WorldWideScience

Sample records for surface conventional methods

  1. Imaging method of brain surface anatomy structures using conventional T2-weighted MR images

    International Nuclear Information System (INIS)

    Hatanaka, Masahiko; Machida, Yoshio; Yoshida, Tadatoki; Katada, Kazuhiro.

    1992-01-01

    As a non-invasive technique for visualizing the brain surface structure by MRI, surface anatomy scanning (SAS) and the multislice SAS methods have been developed. Both techniques require additional MRI scanning to obtain images for the brain surface. In this paper, we report an alternative method to obtain the brain surface image using conventional T2-weighted multislice images without any additional scanning. The power calculation of the image pixel values, which is incorporated in the routine processing, has been applied in order to enhance the cerebrospinal fluid (CSF) contrast. We think that this method is one of practical approaches for imaging the surface anatomy of the brain. (author)

  2. Analysis of reverse heat transfer for conventional and optimized lubri-cooling methods during tangential surface grinding of ABNT 1020 steel

    Directory of Open Access Journals (Sweden)

    Henrique Cotait Razuk

    Full Text Available Abstract A numerical thermal model was developed to evaluate the heat flux which is conducted to a rectangular workpiece of steel plate ABNT 1020, thus making it possible to compute the maximum temperature in the grinding surface, taking into account the rectangular distribution of heat flux, the thermal properties of the grinding wheel conventional Al2O3, the piece to be machined and the lubri-refrigerating fluid. The finite volume method was employed for the discretization of the direct thermal problem from the heat diffusion equation associated with the two-dimensional problem of heat conduction in transient regime. The inverse thermal problem was solved by the Golden Section technique. The thermal flux, when compared to the conventional technique of method of application fluid, was reduced by 84.0% in the practices performed with cutting depth of 30µm, at 74.0% in practices with cutting depth of 45µm and 61.2% in the aggressive practices of 60µm, thus demonstrating the applicability of the optimized method for fluid application.

  3. Conventional laboratory methods for cyanotoxins.

    Science.gov (United States)

    Lawton, Linda A; Edwards, C

    2008-01-01

    It is clear from the literature that numerous methods are available for most cyanotoxins, although many publications on monitoring data indicate that the favored approach is the use proven, robust methods for individual toxins. The most effective approach is the utilization of a robust rapid screen, where positive samples are followed up by qualitative and quantitative analysis to provide the essential decision making data needed for successful management strategies (Fig. 2). Currently, rapid screens are available for microcystins, saxitoxins and anatoxin-a(s), whilst optimisation and validation is needed, many publications report good correlation with the mouse bioassay and HPLC. There is an urgent need for rapid, simple, and inexpensive assays for cylindrospermopsins, anatoxin-a and BMAA. Although methods exist for analysis of BMAA, the fact that a recent study showed 95% of cyanobacteria producing this, some at levels > 6,000 microg g(-1) dry wt, is of concern and rapid screening followed by robust analysis needed. An ideal approach would be a single method capable of extracting and detecting all cyanotoxins. Several publications describe such approaches using LC-MS, but as expected from a group of compounds with diverse chemistry, there are obvious limitations in recoveries during sample processing, chromatographic performance and sensitivity (Dahlmann et al. 2003, Dell'Aversano et al. 2004, Pietsch et al. 2001). Selection of methods must be based on the application requirements, equipment available and cost. For many organisations it may be more cost effective to out-source the occasional analysis. However, as the incidence of blooms appears to be increasing, the need for more rigorous monitoring is needed, sensible investment is needed to meet recommended guidelines. Most of the methods discussed in this paper are suitable for achieving this goal, although clean-up and concentration is usually necessary for physicochemical methods.

  4. Efficacy of low-pressure foam cleaning compared to conventional cleaning methods in the removal of bacteria from surfaces associated with convenience food.

    Science.gov (United States)

    Lambrechts, A A; Human, I S; Doughari, J H; Lues, J F R

    2014-09-01

    Food borne illnesses and food poisoning are cause for concern globally. The diseases are often caused by food contamination with pathogenic bacteria due largely to poor sanitary habits or storage conditions. Prevalence of some bacteria on cleaned and sanitised food contact surfaces from eight convenience food plants in Gauteng (South Africa) was investigated with the view to evaluate the efficacy of the cleaning methods used with such food contact surfaces. The microbial load of eight convenience food manufacturing plants was determined by sampling stainless steel food contact surfaces after they had been cleaned and sanitised at the end of a day's shift. Samples were analysed for Total Plate Count (TPC), Escherichia coli, Salmonella species, Staphylococcus aureus and Listeria species. Results showed that 59 % of the total areas sampled for TPC failed to comply with the legal requirements for surfaces, according to the Foodstuffs, Cosmetics and Disinfectants Act ( 0.05) in terms of Listeria species isolates obtained from both cleaning methods. The LPF method proved to be the superior cleaning option for lowering TPC counts. Regardless of cleaning method used, pathogens continued to flourish on various surfaces, including dry stainless steel, posing a contamination hazard for a considerable period depending on the contamination level and type of pathogen. Intensive training for proper chemical usage and strict procedural compliance among workers for efficient cleaning procedures is recommended.

  5. Fuzzy logic control to be conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Eker, Ilyas [University of Gaziantep, Gaziantep (Turkey). Department of Electrical and Electronic Engineering; Torun, Yunis [University of Gaziantep, Gaziantep (Turkey). Technical Vocational School of Higher Education

    2006-03-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system. (author)

  6. Fuzzy logic control to be conventional method

    International Nuclear Information System (INIS)

    Eker, Ilyas; Torun, Yunis

    2006-01-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system

  7. Comparative evaluation of the three different surface treatments - conventional, laser and Nano technology methods in enhancing the surface characteristics of commercially pure titanium discs and their effects on cell adhesion: An in vitro study.

    Science.gov (United States)

    Vignesh; Nayar, Sanjna; Bhuminathan; Mahadevan; Santhosh, S

    2015-04-01

    The surface area of the titanium dental implant materials can be increased by surface treatments without altering their shape and form, thereby increasing the biologic properties of the biomaterial. A good biomaterial helps in early cell adhesion and cell signaling. In this study, the commercially pure titanium surfaces were prepared to enable machined surfaces to form a control material and to be compared with sandblasted and acid-etched surfaces, laser treated surfaces and titanium dioxide (20 nm) Nano-particle coated surfaces. The surface elements were characterized. The biocompatibility was evaluated by cell culture in vitro using L929 fibroblasts. The results suggested that the titanium dioxide Nano-particle coated surfaces had good osteoconductivity and can be used as a potential method for coating the biomaterial.

  8. Non-conventional energy and propulsion methods

    International Nuclear Information System (INIS)

    Valone, T.

    1991-01-01

    From the disaster of the Space Shuttle, Challenger, to the Kuwaiti oil well fires, we are reminded constantly of our dependence on dangerous, combustible fuels for energy and propulsion. Over the past ten years, there has been a considerable production of new and exciting inventions which defy conventional analysis. The term non-conventional was coined in 1980 by a Canadian engineer to designate a separate technical discipline for this type of endeavor. Since then, several conferences have been devoted solely to these inventions. Integrity Research Corp., an affiliate of the Institute, has made an effort to investigate each viable product, develop business plans for several to facilitate development and marketing, and in some cases, assign an engineering student intern to building a working prototype. Each inventor discussed in this presentation has produced a unique device for free energy generation or highly efficient force production. Included in this paper is also a short summary for non-specialists explaining the physics of free energy generation along with a working definition. The main topics of discussion include: space power, inertial propulsion, kinetobaric force, magnetic motors, thermal fluctuations, over-unity hat pumps, ambient temperature superconductivity and nuclear battery

  9. The surface analysis methods

    International Nuclear Information System (INIS)

    Deville, J.P.

    1998-01-01

    Nowadays, there are a lot of surfaces analysis methods, each having its specificity, its qualities, its constraints (for instance vacuum) and its limits. Expensive in time and in investment, these methods have to be used deliberately. This article appeals to non specialists. It gives some elements of choice according to the studied information, the sensitivity, the use constraints or the answer to a precise question. After having recalled the fundamental principles which govern these analysis methods, based on the interaction between radiations (ultraviolet, X) or particles (ions, electrons) with matter, two methods will be more particularly described: the Auger electron spectroscopy (AES) and x-rays photoemission spectroscopy (ESCA or XPS). Indeed, they are the most widespread methods in laboratories, the easier for use and probably the most productive for the analysis of surface of industrial materials or samples submitted to treatments in aggressive media. (O.M.)

  10. Magnetic resonance dacryocystography: comparison between conventional surface coils and microscopic coils

    International Nuclear Information System (INIS)

    Abreu Junior, Luiz de; Wolosker, Angela Maria Borri; Borri, Maria Lucia; Galvao Filho, Mario de Melo; Hartmann, Luiz Guilherme de Carvalho; D'Ippolito, Giuseppe; Castro, Claudio Campi de

    2008-01-01

    Objective: Magnetic resonance imaging has been utilized in the evaluation of the lacrimal apparatus with some advantages over conventional dacryocystography. The present study was aimed at acquiring high resolution images utilizing microscopic coils for evaluating typical structures of the lacrimal apparatus as compared with the findings observed with conventional surface coils. Materials and methods: Five asymptomatic volunteers with no history of epiphora were submitted to high-field magnetic resonance imaging with microscopic and conventional surface coils, and STIR sequence after instillation of saline solution. The definition of normal anatomic structures of lacrimal apparatuses was compared utilizing conventional and microscopic surface coils. Based on a consensual scoring system, the mean values for each structure were calculated by two observers. Results: In 90% of cases, higher scores were attributed to images acquired with the microscopic coil. On average, a 1.17 point increase was observed in the scoring of anatomic structures imaged with the microscopic coil. Additionally, a subjective improvement was observed in the signal-to-noise ratio with the microscopic coil. Conclusion: Magnetic resonance dacryocystography with microscopic coils is the appropriate method for evaluating the lacrimal apparatus, providing images with better quality as compared with those acquired with conventional surface coils. (author)

  11. Magnetic surfaces, particle orbits and neutral injection in conventional and ultimate torsatrons

    International Nuclear Information System (INIS)

    Anderson, D.T.; Derr, J.A.; Kruckewitt, T.; Shohet, J.L.; Rehker, S.; Tataronis, J.A.

