques does...

  9. Multicenter Comparison of Machine Learning Methods and Conventional Regression for Predicting Clinical Deterioration on the Wards.

    Science.gov (United States)

    Churpek, Matthew M; Yuen, Trevor C; Winslow, Christopher; Meltzer, David O; Kattan, Michael W; Edelson, Dana P

    2016-02-01

    Machine learning methods are flexible prediction algorithms that may be more accurate than conventional regression. We compared the accuracy of different techniques for detecting clinical deterioration on the wards in a large, multicenter database. Observational cohort study. Five hospitals, from November 2008 until January 2013. Hospitalized ward patients None Demographic variables, laboratory values, and vital signs were utilized in a discrete-time survival analysis framework to predict the combined outcome of cardiac arrest, intensive care unit transfer, or death. Two logistic regression models (one using linear predictor terms and a second utilizing restricted cubic splines) were compared to several different machine learning methods. The models were derived in the first 60% of the data by date and then validated in the next 40%. For model derivation, each event time window was matched to a non-event window. All models were compared to each other and to the Modified Early Warning score, a commonly cited early warning score, using the area under the receiver operating characteristic curve (AUC). A total of 269,999 patients were admitted, and 424 cardiac arrests, 13,188 intensive care unit transfers, and 2,840 deaths occurred in the study. In the validation dataset, the random forest model was the most accurate model (AUC, 0.80 [95% CI, 0.80-0.80]). The logistic regression model with spline predictors was more accurate than the model utilizing linear predictors (AUC, 0.77 vs 0.74; p machine learning methods more accurately predicted clinical deterioration than logistic regression. Use of detection algorithms derived from these techniques may result in improved identification of critically ill patients on the wards.

  10. A simple gold nanoparticle-mediated immobilization method to fabricate highly homogeneous DNA microarrays having higher capacities than those prepared by using conventional techniques

    International Nuclear Information System (INIS)

    Jung, Cheulhee; Mun, Hyo Young; Li, Taihua; Park, Hyun Gyu

    2009-01-01

    A simple, highly efficient immobilization method to fabricate DNA microarrays, that utilizes gold nanoparticles as the mediator, has been developed. The fabrication method begins with electrostatic attachment of amine-modified DNA to gold nanoparticles. The resulting gold-DNA complexes are immobilized on conventional amine or aldehyde functionalized glass slides. By employing gold nanoparticles as the immobilization mediator, implementation of this procedure yields highly homogeneous microarrays that have higher binding capacities than those produced by conventional methods. This outcome is due to the increased three-dimensional immobilization surface provided by the gold nanoparticles as well as the intrinsic effects of gold on emission properties. This novel immobilization strategy gives microarrays that produce more intense hybridization signals for the complementary DNA. Furthermore, the silver enhancement technique, made possible only in the case of immobilized gold nanoparticles on the microarrays, enables simple monitoring of the integrity of the immobilized DNA probe.

  11. Ultrasound-assisted extraction of natural antioxidants from the flower of Limonium sinuatum: Optimization and comparison with conventional methods.

    Science.gov (United States)

    Xu, Dong-Ping; Zheng, Jie; Zhou, Yue; Li, Ya; Li, Sha; Li, Hua-Bin

    2017-02-15

    Natural antioxidants are widely used as dietary supplements or food additives. An optimized method of ultrasound-assisted extraction (UAE) was proposed for the effective extraction of antioxidants from the flowers of Limonium sinuatum and evaluated by response surface methodology. In this study, ethanol concentration, ratio of solvent to solid, ultrasonication time and temperature were investigated and optimized using a central composite rotatable design. The optimum extraction conditions were as follows: ethanol concentration, 60%; ratio of solvent to solid, 56.9:1mL/g; ultrasonication time, 9.8min; and temperature, 40°C. Under the optimal UAE conditions, the experimental values (483.01±15.39μmolTrolox/gDW) matched with those predicted (494.13μmolTrolox/gDW) within a 95% confidence level. In addition, the antioxidant activities of UAE were compared with those of conventional maceration and Soxhlet extraction methods, and the ultrasound-assisted extraction could give higher yield of antioxidants and markedly reduce the extraction time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Surface Attachment of Natural Antimicrobial Coatings onto Conventional Polypropylene Nonwoven Fabric and Its Antimicrobial Performance Assessment.

    Science.gov (United States)

    Ding, Lijun; Wang, Hao; Liu, Dan; Zheng, Zhengnan

    2018-02-01

    The growing number of microbial cross-contamination events necessitates the development of novel antimicrobial strategies in the food industry. In this study, a polypropylene nonwoven fabric (PPNWF) was grafted with a natural antimicrobial component, aloe emodin (AE), and its antimicrobial performance was evaluated. The grafted samples (PPNWF-g-AE) were examined using Fourier transform infrared spectroscopy and scanning electron microscopy. AE was effectively grafted onto the surface of the PPNWF through the adsorption covalent effect. Compared with nongrafted PPNWF, the antimicrobial activity of PPNWF-g-AE against Staphylococcus aureus, Escherichia coli, and Candida albicans was significantly enhanced. Scanning electron micrographs confirmed that the inhibitory mechanism of PPNWF-g-AE was the microbicidal function of the grafted AE. These findings indicate that PPNWF-g-AE has potential as an effective antimicrobial material in food applications.

  13. Rapid descriptive sensory methods – Comparison of Free Multiple Sorting, Partial Napping, Napping, Flash Profiling and conventional profiling

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Meinert, Lene

    2012-01-01

    Two new rapid descriptive sensory evaluation methods are introduced to the field of food sensory evaluation. The first method, free multiple sorting, allows subjects to perform ad libitum free sortings, until they feel that no more relevant dissimilarities among products remain. The second method...... is a modal restriction of Napping to specific sensory modalities, directing sensation and still allowing a holistic approach to products. The new methods are compared to Flash Profiling, Napping and conventional descriptive sensory profiling. Evaluations are performed by several panels of expert assessors...... of these repetitions to be significantly more closely related to the conventional profile than other methods. Semantic comparison shows large differences, with closest relations found between the two conventional profiles. This suggests that semantic results from an assessor in an evaluation type with no training...

  14. Comparison of the lysis centrifugation method with the conventional blood culture method in cases of sepsis in a tertiary care hospital.

    Science.gov (United States)

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-07-01

    Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Two hundred nonduplicate blood cultures from cases of sepsis were analyzed using two blood culture methods concurrently for recovery of bacteria from patients diagnosed clinically with sepsis - the conventional blood culture method using trypticase soy broth and the lysis centrifugation method using saponin by centrifuging at 3000 g for 30 minutes. Overall bacteria recovered from 200 blood cultures were 17.5%. The conventional blood culture method had a higher yield of organisms, especially Gram positive cocci. The lysis centrifugation method was comparable with the former method with respect to Gram negative bacilli. The sensitivity of lysis centrifugation method in comparison to conventional blood culture method was 49.75% in this study, specificity was 98.21% and diagnostic accuracy was 89.5%. In almost every instance, the time required for detection of the growth was earlier by lysis centrifugation method, which was statistically significant. Contamination by lysis centrifugation was minimal, while that by conventional method was high. Time to growth by the lysis centrifugation method was highly significant (P value 0.000) as compared to time to growth by the conventional blood culture method. For the diagnosis of sepsis, combination of the lysis centrifugation method and the conventional blood culture method with trypticase soy broth or biphasic media is advocable, in order to achieve faster recovery and a better yield of microorganisms.

  15. Limitations of the Conventional Phase Advance Method for Constant Power Operation of the Brushless DC Motor

    International Nuclear Information System (INIS)

    Lawler, J.S.

    2001-01-01

    The brushless dc motor (BDCM) has high-power density and efficiency relative to other motor types. These properties make the BDCM well suited for applications in electric vehicles provided a method can be developed for driving the motor over the 4 to 6:1 constant power speed range (CPSR) required by such applications. The present state of the art for constant power operation of the BDCM is conventional phase advance (CPA)[1]. In this paper, we identify key limitations of CPA. It is shown that the CPA has effective control over the developed power but that the current magnitude is relatively insensitive to power output and is inversely proportional to motor inductance. If the motor inductance is low, then the rms current at rated power and high speed may be several times larger than the current rating. The inductance required to maintain rms current within rating is derived analytically and is found to be large relative to that of BDCM designs using high-strength rare earth magnets. Th us, the CPA requires a BDCM with a large equivalent inductance

  16. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Ghoos, Y.; Brunser, O.; Lawson, F.; Muzeke, A.; Ndjaye, M.F.

    2000-01-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, 13 CO 2 and H 2 breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  17. Evaluation of various conventional methods for sampling weeds in potato and spinach crops

    Directory of Open Access Journals (Sweden)

    David Jamaica

    2014-04-01

    Full Text Available This study aimed to evaluate (at an exploratory level, some of the different conventional sampling designs in a section of a potato crop and in a commercial crop of spinach. Weeds were sampled in a 16 x 48 m section of a potato crop with a set grid of 192 sections. The cover and density of the weeds were registered in squares of from 0.25 to 64 m². The results were used to create a database that allowed for the simulation of different sampling designs: variables and square size. A second sampling was carried out with these results in a spinach crop of 1.16 ha with a set grid of 6 x 6 m cells, evaluating the cover in 4 m² squares. Another database was created with this information, which was used to simulate other sampling designs such as distribution and quantity of sampling squares. According to the obtained results, a good method for approximating the quantity of squares for diverse samples is 10-12 squares (4 m² for richness per ha and 18 or more squares for abundance per hectare. This square size is optimal since it allows for a sampling of more area without losing sight of low-profile species, with the cover variable best representing the abundance of the weeds.

  18. Surface Imaging Skin Friction Instrument and Method

    Science.gov (United States)

    Brown, James L. (Inventor); Naughton, Jonathan W. (Inventor)

    1999-01-01

    A surface imaging skin friction instrument allowing 2D resolution of spatial image by a 2D Hilbert transform and 2D inverse thin-oil film solver, providing an innovation over prior art single point approaches. Incoherent, monochromatic light source can be used. The invention provides accurate, easy to use, economical measurement of larger regions of surface shear stress in a single test.

  19. A method of determining surface runoff by

    Science.gov (United States)

    Donald E. Whelan; Lemuel E. Miller; John B. Cavallero

    1952-01-01

    To determine the effects of watershed management on flood runoff, one must make a reliable estimate of how much the surface runoff can be reduced by a land-use program. Since surface runoff is the difference between precipitation and the amount of water that soaks into the soil, such an estimate must be based on the infiltration capacity of the soil.

  20. Conventional Treatment of Surface Water Using Moringa Oleifera Seeds Extract as a Primary Coagulant

    Directory of Open Access Journals (Sweden)

    Suleyman A. Muyibi, Ahmed Hissein M Birima, Thamer A. Mohammed

    2012-10-01

    Full Text Available The present study involved the use of a model pilot scale water treatment plant to treat turbid surface water from a stream using processed Moringa oleifera seed with 25 % w/w oil extracted as primary coagulant. The water treatment plant was made up of four unit operations: coagulation, flocculation, sedimentation, and filtration (rapid sand filter. Test runs were carried out for three hours per run over a three-month period with turbidities ranging from 18 to 261 NTU. The turbidity, pH, and alkalinity as well as the filter head loss were measured every 30 minutes during the experimental runs. Average turbidity removal of up to 96 % at an effective doses of 20 and 30 mg/l of oil extracted M. oleifera for low (< 50 NTU and moderate turbidity (< 100 NTU water respectively was observed doses 50 – 80 mg/l for high turbidity (> 100 NTU water. M. oleifera seed extract was found to have no significant effect on pH or alkalinity of the water. The residual turbidities measured during most of the test runs satisfied the Malaysian Guideline for Drinking Water Supplies. Key Words: Moringa oleifera, primary coagulant, coagulation, pilot plant, filtration.

  1. System and method for free-boundary surface extraction

    KAUST Repository

    Algarni, Marei

    2017-10-26

    A method of extracting surfaces in three-dimensional data includes receiving as inputs three-dimensional data and a seed point p located on a surface to be extracted. The method further includes propagating a front outwardly from the seed point p and extracting a plurality of ridge curves based on the propagated front. A surface boundary is detected based on a comparison of distances between adjacent ridge curves and the desired surface is extracted based on the detected surface boundary.

  2. Comparison of molecular and conventional methods for the diagnosis of Fasciola hepatica infection in the field.

    Science.gov (United States)

    Arifin, Maria Immaculata; Höglund, Johan; Novobilský, Adam

    2016-12-15

    The liver fluke, Fasciola hepatica, is one of the major parasite threats to livestock industries world-wide. In sheep and cattle, F. hepatica infection is commonly diagnosed using a range of methods. Aside from conventional coprological and serological diagnostic methods, there are also several molecular methods available based on the detection of liver fluke DNA in faeces. In this study, the outcomes of faecal egg count (FEC), serology and coproantigen ELISA (cELISA) were compared with the performance of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) in diagnosis of F. hepatica from naturally infected cattle and sheep. A total of 64 individual faecal and serum samples were collected from four sheep and beef cattle herds with previous histories of F. hepatica infection. FEC and coproantigen levels were measured in faecal samples and anti-F.hepatica antibody levels were measured in serum samples. DNA samples isolated from faeces were examined both by PCR and LAMP, targeting the internal transcribed spacer 2 (ITS2) region of the F. hepatica genome. Results showed that F. hepatica eggs were present in 28 animals, while coproantigen and specific anti-F. hepatica antibodies were detected in 36 and 53 animals, respectively. Only 3 and 6 samples were positive by PCR and LAMP, respectively. To calculate method specificity and sensitivity, a combination of FEC and cELISA was selected as the composite reference standard (CRS). When compared to the CRS, PCR had a sensitivity of 10.7% and specificity of 100%, whereas LAMP had a sensitivity and specificity of 17.9% and 97.2%, respectively. PCR and LAMP in this field study were highly specific, but both had poor sensitivity compared with FEC and cELISA. Potential reasons for PCR and LAMP failure were inadequate amounts of amplifiable F. hepatica DNA, possibly due to the choice of DNA extraction procedure, amount of faecal material processed, as well as different faeces consistency and

  3. Conventional and unconventional extraction methods applied to the plant, Thymus serpyllum L

    Science.gov (United States)

    Đukić, D.; Mašković, P.; Vesković Moračanin, S.; Kurćubić, V.; Milijašević, M.; Babić, J.

    2017-09-01

    This study deals with the application of two conventional and three non-conventional extraction approaches for isolation of bioactive compounds from the plant Thymus serpyllum L. The extracts obtained were tested regarding their chemical profile (content of phenolics, flavonoids, condensed tannins, gallotannins and anthocyanins) and antioxidant activities. Subcritical water extract of Thymus serpyllum L. generally had the highest concentrations of the chemical bioactive compounds examined and the best antioxidant properties.

  4. A volume-based method for denoising on curved surfaces

    KAUST Repository

    Biddle, Harry

    2013-09-01

    We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

  5. A combination of small bowel imaging methods: conventional enteroclysis with complementary magnetic resonance enteroclysis

    Energy Technology Data Exchange (ETDEWEB)

    Akman, C. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Korman, U. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)]. E-mail: ugurk9@istanbul.edu.tr; Oguet, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Kurugoglu, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Urger, E. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Ulus, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Esen, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Tasci, I. [Department of Surgery, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)

    2005-07-01

    AIM: The aim of this prospective study was to evaluate the overall findings of conventional enteroclysis (CE) with complementary magnetic resonance enteroclysis (MRE) in small bowel disease. METHODS: The study included 32 patients referred from various clinical departments, with known or suspected small bowel disease and abnormalities on CE. Immediately after CE, true fast imaging with steady-state precession (true FISP), and unenhanced and gadolinium-enhanced T1-weighted fast low-angle shot (FLASH) sequences with fat saturation were obtained. Mucosal, mural and luminal changes of the small bowel were evaluated by each technique. In addition, bowel wall thickening, bowel wall enhancement and perienteric changes were assessed by MRE. The radiological findings obtained were evaluated together as a combination, and the role of MRE in the determination of the activity and complications of the small bowel disease was assessed. Radiological findings were correlated with clinical evaluation and follow-up in all cases, including endoscopy in 14 cases and surgery in 5 cases. RESULTS: MRE provided important supplementary mural and extramural information, including degree of pathological wall thickness, mural enhancement pattern associated with disease activity, perivisceral collection, abscess formation, mesenteric fibrofatty proliferation, lymphadenopathy and increase in perienteric vascularity. Short strictures were not revealed on MRE; however, for patients with a history of abdominal malignancy, MRE helped characterize the level of any obstruction and the extent of the disease. CONCLUSION: We recommend MRE for patients who have findings of advanced inflammatory bowel disease or neoplasm on CE examination. The combination of these two techniques can provide important information on the degree and extent of the disorder.

  6. Surface analysis methods in materials science

    CERN Document Server

    Sexton, Brett; Smart, Roger

    1992-01-01

    The idea for this book stemmed from a remark by Philip Jennings of Murdoch University in a discussion session following a regular meeting of the Australian Surface Science group. He observed that a text on surface analysis and applica­ tions to materials suitable for final year undergraduate and postgraduate science students was not currently available. Furthermore, the members of the Australian Surface Science group had the research experience and range of coverage of sur­ face analytical techniques and applications to provide a text for this purpose. A of techniques and applications to be included was agreed at that meeting. The list intended readership of the book has been broadened since the early discussions, particularly to encompass industrial users, but there has been no significant alter­ ation in content. The editors, in consultation with the contributors, have agreed that the book should be prepared for four major groups of readers: - senior undergraduate students in chemistry, physics, metallur...

  7. Novel thin-GaN LED structure adopted micro abraded surface to compare with conventional vertical LEDs in ultraviolet light

    Science.gov (United States)

    Chiang, Yen Chih; Lin, Chien Chung; Kuo, Hao Chung

    2015-04-01

    In this study, novel thin-GaN-based ultraviolet light-emitting diodes (NTG-LEDs) were fabricated using wafer bonding, laser lift-off, dry etching, textured surface, and interconnection techniques. Placing PN electrodes on the same side minimized the absorption caused by electrodes in conventional vertical injection light-emitting diodes (V-LEDs) and the current spreading was improved. The light output power (700 mA) of the NTG-LEDs was enhanced by 18.3% compared with that of the V-LEDs, and the external quantum efficiency (EQE) of the NTG-LEDs was also relatively enhanced by 20.0% compared with that of a reference device. When the current operations were 1,500 mA, the enhancements of the light output power and EQE were 27.4% and 27.2%, respectively. Additionally, the efficiency droop was improved by more than 15% at the same current level.

  8. Surface control alloy substrates and methods of manufacture therefor

    Energy Technology Data Exchange (ETDEWEB)

    Fritzemeier, Leslie G. (Mendon, MA); Li, Qi (Marlborough, MA); Rupich, Martin W. (Framingham, MA); Thompson, Elliott D. (Coventry, RI); Siegal, Edward J. (Malden, MA); Thieme, Cornelis Leo Hans (Westborough, MA); Annavarapu, Suresh (Brookline, MA); Arendt, Paul N. (Los Alamos, NM); Foltyn, Stephen R. (Los Alamos, NM)

    2004-05-04

    Methods and articles for controlling the surface of an alloy substrate for deposition of an epitaxial layer. The invention includes the use of an intermediate layer to stabilize the substrate surface against oxidation for subsequent deposition of an epitaxial layer.

  9. Evaluation of the PetrifilmTM and TEMPO® systems and the conventional method for counting microorganisms in pasteurized milk

    OpenAIRE

    Cirolini, Andréia; Baseggio, Andressa Mara; Miotto, Marília; Ramos, Roberta Juliano; Cattani, Cristhiane Stecanella de Oliveira; Vieira, Cleide Rosana Werneck

    2013-01-01

    New microbiological methods have been developed and commercialized, but their performance must be guaranteed. The aim of the present study was to evaluate the PetrifilmTM and TEMPO® systems compared to the conventional method for counting microorganisms in pasteurized milk. A total of 141 samples of pasteurized milk were analyzed by counting mesophilic aerobic, Coliforms at 35 ºC, Coliforms at 45 ºC, and Escherichia coli microorganisms. High correlation was found between the methods for count...

  10. VOLATILE CONSTITUENTS OF GINGER OIL PREPARED ACCORDING TO IRANIAN TRADITIONAL MEDICINE AND CONVENTIONAL METHOD: A COMPARATIVE STUDY.

    Science.gov (United States)

    Shirooye, Pantea; Mokaberinejad, Roshanak; Ara, Leila; Hamzeloo-Moghadam, Maryam

    2016-01-01

    Herbal medicines formulated as oils were believed to possess more powerful effects than their original plants in Iranian Traditional Medicine (ITM). One of the popular oils suggested for treatment of various indications was ginger oil. In the present study, to suggest a more convenient method of oil preparation (compared to the traditional method), ginger oil has been prepared according to both the traditional and conventional maceration methods and the volatile oil constituents have been compared. Ginger oil was obtained in sesame oil according to both the traditional way and the conventional (maceration) methods. The volatile oil of dried ginger and both oils were obtained by hydro-distillation and analyzed by gas chromatography/mass spectroscopy. Fifty five, fifty nine and fifty one components consisting 94 %, 94 % and 98 % of the total compounds were identified in the volatile oil of ginger, traditional and conventional oils, respectively. The most dominant compounds of the traditional and conventional oils were almost similar; however they were different from ginger essential oil which has also been to possess limited amounts of anti-inflammatory components. It was concluded that ginger oil could be prepared through maceration method and used for indications mentioned in ITM.

  11. On farm evaluation of the effect of low cost drip irrigation on water and crop productivity compared to conventional surface irrigation system

    Science.gov (United States)

    Maisiri, N.; Senzanje, A.; Rockstrom, J.; Twomlow, S. J.

    This on-farm research study was carried out at Zholube irrigation scheme in a semi-arid agro tropical climate of Zimbabwe to determine how low cost drip irrigation technologies compare with conventional surface irrigation systems in terms of water and crop productivity. A total of nine farmers who were practicing surface irrigation were chosen to participate in the study. The vegetable English giant rape ( Brassica napus) was grown under the two irrigation systems with three fertilizer treatments in each system: ordinary granular fertilizer, liquid fertilizer (fertigation) and the last treatment with no fertilizer. These trials were replicated three times in a randomized block design. Biometric parameters of leaf area index (LAI) and fresh weight of the produce, water use efficiency (WUE) were used to compare the performance of the two irrigation systems. A water balance of the inflows and outflows was kept for analysis of WUE. The economic profitability and the operation, maintenance and management requirements of the different systems were also evaluated. There was no significant difference in vegetable yield between the irrigation systems at 8.5 ton/ha for drip compared to 7.8 ton/ha in surface irrigation. There were significant increases in yields due to use of fertilizers. Drip irrigation used about 35% of the water used by the surface irrigation systems thus giving much higher water use efficiencies. The leaf area indices were comparable in both systems with the same fertilizer treatment ranging between 0.05 for surface without fertilizer to 6.8 for low cost drip with fertigation. Low cost drip systems did not reflect any labour saving especially when manually lifting the water into the drum compared to the use of siphons in surface irrigation systems. The gross margin level for surface irrigation was lower than for low cost drip irrigation but the gross margin to total variable cost ratio was higher in surface irrigation systems, which meant that surface

  12. Trainable Methods for Surface Natural Language Generation

    OpenAIRE

    Ratnaparkhi, Adwait

    2000-01-01

    We present three systems for surface natural language generation that are trainable from annotated corpora. The first two systems, called NLG1 and NLG2, require a corpus marked only with domain-specific semantic attributes, while the last system, called NLG3, requires a corpus marked with both semantic attributes and syntactic dependency information. All systems attempt to produce a grammatical natural language phrase from a domain-specific semantic representation. NLG1 serves a baseline syst...

  13. Comparison of Land, Water, and Energy Requirements of Lettuce Grown Using Hydroponic vs. Conventional Agricultural Methods

    Science.gov (United States)

    Lages Barbosa, Guilherme; Almeida Gadelha, Francisca Daiane; Kublik, Natalya; Proctor, Alan; Reichelm, Lucas; Weissinger, Emily; Wohlleb, Gregory M.; Halden, Rolf U.

    2015-01-01

    The land, water, and energy requirements of hydroponics were compared to those of conventional agriculture by example of lettuce production in Yuma, Arizona, USA. Data were obtained from crop budgets and governmental agricultural statistics, and contrasted with theoretical data for hydroponic lettuce production derived by using engineering equations populated with literature values. Yields of lettuce per greenhouse unit (815 m2) of 41 ± 6.1 kg/m2/y had water and energy demands of 20 ± 3.8 L/kg/y and 90,000 ± 11,000 kJ/kg/y (±standard deviation), respectively. In comparison, conventional production yielded 3.9 ± 0.21 kg/m2/y of produce, with water and energy demands of 250 ± 25 L/kg/y and 1100 ± 75 kJ/kg/y, respectively. Hydroponics offered 11 ± 1.7 times higher yields but required 82 ± 11 times more energy compared to conventionally produced lettuce. To the authors’ knowledge, this is the first quantitative comparison of conventional and hydroponic produce production by example of lettuce grown in the southwestern United States. It identified energy availability as a major factor in assessing the sustainability of hydroponics, and it points to water-scarce settings offering an abundance of renewable energy (e.g., from solar, geothermal, or wind power) as particularly attractive regions for hydroponic agriculture. PMID:26086708

  14. Evaluation of conventional and alternative nitrogen fertigation methods for highbush blueberry

    Science.gov (United States)

    A 0.3-ha study was planted in Oct. 2008 to determine the effects of nitrogen (N) fertigation using conventional and alternative drip irrigation systems on shoot growth and early fruit production in six cultivars of northern highbush blueberry. The cultivars included ‘Earliblue’, ‘Duke’, ‘Draper’, ‘B...

  15. Comparison of Land, Water, and Energy Requirements of Lettuce Grown Using Hydroponic vs. Conventional Agricultural Methods.

    Science.gov (United States)

    Barbosa, Guilherme Lages; Gadelha, Francisca Daiane Almeida; Kublik, Natalya; Proctor, Alan; Reichelm, Lucas; Weissinger, Emily; Wohlleb, Gregory M; Halden, Rolf U

    2015-06-16

    The land, water, and energy requirements of hydroponics were compared to those of conventional agriculture by example of lettuce production in Yuma, Arizona, USA. Data were obtained from crop budgets and governmental agricultural statistics, and contrasted with theoretical data for hydroponic lettuce production derived by using engineering equations populated with literature values. Yields of lettuce per greenhouse unit (815 m2) of 41 ± 6.1 kg/m2/y had water and energy demands of 20 ± 3.8 L/kg/y and 90,000 ± 11,000 kJ/kg/y (±standard deviation), respectively. In comparison, conventional production yielded 3.9 ± 0.21 kg/m2/y of produce, with water and energy demands of 250 ± 25 L/kg/y and 1100 ± 75 kJ/kg/y, respectively. Hydroponics offered 11 ± 1.7 times higher yields but required 82 ± 11 times more energy compared to conventionally produced lettuce. To the authors' knowledge, this is the first quantitative comparison of conventional and hydroponic produce production by example of lettuce grown in the southwestern United States. It identified energy availability as a major factor in assessing the sustainability of hydroponics, and it points to water-scarce settings offering an abundance of renewable energy (e.g., from solar, geothermal, or wind power) as particularly attractive regions for hydroponic agriculture.

  16. Manufacturing and characterization of ceramic pigment Zn1-xFexCr2O4 by synthetic non conventional methods

    International Nuclear Information System (INIS)

    Nieves, Leidy Johana Jaramillo; Baena, Oscar Jaime Restrepo

    2012-01-01

    The ceramic pigment with structure Zn 1-x Fe x Cr 2 O 4 (x = 0, 0.5, 1) was synthesized by non conventional methods of coprecipitation assisted by ultrasound and milling of high energy. This pigment was characterized by XRD, XRF, SEM, UV-VIS spectrophotometry and CIELab colorimetry. The aim of this work was studied two alternative methods to the traditional method of synthesis, evaluating the pigment properties, varying the stoichiometry, such as structure, composition, morphology and colorimetric coordinates. The results showed that is possible to obtain the desired crystalline structure at temperatures below 1000 ° C in both cases, also expected hues are obtained according to each stoichiometry, which shows the advantages of using methods non conventional when produce these pigments, since it has a higher controlling the composition, stoichiometry and is obtained at temperatures below compared with traditional ceramic method

  17. Antidepressant use and risk of hip fracture: A comparison of marginal structural models, conventional regression and propensity score methods

    NARCIS (Netherlands)

    Ali, M. Sanni; Groenwold, Rolf H.H.; Belitser, Svetlana V.; Souverein, Patrick C.; Gardarsdottir, Helga; Hoes, Arno W.; De Boer, A.; Klungel, Olaf H.

    2014-01-01

    Background: In observational studies of time-varying treatment, conditioning on time-dependent confounders that are affected by previous treatment using conventional regression methods may adjust-away(indirect) treatment effects.In the presence of unmeasured common causes of confounders and outcome,

  18. Comparison of the modified fluorescent method and conventional Ziehl-Neelsen method in the detection of acidfast bacilli in lymphnode aspirates

    Directory of Open Access Journals (Sweden)

    Annam Vamseedhar

    2009-01-01

    Full Text Available Objectives: The objectives were to correlate the modified fluorescent method with the conventional Ziehl-Neelsen (ZN method for the detection of acid-fast bacilli (AFB and, also to study the efficacy and advantages of using the auramine-rhodamine stain on lymph node aspirates under fluorescent microscopy. Methods: In 108 consecutive patients with a clinical suspicion of tuberculosis (TB presenting with lymphadenopathy, fine needle aspirations were performed. Smears from the aspirates were processed for routine cytology, the conventional ZN method, and the modified fluorescent method. The significance of the modified fluorescent method over the conventional ZN method was analyzed using the chi-square test. Results: Out of 108 aspirates, 102 were studied and remaining 6 were excluded from the study due to diagnosis of malignancy in 4.04% (4/6 and inadequate aspiration in 2.02% (2/6. Among the 102 aspirates, 44.11% (45/102 were positive for AFB on the conventional ZN method, 58.9% (60/102 were indicative of TB on cytology, while the smear positive increased to 81.37% (83/102 on the modified fluorescent method. Conclusions: Fluorescent microscopy has the advantage of speed and ease of screening, and reduces observer fatigue. The modified fluorescent method was found to be more advantageous than routine cytology and conventional ZN method, particularly in paucibacillary cases. The bacillary positivity rates were higher in the modified fluorescent method than in the ZN method. Hence, the modified fluorescent method can be an adjuvant when used with routine cytology for the identification of AFB.

  19. Mineralization of collagen may occur on fibril surfaces: evidence from conventional and high-voltage electron microscopy and three-dimensional imaging

    Science.gov (United States)

    Landis, W. J.; Hodgens, K. J.; Song, M. J.; Arena, J.; Kiyonaga, S.; Marko, M.; Owen, C.; McEwen, B. F.

    1996-01-01

    The interaction between collagen and mineral crystals in the normally calcifying leg tendons from the domestic turkey, Meleagris gallopavo, has been investigated at an ultrastructural level with conventional and high-voltage electron microscopy, computed tomography, and three-dimensional image reconstruction methods. Specimens treated by either aqueous or anhydrous techniques and resin-embedded were appropriately sectioned and regions of early tendon mineralization were photographed. On the basis of individual photomicrographs, stereoscopic pairs of images, and tomographic three-dimensional image reconstructions, platelet-shaped crystals may be demonstrated for the first time in association with the surface of collagen fibrils. Mineral is also observed in closely parallel arrays within collagen hole and overlap zones. The mineral deposition at these spatially distinct locations in the tendon provides insight into possible means by which calcification is mediated by collagen as a fundamental event in skeletal and dental formation among vertebrates.

  20. Comparison of digital radiography and apex locator with the conventional method in root length determination of primary teeth

    OpenAIRE

    I E Neena; A Ananthraj; P Praveen; V Karthik; P Rani

    2011-01-01

    Aim: The purpose of this study was to compare the Working length in primary teeth endodontics using intra oral digital radiovisiography and apex locator with conventional method for accuracy. Materials and Methods: This in vivo study was conducted on 30 primary teeth which were indicated for pulpectomy in the patients of the age group of 5-11 years All experimental teeth had adequate remaining tooth structure for rubber dam isolation and radiographicaly visible canals. Endodontic treatment wa...

  1. Surface renewal method for estimating sensible heat flux | Mengistu ...

    African Journals Online (AJOL)

    For short canopies, latent energy flux may be estimated using a shortened surface energy balance from measurements of sensible and soil heat flux and the net irradiance at the surface. The surface renewal (SR) method for estimating sensible heat, latent energy, and other scalar fluxes has the advantage over other ...

  2. Method for treatment of a surface area of steel

    NARCIS (Netherlands)

    Bhowmik, S.; Aaldert, P.J.

    2009-01-01

    The invention relates to a method for treatment of a surface area of steel by polishing said surface area and performing a plasma treatment of said surface area wherein the plasma treatment is performed at at least atmospheric conditions and wherein the plasma treatment is carried out at a power of

  3. An Alternative to Conventional Rock Fragmentation Methods Using SCDA: A Review

    Directory of Open Access Journals (Sweden)

    Radhika Vidanage De Silva

    2016-11-01

    Full Text Available Global energy and material consumption are expected to rise in exponential proportions during the next few decades, generating huge demands for deep earth energy (oil/gas recovery and mineral processing. Under such circumstances, the continuation of existing methods in rock fragmentation in such applications is questionable due to the proven adverse environmental impacts associated with them. In this regard; the possibility of using more environmentally friendly options as Soundless Chemical Demolition Agents (SCDAs play a vital role in replacing harmful conventional rock fragmentation techniques for gas; oil and mineral recovery. This study reviews up to date research on soundless cracking demolition agent (SCDA application on rock fracturing including its limitations and strengths, possible applications in the petroleum industry and the possibility of using existing rock fragmentation models for SCDA-based rock fragmentation; also known as fracking. Though the expansive properties of SCDAs are currently used in some demolition works, the poor usage guidelines available reflect the insufficient research carried out on its material’s behavior. SCDA is a cementitious powdery substance with quicklime (CaO as its primary ingredient that expands upon contact with water; which results in a huge expansive pressure if this CaO hydration reaction occurs in a confined condition. So, the mechanism can be used for rock fragmentation by injecting the SCDA into boreholes of a rock mass; where the resulting expansive pressure is sufficient to create an effective fracture network in the confined rock mass around the borehole. This expansive pressure development, however, dependent on many factors, where formation water content creates a negative influence on this due to required greater degree of hydration under greater water contents and temperature creates a positive influence by accelerating the reaction. Having a precise understanding of the fracture

  4. The performance of conventional and fluorescence-based methods for occlusal caries detection: an in vivo study with histologic validation.

    Science.gov (United States)

    Diniz, Michele B; Boldieri, Thalita; Rodrigues, Jonas A; Santos-Pinto, Lourdes; Lussi, Adrian; Cordeiro, Rita C L

    2012-04-01

    The authors conducted an in vivo study to determine clinical cutoffs for a laser fluorescence (LF) device, an LF pen and a fluorescence camera (FC), as well as to evaluate the clinical performance of these methods and conventional methods in detecting occlusal caries in permanent teeth by using the histologic gold standard for total validation of the sample. One trained examiner assessed 105 occlusal surfaces by using the LF device, LF pen, FC, International Caries Detection and Assessment System (ICDAS) criteria and bitewing (BW) radiographic methods. After tooth extraction, the authors assessed the teeth histologically. They determined the optimal clinical cutoffs by means of receiver operating characteristic curve analysis. The specificities and sensitivities for enamel and dentin caries detection versus only dentin caries detection thresholds were 0.60 and 0.93 and 0.77 and 0.52 (ICDAS), 1.00 and 0.29 and 0.97 and 0.44 (BW radiography), 1.00 and 0.85 and 0.77 and 0.81 (LF device), 0.80 and 0.89 and 0.71 and 0.85 (LF pen) and 0.80 and 0.74 and 0.49 and 0.85 (FC), respectively. The accuracy values were higher for ICDAS, the LF device and the LF pen than they were for BW radiography and the FC. The clinical cutoffs for sound teeth, enamel carious lesions and dentin carious lesions were, respectively, 0 through 4, 5 through 27 and 28 through 99 (LF device); 0 through 4, 5 through 32 and 33 through 99 (LF pen); and 0 through 1.2, 1.3 and 1.4 through 5.0 (FC). The ICDAS, the LF device and the LF pen demonstrated good performance in helping detect occlusal caries in vivo. The ICDAS did not seem to perform as well at the D(3) threshold (histologic scores 3 and 4) as at the D(1) threshold (histologic scores 1-4). BW radiography and the FC had the lowest performances in helping detect lesions at the D(1) and D(3) thresholds, respectively. Occlusal caries detection should be based primarily on visual inspection. Fluorescence-based methods may be used to provide a second

  5. Applying isotope methods in flowing surface waters

    International Nuclear Information System (INIS)

    Mook, W.G.

    1976-01-01

    The most frequent application of natural or environmental isotopes to investigate surface water is as tracer. Especially the natural variations in the 18 O/ 16 O ratio in rainfall are traced in streams and rivers. The isotopes deuterium, 13 C and 14 C enable refined applications such as the investigation of geochemical processes in waters. 18 O analyses are fairly fast (20 samples per day can be carried out) and require little water (1 to 10 ml). Therefore, the natural variations in the 18 O/ 16 O ratio of water are treated. There is a certain connection between the 18 O/ 16 O and D/H ratios in rainfall waters. 18 O analyses are somewhat easier to perform so that this technique is generally preferred. Additional D analyses are of great use in detecting geochemical processes, e.g. evaporation. Although tritium is still an important agent in hydrological studies, the concentration variations in nature are now lower than for 18 O compared to the usual experimental error. Furthermore, they are not so important geochemically. Accurate tritium measurements require relatively much time (1 or 2 analyses per day), are expensive (50 DM to 150 DM) and require more material (10 to 500 ml water), depending on the desired accuracy. The stable and radioactive carbon isotopes are mainly used in special cases to study certain geochemical processes. (orig./HK) [de

  6. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  7. A new practical method to reconstruct cerebral surface anatomical images for computer-assisted neurosurgery

    Energy Technology Data Exchange (ETDEWEB)

    Nakajima, Shin; Kato, Amami; Yoshimine, Toshiki; Taneda, Mamoru; Hayakawa, Toru (Osaka Univ. (Japan). Faculty of Medicine)

    1994-03-01

    Authors have developed a new, practical method to reconstruct cerebral surface anatomical images for better surgical orientation and surgical planning. Using a personal computer and a commercially available image handling software, an area encompassing the surface gyri and sulci is selected from the most superficial slice of T1-weighted MR images, after which this selected area, on adjusting the alignment, is overlayed onto the next superficial slice. By repeating this procedure for 4 to 7 times, the brain surface image obtained clearly displays the gyri and sulci. A vascular image of the cerebral surface can also be obtained by this same method by using T2-weighted images or MR angiograms. Then, by combining both the brain surface and vascular images, an anatomically reconstructed image of the cerebral surface is achieved. The outlines of the lesion or ventricles can also be added, if necessary, and the entire procedure takes an hour or less. The authors believe that this method is superior to conventional surface anatomy scanning for discriminating anatomical structures close to a lesion. This surface anatomical imaging method has been used for the surgical planning and its use helped to minimize surgical damage to the eloquent areas. (author).

  8. Defatted algal biomass as a non-conventional low-cost adsorbent: surface characterization and methylene blue adsorption characteristics.

    Science.gov (United States)

    Sarat Chandra, T; Mudliar, S N; Vidyashankar, S; Mukherji, S; Sarada, R; Krishnamurthi, K; Chauhan, V S

    2015-05-01

    The present study investigates the use of defatted algal biomass (DAB) as a non-conventional low cost adsorbent. The maximum adsorption capacity of biomass (raw, defatted and sulfuric acid pretreated DAB) was determined by liquid phase adsorption studies in batch mode for the removal of methylene blue present at various concentrations (1, 2, 3, 4, and 5 mg L(-1)) from aqueous solutions. The data was well fitted with Langmuir and Freundlich isotherms. The maximum adsorption capacity for raw, defatted and sulfuric acid pretreated DAB was found to be 6.0, 7.73 and 7.80 mg g(-1), respectively. The specific surface area of raw, defatted and sulfuric acid pretreated DAB was estimated to be 14.70, 18.94, and 19.10 m(2) g(-1), respectively. To evaluate the kinetic mechanism that controls the adsorption process, pseudo-first order, pseudo-second order, intraparticle diffusion and particle diffusion has been tested. The data fitted quite well with pseudo-second order kinetic model. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Ergonomic Assessment of Posture Risk Factors Among Iranian Workers: An Alternative to Conventional Methods

    Directory of Open Access Journals (Sweden)

    Mohammad Khandan

    2018-03-01

    Discussion: Data of the present study suggest that NERPA method was a valid tool compared to RULA. The NERPA method could be used to evaluate standing tasks among industrial workers. However, the concurrent validity of NERPA method compared with results of REBA, as a widely used method, were not verified.

  10. [Hip and knee osteoarthritis. Conventional X-ray best and cheapest diagnostic method].

    Science.gov (United States)

    Boegård, Torsten; Jonsson, Kjell

    2002-10-31

    Osteoarthritis is a multifactorial disease affecting cartilage and subchondral bone. Conventional radiographs are inexpensive and readily available. The hip joint should be examined in weight-bearing with an anteroposterior and a right and left anterior oblique view, rotating the patient 55 degrees in each oblique view. Radiographically established osteoarthritis of the hip is present when the joint space width is less than 3 mm or less than the width in the contralateral hip joint. The femorotibial joint should be examined in a posteroanterior view in weight-bearing and in semiflexion with the central X-ray beam tangential to the medial tibial plateau and with the medial aspect of the foot parallel to the beam. A diagnosis of osteoarthritis of the femorotibial joint is established with the presence of osteophytes at the medial or lateral aspect of the joint. Joint space narrowing with a joint width less than 3 mm is a sign of severe disease. The femoropatellar joint should be examined in skyline view in standing with the X-ray beam parallel to the articular aspect of the patella. A diagnosis of osteoarthritis of the femoropatellar joint is established with a joint space width less than 5 mm. Conventional radiographs of the hip and knee joints are believed to remain the primary examination for detecting signs of degenerative disease in these joints, although MRI is a superior technique for revealing even small areas of degenerative changes.

  11. Chemical method for producing smooth surfaces on silicon wafers

    Science.gov (United States)

    Yu, Conrad

    2003-01-01

    An improved method for producing optically smooth surfaces in silicon wafers during wet chemical etching involves a pre-treatment rinse of the wafers before etching and a post-etching rinse. The pre-treatment with an organic solvent provides a well-wetted surface that ensures uniform mass transfer during etching, which results in optically smooth surfaces. The post-etching treatment with an acetic acid solution stops the etching instantly, preventing any uneven etching that leads to surface roughness. This method can be used to etch silicon surfaces to a depth of 200 .mu.m or more, while the finished surfaces have a surface roughness of only 15-50 .ANG. (RMS).

  12. [A comparative study of blood culture conventional method vs. a modified lysis/centrifugation technique for the diagnosis of fungemias].

    Science.gov (United States)

    Santiago, Axel Rodolfo; Hernández, Betsy; Rodríguez, Marina; Romero, Hilda

    2004-12-01

    The purpose of this work was to compare the efficacy of blood culture conventional method vs. a modified lysis/centrifugation technique. Out of 450 blood specimens received in one year, 100 where chosen for this comparative study: 60 from patients with AIDS, 15 from leukemic patients, ten from febrile neutropenic patients, five from patients with respiratory infections, five from diabetics and five from septicemic patients. The specimens were processed, simultaneously, according to the above mentioned methodologies with daily inspections searching for fungal growth in order to obtain the final identification of the causative agent. The number (40) of isolates recovered was the same using both methods, which included; 18 Candida albicans (45%), ten Candida spp. (25%), ten Histoplasma capsulatum (25%), and two Cryptococcus neoformans (5%). When the fungal growth time was compared by both methods, growth was more rapid when using the modified lysis/centrifugation technique than when using the conventional method. Statistical analysis revealed a significant difference (pcentrifugation technique showed to be more efficacious than the conventional one, and therefore the implementation of this methodology is highly recommended for the isolation of fungi from blood.

  13. Normalisation of conventional analytical methods (XRF And icp) on NAA using different kinds Of geological standard reference material

    International Nuclear Information System (INIS)

    Bounakhla, M.; Embarch, K.; Zahry, F.; Gaudry, A.; Piccot, D.; Gruffat, J.J.; Moutte, J.; Bilal, E.

    2001-01-01

    The aim of this work is the comparison between INAA (Instrumental Neutron Activation Analysis), XRF (X-ray Fluorescence) Analysis and ICP-AES (Inductively Coupled Plasma Atomic Emission Spectrometry) methods for geological samples. The study had been done on 15 standard reference materials (SRM) of different kind of rocks having different origins. For INAA, the irradiation was made in Pierre-Sue Laboratory in France using two reactors, OSIRIS for irradiation with epithermal neutron and ORPHEE for thermal neutron irradiation. Two protocols of irradiation were performed, the first one under cadmium to eliminate thermal neutrons and the second one with a high flux ratio of thermal to epithermal neutrons (f=2000). Concerning XRF, we used two techniques : Energy Dispersive XRF and Wave-length XRF. The ICP-AES spectrometer used was a sequential. In this comparison study, we first normalized the INAA results on the certified values. The measurements of the conventional methods (XRF and ICP-AES) had been normalized on both of INAA results and the certified values. The function used in the fitting of the measured and certified values were a gaussian. It was concluded that both of the conventional methods complement in many cases the results of INAA, but their main disadvantage was poor sensitivity (especially for XRF) in the determination of trace elements, mainly rare elements. However, the conventional methods are necessary in rocks characterization throw major elements determination

  14. Comparison of the Lysis Centrifugation Method with the Conventional Blood Culture Method in Cases of Sepsis in a Tertiary Care Hospital

    OpenAIRE

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-01-01

    Introduction : Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. Objectives: To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Materials and Methods: Two hundred ...