    1979-01-01

    Capabilities in fully non-axisymmetric numerical methods have resulted in a parametric study of various conventional and ultimate torsatron configurations. No superbananas are found in torsatrons without local magnetic wells. Neutral injection calculations show that, if the vacuum magnetic surfaces are well defined, tangential injection is very efficient

  12. REMOVAL OF URANIUM FROM DRINKING WATER BY CONVENTIONAL TREATMENT METHODS

    Science.gov (United States)

    The USEPA currently does not regulate uranium in drinking water but will be revising the radionuclide regulations during 1989 and will propose a maximum contaminant level for uranium. The paper presents treatment technology information on the effectiveness of conventional method...

  13. Comparative Evaluation of Conventional and Accelerated Castings on Marginal Fit and Surface Roughness

    Science.gov (United States)

    Jadhav, Vivek Dattatray; Motwani, Bhagwan K.; Shinde, Jitendra; Adhapure, Prasad

    2017-01-01

    Aims: The aim of this study was to evaluate the marginal fit and surface roughness of complete cast crowns made by a conventional and an accelerated casting technique. Settings and Design: This study was divided into three parts. In Part I, the marginal fit of full metal crowns made by both casting techniques in the vertical direction was checked, in Part II, the fit of sectional metal crowns in the horizontal direction made by both casting techniques was checked, and in Part III, the surface roughness of disc-shaped metal plate specimens made by both casting techniques was checked. Materials and Methods: A conventional technique was compared with an accelerated technique. In Part I of the study, the marginal fit of the full metal crowns as well as in Part II, the horizontal fit of sectional metal crowns made by both casting techniques was determined, and in Part III, the surface roughness of castings made with the same techniques was compared. Statistical Analysis Used: The results of the t-test and independent sample test do not indicate statistically significant differences in the marginal discrepancy detected between the two casting techniques. Results: For the marginal discrepancy and surface roughness, crowns fabricated with the accelerated technique were significantly different from those fabricated with the conventional technique. Conclusions: Accelerated casting technique showed quite satisfactory results, but the conventional technique was superior in terms of marginal fit and surface roughness. PMID:29042726

  14. Base adsorption calorimetry for characterising surface acidity: a comparison between pulse flow and conventional ''static'' techniques

    International Nuclear Information System (INIS)

    Felix, S.P.; Savill-Jowitt, C.; Brown, D.R.

    2005-01-01

    A pulsed flow adsorption microcalorimeter (pulse-FMC) has been developed by modifying a Setaram 111. It is tested in comparison with a conventional pulsed static adsorption microcalorimeter (pulse-SMC) for characterising surface acidity of solid acid catalysts. Small pulses of 1% ammonia in helium are delivered to an activated catalyst sample and its surface acidity is differentially profiled in terms of the molar enthalpy of ammonia adsorption (ΔH ads o ) using a combination of differential scanning calorimeter (DSC) and a downstream thermal conductivity detector (TCD). The pulsing action and its sequences are controlled by in-house developed software and the TCD output also is logged into a PC. Thus, the pulse-FMC is fully automated. Two sulfonated polystyrene resin-type catalysts, Amberlyst 15 and Amberlyst 35, a zeolite of the type H + -ZSM-5 (CT 410) and an acid activated clay (Fulcat 220) are characterised at appropriate temperatures using both the new technique and the conventional static base adsorption method. ΔH ads o versus surface coverage profiles of all the four catalysts obtained from both pulse-FMC and the conventional method are found to be comparable. Results are interpreted in terms of the extent to which NH 3 adsorption on the catalysts surface is under thermodynamic control in the two methods

  15. Dosimetry comparison of pelvimetry methods using conventional radiographs and CT

    International Nuclear Information System (INIS)

    Resten, A.; Suissa, M.; Musset, D.; Mausoleo, F.; Valero, M.; Taylor, S.

    2001-01-01

    To determine the fetal and maternal exposure to radiation by use of thermoluminescent dosimeters in order to compare conventional and CT-scan X-ray. Dosimetry was performed with an anthropomorph phantom. Thermoluminescent dosimeters were positioned on the surface and in the depth of the phantom. Digital radiography of the pelvis was performed according to a standard technique. CT-scan of the pelvis was performed according to the Buthiau's technique. With CT, the dose reached 0.31 to 4.95 mGy, with a dose of 2.32 mGy for the fetal gonads. With standard technique, the doses reached 0.03 to 0.39 mGy, with a dose of 0.39 mGy for the fetal gonads. With CT the fetus and the mother were exposed to 1/10. of the total dose delivered using conventional X-rays and the dose distribution was more homogeneous. (author)

  16. Issues in identifying germ tube positive yeasts by conventional methods.

    Science.gov (United States)

    Yazdanpanah, Atta; Khaithir, Tzar Mohd Nizam

    2014-01-01

    Candida speciation is vital for epidemiology and management of candidiasis. Nonmolecular conventional methods often fail to identify closely related germ tube positive yeasts from clinical specimens. The present study was conducted to identify these yeasts and to highlight issues in conventional versus molecular methods of identification. A total of 98 germ tube positive yeasts from high vaginal swabs were studied over a 12-month period. Isolates were examined with various methods including growth at 42 °C and 45 °C on Sabouraud dextrose agar (SDA), color development on CHROMagar Candida medium, chlamydospore production on corn meal agar at 25 °C, carbohydrate assimilation using ID 32C system, and polymerase chain reaction using a single pair of primers targeting the hyphal wall protein 1 (Hwp1) gene. Of all the isolates studied, 97 were molecularly confirmed as C. albicans and one isolate was identified as C. dubliniensis. No C. africana was detected in this study. The molecular method used in our study was an accurate and useful tool for discriminating C. albicans, C. dubliniensis, and C. africana. The conventional methods, however, were less accurate and riddled with many issues that will be discussed in further details. © 2013 Wiley Periodicals, Inc.

  17. The Ultimate Pile Bearing Capacity from Conventional and Spectral Analysis of Surface Wave (SASW) Measurements

    Science.gov (United States)

    Faizah Bawadi, Nor; Anuar, Shamilah; Rahim, Mustaqqim A.; Mansor, A. Faizal

    2018-03-01

    A conventional and seismic method for determining the ultimate pile bearing capacity was proposed and compared. The Spectral Analysis of Surface Wave (SASW) method is one of the non-destructive seismic techniques that do not require drilling and sampling of soils, was used in the determination of shear wave velocity (Vs) and damping (D) profile of soil. The soil strength was found to be directly proportional to the Vs and its value has been successfully applied to obtain shallow bearing capacity empirically. A method is proposed in this study to determine the pile bearing capacity using Vs and D measurements for the design of pile and also as an alternative method to verify the bearing capacity from the other conventional methods of evaluation. The objectives of this study are to determine Vs and D profile through frequency response data from SASW measurements and to compare pile bearing capacities obtained from the method carried out and conventional methods. All SASW test arrays were conducted near the borehole and location of conventional pile load tests. In obtaining skin and end bearing pile resistance, the Hardin and Drnevich equation has been used with reference strains obtained from the method proposed by Abbiss. Back analysis results of pile bearing capacities from SASW were found to be 18981 kN and 4947 kN compared to 18014 kN and 4633 kN of IPLT with differences of 5% and 6% for Damansara and Kuala Lumpur test sites, respectively. The results of this study indicate that the seismic method proposed in this study has the potential to be used in estimating the pile bearing capacity.

  18. Conventional cable testing methods: strengths, weaknesses and possibilities

    International Nuclear Information System (INIS)

    Reynolds, P.H.

    1988-01-01

    The paper reviews the major conventional methods that can be used to test power plant cables. It assesses their usefulness in diagnosing the condition of the insulation of the cable and then proposes some possible directions for innovation. The methods examined are dc insulation resistance measurement, ac signal injection for continuous monitoring and fault location, and the ac measurement of capacitance and loss angle. Specific subjects considered are the effects of temperature, cable construction and installation, and the validity of insulation resistance or loss angle measurement. The innovative proposals refer to the use of automation in the measurement and of computer-based Expert Systems for the evaluation of the results

  19. Survey and assessment of conventional software verification and validation methods

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.; Mirsky, S.M.

    1993-04-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 134 methods so identified were classified according to their appropriateness for various phases of a developmental lifecycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  20. Conventional and digital radiographic methods in the detection of simulated external root resorptions: A comparative study

    Directory of Open Access Journals (Sweden)

    C J Sanjay

    2009-01-01

    Full Text Available Objective : To evaluate and compare the efficacy of conventional and digital radiographic methods in the detection of simulated external root resorption cavities and also to evaluate whether the detectability was influenced by resorption cavity sizes. Methods : Thirty-two selected teeth from human dentate mandibles were radiographed in orthoradial, mesioradial and distoradial aspect using conventional film (Insight Kodak F-speed; Eastman Kodak, Rochester, NY and a digital sensor (Trophy RVG advanced imaging system with 0.7mm and 1.0mm deep cavities prepared on their vestibular, mesial and distal surfaces at the cervical, middle and apical thirds. Three dental professionals, an endodontist, a radiologist and a general practitioner, evaluated the images twice with a one-week time interval. Results : No statistical significance was seen in the first observation for both conventional and digital radiographic methods in the detection of simulated external root resorptions and for small and medium cavities but statistical difference was noted in the second observation (P< 0.001 for both the methods. Conclusion : Considering the methodology and the overall results, conventional radiographic method (F-speed performed slightly better than the digital radiographic method in the detection of simulated radiographic method but better consistency was seen with the digital system. Overall size of the resorption cavity had no influence on the performance of both methods and suggests that initial external root resorption lesion is not well-appreciated with both the methods as compared to the advanced lesion.

  1. Imaging slit-coupled surface plasmon polaritons using conventional optical microscopy.

    Science.gov (United States)

    Mehfuz, R; Chowdhury, F A; Chau, K J

    2012-05-07

    We develop a technique that now enables surface plasmon polaritons (SPPs) coupled by nano-patterned slits in a metal film to be detected using conventional optical microscopy with standard objective lenses. The crux of this method is an ultra-thin polymer layer on the metal surface, whose thickness can be varied over a nanoscale range to enable controllable tuning of the SPP momentum. At an optimal layer thickness for which the SPP momentum matches the momentum of light emerging from the slit, the SPP coupling efficiency is enhanced about six times relative to that without the layer. The enhanced efficiency results in distinctive and bright plasmonic signatures near the slit visible by naked eye under an optical microscope. We demonstrate how this capability can be used for parallel measurement through a simple experiment in which the SPP propagation distance is extracted from a single microscope image of an illuminated array of nano-patterned slits on a metal surface. We also use optical microscopy to image the focal region of a plasmonic lens and obtain results consistent with a previously-reported results using near-field optical microscopy. Measurement of SPPs near a nano-slit using conventional and widely-available optical microscopy is an important step towards making nano-plasmonic device technology highly accessible and easy-to-use.

  2. Root canal preparation in endodontics: conventional versus laser methods

    Science.gov (United States)

    Goodis, Harold E.; White, Joel M.; Marshall, Sally J.; Marshall, Grayson W.; Moskowitz, Emrey

    1992-06-01

    Conventional cleaning and shaping of root canal systems employs hand and/or rotary instrumentation to remove the contents of the canal and shape the canal to receive a filling material. With the advent of the Nd:YAG laser system another method of accomplishing proper cleaning and shaping is evaluated. Single rooted teeth were radiographed bucco- lingually and mesio-distally and were divided into 2 groups. The first group was accessed and the root canal systems cleaned and shaped with a step back technique utilizing hand files and gates glidden burs. At completion of the procedure the teeth were again radiographed at the same positions as those prior to the procedure. The teeth were split longitudinally and examined under scanning electron microscopy to assess cleaning. The second group of teeth were accessed, and cleaning and shaping was accomplished using the Nd:YAG laser in combination with hand files and rotary instruments. These teeth were subjected to the same analysis as those in the first group. The before and after radiographs of each group were subjected to image analysis to determine effectiveness of the two methods in shaping the canal systems. We will discuss the ability of Nd:YAG to clean and shape root canal spaces and remove smear layer and organic tissue remnants from those areas.

  3. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-03-01

    Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; digitized scannable vinylsiloxanether, VSES-D; and irreversible hydrocolloid, ALG) and 7 digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; Lava COS, LAV; Lava True Definition Scanner, T-Def; 3Shape Trios, TRI; and 3Shape Trios Color, TRC) techniques. Impressions were made 3 times each in 5 participants (N=15). The impressions were then compared within and between the test groups. The cast surfaces were measured point-to-point using the signed nearest neighbor method. Precision was calculated from the (90%-10%)/2 percentile value. The precision ranged from 12.3 μm (VSE) to 167.2 μm (ALG), with the highest precision in the VSE and VSES groups. The deviation pattern varied distinctly according to the impression method. Conventional impressions showed the highest accuracy across the complete dental arch in all groups, except for the ALG group. Conventional and digital impression methods differ significantly in the complete-arch accuracy. Digital impression systems had higher local deviations within the complete arch cast; however, they achieve equal and higher precision than some conventional impression materials. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  4. Bacterial adhesion on conventional and self-ligating metallic brackets after surface treatment with plasma-polymerized hexamethyldisiloxane

    Directory of Open Access Journals (Sweden)

    Rogerio Amaral Tupinambá

    Full Text Available ABSTRACT Introduction: Plasma-polymerized film deposition was created to modify metallic orthodontic brackets surface properties in order to inhibit bacterial adhesion. Methods: Hexamethyldisiloxane (HMDSO polymer films were deposited on conventional (n = 10 and self-ligating (n = 10 stainless steel orthodontic brackets using the Plasma-Enhanced Chemical Vapor Deposition (PECVD radio frequency technique. The samples were divided into two groups according to the kind of bracket and two subgroups after surface treatment. Scanning Electron Microscopy (SEM analysis was performed to assess the presence of bacterial adhesion over samples surfaces (slot and wings region and film layer integrity. Surface roughness was assessed by Confocal Interferometry (CI and surface wettability, by goniometry. For bacterial adhesion analysis, samples were exposed for 72 hours to a Streptococcus mutans solution for biofilm formation. The values obtained for surface roughness were analyzed using the Mann-Whitney test while biofilm adhesion were assessed by Kruskal-Wallis and SNK test. Results: Significant statistical differences (p 0.05. Conclusion: Plasma-polymerized film deposition was only effective on reducing surface roughness and bacterial adhesion in conventional brackets. It was also noted that conventional brackets showed lower biofilm adhesion than self-ligating brackets despite the absence of film.

  5. Bacterial adhesion on conventional and self-ligating metallic brackets after surface treatment with plasma-polymerized hexamethyldisiloxane

    Science.gov (United States)

    Tupinambá, Rogerio Amaral; Claro, Cristiane Aparecida de Assis; Pereira, Cristiane Aparecida; Nobrega, Celestino José Prudente; Claro, Ana Paula Rosifini Alves

    2017-01-01

    ABSTRACT Introduction: Plasma-polymerized film deposition was created to modify metallic orthodontic brackets surface properties in order to inhibit bacterial adhesion. Methods: Hexamethyldisiloxane (HMDSO) polymer films were deposited on conventional (n = 10) and self-ligating (n = 10) stainless steel orthodontic brackets using the Plasma-Enhanced Chemical Vapor Deposition (PECVD) radio frequency technique. The samples were divided into two groups according to the kind of bracket and two subgroups after surface treatment. Scanning Electron Microscopy (SEM) analysis was performed to assess the presence of bacterial adhesion over samples surfaces (slot and wings region) and film layer integrity. Surface roughness was assessed by Confocal Interferometry (CI) and surface wettability, by goniometry. For bacterial adhesion analysis, samples were exposed for 72 hours to a Streptococcus mutans solution for biofilm formation. The values obtained for surface roughness were analyzed using the Mann-Whitney test while biofilm adhesion were assessed by Kruskal-Wallis and SNK test. Results: Significant statistical differences (p 0.05). Conclusion: Plasma-polymerized film deposition was only effective on reducing surface roughness and bacterial adhesion in conventional brackets. It was also noted that conventional brackets showed lower biofilm adhesion than self-ligating brackets despite the absence of film. PMID:28902253

  6. High-resolution MR imaging of triangular fibrocartilage complex (TFCC): comparison of microscopy coils and a conventional small surface coil

    Energy Technology Data Exchange (ETDEWEB)

    Yoshioka, Hiroshi [Department of Radiology, University of Tsukuba, Tsukuba (Japan); Department of Radiology, Brigham and Women' s Hospital, 75 Francis Street, 02115, Boston, MA (United States); Ueno, Teruko; Itai, Yuji [Department of Radiology, University of Tsukuba, Tsukuba (Japan); Tanaka, Toshikazu [Department of Orthopedic Surgery, Tsukuba Kinen Hospital, Tsukuba (Japan); Shindo, Masashi [Tsukuba University Hospital, Tsukuba (Japan)

    2003-10-01

    To compare MR images of the triangular fibrocartilage complex (TFCC) using microscopy coils with those using a conventional surface coil qualitatively and quantitatively. Proton density-weighted images and T2*-weighted images of the TFCC from ten normal volunteers were obtained with a conventional surface coil (C4 coil; 80 mm in diameter), a 47-mm microscopy surface coil and a 23-mm microscopy surface coil at 1.5 T. Qualitative image analysis of MR images with three coils was performed by two radiologists who assigned one of five numerical scores (0, nonvisualization; 1, poor; 2, average; 3, good; 4, excellent) for five TFCC components, which were disc proper, triangular ligament, meniscus homologue, ulnotriquetral and ulnolunate ligament. Quantitative analysis included the signal-to-noise ratio (S/N) of the disc proper of TFCC, the lunate cartilage, the lunate bone and the contrast-noise-ratio (C/N) between articular cartilage and disc proper or bone marrow were measured. All structures show higher scores qualitatively on MR with microscopy coils than those with a C4 coil, and the difference was significant with the exception of the ulnolunate ligament. MR with microscopy coils showed significantly higher S/N values than those with a conventional surface coil (P<0.05 to P<0.001). T2*-weighted images using microscopy coils showed significantly higher cartilage-disc proper C/N and cartilage-bone marrow C/N (P<0.01 to P<0.001). On proton density-weighted images, the C/N between cartilage and disc proper with two microscopy coils was significantly higher (P<0.01) than that with a conventional coil. High-resolution MR images of the normal wrist using microscopy coils were superior to those using a conventional surface coil qualitatively and quantitatively. High-resolution MR imaging with a microscopy coil would be a promising method to diagnose TFCC lesions. (orig.)

  7. Changing perspective on tissue processing - comparison of microwave histoprocessing method with the conventional method

    Directory of Open Access Journals (Sweden)

    G Shrestha

    2015-09-01

    Full Text Available Background: Histopathological examination of tissues requires sliver of formalin fixed tissue that has been chemically processed and then stained with Haematoxylin and Eosin. The time honored conventional method of tissue processing, which requires 12 to 13 hours for completion, is employed at majority of laboratories but is now seeing the

  8. A review on mathematical methods of conventional and Islamic derivatives

    Science.gov (United States)

    Hisham, Azie Farhani Badrol; Jaffar, Maheran Mohd

    2014-12-01

    Despite the impressive growth of risk management tools in financial institutions, Islamic finance remains miles away behind the conventional institutions. Islamic finance products need to comply with the syariah law and prohibitions, therefore they can use fewer of the available risk management tools compared to conventional. Derivatives have proven to be the effective hedging technique and instrument that broadly being used in the conventional institutions to manage their risks. However, derivatives are not generally accepted as the legitimate products in Islamic finance and they remain controversial issues among the Islamic scholars. This paper reviews the evolution of derivatives such as forwards, futures and options and then explores the mathematical models that being used to solve derivatives such as random walk model, asset pricing model that follows Brownian motion and Black-Scholes model. Other than that, this paper also critically discuss the perspective of derivatives from Islamic point of view. In conclusion, this paper delivers the traditional Islamic products such as salam, urbun and istijrar that can be used to create building blocks of Islamic derivatives.