  15. ROUGHNESS ON WOOD SURFACES AND ROUGHNESS MEASUREMENT METHODS

    Directory of Open Access Journals (Sweden)

    İsmail Aydın

    2003-04-01

    Full Text Available Some visual characteristics of wood such as color, pattern and texture determine the quality of manufactured products. Surface properties of wood material are important both in production and marketing after production. Initial studies related to the roughness of wood surface were begun in early 1950’s. However, no general agreed standardization can not have been developed for wood surfaces. Surface roughness of wood is function of the production process, product type and the natural anatomical properties of wood. Contact and non-contact tracing methods are used to measure of wood surface roughness. Surface roughness also affects the gluability and wettability of wood surfaces. The success in finishing also depends on the surface roughness of wood.

  16. Mercury Distribution in the Deûle River (Northern France) Measured by the Diffusive Gradients in Thin Films Technique and Conventional Methods.

    Science.gov (United States)

    Diviš, Pavel; Kadlecová, Milada; Ouddane, Baghdad

    2016-05-01

    The distribution of mercury in surface water and in sediment from Deûle River in Northern France was studied by application of conventional sampling methods and by diffusive gradients in thin films technique (DGT). Concentration of total dissolved mercury in surface water was 20.8 ± 0.8 ng l(-1). The particulate mercury concentration was 6.2 ± 0.6 µg g(-1). The particulate mercury was accumulated in sediment (9.9 ± 2.3 mg kg(-1)), and it was transformed by methylating bacteria to methylmercury, mainly in the first 2-cm layer of the sediment. Total dissolved concentration of mercury in sediment pore water obtained by application of centrifugation extraction was 17.6 ± 4.1 ng l(-1), and it was comparable with total dissolved pore water mercury concentration measured by DGT probe containing Duolite GT-73 resin gel (18.2 ± 4.3 ng l(-1)), taking the sediment heterogeneity and different principles of the applied methods into account. By application of two DGT probes with different resin gels specific for mercury, it was found that approximately 30% of total dissolved mercury in sediment pore water was present in labile forms easy available for biota. The resolution of mercury DGT depth profiles was 0.5 cm, which allows, unlike conventional techniques, to study the connection of the geochemical cycle of mercury with geochemical cycles of iron and manganese.

  17. Structural and electrical properties of copper-nickel-aluminum alloys obtained by conventional powder metallurgy method

    Energy Technology Data Exchange (ETDEWEB)

    Monteiro, Waldemar A.; Carrio, Juan A.G.; Silveira, C.R. da; Pertile, H.K.S., E-mail: fisica.cch@mackenzie.br [Universidade Presbiteriana Mackenzie (UPM/CCH), Sao Paulo, SP (Brazil). Centro de Ciencias e Humanidades. Dept. de Fisica; Silva, L.C.E. da; Buso, S.J., E-mail: jgcarrio@mackenzie.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2009-07-01

    This work looked for to search out systematically, in scale of laboratory, copper-nickel-aluminum alloys (Cu-Ni-Al) with conventional powder metallurgy processing, in view of the maintenance of the electric and mechanical properties with the intention of getting electric connectors of high performance or high mechanical damping. After cold uniaxial pressing (1000 kPa), sintering (780 deg C) and convenient homogenization treatments (500 deg C for different times) under vacuum (powder metallurgy), the obtained Cu-Ni-Al alloys were characterized by optical microscopy, electrical conductivity, Vickers hardness. X rays powder diffraction data were collected for the sintered samples in order to a structural and microstructural analysis. The comparative analysis is based on the sintered density, hardness, macrostructures and microstructures of the samples. (author)

  18. Structural and electrical properties of copper-nickel-aluminum alloys obtained by conventional powder metallurgy method

    International Nuclear Information System (INIS)

    Monteiro, Waldemar A.; Carrio, Juan A.G.; Silveira, C.R. da; Pertile, H.K.S.

    2009-01-01

    This work looked for to search out systematically, in scale of laboratory, copper-nickel-aluminum alloys (Cu-Ni-Al) with conventional powder metallurgy processing, in view of the maintenance of the electric and mechanical properties with the intention of getting electric connectors of high performance or high mechanical damping. After cold uniaxial pressing (1000 kPa), sintering (780 deg C) and convenient homogenization treatments (500 deg C for different times) under vacuum (powder metallurgy), the obtained Cu-Ni-Al alloys were characterized by optical microscopy, electrical conductivity, Vickers hardness. X rays powder diffraction data were collected for the sintered samples in order to a structural and microstructural analysis. The comparative analysis is based on the sintered density, hardness, macrostructures and microstructures of the samples. (author)

  19. Formation of Reflecting Surfaces Based on Spline Methods

    Science.gov (United States)

    Zamyatin, A. V.; Zamyatina, E. A.

    2017-11-01

    The article deals with problem of reflecting barriers surfaces generation by spline methods. The cases of reflection when a geometric model is applied are considered. The surfaces of reflecting barriers are formed in such a way that they contain given points and the rays reflected at these points and hit at the defined points of specified surface. The reflecting barrier surface is formed by cubic splines. It enables a comparatively simple implementation of proposed algorithms in the form of software applications. The algorithms developed in the article can be applied in architecture and construction design for reflecting surface generation in optics and acoustics providing the geometrical model of reflex processes is used correctly.

  20. System and method for extracting a sample from a surface

    Science.gov (United States)

    Van Berkel, Gary; Covey, Thomas

    2015-06-23

    A system and method is disclosed for extracting a sample from a sample surface. A sample is provided and a sample surface receives the sample which is deposited on the sample surface. A hydrophobic material is applied to the sample surface, and one or more devices are configured to dispense a liquid on the sample, the liquid dissolving the sample to form a dissolved sample material, and the one or more devices are configured to extract the dissolved sample material from the sample surface.

  1. Time varying eddy currents on a conducting surface in 3-D using a network mesh method

    International Nuclear Information System (INIS)

    Christensen, U.R.

    1979-04-01

    The method presented in this paper was developed for the purpose of analyzing the eddy currents in the TFTR vacuum vessel. The basic principle in this method lies in representing a conducting surface as a network comprised of a number of branches. Each branch has a resistance and a self-inductance as well as mutuals to all other branches. The resulting branch resistance and branch inductance matrices are transformed into mesh matrices by a conventional network procedure. By using these mesh matrices a set of simultaneous differential equations is then established. The eddy currents are then found by using a standard method for solving simultaneous differential equations

  2. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods

    Directory of Open Access Journals (Sweden)

    Shiva Alavi

    2017-01-01

    Conclusion: MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  3. SELECTION OF NON-CONVENTIONAL MACHINING PROCESSES USING THE OCRA METHOD

    Directory of Open Access Journals (Sweden)

    Miloš Madić

    2015-04-01

    Full Text Available Selection of the most suitable nonconventional machining process (NCMP for a given machining application can be viewed as multi-criteria decision making (MCDM problem with many conflicting and diverse criteria. To aid these selection processes, different MCDM methods have been proposed. This paper introduces the use of an almost unexplored MCDM method, i.e. operational competitiveness ratings analysis (OCRA method for solving the NCMP selection problems. Applicability, suitability and computational procedure of OCRA method have been demonstrated while solving three case studies dealing with selection of the most suitable NCMP. In each case study the obtained rankings were compared with those derived by the past researchers using different MCDM methods. The results obtained using the OCRA method have good correlation with those derived by the past researchers which validate the usefulness of this method while solving complex NCMP selection problems.

  4. Comparison of photographic and conventional methods for tooth shade selection: A clinical evaluation.

    Science.gov (United States)

    Miyajiwala, Juzer S; Kheur, Mohit G; Patankar, Anuya H; Lakha, Tabrez A

    2017-01-01

    This study aimed to compare three different methods used for shade selection, i.e., visual method, spectrophotometer, and digital photography method. Fifty participants were selected from the Out Patient Department of Prosthodontics. Presence of the maxillary right central incisor with no history of any restorative or endodontic procedures was the primary inclusion criterion. The shade of the right maxillary central incisor was determined using all the three shade selection procedures, namely, visual, spectrophotometric, and digital photography method for all the selected participants. The shades obtained in the visual method using a shade guide were noted down for further comparisons. The spectrophotometer reported the L*, a*, and b* values along with the actual shade whereas the digital photography method reported only the L*, a*, and b* values. The agreement between the readings obtained by the three different methods was compared and subjected to appropriate statistical analysis. The results showed that when the three methods studied were compared, there was a statistically significant proportion of agreement between spectrophotometric and visual method ( P < 0.01) with higher proportion of "yes" (agreement) and between the spectrophotometric and digital photography method ( P < 0.01) with higher proportion of "yes" (agreement). Coefficient of agreement (using Kappa coefficient) between spectrophotometric and visual shades revealed a fair agreement. The mean ΔE was 1.69. There was a statistically significant difference between the proportion of ΔE more than and <2, between spectrophotometric and digital photography methods ( P < 0.01) with higher proportion of <2 ΔE. Furthermore, percentage of agreement between shades obtained by the visual and spectrophotometric method showed maximum agreement with A1 shade. It was concluded that the digital photography method emerged as a reliable method for shade selection in a clinical setup.

  5. Evaluation of surface sampling method performance for Bacillus Spores on clean and dirty outdoor surfaces.

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Mollye C.; Einfeld, Wayne; Boucher, Raymond M.; Brown, Gary Stephen; Tezak, Matthew Stephen

    2011-06-01

    Recovery of Bacillus atrophaeous spores from grime-treated and clean surfaces was measured in a controlled chamber study to assess sampling method performance. Outdoor surfaces investigated by wipe and vacuum sampling methods included stainless steel, glass, marble and concrete. Bacillus atrophaeous spores were used as a surrogate for Bacillus anthracis spores in this study designed to assess whether grime-coated surfaces significantly affected surface sampling method performance when compared to clean surfaces. A series of chamber tests were carried out in which known amounts of spores were allowed to gravitationally settle onto both clean and dirty surfaces. Reference coupons were co-located with test coupons in all chamber experiments to provide a quantitative measure of initial surface concentrations of spores on all surfaces, thereby allowing sampling recovery calculations. Results from these tests, carried out under both low and high humidity conditions, show that spore recovery from grime-coated surfaces is the same as or better than spore recovery from clean surfaces. Statistically significant differences between method performance for grime-coated and clean surfaces were observed in only about half of the chamber tests conducted.

  6. Alternative methods to model frictional contact surfaces using NASTRAN

    Science.gov (United States)

    Hoang, Joseph

    1992-01-01

    Elongated (slotted) holes have been used extensively for the integration of equipment into Spacelab racks. In the past, this type of interface has been modeled assuming that there is not slippage between contact surfaces, or that there is no load transfer in the direction of the slot. Since the contact surfaces are bolted together, the contact friction provides a load path determined by the normal applied force (bolt preload) and the coefficient of friction. Three alternate methods that utilize spring elements, externally applied couples, and stress dependent elements are examined to model the contacted surfaces. Results of these methods are compared with results obtained from methods that use GAP elements and rigid elements.

  7. Comparison of methods used to estimate conventional undiscovered petroleum resources: World examples

    Science.gov (United States)

    Ahlbrandt, T.S.; Klett, T.R.

    2005-01-01

    Various methods for assessing undiscovered oil, natural gas, and natural gas liquid resources were compared in support of the USGS World Petroleum Assessment 2000. Discovery process, linear fractal, parabolic fractal, engineering estimates, PETRIMES, Delphi, and the USGS 2000 methods were compared. Three comparisons of these methods were made in: (1) the Neuquen Basin province, Argentina (different assessors, same input data); (2) provinces in North Africa, Oman, and Yemen (same assessors, different methods); and (3) the Arabian Peninsula, Arabian (Persian) Gulf, and North Sea (different assessors, different methods). A fourth comparison (same assessors, same assessment methods but different geologic models), between results from structural and stratigraphic assessment units in the North Sea used only the USGS 2000 method, and hence compared the type of assessment unit rather than the method. In comparing methods, differences arise from inherent differences in assumptions regarding: (1) the underlying distribution of the parent field population (all fields, discovered and undiscovered), (2) the population of fields being estimated; that is, the entire parent distribution or the undiscovered resource distribution, (3) inclusion or exclusion of large outlier fields; (4) inclusion or exclusion of field (reserve) growth, (5) deterministic or probabilistic models, (6) data requirements, and (7) scale and time frame of the assessment. Discovery process, Delphi subjective consensus, and the USGS 2000 method yield comparable results because similar procedures are employed. In mature areas such as the Neuquen Basin province in Argentina, the linear and parabolic fractal and engineering methods were conservative compared to the other five methods and relative to new reserve additions there since 1995. The PETRIMES method gave the most optimistic estimates in the Neuquen Basin. In less mature areas, the linear fractal method yielded larger estimates relative to other methods

  8. Teaching Dental Students to Understand the Temporomandibular Joint Using MRI: Comparison of Conventional and Digital Learning Methods.

    Science.gov (United States)

    Arús, Nádia A; da Silva, Átila M; Duarte, Rogério; da Silveira, Priscila F; Vizzotto, Mariana B; da Silveira, Heraldo L D; da Silveira, Heloisa E D

    2017-06-01

    The aims of this study were to evaluate and compare the performance of dental students in interpreting the temporomandibular joint (TMJ) with magnetic resonance imaging (MRI) scans using two learning methods (conventional and digital interactive learning) and to examine the usability of the digital learning object (DLO). The DLO consisted of tutorials about MRI and anatomic and functional aspects of the TMJ. In 2014, dental students in their final year of study who were enrolled in the elective "MRI Interpretation of the TMJ" course comprised the study sample. After exclusions for nonattendance and other reasons, 29 of the initial 37 students participated in the study, for a participation rate of 78%. The participants were divided into two groups: a digital interactive learning group (n=14) and a conventional learning group (n=15). Both methods were assessed by an objective test applied before and after training and classes. Aspects such as support and training requirements, complexity, and consistency of the DLO were also evaluated using the System Usability Scale (SUS). A significant between-group difference in the posttest results was found, with the conventional learning group scoring better than the DLO group, indicated by mean scores of 9.20 and 8.11, respectively, out of 10. However, when the pretest and posttest results were compared, both groups showed significantly improved performance. The SUS score was 89, which represented a high acceptance of the DLO by the users. The students who used the conventional method of learning showed superior performance in interpreting the TMJ using MRI compared to the group that used digital interactive learning.

  9. Determination of in vitro susceptibility of Mycobacterium tuberculosis to cephalosporins by radiometric and conventional methods

    International Nuclear Information System (INIS)

    Heifets, L.B.; Iseman, M.D.; Cook, J.L.; Lindholm-Levy, P.J.; Drupa, I.

    1985-01-01

    Among eight cephalosporins and cephamycins tested in preliminary in vitro screening against Mycobacterium tuberculosis, the most promising for further study was found to be ceforanide, followed by ceftizoxime, cephapirin, and cefotaxime. Moxalactam, cefoxitin, cefamandole, and cephalothin were found to be not active enough against M. tuberculosis to be considered for further in vitro studies. The antibacterial activity of various ceforanide concentrations was investigated by three methods: (i) the dynamics of radiometric readings (growth index) in 7H12 broth; (ii) the number of CFU in the same medium; and (iii) the proportion method on 7H11 agar plates. There was a good correlation among the results obtained with these methods. The MIC for most strains ranged from 6.0 to 25.0 micrograms/ml. The BACTEC radiometric method is a reliable, rapid, and convenient method for preliminary screening and determination of the level of antibacterial activity of drugs not commonly used against M. tuberculosis

  10. Determination of in vitro susceptibility of Mycobacterium tuberculosis to cephalosporins by radiometric and conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Heifets, L.B.; Iseman, M.D.; Cook, J.L.; Lindholm-Levy, P.J.; Drupa, I.

    1985-01-01

    Among eight cephalosporins and cephamycins tested in preliminary in vitro screening against Mycobacterium tuberculosis, the most promising for further study was found to be ceforanide, followed by ceftizoxime, cephapirin, and cefotaxime. Moxalactam, cefoxitin, cefamandole, and cephalothin were found to be not active enough against M. tuberculosis to be considered for further in vitro studies. The antibacterial activity of various ceforanide concentrations was investigated by three methods: (i) the dynamics of radiometric readings (growth index) in 7H12 broth; (ii) the number of CFU in the same medium; and (iii) the proportion method on 7H11 agar plates. There was a good correlation among the results obtained with these methods. The MIC for most strains ranged from 6.0 to 25.0 micrograms/ml. The BACTEC radiometric method is a reliable, rapid, and convenient method for preliminary screening and determination of the level of antibacterial activity of drugs not commonly used against M. tuberculosis.

  11. Comparative study of age estimation using dentinal translucency by digital and conventional methods

    Science.gov (United States)

    Bommannavar, Sushma; Kulkarni, Meena

    2015-01-01

    Introduction: Estimating age using the dentition plays a significant role in identification of the individual in forensic cases. Teeth are one of the most durable and strongest structures in the human body. The morphology and arrangement of teeth vary from person-to-person and is unique to an individual as are the fingerprints. Therefore, the use of dentition is the method of choice in the identification of the unknown. Root dentin translucency is considered to be one of the best parameters for dental age estimation. Traditionally, root dentin translucency was measured using calipers. Recently, the use of custom built software programs have been proposed for the same. Objectives: The present study describes a method to measure root dentin translucency on sectioned teeth using a custom built software program Adobe Photoshop 7.0 version (Adobe system Inc, Mountain View California). Materials and Methods: A total of 50 single rooted teeth were sectioned longitudinally to derive a 0.25 mm uniform thickness and the root dentin translucency was measured using digital and caliper methods and compared. The Gustafson's morphohistologic approach is used in this study. Results: Correlation coefficients of translucency measurements to age were statistically significant for both the methods (P < 0.125) and linear regression equations derived from both methods revealed better ability of the digital method to assess age. Conclusion: The custom built software program used in the present study is commercially available and widely used image editing software. Furthermore, this method is easy to use and less time consuming. The measurements obtained using this method are more precise and thus help in more accurate age estimation. Considering these benefits, the present study recommends the use of digital method to assess translucency for age estimation. PMID:25709325

  12. Study of the magnetic microstructure of high-coercivity sintered SmCo5 permanent magnets with the conventional Bitter pattern technique and the colloid-SEM method

    International Nuclear Information System (INIS)

    Szmaja, Witold

    2007-01-01

    The magnetic microstructure of high-coercivity sintered SmCo 5 permanent magnets was studied with the conventional Bitter pattern technique, and also for the first time with the colloid-scanning electron microscopy (colloid-SEM) method. Both techniques were supported by digital image acquisition, enhancement and analysis. Thanks to this, it was possible to obtain high-contrast and clear images of the magnetic microstructure and to analyze them in detail, and consequently also to achieve improvements over earlier results. In the thermally demagnetized state the grains were composed of magnetic domains. On the surface perpendicular to the alignment axis, the main domains forming a maze pattern and surface reverse spikes were observed. Investigations on the surface parallel to the alignment axis, especially by the colloid-SEM technique, provided a detailed insight into the orientation of grains. The alignment of grains was good, but certainly not perfect; there were also strongly misaligned grains, although generally very rare. In most cases the domain structures within grains were independent of their neighbors, but in some cases (not so rare) the domain walls were observed to continue through the grain boundaries, indicating significant magnetostatic interaction between neighboring grains. Studies of the behavior of the magnetic microstructure under the influence of an external magnetic field, performed for the first time on the surface parallel to the alignment axis (with the conventional Bitter pattern method), showed that the domain walls move easily within the grains and that the magnetization reversal mechanism is mainly related to the nucleation and growth of reverse domains, i.e. that sintered SmCo 5 magnets are nucleation-dominated systems. Groupwise magnetization reversal of adjacent magnetically coupled grains was observed, an unfavorable effect for high-coercivity magnets. Images obtained by the colloid-SEM technique and the conventional Bitter pattern

  13. Surface-activated joining method for surveillance coupon reconstitution

    International Nuclear Information System (INIS)

    Kaihara, Shoichiro; Nakamura, Terumi

    1993-01-01

    As nuclear power plants approach the end of their license periods and license renewal is contemplated, there is an increasing need to expand the data base of mechanical properties obtainable from archival surveillance specimens. A new joining method for reconstituting broken Charpy specimens is being developed, the objective being to retain the original properties of the material in the process. The new method is called surface-activated joining (SAJ). It is designed to obtain a good junction without applying extra heating and deformation. In particular, the purpose of SAJ is to minimize the width of the heat-affected zone (HAZ) and to decrease the maximum temperature experienced by the specimen during reconsolidation of the two pieces. Generally, machined metal surfaces are contaminated with films of oxide, adsorbed gas, oil, or other vapors that impede bonding of surfaces during joining. However, if surface contamination is removed and the two surfaces are mated as closely as possible, joining can be achieved at low temperatures and modest stress levels. In order to apply the SAJ method, the following requirements must be met: (1) inert atmosphere to protect the surfaces from atmospheric gases and oxidation; (2) removal of the existing contamination layers to activate the surfaces; and (3) method for bringing the two surfaces into very intimate contact prior to joining

  14. Method for Surface Scanning in Medical Imaging and Related Apparatus

    DEFF Research Database (Denmark)

    2015-01-01

    A method and apparatus for surface scanning in medical imaging is provided. The surface scanning apparatus comprises an image source, a first optical fiber bundle comprising first optical fibers having proximal ends and distal ends, and a first optical coupler for coupling an image from the image...

  15. Comparative study of age estimation using dentinal translucency by digital and conventional methods.

    Science.gov (United States)

    Bommannavar, Sushma; Kulkarni, Meena

    2015-01-01

    Estimating age using the dentition plays a significant role in identification of the individual in forensic cases. Teeth are one of the most durable and strongest structures in the human body. The morphology and arrangement of teeth vary from person-to-person and is unique to an individual as are the fingerprints. Therefore, the use of dentition is the method of choice in the identification of the unknown. Root dentin translucency is considered to be one of the best parameters for dental age estimation. Traditionally, root dentin translucency was measured using calipers. Recently, the use of custom built software programs have been proposed for the same. The present study describes a method to measure root dentin translucency on sectioned teeth using a custom built software program Adobe Photoshop 7.0 version (Adobe system Inc, Mountain View California). A total of 50 single rooted teeth were sectioned longitudinally to derive a 0.25 mm uniform thickness and the root dentin translucency was measured using digital and caliper methods and compared. The Gustafson's morphohistologic approach is used in this study. Correlation coefficients of translucency measurements to age were statistically significant for both the methods (P image editing software. Furthermore, this method is easy to use and less time consuming. The measurements obtained using this method are more precise and thus help in more accurate age estimation. Considering these benefits, the present study recommends the use of digital method to assess translucency for age estimation.

  16. Consumer acceptance and aroma characterization of navy bean (Phaseolus vulgaris) powders prepared by extrusion and conventional processing methods.

    Science.gov (United States)

    Szczygiel, Edward J; Harte, Janice B; Strasburg, Gale M; Cho, Sungeun

    2017-09-01

    Food products produced with bean ingredients are gaining in popularity among consumers due to the reported health benefits. Navy bean (Phaseolus vulgaris) powder produced through extrusion can be considered as a resource-efficient alternative to conventional methods, which often involve high water inputs. Therefore, navy bean powders produced with extrusion and conventional methods were assessed for the impact of processing on consumer liking in end-use products and odor-active compounds. Consumer acceptance results reveal significant differences in flavor, texture and overall acceptance scores of several products produced with navy bean powder. Crackers produced with extruded navy bean powder received higher hedonic flavor ratings than those produced with commercial navy bean powder (P < 0.001). GC-O data showed that the commercial powder produced through conventional processing had much greater contents of several aliphatic aldehydes commonly formed via lipid oxidation, such as hexanal, octanal and nonanal with descriptors of 'grassy', 'nutty', 'fruity', 'dusty', and 'cleaner', compared to the extruded powder. Extrusion processed navy bean powders were preferred over commercial powders for certain navy bean powder applications. This is best explained by substantial differences in aroma profiles of the two powders that may have been caused by lipid oxidation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  17. A continuous surface reconstruction method on point cloud captured from a 3D surface photogrammetry system

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wenyang [Department of Bioengineering, University of California, Los Angeles, California 90095 (United States); Cheung, Yam; Sabouri, Pouya; Arai, Tatsuya J.; Sawant, Amit [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas 75390 (United States); Ruan, Dan, E-mail: druan@mednet.ucla.edu [Department of Bioengineering, University of California, Los Angeles, California 90095 and Department of Radiation Oncology, University of California, Los Angeles, California 90095 (United States)

    2015-11-15

    Purpose: To accurately and efficiently reconstruct a continuous surface from noisy point clouds captured by a surface photogrammetry system (VisionRT). Methods: The authors have developed a level-set based surface reconstruction method on point clouds captured by a surface photogrammetry system (VisionRT). The proposed method reconstructs an implicit and continuous representation of the underlying patient surface by optimizing a regularized fitting energy, offering extra robustness to noise and missing measurements. By contrast to explicit/discrete meshing-type schemes, their continuous representation is particularly advantageous for subsequent surface registration and motion tracking by eliminating the need for maintaining explicit point correspondences as in discrete models. The authors solve the proposed method with an efficient narrowband evolving scheme. The authors evaluated the proposed method on both phantom and human subject data with two sets of complementary experiments. In the first set of experiment, the authors generated a series of surfaces each with different black patches placed on one chest phantom. The resulting VisionRT measurements from the patched area had different degree of noise and missing levels, since VisionRT has difficulties in detecting dark surfaces. The authors applied the proposed method to point clouds acquired under these different configurations, and quantitatively evaluated reconstructed surfaces by comparing against a high-quality reference surface with respect to root mean squared error (RMSE). In the second set of experiment, the authors applied their method to 100 clinical point clouds acquired from one human subject. In the absence of ground-truth, the authors qualitatively validated reconstructed surfaces by comparing the local geometry, specifically mean curvature distributions, against that of the surface extracted from a high-quality CT obtained from the same patient. Results: On phantom point clouds, their method

  18. An overview on the conventional and nonconventional methods for manufacturing the metallic glasses

    Directory of Open Access Journals (Sweden)

    Axinte Eugen

    2017-01-01

    Full Text Available Metallic glasses (MGs, first discovered in 1959 at Caltech are currently among the most studied metallic materials. MGs called also glassy metals, amorphous metals, liquid metals, are considered to be among the materials of the future. The “classic” methods for industrialization of MGs are : end-casting in copper molds and protected environment, die forging , atomization for obtaining MG powder ,selective laser melting , imprinting in molds, thermoplastic shaping in the super-cooled temperature region. These methods are suitable for producing high value-added precision components but the problems still exists: expensive tools, limited lifetime of tools and the occurring of crystallization. Actually methods (thermoplastic shaping, casting and die forging are limited by the low flexibility of production and by higher costs of tools and accessories. More suitable methods are greatly desired to machine MGs for their wider applications.

  19. Prospective, Double-Blind Evaluation of Umbilicoplasty Techniques Using Conventional and Crowdsourcing Methods

    NARCIS (Netherlands)

    Veldhuisen, C.L. Van; Kamali, P.; Wu, W.; Becherer, B.E.; Sinno, H.H.; Ashraf, A.A.; Ibrahim, A.M.S.; Tobias, A.; Lee, B.T.; Lin, S.J.

    2017-01-01

    BACKGROUND: Umbilical reconstruction is an important component of deep inferior epigastric perforator (DIEP) flap breast reconstruction. This study evaluated the aesthetics of three different umbilical reconstruction techniques during DIEP flap breast reconstruction. METHODS: From January to April

  20. Detection of Staphylococcus aureus among coagulase positive staphylococci from animal origin based on conventional and molecular methods

    Directory of Open Access Journals (Sweden)

    Nikolina Velizarova Rusenova

    2017-03-01

    Full Text Available The present study aimed to detect Staphylococcus aureus (S. aureus among other coagulase positive staphylococci from animal origin by using conventional methods (biochemical tests and latex agglutination and a molecular method, based on the nuc gene, as the gold standard and to assess the usefulness of these methods. For this purpose, total of 344 staphylococcal isolates were collected and analysed. A total of 156 isolates suspicious for S. aureus were detected by a conventional biochemical method – 88 from cows, 18 from goats, 7 from pigs, 17 from poultry, 7 from rabbits and 19 from dogs. The majority of S. aureus strains gave typical biochemical reactions with the exception of 30 (19.2% and 25 (16% that were VP negative and weak positive in fermenting mannitol, respectively. Twelve strains were found to be non-haemolytic (7.7% and four strains did not ferment trehalose (2.6%. Other staphylococci were identified as S. pseudintermedius (n = 103, S. hyicus (n = 23 and the rest were coagulase-negative staphylococci. Latex agglutination test resulted in rapid positive reactions with S. aureus with exception of 5 strains (3.2% from cow mastitis milk. Positive agglutination reactions were also established with S. pseudintermedius, and S. hyicus. PCR confirmed all strains that were preliminary identified as S. aureus by amplification of 270 bp fragment of nuc gene specific for this species. The atypical reactions in certain strains established in this study have shown that the precise detection of S. aureus from animal origin should be done by combination of conventional and molecular methods.

  1. Conventional methods fail to measure cp(omega) of glass-forming liquids

    DEFF Research Database (Denmark)

    Christensen, Tage Emil; Olsen, Niels Boye; Dyre, Jeppe

    2007-01-01

    thermal-wave method does not measure the isobaric frequency-dependent specific heat cp(omega). This method rather measures a "longitudinal" frequency-dependent specific heat, a quantity defined and detailed here that is in between cp(omega) and cV(omega). This result means that no reliable wide......-frequency measurements of cp(omega) on liquids approaching the calorimetric glass transition exist. We briefly discuss consequences for experiment....

  2. Improved method for efficient imaging of intracellular Cl(-) with Cl-Sensor using conventional fluorescence setup.

    Science.gov (United States)

    Friedel, Perrine; Bregestovski, Piotr; Medina, Igor

    2013-01-01

    Chloride (Cl(-)) homeostasis is known to be fundamental for central nervous system functioning. Alterations in intracellular Cl(-) concentration ([Cl(-)]i) and changes in the efficacy of Cl(-) extrusion are involved in numerous neurological disorders. Therefore, there is a strong need for studies of the dynamics of [Cl(-)]i in different cell types under physiological conditions and during pathology. Several previous works reported having successfully achieved recording of [Cl(-)]i using genetically encoded Cl-Sensor that is composed of the cyan fluorescent protein (CFP) and Cl(-)-sensitive mutant of the yellow fluorescent protein (YFPCl). However, all reported works were performed using specially designed setups with ultra-sensitive CCD cameras. Our multiple attempts to monitor Cl(-)-dependent fluorescence of Cl-Sensor using conventional epifluorescence microscopes did not yield successful results. In the present work, we have analysed the reason of our failures and found that they were caused by a strong inactivation of the YFPCl component of Cl-Sensor during excitation of the CFP with 430 nm light. Based on the obtained results, we reduced 20-fold the intensity of the 430 nm excitation and modified the recording protocol that allows now stable long-lasting ratiometric measurements of Cl-Sensor fluorescence in different cell types including cultured hippocampal neurons and their tiny dendrites and spines. Simultaneous imaging and patch clamp recording revealed that in mature neurons, the novel protocol allows detection of as little as 2 mM changes of [Cl(-)]i from the resting level of 5-10 mM. We demonstrate also a usefulness of the developed [Cl(-)]i measurement procedure for large scale screening of the activity of exogenously expressed potassium-chloride co-transporter KCC2, a major neuronal Cl(-) extruder that is implicated in numerous neurological disorders and is a target for novel therapeutical treatments.

  3. Improved method for efficient imaging of intracellular Cl- with Cl-Sensor using conventional fluorescence setup

    Directory of Open Access Journals (Sweden)

    Perrine eFriedel

    2013-04-01

    Full Text Available Chloride (Cl- homeostasis is known to be fundamental for central nervous system functioning. Alterations in intracellular Cl- concentration ([Cl-]i and changes in the efficacy of Cl- extrusion are involved in numerous neurological disorders. Therefore there is a strong need for studies of the dynamics of [Cl-]i in different cell types under physiological conditions and during pathology. Several previous works reported having successfully achieved recording of [Cl-]i using genetically encoded Cl-Sensor that is composed of the cyan fluorescent protein (CFP and Cl--sensitive mutant of the yellow fluorescent protein (YFPCl. However all reported works were performed using specially designed setups with ultra-sensitive CCD cameras. Our multiple attempts to monitor Cl--dependent fluorescence of Cl-Sensor using conventional epifluorescence microscopes did not yield successful results. In the present work, we have analysed the reason of our failures and found that they were caused by a strong inactivation of the YFPCl component of Cl-Sensor during excitation of the CFP with 430 nm light. Based on the obtained results, we reduced 20-fold the intensity of the 430 nm excitation and modified the recording protocol that allows now stable long-lasting ratiometric measurements of Cl-Sensor fluorescence in different cell types including cultured hippocampal neurons and their tiny dendrites and spines. Simultaneous imaging and patch clamp recording revealed that in mature neurons, the novel protocol allows detection of as little as 2 mM changes of [Cl-]i from the resting level of 5-10 mM. We demonstrate also a usefulness of the developed [Cl-]i measurement procedure for large scale screening of the activity of exogenously expressed potassium-chloride co-transporter KCC2, a major neuronal Cl- extruder, that is implicated in numerous neurological disorders and is a target for novel therapeutical treatments.

  4. Method for atmospheric pressure reactive atom plasma processing for surface modification

    Science.gov (United States)

    Carr, Jeffrey W [Livermore, CA

    2009-09-22

    Reactive atom plasma processing can be used to shape, polish, planarize and clean the surfaces of difficult materials with minimal subsurface damage. The apparatus and methods use a plasma torch, such as a conventional ICP torch. The workpiece and plasma torch are moved with respect to each other, whether by translating and/or rotating the workpiece, the plasma, or both. The plasma discharge from the torch can be used to shape, planarize, polish, and/or clean the surface of the workpiece, as well as to thin the workpiece. The processing may cause minimal or no damage to the workpiece underneath the surface, and may involve removing material from the surface of the workpiece.

  5. Interferometric method for measuring high velocities of diffuse surfaces

    International Nuclear Information System (INIS)

    Maron, Y.

    1978-01-01

    An interferometric method for measuring the displacement of diffuse surfaces moving with velocities of a few microsecond is presented. The method utilizes the interference between two light beams reflected from a constant area of the moving surface at two different angles. It enables the detection of high rate velocity variations. Light source of a fairly low temporal coherence and power around 100mW is needed. (author)

  6. Identification and determination of antibiotic susceptibilities of Brucella strains isolated from patients in van, Turkey by conventional and molecular methods.

    Science.gov (United States)

    Parlak, Mehmet; Güdücüoğlu, Hüseyin; Bayram, Yasemin; Çıkman, Aytekin; Aypak, Cenk; Kılıç, Selçuk; Berktaş, Mustafa

    2013-01-01

    Brucellosis is a worldwide zoonotic disease and still constitutes a major public health problem. In this study, we aimed to identify biovars of Brucella strains isolated from clinical specimens taken from brucellosis patients from the Eastern Anatolia region as well determine the susceptibility of these isolates to tigecycline and azithromycin, drugs that may serve as alternatives to the conventional drugs used in the therapy. Seventy-five Brucella spp. isolates were included in the study. All strains were identified by both conventional and molecular methods. Brucella Multiplex PCR kit (FC-Biotech, Code: 0301, Turkey) and B. melitensis biovar typing PCR kit (FC-Biotech, Code: 0302, Turkey) were used for molecular typing. Antimicrobial susceptibilities of all strains were determined by E-tests. By conventional biotyping, 73 strains were identified as B. melitensis biovar 3 and two strains as B. abortus biovar 3. Molecular typing results were compatible with conventional methods. The MIC50 and MIC90 values of doxycycline were 0.047 and 0.094; tigecycline 0.094 and 0.125; trimethoprim/sulfamethoxazole 0.064 and 0.19; ciprofloxacin 0.19 for both; streptomycin 0.75 and 1; rifampin 1 and 2 and azithromycin 4 and 8. According to the MIC values, doxycycline was found to be the most effective antibiotic, followed by tigecycline, trimethoprim-sulfamethoxazole and ciprofloxacin. Currently recommended antibiotics for the treatment of brucellosis such as doxycycline, rifampin, streptomycin, trimethoprim-sulfamethoxazole and ciprofloxacin were found to be still effective. While our results showed that tigecycline can be used an alternative agent in the treatment of brucellosis, azithromycin has not been confirmed as an appropriate agent for the treatment.

  7. A continuous surface reconstruction method on point cloud captured from a 3D surface photogrammetry system.

    Science.gov (United States)

    Liu, Wenyang; Cheung, Yam; Sabouri, Pouya; Arai, Tatsuya J; Sawant, Amit; Ruan, Dan

    2015-11-01

    To accurately and efficiently reconstruct a continuous surface from noisy point clouds captured by a surface photogrammetry system (VisionRT). The authors have developed a level-set based surface reconstruction method on point clouds captured by a surface photogrammetry system (VisionRT). The proposed method reconstructs an implicit and continuous representation of the underlying patient surface by optimizing a regularized fitting energy, offering extra robustness to noise and missing measurements. By contrast to explicit/discrete meshing-type schemes, their continuous representation is particularly advantageous for subsequent surface registration and motion tracking by eliminating the need for maintaining explicit point correspondences as in discrete models. The authors solve the proposed method with an efficient narrowband evolving scheme. The authors evaluated the proposed method on both phantom and human subject data with two sets of complementary experiments. In the first set of experiment, the authors generated a series of surfaces each with different black patches placed on one chest phantom. The resulting VisionRT measurements from the patched area had different degree of noise and missing levels, since VisionRT has difficulties in detecting dark surfaces. The authors applied the proposed method to point clouds acquired under these different configurations, and quantitatively evaluated reconstructed surfaces by comparing against a high-quality reference surface with respect to root mean squared error (RMSE). In the second set of experiment, the authors applied their method to 100 clinical point clouds acquired from one human subject. In the absence of ground-truth, the authors qualitatively validated reconstructed surfaces by comparing the local geometry, specifically mean curvature distributions, against that of the surface extracted from a high-quality CT obtained from the same patient. On phantom point clouds, their method achieved submillimeter

  8. Accelerated, microwave-assisted, and conventional solvent extraction methods affect anthocyanin composition from colored grains.

    Science.gov (United States)

    Abdel-Aal, El-Sayed M; Akhtar, Humayoun; Rabalski, Iwona; Bryan, Michael

    2014-02-01

    Anthocyanins are important dietary components with diverse positive functions in human health. This study investigates effects of accelerated solvent extraction (ASE) and microwave-assisted extraction (MAE) on anthocyanin composition and extraction efficiency from blue wheat, purple corn, and black rice in comparison with the commonly used solvent extraction (CSE). Factorial experimental design was employed to study effects of ASE and MAE variables, and anthocyanin extracts were analyzed by spectrophotometry, high-performance liquid chromatography-diode array detector (DAD), and liquid chromatography-mass spectrometry chromatography. The extraction efficiency of ASE and MAE was comparable with CSE at the optimal conditions. The greatest extraction by ASE was achieved at 50 °C, 2500 psi, 10 min using 5 cycles, and 100% flush. For MAE, a combination of 70 °C, 300 W, and 10 min in MAE was the most effective in extracting anthocyanins from blue wheat and purple corn compared with 50 °C, 1200 W, and 20 min for black rice. The anthocyanin composition of grain extracts was influenced by the extraction method. The ASE extraction method seems to be more appropriate in extracting anthocyanins from the colored grains as being comparable with the CSE method based on changes in anthocyanin composition. The method caused lower structural changes in anthocaynins compared with the MAE method. Changes in blue wheat anthocyanins were lower in comparison with purple corn or black rice perhaps due to the absence of acylated anthocyanin compounds in blue wheat. The results show significant differences in anthocyanins among the 3 extraction methods, which indicate a need to standardize a method for valid comparisons among studies and for quality assurance purposes. © 2014 Her Majesty the Queen in Right of Canada Journal of Food Science © 2014 Institute of Food Technologists® Reproduced with the permission of the Minister of Agriculture and Agri-Food Canada.

  9. Comparison of accuracies of an intraoral spectrophotometer and conventional visual method for shade matching using two shade guide systems.

    Science.gov (United States)

    Parameswaran, Vidhya; Anilkumar, S; Lylajam, S; Rajesh, C; Narayan, Vivek

    2016-01-01

    This in vitro study compared the shade matching abilities of an intraoral spectrophotometer and the conventional visual method using two shade guides. The results of previous investigations between color perceived by human observers and color assessed by instruments have been inconclusive. The objectives were to determine accuracies and interrater agreement of both methods and effectiveness of two shade guides with either method. In the visual method, 10 examiners with normal color vision matched target control shade tabs taken from the two shade guides (VITAPAN Classical™ and VITAPAN 3D Master™) with other full sets of the respective shade guides. Each tab was matched 3 times to determine repeatability of visual examiners. The spectrophotometric shade matching was performed by two independent examiners using an intraoral spectrophotometer (VITA Easyshade™) with five repetitions for each tab. Results revealed that visual method had greater accuracy than the spectrophotometer. The spectrophotometer; however, exhibited significantly better interrater agreement as compared to the visual method. While VITAPAN Classical shade guide was more accurate with the spectrophotometer, VITAPAN 3D Master shade guide proved better with visual method. This in vitro study clearly delineates the advantages and limitations of both methods. There were significant differences between the methods with the visual method producing more accurate results than the spectrophotometric method. The spectrophotometer showed far better interrater agreement scores irrespective of the shade guide used. Even though visual shade matching is subjective, it is not inferior and should not be underrated. Judicious combination of both techniques is imperative to attain a successful and esthetic outcome.

  10. Development and validation of an alternative to conventional pretreatment methods for residue analysis of butachlor in water, soil, and rice.

    Science.gov (United States)

    Xue, Jiaying; Jiang, Wenqing; Liu, Fengmao; Zhao, Huiyu; Wang, Suli; Peng, Wei

    2014-01-01

    A rapid and effective alternative analytical method for residues of butachlor in water, soil, and rice was established. The operating variables affecting performance of this method, including different extraction conditions and cleanup adsorbents, were evaluated. The determination of butachlor residues in soil, straw, rice hull, and husked rice was performed using GC/MS after extraction with n-hexane and cleanup with graphite carbon black. The average recoveries ranged from 81.5 to 102.7%, with RSDs of 0.6-7.7% for all of the matrixes investigated. The limits of quantitation were 0.05 mg/kg in water and rice plant, and 0.01 mg/kg in soil, straw, rice hull, and husked rice. A comparison among this proposed method, the conventional liquid-liquid extraction, the Quick, Easy, Cheap, Effective, Rugged, and Safe method, and Soxhlet extraction indicated that this method was more suitable for analyzing butachlor in rice samples. The further validation of the proposed method was carried out by Soxhlet extraction for the determination of butachlor residues in the husked rice samples, and the residue results showed there was no obvious difference obtained from these two methods. Samples from a rice field were found to contain butachlor residues below the maximum residue limits set by China (0.5 mg/kg) and Japan (0.1 mg/kg). The proposed method has a strong potential for application in routine screening and processing of large numbers of samples. This study developed a more effective alternative to the conventional analytical methods for analyzing butachlor residues in various matrixes.

  11. Exploring the Leishmania Hydrophilic Acylated Surface Protein B (HASPB) Export Pathway by Live Cell Imaging Methods.

    Science.gov (United States)

    MacLean, Lorna; Price, Helen; O'Toole, Peter

    2016-01-01

    Leishmania major is a human-infective protozoan parasite transmitted by the bite of the female phlebotomine sand fly. The L. major hydrophilic acylated surface protein B (HASPB) is only expressed in infective parasite stages suggesting a role in parasite virulence. HASPB is a "nonclassically" secreted protein that lacks a conventional signal peptide, reaching the cell surface by an alternative route to the classical ER-Golgi pathway. Instead HASPB trafficking to and exposure on the parasite plasma membrane requires dual N-terminal acylation. Here, we use live cell imaging methods to further explore this pathway allowing visualization of key events in real time at the individual cell level. These methods include live cell imaging using fluorescent reporters to determine the subcellular localization of wild type and acylation site mutation HASPB18-GFP fusion proteins, fluorescence recovery after photobleaching (FRAP) to analyze the dynamics of HASPB in live cells, and live antibody staining to detect surface exposure of HASPB by confocal microscopy.

  12. Comparative Analysis Of Conventional Method With Activity Based Costing In PT Mulia Sejati Gallery

    Directory of Open Access Journals (Sweden)

    Irma Nadia Erena

    2016-09-01

    Full Text Available The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data analysis. The results achieved are massive distortion between the calculations using traditional systems and activity based costing system. The conclusions of the whole thesis are activity-based costing system is considered more relevant than traditional systems that are currently used by the company.

  13. A Predictive-Control-Based Over-Modulation Method for Conventional Matrix Converters

    DEFF Research Database (Denmark)

    Zhang, Guanguan; Yang, Jian; Sun, Yao

    2018-01-01

    to further enhance the system performance promptly. This method has advantages like the maximum voltage transfer ratio can reach 0.987 in the experiments; the total harmonic distortion of the input and output current are reduced, and the losses in the matrix converter are decreased. Moreover, the specific......To increase the voltage transfer ratio of the matrix converter and improve the input/output current performance simultaneously, an over-modulation method based on predictive control is proposed in this paper, where the weighting factor is selected by an automatic adjusting mechanism, which is able...

  14. Comparison study of intraoperative surface acquisition methods for surgical navigation.

    Science.gov (United States)

    Simpson, Amber L; Burgner, Jessica; Glisson, Courtenay L; Herrell, S Duke; Ma, Burton; Pheiffer, Thomas S; Webster, Robert J; Miga, Michael I

    2013-04-01

    Soft-tissue image-guided interventions often require the digitization of organ surfaces for providing correspondence from medical images to the physical patient in the operating room. In this paper, the effect of several inexpensive surface acquisition techniques on target registration error and surface registration error (SRE) for soft tissue is investigated. A systematic approach is provided to compare image-to-physical registrations using three different methods of organ spatial digitization: 1) a tracked laser-range scanner (LRS), 2) a tracked pointer, and 3) a tracked conoscopic holography sensor (called a conoprobe). For each digitization method, surfaces of phantoms and biological tissues were acquired and registered to CT image volume counterparts. A comparison among these alignments demonstrated that registration errors were statistically smaller with the conoprobe than the tracked pointer and LRS (pconoscopic holography) of digitizing surfaces for clinical usage. The tracked conoscopic holography device outperforms LRS acquisitions with respect to registration accuracy.

  15. Laser method of acoustical emission control from vibrating surfaces

    Science.gov (United States)

    Motyka, Zbigniew

    2013-01-01

    For limitation of the noise in environment, the necessity occurs of determining and location of sources of sounds emitted from surfaces of many machines and devices, assuring in effect the possibility of suitable constructional changes implementation, targeted at decreasing of their nuisance. In the paper, the results of tests and calculations are presented for plane surface sources emitting acoustic waves. The tests were realized with the use of scanning laser vibrometer which enabled remote registration and the spectral analysis of the surfaces vibrations. The known hybrid digital method developed for determination of sound wave emission from such surfaces divided into small finite elements was slightly modified by distinguishing the phase correlations between such vibrating elements. The final method being developed may find use in wide range of applications for different forms of vibrations of plane surfaces.

  16. A GPU-based mipmapping method for water surface visualization

    Science.gov (United States)

    Li, Hua; Quan, Wei; Xu, Chao; Wu, Yan

    2018-03-01

    Visualization of water surface is a hot topic in computer graphics. In this paper, we presented a fast method to generate wide range of water surface with good image quality both near and far from the viewpoint. This method utilized uniform mesh and Fractal Perlin noise to model water surface. Mipmapping technology was enforced to the surface textures, which adjust the resolution with respect to the distance from the viewpoint and reduce the computing cost. Lighting effect was computed based on shadow mapping technology, Snell's law and Fresnel term. The render pipeline utilizes a CPU-GPU shared memory structure, which improves the rendering efficiency. Experiment results show that our approach visualizes water surface with good image quality at real-time frame rates performance.

  17. An enhanced method for registration of dental surfaces partially scanned by a 3D dental laser scanning.

    Science.gov (United States)

    Park, Seongjin; Kang, Ho Chul; Lee, Jeongjin; Shin, Juneseuk; Shin, Yeong Gil

    2015-01-01

    In this paper, we propose the fast and accurate registration method of partially scanned dental surfaces in a 3D dental laser scanning. To overcome the multiple point correspondence problems of conventional surface registration methods, we propose the novel depth map-based registration method to register 3D surface models. First, we convert a partially scanned 3D dental surface into a 2D image by generating the 2D depth map image of the surface model by applying a 3D rigid transformation into this model. Then, the image-based registration method using 2D depth map images accurately estimates the initial transformation between two consequently acquired surface models. To further increase the computational efficiency, we decompose the 3D rigid transformation into out-of-plane (i.e. x-, y-rotation, and z-translation) and in-plane (i.e. x-, y-translation, and z-rotation) transformations. For the in-plane transformation, we accelerate the transformation process by transforming the 2D depth map image instead of transforming the 3D surface model. For the more accurate registration of 3D surface models, we enhance iterative closest point (ICP) method for the subsequent fine registration. Our initial depth map-based registration well aligns each surface model. Therefore, our subsequent ICP method can accurately register two surface models since it is highly probable that the closest point pairs are the exact corresponding point pairs. The experimental results demonstrated that our method accurately registered partially scanned dental surfaces. Regarding the computational performance, our method delivered about 1.5 times faster registration than the conventional method. Our method can be successfully applied to the accurate reconstruction of 3D dental objects for orthodontic and prosthodontic treatment. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. Alternative sintering methods compared to conventional thermal sintering for inkjet printed silver nanoparticle ink

    NARCIS (Netherlands)

    Niittynen, J.; Abbel, R.; Mäntysalo, M.; Perelaer, J.; Schubert, U.S.; Lupo, D.

    2014-01-01

    In this contribution several alternative sintering methods are compared to traditional thermal sintering as high temperature and long process time of thermal sintering are increasing the costs of inkjet-printing and preventing the use of this technology in large scale manufacturing. Alternative

  19. Has the ThinPrep method of cervical screening maintained its improvement over conventional smears in terms of specimen adequacy?

    LENUS (Irish Health Repository)

    Treacy, A

    2009-04-01

    Liquid-based cytology (LBC) has replaced conventional smear assessment in many centers over recent years. In our laboratory this transfer took place in 1999. At that time we performed a split sample study comparing the conventional method of cervical smear evaluation with the ThinPrep system. This split sample study identified a dramatic improvement in specimen adequacy with LBC. While 11% of conventional preparations were reported as unsatisfactory and almost 9% were reported as suboptimal, evaluation of the same cases using LBC saw this combined figure reduced to 2.3%. AIM: To evaluate whether this dramatic fall in unsatisfactory smears has been maintained with the use of LBC. The database for all smears reported for 2005 (100% LBC) was interrogated. The number of unsatisfactory reports was calculated. The reason for an unsatisfactory report was recorded for each case. The overall unsatisfactory rate was compared with that reported in the 1999 split sample study. A total of 41,312 smear tests were reported in 2005. 1,342 (3.25%) were reported as unsatisfactory. Our findings support the ongoing value of LBC in a routine cervical screening laboratory in terms of continuing to maintain a low rate of unsatisfactory smears.

  20. Hybrid of Natural Element Method (NEM with Genetic Algorithm (GA to find critical slip surface

    Directory of Open Access Journals (Sweden)

    Shahriar Shahrokhabadi

    2014-06-01

    Full Text Available One of the most important issues in geotechnical engineering is the slope stability analysis for determination of the factor of safety and the probable slip surface. Finite Element Method (FEM is well suited for numerical study of advanced geotechnical problems. However, mesh requirements of FEM creates some difficulties for solution processing in certain problems. Recently, motivated by these limitations, several new Meshfree methods such as Natural Element Method (NEM have been used to analyze engineering problems. This paper presents advantages of using NEM in 2D slope stability analysis and Genetic Algorithm (GA optimization to determine the probable slip surface and the related factor of safety. The stress field is produced under plane strain condition using natural element formulation to simulate material behavior analysis utilized in conjunction with a conventional limit equilibrium method. In order to justify the preciseness and convergence of the proposed method, two kinds of examples, homogenous and non-homogenous, are conducted and results are compared with FEM and conventional limit equilibrium methods. The results show the robustness of the NEM in slope stability analysis.

  1. MANIKIN DEMONSTRATION IN TEACHING CONSERVATIVE MANAGEMENT OF POSTPARTUM HAEMORRHAGE: A COMPARISON WITH CONVENTIONAL METHODS

    Directory of Open Access Journals (Sweden)

    Sathi Mangalam Saraswathi

    2016-07-01

    Full Text Available BACKGROUND Even though there are many innovative methods to make classes more interesting and effective, in my department, topics are taught mainly by didactic lectures. This study attempts to compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of post-partum haemorrhage. OBJECTIVE To compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of postpartum haemorrhage. MATERIALS AND METHODS This is an observational study. Eighty four ninth-semester MBBS students posted in Department of Obstetrics and Gynaecology, Government Medical College, Kottayam were selected. They were divided into 2 groups by lottery method. Pre-test was conducted for both groups. Group A was taught by manikin demonstration. Group B was taught by didactic lecture. Feedback response from the students collected after demonstration class was analysed. Post-test was conducted for both the groups after one week. Gain in knowledge of both the groups were calculated from pre-test and post-test scores and compared by Independent sample t test. RESULTS The mean gain in knowledge in group A was 6.4 when compared to group B which is 4.3 and the difference was found to be statistically significant. All of the students in group A felt satisfied and more confident after the class and wanted more topics to be taken by demonstration. CONCLUSION Manikin demonstration class is more effective in teaching conservative management of post-partum haemorrhage and this method can be adopted to teach similar topics in clinical subjects.

  2. Comparison of conventional and bio-treated methods as dust suppressants.

    Science.gov (United States)

    Naeimi, Maryam; Chu, Jian

    2017-10-01

    Dust is an environmental, geotechnical, health, and economical hazard. Fugitive dust emanating along transportation systems such as roads, railways, and airports especially can have significant impacts on health, safety, material loss, cost of maintenance, and interfere with the facilities. Quantitative studies on the effectiveness of the proper dust palliatives and their environmental impact have been studied with a number of biological and chemical methods. The objective of this study was to establish a method for using the microbial Induced calcium carbonate precipitation (MICP) approach to reduce the percent of mass loss against erosive force of wind regarding to the concentration and characteristics of aggregate used, climate, and traffic amounts. The results of this study showed that the required precipitation for dust control of sand by 70% is less than 15 g CaCO 3 /m 2 between sand grains in bio-treated sand. The wind tunnel test results of this study also indicate that the effectiveness of the bio-treatment method for dust control depends on many variables, such as the percent of precipitated calcium carbonate and tensile strength.

  3. Dry matter genotypes of Cynodon by microwave and conventional oven methods

    Directory of Open Access Journals (Sweden)

    Euclides Reuter de Oliveira

    2013-02-01

    Full Text Available The aimed of this work was to comparing the drying process in a microwave oven and forced air ventilation, as well as their effects on the chemical composition of different genotypes of the genus Cynodon (Tifton 85, Jiggs, Russell, Tifton 68 and Vaquero collected at different ages cutting (28, 48, 63 and 79 days. The experimental design was a randomized block in a split-plot design, with 4 replicates. There was no difference (P>0.05 between the methods analyzed on the chemical composition of the genotypes studied. Increasing age cutoff negatively influenced (P<0.05 the crude protein content of the different plant parts. A significant increase (P<0.05 of dry matter, neutral detergent fiber, acid detergent fiber and dry matter production was observed with increasing age cut. The use of the microwave oven is a quick and precise method obtain the dry matter content of the fodder showing efficiency similar to the method of drying in an oven with forced air circulation. The genotypes showed better chemical composition results when handled at age 28 days.

  4. Evaluation of purity with its uncertainty value in high purity lead stick by conventional and electro-gravimetric methods.

    Science.gov (United States)

    Singh, Nahar; Singh, Niranjan; Tripathy, S Swarupa; Soni, Daya; Singh, Khem; Gupta, Prabhat K

    2013-06-26

    A conventional gravimetry and electro-gravimetry study has been carried out for the precise and accurate purity determination of lead (Pb) in high purity lead stick and for preparation of reference standard. Reference materials are standards containing a known amount of an analyte and provide a reference value to determine unknown concentrations or to calibrate analytical instruments. A stock solution of approximate 2 kg has been prepared after dissolving approximate 2 g of Pb stick in 5% ultra pure nitric acid. From the stock solution five replicates of approximate 50 g have been taken for determination of purity by each method. The Pb has been determined as PbSO4 by conventional gravimetry, as PbO2 by electro gravimetry. The percentage purity of the metallic Pb was calculated accordingly from PbSO4 and PbO2. On the basis of experimental observations it has been concluded that by conventional gravimetry and electro-gravimetry the purity of Pb was found to be 99.98 ± 0.24 and 99.97 ± 0.27 g/100 g and on the basis of Pb purity the concentration of reference standard solutions were found to be 1000.88 ± 2.44 and 1000.81 ± 2.68 mg kg-1 respectively with 95% confidence level (k = 2). The uncertainty evaluation has also been carried out in Pb determination following EURACHEM/GUM guidelines. The final analytical results quantifying uncertainty fulfills this requirement and gives a measure of the confidence level of the concerned laboratory. Gravimetry is the most reliable technique in comparison to titremetry and instrumental method and the results of gravimetry are directly traceable to SI unit. Gravimetric analysis, if methods are followed carefully, provides for exceedingly precise analysis. In classical gravimetry the major uncertainties are due to repeatability but in electro-gravimetry several other factors also affect the final results.

  5. Life Cycle Assessment and Water Footprint of Hydrogen Production Methods: From Conventional to Emerging Technologies

    Directory of Open Access Journals (Sweden)

    Andi Mehmeti

    2018-02-01

    Full Text Available A common sustainability issue, arising in production systems, is the efficient use of resources for providing goods or services. With the increased interest in a hydrogen (H2 economy, the life-cycle environmental performance of H2 production has special significance for assisting in identifying opportunities to improve environmental performance and to guide challenging decisions and select between technology paths. Life cycle impact assessment methods are rapidly evolving to analyze multiple environmental impacts of the production of products or processes. This study marks the first step in developing process-based streamlined life cycle analysis (LCA of several H2 production pathways combining life cycle impacts at the midpoint (17 problem-oriented and endpoint (3 damage-oriented levels using the state-of-the-art impact assessment method ReCiPe 2016. Steam reforming of natural gas, coal gasification, water electrolysis via proton exchange membrane fuel cell (PEM, solid oxide electrolyzer cell (SOEC, biomass gasification and reforming, and dark fermentation of lignocellulosic biomass were analyzed. An innovative aspect is developed in this study is an analysis of water consumption associated with H2 production pathways by life-cycle stage to provide a better understanding of the life cycle water-related impacts on human health and natural environment. For water-related scope, Water scarcity footprint (WSF quantified using Available WAter REmaining (AWARE method was applied as a stand-alone indicator. The paper discusses the strengths and weaknesses of each production pathway, identify the drivers of environmental impact, quantify midpoint environmental impact and its influence on the endpoint environmental performance. The findings of this study could serve as a useful theoretical reference and practical basis to decision-makers of potential environmental impacts of H2 production systems.

  6. Kinetics study of hydrochlorothiazide lactose liquid state interaction using conventional isothermal arrhenius method under basic and neutral conditions

    Directory of Open Access Journals (Sweden)

    Faranak Ghaderi

    Full Text Available ABSTRACT The Maillard reaction of hydrochlorothiazide (HCTZ and lactose has been previously demonstrated in pharmaceutical formulations. In this study, the activation energy of - hydrohlorothiazide and lactose interaction in the liquid state was ascertained under basic and neutral conditions. Conventional isothermal High Performance Liquid Chromatography (HPLC technique was employed to ascertain the kinetic parameters using Arrhenius method. Results: The activation energy obtained was 82.43 and 100.28 kJ/mol under basic and neutral conditions, respectively. Consequently, it can be inferred that Maillard reaction is significantly affected by pH, which can be used as a control factor whenever the reaction potentially occurs.

  7. Application of Ultrasonic Sensors in Road Surface Condition Distinction Methods

    Directory of Open Access Journals (Sweden)

    Shota Nakashima

    2016-10-01

    Full Text Available The number of accidents involving elderly individuals has been increasing with the increase of the aging population, posing increasingly serious challenges. Most accidents are caused by reduced judgment and physical abilities, which lead to severe consequences. Therefore, studies on support systems for elderly and visually impaired people to improve the safety and quality of daily life are attracting considerable attention. In this study, a road surface condition distinction method using reflection intensities obtained by an ultrasonic sensor was proposed. The proposed method was applied to movement support systems for elderly and visually impaired individuals to detect dangerous road surfaces and give an alarm. The method did not perform well in previous studies of puddle detection, because the alert provided by the method did not enable users to avoid puddles. This study extended the method proposed by previous studies with respect to puddle detection ability. The findings indicate the effectiveness of the proposed method by considering four road surface conditions. The proposed method could detect puddle conditions. The effectiveness of the proposed method was verified in all four conditions, since users could differentiate between road surface conditions and classify the conditions as either safe or dangerous.

  8. METHOD FOR FABRICATING NANOSCALE PATTERNS ON A SURFACE

    DEFF Research Database (Denmark)

    2000-01-01

    A novel method to fabricate nanoscale pits on Au(111) surfaces in contact with aqueous solution is claimed. The method uses in situ electrochemical scanning tunnelling microscopy with independent electrochemical substrate and tip potential control and very small bias voltages. This is significantly...

  9. Validation of a simplified computer simulation method for plastic forming of metals by conventional tensile tests

    Directory of Open Access Journals (Sweden)

    Daniel Fraga Pinto

    Full Text Available Abstract This work was developed in order to validate a simplified computer simulation method for application in the drawing processes. The results of tensile tests on AISI 1004, AISI 1020 steel and copper were compared to those of computer simulations performed using the Deform-3D TM software. Each specimen was assumed to be an elasto-plastic material and was meshed with 50,000 finite elements. Young's modulus and Poisson's ratio were the only material properties considered in the elastic region; the parameters of Hollomon's equation were used in the plastic region up to constriction. A strain rate of 1x10-3 s-1 was applied during the simulations. In the plastic region, up to the point of constriction, the curves obtained from the simulations showed reasonable correspondence to those determined from physical testing. However, the former diverged from the latter in the elastic and elastic-plastic transition regions. This divergence indicates that microstructural factors may have a greater influence in the transition region than in the plastic region. Moreover, the correlation obtained in the plastic region indicates that the proposed method has the potential to be applied in drawing processes.

  10. Neutron activation analysis of archaeological artifacts using the conventional relative method: a realistic approach for analysis of large samples

    International Nuclear Information System (INIS)

    Bedregal, P.S.; Mendoza, A.; Montoya, E.H.; Cohen, I.M.; Universidad Tecnologica Nacional, Buenos Aires; Oscar Baltuano

    2012-01-01

    A new approach for analysis of entire potsherds of archaeological interest by INAA, using the conventional relative method, is described. The analytical method proposed involves, primarily, the preparation of replicates of the original archaeological pottery, with well known chemical composition (standard), destined to be irradiated simultaneously, in a well thermalized external neutron beam of the RP-10 reactor, with the original object (sample). The basic advantage of this proposal is to avoid the need of performing complicated effect corrections when dealing with large samples, due to neutron self shielding, neutron self-thermalization and gamma ray attenuation. In addition, and in contrast with the other methods, the main advantages are the possibility of evaluating the uncertainty of the results and, fundamentally, validating the overall methodology. (author)

  11. A comparison of conventional methods for the quantification of bacterial cells after exposure to metal oxide nanoparticles.

    Science.gov (United States)

    Pan, Hongmiao; Zhang, Yongbin; He, Gui-Xin; Katagori, Namrata; Chen, Huizhong

    2014-08-21

    Due to potential interference of nanoparticles on bacterial quantification, there is a challenge to develop a fast, accurate and reproducible method for bacterial quantification. Currently various bacterial quantification methods are used by researchers performing nanoparticles study, but there has been no efficacy evaluation of these methods. Here we study interference of nanoparticles on three most commonly used conventional bacterial quantification methods, including colony counting to determine the colony-forming units (CFU), spectrophotometer method of optical density (OD) measurement, and flow cytometry (FCM). Three oxide nanoparticles including ZnO, TiO2, and SiO2 and four bacterial species including Salmonella enterica serovar Newport, Staphylococcus epidermidis, Enterococcus faecalis, and Escherichia coli were included in the test. Results showed that there is no apparent interference of the oxide nanoparticles on quantifications of all four bacterial species by FCM measurement; CFU counting is time consuming, less accurate and not suitable for automation; and the spectrophotometer method using OD measurement was the most unreliable method to quantify and detect the bacteria in the presence of the nanoparticles. In summary, FCM measurement proved to be the best method, which is suitable for rapid, accurate and automatic detection of bacteria in the presence of the nanoparticles.

  12. Comparison of E-test with other conventional susceptibility testing methods for ciprofloxacin and gentamicin against gram negative enteric bacilli.

    Science.gov (United States)

    Ogbolu, D O; Terry-Alli, O A; Daini, O A; Olabiyi, F A; Igharo, E A

    2012-06-01

    Increasing antibiotic resistance in Gram negative bacteria has led to the need for a faster and reliable method for determining antimicrobial susceptibility testing. In a resource poor setting like ours, it's also important to look for methods that will be clinically and economically beneficial to the patient. This study was aimed at evaluating the Epsilometer test (E-test) and conventional methods for determining antimicrobial susceptibility of isolates of Gram-negative enteric bacteria to ciprofloxacin and gentamicin. Disc diffusion, E-test, broth dilution and agar dilution methods were performed on 54 bacterial isolates. Using the E-test, 88.9% of bacterial isolates were resistant to ciprofloxacin, 92.6% were resistant using broth microdilution, 96.3% were resistant using agar dilution and 72.2% were resistant using disc diffusion. Minimum inhibitory concentration (MIC50) of isolates for gentamicin showed significant difference for all the techniques (p 0.05). Both E-test and broth dilution methods showed high levels of agreement (p > 0.05), there were low levels of agreement between E-test and agar dilution method (p < 0.05), especially at MIC50. The E-test can therefore be considered a reliable method to determine antimicrobial susceptibility testing and it gives results which are at least as accurate as those obtained by the broth dilution method.

  13. Real-Time Genetic Algorithms-Based MPPT: Study and Comparison (Theoretical an Experimental with Conventional Methods

    Directory of Open Access Journals (Sweden)

    Slimane Hadji

    2018-02-01

    Full Text Available Maximum Power Point Tracking (MPPT methods are used in photovoltaic (PV systems to continually maximize the PV array output power, which strongly depends on both solar radiation and cell temperature. The PV power oscillations around the maximum power point (MPP resulting from the conventional methods and complexity of the non-conventional ones are convincing reasons to look for novel MPPT methods. This paper deals with simple Genetic Algorithms (GAs based MPPT method in order to improve the convergence, rapidity, and accuracy of the PV system. The proposed method can also efficiently track the global MPP, which is very useful for partial shading. At first, a review of the algorithm is given, followed with many test examples; then, a comparison by means Matlab/Simulink© (R2009b is conducted between the proposed MPPT and, the popular Perturb and Observe (PO and Incremental Conductance (IC techniques. The results show clearly the superiority of the proposed controller. Indeed, with the proposed algorithm, oscillations around the MPP are dramatically minimized, a better stability is observed and increase in the output power efficiency is obtained. All these results are experimentally validated by a test bench developed at LIAS laboratory (Poitiers University, Poitiers, France using real PV panels and a PV emulator which allows one to define a profile insolation model. In addition, the proposed method permits one to perform the test of linearity between the optimal current I mp (current at maximum power and the short-circuit current I sc , and between the optimal voltage V mp and open-circuit voltage V oc , so the current and voltage factors can be easily obtained with our algorithm.

  14. Comparison of dentin hardness between conventional drill and chemomechanical methods in primary and permanent dentition using nanoindenter

    Directory of Open Access Journals (Sweden)

    M Kruthika

    2016-01-01

    Full Text Available Introduction: Latest theories regarding the rationale of carious dentin removal are beginning to question the amount of tissue that needs to be excavated to successfully treat a carious tooth. It is not always easy to make a decision at which point to stop excavation because there is an apparent lack of objective clinical markers. However, hardness of dentin might be a useful marker in this respect. Nanoindentation test is a variety of indentation hardness test applied to small volumes such as teeth which contain nanosized structures. Aims: To compare and evaluate the nanohardness of dentin after chemomechanical (Carie-care method of caries removal with the conventional (rotary instrument method of caries removal in primary and permanent teeth using nanoindenter. Materials and Methods: An in vitro randomized controlled trial was conducted using fifteen primary and fifteen permanent extracted molars with active carious lesion extending into the dentin. The primary and permanent molars were further randomly divided into two subgroups by sectioning the samples into two halves. Caries removal was done using conventional drill (CD and chemomechanical caries removal (CMCR (Carie-care methods. Following the caries removal, the test specimens were subjected for evaluation of nanohardness of dentin using nanoindenter. Student's t-test, analysis of variance, and Bonferroni test were used. Results: Statistically significant difference between the 4 groups with a P < 0.05 was obtained. Conclusions: After caries removal, the hardness of remaining dentin was found to be harder after CMCR method than with the CD method in both primary and permanent teeth, and the remaining dentin of the permanent teeth was found to be harder than the primary teeth after caries removal.

  15. Quantifying Uncertainty in Near Surface Electromagnetic Imaging Using Bayesian Methods

    Science.gov (United States)

    Blatter, D. B.; Ray, A.; Key, K.

    2017-12-01

    Geoscientists commonly use electromagnetic methods to image the Earth's near surface. Field measurements of EM fields are made (often with the aid an artificial EM source) and then used to infer near surface electrical conductivity via a process known as inversion. In geophysics, the standard inversion tool kit is robust and can provide an estimate of the Earth's near surface conductivity that is both geologically reasonable and compatible with the measured field data. However, standard inverse methods struggle to provide a sense of the uncertainty in the estimate they provide. This is because the task of finding an Earth model that explains the data to within measurement error is non-unique - that is, there are many, many such models; but the standard methods provide only one "answer." An alternative method, known as Bayesian inversion, seeks to explore the full range of Earth model parameters that can adequately explain the measured data, rather than attempting to find a single, "ideal" model. Bayesian inverse methods can therefore provide a quantitative assessment of the uncertainty inherent in trying to infer near surface conductivity from noisy, measured field data. This study applies a Bayesian inverse method (called trans-dimensional Markov chain Monte Carlo) to transient airborne EM data previously collected over Taylor Valley - one of the McMurdo Dry Valleys in Antarctica. Our results confirm the reasonableness of previous estimates (made using standard methods) of near surface conductivity beneath Taylor Valley. In addition, we demonstrate quantitatively the uncertainty associated with those estimates. We demonstrate that Bayesian inverse methods can provide quantitative uncertainty to estimates of near surface conductivity.

  16. Optical description and design method with annularly stitched aspheric surface.

    Science.gov (United States)

    Cheng, De-Wen; Chen, Xue-Jiao; Xu, Chen; Hu, Yuan; Wang, Yong-Tian

    2015-12-01

    The relentless pressure for designs with new optical functions, small volume, and light weight has greatly increased the importance of aspheric surfaces. In this paper, we propose an annularly stitched aspheric surface (ASAS) description method to increase the freedom and flexibility of imaging system design. The rotationally symmetric ASAS consists of a circular central zone and one or more annular zones. Two neighboring zones are constrained to have the same derivatives on their joint curve, and this means the ASAS is C1 continuous. This finding is proved and verified by the mathematical deduction of the surface formulas. Two optimization strategies and two design methods with the C1 continuous constraints are also discussed. This surface can greatly facilitate the design and even achieve some previously impossible designs without increasing the fabrication difficulty. Two different systems with the proposed ASAS are optimized and the results are presented. The design results verified the practicability of the ASAS.

  17. Modified prepubic TVT-obturator tape procedure versus the conventional method: a preliminary study.

    Science.gov (United States)

    Long, Cheng-Yu; Wu, Ming-Ping; Wang, Chiu-Lin; Lin, Kun-Ling; Liu, Cheng-Min; Wu, Shu-Hui; Juan, Yung-Shun

    2013-12-01

    To compare the efficacy and safety of the modified prepubic tension-free vaginal tape-obturator (PTVT-O) system procedure with the original TVT-O methods. One hundred and ninety women with urodynamic stress incontinence (USI) were included in this study (93 cases in the TVT-O group and 97 in the PTVT-O group). Clinical assessments before and one year after surgery included urinalyses, 1-h pad tests, urodynamic studies, and a personal interview with the overactive bladder symptom score (OABSS) questionnaire. There were no differences between the two groups in mean age, parity, menopausal status, mean operative time and subjective cure rates (P>0.05), but the efficacy of surgery (cure and improvement) in the PTVT-O group was significantly higher than that in the TVT-O group (P=0.038). Complication rates and visual analog scale (VAS) scores were found to be similar (P>0.05). OABSS decreased significantly after surgery in both groups (P0.05). Our modified procedure is a safe and effective treatment for female USI. It has an advantage over the original TVT-O with better surgical efficacy and comparable postoperative pain, although the follow-up times in this study are different. Copyright © 2013. Published by Elsevier Ireland Ltd.

  18. Effect of the irradiation of bacteria upon their survival rate during conventional methods of meat preservation

    International Nuclear Information System (INIS)

    Szczawinska, M.

    1981-01-01

    The purpose of this paper is to define the effect of irradiation upon the survival rate of non-sporing bacteria (Staphylococcus aureus, Salmonella typhimurium, Escherichia coli, Pseudomonas fluorescens) during basic methods of meat preservation. The bacteria were irradiated in broth by X-rays at a dose that destroyed about 90% of the bacteria (D 10 ). The survival rate of unirradiated and irradiated bacteria during cooling and freezing, in solutions of sodium chloride, nitrates and liquid smoke, was defined. The number of microorganisms was determined directly after irradiation as well as 1, 3, 7, 14, 21 and 28 days after irradiation. The effect of irradiation upon heat resistance of the examined species of bacteria was also defined. The microorganisms were heated in broth, at 70 0 C for 1, 2 and 5 minutes. The obtained results were subjected to statistical analysis. On the basis of the research results, a faster dying rate of irradiated populations of S. aureus and E. coli during any type of preservation treatment, the lack of any reaction to irradiation regarding the survival rate of S. typhimurium, and the lack of any effect of irradiation upon the rate of deterioration of P. fluorescens during freezing and storage in a solution with 10% addition of NaCI, were observed. On the other hand, a pronounced effect of irradiation upon the lowering of the heat resistance of the bacteria, as well as delayed growth in other variants of the experiment, was determined. (author)

  19. Multiscale Finite Element Methods for Flows on Rough Surfaces

    KAUST Repository

    Efendiev, Yalchin

    2013-01-01

    In this paper, we present the Multiscale Finite Element Method (MsFEM) for problems on rough heterogeneous surfaces. We consider the diffusion equation on oscillatory surfaces. Our objective is to represent small-scale features of the solution via multiscale basis functions described on a coarse grid. This problem arises in many applications where processes occur on surfaces or thin layers. We present a unified multiscale finite element framework that entails the use of transformations that map the reference surface to the deformed surface. The main ingredients of MsFEM are (1) the construction of multiscale basis functions and (2) a global coupling of these basis functions. For the construction of multiscale basis functions, our approach uses the transformation of the reference surface to a deformed surface. On the deformed surface, multiscale basis functions are defined where reduced (1D) problems are solved along the edges of coarse-grid blocks to calculate nodalmultiscale basis functions. Furthermore, these basis functions are transformed back to the reference configuration. We discuss the use of appropriate transformation operators that improve the accuracy of the method. The method has an optimal convergence if the transformed surface is smooth and the image of the coarse partition in the reference configuration forms a quasiuniform partition. In this paper, we consider such transformations based on harmonic coordinates (following H. Owhadi and L. Zhang [Comm. Pure and Applied Math., LX(2007), pp. 675-723]) and discuss gridding issues in the reference configuration. Numerical results are presented where we compare the MsFEM when two types of deformations are used formultiscale basis construction. The first deformation employs local information and the second deformation employs a global information. Our numerical results showthat one can improve the accuracy of the simulations when a global information is used. © 2013 Global-Science Press.

  20. Response surface methodology: A non-conventional statistical tool to maximize the throughput of Streptomyces species biomass and their bioactive metabolites.

    Science.gov (United States)

    Latha, Selvanathan; Sivaranjani, Govindhan; Dhanasekaran, Dharumadurai

    2017-09-01

    Among diverse actinobacteria, Streptomyces is a renowned ongoing source for the production of a large number of secondary metabolites, furnishing immeasurable pharmacological and biological activities. Hence, to meet the demand of new lead compounds for human and animal use, research is constantly targeting the bioprospecting of Streptomyces. Optimization of media components and physicochemical parameters is a plausible approach for the exploration of intensified production of novel as well as existing bioactive metabolites from various microbes, which is usually achieved by a range of classical techniques including one factor at a time (OFAT). However, the major drawbacks of conventional optimization methods have directed the use of statistical optimization approaches in fermentation process development. Response surface methodology (RSM) is one of the empirical techniques extensively used for modeling, optimization and analysis of fermentation processes. To date, several researchers have implemented RSM in different bioprocess optimization accountable for the production of assorted natural substances from Streptomyces in which the results are very promising. This review summarizes some of the recent RSM adopted studies for the enhanced production of antibiotics, enzymes and probiotics using Streptomyces with the intention to highlight the significance of Streptomyces as well as RSM to the research community and industries.

  1. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Brunser, O.; Cruchet, S.; Gotteland, M.; Verbeke, S.

    2000-01-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The 13 C-urea breath test ( 13 C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the 13 C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics

  2. Supercritical CO2 Extracts and Volatile Oil of Basil (Ocimum basilicum L. Comparison with Conventional Methods

    Directory of Open Access Journals (Sweden)

    José Coelho

    2018-03-01

    Full Text Available Interest in new products from aromatic plants as medical and nutritional compounds is increasing. The aim of this work was to apply different extraction methods, including the use of supercritical carbon dioxide extraction, and to test the antioxidant activity of basil (Ocimum basilicum L. extracts. In vitro efficacy assessments were performed using enzymatic assays. Essential oil obtained by hydrodistillation and volatile oil obtained from supercritical fluid extraction were analyzed by gas chromatography to quantify components. The total phenolic content in the extracts ranged from 35.5 ± 2.9 to 85.3 ± 8.6 mg of gallic acid equivalents and the total flavonoid content ranged from 35.5 ± 2.9 to 93.3 ± 3.9 micromole catechin equivalents per gram of dry weight of extract. All the extracts showed an antioxidant activity with 2,2-diphenyl-1-picrylhydrazyl (DPPH, 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS, and the reducing power test. Extracts obtained from methanol had a higher antioxidant capacity per the DPPH test results (IC50 = 3.05 ± 0.36 mg/mL and the reducing power test assay 306.8 ± 21.8 μmol of trolox equivalents per gram of extract (TE/g compared with ethanolic or supercritical fluid extracts. However, using the ABTS assay, the extract obtained by supercritical fluid extraction had a higher antioxidant capacity with an IC50 of 1.74 ± 0.05 mg/mL. Finally, the examined extracts showed practically no acetylcholinesterase (AChE inhibitory capacity and a slight inhibitory activity against tyrosinase.

  3. Conventional methods and emerging wastewater polishing technologies for palm oil mill effluent treatment: a review.

    Science.gov (United States)

    Liew, Wai Loan; Kassim, Mohd Azraai; Muda, Khalida; Loh, Soh Kheang; Affam, Augustine Chioma

    2015-02-01

    The Malaysian palm oil industry is a major revenue earner and the country is ranked as one of the largest producers in the world. However, growth of the industry is synonymous with a massive production of agro-industrial wastewater. As an environmental protection and public health concern, the highly polluting palm oil mill effluent (POME) has become a major attention-grabber. Hence, the industry is targeting for POME pollution abatement in order to promote a greener image of palm oil and to achieve sustainability. At present, most palm oil mills have adopted the ponding system for treatment. Due to the successful POME pollution abatement experiences, Malaysia is currently planning to revise the effluent quality standards towards a more stringent discharge limits. Hence, the current trend of POME research focuses on developing tertiary treatment or polishing systems for better effluent management. Biotechnologically-advanced POME tertiary (polishing) technologies as well as other physicochemical methods are gaining much attention as these processes are the key players to push the industry towards the goal of environmental sustainability. There are still ongoing treatment technologies being researched and the outcomes maybe available in a while. However, the research completed so far are compiled herein and reported for the first time to acquire a better perspective and insight on the subject with a view of meeting the new standards. To this end, the most feasible technology could be the combination of advanced biological processes (bioreactor systems) with extended aeration, followed by solids separation prior to discharge. Chemical dosing is favoured only if effluent of higher quality is anticipated. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Experimental Method for Measuring Dust Load on Surfaces in Rooms

    DEFF Research Database (Denmark)

    Lengweiler, Philip; Nielsen, Peter V.; Moser, Alfred

    , there is a need for better understanding of the mechanism of dust deposition and resuspension. With the presented experimental setup, the dust load on surfaces in a channel can be measured as a function of the environmental and surface conditions and the type of particles under controlled laboratory conditions.......A new experimental setup to investigate the physical process of dust deposition and resuspension on and from surfaces is introduced. Dust deposition can reduce the airborne dust concentration considerably. As a basis for developing methods to eliminate dust-related problems in rooms...

  5. Noise robustness of interferometric surface topography evaluation methods. Correlogram correlation

    Science.gov (United States)

    Kiselev, Ilia; Kiselev, Egor I.; Drexel, Michael; Hauptmannl, Michael

    2017-12-01

    Different surface height estimation methods are differently affected by interferometric noise. From a theoretical analysis we obtain height variance estimators for the methods. The estimations allow us to rigorously compare the noise robustness of popular evaluation algorithms. The envelope methods have the highest variances and hence the lowest noise resistances. The noise robustness improves from the envelope to the phase methods, but a technique involving the correlation of correlograms is superior even to the latter. We dwell on some details of this correlogram correlation method and the range of its application.

  6. Surface Enrichment by Conventional and Polymerizable Sulfated Nonylphenol Ethoxylate Emulsifiers in Water-Based Pressure-Sensitive Adhesive

    Science.gov (United States)

    Jilin Zhang; Yuxi Zhao; Matthew R. Dubay; Steven J. Severtson; Larry E. Gwin; Carl J. Houtman

    2013-01-01

    Comparisons of properties are made for pressure-sensitive adhesives (PSAs) generated via emulsion polymerization using both conventional and reactive emulsifiers. The emulsifiers are ammonium salts of sulfated nonylphenol ethoxylates with similar chemical structures and hydrophilic−lipophilic balances. The polymerizable surfactant possesses a reactive double...

  7. QTL mapping for downy mildew resistance in cucumber via bulked segregant analysis using next-generation sequencing and conventional methods.

    Science.gov (United States)

    Win, Khin Thanda; Vegas, Juan; Zhang, Chunying; Song, Kihwan; Lee, Sanghyeob

    2017-01-01

    QTL mapping using NGS-assisted BSA was successfully applied to an F 2 population for downy mildew resistance in cucumber. QTLs detected by NGS-assisted BSA were confirmed by conventional QTL analysis. Downy mildew (DM), caused by Pseudoperonospora cubensis, is one of the most destructive foliar diseases in cucumber. QTL mapping is a fundamental approach for understanding the genetic inheritance of DM resistance in cucumber. Recently, many studies have reported that a combination of bulked segregant analysis (BSA) and next-generation sequencing (NGS) can be a rapid and cost-effective way of mapping QTLs. In this study, we applied NGS-assisted BSA to QTL mapping of DM resistance in cucumber and confirmed the results by conventional QTL analysis. By sequencing two DNA pools each consisting of ten individuals showing high resistance and susceptibility to DM from a F 2 population, we identified single nucleotide polymorphisms (SNPs) between the two pools. We employed a statistical method for QTL mapping based on these SNPs. Five QTLs, dm2.2, dm4.1, dm5.1, dm5.2, and dm6.1, were detected and dm2.2 showed the largest effect on DM resistance. Conventional QTL analysis using the F 2 confirmed dm2.2 (R 2  = 10.8-24 %) and dm5.2 (R 2  = 14-27.2 %) as major QTLs and dm4.1 (R 2  = 8 %) as two minor QTLs, but could not detect dm5.1 and dm6.1. A new QTL on chromosome 2, dm2.1 (R 2  = 28.2 %) was detected by the conventional QTL method using an F 3 population. This study demonstrated the effectiveness of NGS-assisted BSA for mapping QTLs conferring DM resistance in cucumber and revealed the unique genetic inheritance of DM resistance in this population through two distinct major QTLs on chromosome 2 that mainly harbor DM resistance.

  8. Comparison of INSURE method with conventional mechanical ventilation after surfactant administration in preterm infants with respiratory distress syndrome: therapeutic challenge.

    Science.gov (United States)

    Nayeri, Fatemeh Sadat; Esmaeilnia Shirvani, Tahereh; Aminnezhad, Majid; Amini, Elaheh; Dalili, Hossein; Moghimpour Bijani, Faezeh

    2014-01-01

    Administration of endotracheal surfactant is potentially the main treatment for neonates suffering from RDS (Respiratory Distress Syndrome), which is followed by mechanical ventilation. Late and severe complications may develop as a consequence of using mechanical ventilation. In this study, conventional methods for treatment of RDS are compared with surfactant administration, use of mechanical ventilation for a brief period and NCPAP (Nasal Continuous Positive Airway Pressure), (INSURE method ((Intubation, Surfactant administration and extubation)). A randomized clinical trial study was performed, including all newborn infants with diagnosed RDS and a gestational age of 35 weeks or less, who were admitted in NICU of Valiasr hospital. The patients were then divided randomly into two CMV (Conventional Mechanical Ventilation) and INSURE groups. Surfactant administration and consequent long-term mechanical ventilation were done in the first group (CMV group). In the second group (INSURE group), surfactant was administered followed by a short-term period of mechanical ventilation. The infants were then extubated, and NCPAP was embedded. The comparison included crucial duration of mechanical ventilation and oxygen therapy, IVH (Intraventricular Hemorrhage), PDA (Patent Ductus Arteriosus), air-leak syndromes, BPD (Broncho-Pulmonary Dysplasia) and mortality rate. The need for mechanical ventilation in 5th day of admission was 43% decreased (P=0.005) in INSURE group in comparison to CMV group. A decline (P=0.01) in the incidence of IVH and PDA was also achieved. Pneumothorax, chronic pulmonary disease and mortality rates, were not significantly different among two groups. (P=0.25, P=0.14, P=0.25, respectively). This study indicated that INSURE method in the treatment of RDS decreases the need for mechanical ventilation and oxygen-therapy in preterm neonates. Moreover, relevant complications as IVH and PDA were observed to be reduced. Thus, it seems rationale to perform

  9. Enumeration of coliforms and Escherichia coli in frozen black tiger shrimp Penaeus monodon by conventional and rapid methods.

    Science.gov (United States)

    Suwansonthichai, Sasithorn; Rengpipat, Sirirat

    2003-03-15

    Conventional (most probable number, MPN) and rapid methods-including Chromocult coliform agar (CCA), Fluorocult(R) LMX broth (LMX), and Petrifilm Escherichia coli count plates (PEC) for enumeration of coliforms and E. coli in frozen black tiger shrimp from Thailand were compared in order to assess the possibility of using one of the rapid methods for routine analysis. Enumeration of coliforms and E. coli from 18 samples of regular frozen black tiger shrimp and 156 samples of frozen black tiger shrimp experimentally contaminated with coliforms or E. coli at concentrations of approximately 10, approximately 10(2), and approximately 10(3) CFU g(-1) revealed that at the level of approximately 10 CFU g(-1), coliform numbers ranked as LMX>CCA>MPN=PEC and E. coli as MPN=LMX=PEC=CCA. At the level of approximately 10(2) CFU g(-1), coliform numbers ranked as LMX>MPN=PEC=CCA and E. coli as MPN=LMX>PEC=CCA. At the level of 10(3) CFU g(-1), coliforms ranked as LMX>MPN=CCA>PEC and E. coli as MPN>LMX>CCA>PEC. Agreements with the conventional MPN method for coliforms were LMX 108%, PEC 87.2%, and CCA 91.2% and agreements for E. coli were LMX 101%, PEC 95.7%, and CCA 96.3%. Sensitivities (%) ranked LMX>MPN>CCA=PEC for coliforms and E. coli, whereas equal specificities (100%) of all methods for coliforms and E. coli were demonstrated. Rankings for the other parameters compared were: convenience, PEC>CCA=LMX>MPN; time to detection, MPN>LMX=PEC=CCA; expense, MPN=PEC>CCA>LMX; labor, MPN>LMX=CCA>PEC; accuracy for coliforms, PEC>CCA>MPN>LMX; and accuracy for E. coli, PEC=CCA>LMX>MPN.

  10. Comparison of INSURE method with conventional mechanical ventilation after surfactant administration in preterm infants with respiratory distress syndrome: therapeutic challenge.