  9. Method of measuring surface density

    International Nuclear Information System (INIS)

    Gregor, J.

    1982-01-01

    A method is described of measuring surface density or thickness, preferably of coating layers, using radiation emitted by a suitable radionuclide, e.g., 241 Am. The radiation impinges on the measured material, e.g., a copper foil and in dependence on its surface density or thickness part of the flux of impinging radiation is reflected and part penetrates through the material. The radiation which has penetrated through the material excites in a replaceable adjustable backing characteristic radiation of an energy close to that of the impinging radiation (within +-30 keV). Part of the flux of the characteristic radiation spreads back to the detector, penetrates through the material in which in dependence on surface density or thickness of the coating layer it is partly absorbed. The flux of the penetrated characteristic radiation impinging on the face of the detector is a function of surface density or thickness. Only that part of the energy is evaluated of the energy spectrum which corresponds to the energy of characteristic radiation. (B.S.)

  10. Nuclear or conventional power for surface combatant ships: Department of the Navy. Report to the Congress

    International Nuclear Information System (INIS)

    1977-01-01

    GAO reviewed the controversy over whether the Navy's major surface combatant ships should be all nuclear powered, all conventionally powered, or a mix of both. Nuclear ships are more capable but cost more and their relative cost-effectiveness cannot be measured because Navy analysts cannot quantify many benefits of nuclear power. The Congress, in reviewing Navy shipbuilding plans for surface combatant ships, should be cognizant that buying only conventional ships will maximize naval firepower; buying only nuclear ships will provide mobility and greater freedom from logistics support; and buying a mix is a third option providing, to varying degrees, the advantages and disadvantages of the all-nuclear and all-conventional options

  11. Comparative study of the geostatistical ore reserve estimation method over the conventional methods

    International Nuclear Information System (INIS)

    Kim, Y.C.; Knudsen, H.P.

    1975-01-01

    Part I contains a comprehensive treatment of the comparative study of the geostatistical ore reserve estimation method over the conventional methods. The conventional methods chosen for comparison were: (a) the polygon method, (b) the inverse of the distance squared method, and (c) a method similar to (b) but allowing different weights in different directions. Briefly, the overall result from this comparative study is in favor of the use of geostatistics in most cases because the method has lived up to its theoretical claims. A good exposition on the theory of geostatistics, the adopted study procedures, conclusions and recommended future research are given in Part I. Part II of this report contains the results of the second and the third study objectives, which are to assess the potential benefits that can be derived by the introduction of the geostatistical method to the current state-of-the-art in uranium reserve estimation method and to be instrumental in generating the acceptance of the new method by practitioners through illustrative examples, assuming its superiority and practicality. These are given in the form of illustrative examples on the use of geostatistics and the accompanying computer program user's guide

  12. Conventional and more recent methods of radiodiagnosis of mammary carcinoma

    International Nuclear Information System (INIS)

    Kutarna, A.; Klacko, J.; Malatin, O.; Glomba, J.; Celovsky, F.

    1988-01-01

    The methods are listed and briefly characterized. They are categorized by energy used and for some, future applications are given. X-ray methods are believed to be the most frequently used and deemed to remain so. (M.D.)

  13. Tomographs based on non-conventional radiation sources and methods

    International Nuclear Information System (INIS)

    Barbuzza, R.; Fresno, M. del; Venere, Marcelo J.; Clausse, Alejandro; Moreno, C.

    2000-01-01

    Computer techniques for tomographic reconstruction of objects X-rayed with a compact plasma focus (PF) are presented. The implemented reconstruction algorithms are based on stochastic searching of solutions of Radon equation, using Genetic Algorithms and Monte Carlo methods. Numerical experiments using actual projections were performed concluding the feasibility of the application of both methods in tomographic reconstruction problem. (author)

  14. Conventional estimating method of earthquake response of mechanical appendage system

    International Nuclear Information System (INIS)

    Aoki, Shigeru; Suzuki, Kohei

    1981-01-01

    Generally, for the estimation of the earthquake response of appendage structure system installed in main structure system, the method of floor response analysis using the response spectra at the point of installing the appendage system has been used. On the other hand, the research on the estimation of the earthquake response of appendage system by the statistical procedure based on probability process theory has been reported. The development of a practical method for simply estimating the response is an important subject in aseismatic engineering. In this study, the method of estimating the earthquake response of appendage system in the general case that the natural frequencies of both structure systems were different was investigated. First, it was shown that floor response amplification factor was able to be estimated simply by giving the ratio of the natural frequencies of both structure systems, and its statistical property was clarified. Next, it was elucidated that the procedure of expressing acceleration, velocity and displacement responses with tri-axial response spectra simultaneously was able to be applied to the expression of FRAF. The applicability of this procedure to nonlinear system was examined. (Kako, I.)

  15. Energy indices in irrigated wheat production under conservation and conventional tillage and planting methods

    Directory of Open Access Journals (Sweden)

    S. M Hosseini

    2016-04-01

    using a moldboard plow and secondary tillage operation was done using a disk harrow and land leveler. Seed bed was prepared in the reduced tillage method using a tine and disc cultivator which was able to complete the primary and secondary tillage operations simultaneously. Wheat seed was directly planted using direct planter without any seed bed preparation in the zero tillage method. Surface irrigation method was used to irrigate the plots and 11970 m3/ha water was consumed in each treatment. Input energies including direct energy (diesel and electricity and indirect energy (water, labor, seed, fertilizer, chemicals, and machinery were measured and calculated. Output energies (energy of grain and straw were measured in each treatment and the share of each input energy, energy ratio, net energy gain, and energy productivity were determined and compared. Collected data were analyzed using SAS software and Duncan’s multiple range tests was used to compare the treatments means. Results and Discussion: Results showed that tillage and planting methods had a significant effect on fuel and machinery energies; while, the total input energy, crop grain yield, and crop biologic yield were not affected by the tillage and planting methods (Table 4. Fertilizers and chemicals had the highest contribution in input energy of all treatments. Results also indicated that reduced tillage and seeding with Roto-seeder had the highest energy ratio (1.46 and the lowest energy ratio (1.40 was related to the conventional tillage methods (Fig.1. The highest net energy gain (47653 MJ was obtained from the reduced tillage and seeding with Roto-seeder; while, the lowest amount of net energy gain (41388 MJ was related to the conventional tillage and planting with Machine Barzegar grain drill (Fig.3. Results also showed that the reduced tillage and seeding with Roto-seeder had the highest energy productivity (0.115 kg MJ-1 and the conventional tillage treatments had the lowest energy productivity

  16. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions.

    Science.gov (United States)

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-09-01

    Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. Impressions were obtained via two conventional (metal full-arch tray, CI, and triple tray, T-Tray) and seven digital impression systems (Lava True Definition Scanner, T-Def; Lava Chairside Oral Scanner, COS; Cadent iTero, ITE; 3Shape Trios, TRI; 3Shape Trios Color, TRC; CEREC Bluecam, Software 4.0, BC4.0; CEREC Bluecam, Software 4.2, BC4.2; and CEREC Omnicam, OC). Impressions were taken three times for each of five subjects (n = 15). The impressions were then superimposed within the test groups. Differences from model surfaces were measured using a normal surface distance method. Precision was calculated using the Perc90_10 value. The values for all test groups were statistically compared. The precision ranged from 18.8 (CI) to 58.5 μm (T-Tray), with the highest precision in the CI, T-Def, BC4.0, TRC, and TRI groups. The deviation pattern varied distinctly depending on the impression method. Impression systems with single-shot capture exhibited greater deviations at the tooth surface whereas high-frame rate impression systems differed more in gingival areas. Triple tray impressions displayed higher local deviation at the occlusal contact areas of upper and lower jaw. Digital quadrant impression methods achieve a level of precision, comparable to conventional impression techniques. However, there are significant differences in terms of absolute values and deviation pattern. With all tested digital impression systems, time efficient capturing of quadrant impressions is possible. The clinical precision of digital quadrant impression models is sufficient to cover a broad variety of

  17. A Critical Analysis of the Conventionally Employed Creep Lifing Methods.

    Science.gov (United States)

    Abdallah, Zakaria; Gray, Veronica; Whittaker, Mark; Perkins, Karen

    2014-04-29

    The deformation of structural alloys presents problems for power plants and aerospace applications due to the demand for elevated temperatures for higher efficiencies and reductions in greenhouse gas emissions. The materials used in such applications experience harsh environments which may lead to deformation and failure of critical components. To avoid such catastrophic failures and also increase efficiency, future designs must utilise novel/improved alloy systems with enhanced temperature capability. In recognising this issue, a detailed understanding of creep is essential for the success of these designs by ensuring components do not experience excessive deformation which may ultimately lead to failure. To achieve this, a variety of parametric methods have been developed to quantify creep and creep fracture in high temperature applications. This study reviews a number of well-known traditionally employed creep lifing methods with some more recent approaches also included. The first section of this paper focuses on predicting the long-term creep rupture properties which is an area of interest for the power generation sector. The second section looks at pre-defined strains and the re-production of full creep curves based on available data which is pertinent to the aerospace industry where components are replaced before failure.

  18. Surface Treatment And Protection Method For Cadium Zinc Telluride Crystals

    Science.gov (United States)

    Wright, Gomez W.; James, Ralph B.; Burger, Arnold; Chinn, Douglas A.

    2006-02-21

    A method for treatment of the surface of a CdZnTe (CZT) crystal that provides a native dielectric coating to reduce surface leakage currents and thereby, improve the resolution of instruments incorporating detectors using CZT crystals. A two step process is disclosed, etching the surface of a CZT crystal with a solution of the conventional bromine/methanol etch treatment, and after attachment of electrical contacts, passivating the CZT crystal surface with a solution of 10 w/o NH4F and 10 w/o H2O2 in water.

  19. [Study on friction and wear properties of dental zirconia ceramics processed by microwave and conventional sintering methods].