    Directory of Open Access Journals (Sweden)

    Fatemeh Sadat Nayeri

    2014-08-01

    Full Text Available Administration of endotracheal surfactant is potentially the main treatment for neonates suffering from RDS (Respiratory Distress Syndrome, which is followed by mechanical ventilation. Late and severe complications may develop as a consequence of using mechanical ventilation. In this study, conventional methods for treatment of RDS are compared with surfactant administration, use of mechanical ventilation for a brief period and NCPAP (Nasal Continuous Positive Airway Pressure, (INSURE method ((Intubation, Surfactant administration and extubation. A randomized clinical trial study was performed, including all newborn infants with diagnosed RDS and a gestational age of 35 weeks or less, who were admitted in NICU of Valiasr hospital. The patients were then divided randomly into two CMV (Conventional Mechanical Ventilation and INSURE groups. Surfactant administration and consequent long-term mechanical ventilation were done in the first group (CMV group. In the second group (INSURE group, surfactant was administered followed by a short-term period of mechanical ventilation. The infants were then extubated, and NCPAP was embedded. The comparison included crucial duration of mechanical ventilation and oxygen therapy, IVH (Intraventricular Hemorrhage, PDA (Patent Ductus Arteriosus, air-leak syndromes, BPD (Broncho-Pulmonary Dysplasia and mortality rate. The need for mechanical ventilation in 5th day of admission was 43% decreased (P=0.005 in INSURE group in comparison to CMV group. A decline (P=0.01 in the incidence of IVH and PDA was also achieved. Pneumothorax, chronic pulmonary disease and mortality rates, were not significantly different among two groups. (P=0.25, P=0.14, P=0.25, respectively. This study indicated that INSURE method in the treatment of RDS decreases the need for mechanical ventilation and oxygen-therapy in preterm neonates. Moreover, relevant complications as IVH and PDA were observed to be reduced. Thus, it seems rationale to

  11. 3D electric field calculation with surface charge method

    International Nuclear Information System (INIS)

    Yamada, S.

    1992-01-01

    This paper describes an outline and some examples of three dimensional electric field calculations with a computer code developed at NIRS. In the code, a surface charge method is adopted because of it's simplicity in the mesh establishing procedure. The charge density in a triangular mesh is assumed to distribute with a linear function of the position. The electric field distribution is calculated for a pair of drift tubes with the focusing fingers on the opposing surfaces. The field distribution in an acceleration gap is analyzed with a Fourier-Bessel series expansion method. The calculated results excellently reproduces the measured data with a magnetic model. (author)

  12. Comparison of optical design methods of freeform surfaces for imaging applications

    Science.gov (United States)

    Agócs, Tibor

    2015-09-01

    Optical systems based on freeform optical components offer many advantages over conventional systems in imaging applications, e.g. superior image quality, compact and lightweight designs. There are a few well established manufacturing method that can be used for the generation of freeform surfaces with low surface form error and low surface roughness, in the case of freeform mirrors e.g. diamond turning, nickel plating and post-polishing. Metrology is evolving rapidly, although developments are still needed in order to verify the manufactured surface with the necessary accuracy. Optical design methods of freeform surfaces are also lagging behind, many algorithms address non-imaging applications, but in the field of imaging (image-forming) only a few exists and works with various limitations. We compare the available techniques in freeform optical design for imaging and explore the advantages, disadvantages and boundary conditions of the different methods. We also intend to identify the most useful concepts and investigate how they can be embedded into commercially available optical design software.

  13. A comparative trial of Gobin's method versus conventional surgery for refractive/accommodative esotropia uncorrected by non-surgical methods.

    Science.gov (United States)

    Molteno, A C; Kindon, R

    2000-01-01

    Gobin's theory of strabismus emphasizes the importance of diagnosis and correction of oblique muscle dysfunction when operating on the horizontal muscles to correct eso- and exodeviations in infancy. The purpose of this study was to compare outcomes for the two schools for this type of strabismus. Two cohorts of infants, one treated by the classical approach of correcting horizontal deviation alone except in the presence of "significant" oblique dysfunction, while the other treated by Gobin's techniques, have been followed for a minimum of six years. The infants managed according to Gobin's method achieved "statistically significantly" better final results in terms of a higher percentage of cases achieving binocular vision, 81% versus 44% for the classical approach. They also had a reduced incidence of functional amblyopia after completion of treatment, 11% versus 39%. Gobin's theories and techniques deserve careful attention from all surgeons involved in treating infants with strabismus and amblyopia.

  14. Correction of surface aberration in strain scanning method with analyzer

    International Nuclear Information System (INIS)

    Shobu, Takahisa; Mizuki, Junichiro; Suzuki, Kenji; Akiniwa, Yoshiaki; Tanaka, Keisuke

    2006-01-01

    When a gauge volume sank below a specimen surface, the diffraction angle shifts. Thus, it is required to correct the surface aberration. For the annealed specimen of S45C, the shift in the diffraction angle was investigated using a strain scanning method with Ge (111) analyzer. This phenomenon was caused by the difference in the centroid between the geometric and the instrumental gauge volumes. This difference is explained by the following factors; 1) the change in the gauge volume by the divergence of the analyzer, 2) the X-ray penetration depth, 3) the gap of the centre line between the double receiving slits due to mis-setting the analyzer. As a result, the correcting method considered into these factors was proposed. For the shot-peened specimens of S45C, the diffraction angles were measured and corrected by our method. The distribution of the residual stress agreed with that obtained by the removal method. (author)

  15. Method and Apparatus for Creating a Topography at a Surface

    Science.gov (United States)

    Adams, David P.; Sinclair, Michael B.; Mayer, Thomas M.; Vasile, Michael J.; Sweatt, William C.

    2008-11-11

    Methods and apparatus whereby an optical interferometer is utilized to monitor and provide feedback control to an integrated energetic particle column, to create desired topographies, including the depth, shape and/or roughness of features, at a surface of a specimen. Energetic particle columns can direct energetic species including, ions, photons and/or neutral particles to a surface to create features having in-plane dimensions on the order of 1 micron, and a height or depth on the order of 1 nanometer. Energetic processes can include subtractive processes such as sputtering, ablation, focused ion beam milling and, additive processes, such as energetic beam induced chemical vapor deposition. The integration of interferometric methods with processing by energetic species offers the ability to create desired topographies at surfaces, including planar and curved shapes.

  16. Multi-phase-field method for surface tension induced elasticity

    Science.gov (United States)

    Schiedung, Raphael; Steinbach, Ingo; Varnik, Fathollah

    2018-01-01

    A method, based on the multi-phase-field framework, is proposed that adequately accounts for the effects of a coupling between surface free energy and elastic deformation in solids. The method is validated via a number of analytically solvable problems. In addition to stress states at mechanical equilibrium in complex geometries, the underlying multi-phase-field framework naturally allows us to account for the influence of surface energy induced stresses on phase transformation kinetics. This issue, which is of fundamental importance on the nanoscale, is demonstrated in the limit of fast diffusion for a solid sphere, which melts due to the well-known Gibbs-Thompson effect. This melting process is slowed down when coupled to surface energy induced elastic deformation.

  17. Temperature sensitive surfaces and methods of making same

    Science.gov (United States)

    Liang, Liang [Richland, WA; Rieke, Peter C [Pasco, WA; Alford, Kentin L [Pasco, WA

    2002-09-10

    Poly-n-isopropylacrylamide surface coatings demonstrate the useful property of being able to switch charateristics depending upon temperature. More specifically, these coatings switch from being hydrophilic at low temperature to hydrophobic at high temperature. Research has been conducted for many years to better characterize and control the properties of temperature sensitive coatings. The present invention provides novel temperature sensitive coatings on articles and novel methods of making temperature sensitive coatings that are disposed on the surfaces of various articles. These novel coatings contain the reaction products of n-isopropylacrylamide and are characterized by their properties such as advancing contact angles. Numerous other characteristics such as coating thickness, surface roughness, and hydrophilic-to-hydrophobic transition temperatures are also described. The present invention includes articles having temperature-sensitve coatings with improved properties as well as improved methods for forming temperature sensitive coatings.

  18. Localized surface plasmon resonance mercury detection system and methods

    Science.gov (United States)

    James, Jay; Lucas, Donald; Crosby, Jeffrey Scott; Koshland, Catherine P.

    2016-03-22

    A mercury detection system that includes a flow cell having a mercury sensor, a light source and a light detector is provided. The mercury sensor includes a transparent substrate and a submonolayer of mercury absorbing nanoparticles, e.g., gold nanoparticles, on a surface of the substrate. Methods of determining whether mercury is present in a sample using the mercury sensors are also provided. The subject mercury detection systems and methods find use in a variety of different applications, including mercury detecting applications.

  19. Method and apparatus for aligning laser reflective surfaces

    International Nuclear Information System (INIS)

    Caruolo, A.B.; Davis, J.W.; Walch, A.P.

    1975-01-01

    Methods and apparatus used in the alignment of high power laser systems to obtain optimum performance are disclosed. An external source of visible radiation provides an alignment beam which is reflected along the axis of a resonator. Reflecting surfaces of the resonator are aligned with respect to the axis located by the visible beam

  20. An alternative safer and cost effective surface sterilization method for ...

    African Journals Online (AJOL)

    Regardless of its serious health effect, mercury chloride is frequently utilized for surface sterilization to mitigate microbial contamination in sugarcane tissue culture. The current study aimed at finding an alternative safer and cost effective sterilization method to substitute mercury chloride. In the study, sugarcane shoot tip ...

  1. Response surface method to optimize the low cost medium for ...

    African Journals Online (AJOL)

    A protease producing Bacillus sp. GA CAS10 was isolated from ascidian Phallusia arabica, Tuticorin, Southeast coast of India. Response surface methodology was employed for the optimization of different nutritional and physical factors for the production of protease. Plackett-Burman method was applied to identify ...

  2. Surface sterilization method for reducing microbial contamination of ...

    African Journals Online (AJOL)

    An effective disinfection method for strawberry (Fragaria x ananassa Duch.) cv. Senga Sengana micropropagation using runner tips and nodal segments as explants was developed. The explants were surface sterilized with different sterilants for different durations. The present studies on the effect of different regimes of ...

  3. Assessment methods of injection moulded nano-patterned surfaces

    DEFF Research Database (Denmark)

    Menotti, S.; Bisacco, G.; Hansen, H. N.

    2014-01-01

    algorithm for feature recognition. To compare the methods, the mould insert and a number of replicated nano-patterned surfaces, injection moulded with an induction heating aid, were measured on nominally identical locations by means of an atomic force microscope mounted on a manual CMM....

  4. An alternative safer and cost effective surface sterilization method for ...

    African Journals Online (AJOL)

    user

    2013-10-30

    Oct 30, 2013 ... Regardless of its serious health effect, mercury chloride is frequently utilized for surface sterilization to mitigate microbial contamination in sugarcane tissue culture. The current study aimed at finding an alternative safer and cost effective sterilization method to substitute mercury chloride. In the study,.

  5. Polymer surface modification using UV treatment for attachment of natamycin and the potential applications for conventional food cling wrap (LDPE)

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joongmin, E-mail: shinj@uwstout.edu [Engineering and Technology, University of Wisconsin-Stout, Menomonie, WI, 54751 (United States); Liu, Xiaojing [Mechanical and Electronic Engineering, Wuhan University of Technology, Wuhan (China); Chikthimmah, Naveen [Food Science and Technology, University of Wisconsin-Stout, Menomonie, WI, 54751 (United States); Lee, Youn Suk [Department of Packaging, Yonsei University, Gangwon 220-710 (Korea, Republic of)

    2016-11-15

    Highlights: • The study suggests an optimized method for UV-induced antimicrobial agents grafting on LDPE. • The study evaluated the effective of various solvents for acrylic acid and natamycin grafting on LDPE. • The study investigated chemical and mechanical property changes by various times of UV light treatments. • Natamycin grafted film demonstrated antifungal function against mold and yeast. - Abstract: The purpose of this study was to develop an active non-migratory antifungal Low Density Polyethylene (LDPE) polymer for use in food packaged applications. The functional acrylic acid monomer was grafted on the LDPE film surface by photo-initiated graft polymerization using Ultra Violet light irradiation (from 0 to 5 min). Natamycin, an antifungal agent, was applied to the treated film to bind with the pendent functional groups and were evaluated its performance against mold and yeast. The grafted amounts were determined by gravimetric measurement and dye absorbance. Attenuated Total Reflectance/Fourier Transfer Infrared Spectroscopy, scanning electron microscopy, mechanical strength test was used to characterize film properties. The antifungal efficacy of the film was evaluated with Saccharomyces cerevisiae and Penicillium chrysogenum on growth media and fresh cut cantaloupe. The amounts of the grafted group were increased with the longer ultraviolet exposure time. The amount of the grafted natamycin on the treated film was up to 49.87 μg/cm{sup 2}, and the film inhibited mycelium formation of P. chrysogenum spores by over 60%. Due to the thickness of the film (less than 12.25 μm), long time UV exposure decrease the film’s mechanical strength. The application of such non-migratory active packaging film represents a promising approach to maintaining food quality with reduced additive.

  6. Comparison of surface sampling methods for virus recovery from fomites.

    Science.gov (United States)

    Julian, Timothy R; Tamayo, Francisco J; Leckie, James O; Boehm, Alexandria B

    2011-10-01

    The role of fomites in infectious disease transmission relative to other exposure routes is difficult to discern due, in part, to the lack of information on the level and distribution of virus contamination on surfaces. Comparisons of studies intending to fill this gap are difficult because multiple different sampling methods are employed and authors rarely report their method's lower limit of detection. In the present study, we compare a subset of sampling methods identified from a literature review to demonstrate that sampling method significantly influences study outcomes. We then compare a subset of methods identified from the review to determine the most efficient methods for recovering virus from surfaces in a laboratory trial using MS2 bacteriophage as a model virus. Recoveries of infective MS2 and MS2 RNA are determined using both a plaque assay and quantitative reverse transcription-PCR, respectively. We conclude that the method that most effectively recovers virus from nonporous fomites uses polyester-tipped swabs prewetted in either one-quarter-strength Ringer's solution or saline solution. This method recovers a median fraction for infective MS2 of 0.40 and for MS2 RNA of 0.07. Use of the proposed method for virus recovery in future fomite sampling studies would provide opportunities to compare findings across multiple studies.

  7. Surface zwitterionization: Effective method for preventing oral bacterial biofilm formation on hydroxyapatite surfaces

    Science.gov (United States)

    Lee, Myoungjin; Kim, Heejin; Seo, Jiae; Kang, Minji; Kang, Sunah; Jang, Joomyung; Lee, Yan; Seo, Ji-Hun

    2018-01-01

    In this study, we conducted surface zwitterionization of hydroxyapatite (HA) surfaces by immersing them in the zwitterionic polymer solutions to provide anti-bacterial properties to the HA surface. Three different monomers containing various zwitterionic groups, i.e., phosphorylcholine (PC), sulfobetaine (SB), and carboxybetaine (CB), were copolymerized with the methacrylic monomer containing a Ca2+-binding moiety, using the free radical polymerization method. As a control, functionalization of the copolymer containing the Ca2+-binding moiety was synthesized using a hydroxy group. The stable immobilization of the zwitterionic functional groups was confirmed by water contact angle analysis and X-ray photoelectron spectroscopy (XPS) measurement conducted after the sonication process. The zwitterionized HA surface showed significantly decreased protein adsorption, whereas the hydroxyl group-coated HA surface showed limited efficacy. The anti-bacterial adhesion property was confirmed by conducting Streptococcus mutans (S. mutans) adhesion tests for 6 h and 24 h. When furanone C-30, a representative anti-quorum sensing molecule for S. mutans, was used, only a small amount of bacteria adhered after 6 h and the population did not increase after 24 h. In contrast, zwitterionized HA surfaces showed almost no bacterial adhesion after 6 h and the effect was retained for 24 h, resulting in the lowest level of oral bacterial adhesion. These results confirm that surface zwitterionization is a promising method to effectively prevent oral bacterial adhesion on HA-based materials.

  8. Conventional wound management versus a closed suction irrigation method for infected laparotomy wound--a comparative study.

    Science.gov (United States)

    Zhen, Zuo Jun; Lai, Eric C H; Lee, Qing Han; Chen, Huan Wei; Lau, Wan Yee; Wang, Feng Jie

    2011-01-01

    The aim of this study was to evaluate the efficacy of a closed suction irrigation method for the management of infected laparotomy wounds. This is a retrospective study on consecutive patients with infected laparotomy wounds managed in a single tertiary referral hospital from January 2004 to March 2009. The wounds were laid open, debrided and cleansed with hydrogen peroxide, povidone iodine and normal saline. The wounds were either conventionally treated with normal saline dressings followed by secondary suturing when healthy granulation tissues were formed (the Control group) or by the closed suction irrigation method after suturing the wound (the Study Group). There were 70 patients in the Study Group and 60 patients in the Control Group. The hospital stay (mean ± SD, 9.2 ± 0.1 vs. 20.5 ± 0.6 days, P irrigation method for infected laparotomy wounds. The closed suction irrigation method decreased hospital stay and allowed early rehabilitation. The findings of our study need to be substantiated in large-scale randomized controlled trials. Copyright © 2011 Surgical Associates Ltd. Published by Elsevier Ltd. All rights reserved.

  9. ''Augmented reality'' in conventional simulation by projection of 3-D structures into 2-D images. A comparison with virtual methods

    International Nuclear Information System (INIS)

    Deutschmann, H.; Nairz, O.; Zehentmayr, F.; Fastner, G.; Sedlmayer, F.; Steininger, P.; Kopp, P.; Merz, F.; Wurstbauer, K.; Kranzinger, M.; Kametriser, G.; Kopp, M.

    2008-01-01

    Background and purpose: in this study, a new method is introduced, which allows the overlay of three-dimensional structures, that have been delineated on transverse slices, onto the fluoroscopy from conventional simulators in real time. Patients and methods: setup deviations between volumetric imaging and simulation were visualized, measured and corrected for 701 patient isocenters. Results: comparing the accuracy to mere virtual simulation lacking additional X-ray imaging, a clear benefit of the new method could be shown. On average, virtual prostate simulations had to be corrected by 0.48 cm (standard deviation [SD] 0.38), and those of the breast by 0.67 cm (SD 0.66). Conclusion: the presented method provides an easy way to determine entity-specific safety margins related to patient setup errors upon registration of bony anatomy (prostate 0.9 cm for 90% of cases, breast 1.3 cm). The important role of planar X-ray imaging was clearly demonstrated. The innovation can also be applied to adaptive image-guided radiotherapy (IGRT) protocols. (orig.)

  10. Evaluation of the PetrifilmTM and TEMPO® systems and the conventional method for counting microorganisms in pasteurized milk

    Directory of Open Access Journals (Sweden)

    Andréia Cirolini

    2013-12-01

    Full Text Available New microbiological methods have been developed and commercialized, but their performance must be guaranteed. The aim of the present study was to evaluate the PetrifilmTM and TEMPO® systems compared to the conventional method for counting microorganisms in pasteurized milk. A total of 141 samples of pasteurized milk were analyzed by counting mesophilic aerobic, Coliforms at 35 ºC, Coliforms at 45 ºC, and Escherichia coli microorganisms. High correlation was found between the methods for counting Coliforms at 35 ºC, but low correlation was found for counting mesophilic aerobic, Coliforms at 45 ºC, and Escherichia coli. No significant statistical difference was found among the three methods for counting Coliforms at 35 ºC; however, the mean counts of mesophilic aerobic, Coliforms at 45 ºC, and Escherichia coli showed significant statistical difference. PetrifilmTM and TEMPO® systems had satisfactory results for Coliforms at 35 ºC in pasteurized milk but low performance for mesophilic aerobic, Coliforms at 45 ºC and Escherichia coli.

  11. Strategies for Solving Potential Problems Associated with Laboratory Diffusion and Batch Experiments - Part 1: An Overview of Conventional Test Methods

    International Nuclear Information System (INIS)

    Zhang, M.; Takeda, M.; Nakajima, H.

    2006-01-01

    Laboratory diffusion testing as well as batch experiments are well established and widely adopted techniques for characterizing the diffusive and adsorptive properties of geological, geotechnical, and synthetic materials in both scientific and applied fields, including geological disposal of radioactive waste. Although several types of diffusion test, such as the through- diffusion test, in-diffusion test, out-diffusion test, and column test, are currently available, different methods may have different advantages and disadvantages. In addition, traditional methods may have limitations, such as the need for relatively long test times, cumbersome test procedures, and the possibility of errors due to differences between analytical assumptions and actual test conditions. Furthermore, traditional batch experiments using mineral powders are known to overestimate the sorption coefficient. In part 1 of this report, we present a brief overview of laboratory diffusion and batch experiments. The advantages, disadvantages, limitations, and/or potential problems associated with individual tests were compared and summarized. This comprehensive report will provide practical references for reviewing the results obtained from relevant experiments, especially from the viewpoint of regulation. To solve and/or eliminate the potential problems associated with conventional methods, and to obtain the diffusion coefficient and rock capacity factor from a laboratory test both rapidly and accurately, part 2 of this study discusses possible strategies involving the development of rigorous solutions to some relevant test methods, and sensitivity analyses for the related tests that may be helpful to judge the accuracy of the two parameters to be determined from individual tests. (authors)

  12. Comparison of polyacetylene content in organically and conventionally grown carrots using a fast ultrasonic liquid extraction method.

    Science.gov (United States)

    Søltoft, Malene; Eriksen, Morten Rosbjørn; Träger, Anne Wibe Braendholt; Nielsen, John; Laursen, Kristian Holst; Husted, Søren; Halekoh, Ulrich; Knuthsen, Pia

    2010-07-14

    A rapid and sensitive analytical method for quantification of polyacetylenes in carrot roots was developed. The traditional extraction method (stirring) was compared to a new ultrasonic liquid processor (ULP)-based methodology using high-performance liquid chromatography-ultraviolet (HPLC-UV) and mass spectrometry (MS) for identification and quantification of three polyacetylenes. ULP was superior because a significant reduction in extraction time and improved extraction efficiencies were obtained. After optimization, the ULP method showed good selectivity, precision [relative standard deviations (RSDs) of 2.3-3.6%], and recovery (93% of falcarindiol) of the polyacetylenes. The applicability of the method was documented by comparative analyses of carrots grown organically or conventionally in a 2 year field trial study. The average concentrations of falcarindiol, falcarindiol-3-acetate, and falcarinol in year 1 were 222, 30, and 94 mug of falcarindiol equiv/g of dry weight, respectively, and 3-15% lower in year 2. The concentrations were not significantly influenced by the growth system, but a significant year-year variation was observed for falcarindiol-3-acetate.

  13. A novel test method for quantifying surface tack of polypropylene compound surfaces

    Directory of Open Access Journals (Sweden)

    2011-11-01

    Full Text Available While adhesiveness is required for polymer surfaces in special applications, tacky surfaces are generally undesirable in many applications like automotive interior parts. The tackiness of polymer surface results from a combination of composition and additivation, and it can change significantly in natural or accelerated ageing. Since there is no established, uniform method to characterize surface tack, the major focus of the present work was on the development of an objective quantification method. A setup having a soft die tip attached to a standard tensile tester was developed aiming for correlation to the human sense of touch. Three different model thermoplastic polyolefin (TPO compound formulations based on a high-impact isotactic polypropylene (iPP composition with varying amounts and types of anti-scratch additives were used for these investigations. As the surface tack phenomenon is related to ageing and weathering, the material’s examination was also performed after various intervals of weathering. The developed method allows a fast assessment of the effect of polymer composition variations and different additive formulations on surface tack and gives identical rankings as the standardized haptic panel.

  14. A study of phase stability in invar Fe--Ni alloys obtained by non-conventional methods

    Science.gov (United States)

    Scorzelli, R. B.

    1997-09-01

    It is known that thermodynamic equilibrium in Fe--Ni alloys, in the invar composition at temperatures below 450°C, is difficult to achieve because of the slow diffusion rate at low temperatures. One of the ways in which we can study phase transformation which may be responsible for invar behavior is to investigate: (i) materials of similar composition obtained by non-conventional methods, known to allow the enhancement of diffusion at temperatures where atomic mobility is nil on the laboratory time scale; (ii) materials which have been treated for very long periods of time (geological time scale) in the same temperature range, such as in meteorites. In this context we have studied the phase stability of Fe--Ni phases in mechanically alloyed powders, in ion-beam mixed multilayers and in meteorites.

  15. Comparison of GeneXpert MTB/RIF and conventional methods for the diagnosis of tuberculosis in Kosovo.

    Science.gov (United States)

    Bajrami, Rrezarta; Mulliqi, Gjyle; Kurti, Arsim; Lila, Greta; Raka, Lul

    2016-04-28

    Tuberculosis (TB) is a major public health problem worldwide, with the highest mortality occurring in developing countries. The burden of TB in Kosovo is among the highest in Europe. The aim of this study was to compare Cepheid GeneXpert MTB/RIF assay for direct detection of Mycobacterium tuberculosis complex (MTBC) and rifampin (RIF) resistance with conventional methods. A cross-sectional design to evaluate diagnostic tests was carried out at the Department of Microbiology, National Institute of Public Health of Kosovo and Lung Clinic, from January to June 2014. The detection of MTBC and RIF resistance using the Xpert MTB/RIF assay was assessed in 116 specimens received from 110 patients suspected of having TB and compared with conventional smear microscopy and culture methods. Fifty-eight patients (52.7%) were male, and the mean age was 48.6±18.1 years. Twenty-nine patients (26.4%) had underlying lung diseases. Of the 116 specimens investigated, 28 (24.1%) were MTBC-positive by culture, while 34 (29.3%) were positive by Xpert assay. Two samples showed false-negative Xpert results. Compared with culture, the Xpert assay achieved 82.3% (95% CI: 65.5%-93.2%) sensitivity, and 97.6% (95% CI: 91.5%-99.7%) specificity. GeneXpert could detect 11.7% and 50% additional positive cases as compared to Lowenstein-Jensen culture and smear microscopy, respectively. Three cases with resistance to rifampin were detected from clinical isolates. The GeneXpert MTB/RIF assay is a helpful tool for rapid diagnosis and prompt treatment of TB.

  16. Advances in calibration methods for micro- and nanoscale surfaces

    Science.gov (United States)

    Leach, R. K.; Giusca, C. L.; Coupland, J. M.

    2012-04-01

    Optical surface topography measuring instrument manufacturers often quote accuracies of the order of nanometres and claim that the instruments can reliably measure a range of surfaces with structures on the micro- to nanoscale. However, for many years there has been debate about the interpretation of the data from optical surface topography measuring instruments. Optical artefacts in the output data and a lack of a calibration infrastructure mean that it can be difficult to get optical instruments to agree with contact stylus instruments. In this paper, the current situation with areal surface topography measurements is discussed along with the ISO specification standards that are in draft form. An infrastructure is discussed whereby the ISO-defined metrological characteristics of optical instruments can be determined, but these characteristics do not allow the instrument to measure complex surfaces. Current research into methods for determining the transfer function of optical instruments is reviewed, which will allow the calibration of optical instruments to measure complex surfaces, at least in the case of weak scattering. The ability of some optical instruments to measure outside the spatial bandwidth limitation of the numerical aperture is presented and some general outlook for future work given.

  17. Optical triangulation method for height measurements on water surfaces

    Science.gov (United States)

    Maas, Hans-Gerd; Hentschel, Bernd; Schreiber, Frank

    2003-01-01

    Optical triangulation methods based on a laser light sheet and a camera are frequently used as a surface measurement technique in a wide range of applications. They allow for the fast accurate determination of height profiles, based on relatively simple hardware and software configurations. Moreover, they can be implemented very efficiently and are especially suited for measurements on moving objects such as products on an assembly line. The study presented in the paper describes the adaptation of laser light sheet optical triangulation techniques to the task of water level profile measurements in hydromechanics experimental facilities. The properties of water surfaces necessitate several modifications of optical triangulation techniques to make them applicable: The mirror-like reflection properties of water surfaces form a contradiction to the assumption of diffuse reflection, on which standard light sheet triangulation techniques are based; this problem can be circumvented by using a diffuse reflecting projection plane to capture the mirror-like reflection of the laser line from the water surface. Due to the angle of incidence law, however, water surface tilts caused by waves will usually cause a strong degradation of the quality of the results when using reflected light; this effect can largely be compensated by processing max-store images derived from short image sequences rather than single images. These extensions of optical triangulation turned out to be crucial for the applicability of the method on water surfaces. Besides the theoretical concept and a sensitivity analysis of the method, a system configuration is outlined, and the results of a number of practical experiments are shown and discussed.

  18. Arthroscopic release using F and C method versus conventional open release method in the treatment of gluteal muscle contracture: a comparative study.

    Science.gov (United States)

    Rai, Saroj; Jin, Shengyang; Meng, Chunqing; Chaudhary, Nabin; Tamang, Nira; Wang, Xiaohong; Liu, Xianzhe; Wang, Hong; Yang, Shuhua

    2017-03-16

    Gluteal muscle contracture (GMC), a debilitating disease, usually starts in early childhood after variable dose of injections around the buttock, if left untreated it worsens gradually and persists throughout the life. Because the disease mostly affects adolescents and adults, there is always an aesthetic concerns. Purposeof the study was to introduce the arthroscopic F and C method of GMC release, and to compare its clinical efficiency with conventional open surgery in terms of clinical outcome, rate of complications, patient's satisfactions, and recurrence. Between Jan 2013 and July 2015, 75 patients received an arthroscopic release with F and C release method and 71 patients received conventional open release of GMC. Primary surgeries in 16 years or older patients were included in the study. Two groups were compared clinically using Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL), Hip Outcome Scores - Sports Subscale (HOS-Sports), Visual Analogue Scale (VAS), and Ye et al. evaluation criteria. No statistically significant differences were observed in Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL) (P = 0.078), Hip Outcome Scores - Sports Subscale (HOS-Sports) (P = 0.340), and Visual Analogue Scale (VAS) (P = 0.524) between the two groups. 74 (98.7%) patients in the arthroscopic surgery group had good to excellent results, whereas 69 (97.1%) patients in the conventional open surgery group had good to excellent results (P = 0.727). No statistically significant difference was observed in recurrence rate (P = 0.612). Statistically significant differences were observed in incision length, use of post-operative analgesia, post-operative off-bed activity, and hospital stay. Complications were significantly higher in the conventional open surgery group (n = 21) than in the arthroscopic surgery group (n = 10) (P = 0.016). More importantly, cosmetic satisfaction was 100% in arthroscopic release group

  19. Uncommon or cryptic? Challenges in estimating leopard seal abundance by conventional but state-of-the-art methods

    Science.gov (United States)

    Southwell, Colin; Paxton, Charles G. M.; Borchers, David; Boveng, Peter; Rogers, Tracey; de la Mare, William K.

    2008-04-01

    The method traditionally used to estimate pack-ice seal abundance employs sighting surveys from ships or aircraft to estimate the number of seals hauled out on the ice, combined with studies of haul-out behaviour to estimate the proportion of time spent on the ice. Application of this approach has been improved in recent times by developments in survey methodology and satellite technology that theoretically allow biases in the estimation of hauled-out abundance and haul-out behaviour to be accounted for that previously could not be addressed. A survey using these conventional but state-of-the-art methods was undertaken in the summer of 1999/2000 off east Antarctica between longitudes 64°E and 150°E to estimate the abundance of leopard ( Hydrurga leptonyx) and other pack-ice seal species. Because they are either uncommon or very cryptic, very few leopard seals were encountered despite a large survey effort. This presented challenges in both application of the methods and analysis of the data. Abundance estimates were derived using a number of plausible predictive models. The model considered as the most reliable returned best estimates of 7300 and 12,100 for definite and definite plus probable leopard seal sightings, respectively, with 95% confidence intervals of 3700-14,500 and 7100-23,400. These estimates are likely to be negatively biased and should be treated as minimum estimates only.

  20. Assessment of Biological Kinetics in a Conventional Municipal WWTP by Means of the Oxygen Uptake Rate Method

    Directory of Open Access Journals (Sweden)

    Vincenzo Torretta

    2014-04-01

    Full Text Available Pollution control of surface water bodies requires stringent checks on wastewater treatment plants performances. The satisfactory operation of biological treatment, commonly performed by means of activated sludge processes, requires a number of controlling and monitoring procedures. Suitable respirometric techniques for the determination of the kinetic parameters that regulate biological processes have been implemented in order to achieve this aim. This paper describes the results of an experimental research carried out in a conventional Italian municipal wastewater treatment plant. Particularly, the research has been finalized to both evaluate the biological process for the removal of biodegradable pollutants, such as carbonaceous substrates and ammonia nitrogen, and to collect data in order to evaluate a possible plant upgrade. Heterotrophic and autotrophic biomass kinetic parameters have been examined using respirometric techniques based on oxygen uptake measurements. The research performed makes a valuable contribution toward verifying the reliability of the values proposed in the literature for some kinetic parameters, which have been commonly used for a long time.

  1. Method for Reduction of Silver Biocide Plating on Metal Surfaces

    Science.gov (United States)

    Steele, John; Nalette, Timothy; Beringer, Durwood

    2013-01-01

    Silver ions in aqueous solutions (0.05 to 1 ppm) are used for microbial control in water systems. The silver ions remain in solution when stored in plastic containers, but the concentration rapidly decreases to non-biocidal levels when stored in metal containers. The silver deposits onto the surface and is reduced to non-biocidal silver metal when it contacts less noble metal surfaces, including stainless steel, titanium, and nickel-based alloys. Five methods of treatment of contact metal surfaces to deter silver deposition and reduction are proposed: (1) High-temperature oxidation of the metal surface; (2) High-concentration silver solution pre-treatment; (3) Silver plating; (4) Teflon coat by vapor deposition (titanium only); and (5) A combination of methods (1) and (2), which proved to be the best method for the nickel-based alloy application. The mechanism associated with surface treatments (1), (2), and (5) is thought to be the development of a less active oxide layer that deters ionic silver deposition. Mechanism (3) is an attempt to develop an equilibrium ionic silver concentration via dissolution of metallic silver. Mechanism (4) provides a non-reactive barrier to deter ionic silver plating. Development testing has shown that ionic silver in aqueous solution was maintained at essentially the same level of addition (0.4 ppm) for up to 15 months with method (5) (a combination of methods (1) and (2)), before the test was discontinued for nickel-based alloys. Method (1) resulted in the maintenance of a biocidal level (approximately 0.05 ppm) for up to 10 months before that test was discontinued for nickel-based alloys. Methods (1) and (2) used separately were able to maintain ionic silver in aqueous solution at essentially the same level of addition (0.4 ppm) for up to 10 months before the test was discontinued for stainless steel alloys. Method (3) was only utilized for titanium alloys, and was successful at maintaining ionic silver in aqueous solution at

  2. Comparative evaluation of the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods.

    Science.gov (United States)

    Devgan, Manish; Nanda, Arun; Ansari, Shahid Husain

    2013-09-01

    The aim of the present study was to assess the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods. Aqueous and ethanol extracts of Pterocarpus marsupium heartwood were prepared by conventional methods (infusion, decoction, maceration and percolation) and non conventional methods, such as ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE). The crude aqueous extracts were administered orally to both normal and alloxan induced male albino rats (Sprague-Dawley strain). The experimental set up consisted of 48 male albino rats divided into 6 groups: Normal control, diabetic control (sterile normal saline, 1 ml/100 g body weight), standard (gliclazide, 25 mg/1000g of body weight), groups 4-6 (crude aqueous percolation, optimized UAE and MAE extract, 250 mg/1000g of body weight). In acute treatment, the reduction of blood glucose level was statistically significant with the oral administration of UAE and percolation aqueous extracts to the hyperglycemic rats. In sub-acute treatment, the UAE aqueous extract led to consistent and statistically significant (p<0.001) reduction in the blood glucose levels. There was no abnormal change in body weight of the hyperglycemic animals after 10 days of administration of plant extracts and gliclazide. This study justifies the traditional claim and provides a rationale for the use of Pterocarpus marsupium to treat diabetes mellitus. The antidiabetic activity of Pterocarpus marsupium can be enhanced by extracting the heartwood by non conventional method of UAE.

  3. Methods to study microbial adhesion on abiotic surfaces

    Directory of Open Access Journals (Sweden)

    Ana Meireles

    2015-09-01

    Full Text Available Microbial biofilms are a matrix of cells and exopolymeric substances attached to a wet and solid surface and are commonly associated to several problems, such as biofouling and corrosion in industries and infectious diseases in urinary catheters and prosthesis. However, these cells may have several benefits in distinct applications, such as wastewater treatment processes, microbial fuel cells for energy production and biosensors. As microbial adhesion is a key step on biofilm formation, it is very important to understand and characterize microbial adhesion to a surface. This study presents an overview of predictive and experimental methods used for the study of bacterial adhesion. Evaluation of surface physicochemical properties have a limited capacity in describing the complex adhesion process. Regarding the experimental methods, there is no standard method or platform available for the study of microbial adhesion and a wide variety of methods, such as colony forming units counting and microscopy techniques, can be applied for quantification and characterization of the adhesion process.

  4. Simulating condensation on microstructured surfaces using Lattice Boltzmann Method

    Science.gov (United States)

    Alexeev, Alexander; Vasyliv, Yaroslav

    2017-11-01

    We simulate a single component fluid condensing on 2D structured surfaces with different wettability. To simulate the two phase fluid, we use the athermal Lattice Boltzmann Method (LBM) driven by a pseudopotential force. The pseudopotential force results in a non-ideal equation of state (EOS) which permits liquid-vapor phase change. To account for thermal effects, the athermal LBM is coupled to a finite volume discretization of the temperature evolution equation obtained using a thermal energy rate balance for the specific internal energy. We use the developed model to probe the effect of surface structure and surface wettability on the condensation rate in order to identify microstructure topographies promoting condensation. Financial support is acknowledged from Kimberly-Clark.

  5. Facile stamp patterning method for superhydrophilic/superhydrophobic surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Lyu, Sungnam, E-mail: blueden@postech.ac.kr; Hwang, Woonbong, E-mail: whwang@postech.ac.kr [Department of Mechanical Engineering, POSTECH, Pohang 680-749 (Korea, Republic of)

    2015-11-16

    Patterning techniques are essential to many research fields such as chemistry, biology, medicine, and micro-electromechanical systems. In this letter, we report a simple, fast, and low-cost superhydrophobic patterning method using a superhydrophilic template. The technique is based on the contact stamping of the surface during hydrophobic dip coating. Surface characteristics were measured using scanning electron microscopy and energy-dispersive X-ray spectroscopic analysis. The results showed that the hydrophilic template, which was contacted with the stamp, was not affected by the hydrophobic solution. The resolution study was conducted using a stripe shaped stamp. The patterned line was linearly proportional to the width of the stamp line with a constant narrowing effect. A surface with regions of four different types of wetting was fabricated to demonstrate the patterning performance.

  6. Scattering of surface waves modelled by the integral equation method

    Science.gov (United States)

    Lu, Laiyu; Maupin, Valerie; Zeng, Rongsheng; Ding, Zhifeng

    2008-09-01

    The integral equation method is used to model the propagation of surface waves in 3-D structures. The wavefield is represented by the Fredholm integral equation, and the scattered surface waves are calculated by solving the integral equation numerically. The integration of the Green's function elements is given analytically by treating the singularity of the Hankel function at R = 0, based on the proper expression of the Green's function and the addition theorem of the Hankel function. No far-field and Born approximation is made. We investigate the scattering of surface waves propagating in layered reference models imbedding a heterogeneity with different density, as well as Lamé constant contrasts, both in frequency and time domains, for incident plane waves and point sources.

  7. Response-Surface Methods in R, Using rsm

    Directory of Open Access Journals (Sweden)

    Russell V. Lenth

    2009-10-01

    Full Text Available This article describes the recent package rsm, which was designed to provide R support for standard response-surface methods. Functions are provided to generate central-composite and Box-Behnken designs. For analysis of the resulting data, the package provides for estimating the response surface, testing its lack of fit, displaying an ensemble of contour plots of the fitted surface, and doing follow-up analyses such as steepest ascent, canonical analysis, and ridge analysis. It also implements a coded-data structure to aid in this essential aspect of the methodology. The functions are designed in hopes of providing an intuitive and effective user interface. Potential exists for expanding the package in a variety of ways.

  8. Exploration on Kerf-angle and Surface Roughness in Abrasive Waterjet Machining using Response Surface Method

    Science.gov (United States)

    Babu, Munuswamy Naresh; Muthukrishnan, Nambi

    2017-05-01

    Abrasive waterjet machining is a mechanical based unconventional cutting process which uses a mixture of abrasives and pressurized water as an intermediate to cut the material. The present paper focuses in analyzing the effect process parameters like feed rate, water pressure, standoff distance and abrasive flow rate on the surface roughness and kerf-angle of AISI 1018 mild steel experimentally. The experiments were performed under Taguchi's L27 orthogonal array. Moreover, the optimal parameter that significantly reduces the surface roughness and kerf-angle were calculated through response surface method. The most dominating process parameter that affects the responses was calculated by the Analysis of variance. In addition, machined surfaces are further subjected to scanning electron microscope (SEM) and atomic force microscope (AFM) for detailed study on the texture developed.

  9. [Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

    Science.gov (United States)

    Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

    2011-01-01

    The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  10. Clinical outcomes for patients finished with the SureSmile™ method compared with conventional fixed orthodontic therapy

    Science.gov (United States)

    Alford, Timothy J.; Roberts, W. Eugene; Hartsfield, James K.; Eckert, George J.; Snyder, Ronald J.

    2016-01-01

    Objective Utilize American Board of Orthodontics (ABO) cast/radiographic evaluation (CRE) to compare a series of 63 consecutive patients, finished with manual wire bending (conventional) treatment, vs a subsequent series of 69 consecutive patients, finished by the same orthodontist using the SureSmile™ (SS) method. Materials and Methods Records of 132 nonextraction patients were scored by a calibrated examiner blinded to treatment mode. Age and discrepancy index (DI) between groups were compared by t-tests. A chi-square test was used to compare for differences in sex and whether the patient was treated using braces only (no orthopedic correction). Analysis of covariance tested for differences in CRE outcomes and treatment times, with sex and DI included as covariates. A logarithmic transformation of CRE outcomes and treatment times was used because their distributions were skewed. Significance was defined as P space closure; however, second-order root angulation (RA) was inferior. Conclusion SS patients were treated in less time to better CRE scores for first-order rotation (AR) and interproximal space closure (IC) but on the average, malocclusions were less complex and second order root alignment was inferior, compared with patients finished with manual wire bending. PMID:21261488

  11. Interrogating the Conventional Boundaries of Research Methods in Social Sciences: The Role of Visual Representation in Ethnography

    Directory of Open Access Journals (Sweden)

    Nel Glass

    2008-05-01

    Full Text Available The author will propose that the use of performative social science is a means to deliberately interrogate long held conventions of established research. The innovative role of visual art representation in data collection, analysis and public engagement with research will be discussed. Examples will be drawn from two postmodern feminist ethnographic research which investigated academic professional development, resilience, hope and optimism in the UK, US, Australia and New Zealand from 1997-2005. Artwork was initially created as data collection and digitalised as representation to intentionally validate the voices of research participants, the researcher and viewers of the work. The research participants and viewers were given opportunities to actively engage with the visual work. Artwork complimented two additional research methods: critical conversational interviewing and reflective journaling. This paper will address the ways inclusion of art methods contributed and deepened data representation. The role of crafting artwork in the field, the artistic changes that represented the complexity of data analysis and engagement with the work will be explored. It will be argued that the creation and engagement with artwork in research is an empowering and dynamic process for researchers and participants. It is an innovative means of representing intersubjectivity that results in reciprocity. URN: urn:nbn:de:0114-fqs0802509

  12. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    International Nuclear Information System (INIS)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-01-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm 3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  13. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    Science.gov (United States)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-06-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  14. Theoretical studies of potential energy surfaces and computational methods

    Energy Technology Data Exchange (ETDEWEB)

    Shepard, R. [Argonne National Laboratory, IL (United States)

    1993-12-01

    This project involves the development, implementation, and application of theoretical methods for the calculation and characterization of potential energy surfaces involving molecular species that occur in hydrocarbon combustion. These potential energy surfaces require an accurate and balanced treatment of reactants, intermediates, and products. This difficult challenge is met with general multiconfiguration self-consistent-field (MCSCF) and multireference single- and double-excitation configuration interaction (MRSDCI) methods. In contrast to the more common single-reference electronic structure methods, this approach is capable of describing accurately molecular systems that are highly distorted away from their equilibrium geometries, including reactant, fragment, and transition-state geometries, and of describing regions of the potential surface that are associated with electronic wave functions of widely varying nature. The MCSCF reference wave functions are designed to be sufficiently flexible to describe qualitatively the changes in the electronic structure over the broad range of geometries of interest. The necessary mixing of ionic, covalent, and Rydberg contributions, along with the appropriate treatment of the different electron-spin components (e.g. closed shell, high-spin open-shell, low-spin open shell, radical, diradical, etc.) of the wave functions, are treated correctly at this level. Further treatment of electron correlation effects is included using large scale multireference CI wave functions, particularly including the single and double excitations relative to the MCSCF reference space. This leads to the most flexible and accurate large-scale MRSDCI wave functions that have been used to date in global PES studies.

  15. Comparison of optical methods for surface roughness characterization

    DEFF Research Database (Denmark)

    Feidenhans'l, Nikolaj Agentoft; Hansen, Poul Erik; Pilny, Lukas

    2015-01-01

    We report a study of the correlation between three optical methods for characterizing surface roughness: a laboratory scatterometer measuring the bi-directional reflection distribution function (BRDF instrument), a simple commercial scatterometer (rBRDF instrument), and a confocal optical profiler...... of the scattering angle distribution (Aq). The twenty-two investigated samples were manufactured with several methods in order to obtain a suitable diversity of roughness patterns.Our study shows a one-to-one correlation of both the Rq and the Rdq roughness values when obtained with the BRDF and the confocal...

  16. Histological validation of cone-beam computed tomography versus laser fluorescence and conventional diagnostic methods for occlusal caries detection.

    Science.gov (United States)

    Ozturk, Elif; Sinanoglu, Alper

    2015-02-01

    The purpose of this study was to compare the validity of visual (VE), radiological (RE), cone beam computed tomography (CBCT), and laser fluorescence (LFE) examination methods for the detection of the occlusal noncavitated caries in permanent posterior teeth. Two examiners assessed 121 selected sites on the occlusal surfaces of 44 molar teeth by visual (International Caries Assessment and Detection System II [ICDAS]), radiographic (bite-wing projection) cone-beam computed tomography, and laser fluorescence (DIAGNOdent Pen) examination methods. After a 1-week interval, each measurement was repeated by two examiners. Then, the teeth were sectioned, and histological evaluation was performed, which serves as the gold standard. The lesion depths were classified and correlated with the methods evaluated for validation. The intra- and inter-examiner reliability (sensitivity, specificity) and reproducibility of all examination methods were calculated using a weighted Cohen's κ statistic. The correlation between the examination methods was determined using receiver operating characteristic (ROC) analysis indicating the area under the curve (AUC). CBCT exhibited excellent intra-examiner (0.76 for examiner 1, 0.78 for examiner 2) and fair to good inter-examiner (0.63 for the first, 0.64 for the second measurements) reproducibility. The intra-examiner reproducibility was excellent for the LFE method according to the weighted κ values of examiners 1 (0.90) and 2 (0.79). Among the combined methods, the highest AUC values (0.81-0.95) were obtained for the CBCT examination method performed by the two examiners at both the first and second measurements. Cone beam computed tomography showed better performance than other diagnostic methods.

  17. Evaluation of Accuracy of DIAGNOdent in Diagnosis of Primary and Secondary Caries in Comparison to Conventional Methods

    Science.gov (United States)

    Nokhbatolfoghahaie, Hanieh; Alikhasi, Marzieh; Chiniforush, Nasim; Khoei, Farzaneh; Safavi, Nassimeh; Yaghoub Zadeh, Behnoush

    2013-01-01

    Introduction: Today the prevalence of teeth decays has considerably decreased. Related organizations and institutions mention several reasons for it such as improvement of decay diagnostic equipment and tools which are even capable of detecting caries in their initial stages. This resulted in reduction of costs for patients and remarkable increase in teeth life span. There are many methods for decay diagnostic, like: visual and radiographic methods, devices with fluorescence such as Quantitative light-induced fluorescence (QLF), Vista proof, Laser fluorescence (LF or DIAGNOdent), Fluorescence Camera (FC) and Digital radiography. Although DIAGNOdent is considered a valuable device for decay diagnostic ,there are concerns regarding its efficacy and accuracy. Considering the sensitivity of decaydiagnosis and the exorbitant annual expenses supported by government and people for caries treatment, finding the best method for early caries detection is of the most importance. Numerous studies were performed to compare different diagnostic methods with conflicting results. The objective of this study is a comparative review of the efficiency of DIAGNOdent in comparison to visual methods and radiographic methods in the diagnostic of teeth occlusal surfaces. Methods: Search of PubMed, Google Scholar electronic resources was performed in order to find clinical trials in English in the period between 1998 and 2013. Full texts of only 35 articles were available. Conclusion: Considering the sensitivity and specificity reported in the different studies, it seems that DIAGNOdent is an appropriate modality for caries detection as a complementary method beside other methods and its use alone to obtain treatment plan is not enough. PMID:25606325

  18. Capillary meniscus dynamometry—method for determining the surface tension of drops and bubbles with isotropic and anisotropic surface stress distributions.

    Science.gov (United States)

    Danov, Krassimir D; Stanimirova, Rumyana D; Kralchevsky, Peter A; Marinova, Krastanka G; Alexandrov, Nikola A; Stoyanov, Simeon D; Blijdenstein, Theodorus B J; Pelan, Eddie G

    2015-02-15

    The stresses acting in interfacial adsorption layers with surface shear elasticity are, in general, anisotropic and non-uniform. If a pendant drop or buoyant bubble is covered with such elastic layer, the components of surface tension acting along the "meridians" and "parallels", σ(s) and σ(φ), can be different and, then, the conventional drop shape analysis (DSA) is inapplicable. Here, a method for determining σ(s) and σ(φ) is developed for axisymmetric menisci. This method, called 'capillary meniscus dynamometry' (CMD), is based on processing data for the digitized drop/bubble profile and capillary pressure. The principle of the CMD procedure for data processing is essentially different from that of DSA. Applying the tangential and normal surface stress balance equations, σ(s) and σ(φ) are determined in each interfacial point without using any rheological model. The computational procedure is fast and could be used in real time, during a given process. The method is applied to determine σ(s) and σ(φ) for bubbles and drops formed on the tip of a capillary immersed in solutions of the protein HFBII hydrophobin. Upon a surface compression, meridional wrinkles appear on the bubble surface below the bubble "equator", where the azimuthal tension σ(φ) takes negative values. The CMD method allows one to determine the local tensions acting in anisotropic interfacial layers (films, membranes), like those formed from proteins, polymers, asphaltenes and phospholipids. The CMD is applicable also to fluid interfaces (e.g. surfactant solutions), for which it gives the same surface tension as the conventional methods. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Delta self-consistent field method to obtain potential energy surfaces of excited molecules on surfaces

    DEFF Research Database (Denmark)

    Gavnholt, Jeppe; Olsen, Thomas; Engelund, Mads

    2008-01-01

    is a density-functional method closely resembling standard density-functional theory (DFT), the only difference being that in Delta SCF one or more electrons are placed in higher lying Kohn-Sham orbitals instead of placing all electrons in the lowest possible orbitals as one does when calculating the ground......-photoemission spectroscopy measurements. This comparison shows that the modified Delta SCF method gives results in close agreement with experiment, significantly closer than the comparable methods. For N2 adsorbed on ruthenium (0001) we map out a two-dimensional part of the potential energy surfaces in the ground state...

  20. Serological responses to Cryptosporidium antigens in inhabitants of Hungary using conventionally filtered surface water and riverbank filtered drinking water.

    Science.gov (United States)

    Farkas, K; Plutzer, J; Moltchanova, E; Török, A; Varró, M J; Domokos, K; Frost, F; Hunter, P R

    2015-10-01

    In this study the putative protective seroprevalence (PPS) of IgG antibodies to the 27-kDa and 15/17-kDa Cryptosporidium antigens in sera of healthy participants who were and were not exposed to Cryptosporidium oocysts via surface water-derived drinking water was compared. The participants completed a questionnaire regarding risk factors that have been shown to be associated with infection. The PPS was significantly greater (49-61%) in settlements where the drinking water originated from surface water, than in the control city where riverbank filtration was used (21% and 23%). Logistic regression analysis on the risk factors showed an association between bathing/swimming in outdoor pools and antibody responses to the 15/17-kDa antigen complex. Hence the elevated responses were most likely due to the use of contaminated water. Results indicate that waterborne Cryptosporidium infections occur more frequently than reported but may derive from multiple sources.

  1. TWO METHODS FOR REMOTE ESTIMATION OF COMPLETE URBAN SURFACE TEMPERATURE

    Directory of Open Access Journals (Sweden)

    L. Jiang

    2017-09-01

    Full Text Available Complete urban surface temperature (TC is a key parameter for evaluating the energy exchange between the urban surface and atmosphere. At the present stage, the estimation of TC still needs detailed 3D structure information of the urban surface, however, it is often difficult to obtain the geometric structure and composition of the corresponding temperature of urban surface, so that there is still lack of concise and efficient method for estimating the TC by remote sensing. Based on the four typical urban surface scale models, combined with the Envi-met model, thermal radiant directionality forward modeling and kernel model, we analyzed a complete day and night cycle hourly component temperature and radiation temperature in each direction of two seasons of summer and winter, and calculated hemispherical integral temperature and TC. The conclusion is obtained by examining the relationship of directional radiation temperature, hemispherical integral temperature and TC: (1 There is an optimal angle of radiation temperature approaching the TC in a single observation direction when viewing zenith angle is 45–60°, the viewing azimuth near the vertical surface of the sun main plane, the average absolute difference is about 1.1 K in the daytime. (2 There are several (3–5 times directional temperatures of different view angle, under the situation of using the thermal radiation directionality kernel model can more accurately calculate the hemispherical integral temperature close to TC, the mean absolute error is about 1.0 K in the daytime. This study proposed simple and effective strategies for estimating TC by remote sensing, which are expected to improve the quantitative level of remote sensing of urban thermal environment.

  2. Two Methods for Remote Estimation of Complete Urban Surface Temperature

    Science.gov (United States)

    Jiang, L.; Zhan, W.; Zou, Z.

    2017-09-01

    Complete urban surface temperature (TC) is a key parameter for evaluating the energy exchange between the urban surface and atmosphere. At the present stage, the estimation of TC still needs detailed 3D structure information of the urban surface, however, it is often difficult to obtain the geometric structure and composition of the corresponding temperature of urban surface, so that there is still lack of concise and efficient method for estimating the TC by remote sensing. Based on the four typical urban surface scale models, combined with the Envi-met model, thermal radiant directionality forward modeling and kernel model, we analyzed a complete day and night cycle hourly component temperature and radiation temperature in each direction of two seasons of summer and winter, and calculated hemispherical integral temperature and TC. The conclusion is obtained by examining the relationship of directional radiation temperature, hemispherical integral temperature and TC: (1) There is an optimal angle of radiation temperature approaching the TC in a single observation direction when viewing zenith angle is 45-60°, the viewing azimuth near the vertical surface of the sun main plane, the average absolute difference is about 1.1 K in the daytime. (2) There are several (3-5 times) directional temperatures of different view angle, under the situation of using the thermal radiation directionality kernel model can more accurately calculate the hemispherical integral temperature close to TC, the mean absolute error is about 1.0 K in the daytime. This study proposed simple and effective strategies for estimating TC by remote sensing, which are expected to improve the quantitative level of remote sensing of urban thermal environment.

  3. Sectional localization of a small hepatocellular carcinoma in the right hepatic lobe by computed tomography: Comparison between the conventional and portal vein tracing methods

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Chun-Gao [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); The First Affiliated Hospital of Nanjing Medical University, Department of Interventional Radiology, Nanjing (China); Chung, Jin Wook; Hur, Saebeom; Lee, Myungsu; Kim, Hyo-Cheol; Jae, Hwan Jun; Yin, Yong-Hu; Kim, Young Il [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); Ahn, Sang-bu [Dongnam Institution of Radiological and Medical Sciences, Department of Radiology, Busan (Korea, Republic of); Cho, Baik Hwan [Chonbuk National University Hospital, Department of Radiology, Jeonju (Korea, Republic of)

    2016-12-15

    To compare the accuracy of the conventional and portal vein tracing methods in the right hepatic lobe in multidetector computed tomography (MDCT). This retrospective study included patients with hepatocellular carcinoma (HCC) lesions in the right hepatic lobe who underwent multiphasic MDCT and C-arm CT hepatic arteriography (C-arm CTHA) for chemoembolization. The accuracies of the conventional and portal vein tracing methods were evaluated using C-arm CTHA as the gold standard. A total of 147 patients with 205 HCC nodules were included. The C-arm CTHA could identify all the tumour-feeding arteries and consequently demonstrated that 120 lesions were located in the anterior section, 78 in the posterior section, and 7 in the border zone. The accuracy rates of conventional vs. portal vein tracing methods were 71.7 % vs. 98.3 % for the anterior section lesions, 67.9 % vs. 96.2 % for the posterior section, and 28.6 % vs. 57.1 % for the border zone. The portal vein tracing method was more accurate than the conventional method (P<0.001). The portal vein tracing method should be used for sectional localization of HCCs in the right lobe, because it predicts the location more accurately than the conventional method. (orig.)

  4. Non thermal plasma surface cleaner and method of use

    KAUST Repository

    Neophytou, Marios

    2017-09-14

    Described herein are plasma generation devices and methods of use of the devices. The devices can be used for the cleaning of various surfaces and/or for inhibiting or preventing the accumulation of particulates, such as dust, or moisture on various surfaces. The devices can be used to remove dust and other particulate contaminants from solar panels and windows, or to avoid or minimize condensation on various surfaces. In an embodiment a plasma generation device is provided. The plasma generation device can comprise: a pair of electrodes (1,2) positioned in association with a surface of a dielectric substrate (3). The pair of electrodes (1,2) can comprise a first electrode (1) and a second electrode (2). The first electrode and second electrode can be of different sizes, one of the electrodes being smaller than the other of the electrodes. The first electrode and second electrode can be separated by a distance and electrically connected to a voltage source (4,5).

  5. En-face optical coherence tomography as a novel tool for exploring the ocular surface: a pilot comparative study to conventional B-scans and in vivo confocal microscopy.

    Science.gov (United States)

    Tahiri Joutei Hassani, Rachid; Liang, Hong; El Sanharawi, Mohamed; Brasnu, Emmanuelle; Kallel, Sofiene; Labbé, Antoine; Baudouin, Christophe

    2014-10-01

    To explore the potential of spectral-domain optical coherence tomography (SD-OCT) using the en-face technology for the imaging of ocular surface diseases and to correlate the findings with in vivo confocal microscopy (IVCM) images. 113 eyes of 75 subjects with various ocular surface diseases were investigated with the RTVue(®) anterior-segment en face OCT. En face OCT images were compared to B-scan OCT and IVCM images. Patients with corneal dystrophies, corneal deposits, keratitis, pterygium, conjunctivochalasis, or ocular surface squamous neoplasia and patients who underwent lamellar corneal surgeries were included. En-face OCT images showed ocular surface tissue changes that were not discernible using conventional B-scan OCT. Nevertheless, there was a good correlation with IVCM analysis. Compared with IVCM, the major advantages of en-face OCT included easy operation and rapid image acquisition, with minimal operator experience required. In addition, the non-contact method avoided patient discomfort and external pressure on the globe, which was especially useful in patients with corneal dystrophies, ulcers, or corneal abscesses. Although the resolution of en-face OCT was lower than that of IVCM, it allowed useful overall visualization of corneal lesions due to the larger areas analyzed. En-face SD-OCT is a novel, valuable tool to assess a wide variety of ocular surface diseases. It can provide additional information and new insight into different ocular surface conditions with no corneal contact. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Physical and chemical characterization methods of surfaces and interfaces; Methodes de caracterisation physico-chimique des surfaces et des interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Barthes-Labrousse, M.G. [Centre d`Etudes de Chimie Metallurgique, 94 - Vitry-sur-Seine (France)

    1997-12-31

    The main physical and chemical characterization techniques of surfaces and interfaces are presented. There are: Auger electron spectroscopy, photoelectron spectroscopies (XPS and UPS), secondary ions mass spectroscopy (SIMS), infrared and Raman spectroscopies, electron energy loss spectroscopy (EELS and HREELS) and atomic force microscopy (AFM). For each method is given the theoretical principle, the apparatus and the main uses of the techniques. (O.M.) 27 refs.

  7. Surface charge method for molecular surfaces with curved areal elements I. Spherical triangles

    Science.gov (United States)

    Yu, Yi-Kuo

    2018-03-01

    Parametrizing a curved surface with flat triangles in electrostatics problems creates a diverging electric field. One way to avoid this is to have curved areal elements. However, charge density integration over curved patches appears difficult. This paper, dealing with spherical triangles, is the first in a series aiming to solve this problem. Here, we lay the ground work for employing curved patches for applying the surface charge method to electrostatics. We show analytically how one may control the accuracy by expanding in powers of the the arc length (multiplied by the curvature). To accommodate not extremely small curved areal elements, we have provided enough details to include higher order corrections that are needed for better accuracy when slightly larger surface elements are used.

  8. Quasimonochromatic x-ray computed tomography by the balanced filter method using a conventional x-ray source

    International Nuclear Information System (INIS)

    Saito, Masatoshi

    2004-01-01

    A quasimonochromatic x-ray computed tomography (CT) system utilizing balanced filters has recently been developed for acquiring quantitative CT images. This system consisted of basic components such as a conventional x-ray generator for radiography, a stage for mounting and rotating objects, and an x-ray line sensor camera. Metallic sheets of Er and Yb were used as the balanced filters for obtaining quasimonochromatic incident x rays that include the characteristic lines of the W Kα doublet from a tungsten target. The mean energy and energy width of the quasimonochromatic x rays were determined to be 59.0 and 1.9 keV, respectively, from x-ray spectroscopic measurements using a high-purity Ge detector. The usefulness of the present x-ray CT system was demonstrated by obtaining spatial distributions of the linear attenuation coefficients of three selected samples--a 20 cm diameter cylindrical water phantom, a 3.5 cm diameter aluminum rod, and a human head phantom. The results clearly indicate that this apparatus is surprisingly effective for estimating the distribution of the linear attenuation coefficients without any correction of the beam-hardening effect. Thus, implementing the balanced filter method on an x-ray CT scanner has promise in producing highly quantitative CT images

  9. Comparison of Microleakage of Glass Ionomer Restoration in Primary Teeth Prepared by Er: YAG Laser and the Conventional Method

    Directory of Open Access Journals (Sweden)

    M. Ghandehari

    2012-01-01

    Full Text Available Objective: One of the main criteria in evaluating the restorative materials is the degree of microleakage. The aim of this study was to compare the microleakage of glass ionomer restored cavities prepared by Er:YAG laser or turbine and bur.Materials and Methods: Twenty extracted caries-free deciduous posterior teeth were selected for this study. The teeth were randomly divided into two groups for cavity preparation. Cavities in group one were prepared by high speed turbine and bur. In the second group, Er:YAG laser with a 3W output power, 300 mJ energy and 10 Hz frequency was used. Cavities were restored with GC Fuji II LC. After thermocycling, the samples were immersed into 0.5% methylene blue solution. They were sectioned for examination under optic microscope.Results: The Wilcoxon signed ranks test showed no significant difference between microleakage of the laser group and the conventional group (P>0.05.Conclusion: Er:YAG laser with its advantages in pediatric dentistry may be suggested as an alternative device for cavity preparation.Key Words: Er:YAG laser, Glass ionomer, Microleakage

  10. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth#

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-01-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%). PMID:27604860

  11. A new method for patterning azopolymer thin film surfaces

    Science.gov (United States)

    Sorkhabi, Sh. Golghasemi; Barille, R.; Ahmadi-Kandjani, S.; Zielinska, S.; Ortyl, E.

    2017-04-01

    We present a simple bottom-up approach via an incoherent unpolarized illumination and the choice of a solvent-droplet-induced-dewetting method to photoinduce nano doughnuts on the surface of azopolymer thin films. We demonstrate that doughnut-shaped nanostructures can be formed and tailored with a wide range of typical sizes, thus providing a rich field of applications using surface photo-patterning. Furthermore, due to the presence of highly photoactive azobenzene derivative in the material, illumination of these nanostructures by a polarized laser light shows the possibility of a further growth and reshaping opening the way for fundamental studies of size-dependent scaling laws of optical properties and possible fabrication of nano-reactor or nano-trap patterns.

  12. Economic method for helical gear flank surface characterisation

    Science.gov (United States)

    Koulin, G.; Reavie, T.; Frazer, R. C.; Shaw, B. A.

    2018-03-01

    Typically the quality of a gear pair is assessed based on simplified geometric tolerances which do not always correlate with functional performance. In order to identify and quantify functional performance based parameters, further development of the gear measurement approach is required. Methodology for interpolation of the full active helical gear flank surface, from sparse line measurements, is presented. The method seeks to identify the minimum number of line measurements required to sufficiently characterise an active gear flank. In the form ground gear example presented, a single helix and three profile line measurements was considered to be acceptable. The resulting surfaces can be used to simulate the meshing engagement of a gear pair and therefore provide insight into functional performance based parameters. Therefore the assessment of the quality can be based on the predicted performance in the context of an application.

  13. Narrowing of the middle cerebral artery: artificial intelligence methods and comparison of transcranial color coded duplex sonography with conventional TCD.

    Science.gov (United States)

    Swiercz, Miroslaw; Swiat, Maciej; Pawlak, Mikolaj; Weigele, John; Tarasewicz, Roman; Sobolewski, Andrzej; Hurst, Robert W; Mariak, Zenon D; Melhem, Elias R; Krejza, Jaroslaw

    2010-01-01

    The goal of the study was to compare performances of transcranial color-coded duplex sonography (TCCS) and transcranial Doppler sonography (TCD) in the diagnosis of the middle cerebral artery (MCA) narrowing in the same population of patients using statistical and nonstatistical intelligent models for data analysis. We prospectively collected data from 179 consecutive routine digital subtraction angiography (DSA) procedures performed in 111 patients (mean age 54.17+/-14.4 years; 59 women, 52 men) who underwent TCD and TCCS examinations simultaneously. Each patient was examined independently using both ultrasound techniques, 267 M1 segments of MCA were assessed and narrowings were classified as 50% lumen reduction. Diagnostic performance was estimated by two statistical and two artificial neural networks (ANN) classification methods. Separate models were constructed for the TCD and TCCS sonographic data, as well as for detection of "any narrowing" and "severe narrowing" of the MCA. Input for each classifier consisted of the peak-systolic, mean and end-diastolic velocities measured with each sonographic method; the output was MCA narrowing. Arterial narrowings less or equal 50% of lumen reduction were found in 55 and >50% narrowings in 26 out of 267 arteries, as indicated by DSA. In the category of "any narrowing" the rate of correct assignment by all models was 82% to 83% for TCCS and 79% to 81% for TCD. In the diagnosis of >50% narrowing the overall classification accuracy remained in the range of 89% to 90% for TCCS data and 90% to 91% for TCD data. For the diagnosis of any narrowing, the sensitivity of the TCCS was significantly higher than that of the TCD, while for diagnosis of >50% MCA narrowing, sensitivity of the TCCS was similar to sensitivity of the TCD. Our study showed that TCCS outperforms conventional TCD in detection of 50% MCA narrowing. (E-mail: jaroslaw.krejza@uphs.upenn.edu).

  14. An experimental method for making spectral emittance and surface temperature measurements of opaque surfaces

    International Nuclear Information System (INIS)

    Moore, Travis J.; Jones, Matthew R.; Tree, Dale R.; Daniel Maynes, R.; Baxter, Larry L.

    2011-01-01

    An experimental procedure has been developed to make spectral emittance and temperature measurements. The spectral emittance of an object is calculated using measurements of the spectral emissive power and of the surface temperature of the object obtained using a Fourier transform infrared (FTIR) spectrometer. A calibration procedure is described in detail which accounts for the temperature dependence of the detector. The methods used to extract the spectral emissive power and surface temperature from measured infrared spectra were validated using a blackbody radiator at known temperatures. The average error in the measured spectral emittance was 2.1% and the average difference between the temperature inferred from the recorded spectra and the temperature indicated on the blackbody radiator was 1.2%. The method was used to measure the spectral emittance of oxidized copper at various temperatures.

  15. Optimizing pressurized liquid extraction of microbial lipids using the response surface method.

    Science.gov (United States)

    Cescut, J; Severac, E; Molina-Jouve, C; Uribelarrea, J-L

    2011-01-21

    Response surface methodology (RSM) was used for the determination of optimum extraction parameters to reach maximum lipid extraction yield with yeast. Total lipids were extracted from oleaginous yeast (Rhodotorula glutinis) using pressurized liquid extraction (PLE). The effects of extraction parameters on lipid extraction yield were studied by employing a second-order central composite design. The optimal condition was obtained as three cycles of 15 min at 100°C with a ratio of 144 g of hydromatrix per 100 g of dry cell weight. Different analysis methods were used to compare the optimized PLE method with two conventional methods (Soxhlet and modification of Bligh and Dyer methods) under efficiency, selectivity and reproducibility criteria thanks to gravimetric analysis, GC with flame ionization detector, High Performance Liquid Chromatography linked to Evaporative Light Scattering Detector (HPLC-ELSD) and thin-layer chromatographic analysis. For each sample, the lipid extraction yield with optimized PLE was higher than those obtained with referenced methods (Soxhlet and Bligh and Dyer methods with, respectively, a recovery of 78% and 85% compared to PLE method). Moreover, the use of PLE led to major advantages such as an analysis time reduction by a factor of 10 and solvent quantity reduction by 70%, compared with traditional extraction methods. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. Comparative study on combined co-pyrolysis/gasification of walnut shell and bituminous coal by conventional and congruent-mass thermogravimetric analysis (TGA) methods.

    Science.gov (United States)

    Zhang, Yan; Fan, Di; Zheng, Yan

    2016-01-01

    Combined co-pyrolysis/gasification of bituminous coal (BC) and walnut shell (WS) are comparatively studied with both conventional and congruent-mass thermogravimertric analysis (TGA) methods. The results indicate that BC and WS exhibit additivity in the co-pyrolysis step. However, the gasification reactivity of chars in subsequent gasification step exhibits remarkable sample-mass dependence, which causes the illusions in synergy and inhibition effects when conventional TGA tests are conducted. A congruent-mass TGA method has been developed to overcome the limitations of the conventional TGA mode. One of the advantages of this method is that it can reduce to a minimum the effect of sample mass on reactivity. Thus, the degree of synergy or inhibition can be directly estimated from the deviation of the experimental TG curves between the two separated and blended samples. We recommend this method in studying the co-processing behavior between coal and biomass. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Roman sophisticated surface modification methods to manufacture silver counterfeited coins

    Science.gov (United States)

    Ingo, G. M.; Riccucci, C.; Faraldi, F.; Pascucci, M.; Messina, E.; Fierro, G.; Di Carlo, G.

    2017-11-01

    By means of the combined use of X-ray photoelectron spectroscopy (XPS), optical microscopy (OM) and scanning electron microscopy (SEM) coupled with energy dispersive X-ray spectroscopy (EDS) the surface and subsurface chemical and metallurgical features of silver counterfeited Roman Republican coins are investigated to decipher some aspects of the manufacturing methods and to evaluate the technological ability of the Roman metallurgists to produce thin silver coatings. The results demonstrate that over 2000 ago important advances in the technology of thin layer deposition on metal substrates were attained by Romans. The ancient metallurgists produced counterfeited coins by combining sophisticated micro-plating methods and tailored surface chemical modification based on the mercury-silvering process. The results reveal that Romans were able systematically to chemically and metallurgically manipulate alloys at a micro scale to produce adherent precious metal layers with a uniform thickness up to few micrometers. The results converge to reveal that the production of forgeries was aimed firstly to save expensive metals as much as possible allowing profitable large-scale production at a lower cost. The driving forces could have been a lack of precious metals, an unexpected need to circulate coins for trade and/or a combinations of social, political and economic factors that requested a change in money supply. Finally, some information on corrosion products have been achieved useful to select materials and methods for the conservation of these important witnesses of technology and economy.

  18. Methods on estimation of the evaporation from water surface

    International Nuclear Information System (INIS)

    Trajanovska, Lidija; Tanushevska, Dushanka; Aleksovska, Nina

    2001-01-01

    The whole world water supply on the Earth is in close dependence on hydrological cycle connected with water circulation at Earth-Atmosphere route through evaporation, precipitation and water runoff. Evaporation exists worldwide where the atmosphere is unsatiated of water steam (when there is humidity in short supply) and it depends on climatic conditions in some regions. The purpose of this paper is to determine a method for estimation of evaporation of natural water surface in our areas, that means its determination as exact as possible. (Original)

  19. Novel method for the simultaneous estimation of density and surface tension of liquids

    International Nuclear Information System (INIS)

    Thirunavukkarasu, G.; Srinivasan, G.J.

    2003-01-01

    The conventional Hare's apparatus generally used for the determination of density of liquids has been modified by replacing its vertical arms (glass tubes) with capillary tubes of 30 cm length and 0.072 cm diameter. When the columns of liquids are drawn through the capillary tubes with reduced pressure at the top of the liquid columns and kept at equilibrium with the atmospheric pressure acting on the liquid surface outside the capillary tubes, the downward pressure due to gravity of the liquid columns has to be coupled with the pressure arising due to the effect of surface tension of the liquids. A fresh expression for the density and surface tension of liquids has been arrived at while equating the pressure balancing system for the two individual liquid columns of the modified Hare's apparatus. The experimental results showed that the proposed method is precise and accurate in the simultaneous estimation of density and surface tension of liquids, with an error of less than 5%

  20. Evaluation of surface renewal and flux-variance methods above agricultural and forest surfaces

    Science.gov (United States)

    Fischer, M.; Katul, G. G.; Noormets, A.; Poznikova, G.; Domec, J. C.; Trnka, M.; King, J. S.

    2016-12-01

    Measurements of turbulent surface energy fluxes are of high interest in agriculture and forest research. During last decades, eddy covariance (EC), has been adopted as the most commonly used micrometeorological method for measuring fluxes of greenhouse gases, energy and other scalars at the surface-atmosphere interface. Despite its robustness and accuracy, the costs of EC hinder its deployment at some research experiments and in practice like e.g. for irrigation scheduling. Therefore, testing and development of other cost-effective methods is of high interest. In our study, we tested performance of surface renewal (SR) and flux variance method (FV) for estimates of sensible heat flux density. Surface renewal method is based on the concept of non-random transport of scalars via so-called coherent structures which if accurately identified can be used for the computing of associated flux. Flux variance method predicts the flux from the scalar variance following the surface-layer similarity theory. We tested SR and FV against EC in three types of ecosystem with very distinct aerodynamic properties. First site was represented by agricultural wheat field in the Czech Republic. The second site was a 20-m tall mixed deciduous wetland forest on the coast of North Carolina, USA. The third site was represented by pine-switchgrass intercropping agro-forestry system located in coastal plain of North Carolina, USA. Apart from solving the coherent structures in a SR framework from the structure functions (representing the most common approach), we applied ramp wavelet detection scheme to test the hypothesis that the duration and amplitudes of the coherent structures are normally distributed within the particular 30-minutes time intervals and so just the estimates of their averages is sufficient for the accurate flux determination. Further, we tested whether the orthonormal wavelet thresholding can be used for isolating of the coherent structure scales which are associated with

  1. Comparison of dimensionality reduction methods for wood surface inspection

    Science.gov (United States)

    Niskanen, Matti; Silven, Olli

    2003-04-01

    Dimensionality reduction methods for visualization map the original high-dimensional data typically into two dimensions. Mapping preserves the important information of the data, and in order to be useful, fulfils the needs of a human observer. We have proposed a self-organizing map (SOM)- based approach for visual surface inspection. The method provides the advantages of unsupervised learning and an intuitive user interface that allows one to very easily set and tune the class boundaries based on observations made on visualization, for example, to adapt to changing conditions or material. There are, however, some problems with a SOM. It does not address the true distances between data, and it has a tendency to ignore rare samples in the training set at the expense of more accurate representation of common samples. In this paper, some alternative methods for a SOM are evaluated. These methods, PCA, MDS, LLE, ISOMAP, and GTM, are used to reduce dimensionality in order to visualize the data. Their principal differences are discussed and performances quantitatively evaluated in a few special classification cases, such as in wood inspection using centile features. For the test material experimented with, SOM and GTM outperform the others when classification performance is considered. For data mining kinds of applications, ISOMAP and LLE appear to be more promising methods.

  2. Polymer surface modification using UV treatment for attachment of natamycin and the potential applications for conventional food cling wrap (LDPE)

    Science.gov (United States)

    Shin, Joongmin; Liu, Xiaojing; Chikthimmah, Naveen; Lee, Youn Suk

    2016-11-01

    The purpose of this study was to develop an active non-migratory antifungal Low Density Polyethylene (LDPE) polymer for use in food packaged applications. The functional acrylic acid monomer was grafted on the LDPE film surface by photo-initiated graft polymerization using Ultra Violet light irradiation (from 0 to 5 min). Natamycin, an antifungal agent, was applied to the treated film to bind with the pendent functional groups and were evaluated its performance against mold and yeast. The grafted amounts were determined by gravimetric measurement and dye absorbance. Attenuated Total Reflectance/Fourier Transfer Infrared Spectroscopy, scanning electron microscopy, mechanical strength test was used to characterize film properties. The antifungal efficacy of the film was evaluated with Saccharomyces cerevisiae and Penicillium chrysogenum on growth media and fresh cut cantaloupe. The amounts of the grafted group were increased with the longer ultraviolet exposure time. The amount of the grafted natamycin on the treated film was up to 49.87 μg/cm2, and the film inhibited mycelium formation of P. chrysogenum spores by over 60%. Due to the thickness of the film (less than 12.25 μm), long time UV exposure decrease the film's mechanical strength. The application of such non-migratory active packaging film represents a promising approach to maintaining food quality with reduced additive.

  3. A new surface resistance measurement method with ultrahigh sensitivity

    International Nuclear Information System (INIS)

    Liang, Changnian.

    1993-01-01

    A superconducting niobium triaxial cavity has been designed and fabricated to study residual surface resistance of planar superconducting materials. The edge of a 25.4 mm or larger diameter sample in the triaxial cavity is located outside the strong field region. Therefore, the edge effects and possible losses between the thin film and the substrate have been minimized, ensuring that induced RF losses are intrinsic to the test material. The fundamental resonant frequency of the cavity is the same as the working frequency of CEBAF cavities. The cavity has a compact size compared to its TE 011 counterpart, which makes it more sensitive to the sample's loss. For even higher sensitivity, a calorimetry method has been used to measure the RF losses on the superconducting sample. At 2 K, a 2 μK temperature change can be resolved by using carbon resistor sensors. The temperature distribution caused by RF heating is measured by 16 carbon composition resistor sensors. A 0.05 μW heating power can be detected as such a resolution, which translates to a surface resistance of 0.02 nΩ at a surface magnetic field of 52 Oe. This is the most sensitive device for surface resistance measurements to date. In addition, losses due to the indium seal, coupling probes, field emission sites other than the sample, and all of the high field resonator surface, are excluded in the measurement. Surface resistance of both niobium and high-Tc superconducting thin films has been measured. A low R s of 35.2 μΩ was measured for a 25.4 mm diameter YBa 2 Cu 3 O 7 thin film at 1.5 GHz and at 2 K. The measurement result is the first result for a large area epitaxially grown thin film sample at such a low RF frequency. The abrupt disappearance of multipacting between two parallel plates has been observed and monitored with the 16 temperature mapping sensors. Field emission or some field dependent anomalous RF losses on the niobium plate have also been observed

  4. Evolution of the indigenous microbiota in modified atmosphere packaged Atlantic horse mackerel (Trachurus trachurus) identified by conventional and molecular methods.

    Science.gov (United States)

    Alfaro, Begoña; Hernandez, Igor

    2013-10-15

    A combination of conventional methods and genetic identification (PCR sequencing) was used to study the dynamics of the bacterial population during the spoilage of modified atmosphere packaged (MAP) Atlantic horse mackerel (Trachurus trachurus) fillets. The cultivable microflora in Atlantic horse mackerel samples packaged in a modified atmosphere (48% CO2, 50% N2 and 2% O2) at refrigeration temperature (6 °C) was measured on days 1, 5 and 7 using non-selective (Long and Hammer agar) and selective media (Kligler's iron agar, STAA and MRS). The microflora was genetically characterised using partial amplification of 16S rRNA gene sequences from 309 bacterial isolates obtained from Long and Hammer agar. At the end of the shelf life (5 days), the total viable counts (TVC) on Long and Hammer agar were not significantly different to the LAB counts on MRS agar (p>0.05). The molecular approach showed that Photobacterium, Arthrobacter, Chryseobacterium and Pseudoclavibacter (44.5% of total) dominated the microbial composition of the fish at the beginning of storage. However, Serratia, Shewanella and Yersinia dominated at the late spoilage stages (over 57.2% of the total). Carnobacterium was the most important species of the lactic acid bacteria (LAB) and was identified at the beginning and end of the storage period. Vibrio spp. was only found at the end of the shelf life. This research demonstrates that the microbial biodiversity in MAP Atlantic horse mackerel is enormous and the dominant species change over the storage time. The results presented here on the dominant communities in fish products will make it possible to accurately select the best preservation practices. © 2013.

  5. Evaluation of Surface Treatment Methods on the Bond Strength of Zirconia Ceramics Systems, Resin Cements and Tooth Surface

    Directory of Open Access Journals (Sweden)

    Akkuş Emek

    2015-07-01

    Full Text Available Objectives: To compare the effects of airborne-particle abrasion (APA and tribochemical silica coating (TSC surface treatment methods on the shear bond strength of zirconia ceramics systems, resin cements and tooth surface

  6. A plateau-valley separation method for multifunctional surfaces characterization

    DEFF Research Database (Denmark)

    Godi, Alessandro; Kühle, A.; De Chiffre, Leonardo

    2012-01-01

    Turned multifunctional surfaces are a new typology of textured surfaces presenting a flat plateau region and deterministically distributed lubricant reservoirs. Existing standards are not suitable for the characterization of such surfaces, providing at times values without physical meaning. A new...

  7. A METHOD FOR POST-TREATMENT OF AN ARTICLE WITH A METALLIC SURFACE AS WELL AS A TREATMENT SOLUTION TO BE USED IN THE METHOD

    DEFF Research Database (Denmark)

    1993-01-01

    A method and a treatment solution for post-treatment of an article with a metallic surface, where the metallic surface is made of one or more metals of a standard oxidation potential within the range -2.5 to +0.5 V. A thin coating is formed on the metallic surface by a treatment with an aqueous...... conditions where the metal surface is maintained at a potential within the range of -600 and -1800 mV/nhe. A corrosion-protecting and/or decorative effect is obtained which can be compared with the effect obtained by conventional chromate treatment, and which avoids the environmental and toxicologic...... solution containing a molybdenum compound selected among molybdic acid and salts thereof in a concentration of 2.9 to 9.8 g/l calculated as molybdenum, as well as a compound capable of forming a heteropolymolybdate, such as phosphoric acid, together with a molybdate. The treatment is performed under...

  8. Guidelines for the verification and validation of expert system software and conventional software: Volume 2, Survey and assessment of conventional software verification and validation methods Revision 1, Final report

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.H.; Hayes, J.E.; Mirsky, S.M.

    1995-05-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit Metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  9. Dumping convention

    International Nuclear Information System (INIS)

    Roche, P.

    1992-01-01

    Sea dumping of radioactive waste has, since 1983, been precluded under a moratorium established by the London Dumping Convention. Pressure from the nuclear industry to allow ocean dumping of nuclear waste is reported in this article. (author)

  10. Comparison Of INAA Methods (Long Conventional, Cyclic And Pseudo-Cyclic) For The Determination Of Se In Biological Samples

    International Nuclear Information System (INIS)

    Sarheel, A.

    2004-01-01

    Selenium content in serum blood, sample were received from international comparison programme (SABC) has been determined by Cyclic irradiation, pseudo-cyclic irradiation and long irradiation conventional Instrumental neutron activation analysis through the 162 keV gamma ray of the 77m Se nuclide for both cyclic and pseudo-cyclic and 264 keV gamma ray of 75 Se nuclide for conventional (long irradiation). The CINAA involve irradiation of samples for 20 s, decay for 15 s and counting for 20 s, samples recycling four times to improve the precision. The PCINAA involve irradiation of samples for 20 s, decay for 20 s and counting for 30s, samples recycling four times day by day. The Conventional (long irradiation) involve irradiation of samples for 20 hr (1 week), decay for 4 weeks and counting for 20 hr. The accuracy has been evaluated by analyzing the certified reference materials. (Author)

  11. Efficacious and safe orotracheal intubation for laboratory mice using slim torqueable guidewire-based technique: comparisons between a modified and a conventional method.

    Science.gov (United States)

    Su, Chieh-Shou; Lai, Hui-Chin; Wang, Chih-Yen; Lee, Wen-Lieng; Wang, Kuo-Yang; Yang, Ya-Ling; Wang, Li-Chun; Liu, Chia-Ning; Liu, Tsun-Jui

    2016-01-18

    Tracheal intubation of laboratory mice remains essential yet challenging for most researchers. The aim of this study was to investigate whether this procedure can be more efficiently and safely accomplished by a novel method using slim and torqueable guidewires to guide access to the trachea. This study was carried out in an animal laboratory affiliated to a tertiary medical center. Mice weighing 22 to 28 g were subjected to various open-chest experiments after being anesthetized with intraperitoneal ketamine (100 mg/kg) and lidocaine hydrochloride (10 mg/kg). The oropharyngeal cavity was opened with angled tissue forceps, and the trachea was transilluminated using an external light. The vocal cords were then crossed using either the Conventional method with a 38-mm-long, end-blunted stiff needle as a guide for insertion of a 22-gauge, 25-mm-long intravenous catheter into the trachea, or the Modified method utilizing using a 0.014-inch-thin torqueable wire as the guide to introduce an identical tube over it into the trachea. The epithelial integrity of the trachea was later examined histologically when the animals were sacrificed either immediately after the surgery or at 28 days post-surgery, depending on the corresponding research protocols. Orotracheal intubation was successfully completed in all mice using either the Conventional (N = 42) or the Modified method (N = 50). With the Modified method, intubation took less time (1.73 vs. 2.17 min, Modified vs. Conventional, p Conventional method. Histological analysis revealed a significantly lower incidence of immediate (0% vs. 39%, p Conventional method. Tracheal intubation for laboratory mice can be completed efficiently, safely and atraumatically using the proposed Modified method employing readily available inexpensive instruments.

  12. Biological methods used to assess surface water quality

    Directory of Open Access Journals (Sweden)

    Szczerbiñska Natalia

    2015-12-01

    Full Text Available In accordance with the guidelines of the Water Framework Directive 2000/60 (WFD, both ecological and chemical statuses determine the assessment of surface waters. The profile of ecological status is based on the analysis of various biological components, and physicochemical and hydromorphological indicators complement this assessment. The aim of this article is to present the biological methods used in the assessment of water status with a special focus on bioassay, as well as to provide a review of methods of monitoring water status. Biological test methods include both biomonitoring and bioanalytics. Water biomonitoring is used to assess and forecast the status of water. These studies aim to collect data on water pollution and forecast its impact. Biomonitoring uses organisms which are characterized by particular vulnerability to contaminants. Bioindicator organisms are algae, fungi, bacteria, larval invertebrates, cyanobacteria, macroinvertebrates, and fish. Bioanalytics is based on the receptors of contaminants that can be biologically active substances. In bioanalytics, biosensors such as viruses, bacteria, antibodies, enzymes, and biotests are used to assess degrees of pollution.

  13. Determination of Consumers'Preferences for Conventional, Healthy and Organic Cucumbers in Isfahan City Using Choice Experiment Method

    Directory of Open Access Journals (Sweden)

    A. Sandoghi

    2016-03-01

    Full Text Available Introduction: Continuing growth in human population and consumptionmeans that the global demand for food will increase for at least another 40 years and that the world needs 70-100% more food by 2050. Environmental issues such as climate change, depletion of naturalresources and biodiversity loss increasingly threaten the welfare ofhuman civilization. Confronting these threats requires, among otherthings, behavioral changes in citizens, governments and companies.Farmers and other producers are responding to consumer concerns about pesticides by creating new marketing opportunities for products grown with environmentally sound practices. Environmental economists are increasingly interested in better understanding of how people cognitively organize their beliefs and attitudes towards environmental change in order to identify key motives and barriers that stimulate or prevent action.The purpose of the presentinvestigation is to evaluate the consumers’ preferences and factors affecting their choice for conventional, healthy and organic cucumbers in Isfahan, Iran. Materials and Methods: Data were collected on a sample of 230consumers in 2013 by using the proportionate stratification samplingmethod through face-to-face interviews based on a comprehensive structured questionnaire. Before the survey, the reliability and validity of the questionnaire were initially evaluated in a pre-test study, respectively, by using Cronbach’s alpha coefficient and Kaiser-Meyer-Olkin (KMO criteria. Individual preferences were uncovered in choice experiment method (CEM by a contingent ranking experiment. In a contingent ranking experiment, respondents are required to rank a set of alternative options, characterized by a number of attributes, which are offered at different levels across the options.Data were analyzed by multinomial logit models. The approach consists of modeling utility, that isto say the net benefit a consumer obtains from selecting a

  14. Integral methods for shallow free-surface flows with separation

    DEFF Research Database (Denmark)

    Watanabe, S.; Putkaradze, V.; Bohr, Tomas

    2003-01-01

    eddy and separated flow. Assuming a variable radial velocity profile as in Karman-Pohlhausen's method, we obtain a system of two ordinary differential equations for stationary states that can smoothly go through the jump. Solutions of the system are in good agreement with experiments. For the flow down...... an inclined plane we take a similar approach and derive a simple model in which the velocity profile is not restricted to a parabolic or self-similar form. Two types of solutions with large surface distortions are found: solitary, kink-like propagating fronts, obtained when the flow rate is suddenly changed......, and stationary jumps, obtained, for instance, behind a sluice gate. We then include time dependence in the model to study the stability of these waves. This allows us to distinguish between sub- and supercritical flows by calculating dispersion relations for wavelengths of the order of the width of the layer....

  15. Method for producing high surface area chromia materials for catalysis

    Science.gov (United States)

    Gash, Alexander E [Brentwood, CA; Satcher, Joe [Patterson, CA; Tillotson, Thomas [Tracy, CA; Hrubesh, Lawrence [Pleasanton, CA; Simpson, Randall [Livermore, CA

    2007-05-01

    Nanostructured chromium(III)-oxide-based materials using sol-gel processing and a synthetic route for producing such materials are disclosed herein. Monolithic aerogels and xerogels having surface areas between 150 m.sup.2/g and 520 m.sup.2/g have been produced. The synthetic method employs the use of stable and inexpensive hydrated-chromium(III) inorganic salts and common solvents such as water, ethanol, methanol, 1-propanol, t-butanol, 2-ethoxy ethanol, and ethylene glycol, DMSO, and dimethyl formamide. The synthesis involves the dissolution of the metal salt in a solvent followed by an addition of a proton scavenger, such as an epoxide, which induces gel formation in a timely manner. Both critical point (supercritical extraction) and atmospheric (low temperature evaporation) drying may be employed to produce monolithic aerogels and xerogels, respectively.