    Science.gov (United States)

    Guoxin, Hu; Ying, Yang; Yuemei, Jiang; Wenjing, Xia

    2017-04-01

    This study evaluated the wear of an antagonist and friction and wear properties of dental zirconia ceramic that was subjected to microwave and conventional sintering methods. Ten specimens were fabricated from Lava brand zirconia and randomly assigned to microwave and conventional sintering groups. A profile tester for surface roughness was used to measure roughness of the specimens. Wear test was performed, and steatite ceramic was used as antagonist. Friction coefficient curves were recorded, and wear volume were calculated. Finally, optical microscope was used to observe the surface morphology of zirconia and steatite ceramics. Field emission scanning electron microscopy was used to observe the microstructure of zirconia. Wear volumes of microwave and conventionally sintered zirconia were (6.940±1.382)×10⁻², (7.952±1.815) ×10⁻² mm³, respectively. Moreover, wear volumes of antagonist after sintering by the considered methods were (14.189±4.745)×10⁻², (15.813±3.481)×10⁻² mm³, correspondingly. Statistically significant difference was not observed in the wear resistance of zirconia and wear volume of steatite ceramic upon exposure to two kinds of sintering methods. Optical microscopy showed that ploughed surfaces were apparent in zirconia. The wear surface of steatite ceramic against had craze, accompanied by plough. Scanning electron microscopy showed that zirconia was sintered compactly when subjected to both conventional sintering and microwave methods, whereas grains of zirconia sintered by microwave alone were smaller and more uniform. Two kinds of sintering methods are successfully used to produce dental zirconia ceramics with similar friction and wear properties.
.

  20. Conventional and improved cytotoxicity test methods of newly developed biodegradable magnesium alloys

    Science.gov (United States)

    Han, Hyung-Seop; Kim, Hee-Kyoung; Kim, Yu-Chan; Seok, Hyun-Kwang; Kim, Young-Yul

    2015-11-01

    Unique biodegradable property of magnesium has spawned countless studies to develop ideal biodegradable orthopedic implant materials in the last decade. However, due to the rapid pH change and extensive amount of hydrogen gas generated during biocorrosion, it is extremely difficult to determine the accurate cytotoxicity of newly developed magnesium alloys using the existing methods. Herein, we report a new method to accurately determine the cytotoxicity of magnesium alloys with varying corrosion rate while taking in-vivo condition into the consideration. For conventional method, extract quantities of each metal ion were determined using ICP-MS and the result showed that the cytotoxicity due to pH change caused by corrosion affected the cell viability rather than the intrinsic cytotoxicity of magnesium alloy. In physiological environment, pH is regulated and adjusted within normal pH (˜7.4) range by homeostasis. Two new methods using pH buffered extracts were proposed and performed to show that environmental buffering effect of pH, dilution of the extract, and the regulation of eluate surface area must be taken into consideration for accurate cytotoxicity measurement of biodegradable magnesium alloys.

  1. Surface severe plastic deformation of AISI 304 via conventional shot peening, severe shot peening and repeening

    Energy Technology Data Exchange (ETDEWEB)

    Unal, Okan, E-mail: unalokan78@gmail.com [Mechanical Engineering Department, Bartın University, Bartın 74100 (Turkey); Varol, Remzi [Mechanical Engineering Department, Suleyman Demirel University, Isparta 32200 (Turkey)

    2015-10-01

    Highlights: • CSP and SSP treatments transform austenite to metastable martensite structure. • Nanograin layer thickness after CSP and SSP is 8 μm and 22 μm, respectively. • Shot peening leads to carbon segregation from coarse to nano grain layer. • Repeening is an effective way to reduce surface roughness. - Abstract: Air blast conventional shot peening (CSP), severe shot peening (SSP) and repeening (RP) as a severe plastic deformation applications on AISI 304 austenitic stainless steel is addressed. Shot peened specimens are investigated based on optical, FESEM and digital microscope. The investigations present the austenite transformation to metastable martensite via mechanical twinning due to plastic deformation with high strain rates. It is found that SSP induces thicker nanograin layer with compared to CSP. In XRD studies, the austenite peaks broaden by means of severe shot peening and FWHM increase reveals the grain size reduction below 25 nm regimes on the surface. In EDAX line analysis of CSP specimen, carbon content increase has been detected from deformed layer through the nanocrystalline layer then the content reduces. The carbon segregation takes place due to the energy level distinction between dislocations and Fe−C bonds. 3d contour digital microscope studies and roughness investigations reveal that SSP has deleterious side effect on the surface roughness and surface flatness. However, RP is an effective way to reduce the surface roughness to reasonable values.

  2. Comparison of surface roughness and bacterial adhesion between cosmetic contact lenses and conventional contact lenses.

    Science.gov (United States)

    Ji, Yong Woo; Cho, Young Joo; Lee, Chul Hee; Hong, Soon Ho; Chung, Dong Yong; Kim, Eung Kweon; Lee, Hyung Keun

    2015-01-01

    To compare physical characteristics of cosmetic contact lenses (Cos-CLs) and conventional contact lenses (Con-CLs) that might affect susceptibility to bacterial adhesion on the contact lens (CL) surface. Surface characteristics of Cos-CLs and Con-CLs made from the same material by the same manufacturer were measured by atomic force microscopy (AFM) and scanning electron microscopy. To determine the extent and rate of bacterial adhesion, Cos-CL and Con-CL were immersed in serum-free Roswell Park Memorial Institute media containing Staphylococcus aureus or Pseudomonas aeruginosa. Additionally, the rate of removal of adherent bacteria was evaluated using hand rubbing or immersion in multipurpose disinfecting solutions (MPDS). The mean surface roughness (root mean square and peak-to-valley value) measured by AFM was significantly higher for Cos-CL than for Con-CL. At each time point, significantly more S. aureus and P. aeruginosa adhered to Cos-CL than to Con-CL, which correlated with the surface roughness of CL. In Cos-CL, bacteria were mainly found on the tinted surface rather than on the noncolored or convex areas. Pseudomonas aeruginosa attached earlier than S. aureus to all types of CL. However, P. aeruginosa was more easily removed from the surface of CL than S. aureus by hand rubbing or MPDS soaking. Increased surface roughness is an important physical factor for bacterial adhesion in Cos-CL, which may explain why rates of bacterial keratitis rates are higher in Cos-CL users in CL physical characteristics.

  3. CAM visual stimulation with conventional method of occlusion treatment in amblyopia: a randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Ali Reza Jafari

    2014-04-01

    Conclusion: Using of CAM visual stimulation along with conventional occlusion will further improve visual acuity and stereopsis in amblyopic children. These findings recommended the CAM visual stimulation as an accompanying and complementary method in amblyopia treatment.

  4. METHODS TO DEVELOP A TOROIDAL SURFACE

    Directory of Open Access Journals (Sweden)

    DANAILA Ligia

    2017-05-01

    Full Text Available The paper work presents two practical methods to draw the development of a surface unable to be developed applying classical methods of Descriptive Geometry, the toroidal surface, frequently met in technical practice. The described methods are approximate ones; the development is obtained with the help of points. The accuracy of the methods is given by the number of points used when drawing. As for any other approximate method, when practically manufactured the development may need to be adjusted on site.

  5. Effects of conventional welding and laser welding on the tensile strength, ultimate tensile strength and surface characteristics of two cobalt-chromium alloys: a comparative study.

    Science.gov (United States)

    Madhan Kumar, Seenivasan; Sethumadhava, Jayesh Raghavendra; Anand Kumar, Vaidyanathan; Manita, Grover

    2012-06-01

    The purpose of this study was to evaluate the efficacy of laser welding and conventional welding on the tensile strength and ultimate tensile strength of the cobalt-chromium alloy. Samples were prepared with two commercially available cobalt-chromium alloys (Wironium plus and Diadur alloy). The samples were sectioned and the broken fragments were joined using Conventional and Laser welding techniques. The welded joints were subjected to tensile and ultimate tensile strength testing; and scanning electron microscope to evaluate the surface characteristics at the welded site. Both on laser welding as well as on conventional welding technique, Diadur alloy samples showed lesser values when tested for tensile and ultimate tensile strength when compared to Wironium alloy samples. Under the scanning electron microscope, the laser welded joints show uniform welding and continuous molt pool all over the surface with less porosity than the conventionally welded joints. Laser welding is an advantageous method of connecting or repairing cast metal prosthetic frameworks.

  6. Increased recovery of touch DNA evidence using FTA paper compared to conventional collection methods.

    Science.gov (United States)

    Kirgiz, Irina A; Calloway, Cassandra

    2017-04-01

    21 samples (69%) and a partial profile was observed for nine samples (25%); STR analysis failed for two samples collected using tape (6%). In conclusion, we show that the FTA paper scraping method has the potential to collect higher DNA yields from touch DNA evidence deposited on non-porous surfaces often encountered in criminal cases compared to conventional methods. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  7. Investigation of Industrialised Building System Performance in Comparison to Conventional Construction Method

    Directory of Open Access Journals (Sweden)

    Othuman Mydin M.A.

    2014-03-01

    Full Text Available Conventional construction methods are still widely practised, although many researches have indicated that this method is less effective compared to the IBS construction method. The existence of the IBS has added to the many techniques within the construction industry. This study is aimed at making comparisons between the two construction approaches. Case studies were conducted at four sites in the state of Penang, Malaysia. Two projects were IBS-based while the remaining two deployed the conventional method of construction. Based on an analysis of the results, it can be concluded that the IBS approach has more to offer compared to the conventional method. Among these advantages are shorter construction periods, reduced overall costs, less labour needs, better site conditions and the production of higher quality components.

  8. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions

    OpenAIRE

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-01-01

    OBJECTIVES Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. MATERIALS AND METHODS Impressions were obtained via two conventional (metal full-arch tray, CI, ...

  9. 10 CFR Appendix I to Subpart B of... - Uniform Test Method for Measuring the Energy Consumption of Conventional Ranges, Conventional...

    Science.gov (United States)

    2010-01-01

    ... PROGRAM FOR CONSUMER PRODUCTS Test Procedures Pt. 430, Subpt. B, App. I Appendix I to Subpart B of Part... between the center and the corners of the conventional gas oven on the diagonals of a horizontal plane...