  16. Method of impressing and reading out a surface charge on a multilayered detector structure

    International Nuclear Information System (INIS)

    Zermeno, A.; Marsh, L.M.; Cowart, R.W.

    1981-01-01

    A latent charge image is recorded on and reproduced from a multilayered detector. Firstly the detector is given a uniform surface charge on its photoconductive layer. This layer is then biased with an electric field of opposite polarity to the surface charge. The detector is then exposed to a modulated radiation flux to cause at least partial discharge of the photoconductive layer. The latent charge image of the modulated radiation flux is thus stored and later read by scanning the surface of the photoconductive layer with a small diameter photon beam to discharge further sequentially the photoconductive layer. The changing electrical potential of this discharge is detected and processed into a video signal by a processor for storage or display. This invention provides a method and apparatus capable of replacing conventional photographic and radiographic films. It also provides an X-ray sensing system which produces radiographic images of a patient using a lower radiation dosage. The output is an analog or digital video signal that may be displayed on a television monitor, recorded on film or directly stored or processed in a computer for image enhancement or pattern recognition. Other aspects are detailed. (U.K.)

  17. Exploring the 3D Surfaces with Modified Method of Steepest Descent

    Directory of Open Access Journals (Sweden)

    Wioletta GRZENDA

    2012-06-01

    Full Text Available Aim: To prove expediency of the steepest descent method to divide a given cloud of (Y, X1, X2 points into the spatial clusters with purpose to estimate a simple regression model Y = f(Z|X1,X2 at each cluster. Material and Method: The exemplary data sets {Y, X1, X2} were drawn randomly from assumed 3D surface: Y = f(X1,X2, and then a random noise was added to variable Y. A polynomial model Y = f(X1,X2 and a set of models Y = f(Z|X1,X2 were estimated separately, both under Akaike information criterion (AIC, and then compared with respect to their determination coefficients R-square, and the residuals’ distributions. Results: In the artificial data set studied, the both compared methods after several iterations can provide regression models of the quite similar quality. Conclusions: Because the proposed novel method seems to be more robust to outliers, and easier to graphical presentations and to intuitive understanding than the conventional way of building a regression model, the proposed novel method can be recommended to use by non-statisticians, especially in situation when, besides usual moderate noise, the sporadic but influential measurement errors can occur.

  18. Rapid surface enhanced Raman scattering detection method for chloramphenicol residues

    Science.gov (United States)

    Ji, Wei; Yao, Weirong

    2015-06-01

    Chloramphenicol (CAP) is a widely used amide alcohol antibiotics, which has been banned from using in food producing animals in many countries. In this study, surface enhanced Raman scattering (SERS) coupled with gold colloidal nanoparticles was used for the rapid analysis of CAP. Density functional theory (DFT) calculations were conducted with Gaussian 03 at the B3LYP level using the 3-21G(d) and 6-31G(d) basis sets to analyze the assignment of vibrations. Affirmatively, the theoretical Raman spectrum of CAP was in complete agreement with the experimental spectrum. They both exhibited three strong peaks characteristic of CAP at 1104 cm-1, 1344 cm-1, 1596 cm-1, which were used for rapid qualitative analysis of CAP residues in food samples. The use of SERS as a method for the measurements of CAP was explored by comparing use of different solvents, gold colloidal nanoparticles concentration and absorption time. The method of the detection limit was determined as 0.1 μg/mL using optimum conditions. The Raman peak at 1344 cm-1 was used as the index for quantitative analysis of CAP in food samples, with a linear correlation of R2 = 0.9802. Quantitative analysis of CAP residues in foods revealed that the SERS technique with gold colloidal nanoparticles was sensitive and of a good stability and linear correlation, and suited for rapid analysis of CAP residue in a variety of food samples.

  19. Layer-by-Layer Method for the Synthesis and Growth of Surface Mounted Metal-Organic Frameworks (SURMOFs

    Directory of Open Access Journals (Sweden)

    Osama Shekhah

    2010-02-01

    Full Text Available A layer-by-layer method has been developed for the synthesis of metal-organic frameworks (MOFs and their deposition on functionalized organic surfaces. The approach is based on the sequential immersion of functionalized organic surfaces into solutions of the building blocks of the MOF, i.e., the organic ligand and the inorganic unit. The synthesis and growth of different types of MOFs on substrates with different functionalization, like COOH, OH and pyridine terminated surfaces, were studied and characterized with different surface characterization techniques. A controlled and highly oriented growth of very homogenous films was obtained using this method. The layer-by-layer method offered also the possibility to study the kinetics of film formation in more detail using surface plasmon resonance and quartz crystal microbalance. In addition, this method demonstrates the potential to synthesize new classes of MOFs not accessible by conventional methods. Finally, the controlled growth of MOF thin films is important for many applications like chemical sensors, membranes and related electrodes.

  20. Method for Qualification of Coatings Applied to Wet Surfaces

    Science.gov (United States)

    2009-12-16

    The field application of a pipeline repair or rehabilitation coating usually cannot wait until ambient conditions become optimal. In a humid environment, water can condense on the pipe surface because the pipe surface is usually cooler than the ambie...

  1. Response Surface Methods For Spatially-Resolved Optical Measurement Techniques

    Science.gov (United States)

    Danehy, P. M.; Dorrington, A. A.; Cutler, A. D.; DeLoach, R.

    2003-01-01

    Response surface methods (or methodology), RSM, have been applied to improve data quality for two vastly different spatially-resolved optical measurement techniques. In the first application, modern design of experiments (MDOE) methods, including RSM, are employed to map the temperature field in a direct-connect supersonic combustion test facility at NASA Langley Research Center. The laser-based measurement technique known as coherent anti-Stokes Raman spectroscopy (CARS) is used to measure temperature at various locations in the combustor. RSM is then used to develop temperature maps of the flow. Even though the temperature fluctuations at a single point in the flowfield have a standard deviation on the order of 300 K, RSM provides analytic fits to the data having 95% confidence interval half width uncertainties in the fit as low as +/- 30 K. Methods of optimizing future CARS experiments are explored. The second application of RSM is to quantify the shape of a 5-meter diameter, ultra-lightweight, inflatable space antenna at NASA Langley Research Center. Photogrammetry is used to simultaneously measure the shape of the antenna at approximately 500 discrete spatial locations. RSM allows an analytic model to be developed that describes the shape of the majority of the antenna with an uncertainty of 0.4 mm, with 95% confidence. This model would allow a quantitative comparison between the actual shape of the antenna and the original design shape. Accurately determining this shape also allows confident interpolation between the measured points. Such a model could, for example, be used for ray tracing of radio-frequency waves up to 95 GHz. to predict the performance of the antenna.

  2. ROUGHNESS ON WOOD SURFACES AND ROUGHNESS MEASUREMENT METHODS

    OpenAIRE

    İsmail Aydın; Gürsel Çolakoğlu

    2003-01-01

    Some visual characteristics of wood such as color, pattern and texture determine the quality of manufactured products. Surface properties of wood material are important both in production and marketing after production. Initial studies related to the roughness of wood surface were begun in early 1950’s. However, no general agreed standardization can not have been developed for wood surfaces. Surface roughness of wood is function of the production process, product type and the natural anatomic...

  3. Screening and DetectingSalmonellain Different Food Matrices in Southern Tunisia Using a Combined Enrichment/Real-Time PCR Method: Correlation with Conventional Culture Method.

    Science.gov (United States)

    Siala, Mariam; Barbana, Amina; Smaoui, Salma; Hachicha, Salma; Marouane, Chema; Kammoun, Sana; Gdoura, Radhouane; Messadi-Akrout, Férièle

    2017-01-01

    A combined enrichment/ newly developed invA TaqMan ® real-time PCR (qPCR) method as a screening assay to detect Salmonella spp. in 500 naturally food matrices is evaluated. DNA template for qPCR was extracted from an overnight pre-enriched sample in buffered peptone water using lysis-guanidine isothiocyanate method. Heterologous internal amplification control (IAC) was incorporated during qPCR assays and co-amplified with the invA gene of the target pathogen. InvA qPCR exhibited 100% specificity when testing 94 Salmonella strains (inclusivity) and 32 non- Salmonella strains (exclusivity). The qPCR showed a consistent detection of two copies of the invA gene/PCR reaction, a good intra- and inter-run reproducibility with a good PCR efficiency (89.6%). QPCR was sensitive and showed Salmonella detection at 8.5 × 10 0 CFU mL -1 of artificially spiked poultry meat -BWP solution in less than 40 cycles. When analyzing 500 different food matrices and comparing the results with the ISO 6579:2002 conventional culture method, the sensitivity and specificity were 100 and 76.6%, respectively. QPCR showed Salmonella spp. DNA in raw poultry meat 27/45 (60%), milk 31/93 (33.3%), raw red meat 5/13 (38.5%), and fish 11/46 (23.9%) samples. The prevalence of Salmonella spp. in cakes, dairy, cooked meals, charcuterie products using qPCR was 11/14 (26.8%), 5/22 (22.7%), 32/150 (21.3%), and 5/20 (25%), respectively, compared to 0% as demonstrated by culture. S. Anatum was the most common serovar found associated with red meat compared to S. kentucky isolated from fish and poultry meat. In conclusion, our study is the first to use a combined enrichment/ invA qPCR method as a screening assay to detect Salmonella DNA in different types of commercialized food in Southern Tunisia. QPCR results indicate that Salmonella contamination is common in milk and in other types of food samples.

  4. Screening and Detecting Salmonella in Different Food Matrices in Southern Tunisia Using a Combined Enrichment/Real-Time PCR Method: Correlation with Conventional Culture Method

    Directory of Open Access Journals (Sweden)

    Mariam Siala

    2017-12-01

    Full Text Available A combined enrichment/ newly developed invA TaqMan® real-time PCR (qPCR method as a screening assay to detect Salmonella spp. in 500 naturally food matrices is evaluated. DNA template for qPCR was extracted from an overnight pre-enriched sample in buffered peptone water using lysis–guanidine isothiocyanate method. Heterologous internal amplification control (IAC was incorporated during qPCR assays and co-amplified with the invA gene of the target pathogen. InvA qPCR exhibited 100% specificity when testing 94 Salmonella strains (inclusivity and 32 non-Salmonella strains (exclusivity. The qPCR showed a consistent detection of two copies of the invA gene/PCR reaction, a good intra- and inter-run reproducibility with a good PCR efficiency (89.6%. QPCR was sensitive and showed Salmonella detection at 8.5 × 100 CFU mL-1 of artificially spiked poultry meat -BWP solution in less than 40 cycles. When analyzing 500 different food matrices and comparing the results with the ISO 6579:2002 conventional culture method, the sensitivity and specificity were 100 and 76.6%, respectively. QPCR showed Salmonella spp. DNA in raw poultry meat 27/45 (60%, milk 31/93 (33.3%, raw red meat 5/13 (38.5%, and fish 11/46 (23.9% samples. The prevalence of Salmonella spp. in cakes, dairy, cooked meals, charcuterie products using qPCR was 11/14 (26.8%, 5/22 (22.7%, 32/150 (21.3%, and 5/20 (25%, respectively, compared to 0% as demonstrated by culture. S. Anatum was the most common serovar found associated with red meat compared to S. kentucky isolated from fish and poultry meat. In conclusion, our study is the first to use a combined enrichment/invA qPCR method as a screening assay to detect Salmonella DNA in different types of commercialized food in Southern Tunisia. QPCR results indicate that Salmonella contamination is common in milk and in other types of food samples.

  5. A New Method Based on TOPSIS and Response Surface Method for MCDM Problems with Interval Numbers

    Directory of Open Access Journals (Sweden)

    Peng Wang

    2015-01-01

    Full Text Available As the preference of design maker (DM is always ambiguous, we have to face many multiple criteria decision-making (MCDM problems with interval numbers in our daily life. Though there have been some methods applied to solve this sort of problem, it is always complex to comprehend and sometimes difficult to implement. The calculation processes are always ineffective when a new alternative is added or removed. In view of the weakness like this, this paper presents a new method based on TOPSIS and response surface method (RSM for MCDM problems with interval numbers, RSM-TOPSIS-IN for short. The key point of this approach is the application of deviation degree matrix, which ensures that the DM can get a simple response surface (RS model to rank the alternatives. In order to demonstrate the feasibility and effectiveness of the proposed method, three illustrative MCMD problems with interval numbers are analysed, including (a selection of investment program, (b selection of a right partner, and (c assessment of road transport technologies. The contrast of ranking results shows that the RSM-TOPSIS-IN method is in good agreement with those derived by earlier researchers, indicating it is suitable to solve MCDM problems with interval numbers.

  6. Comparison of the quantitative dry culture methods with both conventional media and most probable number method for the enumeration of coliforms and Escherichia coli/coliforms in food.

    Science.gov (United States)

    Teramura, H; Sota, K; Iwasaki, M; Ogihara, H

    2017-07-01

    Sanita-kun™ CC (coliform count) and EC (Escherichia coli/coliform count), sheet quantitative culture systems which can avoid chromogenic interference by lactase in food, were evaluated in comparison with conventional methods for these bacteria. Based on the results of inclusivity and exclusivity studies using 77 micro-organisms, sensitivity and specificity of both Sanita-kun™ met the criteria for ISO 16140. Both media were compared with deoxycholate agar, violet red bile agar, Merck Chromocult™ coliform agar (CCA), 3M Petrifilm™ CC and EC (PEC) and 3-tube MPN, as reference methods, in 100 naturally contaminated food samples. The correlation coefficients of both Sanita-kun™ for coliform detection were more than 0·95 for all comparisons. For E. coli detection, Sanita-kun™ EC was compared with CCA, PEC and MPN in 100 artificially contaminated food samples. The correlation coefficients for E. coli detection of Sanita-kun™ EC were more than 0·95 for all comparisons. There were no significant differences in all comparisons when conducting a one-way analysis of variance (anova). Both Sanita-kun™ significantly inhibited colour interference by lactase when inhibition of enzymatic staining was assessed using 40 natural cheese samples spiked with coliform. Our results demonstrated Sanita-kun™ CC and EC are suitable alternatives for the enumeration of coliforms and E. coli/coliforms, respectively, in a variety of foods, and specifically in fermented foods. Current chromogenic media for coliforms and Escherichia coli/coliforms have enzymatic coloration due to breaking down of chromogenic substrates by food lactase. The novel sheet culture media which have film layer to avoid coloration by food lactase have been developed for enumeration of coliforms and E. coli/coliforms respectively. In this study, we demonstrated these media had comparable performance with reference methods and less interference by food lactase. These media have a possibility not only

  7. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto

    Science.gov (United States)

    Bond, Tiziana C.; Miles, Robin; Davidson, James C.; Liu, Gang Logan

    2014-07-22

    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  8. Transfer of pharmacopoeial liquid chromatography reversedphase methods for determination of related compounds in diclofenac sodium and metamizole sodium from conventional to core-shell column

    Directory of Open Access Journals (Sweden)

    Katerina Brezovska

    2015-04-01

    Full Text Available Core-shell silica particles were developed as a new material for chromatographic stationary phases in order to provide fast and high efficiency separations of small and large molecules and complex samples, at pressures compatible with conventional HPLC equipment. The aim of our work was to show the applicability of the HPLC columns based on a core-shell technology for determination of related substances in diclofenac sodium and in metamizole sodium using the methods described in the corresponding monographs of the European pharmacopoeia. The obtained results have shown that the proposed methods can be successfully transferred on core shell column, with suitable adjustment of injection volume and flow rate. The advantage of using core-shell column is fast and highly efficient separation on conventional HPLC equipment with increased sensitivity of the method and high throughput of the analysis, providing enhanced lab productivity and reduced costs.

  9. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Directory of Open Access Journals (Sweden)

    Sung-Hye You

    2017-01-01

    Full Text Available Purpose The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL, for measuring the volume of parathyroid glands. Methods Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D and three-dimensional (3D methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. Results The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. Conclusion The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  10. Evaluation of Microstructure and Mechanical Properties of Al-TiC Metal Matrix Composite Prepared by Conventional, Microwave and Spark Plasma Sintering Methods

    Directory of Open Access Journals (Sweden)

    Ehsan Ghasali

    2017-10-01

    Full Text Available In this research, the mechanical properties and microstructure of Al-15 wt % TiC composite samples prepared by spark plasma, microwave, and conventional sintering were investigated. The sintering process was performed by the speak plasma sintering (SPS technique, microwave and conventional furnaces at 400 °C, 600 °C, and 700 °C, respectively. The results showed that sintered samples by SPS have the highest relative density (99% of theoretical density, bending strength (291 ± 12 MPa, and hardness (253 ± 23 HV. The X-ray diffraction (XRD investigations showed the formation of TiO2 from the surface layer decomposition of TiC particles. Scanning electron microscopy (SEM micrographs demonstrated uniform distribution of reinforcement particles in all sintered samples. The SEM/EDS analysis revealed the formation of TiO2 around the porous TiC particles.

  11. Towards non-conventional methods of designing register-based epidemiological studies: An application to pediatric research.

    Science.gov (United States)

    Gong, Tong; Brew, Bronwyn; Sjölander, Arvid; Almqvist, Catarina

    2017-07-01

    Various epidemiological designs have been applied to investigate the causes and consequences of fetal growth restriction in register-based observational studies. This review seeks to provide an overview of several conventional designs, including cohort, case-control and more recently applied non-conventional designs such as family-based designs. We also discuss some practical points regarding the application and interpretation of family-based designs. Definitions of each design, the study population, the exposure and the outcome measures are briefly summarised. Examples of study designs are taken from the field of low birth-weight research for illustrative purposes. Also examined are relative advantages and disadvantages of each design in terms of assumptions, potential selection and information bias, confounding and generalisability. Kinship data linkage, statistical models and result interpretation are discussed specific to family-based designs. When all information is retrieved from registers, there is no evident preference of the case-control design over the cohort design to estimate odds ratios. All conventional designs included in the review are prone to bias, particularly due to residual confounding. Family-based designs are able to reduce such bias and strengthen causal inference. In the field of low birth-weight research, family-based designs have been able to confirm a negative association not confounded by genetic or shared environmental factors between low birth weight and the risk of asthma. We conclude that there is a broader need for family-based design in observational research as evidenced by the meaningful contributions to the understanding of the potential causal association between low birth weight and subsequent outcomes.

  12. Sodium sulfanilate dihydrate (SSDH) single crystals grown by conventional slow evaporation and Sankaranarayanan–Ramasamy (SR) method and its comparative characterization analysis

    International Nuclear Information System (INIS)

    Senthil Pandian, M.; Ramasamy, P.

    2012-01-01

    Graphical abstract: (a) Unidirectional nonlinear optical sodium sulfanilate dihydrate (SSDH) single crystal grown by SR method and (b and c) cut and polished wafers of SR method grown SSDH single crystals. Highlights: ► Sodium sulfanilate dihydrate single crystal was grown by Sankaranarayanan–Ramasamy method which has the sizes of 100 mm length and 30 mm diameter for the first time. ► The conventional and SR-grown SSDH single crystals were characterized using etching, laser damage threshold, microhardness, UV–vis, birefringence and dielectric tensor analysis. ► The SR-grown SSDH crystal has higher LDT, microhardness, transparency, birefringence and lower dislocation density, dielectric loss than the crystal grown by conventional method. ► The dielectric tensor components were measured and found to be ε 11 = 12.2, ε 22 = 9.5, and ε 33 = 8.5. - Abstract: A transparent uniaxial sodium sulfanilate dihydrate (SSDH) single crystal having dimension of 30 mm diameter and 100 mm length was grown by Sankaranarayanan–Ramasamy (SR) method with a growth rate of 1 mm per day. Using an identical solution the conventional crystal grown to a dimension of 12 mm × 20 mm × 5 mm was obtained over a period of 20 days. The crystal structure has been confirmed by single crystal X-ray diffraction (XRD) measurement. The crystalline perfection of sodium sulfanilate dihydrate crystals grown by slow evaporation solution technique (SEST) and SR method were characterized using chemical etching, laser damage threshold, Vickers microhardness, UV–vis NIR, birefringence and dielectric analysis. The above study indicates that the crystal quality of the Sankaranarayanan–Ramasamy (SR) method grown sodium sulfanilate dihydrate is good compared to conventional solution method grown SSDH crystal. The growth features of inclusions, low angle grain boundaries, twins and micro-cracks have been observed in conventional method grown SSDH crystals. The dielectric tensor components for

  13. No Major Differences Found between the Effects of Microwave-Based and Conventional Heat Treatment Methods on Two Different Liquid Foods

    Science.gov (United States)

    Géczi, Gábor; Horváth, Márk; Kaszab, Tímea; Alemany, Gonzalo Garnacho

    2013-01-01

    Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values) of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other ways as well. PMID

  14. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Energy Technology Data Exchange (ETDEWEB)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon [Dept. of Radiology, Korea University Anam Hospital, Seoul (Korea, Republic of); Suh, Sangil; Ryoo, In Seon; Seol, Hae Young [Dept. of Radiology, Korea University Guro Hospital, Seoul (Korea, Republic of); Lee, Young Hen; Seo, Hyung Suk [Dept. of Radiology, Korea University Ansan Hospital, Ansan (Korea, Republic of)

    2017-01-15

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  15. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    International Nuclear Information System (INIS)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon; Suh, Sangil; Ryoo, In Seon; Seol, Hae Young; Lee, Young Hen; Seo, Hyung Suk

    2017-01-01

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism

  16. Comparison of Conventional Methods and Laser-Assisted Rapid Prototyping for Manufacturing Fixed Dental Prostheses: An In Vitro Study.

    Science.gov (United States)

    Pompa, Giorgio; Di Carlo, Stefano; De Angelis, Francesca; Cristalli, Maria Paola; Annibali, Susanna

    2015-01-01

    This study assessed whether there are differences in marginal fit between laser-fusion and conventional techniques to produce fixed dental prostheses (FDPs). A master steel die with 2 abutments was produced to receive a posterior 4-unit FDPs and single copings. These experimental models were divided into three groups (n = 20/group) manufactured: group 1, Ni-Cr alloy, with a lost-wax casting technique; group 2, Co-Cr alloy, with selective laser melting (SLM); and group 3, yttria-tetragonal zirconia polycrystal (Y-TZP), with a milling system. All specimens were cut along the longitudinal axis and their adaptation was measured at the marginal and shoulder areas on the right and left sides of each abutment. Measurements were made using a stereomicroscope (×60 magnification) and a scanning electron microscope (×800 magnification). The data were analyzed using one-way analysis of variance and the Bonferroni post hoc test, with a significance cutoff of 5%. Significant differences (P < 0.05) were observed between group 3 and the other groups. The marginal opening was smallest with Co-Cr alloy substructures, while the shoulder opening was smallest with Ni-Cr alloy substructures. Within the limitations of this study, the marginal fit of an FDP is better with rapid prototyping (RP) via SLM than conventional manufacturing systems.

  17. Application of Taguchi method to optimization of surface roughness during precise turning of NiTi shape memory alloy

    Science.gov (United States)

    Kowalczyk, M.

    2017-08-01

    This paper describes the research results of surface quality research after the NiTi shape memory alloy (Nitinol) precise turning by the tools with edges made of polycrystalline diamonds (PCD). Nitinol, a nearly equiatomic nickel-titanium shape memory alloy, has wide applications in the arms industry, military, medicine and aerospace industry, and industrial robots. Due to their specific properties NiTi alloys are known to be difficult-to-machine materials particularly by using conventional techniques. The research trials were conducted for three independent parameters (vc, f, ap) affecting the surface roughness were analyzed. The choice of parameter configurations were performed by factorial design methods using orthogonal plan type L9, with three control factors, changing on three levels, developed by G. Taguchi. S/N ratio and ANOVA analyses were performed to identify the best of cutting parameters influencing surface roughness.

  18. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  19. Comparison of Resource Requirements for a Wind Tunnel Test Designed with Conventional vs. Modern Design of Experiments Methods

    Science.gov (United States)

    DeLoach, Richard; Micol, John R.

    2011-01-01

    The factors that determine data volume requirements in a typical wind tunnel test are identified. It is suggested that productivity in wind tunnel testing can be enhanced by managing the inference error risk associated with evaluating residuals in a response surface modeling experiment. The relationship between minimum data volume requirements and the factors upon which they depend is described and certain simplifications to this relationship are realized when specific model adequacy criteria are adopted. The question of response model residual evaluation is treated and certain practical aspects of response surface modeling are considered, including inference subspace truncation. A wind tunnel test plan developed by using the Modern Design of Experiments illustrates the advantages of an early estimate of data volume requirements. Comparisons are made with a representative One Factor At a Time (OFAT) wind tunnel test matrix developed to evaluate a surface to air missile.

  20. Simplified method for preparation of concentrated exoproteins produced by Staphylococcus aureus grown on surface of cellophane bag containing liquid medium.

    Science.gov (United States)

    Ikigai, H; Seki, K; Nishihara, S; Masuda, S

    1988-01-01

    A simplified method for preparation of concentrated exoproteins including protein A and alpha-toxin produced by Staphylococcus aureus was successfully devised. The concentrated proteins were obtained by cultivating S. aureus organisms on the surface of a liquid medium-containing cellophane bag enclosed in a sterilized glass flask. With the same amount of medium, the total amount of proteins obtained by the method presented here was identical with that obtained by conventional liquid culture. The concentration of proteins obtained by the method, however, was high enough to observe their distinct bands stained on polyacrylamide gel electrophoresis. This method was considered quite useful not only for large-scale cultivation for the purification of staphylococcal proteins but also for small-scale study using the proteins. The precise description of the method was presented and its possible usefulness was discussed.

  1. In vitro performance of QLF system and conventional methods for detection of occlusal caries around tooth-colored restorations in primary molars.

    Science.gov (United States)

    Lenzi, Tathiane L; Piovesan, Chaiana; Mendes, Fausto M; Braga, Mariana M; Raggio, Daniela P

    2016-01-01

    Secondary caries is the main reason for restoration replacement, and therefore, an accurate detection of this type of condition is fundamental. To compare in vitro the performance of different conventional and quantitative light-induced fluorescence-based (QLF) methods in detecting occlusal caries around resin composite restorations in primary molars. Two examiners evaluated independently 42 sites adjacent to tooth-colored restorations using visual inspection (ICDAS-CARS), radiographic examination, and QLF. Histological examination was used as reference standard method. Area under the ROC curve (Az), sensitivity, specificity, and accuracy of the methods were calculated at enamel (D1) and dentin caries (D3) lesions thresholds. Intra- and interexaminer reproducibility were calculated using intraclass correlation coefficient (ICC) and kappa statistics. There was no difference among the methods considering Az at D1 threshold. Visual inspection, radiograph, and QLF (scores) methods presented similar sensitivities and significantly higher than those obtained with the QLF (∆F%). At D3 threshold, there were no differences among the methods regarding sensitivities, specificities, and accuracy, except for the examiner 2 with the QLF (∆F%) who achieved a very low sensitivity value. Conventional methods are similar to QLF methods for detecting caries around tooth-colored restorations in primary teeth. © 2015 BSPD, IAPD and John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Safety of type and screen method compared to conventional antiglobulin crossmatch procedures for compatibility testing in Indian setting

    Directory of Open Access Journals (Sweden)

    Chaudhary Rajendra

    2011-01-01

    Full Text Available Background: Over the past 30 years, pretransfusion tests have undergone considerable modification. In 1984, AABB recommended that the full cross match could be replaced by an abbreviated cross match in patients with negative antibody screen. However, before implementation of such a policy, issue regarding safety of T & S needs to be evaluated. Objectives: The aim of pretransfusion testing (PTT is to ensure that enough red blood cells (RBCs in the selected red cell components will survive when transfused. Results and Conclusion: We have, therefore in this study; evaluated safety of T & S procedure for PTT in comparison with conventional test tube cross match. The T & S procedure gave a safety of 91.6%. Also, the usefulness of the T & S was shown through the detection of unexpected antibodies in 0.75% (15 out of 2026 of cases.

  3. Noble-TLBO MPPT Technique and its Comparative Analysis with Conventional methods implemented on Solar Photo Voltaic System

    Science.gov (United States)

    Patsariya, Ajay; Rai, Shiwani; Kumar, Yogendra, Dr.; Kirar, Mukesh, Dr.

    2017-08-01

    The energy crisis particularly with developing GDPs, has bring up to a new panorama of sustainable power source like solar energy, which has encountered huge development. Progressively high infiltration level of photovoltaic (PV) era emerges in keen matrix. Sunlight based power is irregular and variable, as the sun based source at the ground level is exceedingly subject to overcast cover inconstancy, environmental vaporized levels, and other climate parameters. The inalienable inconstancy of substantial scale sun based era acquaints huge difficulties with keen lattice vitality administration. Exact determining of sun powered power/irradiance is basic to secure financial operation of the shrewd framework. In this paper a noble TLBO-MPPT technique has been proposed to address the vitality of solar energy. A comparative analysis has been presented between conventional PO, IC and the proposed MPPT technique. The research has been done on Matlab Simulink software version 2013.

  4. Comparison of accuracies of an intraoral spectrophotometer and conventional visual method for shade matching using two shade guide systems

    Directory of Open Access Journals (Sweden)

    Vidhya Parameswaran

    2016-01-01

    Conclusion: This in vitro study clearly delineates the advantages and limitations of both methods. There were significant differences between the methods with the visual method producing more accurate results than the spectrophotometric method. The spectrophotometer showed far better interrater agreement scores irrespective of the shade guide used. Even though visual shade matching is subjective, it is not inferior and should not be underrated. Judicious combination of both techniques is imperative to attain a successful and esthetic outcome.

  5. Comparison of the heat shock response induced by conventional heating and two methods of delivery of pulsed radiofrequency energy

    International Nuclear Information System (INIS)

    Laurence, J.A.; University of Sydney, NSW; McKenzie, D.R.; Veas, L.; French, P.W.

    2002-01-01

    Full text: In 2001, we published a (hypothetical) mechanism by which radiofrequency (RF) radiation from mobile phones could induce cancer, via the chronic induction of the heat shock response (HSR). This hypothesis provides the focus for our research. Other groups have reported induction of the HSR by RF at apparently non thermal levels. The aim of this study was to determine whether the HSR induced by RF is (a) truly non thermal and (b) quantitatively or qualitatively different from that induced by conventional heating of cells. A rat mast cell line, RBL-2H3, was chosen as the target RBL-2H3 cells were exposed in an air incubator at 41.1 deg C for 45 minutes and 75 minutes, and then returned to a 37 deg C incubator. Sham exposures were performed in the same air incubator at 37 deg C. Cells were exposed for 1 hour in the two pulsed RF exposure systems. The first was a converted 750W microwave oven that emits a short burst of 2.45GHz pulses at the start of each contiguous six minute period. This exposes cells to an average specific energy absorption rate (SAR) of 20W/kg. The second system was a TEM cell, which simulates. GSM pulses - the earner frequency is 0.9GHz pulse modulated at 217Hz. The SAR was approx 0.1W/kg. Both of these exposure systems are housed in incubators maintained at 37 deg C. Sham exposures were performed in the two systems with the same conditions but with no RF radiation present. Cell samples for the conventional heating and microwave exposures were taken 0, 2. 5, 5 and 20 hours after exposure, and expression of heat shock proteins hsp 110, 90, 70, 60 and 56 were determined by Western Blotting and compared between exposures

  6. Water pressure head and temperature impact on isoxaflutole degradation in crop residues and loamy surface soil under conventional and conservation tillage management.

    Science.gov (United States)

    Alletto, Lionel; Coquet, Yves; Bergheaud, Valérie; Benoit, Pierre

    2012-08-01

    Laboratory incubations were performed in order to evaluate the dissipation of the proherbicide isoxaflutole in seedbed layer soil samples from conventional and conservation tillage systems and in maize and oat residues left at the soil surface under conservation tillage. The effects of temperature and water pressure head on radiolabelled isoxaflutole degradation were studied for each sample for 21d. Mineralisation of isoxaflutole was low for all samples and ranged from 0.0% to 0.9% of applied (14)C in soil samples and from 0.0% to 2.4% of applied (14)C in residue samples. In soil samples, degradation half-life of isoxaflutole ranged from 9 to 26h, with significantly higher values under conservation tillage. In residue samples, degradation half-life ranged from 3 to 31h, with significantly higher values in maize residues, despite a higher mineralisation and bound residue formation than in oat residues. Whatever the sample, most of the applied (14)C remained extractable during the experiment and, after 21d, less than 15% of applied (14)C were unextractable. This extractable fraction was composed of diketonitrile, benzoic acid derivative and several unidentified metabolites, with one of them accounting for more than 17% of applied (14)C. This study showed that tillage system design, including crop residues management, could help reducing the environmental impacts of isoxaflutole. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Optimization of ultrasound-assisted extraction to obtain mycosterols from Agaricus bisporus L. by response surface methodology and comparison with conventional Soxhlet extraction.

    Science.gov (United States)

    Heleno, Sandrina A; Diz, Patrícia; Prieto, M A; Barros, Lillian; Rodrigues, Alírio; Barreiro, Maria Filomena; Ferreira, Isabel C F R

    2016-04-15

    Ergosterol, a molecule with high commercial value, is the most abundant mycosterol in Agaricus bisporus L. To replace common conventional extraction techniques (e.g. Soxhlet), the present study reports the optimal ultrasound-assisted extraction conditions for ergosterol. After preliminary tests, the results showed that solvents, time and ultrasound power altered the extraction efficiency. Using response surface methodology, models were developed to investigate the favourable experimental conditions that maximize the extraction efficiency. All statistical criteria demonstrated the validity of the proposed models. Overall, ultrasound-assisted extraction with ethanol at 375 W during 15 min proved to be as efficient as the Soxhlet extraction, yielding 671.5 ± 0.5mg ergosterol/100 g dw. However, with n-hexane extracts with higher purity (mg ergosterol/g extract) were obtained. Finally, it was proposed for the removal of the saponification step, which simplifies the extraction process and makes it more feasible for its industrial transference. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients

    OpenAIRE

    Meng-Ting Huang; Robert Kuo-Kuang Lee; Chung-Hao Lu; Ying-Jie Chen; Sheng-Hsiang Li; Yuh-Ming Hwu

    2015-01-01

    Objective: To evaluate if hyaluronic acid (HA)-bound spermatozoa surpassed conventional microscopy-selected spermatozoa in the status of sperm DNA integrity by acridine orange (AO) fluorescence staining. Materials and methods: Spermatozoa obtained from couples with indication for the intracytoplasmic sperm injection (ICSI) procedure due to male infertility (n = 34) and control males with normal sperm parameters (n = 12) were analyzed using AO fluorescence staining after density-gradient ce...

  9. Analytical methods for the characterization of surface finishing in bricks

    International Nuclear Information System (INIS)

    Nardini, I.; Zendri, E.; Biscontin, G.; Brunetin, A.

    2006-01-01

    The recent restoration works of Santo Stefano Church Facade (XV century) in Venice have shown traces variously saved of different kind of surface finishes. These finishes were found on the brick's surface both in the masonry and in the decorative elements. Different brick's surface and decorative tile samples were investigated using several techniques: optical microscopy, scanning electron-microscopy, thermal analysis, infrared spectroscopy and reflectance Fourier transform infrared microspectroscopy. The evaluation of the reached results was used to understand the decorative techniques and to recognize the material employed

  10. Carbon nanotube oscillator surface profiling device and method of use

    Science.gov (United States)

    Popescu, Adrian [Tampa, FL; Woods, Lilia M [Tampa, FL; Bondarev, Igor V [Fuquay Varina, NC

    2011-11-15

    The proposed device is based on a carbon nanotube oscillator consisting of a finite length outer stationary nanotube and a finite length inner oscillating nanotube. Its main function is to measure changes in the characteristics of the motion of the carbon nanotube oscillating near a sample surface, and profile the roughness of this surface. The device operates in a non-contact mode, thus it can be virtually non-wear and non-fatigued system. It is an alternative to the existing atomic force microscope (AFM) tips used to scan surfaces to determine their roughness.

  11. Contribution of surface analysis spectroscopic methods to the lubrication field

    International Nuclear Information System (INIS)

    Blanc, C.

    1979-01-01

    The analytical surface technics such as ESCA, AES and SIMS are tested to be applied to a particular lubrication field. One deals with a 100 C 6 steel surface innumered in tricresylphosphate at 110 0 C for 15 days. The nature of the first layers is studied after relevant solvant cleaning. An iron oxide layer is produced on the bearing surface, namely αFe 2 -O 3 . ESCA, AES and SIMS studies show an overlayer of iron phosphate. The exact nature of iron phosphate is not clearly established but the formation of a ferrous phosphate coating can be assumed from ESCA analysis [fr

  12. A randomized controlled trial of the Arctic Sun Temperature Management System versus conventional methods for preventing hypothermia during off-pump cardiac surgery.

    Science.gov (United States)

    Grocott, Hilary P; Mathew, Joseph P; Carver, Elizabeth H; Phillips-Bute, Barbara; Landolfo, Kevin P; Newman, Mark F

    2004-02-01

    In this trial we compared the hypothermia avoidance abilities of the Arctic Sun Temperature Management System (a servo-regulated system that circulates temperature-controlled water through unique energy transfer pads adherent to the patient's body) with conventional temperature control methods. Patients undergoing off-pump coronary artery bypass (OPCAB) surgery were randomized to either the Arctic Sun System alone (AS group) or conventional methods (control group; increased room temperature, heated IV fluids, convective forced air warming system) for the prevention of hypothermia (defined by a temperature temperature servo-regulated to a target of 36.8 degrees C. Temperature was recorded throughout the operative period and comparisons were made between groups for both the time and area under the curve (AUC) for a temperature control group = 15) were studied. The AS group had significantly less hypothermia than the control group, both for duration of time control group; P = 0.0008) as well as for AUCcontrol group; P = 0.002). The Arctic Sun Temperature Management System significantly reduced intraoperative hypothermia during OPCAB surgery. Importantly, this was achieved in the absence of any other temperature modulating techniques, including the use of IV fluid warming or increases in the ambient operating room temperature. The Arctic Sun Temperature Management System was more effective than conventional methods in preventing hypothermia during off-pump coronary artery bypass graft surgery.

  13. Flow patterns and transport in Rayleigh surface acoustic wave streaming: combined finite element method and raytracing numerics versus experiments.

    Science.gov (United States)

    Frommelt, Thomas; Gogel, Daniel; Kostur, Marcin; Talkner, Peter; Hänggi, Peter; Wixforth, Achim

    2008-10-01

    This work presents an approach for determining the streaming patterns that are generated by Rayleigh surface acoustic waves in arbitrary 3-D geometries by finite element method (FEM) simulations. An efficient raytracing algorithm is applied on the acoustic subproblem to avoid the unbearable memory demands and computational time of a conventional FEM acoustics simulation in 3-D. The acoustic streaming interaction is modeled by a body force term in the Stokes equation. In comparisons between experiments and simulated flow patterns, we demonstrate the quality of the proposed technique.

  14. A simple method for the preparation of difficult 99mTc complexes using surface adsorbed stannous ions

    International Nuclear Information System (INIS)

    Maddalena, D.J.; Snowdon, G.M.; Pojer, P.M.

    1987-01-01

    A simple new technique where stannous tin is adsorbed on the inner surface of plastic tubing and used to reduce ( 99m Tc) pertechnetate prior to labelling radiopharmaceuticals, has been evaluated, using some lipophillic and metal containing ligands. Complexes formed using the technique had good labelling efficiency and behaved the same in rat biodistribution studies as those prepared using conventional labelling methods. The labelling efficiency of the ligands was not related to their lipophillicity suggesting that this technique may be useful for labelling lipophillic and other difficult ligands such as those containing metals, which are incompatible with free stannous ions in solution. (M.E.L.) [es

  15. Method and coating composition for protecting and decontaminating surfaces

    Science.gov (United States)

    Overhold, D C; Peterson, M D

    1959-03-10

    A protective coating useful in the decontamination of surfaces exposed to radioactive substances is described. This coating is placed on the surface before use and is soluble in water, allowing its easy removal in the event decontamination becomes necessary. Suitable coating compositions may be prepared by mixing a water soluble carbohydrate such as sucrose or dextrin, together with a hygroscopic agent such as calcium chloride or zinc chloride.

  16. Influence of various surface-conditioning methods on the bond strength of metal brackets to ceramic surfaces

    NARCIS (Netherlands)

    Schmage, P; Nergiz, [No Value; Herrmann, W; Ozcan, M; Nergiz, Ibrahim; �zcan, Mutlu

    With the increase in adult orthodontic treatment comes the need to find a reliable method for bonding orthodontic brackets onto metal or ceramic crowns and fixed partial dentures. In this study, shear bond strength and surface roughness tests were used to examine the effect of 4 different surface

  17. Feasibility of using a seismic surface wave method to study seasonal and weather effects on shallow surface soils

    Science.gov (United States)

    The objective of this paper is to study the feasibility of using a seismic surface wave method to investigate seasonal and weather effects on shallow surface soils. In the study, temporal variations of subsurface soil properties were measured and monitored by using a combination of a new seismic su...

  18. Group IV nanocrystals with ion-exchangeable surface ligands and methods of making the same

    Energy Technology Data Exchange (ETDEWEB)

    Wheeler, Lance M.; Nichols, Asa W.; Chernomordik, Boris D.; Anderson, Nicholas C.; Beard, Matthew C.; Neale, Nathan R.

    2018-01-09

    Methods are described that include reacting a starting nanocrystal that includes a starting nanocrystal core and a covalently bound surface species to create an ion-exchangeable (IE) nanocrystal that includes a surface charge and a first ion-exchangeable (IE) surface ligand ionically bound to the surface charge, where the starting nanocrystal core includes a group IV element.

  19. A novel surface cleaning method for chemical removal of fouling lead layer from chromium surfaces

    Science.gov (United States)

    Gholivand, Kh.; Khosravi, M.; Hosseini, S. G.; Fathollahi, M.

    2010-10-01

    Most products especially metallic surfaces require cleaning treatment to remove surface contaminations that remain after processing or usage. Lead fouling is a general problem which arises from lead fouling on the chromium surfaces of bores and other interior parts of systems which have interaction with metallic lead in high temperatures and pressures. In this study, a novel chemical solution was introduced as a cleaner reagent for removing metallic lead pollution, as a fouling metal, from chromium surfaces. The cleaner aqueous solution contains hydrogen peroxide (H 2O 2) as oxidizing agent of lead layer on the chromium surface and acetic acid (CH 3COOH) as chelating agent of lead ions. The effect of some experimental parameters such as acetic acid concentration, hydrogen peroxide concentration and temperature of the cleaner solution during the operation on the efficiency of lead cleaning procedure was investigated. The results of scanning electron microscopy (SEM) showed that using this procedure, the lead pollution layer could be completely removed from real chromium surfaces without corrosion of the original surface. Finally, the optimum conditions for the complete and fast removing of lead pollution layer from chromium surfaces were proposed. The experimental results showed that at the optimum condition (acetic acid concentration 28% (V/V), hydrogen peroxide 8% (V/V) and temperature 35 °C), only 15-min time is needed for complete removal of 3 g fouling lead from a chromium surface.

  20. Comparison of Polyacetylene Content in Organically and Conventionally Grown Carrots Using a Fast Ultrasonic Liquid Extraction Method

    DEFF Research Database (Denmark)

    Søltoft, Malene; Eriksen, Morten Rosbjørn; Träger, Anne Wibe Brændholt

    2010-01-01

    A rapid and sensitive analytical method for quantification of polyacetylenes in carrot roots was developed. The traditional extraction method (stirring) was compared to a new ultrasonic liquid processor (ULP)-based methodology using high-performance liquid chromatography−ultraviolet (HPLC−UV) and...

  1. Comparative efficacy of conventional diagnostic methods and evaluation of polymerase chain reaction for the diagnosis of bovine brucellosis

    Directory of Open Access Journals (Sweden)

    Raheela Akhtar

    2010-04-01

    Full Text Available The comparative efficacy of Rose Bengal Plate Test (RBPT and Milk Ring test (MRT was calculated in terms of sensitivity and specificity for the diagnosis of bovine brucellosis in cows (Group A and buffaloes (Group B from Lahore and Okara districts of Punjab, Pakistan. Using bacterial growth as a gold standard RBPT showed high sensitivity values of 100% in both groups. While its specificity was 96.29% (Group A and 90.62% (Group B. On the other hands MRT showed low sensitivity (80.0% in Group A; 86.6% in Group B while its specificity was 100% in all the animals of both groups. The calculated positive predictive and negative predictive values of both groups were in correspondence with their specificity and sensitivity values respectively. High sensitivity and low specificity of RBPT as compare to high specificity and low sensitivity of MRT in all groups suggested the poor efficacy of both tests used individually as compare to bacterial growth. In the continuation of this study polymerase chain reaction (PCR was evaluated for its diagnostic efficacy of quick Brucella abortus isolation from same samples. PCR conducted on serum samples gave more positive results than on milk samples. Therefore, the combination of both conventional tests alongwith serum PCR can be recommended. [Vet. World 2010; 3(2.000: 53-56

  2. Religious versus Conventional Psychotherapy for Major Depression in Patients with Chronic Medical Illness: Rationale, Methods, and Preliminary Results

    Directory of Open Access Journals (Sweden)

    Harold G. Koenig

    2012-01-01

    Full Text Available This paper (1 reviews the physical and religious barriers to CBT that disabled medically ill-depressed patients face, (2 discusses research on the relationship between religion and depression-induced physiological changes, (3 describes an ongoing randomized clinical trial of religious versus secular CBT in chronically ill patients with mild-to-moderate major depression designed to (a overcome physical and religious barriers to CBT and (b compare the efficacy of religious versus secular CBT in relieving depression and improving immune and endocrine functions, and (4 presents preliminary results that illustrate the technical difficulties that have been encountered in implementing this trial. CBT is being delivered remotely via instant messaging, telephone, or Skype, and Christian, Jewish, Muslim, Buddhist, and Hindu versions of religious CBT are being developed. The preliminary results described here are particular to the technologies employed in this study and are not results from the CBT clinical trial whose findings will be published in the future after the study ends and data are analyzed. The ultimate goal is to determine if a psychotherapy delivered remotely that integrates patients’ religious resources improves depression more quickly than a therapy that ignores them, and whether religious CBT is more effective than conventional CBT in reversing depression-induced physiological changes.

  3. The usefulness of levin tube inserted drip infusion spiral CT: comparison with conventional method in subtotal gastrectomy patients

    International Nuclear Information System (INIS)

    Park, Young Jin; Kim, Young Hwan; Yoon, Jung Hee; Cha, Soon Joo; Kim, Jeong Sook; Kim, Sung Rok; Hur, Gham; Rhim, Hyun Chul

    1998-01-01

    The purpose of this study is to access the usefulness of newly designed Levin tube inserted drip infusion spiral CT for the evaluation of remnant stomach and anastomosis site in patients who have undergone subtotal gastrectomy for stomach cancer. A new technique named Levin tube inserted drip infusion spiral CT was used to prospectively study 23 patients. A 16Fr Levin tube was inserted into the remnant stomach; 500 ml of tap water was drip infused just before CT scanning and an additional 500 ml of water was infused during IV contrast injection. Water was infused by gravity, using a water bottle suspended at a height of 90 cm (Group A). The 31 patients who underwent conventional spiral CT scanning immediately after the divided ingestion of 900 ml diluted gastrografin were selected as a control group (Group B). The anatomic delineation of the anastomosis site was graded by two radiologists as excellent (3), good(2), fair (1) or poor (0). To evaluate the degree of distension, the maximal diameters of remnant stomach and the anastomosis site, and the thickness of the stomach wall, were also measured. In patients who had undergone subtobal gastrectomy, Levin tube inserted drip infusion spiral CT showed excellent anatomic delineation of the site of anastomosis and remnant stomach. We found that because it increases the distension of remnant stomach and the anastomosis site, this technique is effective for the evaluation of postoperative stomach. (author). 10 refs., 2 tabs., 3 figs

  4. Laparoscopically assisted vaginal hysterectomy using the light-endorsed transvaginal section technique versus the conventional method: a preliminary study.

    Science.gov (United States)

    Lee, J N; Tsai, E M

    2000-01-01

    Laparoscopically assisted vaginal hysterectomy (LAVH) is now being used by an increasing number of gynecologists. However, problems, such as the long operating time, the inherent difficulty of the technique, and limitations of the skills of the surgeons, still exist. Pelvic adhesion, especially in the vesicouterine reflection, may increase the difficulty and morbidity of the operation. We here describe a simple technique, called light-endorsed transvaginal section (LETS), which can facilitate the effectiveness and safety of LAVH. We have designed prospective studies to compare results obtained in 50 cases treated using LAVH plus LETS (study group) with those obtained in 50 cases treated by conventional LAVH (control group). We further divided the study group into 25 'complicated' cases (with pelvic adhesion) and 25 'easy' cases (without pelvic adhesion). The results show that the LETS technique is a simple, safe, and easy way of increasing the efficacy of LAVH, especially as a supplement to LAVH in the presence of pelvic adhesions. Copyright 2000 S. Karger AG, Basel

  5. Comparing the effect of sub-critical water extraction with conventional extraction methods on the chemical composition of Lavandula stoechas.

    Science.gov (United States)

    Giray, E Sultan; Kirici, Saliha; Kaya, D Alpaslan; Türk, Murat; Sönmez, Ozgür; Inan, Memet

    2008-01-15

    The volatile extract composition of Lavandula stoechas flowers obtained by hydrodistillation (HD), subcrtical water extraction (SbCWE) and organic solvent extraction under ultrasonic irradiation (USE) were estimated by gas chromatography-mass spectrometry (GC-MS). One hundred and twenty four components were detected in SbCWE extracts while 94 and 65 signals were gained from HD and USE extracts, respectively. Most of the constituents were identified. The major compounds in all three extracts were fenchon, camphor, myrtenyl acetate, myrtenol and 1,8-cineol, but they differ in quantitatively. The total monoterpene hydrocarbons are higher in HD and USE extracts than those of SbCWE extract. However, SbCWE extract had higher concentration of light oxygenated compounds which contributes to the fragrance of the oil in a major extension. Heavy-oxygenated compounds was also in higher abundance in SbCWE extract (9.90%) than those of HD and USE extracts (3.19 and 4.78%, respectively). Effect of temperature on the extraction yield of SbCWE was investigated and while oil yield was increasing with an increase in temperature, a decrease in the extraction ability of sub-critical water toward the more polar compounds such as, 1,8-cineol, camphor and fenchon, was observed. Kinetic studies shown that SbCWE is clearly quicker than conventional alternatives. Most of components of volatile compounds were extracted at 15min.

  6. Prevalence and pattern of antimicrobial susceptibility in Escherichia coli isolated from pigs reared under antimicrobial-free and conventional production methods.

    Science.gov (United States)

    Bunner, Christine A; Norby, Bo; Bartlett, Paul C; Erskine, Ronald J; Downes, Frances P; Kaneene, John B

    2007-07-15

    To determine and compare levels and patterns of antimicrobial resistance among Escherichia coli isolated from pigs on farms that did not use antimicrobial agents versus pigs produced under conventional methods. Cross-sectional study. Sample Population-35 antimicrobial-free and 60 conventional swine farms. Farms were visited once, and fecal samples were collected from 15 finisher pigs if available. One E coli isolate from each sample was tested for susceptibility pattern to 14 antimicrobial agents by use of microbroth dilution. E coli isolates were recovered from 1,381 (97.1%) of 1,422 fecal samples. Herd size was significantly larger for conventional swine farms. Resistance to ceftriaxone, ciprofloxacin, or nalidixic acid was not observed on any of the 95 farms. Three isolates from 2 conventional farms were resistant to ceftiofur. Conventional farms had significantly higher levels of resistance to ampicillin, sulfamethoxazole, tetracycline, and chloramphenicol, compared with antimicrobial-free farms. Fourteen percent of E coli isolates were susceptible or had intermediate resistance to all the tested antimicrobial agents. The 3 most frequent patterns of multiple resistance were streptomycin-tetracycline, sulfamethoxazole-tetracycline, and kanamycin-streptomycin-sulfamethoxazole-tetracycline. Cessation of antimicrobial use did not appear to result in an immediate reduction in antimicrobial resistance in swine farms. Prospective studies of long-term antimicrobial usage and cessation are needed to estimate the extent to which food animal production may be contributing to antimicrobial drug resistance and might provide a direct measure of the rates of reversibility of antimicrobial drug resistance that might be achieved by curtailing antimicrobial usage.

  7. Reducing Motional Decoherence in Ion Traps with Surface Science Methods

    Science.gov (United States)

    Haeffner, Hartmut

    2014-03-01

    Many trapped ions experiments ask for low motional heating rates while trapping the ions close to trapping electrodes. However, in practice small ion-electrode distances lead to unexpected high heating rates. While the mechanisms for the heating is still unclear, it is now evident that surface contamination of the metallic electrodes is at least partially responsible for the elevated heating rates. I will discuss heating rate measurements in a microfabricated surface trap complemented with basic surface science studies. We monitor the elemental surface composition of the Cu-Al alloy trap with an Auger spectrometer. After bake-out, we find a strong Carbon and Oxygen contamination and heating rates of 200 quanta/s at 1 MHz trap frequency. After removing most of the Carbon and Oxygen with Ar-Ion sputtering, the heating rates drop to 4 quanta/s. Interestingly, we still measure the decreased heating rate even after the surface oxidized from the background gas throughout a 40-day waiting time in UHV.

  8. National implementation of the UNECE convention on long-range transboundary air pollution (effects). Pt. 1. Deposition loads: methods, modelling and mapping results, trends

    Energy Technology Data Exchange (ETDEWEB)

    Gauger, Thomas [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE); Stuttgart Univ. (Germany). Inst. of Navigation; Haenel, Hans-Dieter; Roesemann, Claus [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE)] (and others)

    2008-09-15

    The report on the implementation of the UNECE convention on long-range transboundary air pollution Pt.1, deposition loads (methods, modeling and mapping results, trends) includes the following chapters: Introduction, deposition on air pollutants used for the input for critical loads in exceeding calculations, methods applied for mapping total deposition loads, mapping wet deposition, wet deposition mapping results, mapping dry deposition, dry deposition mapping results, cloud and fog mapping results, total deposition mapping results, modeling the air concentration of acidifying components and heavy metals, agricultural emissions of acidifying and eutrophying species.

  9. Biomimetic superhydrophobic polyolefin surfaces fabricated with a facile scraping, bonding and peeling method

    NARCIS (Netherlands)

    Feng, Huanhuan; Zheng, Tingting; Wang, Huiliang

    2016-01-01

    Inspired by the superhydrophobicity of juicy peach surface, on which microscale hairs are standing vertically to the surface plane, an extremely simple, inexpensive physical method is developed for fabrication of superhydrophobic polyolefin surfaces over large areas. This method includes three

  10. Comparison of sampling methods to recover germinated Bacillus anthracis and Bacillus thuringiensis endospores from surface coupons.

    Science.gov (United States)

    Mott, T M; Shoe, J L; Hunter, M; Woodson, A M; Fritts, K A; Klimko, C P; Quirk, A V; Welkos, S L; Cote, C K

    2017-05-01

    In an attempt to devise decontamination methods that are both effective and minimally detrimental to the environment, we evaluated germination induction as an enhancement to strategies for Bacillus anthracis spore decontamination. To determine an optimal method for the recovery of germinating spores from different matrices, it was critical to ensure that the sampling procedures did not negatively impact the viability of the germinating spores possibly confounding the results and downstream analyses of field trial data. Therefore, the two main objectives of this study were the following: (i) development of an effective processing protocol capable of recovering the maximum number of viable germinating or germinated spores from different surface materials; and (ii) using a model system of spore contamination, employ this protocol to evaluate the potential applicability of germination induction to wide-area decontamination of B. anthracis spores. We examined parameters affecting the sampling efficiencies of B. anthracis and the surrogate species Bacillus thuringiensis on nonporous and porous materials. The most efficient extraction from all matrices was observed using PBS with 0·01% Tween 80 extraction buffer. The addition of a sonication and/or extended vortex treatment did not yield significant increases in spore or germinated spore recovery. Our data demonstrate that previous germination-induction experiments performed in suspension can be reproduced when Bacillus spores are deposited onto reference surfaces materials. Our proof of concept experiment illustrated that a germination pretreatment step significantly improves conventional secondary decontamination strategies and remediation plans. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  11. Method of removing hazardous material deposited on concrete surface

    International Nuclear Information System (INIS)

    Komatsu, Fumiaki; Baba, Kyoji.

    1991-01-01

    A salt compound containing a carbonate group such as sodium carbonate or potassium carbonate is dissolved in water and the aqueous solution is sprayed on the surface of concretes, kept for a predetermined period and dried to deposit the carbonate on the surface of the concretes. Then, aqueous solution of an organic acid such as oxalic acid or citric acid is sprayed and reacted with the carbonate to form bubbles of gaseous carbon dioxide. With such procedures, hazardous material containing radioactive materials intruded to the unevenness or fine holes on the surface of the concrete, or heavy metals such as hexavalent chromium or lead are deposited to the bubbles of gaseous carbon dioxide to be raised up therewith. By removing the bubbles, hazardous materials such as radioactive materials or heavy metals intruded to the concretes can be removed without generating powdery dusts, without requiring a large-scaled device and without changing the characteristic of the concretes. (T.M.)

  12. Methods of remote surface chemical analysis for asteroid missions

    International Nuclear Information System (INIS)

    Sagdeev, R.Z.; Managadze, G.G.; Shutyaev, I.Yu.; Timofeev, P.P.; Szegoe, K.

    1984-06-01

    Different remote sensing methods are discussed which can be applied to investigate the chemical composition of minor bodies of the Solar System. The secondary-ion method, remote laser mass-analysis and electron beam induced X-ray emission analysis are treated in detail. Relative advantages of these techniques are analyzed. The physical limitation of the methods: effects of solar magnetic field and solar wind on the secondary-ion and laser methods and the effect of electrostatic potential of the space apparatus on the ion and electron beam methods are described. First laboratory results of remote laser method are given. (D.Gy.)

  13. A surface refractive index scanning system and method

    DEFF Research Database (Denmark)

    2015-01-01

    The invention relates to a surface refractive index scanning system for characterization of a sample. The system comprises a grating device for holding or receiving the sample, the device comprising at least a first grating region having a first grating width along a transverse direction, and a s......The invention relates to a surface refractive index scanning system for characterization of a sample. The system comprises a grating device for holding or receiving the sample, the device comprising at least a first grating region having a first grating width along a transverse direction...

  14. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    Science.gov (United States)

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  15. Comparison of Polyacetylene Content in Organically and Conventionally Grown Carrots Using a Fast Ultrasonic Liquid Extraction Method

    OpenAIRE

    Søltoft, Malene; Eriksen, M.R.; Träger, A.W.B.; Nielsen, J.; Laursen, Kristian Holst; Husted, Søren; Halekoh, Ulrich; Knuthsen, Pia

    2010-01-01

    A rapid and sensitive analytical method for quantification of polyacetylenes in carrot roots was developed. The traditional extraction method (stirring) was compared to a new ultrasonic liquid processor (ULP)-based methodology using high-performance liquid chromatography−ultraviolet (HPLC−UV) and mass spectrometry (MS) for identification and quantification of three polyacetylenes. ULP was superior because a significant reduction in extraction time and improved extraction efficiencies were ob...

  16. Hydrothermal synthesis of TiO2 Nanotubes: Microwave heating versus conventional heating

    CSIR Research Space (South Africa)

    Sikhwivhilu, LM

    2010-01-01

    Full Text Available and rutile phases. Conventional heating resulted in the formation of tubes with a titanate structure. The two methods yielded tubular structures with similar size dimensions, surface areas and morphologies. The two methods gave 100 % yields of tubes...

  17. Clinical comparative study between the use of lasers and conventional methods of diagnosis and treatment in deciduous teeth with presence of carious lesion

    International Nuclear Information System (INIS)

    Pulga, Fabiane Galvao

    2001-01-01

    The aim of this work was to evaluate the efficiency of deciduous tooth cavity preparation by the Er:YAG laser in comparison with the conventional burr rotary instrument. Besides, we have used the laser fluorescence technique (DIAGNOdent equipment) for diagnosis and compared it to the usual tactile and visual examination as well as X-ray diagnosis. For this purpose, 20 chronic occlusal carious deciduous molar teeth from children with the ages between 5 to 10 years old were selected. Selection was ma de according to visual inspection, X-ray periapical image and measures of the DIAGNOdent. For treatment the teeth were divided in two groups, 10 to be treated by the Er:YAG laser and 10 with conventional burr. For enamel, the laser energy used was in the interval from 200 to 300 mJ; for the dentine the range was from 100 mJ to 200 mJ. In both cases, the laser frequency was in the range from 2 to 4 Hz. The results have shown that the laser treatment was more accepted by the children than the conventional burro Clinical evaluation of the cavity preparation indicates that the Er:YAG laser treatment is recommend. The DIAGNOdent evaluation method was very effective for diagnosis of carious tissue for initial detection. After successful removal of the carious tissue, confirmed by visual inspection, the DIAGNOdent evaluation method was only effective for the treatment with conventional burro For evaluation of the tooth after cavity preparation with the Er:YAG laser, the measurements oscillate covering the full range of the equipment. Therefore, the use of the DIAGNOdent equipment is indicated only for initial caries diagnosis. (author)

  18. Response surface method applied to optimization of estradiol ...

    Indian Academy of Sciences (India)

    An optimization process based on response surface methodology was carried out in order to develop a statistical model which describes the relationship between active independent variables and estradiol flux. This model can be used to find out a combination of factor levels during response optimization. Possible options ...

  19. Membrane mimetic surface functionalization of nanoparticles: Methods and applications

    Science.gov (United States)

    Weingart, Jacob; Vabbilisetty, Pratima; Sun, Xue-Long

    2013-01-01

    Nanoparticles (NPs), due to their size-dependent physical and chemical properties, have shown remarkable potential for a wide range of applications over the past decades. Particularly, the biological compatibilities and functions of NPs have been extensively studied for expanding their potential in areas of biomedical application such as bioimaging, biosensing, and drug delivery. In doing so, surface functionalization of NPs by introducing synthetic ligands and/or natural biomolecules has become a critical component in regards to the overall performance of the NP system for its intended use. Among known examples of surface functionalization, the construction of an artificial cell membrane structure, based on phospholipids, has proven effective in enhancing biocompatibility and has become a viable alternative to more traditional modifications, such as direct polymer conjugation. Furthermore, certain bioactive molecules can be immobilized onto the surface of phospholipid platforms to generate displays more reminiscent of cellular surface components. Thus, NPs with membrane-mimetic displays have found use in a range of bioimaging, biosensing, and drug delivery applications. This review herein describes recent advances in the preparations and characterization of integrated functional NPs covered by artificial cell membrane structures and their use in various biomedical applications. PMID:23688632

  20. Ion implantation method for preparing polymers having oxygen erosion resistant surfaces

    Science.gov (United States)

    Lee, Eal H.; Mansur, Louis K.; Heatherly, Jr., Lee

    1995-01-01

    Hard surfaced polymers and the method for making them are generally described. Polymers are subjected to simultaneous multiple ion beam bombardment, that results in a hardening of the surface, improved wear resistance, and improved oxygen erosion resistance.

  1. A surface defects inspection method based on multidirectional gray-level fluctuation

    Directory of Open Access Journals (Sweden)

    Yunpeng Ma

    2017-05-01

    Full Text Available Machine vision inspection technology provides an efficient tool for surface defects inspection. However, because of the multiformity of surface defects, the existing machine vision methods for surface defects inspection are limited by application scenarios. In order to improve the versatility of algorithms, and to process various kinds of images more accurately, we propose a new adaptive method for surface defect detection, named neighborhood gray-level difference method using the multidirectional gray-level fluctuation. This method changes thresholds and step values by extracting gray-level-fluctuating condition of images, and then it uses the neighborhood gray-level difference to segment defects from background. Experimental results demonstrate the effectiveness of the proposed method for inspecting different surface defects. Compared with other methods, the proposed method can be applied to inspect various surface defects, and it can provide more accurate defect segmentation results.

  2. First-principles Green's-function method for surface calculations: A pseudopotential localized basis set approach

    Science.gov (United States)

    Smidstrup, Søren; Stradi, Daniele; Wellendorff, Jess; Khomyakov, Petr A.; Vej-Hansen, Ulrik G.; Lee, Maeng-Eun; Ghosh, Tushar; Jónsson, Elvar; Jónsson, Hannes; Stokbro, Kurt

    2017-11-01

    We present an efficient implementation of a surface Green's-function method for atomistic modeling of surfaces within the framework of density functional theory using a pseudopotential localized basis set approach. In this method, the system is described as a truly semi-infinite solid with a surface region coupled to an electron reservoir, thereby overcoming several fundamental drawbacks of the traditional slab approach. The versatility of the method is demonstrated with several applications to surface physics and chemistry problems that are inherently difficult to address properly with the slab method, including metal work function calculations, band alignment in thin-film semiconductor heterostructures, surface states in metals and topological insulators, and surfaces in external electrical fields. Results obtained with the surface Green's-function method are compared to experimental measurements and slab calculations to demonstrate the accuracy of the approach.

  3. Occurrence of salmonella and Listeria spp. on retail poultry products in south Italy and comparison of conventional and rapid methods for their detection.

    Science.gov (United States)

    Isidori, M; Pascarella, L; Parrella, A

    2007-06-01

    Salmonella and Listeria spp. are frequently detected in poultry meats. Conventional isolation and identification methods to detect these microrganisms in food are laborious and time-consuming. In the present study the occurrence of Salmonellae and Listeriae on 362 samples of retail poultry in Caserta, South Italy was evaluated and standard microbiological and rapid methods were compared. Furthermore, the samples were collected and analyzed twice a week, on Monday and Friday to establish their possible variability from storage. Both methods showed a strong contamination of samples by Listeria spp. (about 50% for both methods) with 12% Listeria monocytogenes while the contamination of Salmonella was poorer (14-15%). The two procedures showed a good agreement for the detection of Listeriae while the sensitivity of the Rapid test for Salmonellae was poorer (75%). Data about sampling on Monday and Friday highlighted a significant increase in Listeria spp. at the end of the week.

  4. Superiority of Spacer/Mask Topical Anesthetic Compared with Conventional Spray and Gargle Method for Fibreoptic Bronchoscopy

    Directory of Open Access Journals (Sweden)

    RC Balkissoon

    1996-01-01

    Full Text Available OBJECTIVE: To compare the safety and efficacy of a new spacer-oral nasal mask device with those of the standard needle nozzle spray method for the delivery of aerosolized lidocaine to the upper airway for pre-bronchoscopic anaesthesia in a tertiary care hospital.

  5. Effectiveness of two conventional methods for seismic retrofit of steel and RC moment resisting frames based on damage control criteria

    Science.gov (United States)

    Beheshti Aval, Seyed Bahram; Kouhestani, Hamed Sadegh; Mottaghi, Lida

    2017-07-01

    This study investigates the efficiency of two types of rehabilitation methods based on economic justification that can lead to logical decision making between the retrofitting schemes. Among various rehabilitation methods, concentric chevron bracing (CCB) and cylindrical friction damper (CFD) were selected. The performance assessment procedure of the frames is divided into two distinct phases. First, the limit state probabilities of the structures before and after rehabilitation are investigated. In the second phase, the seismic risk of structures in terms of life safety and financial losses (decision variables) using the recently published FEMA P58 methodology is evaluated. The results show that the proposed retrofitting methods improve the serviceability and life safety performance levels of steel and RC structures at different rates when subjected to earthquake loads. Moreover, these procedures reveal that financial losses are greatly decreased, and were more tangible by the application of CFD rather than using CCB. Although using both retrofitting methods reduced damage state probabilities, incorporation of a site-specific seismic hazard curve to evaluate mean annual occurrence frequency at the collapse prevention limit state caused unexpected results to be obtained. Contrary to CFD, the collapse probability of the structures retrofitted with CCB increased when compared with the primary structures.

  6. Effect of Nonthermal, Conventional, and Combined Disinfection Technologies on the Stability of Human Adenoviruses as Fecal Contaminants on Surfaces of Fresh Ready-to-Eat Products.

    Science.gov (United States)

    Birmpa, Angeliki; Bellou, Maria; Kokkinos, Petros; Vantarakis, Apostolos

    2016-03-01

    Over one-half of foodborne diseases are believed to be of viral origin. The ability of viruses to persist in the environment and fresh produce, as well as their low infectious dose, allows even a small amount of contamination to cause serious foodborne problems. Moreover, the consumer's demands for fresh, convenient, and safe foods have prompted research into alternative food disinfection technologies. Our study focuses on viral inactivation by both conventional and alternative nonthermal disinfection technologies on different fresh ready-to-eat food products. The use of chlorine, as well as that of nonthermal technologies such as UV light and ultrasound (US), was tested for different treatment times. UV nonthermal technology was found to be more effective for the disinfection of human adenoviruses (hAdVs) compared with US, achieving a log reduction of 2.13, 1.25, and 0.92 for lettuce, strawberries, and cherry tomatoes, respectively, when UV treatment was implemented for 30 min. US treatment for the same period achieved a log reduction of 0.85, 0.53, and 0.36, respectively. The sequential use of US and UV was found to be more effective compared with when the treatments were used separately, for the same treatment time, thus indicating a synergistic effect. In addition, human adenoviruses were inactivated sooner, when chlorine treatment was used. Therefore, the effect of each disinfection method was dependent upon the treatment time and the type of food.

  7. Investigating the organic and conventional production type of olive oil with target and suspect screening by LC-QTOF-MS, a novel semi-quantification method using chemical similarity and advanced chemometrics.

    Science.gov (United States)

    Kalogiouri, Natasa P; Aalizadeh, Reza; Thomaidis, Nikolaos S

    2017-09-01

    The discrimination of organic and conventional production has been a critical topic of public discussion and constitutes a scientific issue. It remains a challenge to establish a correlation between the agronomical practices and their effects on the composition of olive oils, especially the phenolic composition, since it defines their organoleptic and nutritional value. Thus, a liquid chromatography-electrospray ionization-quadrupole time of flight tandem mass spectrometric method was developed, using target and suspect screening workflows, coupled with advanced chemometrics for the identification of phenolic compounds and the discrimination between organic and conventional extra virgin olive oils. The method was optimized by one-factor design and response surface methodology to derive the optimal conditions of extraction (methanol/water (80:20, v/v), pure methanol, or acetonitrile) and to select the most appropriate internal standard (caffeic acid or syringaldehyde). The results revealed that extraction with methanol/water (80:20, v/v) was the optimum solvent system and syringaldehyde 1.30 mg L -1 was the appropriate internal standard. The proposed method demonstrated low limits of detection in the range of 0.002 (luteolin) to 0.028 (tyrosol) mg kg -1 . Then, it was successfully applied in 52 olive oils of Kolovi variety. In total, 13 target and 24 suspect phenolic compounds were identified. Target compounds were quantified with commercially available standards. A novel semi-quantitation strategy, based on chemical similarity, was introduced for the semi-quantification of the identified suspects. Finally, ant colony optimization-random forest model selected luteolin as the only marker responsible for the discrimination, during a 2-year study. Graphical abstract Investigation of the organic and conventional production type of olive oil by LC-QTOF-MS.

  8. The orthogonal gradients method: A radial basis functions method for solving partial differential equations on arbitrary surfaces

    KAUST Repository

    Piret, Cécile

    2012-05-01

    Much work has been done on reconstructing arbitrary surfaces using the radial basis function (RBF) method, but one can hardly find any work done on the use of RBFs to solve partial differential equations (PDEs) on arbitrary surfaces. In this paper, we investigate methods to solve PDEs on arbitrary stationary surfaces embedded in . R3 using the RBF method. We present three RBF-based methods that easily discretize surface differential operators. We take advantage of the meshfree character of RBFs, which give us a high accuracy and the flexibility to represent the most complex geometries in any dimension. Two out of the three methods, which we call the orthogonal gradients (OGr) methods are the result of our work and are hereby presented for the first time. © 2012 Elsevier Inc.

  9. Ion Beam Methods for the Surface Characterization of Polymers.

    Science.gov (United States)

    1982-02-01

    These surface spectroscopies are useful in many areas of polymer technology including synthesis, extrusion and forming, and long time durability and...Pure and Applied Chemistry Meeting on Polymer Degradation held at Durham University, Durham, England, in July 1981. The author thanks Dr. W. J. Feast...25 7 SIMS Data in Mass Range 160-330 from Teflon Using Charge Neutralization (Ref. 19) 26 8 (a) ISS/SIMS Data for Polypropylene Using 3He+ at 2500 eV

  10. Methods of Attaching or Grafting Carbon Nanotubes to Silicon Surfaces and Composite Structures Derived Therefrom

    Science.gov (United States)

    Tour, James M. (Inventor); Chen, Bo (Inventor); Flatt, Austen K. (Inventor); Stewart, Michael P. (Inventor); Dyke, Christopher A. (Inventor); Maya, Francisco (Inventor)

    2012-01-01

    The present invention is directed toward methods of attaching or grafting carbon nanotubes (CNTs) to silicon surfaces. In some embodiments, such attaching or grafting occurs via functional groups on either or both of the CNTs and silicon surface. In some embodiments, the methods of the present invention include: (1) reacting a silicon surface with a functionalizing agent (such as oligo(phenylene ethynylene)) to form a functionalized silicon surface; (2) dispersing a quantity of CNTs in a solvent to form dispersed CNTs; and (3) reacting the functionalized silicon surface with the dispersed CNTs. The present invention is also directed to the novel compositions produced by such methods.

  11. Artificial Intelligence Mechanisms on Interactive Modified Simplex Method with Desirability Function for Optimising Surface Lapping Process

    Directory of Open Access Journals (Sweden)

    Pongchanun Luangpaiboon

    2014-01-01

    Full Text Available A study has been made to optimise the influential parameters of surface lapping process. Lapping time, lapping speed, downward pressure, and charging pressure were chosen from the preliminary studies as parameters to determine process performances in terms of material removal, lap width, and clamp force. The desirability functions of the-nominal-the-best were used to compromise multiple responses into the overall desirability function level or D response. The conventional modified simplex or Nelder-Mead simplex method and the interactive desirability function are performed to optimise online the parameter levels in order to maximise the D response. In order to determine the lapping process parameters effectively, this research then applies two powerful artificial intelligence optimisation mechanisms from harmony search and firefly algorithms. The recommended condition of (lapping time, lapping speed, downward pressure, and charging pressure at (33, 35, 6.0, and 5.0 has been verified by performing confirmation experiments. It showed that the D response level increased to 0.96. When compared with the current operating condition, there is a decrease of the material removal and lap width with the improved process performance indices of 2.01 and 1.14, respectively. Similarly, there is an increase of the clamp force with the improved process performance index of 1.58.

  12. Building a memory palace in minutes: equivalent memory performance using virtual versus conventional environments with the Method of Loci.

    Science.gov (United States)

    Legge, Eric L G; Madan, Christopher R; Ng, Enoch T; Caplan, Jeremy B

    2012-11-01

    The Method of Loci (MOL) is an ancient mnemonic strategy used to enhance serial recall. Traditionally, the MOL is carried out by imagining navigating a familiar environment and "placing" the to-be-remembered items in specific locations. For retrieval, the mnemonist re-imagines walking through the environment, "looking" for those items in order. Here we test a novel MOL method, where participants use a briefly studied virtual environment as the basis for the MOL and applied the strategy to 10 lists of 11 unrelated words. When our virtual environments were used, the MOL was as effective, compared to an uninstructed control group, as the traditional MOL where highly familiar environments were used. Thus, at least for naïve participants, a highly detailed environment does not support substantially better memory for verbal serial lists. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Review of Electrical and Gravity Methods of Near-Surface ...

    African Journals Online (AJOL)

    The theory and practice of electrical and gravity methods of geophysics for groundwater exploration was reviewed with illustrations and data examples. With the goal of reducing cases of borehole/water-well failure attributed to the lack of the knowledge of the methods of geophysics for groundwater exploration and ...

  14. Review of Electrical and Gravity Methods of Near-Surface ...

    African Journals Online (AJOL)

    USER

    method of groundwater exploration was discussed with field data from Wokbedilo community in Ethopia. ... Electromagnetic and electrical methods have shown superior suitability for groundwater exploration because rock properties that are crucial to hydrogeology ..... Where M and R are the mass and radius of the earth.

  15. Photoswitchable method for the ordered attachment of proteins to surfaces

    Science.gov (United States)

    Camarero, Julio A.; De Yoreo, James J.; Kwon, Youngeun

    2010-04-20

    Described herein is a method for the attachment of proteins to any solid support with control over the orientation of the attachment. The method is extremely efficient, not requiring the previous purification of the protein to be attached, and can be activated by UV-light. Spatially addressable arrays of multiple protein components can be generated by using standard photolithographic techniques.

  16. Assessment of real-time PCR based methods for quantification of pollen-mediated gene flow from GM to conventional maize in a field study.

    Science.gov (United States)

    Pla, Maria; La Paz, José-Luis; Peñas, Gisela; García, Nora; Palaudelmàs, Montserrat; Esteve, Teresa; Messeguer, Joaquima; Melé, Enric

    2006-04-01

    Maize is one of the main crops worldwide and an increasing number of genetically modified (GM) maize varieties are cultivated and commercialized in many countries in parallel to conventional crops. Given the labeling rules established e.g. in the European Union and the necessary coexistence between GM and non-GM crops, it is important to determine the extent of pollen dissemination from transgenic maize to other cultivars under field conditions. The most widely used methods for quantitative detection of GMO are based on real-time PCR, which implies the results are expressed in genome percentages (in contrast to seed or grain percentages). Our objective was to assess the accuracy of real-time PCR based assays to accurately quantify the contents of transgenic grains in non-GM fields in comparison with the real cross-fertilization rate as determined by phenotypical analysis. We performed this study in a region where both GM and conventional maize are normally cultivated and used the predominant transgenic maize Mon810 in combination with a conventional maize variety which displays the characteristic of white grains (therefore allowing cross-pollination quantification as percentage of yellow grains). Our results indicated an excellent correlation between real-time PCR results and number of cross-fertilized grains at Mon810 levels of 0.1-10%. In contrast, Mon810 percentage estimated by weight of grains produced less accurate results. Finally, we present and discuss the pattern of pollen-mediated gene flow from GM to conventional maize in an example case under field conditions.

  17. Ernst Equation and Riemann Surfaces: Analytical and Numerical Methods

    Energy Technology Data Exchange (ETDEWEB)

    Ernst, Frederick J [FJE Enterprises, 511 County Route 59, Potsdam, NY 13676 (United States)

    2007-06-18

    source can be represented by discontinuities in the metric tensor components. The first two chapters of this book are devoted to some basic ideas: in the introductory chapter 1 the authors discuss the concept of integrability, comparing the integrability of the vacuum Ernst equation with the integrability of nonlinear equations of Korteweg-de Vries (KdV) type, while in chapter 2 they describe various circumstances in which the vacuum Ernst equation has been determined to be relevant, not only in connection with gravitation but also, for example, in the construction of solutions of the self-dual Yang-Mills equations. It is also in this chapter that one of several equivalent linear systems for the Ernst equation is described. The next two chapters are devoted to Dmitry Korotkin's concept of algebro-geometric solutions of a linear system: in chapter 3 the structure of such solutions of the vacuum Ernst equation, which involve Riemann theta functions of hyperelliptic algebraic curves of any genus, is contrasted with the periodic structure of such solutions of the KdV equation. How such solutions can be obtained, for example, by solving a matrix Riemann-Hilbert problem and how the metric tensor of the associated spacetime can be evaluated is described in detail. In chapter 4 the asymptotic behaviour and the similarity structure of the general algebro-geometric solutions of the Ernst equation are described, and the relationship of such solutions to the perhaps more familiar multi-soliton solutions is discussed. The next three chapters are based upon the authors' own published research: in chapter 5 it is shown that a problem involving counter-rotating infinitely thin disks of matter can be solved in terms of genus two Riemann theta functions, while in chapter 6 the authors describe numerical methods that facilitate the construction of such solutions, and in chapter 7 three-dimensional graphs are displayed that depict all metrical fields of the associated spacetime

  18. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR.

    Science.gov (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane

    2017-10-01

    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  19. Comparing personal alpha dosimetry with the conventional area monitoring-time weighting methods of exposure estimation: a Canadian assessment

    International Nuclear Information System (INIS)

    Balint, A.B.; Viljoen, J.

    1988-01-01

    An experimental personal alpha dosimetry program for monitoring exposures of uranium mining facility workers in Canada has been completed. All licenced operating mining facilities were participating. Dosimetry techniques, description of dosimeters used by licences, performance and problems associated with the implementation of the programme as well as technical and administrative advantages and difficulties experienced are discussed. Area monitoring-time weighting methods used and results obtained to determine individual radon and thoron daughter exposure and exposure results generated by using dosimeters are assessed and compared

  20. Integral methods for shallow free-surface flows with separation

    DEFF Research Database (Denmark)

    Watanabe, S.; Putkaradze, V.; Bohr, Tomas

    2003-01-01

    an inclined plane we take a similar approach and derive a simple model in which the velocity profile is not restricted to a parabolic or self-similar form. Two types of solutions with large surface distortions are found: solitary, kink-like propagating fronts, obtained when the flow rate is suddenly changed......, and stationary jumps, obtained, for instance, behind a sluice gate. We then include time dependence in the model to study the stability of these waves. This allows us to distinguish between sub- and supercritical flows by calculating dispersion relations for wavelengths of the order of the width of the layer....

  1. A new method for background rejection with surface sensitive bolometers

    International Nuclear Information System (INIS)

    Nones, C.; Foggetta, L.; Giuliani, A.; Pedretti, M.; Salvioni, C.; Sangiorgio, S.

    2006-01-01

    We report the performance of three prototype TeO 2 macrobolometers, able to identify events due to energy deposited at the detector surface. This capability is obtained by thermally coupling thin active layers to the main absorber of the bolometer, and is proved by irradiating the detectors with alpha particles. This technique can be very useful in view of background study and reduction for the CUORE experiment, a next generation Double Beta Decay search based on TeO 2 macrobolometers and to be installed in the Laboratori Nazionali del Gran Sasso

  2. Comparison of conventional straight and swan-neck straight catheters inserted by percutaneous method for continuous ambulatory peritoneal dialysis: a single-center study.

    Science.gov (United States)

    Singh, Shivendra; Prakash, Jai; Singh, R G; Dole, P K; Pant, Pragya

    2015-10-01

    To evaluate the incidence of mechanical and infectious complications of conventional straight catheter (SC) versus swan-neck straight catheter (SNSC) implanted by percutaneous method. We retrospectively analyzed 45 catheter insertions being done by percutaneous method from January 1, 2011, to May 31, 2014. SC was inserted in 24 patients, and SNSC was inserted in 21 patients. Baseline characteristics for the two groups were similar with respect to age, sex and diabetic nephropathy as the cause for end-stage renal disease. Incidence of mechanical and infectious complications in SNSC group was found to be low as compared to the SC group and was statistically significant (1 in 11.6 patient months vs. 1 in 14.4 patient months, p = 0.02). Catheter migration was found to be the most common mechanical complication (20 %), and peritonitis was found to be the most common infectious complication in conventional SC group (27 episodes in 420 patient months vs. 11 episodes in 333 patient months, p = 0.03). The incidence of exit site and tunnel infection rates revealed no difference between the groups. SNSC insertion by percutaneous method is associated with low mechanical and infectious complications.

  3. Using of the surface activation method for enhancement of machine realibility

    International Nuclear Information System (INIS)

    Postnikov, V.I.; Garbar, I.N.

    1979-01-01

    A surface activation method is described for controlling the wear of units and details, allowing one to measure the wear at continuous operation of the mechanism by any program. The main advantages of the surface activation method for the wear tests are shown. By means of that method it was possible to develop a simultaneous controlling conjugate detail wear, and a method of different-activity brands, as well as the method for repeated activation of details. Development of theory for the engineering and technology of engine wear control by the surface activation method allowed one to improve the efficiency and reduce the time of research in the field of friction and wear

  4. Optimization of microcapsules shell structure to preserve labile compounds: A comparison between microfluidics and conventional homogenization method.

    Science.gov (United States)

    Ravanfar, Raheleh; Comunian, Talita A; Dando, Robin; Abbaspourrad, Alireza

    2018-02-15

    A new technique is presented to optimize the formulation of microcapsules loaded with labile compounds. Fish oil was loaded into the microcapsule core and protected with a shell composed of whey protein microgel/beet pectin complexes. The microcapsules were formed using two different methods: microfluidics and homogenization. The microcapsules were further classified into three sub-groups. The first group was the microcapsules cross-linked with laccase (MCL), the second group was the microcapsules cross-linked with divalent cationic CaCl 2 salt (MCS), and the third group consisted of control microcapsules (CM), with no cross-linking. The microfluidics method enabled tracking of the effect of the shell cross-linking ability of laccase, or CaCl 2 , on microcapsules. It was demonstrated that MCL obtained by microfluidics are more physicochemically stable than those produced via a homogenizer. The effect of cross-linking agents on the microcapsules were more significant when the microcapsules were produced by microfluidics. Published by Elsevier Ltd.

  5. Prediction of postoperative pulmonary function: preliminary comparison of single-breath dual-energy xenon CT with three conventional methods.

    Science.gov (United States)

    Yanagita, Hisami; Honda, Norinari; Nakayama, Mitsuo; Watanabe, Wataru; Shimizu, Yuji; Osada, Hisato; Nakada, Kei; Okada, Takemichi; Ohno, Hitoshi; Takahashi, Takeo; Otani, Katharina

    2013-06-01

    To assess the use of xenon ventilation maps (Xe-images) for predicting postoperative pulmonary function. After study approval by the institutional review board, written informed consent was obtained from 30 patients with lung tumors who underwent pre- and postoperative spirometry, pulmonary perfusion SPECT and dual-energy CT (80 kV and 140 kV/Sn) after single-breath inspiration of 35 % xenon. Xe-images were calculated by three-material decomposition. Sum of pixel values of the part to be resected (A) and of the whole lung (B) on Xe-images or lung perfusion SPECT, and volumes or the number of segments of the part to be resected (A) and of the whole lung (B) on Xe-images were enumerated, respectively. We multiplied (1 - A/B) by each preoperative value from spirometry for prediction. Predictions by each of the four methods were compared with postoperative values. Predicted values for vital capacity (VC), forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV1) by the four methods regressed significantly with measured values (R (2) = 0.56-0.77, p < 0.001 for all). Analysis of Xe-images can predict postoperative VC, FVC and FEV1 with accuracy comparable to that of CT volumetry.

  6. Prediction of postoperative pulmonary function. Preliminary comparison of single-breath dual-energy xenon CT with three conventional methods

    International Nuclear Information System (INIS)

    Yanagita, Hisami; Honda, Norinari; Nakayama, Mitsuo

    2013-01-01

    The purpose of this study was to assess the use of xenon ventilation maps (Xe-images) for predicting postoperative pulmonary function. After study approval by the institutional review board, written informed consent was obtained from 30 patients with lung tumors who underwent pre- and postoperative spirometry, pulmonary perfusion single photon emission computed tomography (SPECT) and dual-energy CT (80 kV and 140 kV/Sn) after single-breath inspiration of 35% xenon. Xe-images were calculated by three-material decomposition. Sum of pixel values of the part to be resected (A) and of the whole lung (B) on Xe-images or lung perfusion SPECT, and volumes or the number of segments of the part to be resected (A) and of the whole lung (B) on Xe-images were enumerated, respectively. We multiplied (1-A/B) by each preoperative value from spirometry for prediction. Predictions by each of the four methods were compared with postoperative values. Predicted values for vital capacity (VC), forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV 1 ) by the four methods regressed significantly with measured values (R 2 =0.56-0.77, p 1 with accuracy comparable to that of CT volumetry. (author)

  7. Advanced Bayesian Methods for Lunar Surface Navigation, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — The key innovation of this project is the application of advanced Bayesian methods to integrate real-time dense stereo vision and high-speed optical flow with an...

  8. Advanced Bayesian Methods for Lunar Surface Navigation, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — The key innovation of this project will be the application of advanced Bayesian methods to integrate real-time dense stereo vision and high-speed optical flow with...

  9. Natural Language Processing-Enabled and Conventional Data Capture Methods for Input to Electronic Health Records: A Comparative Usability Study.

    Science.gov (United States)

    Kaufman, David R; Sheehan, Barbara; Stetson, Peter; Bhatt, Ashish R; Field, Adele I; Patel, Chirag; Maisel, James Mark

    2016-10-28

    The process of documentation in electronic health records (EHRs) is known to be time consuming, inefficient, and cumbersome. The use of dictation coupled with manual transcription has become an increasingly common practice. In recent years, natural language processing (NLP)-enabled data capture has become a viable alternative for data entry. It enables the clinician to maintain control of the process and potentially reduce the documentation burden. The question remains how this NLP-enabled workflow will impact EHR usability and whether it can meet the structured data and other EHR requirements while enhancing the user's experience. The objective of this study is evaluate the comparative effectiveness of an NLP-enabled data capture method using dictation and data extraction from transcribed documents (NLP Entry) in terms of documentation time, documentation quality, and usability versus standard EHR keyboard-and-mouse data entry. This formative study investigated the results of using 4 combinations of NLP Entry and Standard Entry methods ("protocols") of EHR data capture. We compared a novel dictation-based protocol using MediSapien NLP (NLP-NLP) for structured data capture against a standard structured data capture protocol (Standard-Standard) as well as 2 novel hybrid protocols (NLP-Standard and Standard-NLP). The 31 participants included neurologists, cardiologists, and nephrologists. Participants generated 4 consultation or admission notes using 4 documentation protocols. We recorded the time on task, documentation quality (using the Physician Documentation Quality Instrument, PDQI-9), and usability of the documentation processes. A total of 118 notes were documented across the 3 subject areas. The NLP-NLP protocol required a median of 5.2 minutes per cardiology note, 7.3 minutes per nephrology note, and 8.5 minutes per neurology note compared with 16.9, 20.7, and 21.2 minutes, respectively, using the Standard-Standard protocol and 13.8, 21.3, and 18.7 minutes

  10. Evaluation of chemical surface treatment methods for mitigation of PWSCC

    International Nuclear Information System (INIS)

    Dame, C.; Marks, C.; Olender, A.; Farias, J.

    2015-01-01

    As part of its mission to propose innovative and safe technologies to mitigate Primary Water Stress Corrosion Cracking (PWSCC) in Pressurized Water Reactors (PWR), EPRI recently initiated a program to evaluate potential new chemical surface treatments that might delay the occurrence of PWSCC such that no failure of components would be observed during their lifetime. Among the initial screening of more than thirty technologies, seven were selected for a more detailed review. The selected technologies were: nickel and nickel alloy plating, organic inhibitors, chromium-based inhibitors, silicon carbide, titanium-based inhibitors, rare earth metal (REM)-based inhibitors and encapsulation. The conclusions of the review of these technologies were that two of them were worth pursuing, titanium-based and REM-based inhibitors, and that evaluating the radiological consequences of injecting these products in the primary system, as well as assessing their efficacy to mitigate PWSCC, should be prioritized as the next required steps in qualification for implementation. (authors)

  11. Application of response surface methodology method in designing corrosion inhibitor

    Science.gov (United States)

    Asmara, Y. P.; Athirah; Siregar, J. P.; Kurniawan, T.; Bachtiar, D.