  10. The clinical significance of computerized axial tomography (CAT) in consideration of conventional diagnostic methods

    International Nuclear Information System (INIS)

    Huenig, R.

    1976-01-01

    Regarding CAT of the intracranial region, the article informs on a) techniques of examination including the production of normal structures, b) the recognizable pathological changes, c) possibilities of enhancement, d) possibilities of course observation, e) limitations of the methods, as well as on f) risk/benefit aspects g) benefit/cost calculations as compared to conventional methods, and on h) the influence of CAT on the frequency of conventional methods of examination. Regarding CAT of the extracranial region, the information available up to the meeting is reported on. (orig./LH) [de

  11. Comparison between laser terahertz emission microscope and conventional methods for analysis of polycrystalline silicon solar cell

    Directory of Open Access Journals (Sweden)

    Hidetoshi Nakanishi

    2015-11-01

    Full Text Available A laser terahertz emission microscope (LTEM can be used for noncontact inspection to detect the waveforms of photoinduced terahertz emissions from material devices. In this study, we experimentally compared the performance of LTEM with conventional analysis methods, e.g., electroluminescence (EL, photoluminescence (PL, and laser beam induced current (LBIC, as an inspection method for solar cells. The results showed that LTEM was more sensitive to the characteristics of the depletion layer of the polycrystalline solar cell compared with EL, PL, and LBIC and that it could be used as a complementary tool to the conventional analysis methods for a solar cell.

  12. Comparison of the efficacy of conventional slow freezing and rapid cryopreservation methods for bovine embryos

    NARCIS (Netherlands)

    Wagtendonk-de Leeuw, van A.M.; Daas, den J.H.; Kruip, T.A.; Rail, W.F.

    1995-01-01

    Day 7 bovine morulae and early blastocysts were randomly assigned to one of four cryopreservation methods: (i) a modified conventional controlled slow freezing and stepwise dilution after thawing; and three methods which enable direct transfer of the embryo into the recipient upon thawing: (ii)

  13. A Conceptual Design and Analysis Method for Conventional and Unconventional Airplanes

    NARCIS (Netherlands)

    Elmendorp, R.J.M.; Vos, R.; La Rocca, G.

    2014-01-01

    A design method is presented that has been implemented in a software program to investigate the merits of conventional and unconventional transport airplanes. Design and analysis methods are implemented in a design tool capable of creating a conceptual design based on a set of toplevel requirements.

  14. The efficacy of selective calculus ablation at 400 nm: comparison to conventional calculus removal methods

    Science.gov (United States)

    Schoenly, Joshua E.; Seka, Wolf; Romanos, Georgios; Rechmann, Peter

    A desired outcome of scaling and root planing is the complete removal of calculus and infected root tissue and preservation of healthy cementum for rapid healing of periodontal tissues. Conventional periodontal treatments for calculus removal, such as hand instrument scaling and ultrasonic scaling, often deeply scrape the surface of the underlying hard tissue and may leave behind a smear layer. Pulsed lasers emitting at violet wavelengths (specifically, 380 to 400 nm) are a potential alternative treatment since they can selectively ablate dental calculus without ablating pristine hard tissue (i.e., enamel, cementum, and dentin). In this study, light and scanning electron microscopy are used to compare and contrast the efficacy of in vitro calculus removal for several conventional periodontal treatments (hand instruments, ultrasonic scaler, and Er:YAG laser) to calculus removal with a frequency-doubled Ti:sapphire (λ = 400 nm). After calculus removal, enamel and cementum surfaces are investigated for calculus debris and damage to the underlying hard tissue surface. Compared to the smear layer, grooves, and unintentional hard tissue removal typically found using these conventional treatments, calculus removal using the 400-nm laser is complete and selective without any removal of pristine dental hard tissue. Based on these results, selective ablation from the 400-nm laser appears to produce a root surface that would be more suitable for successful healing of periodontal tissues.

  15. Residential surface soil guidance values applied worldwide to the original 2001 Stockholm Convention POP pesticides.

    Science.gov (United States)

    Jennings, Aaron A; Li, Zijian

    2015-09-01

    Surface soil contamination is a worldwide problem. Many regulatory jurisdictions attempt to control human exposures with regulatory guidance values (RGVs) that specify a soil's maximum allowable concentration. Pesticides are important soil contaminants because of their intentional toxicity and widespread surface soil application. Worldwide, at least 174 regulatory jurisdictions from 54 United Nations member states have published more than 19,400 pesticide RGVs for at least 739 chemically unique pesticides. This manuscript examines the variability of the guidance values that are applied worldwide to the original 2001 Stockholm Convention persistent organic pollutants (POP) pesticides (Aldrin, Chlordane, DDT, Dieldrin, Endrin, Heptachlor, Mirex, and Toxaphene) for which at least 1667 RGVs have been promulgated. Results indicate that the spans of the RGVs applied to each of these pesticides vary from 6.1 orders of magnitude for Toxaphene to 10.0 orders of magnitude for Mirex. The distribution of values across these value spans resembles the distribution of lognormal random variables, but also contain non-random value clusters. Approximately 40% of all the POP RGVs fall within uncertainty bounds computed from the U.S. Environmental Protection Agency (USEPA) RGV cancer risk model. Another 22% of the values fall within uncertainty bounds computed from the USEPA's non-cancer risk model, but the cancer risk calculations yield the binding (lowest) value for all POP pesticides except Endrin. The results presented emphasize the continued need to rationalize the RGVs applied worldwide to important soil contaminants. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Mpl traffics to the cell surface through conventional and unconventional routes.

    Science.gov (United States)

    Cleyrat, Cédric; Darehshouri, Anza; Steinkamp, Mara P; Vilaine, Mathias; Boassa, Daniela; Ellisman, Mark H; Hermouet, Sylvie; Wilson, Bridget S

    2014-09-01

    Myeloproliferative neoplasms (MPNs) are often characterized by JAK2 or calreticulin (CALR) mutations, indicating aberrant trafficking in pathogenesis. This study focuses on Mpl trafficking and Jak2 association using two model systems: human erythroleukemia cells (HEL; JAK2V617F) and K562 myeloid leukemia cells (JAK2WT). Consistent with a putative chaperone role for Jak2, Mpl and Jak2 associate on both intracellular and plasma membranes (shown by proximity ligation assay) and siRNA-mediated knockdown of Jak2 led to Mpl trapping in the endoplasmic reticulum (ER). Even in Jak2 sufficient cells, Mpl accumulates in punctate structures that partially colocalize with ER-tracker, the ER exit site marker (ERES) Sec31a, the autophagy marker LC3 and LAMP1. Mpl was fused to miniSOG, a genetically encoded tag for correlated light and electron microscopy. Results suggest that a fraction of Mpl is taken up into autophagic structures from the ER and routed to autolyososomes. Surface biotinylation shows that both immature and mature Mpl reach the cell surface; in K562 cells Mpl is also released in exosomes. Both forms rapidly internalize upon ligand addition, while recovery is primarily attributed to immature Mpl. Mpl appears to reach the plasma membrane via both conventional ER-Golgi and autolysosome secretory pathways, as well as recycling. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Bacterial adhesion on conventional and self-ligating metallic brackets after surface treatment with plasma-polymerized hexamethyldisiloxane.

    Science.gov (United States)

    Tupinambá, Rogerio Amaral; Claro, Cristiane Aparecida de Assis; Pereira, Cristiane Aparecida; Nobrega, Celestino José Prudente; Claro, Ana Paula Rosifini Alves

    2017-01-01

    Plasma-polymerized film deposition was created to modify metallic orthodontic brackets surface properties in order to inhibit bacterial adhesion. Hexamethyldisiloxane (HMDSO) polymer films were deposited on conventional (n = 10) and self-ligating (n = 10) stainless steel orthodontic brackets using the Plasma-Enhanced Chemical Vapor Deposition (PECVD) radio frequency technique. The samples were divided into two groups according to the kind of bracket and two subgroups after surface treatment. Scanning Electron Microscopy (SEM) analysis was performed to assess the presence of bacterial adhesion over samples surfaces (slot and wings region) and film layer integrity. Surface roughness was assessed by Confocal Interferometry (CI) and surface wettability, by goniometry. For bacterial adhesion analysis, samples were exposed for 72 hours to a Streptococcus mutans solution for biofilm formation. The values obtained for surface roughness were analyzed using the Mann-Whitney test while biofilm adhesion were assessed by Kruskal-Wallis and SNK test. Significant statistical differences (pbrackets after surface treatment and between conventional and self-ligating brackets; no significant statistical differences were observed between self-ligating groups (p> 0.05). Plasma-polymerized film deposition was only effective on reducing surface roughness and bacterial adhesion in conventional brackets. It was also noted that conventional brackets showed lower biofilm adhesion than self-ligating brackets despite the absence of film.

  18. In-vitro evaluation of the accuracy of conventional and digital methods of obtaining full-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Mehl, Albert

    2015-01-01

    To investigate the accuracy of conventional and digital impression methods used to obtain full-arch impressions by using an in-vitro reference model. Eight different conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; and irreversible hydrocolloid, ALG) and digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; and Lava COS, LAV) full-arch impressions were obtained from a reference model with a known morphology, using a highly accurate reference scanner. The impressions obtained were then compared with the original geometry of the reference model and within each test group. A point-to-point measurement of the surface of the model using the signed nearest neighbour method resulted in a mean (10%-90%)/2 percentile value for the difference between the impression and original model (trueness) as well as the difference between impressions within a test group (precision). Trueness values ranged from 11.5 μm (VSE) to 60.2 μm (POE), and precision ranged from 12.3 μm (VSE) to 66.7 μm (POE). Among the test groups, VSE, VSES, and CER showed the highest trueness and precision. The deviation pattern varied with the impression method. Conventional impressions showed high accuracy across the full dental arch in all groups, except POE and ALG. Conventional and digital impression methods show differences regarding full-arch accuracy. Digital impression systems reveal higher local deviations of the full-arch model. Digital intraoral impression systems do not show superior accuracy compared to highly accurate conventional impression techniques. However, they provide excellent clinical results within their indications applying the correct scanning technique.