    2017-10-01

    In oil and gas pipelines and offshore structure, inhibitors have been considered to be the first choice to reduce corrosion rate. There are many corrosion inhibitor compositions available in the market. To produce the best corrosion inhibitor requires many experimental data which is not efficient. These experiments used response surface methodology (RSM) to select corrosion inhibitor compositions. The experiments investigated effects of corrosion inhibition on corrosion rate of low carbon steel in 3% NaCl solution with different concentrations of selected main inhibitor compositions which are ethyl acetate (EA), ethylene glycol (EG) and sodium benzoate (SB). Corrosion rate were calculated using linear polarization resistance (LPR). All of the experiments were set in natural conditions at pH 7. MINITAB® version 15 was used for data analysis. It is shown that a quadratic model is a representative model can predict best corrosion inhibitor composition comprehensibly.

  12. Preparation of nickel and Ni{sub 3}Sn nanoparticles via extension of conventional citric acid and ethylene diamine tetraacetic acid mediated sol–gel method

    Energy Technology Data Exchange (ETDEWEB)

    Li, Pingyun, E-mail: lpyljr@126.com; Deng, Guodong; Guo, Xiaode; Liu, Hongying; Jiang, Wei; Li, Fengsheng

    2016-05-25

    This work aims to extend the application field of sol–gel process from conventional oxides, carbides, sulfides to metallic nanocrystalline materials. Metallic ions were coordinated with chelating agents of citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) in aqueous solution. Then the solutions were dried at 383 K, resulting in the formation of sol and gel. Heating treatments of dried gels were then carried out with protection of N{sub 2} atmosphere. Ni and Ni{sub 3}Sn alloy nanoparticles were obtained by this sol–gel method in the range of 623–823 K. The as-prepared Ni and Ni{sub 3}Sn alloy nanoparticles have average grain sizes of 15 and 30 nm, and have face-centred-cubic (fcc) crystalline phase. Our results provide new insight into the application of conventional sol–gel method. - Graphical abstract: Sol–gel method is conventionally applied to prepare oxides, carbides, and sulfides. In this work, the application field of sol–gel method is extended to metallic nanoparticles. By using citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) mediated sol–gel method, metallic Ni (a and c) and Ni{sub 3}Sn (b and d) alloy nanoparticles can be prepared when the heating treatments are performed under N{sub 2} protecting atmosphere. The Ni and Ni{sub 3}Sn nanoparticles have face-centered-cubic (fcc) crystalline phase and ultrafine grain sizes. Diffraction peaks of (110) superstructure reflection plane of Ni{sub 3}Sn nanoparticles can also be observed in Figure b, which can be considered as direct evidence of formation of alloy crystalline phase by performing this sol–gel method. - Highlights: • Ni and Ni{sub 3}Sn alloy nanoparticles have been prepared by sol–gel processes. • Citric acid and ethylene diamine tetraacetic acid were applied as chelating agent. • Diffraction peak of superstructure reflection plane of Ni{sub 3}Sn was detected by XRD. • A novel strategy for preparation of alloy nanoparticles has been presented.

  13. Mixture and method for simulating soiling and weathering of surfaces

    Science.gov (United States)

    Sleiman, Mohamad; Kirchstetter, Thomas; Destaillats, Hugo; Levinson, Ronnen; Berdahl, Paul; Akbari, Hashem

    2018-01-02

    This disclosure provides systems, methods, and apparatus related to simulated soiling and weathering of materials. In one aspect, a soiling mixture may include an aqueous suspension of various amounts of salt, soot, dust, and humic acid. In another aspect, a method may include weathering a sample of material in a first exposure of the sample to ultraviolet light, water vapor, and elevated temperatures, depositing a soiling mixture on the sample, and weathering the sample in a second exposure of the sample to ultraviolet light, water vapor, and elevated temperatures.

  14. Comparison of in-situ gamma ray spectrometry measurements with conventional methods in determination natural and artificial nuclides in soil

    International Nuclear Information System (INIS)

    Al-Masri, M. S.; Doubal, A. W.

    2010-12-01

    Two nuclear analytical techniques (In-Situ Gamma ray spectrometry and laboratory gamma ray spectrometry) for determination of natural and artificial radionuclides in soil have been validated. The first technique depends on determination of radioactivity content of representative samples of the studied soil after laboratory preparation, while the second technique is based on direct determination of radioactivity content of soil using in-situ gamma-ray spectrometer. Analytical validation parameter such as detection limits, repeatability, reproducibility in addition to measurement uncertainties were estimated and compared for both techniques. Comparison results have shown that the determination of radioactivity in soil should apply the two techniques together where each of techniques is characterized by its low detection limit and uncertainty suitable for defined application of measurement. Radioactive isotopes in various locations were determined using the two methods by measuring 40 k, 238 U,and 137 Cs. The results showed that there are differences in attenuation factors due to soil moisture content differences; wet weight corrections should be applied when the two techniques are compared. (author)

  15. Indium-111-labeled autologous leukocyte imaging and fecal excretion. Comparison with conventional methods of assessment of inflammatory bowel disease

    International Nuclear Information System (INIS)

    Leddin, D.J.; Paterson, W.G.; DaCosta, L.R.; Dinda, P.K.; Depew, W.T.; Markotich, J.; McKaigney, J.P.; Groll, A.; Beck, I.T.

    1987-01-01

    This study was designed to evaluate the role of 111 In-labeled leukocyte imaging and fecal excretion in the assessment of inflammatory bowel disease. We compared these tests to various indices of disease activity in Crohn's disease, to Truelove's grading in ulcerative colitis, and to endoscopy, x-ray, and pathology in both diseases. Eleven controls, 16 patients with Crohn's disease, 13 with ulcerative colitis, and 3 with other types of acute bowel inflammation were studied (positive controls). Indium scanning was performed at 1, 4, and 24 hr. Fourteen of 16 patients with active Crohn's disease had positive scans but in only five was localization accurate. One patient had inactive ulcerative colitis, and the scan was negative. Of 12 patients with active ulcerative colitis, 10 had positive scans but disease localization was accurate in only four. Disease extent was correctly defined in 1 of the 3 Positive Controls. There was no significant difference in the accuracy of scanning at 1, 4, or 24 hr. 111 In fecal excretion was significantly higher in patients with inflammatory bowel disease than in controls, and there was correlation between 111 In fecal excretion and most of the indices of disease activity in Crohn's disease. In ulcerative colitis, 111 In fecal excretion did not correlate with Truelove's grading but reflected colonoscopic assessment of severity. In conclusion, 111 In-labeled leukocyte scanning lacks sensitivity with respect to disease extent, but fecal excretion of 111 In correlates well with disease severity as determined by other methods

  16. Comparison of conventional full spine radiographs and fluoroscopic scanning method in young patients with idiopathic scoliosis; Vergleich von konventioneller Wirbelsaeulenganzaufnahme und fluoroskopischer Scan-Methode bei jungen Patienten mit idiopathischer Skoliose

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, J.; Kottke, R.; Claussen, C. [Abt. fuer Radiologische Diagnostik, Universitaetsklinikum Tuebingen (Germany); Kluba, T.; Niemeyer, T.; Hahnfeldt, T. [Klinik und Poliklinik fuer Orthopaedie, Universitaetsklinikum Tuebingen (Germany); Vonthein, R. [Inst. fuer Medizinische Biometrie, Universitaetsklinikum Tuebingen (Germany); Kamm, K.F. [Philips Medizin Systeme GmbH, Hamburg (Germany)

    2005-08-01

    Purpose: evaluation of low-dose full spine radiographs using fluoroscopic images for the assessment of the Cobb angle measurement in patients with scoliosis. Material and methods: twenty-one consecutive patients (aged 10-27 years, mean age 14 years) with a conventional full spine examination (film speed class 800) underwent a follow-up exam using digital pulsed fluoroscopy (Multi Diagnost 4, Philips Medical Systems, Eindhoven, The Netherlands). The mean follow-up was 9 months. During a synchronized scan with a C-arm speed of 4 cm/sec fluoroscopic images were stored with a pulsed frequency of 3 images per second. The single images were merged and reconstructed to one image with the software easy spine (Philips medical Systems, Eindhoven, The Netherlands). The corresponding dose-area product values (DAP) of both methods were compared. Three independent observers assessed Cobb angles and image quality for each technique. Results: the mean DAP values for conventional imaging was 94.9 cGy x cm{sup 2} and for fluoroscopy 7.8 cGy x cm{sup 2}, respectively. A significant dose reduction of 91.8% (CI 91% to 95%) was calculated. The average absolute angle difference between the observers was found to be 2.7 for conventional imaging and 2.4 for the fluoroscopic method. Interobserver standard deviation of 2.9 was lower than the 5.3 for conventional images. Image quality was better in the conventional images. Conclusion: using the scanning method, we could achieve a mean reduction of the radiation dose of 92%, while the accuracy of the Cobb angle measurements was comparable for both techniques despite of reduced image quality of digital fluoroscopy. (orig.)

  17. Ex Vivo Comparison of Mtwo and RaCe Rotary File Systems in Root Canal Deviation: One File Only versus the Conventional Method

    Directory of Open Access Journals (Sweden)

    Mohsen Aminsobhani

    2016-01-01

    Full Text Available Objectives: Cleaning and shaping of the root canal system is an important step in endodontic therapy. New instruments incorporate new preparation techniques that can improve the efficacy of cleaning and shaping. The aim of this study was to compare the efficacy of Mtwo and RaCe rotary file systems in straightening the canal curvature using only one file or the conventional method.Materials and Methods: Sixty mesial roots of extracted human mandibular molars were prepared by RaCe and Mtwo nickel-titanium (NiTi rotary files using the conventional and only one rotary file methods. The working length was 18 mm and the curvatures of the root canals were between 15-45°. By superimposing x-ray images before and after the instrumentation, deviation of the canals was assessed using Adobe Photoshop CS3 software. Preparation time was recorded. Data were analyzed using three-way ANOVA and Tukey’s post hoc test.Results: There were no significant differences between RaCe and Mtwo or between the two root canal preparation methods in root canal deviation in buccolingual and mesiodistal radiographs (P>0.05. Changes of root canal curvature in >35° subgroups were significantly more than in other subgroups with smaller canal curvatures. Preparation time was shorter in one file only technique.Conclusion: According to the results, the two rotary systems and the two root canal preparation methods had equal efficacy in straightening the canals; but the preparation time was shorter in one file only group.

  18. A simple method to assess bacterial attachment to surfaces

    Digital Repository Service at National Institute of Oceanography (India)

    Sonak; Bhosle

    of ineubation. There was a highly significant positive linear relationship between crystal violet stained attached cells and the viable cell count of cells attached to aluminium panels (r = 0.9997; p less than 0.001: n = 6). The method is relatively simple...

  19. Comparative evaluation of optical methods and conventional isotope techniques for the detection of insulin receptors in heterogenous cell systems

    International Nuclear Information System (INIS)

    Thun, C.

    1984-01-01

    The findings of studies using radioactively labelled (I-125) insulin to characterise its binding to various heterogenous cell systems had led to a classification of the relevant receptors with those of high affinity and low capacity or vice versa. This, in turn, raised questions as to the binding properties of each individual cell or cell material of a heterogenous nature. Apparently homogenous (lymphocytes) and heterogenous (blood and islet cells) cell populations were investigated on the basis of various techniques for the separate evaluation of individual cells, which were cytofluorometry using FITC insulin and the analysis of gold insulin under the electron microscope. For the association kinetics and equilibration analysis or affinity and receptor quantity a radioactive tracer and light microscope were used. Insulin was shown to bind to erythrocytes, reticulocytes, monocytes and lymphocytes and this result finds confirmation in the relevant literature. Furthermore, binding parameters could be determined for isolated islet cells. Cytofluorometry pointed to the fact that the insulin receptors of an apparently homogenous cell system differed in affinity and number and permitted the use of a multiple parameter procedure. Thus, it holds out promise as a method to be routinely used in the clinical diagnosis of binding parameters, without requiring previous separation procedures that are complicated or involve a loss of material. Transmission electron microscopy permitted conclusions to be drawn as to the type of cell to which insulin is attached. Owing to the use of gold insulin it was possible to throw some light on the factors determining the fate of membrane-bound insulin during its uptake into the cell. (TRV) [de

  20. The calculation of surface free energy based on embedded atom method for solid nickel

    International Nuclear Information System (INIS)

    Luo Wenhua; Hu Wangyu; Su Kalin; Liu Fusheng

    2013-01-01

    Highlights: ► A new solution for accurate prediction of surface free energy based on embedded atom method was proposed. ► The temperature dependent anisotropic surface energy of solid nickel was obtained. ► In isotropic environment, the approach does not change most predictions of bulk material properties. - Abstract: Accurate prediction of surface free energy of crystalline metals is a challenging task. The theory calculations based on embedded atom method potentials often underestimate surface free energy of metals. With an analytical charge density correction to the argument of the embedding energy of embedded atom method, an approach to improve the prediction for surface free energy is presented. This approach is applied to calculate the temperature dependent anisotropic surface energy of bulk nickel and surface energies of nickel nanoparticles, and the obtained results are in good agreement with available experimental data.

  1. The modal surface interpolation method for damage localization

    Science.gov (United States)

    Pina Limongelli, Maria

    2017-05-01

    The Interpolation Method (IM) has been previously proposed and successfully applied for damage localization in plate like structures. The method is based on the detection of localized reductions of smoothness in the Operational Deformed Shapes (ODSs) of the structure. The IM can be applied to any type of structure provided the ODSs are estimated accurately in the original and in the damaged configurations. If the latter circumstance fails to occur, for example when the structure is subjected to an unknown input(s) or if the structural responses are strongly corrupted by noise, both false and missing alarms occur when the IM is applied to localize a concentrated damage. In order to overcome these drawbacks a modification of the method is herein investigated. An ODS is the deformed shape of a structure subjected to a harmonic excitation: at resonances the ODS are dominated by the relevant mode shapes. The effect of noise at resonance is usually lower with respect to other frequency values hence the relevant ODS are estimated with higher reliability. Several methods have been proposed to reliably estimate modal shapes in case of unknown input. These two circumstances can be exploited to improve the reliability of the IM. In order to reduce or eliminate the drawbacks related to the estimation of the ODSs in case of noisy signals, in this paper is investigated a modified version of the method based on a damage feature calculated considering the interpolation error relevant only to the modal shapes and not to all the operational shapes in the significant frequency range. Herein will be reported the comparison between the results of the IM in its actual version (with the interpolation error calculated summing up the contributions of all the operational shapes) and in the new proposed version (with the estimation of the interpolation error limited to the modal shapes).

  2. A quantitative method to estimate high gloss polished tool steel surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Rebeggiani, S; Rosen, B-G [Halmstad University, The Functional Surfaces Research Group, Box 823, SE-301 18 HALMSTAD (Sweden); Sandberg, A, E-mail: sabina.rebeggiani@hh.se [Uddeholms AB, SE-683 85 Hagfors (Sweden)

    2011-08-19

    Visual estimations are today the most common way to assess the surface quality of moulds and dies; a method that are both subjective and, with today's high demands on surfaces, hardly usable to distinguish between the finest surface qualities. Instead a method based on non-contact 3D-surface texture analysis is suggested. Several types of tool steel samples, manually as well as machine polished, were analysed to study different types of surface defects such as pitting, orange peel and outwardly features. The classification of the defect structures serves as a catalogue where known defects are described. Suggestions of different levels of 'high surface quality' defined in numerical values adapted to high gloss polished tool steel surfaces are presented. The final goal is to develop a new manual that can work as a 'standard' for estimations of tool steel surfaces for steel producers, mould makers, polishers etc.

  3. Comparison of two methods of surface profile extraction from multiple ultrasonic range measurements

    NARCIS (Netherlands)

    Barshan, B; Baskent, D

    Two novel methods for surface profile extraction based on multiple ultrasonic range measurements are described and compared. One of the methods employs morphological processing techniques, whereas the other employs a spatial voting scheme followed by simple thresholding. Morphological processing

  4. Effect of ecological surface treatment method on friction strength properties of nettle (urtica dioica) fibre yarns

    Science.gov (United States)

    Şansal, S.; Mıstık, S. I.; Fettahov, R.; Ovalı, S.; Duman, M.

    2017-10-01

    Over the last few decades, more attention is given to lignocellulose based fibres as reinforcement material in the polymer composites owing to the environmental pollution caused by the extensive usage of synthetic and inorganic fibres. Developing new natural fibre reinforced composites is the focus of many researches nowadays. They are made from renewable resources and they have less environmental effect in comparison to inorganic fibre reinforced composites. The interest of consumers in eco-friendly natural fibres and textiles has increased in recent years. Unlike inorganic fibres, natural fibres present light weight, high strength/density ratio and are readily available, environmentally friendly and biodegradable. Many different types of natural fibres are exploited for the production of biodegradable polymer composites. The nettle (Urtica dioica L.) is a well-known plant growing on rural sites of Europe, Asia, and North America. Nettle plant contains fibre similar to hemp and flax. However, similar to other natural fibres, nettle fibres are poorly compatible with the thermoplastic matrix of composites, due to their hydrophilic character which reduces mechanical properties of nettle fibre reinforced thermoplastics. In order to improve the fibrematrix adhesion of the natural fibre reinforced composites, surface treatment processes are applied to the lignocellulose fibres. In this study nettle (urtica dioica) fibre yarns were treated with NaOH by using conventional, ultrasonic and microwave energy methods. After treatment processes tensile strength, elongation, friction strength and SEM observations of the nettle fibre yarns were investigated. All treatment processes were improved the tensile strength, elongation and friction strength properties of the nettle fibre yarns. Also higher tensile strength, elongation and friction strength properties were obtained from treated nettle fibre yarns which treated by using microwave energy method.

  5. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  6. A new quantitative index of lobar air trapping in chronic obstructive pulmonary disease (COPD): Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Nagatani, Yukihiro, E-mail: yatsushi@belle.shiga-med.ac.jp [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Murata, Kiyoshi; Takahashi, Masashi; Nitta, Norihisa [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Nakano, Yasutaka [Division of Respiratory Medicine, Department of Internal Medicine, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Sonoda, Akinaga; Otani, Hideji [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Okabe, Hidetoshi [Department of Clinical Laboratory, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Ogawa, Emiko [Health Administration Center, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2015-05-15

    Highlights: • In the total lung field, AVI had excellent correlation with FEV{sub 1}/FVC. • AVI showed differences between three groups classified by the COPD severity. • In a lobe-based analysis, AVI did not mostly correlated with volume decrease ratio. • In a lobe-based analysis, coefficient of variation was relatively small in AVI. • In some lobes, AVI associated with the COPD severity despite respiratory level. - Abstract: Purpose: To determine the usefulness of newly-proposed index (attenuation–volume index, AVI: increase in mean value of lung attenuation (MVLA) divided by volume decrease ratio (VDR)) for quantitative assessment of lobar air trapping (LAT) using expiratory/inspiratory (E/I) computed tomography (CT) by minimizing influence of respiratory level. Materials and methods: Institutional review board approved study protocol. Twenty-one moderate or severe COPD (group A), 16 mild COPD (group B) and 26 normal volunteers (group C) underwent both E/I scans via 320-row CT and pulmonary functional test (PFT). Volume image data were automatically segmented into six lung lobes with minimal manual intervention. AVI, pixel index (PI), air trapping ratio (ATR) and relative volume change (RVC{sub 860–950}) were calculated in total lung (TL) and each lobe. Four indices in TL were correlated with both PFT result and VDR and those in TL and each lobe were compared between three groups. Results: Similar to ATR, AVI correlated with both FEV{sub 1}/FVC (r = 0.772, p < 0.01) and RV/TLC (r = −0.726, p < 0.01) and demonstrated a significant difference between three groups in both TL (group A: 1.69 ± 0.45, group B: 2.21 ± 0.45 and group C: 2.80 ± 0.44) and five lobes except for left lingular segment. In a lobe-based analysis regarding relationship with VDR, AVI was much less dependent than ATR, although regression lines of groups A and C were separated for AVI as well as ATR. Coefficient of variation of either PI or RVC{sub 860–950} was significantly

  7. Comparison of validity of DIAGNOdent with conventional methods for detection of occlusal caries in primary molars using the histological gold standard: An in vivo study

    Directory of Open Access Journals (Sweden)

    Goel A

    2009-01-01

    Full Text Available Aim: This study was conducted to compare the in vivo effectiveness of DIAGNOdent with other conventional methods (visual, tactile and bitewing radiographs for the detection of occlusal caries in primary molars. Another objective of the study was to calculate new cut-off limits for the detection of caries by DIAGNOdent in primary teeth. Materials and Methods: Eighty-four primary molars in 52 children (aged 8-12 years, which were indicated for extraction, were selected and evaluated for dental caries using DIAGNOdent, visual and tactile examination and bitewing radiographs. Histological examination of the sections, prepared subsequent to extraction of the teeth, served as the gold standard for comparison of the above-mentioned methods. Results: When considering enamel caries, values obtained for sensitivity, specificity and accuracy were 48.15, 100 and 49.40% for visual examination, 48.15, 100.00 and 49.40% for tactile examination, 49.38, 50.00 and 49.40% for bitewing radiographs, 85.19, 50.00 and 84.34% for DIAGNOdent scores interpreted according to manufacturer′s cut-off limits and 81.48, 100.00 and 81.93% for DIAGNOdent scores interpreted according to newly formulated cut-off limits, respectively. At dentin caries cut-off levels, the values of sensitivity, specificity and accuracy for visual examination were 52.78, 89.36 and 73.49%; 50.00, 91.49 and 73.49% for tactile examination; 30.56, 82.98 and 60.24% for bitewing radiographs; 72.22, 76.60 and 74.70% for DIAGNOdent scores when interpreted according to manufacturer′s cut-off limits and 77.48, 74.47 and 75.90%, respectively, for the DIAGNOdent scores when interpreted according to the newly formulated cut-off limits. Conclusions: DIAGNOdent showed higher sensitivity and accuracy as compared with other conventional methods for detection of enamel caries, whereas for detection of dentinal caries, even though the sensitivity was high, accuracy of the DIAGNOdent device was similar to other

  8. Method of defence of solder surface from oxidization

    Directory of Open Access Journals (Sweden)

    Kurmashev Sh. D.

    2010-02-01

    Full Text Available Compositions are developed for defence of fusion solder from oxidization on the basis of mixture of glycerin, urea and powders of refractory oxides, carbides (Al2O3, TiO2, SIC, graphite. The offered compositions can be used for defence of fusion of solder from oxidization in the process of soludering and tinning of explorers, and also electric conclusions of elements of radio electronic apparatus by the method of immersion in stationary baths.

  9. Comparison of real-time PCR methods for the detection of Naegleria fowleri in surface water and sediment.

    Science.gov (United States)

    Streby, Ashleigh; Mull, Bonnie J; Levy, Karen; Hill, Vincent R

    2015-05-01

    Naegleria fowleri is a thermophilic free-living ameba found in freshwater environments worldwide. It is the cause of a rare but potentially fatal disease in humans known as primary amebic meningoencephalitis. Established N. fowleri detection methods rely on conventional culture techniques and morphological examination followed by molecular testing. Multiple alternative real-time PCR assays have been published for rapid detection of Naegleria spp. and N. fowleri. Foursuch assays were evaluated for the detection of N. fowleri from surface water and sediment. The assays were compared for thermodynamic stability, analytical sensitivity and specificity, detection limits, humic acid inhibition effects, and performance with seeded environmental matrices. Twenty-one ameba isolates were included in the DNA panel used for analytical sensitivity and specificity analyses. N. fowleri genotypes I and III were used for method performance testing. Two of the real-time PCR assays were determined to yield similar performance data for specificity and sensitivity for detecting N. fowleri in environmental matrices.

  10. Laser-induced breakdown spectroscopy of archaeological findings with calibration-free inverse method: comparison with classical laser-induced breakdown spectroscopy and conventional techniques.

    Science.gov (United States)

    Gaudiuso, R; Dell'Aglio, M; De Pascale, O; Loperfido, S; Mangone, A; De Giacomo, A

    2014-02-27

    A modified version of the calibration-free (CF) method was applied to the analysis of a set of archaeological brooches made of various copper-based alloys and coming from the archaeological site of Egnatia (Apulia, Southern Italy). The developed methodology consists in determining the plasma temperature by reversing the set of equations employed in the usual CF algorithm, and it is thus referred to as "inverse method". The plasma temperature is determined for one certified standard, by using its known elemental composition as an input data, and then applied to the set of unknown samples to evaluate their composition in a CF mode. The feasibility of such an approach is demonstrated by comparing the results obtained with classical LIBS (drawing calibration lines with a series of matrix-matched certified standards) and with independent measurements performed with a conventional technique (LA-ICP-MS). Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Precision Fit of Screw-Retained Implant-Supported Fixed Dental Prostheses Fabricated by CAD/CAM, Copy-Milling, and Conventional Methods.

    Science.gov (United States)

    de França, Danilo Gonzaga; Morais, Maria Helena; das Neves, Flávio D; Carreiro, Adriana Fonte; Barbosa, Gustavo As

    The aim of this study was to evaluate the effectiveness of fabrication methods (computer-aided design/computer-aided manufacture [CAD/CAM], copy-milling, and conventional casting) in the fit accuracy of three-unit, screw-retained fixed dental prostheses. Sixteen three-unit implant-supported screw-retained frameworks were fabricated to fit an in vitro model. Eight frameworks were fabricated using the CAD/CAM system, four in zirconia and four in cobalt-chromium. Four zirconia frameworks were fabricated using the copy-milled system, and four were cast in cobalt-chromium using conventional casting with premachined abutments. The vertical and horizontal misfit at the implant-framework interface was measured using scanning electron microscopy at ×250. The results for vertical misfit were analyzed using Kruskal-Wallis and Mann-Whitney tests. The horizontal misfits were categorized as underextended, equally extended, or overextended. Statistical analysis established differences between groups according to the chi-square test (α = .05). The mean vertical misfit was 5.9 ± 3.6 μm for CAD/CAM-fabricated zirconia, 1.2 ± 2.2 μm for CAD/CAM-fabricated cobalt-chromium frameworks, 7.6 ± 9.2 μm for copy-milling-fabricated zirconia frameworks, and 11.8 (9.8) μm for conventionally fabricated frameworks. The Mann-Whitney test revealed significant differences between all but the zirconia-fabricated frameworks. A significant association was observed between the horizontal misfits and the fabrication method. The percentage of horizontal misfits that were underextended and overextended was higher in milled zirconia (83.3%), CAD/CAM cobaltchromium (66.7%), cast cobalt-chromium (58.3%), and CAD/CAM zirconia (33.3%) frameworks. CAD/CAM-fabricated frameworks exhibit better vertical misfit and low variability compared with copy-milled and conventionally fabricated frameworks. The percentage of interfaces equally extended was higher when CAD/CAM and zirconia were used.

  12. Soft-landing ion deposition of isolated radioactive probe atoms on surfaces: A novel method

    NARCIS (Netherlands)

    Laurens, C.R; Rosu, M.F; Pleiter, F; Niesen, L

    1997-01-01

    We present a method to deposit a wide range of radioactive probe atoms on surfaces, without introducing lattice damage or contaminating the surface with other elements or isotopes. In this method, the probe atoms are mass separated using an isotope separator, decelerated to 5 eV, and directly

  13. Air powder abrasive treatment as an implant surface cleaning method: a literature review

    NARCIS (Netherlands)

    Tastepe, C.S.; van Waas, R.; Liu, Y.; Wismeijer, D.

    2012-01-01

    OBJECTIVE: To evaluate the air powder abrasive treatment as an implant surface cleaning method for peri-implantitis based on the existing literature. MATERIALS AND METHODS: A PubMed search was conducted to find articles that reported on air powder abrasive treatment as an implant surface cleaning

  14. Determination of optimum "multi-channel surface wave method" field parameters.

    Science.gov (United States)

    2012-12-01

    Multi-channel surface wave methods (especially the multi-channel analyses of surface wave method; MASW) are routinely used to : determine the shear-wave velocity of the subsurface to depths of 100 feet for site classification purposes. Users are awar...

  15. Developments of a bonding technique for optical materials by a surface activation method

    International Nuclear Information System (INIS)

    Sugiyama, Akira; Oda, Tomohiro; Abe, Tomoyuki; Kusunoki, Isao

    2005-01-01

    We started developing the laser crystal bounding by the surface activation method which can splice crystals together without using hydrogen bonding. For the surface activation, neutral argon beams were used for irradiation of specimens. In the bonding trials with sapphire crystals, we recognized possibility of the bonding method for optical elements. (author)

  16. Method of electrode printing on one or more surfaces of a dielectric substrate

    KAUST Repository

    Neophytou, Marios

    2017-09-14

    Described herein is a method for printing electrodes surfaces of a dielectric substrate. Provided herein is a new method of depositing electrically conductive electrodes of any shape on flexible and/or rigid dielectric substrates/surfaces and devices so produced. In various embodiments, the devices can generate ionic wind, for example to remove dust or other debris or contaminants or to remove ice or humidity from a surface.

  17. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    International Nuclear Information System (INIS)

    Koster, Marijke; Reijnders, Lucas; Oost, Nathalie R. van; Peijnenburg, Willie J.G.M.

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl 2 and 0.43 M HNO 3 , digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl 2 correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl 2 . A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C E (effective concentration) measured by a DGT-device, CaCl 2 extracted zinc and the zinc content in the pore water of all soils. The correlation with C E was not significant for lupine, neither for spiked soils, nor for field soils (p ≤ 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods

  18. Application of the gyroscopic method in subterranean orientation. Comparison with conventional methods. Aplicacion del metodo gyroscopic en la orientacion subterranea. Comparacion con los metodos convencionales

    Energy Technology Data Exchange (ETDEWEB)

    Saez Garcia, E.; Fuente Martin, P.L. (HUNOSA, Madrid (Spain))

    1988-01-01

    This entry tries to revise the most used method for the direction transition what with exterior and interior using plumbs in connected with vertical shaft coalmines. A technical and economic cooperation was also realized between the indicated method and the gyroscope.

  19. A Level Set Discontinuous Galerkin Method for Free Surface Flows - and Water-Wave Modeling

    DEFF Research Database (Denmark)

    Grooss, Jesper

    2005-01-01

    We present a discontinuous Galerkin method on a fully unstructured grid for the modeling of unsteady incompressible fluid flows with free surfaces. The surface is modeled by a level set technique. We describe the discontinuous Galerkin method in general, and its application to the flow equations...... equations in time are discussed. We investigate theory of di erential algebraic equations, and connect the theory to current methods for solving the unsteady fluid flow equations. We explore the use of a semi-implicit spectral deferred correction method having potential to achieve high temporal order....... The deferred correction method is applied on the fluid flow equations and show good results in periodic domains. We describe the design of a level set method for the free surface modeling. The level set utilize the high order accurate discontinuous Galerkin method fully and represent smooth surfaces very...

  20. Evaluation of conventional and response surface level optimisation of n-dodecane (n-C12) mineralisation by psychrotolerant strains isolated from pristine soil at Southern Victoria Island, Antarctica.

    Science.gov (United States)

    Habib, Syahir; Ahmad, Siti Aqlima; Johari, Wan Lutfi Wan; Shukor, Mohd Yunus Abd; Alias, Siti Aisyah; Khalil, Khalilah Abdul; Yasid, Nur Adeela

    2018-03-17

    Biodegradation of hydrocarbons in Antarctic soil has been reported to be achieved through the utilisation of indigenous cold-adapted microorganisms. Although numerous bacteria isolated from hydrocarbon-contaminated sites in Antarctica were able to demonstrate promising outcomes in utilising hydrocarbon components as their energy source, reports on the utilisation of hydrocarbons by strains isolated from pristine Antarctic soil are scarce. In the present work, two psychrotolerant strains isolated from Antarctic pristine soil with the competency to utilise diesel fuel as the sole carbon source were identified and optimised through conventional and response surface method. Two potent hydrocarbon-degraders (ADL15 and ADL36) were identified via partial 16S rRNA gene sequence analysis, and revealed to be closely related to the genus Pseudomonas and Rhodococcus sp., respectively. Factors affecting diesel degradation such as temperature, hydrocarbon concentration, pH and salt tolerance were studied. Although strain ADL36 was able to withstand a higher concentration of diesel than strain ADL15, both strains showed similar optimal condition for the cell's growth at pH 7.0 and 1.0% (w/v) NaCl at the conventional 'one-factor-at-a-time' level. Both strains were observed to be psychrotrophs with optimal temperatures of 20 °C. Qualitative and quantitative analysis were performed with a gas chromatograph equipped with a flame ionisation detector to measure the reduction of n-alkane components in diesel. In the pre-screening medium, strain ADL36 showed 83.75% of n-dodecane mineralisation while the reduction of n-dodecane by strain ADL15 was merely at 22.39%. The optimised condition for n-dodecane mineralisation predicted through response surface methodology enhanced the reduction of n-dodecane to 99.89 and 38.32% for strain ADL36 and strain ADL15, respectively. Strain ADL36 proves to be a better candidate for bioaugmentation operations on sites contaminated with aliphatic

  1. Using parallel computing methods to improve log surface defect detection methods

    Science.gov (United States)

    R. Edward Thomas; Liya. Thomas

    2013-01-01

    Determining the size and location of surface defects is crucial to evaluating the potential yield and value of hardwood logs. Recently a surface defect detection algorithm was developed using the Java language. This algorithm was developed around an earlier laser scanning system that had poor resolution along the length of the log (15 scan lines per foot). A newer...

  2. Importance of the carbon surface chemistry: methods of characterization; Importance de la chimie de surface des materiaux carbones

    Energy Technology Data Exchange (ETDEWEB)

    Burg, Ph. [Universite Paul Verlaine, Lab. de Chimie et Applications, UFR Sciences, 57 - Metz (France); Vix-Guterl, C. [Centre National de la Recherche Scientifique, Institut de Chimie des Surfaces et Interfaces (ICSI) UPR CNRS 9069, 68 - Mulhouse (France)

    2006-03-15

    The diversity of the carbonaceous materials in terms of chemical composition and porous texture explains their large field of applications. The performances of such materials are often influenced by their surface chemistry that is not easy to investigate. Thus a large range of complementary analytical methods is necessary. (authors)

  3. Studies on the interaction between nanodiamond and human hemoglobin by surface tension measurement and spectroscopy methods.

    Science.gov (United States)

    Pishkar, Leila; Taheri, Saba; Makarem, Somayeh; Alizadeh Zeinabad, Hojjat; Rahimi, Arash; Saboury, Ali Akbar; Falahati, Mojtaba

    2017-02-01

    In this study, a novel method to probe molecular interactions and binding of human hemoglobin (Hb) with nanodiamond (ND) was introduced based on the surface tension measurement. This method complements conventional techniques, which are basically done by zeta potential and dynamic light scattering (DLS) measurements, near and far circular dichroism (CD) spectroscopy, intrinsic and extrinsic fluorescence spectroscopy. Addition of ND to Hb solution increased the surface tension value of Hb-ND complex relative to those of Hb and ND molecules. The zeta potential values reveled that Hb and ND provide identical charge distribution at pH 7.5. DLS measurements demonstrated that Hb, ND, and ND-Hb complex have hydrodynamic radiuses of 98.37 ± 4.57, 122.07 ± 7.88 nm and 62.27 ± 3.70 at pH of 7.5 respectively. Far and near UV-CD results indicated the loss of α-helix structure and conformational changes of Hb, respectively. Intrinsic fluorescence data demonstrated that the fluorescence quenching of Hb by ND was the result of the static quenching. The hydrophobic interaction plays a pivotal role in the interaction of ND with Hb. Fluorescence intensity changes over time revealed conformational change of Hb continues after the mixing of the components (Hb-ND) till 15 min, which is indicative of the denaturation of the Hb relative to the protein control. Extrinsic fluorescence data showed a considerable enhancement of the ANS fluorescence intensity of Hb-ND system relative to the Hb till 60 nM of ND, likely persuaded by greater exposure of nonpolar residues of Hb hydrophobic pocket. The remarkable decrease in T m value of Hb in Hb-ND complex exhibits interaction of Hb with ND conducts to conformational changes of Hb. This study offers consequential discrimination into the interaction of ND with proteins, which may be of significance for further appeal of these nanoparticles in biotechnology prosecution.

  4. Inductance and resistance measurement method for vessel detection and coil powering in all-surface inductive heating systems composed of outer squircle coils

    Directory of Open Access Journals (Sweden)

    Veli Tayfun Kilic

    2017-05-01

    Full Text Available In this work, we investigate a method proposed for vessel detection and coil powering in an all-surface inductive heating system composed of outer squircle coils. Besides conventional circular coils, coils with different shapes such as outer squircle coils are used for and enable efficient all-surface inductive heating. Validity of the method, which relies on measuring inductance and resistance values of a loaded coil at different frequencies, is experimentally demonstrated for a coil with shape different from conventional circular coil. Simple setup was constructed with a small coil to model an all-surface inductive heating system. Inductance and resistance maps were generated by measuring coil’s inductance and resistance values at different frequencies loaded by a plate made of different materials and located at various positions. Results show that in an induction hob for various coil geometries it is possible to detect a vessel’s presence, to identify its material type and to specify its position on the hob surface by considering inductance and resistance of the coil measured on at least two different frequencies. The studied method is important in terms of enabling safe, efficient and user flexible heating in an all-surface inductive heating system by automatically detecting the vessel’s presence and powering on only the coils that are loaded by the vessel with predetermined current levels.

  5. A robust real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wenyang [Department of Bioengineering, University of California, Los Angeles, Los Angeles, California 90095 (United States); Cheung, Yam [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas 75390 (United States); Sawant, Amit [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas, 75390 and Department of Radiation Oncology, University of Maryland, College Park, Maryland 20742 (United States); Ruan, Dan, E-mail: druan@mednet.ucla.edu [Department of Bioengineering, University of California, Los Angeles, Los Angeles, California 90095 and Department of Radiation Oncology, University of California, Los Angeles, Los Angeles, California 90095 (United States)

    2016-05-15

    Purpose: To develop a robust and real-time surface reconstruction method on point clouds captured from a 3D surface photogrammetry system. Methods: The authors have developed a robust and fast surface reconstruction method on point clouds acquired by the photogrammetry system, without explicitly solving the partial differential equation required by a typical variational approach. Taking advantage of the overcomplete nature of the acquired point clouds, their method solves and propagates a sparse linear relationship from the point cloud manifold to the surface manifold, assuming both manifolds share similar local geometry. With relatively consistent point cloud acquisitions, the authors propose a sparse regression (SR) model to directly approximate the target point cloud as a sparse linear combination from the training set, assuming that the point correspondences built by the iterative closest point (ICP) is reasonably accurate and have residual errors following a Gaussian distribution. To accommodate changing noise levels and/or presence of inconsistent occlusions during the acquisition, the authors further propose a modified sparse regression (MSR) model to model the potentially large and sparse error built by ICP with a Laplacian prior. The authors evaluated the proposed method on both clinical point clouds acquired under consistent acquisition conditions and on point clouds with inconsistent occlusions. The authors quantitatively evaluated the reconstruction performance with respect to root-mean-squared-error, by comparing its reconstruction results against that from the variational method. Results: On clinical point clouds, both the SR and MSR models have achieved sub-millimeter reconstruction accuracy and reduced the reconstruction time by two orders of magnitude to a subsecond reconstruction time. On point clouds with inconsistent occlusions, the MSR model has demonstrated its advantage in achieving consistent and robust performance despite the introduced

  6. Sanitizer efficacy against murine norovirus, a surrogate for human norovirus, on stainless steel surfaces when using three application methods.

    Science.gov (United States)

    Bolton, Stephanie L; Kotwal, Grishma; Harrison, Mark A; Law, S Edward; Harrison, Judy A; Cannon, Jennifer L

    2013-02-01

    Human noroviruses are major etiologic agents of epidemic gastroenteritis. Outbreaks are often accompanied by contamination of environmental surfaces, but since these viruses cannot be routinely propagated in laboratory cultures, their response to surface disinfectants is predicted by using surrogates, such as murine norovirus 1 (MNV-1). This study compared the virucidal efficacies of various liquid treatments (three sanitizer liquids, 5% levulinic acid plus 2% SDS [LEV/SDS], 200 ppm chlorine, and an isopropanol-based quaternary ammonium compound [Alpet D2], and two control liquids, sterile tap water and sterile tap water plus 2% SDS) when delivered to MNV-1-inoculated stainless steel surfaces by conventional hydraulic or air-assisted, induction-charged (AAIC) electrostatic spraying or by wiping with impregnated towelettes. For the spray treatments, LEV/SDS proved effective when applied with hydraulic and AAIC electrostatic spraying, providing virus reductions of 2.71 and 1.66 log PFU/ml, respectively. Alpet D2 provided a 2.23-log PFU/ml reduction with hydraulic spraying, outperforming chlorine (1.16-log PFU/ml reduction). Chlorine and LEV/SDS were equally effective as wipes, reducing the viral load by 7.05 log PFU/ml. Controls reduced the viral load by 3 log PFU/ml with wiping. Results indicated that both sanitizer type and application methods should be carefully considered when choosing a surface disinfectant to best prevent and control environmental contamination by noroviruses.

  7. Measurement of the specific surface area of loose copper deposit by electrochemical methods

    Directory of Open Access Journals (Sweden)

    E. A. Dolmatova

    2016-07-01

    Full Text Available In the work the surface area of the electrode with dispersed copper deposit obtained within 30 seconds was evaluated by techniques of chronopotentiometry (CPM and impedance spectroscopy. In method CPM the electrode surface available for measurement depends on the value of the polarizing current. At high currents during the transition time there is a change of surface relief that can not determine the full surface of loose deposit. The electrochemical impedance method is devoid of this shortcoming since the measurements are carried out in indifferent electrolyte in the absence of current. The area measured by the impedance is tens of times higher than the value obtained by chronopotentiometry. It is found that from a solution containing sulfuric acid the deposits form with a high specific surface area. Based on these data it was concluded that the method of impedance spectroscopy can be used to measure in situ the surface area of the dispersed copper deposits.

  8. Comparison of oxygen saturation levels in patients receiving Technegas by the conventional unassisted method vs. the positive ventilation delivery system (PVDS)

    International Nuclear Information System (INIS)

    Dobson, M.P.; Leiper, C.A.; Lee, K.; Dixson, H.

    2000-01-01

    Full text: The purpose of this study is to compare oxygen saturation levels (SaO 2 ) in 289 patients undergoing conventional lung ventilation scintigraphy (control group) and 27 patients undergoing Positive Ventilation Delivery System (PVDS). The 27 patients where selected as their conventional method of inhalation proved to be inadequate or non-diagnostic. The patients underwent a second ventilation using PVDS, which improved the diagnostic quality of the ventilation image and assisted in clinical management decisions. Some patients in both the PVDS and the control group experienced a transient lowering in their SaO 2 . The mean initial SaO 2 in the control group did not fall below 94.9% and in the PVDS group measured 90.6%. 93% (25/27) of patients in the PVDS group were assessed as non CO 2 retaining, and received oxygen at 10L/min during Technegas inhalation. The mean trough saturation in the PVDS group was 91.7% which was significantly higher than that of the control group (86.9%). No patient in either group experienced any significant complication attributed to the transient tall in SaO 2 during technegas administration. We conclude that oxygen supplied as part of the PVDS system ameliorates the transient reduction in SaO 2 seen during standard Technegas administration. Copyright (2000) The Australian and New Zealand Society of Nuclear Medicine Inc

  9. Assessment of the Performance of Three Dynamical Climate Downscaling Methods Using Different Land Surface Information over China

    Directory of Open Access Journals (Sweden)

    Peng Liu

    2018-03-01

    Full Text Available This study aims to assess the performance of different dynamical downscaling methods using updated land surface information. Particular attention is given to obtaining high-resolution climate information over China by the combination of an appropriate dynamical downscaling method and updated land surface information. Two group experiments using two land surface datasets are performed, including default Weather Research and Forecasting (WRF land surface data (OLD and accurate dynamically accordant MODIS data (NEW. Each group consists of three types of experiments for the summer of 2014, including traditional continuous integration (CT, spectral nudging (SN, and re-initialization (Re experiments. The Weather Research and Forecasting (WRF model is used to dynamically downscale ERA-Interim (reanalysis of the European Centre for Medium-Range Weather Forecast, ECMWF data with a grid spacing of 30 km over China. The simulations are evaluated via comparison with observed conventional meteorological variables, showing that the CT method, which notably overestimates 2 m temperature and underestimates 2 m relative humidity across China, performs the worst; the SN and Re runs outperform the CT method, and the Re shows the smallest RMSE (root means square error. A comparison of observed and simulated precipitation shows that the SN simulation is closest to the observed data, while the CT and Re simulations overestimate precipitation south of the Yangtze River. Compared with the OLD group, the RMSE values of temperature and relative humidity are significantly improved in CT and SN, and there is smaller improved in Re. However, obvious improvements in precipitation are not evident.

  10. Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

    Science.gov (United States)

    Ku, Bon Ki; Kulkarni, Pramod

    2012-05-01

    We compare different approaches to measure