  19. Self-disinfecting Alginate vs Conventional Alginate: Effect on Surface Hardness of Gypsum Cast-An in vitro Study.

    Science.gov (United States)

    Madhavan, Ranjith; George, Navia; Thummala, Niharika R; Ravi, S V; Nagpal, Ajay

    2017-11-01

    For the construction of any dental prosthesis, accurate impressions are necessary. Hence, we undertook the present study to evaluate and compare the surface hardness of gypsum casts poured from impressions made using conventional alginate and self-disinfecting alginate. A total of 30 impressions of stainless steel die were made, out of which 15 impressions were made with conventional alginate and 15 were made with self-disinfecting alginate and poured using Type III dental stone. Thirty stone specimens were subjected for hardness testing. Data were analyzed using independent samples t-test to compare the mean surface hardness. Difference in surface hardness was statistically insignificant (p > 0.05). Surface hardness of gypsum casts poured using impressions made from self-disinfecting alginate and conventional alginates were comparable. Self-disinfecting alginates may be employed in clinical practice as safe and effective materials to overcome the infection control issues without compromising on the properties of the material.

  20. Why conventional detection methods fail in identifying the existence of contamination events.

    Science.gov (United States)

    Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han

    2016-04-15

    Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Monte Carlo method for random surfaces

    International Nuclear Information System (INIS)

    Berg, B.

    1985-01-01

    Previously two of the authors proposed a Monte Carlo method for sampling statistical ensembles of random walks and surfaces with a Boltzmann probabilistic weight. In the present paper we work out the details for several models of random surfaces, defined on d-dimensional hypercubic lattices. (orig.)

  2. The comparative evaluation of patients′ body dry weight under hemodialysis using two methods: Bioelectrical impedance analysis and conventional method

    Directory of Open Access Journals (Sweden)

    Neda Alijanian

    2012-01-01

    Full Text Available Background: Dry weight (DW is an important concept related to patients undergoing hemodialysis. Conventional method seems to be time consuming and operator dependent. Bio impedance analysis (BIA is a new and simple method reported to be an accurate way for estimating DW. In this study, we aimed to compare the conventional estimation of DW with measuring DW by BIA. Materials and Methods: This study involved 130 uremic patients, performed in Isfahan, Iran. DW was calculated by both conventional (CDW and BIA (BIADW method and results were compared based on different grouping factors including sex, underlying cause of renal failure (RF (diabetic RF and non-diabetic RF, body mass index (BMI status, and sessions of hemodialysis. We also calculated the difference between DWs of 2 methods (DW diff = CDW-BIADW. Results: The mean of BIADW was significantly lower than CDW (57.20 ± 1.82 vs 59.36 ± 1.77, P value < 0.001. After grouping cases according to the underlying cause, BMI, sex, and dialysis sessions BIADW was significantly lower than CDW. Conclusion: Based on the combination of problems with CDW measurement which are corrected by BIA, and more clinical reliability of CDW, we concluded that although conventional method is a time-consuming and operator-dependent way to assess DW, DW could be estimated by combining both of these methods by finding the mathematic correlation between these methods.

  3. Removal of antibiotics from surface and distilled water in conventional water treatment processes

    Science.gov (United States)

    Adams, C.; Wang, Y.; Loftin, K.; Meyer, M.

    2002-01-01

    Conventional drinking water treatment processes were evaluated under typical water treatment plant conditions to determine their effectiveness in the removal of seven common antibiotics: carbadox, sulfachlorpyridazine, sulfadimethoxine, sulfamerazine, sulfamethazine, sulfathiazole, and trimethoprim. Experiments were conducted using synthetic solutions prepared by spiking both distilled/ deionized water and Missouri River water with the studied compounds. Sorption on Calgon WPH powdered activated carbon, reverse osmosis, and oxidation with chlorine and ozone under typical plant conditions were all shown to be effective in removing the studied antibiotics. Conversely, coagulation/flocculation/sedimentation with alum and iron salts, excess lime/soda ash softening, ultraviolet irradiation at disinfection dosages, and ion exchange were all relatively ineffective methods of antibiotic removal. This study shows that the studied antibiotics could be effectively removed using processes already in use many water treatment plants. Additional work is needed on by-product formation and the removal of other classes of antibiotics.

  4. "Effect of nano-filled surface coating agent on fluoride release from conventional glass ionomer cement: An in vitro trial"

    OpenAIRE

    S Tiwari; B Nandlal

    2013-01-01

    Context: To overcome the drawbacks of glass ionomer cement of sensitivity to initial desiccation and moisture contamination the use of surface coating agent is recommended. The search in this area led to invent of use of nanofillers in surface coating agent, but its effect on fluoride release is not clear. Aim: The aim of this study is to evaluate and compare the fluoride release from conventional glass ionomer cement with and without surface coating agent. Settings and Design: This in vitro ...

  5. Comparison of Transmission Line Methods for Surface Acoustic Wave Modeling

    Science.gov (United States)

    Wilson, William; Atkinson, Gary

    2009-01-01

    Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method (a first order model), and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices. Keywords: Surface Acoustic Wave, SAW, transmission line models, Impulse Response Method.

  6. Surface physics theoretical models and experimental methods

    CERN Document Server

    Mamonova, Marina V; Prudnikova, I A

    2016-01-01

    The demands of production, such as thin films in microelectronics, rely on consideration of factors influencing the interaction of dissimilar materials that make contact with their surfaces. Bond formation between surface layers of dissimilar condensed solids-termed adhesion-depends on the nature of the contacting bodies. Thus, it is necessary to determine the characteristics of adhesion interaction of different materials from both applied and fundamental perspectives of surface phenomena. Given the difficulty in obtaining reliable experimental values of the adhesion strength of coatings, the theoretical approach to determining adhesion characteristics becomes more important. Surface Physics: Theoretical Models and Experimental Methods presents straightforward and efficient approaches and methods developed by the authors that enable the calculation of surface and adhesion characteristics for a wide range of materials: metals, alloys, semiconductors, and complex compounds. The authors compare results from the ...

  7. A new method to characterize dopant profiles in NMOSFETs using conventional transmission electron microscopy

    International Nuclear Information System (INIS)

    Kawamura, Kazuo; Ikeda, Kazuto; Terauchi, Masami

    2004-01-01

    We have developed a new method using conventional transmission electron microscopy (TEM) to obtain two dimensional dopant profiles in silicon and applied it to 40 nm-gate-length N + /p metal oxide semiconductor field effect transistors (MOSFETs). The results are consistent with those of selective-chemically etched samples observed by TEM. This method, using focused ion beam (FIB) sample preparation and conventional TEM, has the great advantage of simple sample preparation and high spatial resolution compared to other characterization methods, such as atomic capacitance microscopy, spreading resistance microscopy, and TEM combined with selective chemical etching. This indicates that this method can be applicable to the analysis of FETs at the 65 nm or smaller node

  8. Conventional and Alternative Disinfection Methods of Legionella in Water Distribution Systems – Review

    Directory of Open Access Journals (Sweden)

    Pūle Daina

    2016-12-01

    Full Text Available Prevalence of Legionella in drinking water distribution systems is a widespread problem. Outbreaks of Legionella caused diseases occur despite various disinfectants are used in order to control Legionella. Conventional methods like thermal disinfection, silver/copper ionization, ultraviolet irradiation or chlorine-based disinfection have not been effective in the long term for control of biofilm bacteria. Therefore, research to develop more effective disinfection methods is still necessary.

  9. Methods for assessing phosphorus overfeeding on organic and conventional dairy farms.

    Science.gov (United States)

    Nordqvist, M; Holtenius, K; Spörndly, R

    2014-02-01

    Phosphorus (P) losses from dairy farms can severely damage aquatic ecosystems, so it is important to have tools to assess overfeeding of P. This study screened P intake and faecal excretion of different P fractions in dairy cows on conventional and organic farms, compared the P feeding level of the herds against the recommendations and analysed different sampling and analysis methods for assessing the general status of P feeding on the farms. The organic (n=14) and conventional farms (n=15) were of comparable size and were located in southern Sweden. On each farm, feed intake was registered for 10 cows representing four different lactation stages and their P intake was calculated and related to current recommendations. Faecal samples taken from the same cows were analysed for total P (TP) and soluble P. Milk production data for the cows were obtained from the Swedish official milk recording scheme. TP was determined in one slurry sample per farm. More than 70% of the cows studied, representing both conventional and organic herds, consumed P in excess of the recommendations. Conventional herds had higher P content in the ration than organic herds, and lactating cows in conventional herds had higher faecal concentrations of total and soluble P than those in organic herds. However in dry cows, the P content of the ration and soluble P and TP in faeces did not differ between the two management systems. Soluble P was well correlated to TP in faeces, and both were good indicators of P overfeeding.

  10. Surface modifying method for metal member

    International Nuclear Information System (INIS)

    Amano, Kazuo; Enomoto, Kunio; Hirano, Akihiko; Hirano, Atsuya; Hattori, Shigeo; Hayashi, Eisaku; Ueyama, Toshiharu; Hayashi, Makoto

    1998-01-01

    A surface of a metal member such as carbon steel to be used in a corrosion circumstance such as in a nuclear power plant and a thermoelectric plant are polished. A printing method is conducted for removing obstacles on the surface of the member. Namely, a photographing printing paper immersed in a diluted sulfuric acid solution is appended tightly to the portion with its surface polished smoothly. Sulfur present in the form of an obstacle of MnS or present alone in the material reacts with the sulfuric acid to form a sulfuric acid gas, and reacts with Ag of the printing paper to discolor the printing paper to brown. When a peeled printing paper is discolored to brown, sulfur printing is repeated. After conforming that the peeled printing paper is white, the surface is washed. Subsequently, surface plasticization is conducted by water jet peening or shot peening. (I.N.)

  11. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    International Nuclear Information System (INIS)

    Kouchakzadeh, Ahmad; Tavakoli, Teymur

    2011-01-01

    Highlights: → Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. → Using thermophysical properties of air and matter. → This manner could be utilized in similar dryer for other agricultural products. → Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  12. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    Energy Technology Data Exchange (ETDEWEB)

    Kouchakzadeh, Ahmad [Agri Machinery Engineering, Ilam University, Ilam (Iran, Islamic Republic of); Tavakoli, Teymur [Agri Machinery Engineering, Tarbyat Modares University, Tehran (Iran, Islamic Republic of)

    2011-07-15

    Highlights: {yields} Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. {yields} Using thermophysical properties of air and matter. {yields} This manner could be utilized in similar dryer for other agricultural products. {yields} Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  13. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology

    Directory of Open Access Journals (Sweden)

    Udasimath Shivakumarswamy

    2012-01-01

    Full Text Available Background: The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS method. Aims: To compare the morphological features of the CS method with those of the cell block (CB method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. Materials and Methods: The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the ′z test′ was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer′s χ2 test was used to identify the additional yield for malignancy by the CB method. Results: Cellularity and additional yield for malignancy was 15% more by the CB method. Conclusions: The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  14. Selecting the patients for morning report sessions: case-based vs. conventional method.

    Science.gov (United States)

    Rabiei, Mehdi; Saeidi, Masumeh; Kiani, Mohammad Ali; Amin, Sakineh Mohebi; Ahanchian, Hamid; Jafari, Seyed Ali; Kianifar, Hamidreza

    2015-08-01

    One of the most important issues in morning report sessions is the number of patients. The aim of this study was to investigate and compare the number of cases reported in the morning report sessions in terms of case-based and conventional methods from the perspective of pediatric residents of Mashhad University of Medical Sciences. The present study was conducted on 24 pediatric residents of Mashhad University of Medical Sciences in the academic year 2014-2015. In this survey, the residents replied to a 20-question researcher-made questionnaire that had been designed to measure the views of residents regarding the number of patients in the morning report sessions using case-based and conventional methods. The validity of the questionnaire was confirmed by experts' views and its reliability by calculating Cronbach's alpha coefficients. Data were analyzed by t-test analysis. The mean age of the residents was 30.852 ± 2.506, and 66.6% of them were female. The results showed that there was no significant relationship among the variables of academic year, gender, and residents' perspective to choosing the number of patients in the morning report sessions (P > 0.05). T-test analysis showed a significant relationship among the average scores of residents in the selection of the case-based method in comparison to the conventional method (P case-based morning report was preferred compared to the conventional method. This method makes residents pay more attention to the details of patients' issues and therefore helps them to better plan how to address patient problems and improve their differential diagnosis skills.

  15. Comparison of multimedia system and conventional method in patients’ selecting prosthetic treatment

    Directory of Open Access Journals (Sweden)

    Baghai R

    2010-12-01

    Full Text Available "nBackground and Aims: Selecting an appropriate treatment plan is one of the most critical aspects of dental treatments. The purpose of this study was to compare multimedia system and conventional method in patients' selecting prosthetic treatment and the time consumed."nMaterials and Methods: Ninety patients were randomly divided into three groups. Patients in group A, once were instructed using the conventional method of dental office and once multimedia system and time was measured in seconds from the beginning of the instruction till the patient had came to decision. The patients were asked about the satisfaction of the method used for them. In group B, patients were only instructed using the conventional method, whereas they were only exposed to soft ware in group C. The data were analyzed with Paired-T-test"n(in group A and T-test and Mann-Whitney test (in groups B and C."nResult: There was a significant difference between multimedia system and conventional method in group A and also between groups B and C (P<0.001. In group A and between groups B and C, patient's satisfaction about multimedia system was better. However, in comparison between groups B and C, multimedia system did not have a significant effect in treatment selection score (P=0.08."nConclusion: Using multimedia system is recommended due to its high ability in giving answers to a large number of patient's questions as well as in terms of marketing.

  16. Antibacterial activity, surface roughness, flexural strength, and solubility of conventional luting cements containing chlorhexidine diacetate/cetrimide mixtures.

    Science.gov (United States)

    Korkmaz, Fatih Mehmet; Tüzüner, Tamer; Baygin, Ozgul; Buruk, Celal Kurtulus; Durkan, Rukiye; Bagis, Bora

    2013-08-01

    The failure of fixed dental restorations is commonly associated with caries. The use of conventional luting cements containing antibacterial agents may overcome this problem. The purpose of this study was to evaluate the antibacterial activity (ABA), surface roughness (Ra), flexural strength (FS), and solubility (SL) patterns of the conventional dental luting cements zinc phosphate (ZP), zinc polycarboxylate (PC), and glass ionomer (GIC) after the addition of 5% chlorhexidine diacetate/cetrimide (CHX+CT). Antibacterial agents with a total concentration of 5% (2.5% CHX+2.5% CT) were added to antibacterial agent-free conventional luting cement powders (ZPC, PCC, and GICC) and designated as experimental groups (ZPE, PCE, and GICE). ABA against Streptococcus mutans (SM) and Lactobacillus casei (LB) was examined by using the agar diffusion test method. Ra, FS, and SL values were obtained after storage in distilled water at 37°C for 24 hours. The Kruskal-Wallis and Mann Whitney U with Bonferroni correction tests were used to test for agar diffusion (α=.05) and 2-way ANOVA and Fisher Least Significant Difference (LSD) test were used to measure Ra, FS, and SL (α=.05). The control groups exhibited limited ABA. With the exception of PCE>PCC on day 1 for SM, all experimental groups showed significantly greater and longer-lasting protection against SM and LB bacteria for up to 180 days than their controls (PZPE; P>.05, PCC>PCE; PGICC (P>.05) when compared with their individual controls. Control groups exhibited higher FS values than did the experimental groups (ZPC>ZPE; PPCE; PGICE; P>.05). The experimental groups exhibited higher solubilities than did their controls in the ZPC (P>.05) and GICC groups (P<.05) but were lower in PCC group (P<.05). Incorporating a 5% CHX+CT mixture into conventional dental luting cements and altering their Ra, FS, and SL values may provide greater antibacterial protection against SM and LB. Copyright © 2013 The Editorial Council of the

  17. Conservation Farming and Changing Climate: More Beneficial than Conventional Methods for Degraded Ugandan Soils

    Directory of Open Access Journals (Sweden)

    Drake N. Mubiru

    2017-06-01

    Full Text Available The extent of land affected by degradation in Uganda ranges from 20% in relatively flat and vegetation-covered areas to 90% in the eastern and southwestern highlands. Land degradation has adversely affected smallholder agro-ecosystems including direct damage and loss of critical ecosystem services such as agricultural land/soil and biodiversity. This study evaluated the extent of bare grounds in Nakasongola, one of the districts in the Cattle Corridor of Uganda and the yield responses of maize (Zea mays and common bean (Phaseolus vulgaris L. to different tillage methods in the district. Bare ground was determined by a supervised multi-band satellite image classification using the Maximum Likelihood Classifier (MLC. Field trials on maize and bean grain yield responses to tillage practices used a randomized complete block design with three replications, evaluating conventional farmer practice (CFP; permanent planting basins (PPB; and rip lines, with or without fertilizer in maize and bean rotations. Bare ground coverage in the Nakasongola District was 187 km2 (11% of the 1741 km2 of arable land due to extreme cases of soil compaction. All practices, whether conventional or the newly introduced conservation farming practices in combination with fertilizer increased bean and maize grain yields, albeit with minimal statistical significance in some cases. The newly introduced conservation farming tillage practices increased the bean grain yield relative to conventional practices by 41% in PPBs and 43% in rip lines. In maize, the newly introduced conservation farming tillage practices increased the grain yield by 78% on average, relative to conventional practices. Apparently, conservation farming tillage methods proved beneficial relative to conventional methods on degraded soils, with the short-term benefit of increasing land productivity leading to better harvests and food security.

  18. Adherence of Candida to complete denture surfaces in vitro: A comparison of conventional and CAD/CAM complete dentures.

    Science.gov (United States)

    Al-Fouzan, Afnan F; Al-Mejrad, Lamya A; Albarrag, Ahmed M

    2017-10-01

    The goal of this study was to compare the adhesion of Candida albicans to the surfaces of CAD/CAM and conventionally fabricated complete denture bases. Twenty discs of acrylic resin poly (methyl methacrylate) were fabricated with CAD/CAM and conventional procedures (heat-polymerized acrylic resin). The specimens were divided into two groups: 10 discs were fabricated using the CAD/CAM procedure (Wieland Digital Denture Ivoclar Vivadent), and 10 discs were fabricated using a conventional flasking and pressure-pack technique. Candida colonization was performed on all the specimens using four Candida albicans isolates. The difference in Candida albicans adhesion on the discs was evaluated. The number of adherent yeast cells was calculated by the colony-forming units (CFU) and by Fluorescence microscopy. There was a significant difference in the adhesion of Candida albicans to the complete denture bases created with CAD/CAM and the adhesion to those created with the conventional procedure. The CAD/CAM denture bases exhibited less adhesion of Candida albicans than did the denture bases created with the conventional procedure ( P CAD/CAM procedure for fabricating complete dentures showed promising potential for reducing the adherence of Candida to the denture base surface. Clinical Implications. Complete dentures made with the CAD/CAM procedure might decrease the incidence of denture stomatitis compared with conventional dentures.

  19. Effectiveness of Video Demonstration over Conventional Methods in Teaching Osteology in Anatomy.

    Science.gov (United States)

    Viswasom, Angela A; Jobby, Abraham

    2017-02-01

    Technology and its applications are the most happening things in the world. So, is it in the field of medical education. This study was an evaluation of whether the conventional methods can compete with the test of technology. A comparative study of traditional method of teaching osteology in human anatomy with an innovative visual aided method. The study was conducted on 94 students admitted to MBBS 2014 to 2015 batch of Travancore Medical College. The students were divided into two academically validated groups. They were taught using conventional and video demonstrational techniques in a systematic manner. Post evaluation tests were conducted. Analysis of the mark pattern revealed that the group taught using traditional method scored better when compared to the visual aided method. Feedback analysis showed that, the students were able to identify bony features better with clear visualisation and three dimensional view when taught using the video demonstration method. The students identified visual aided method as the more interesting one for learning which helped them in applying the knowledge gained. In most of the questions asked, the two methods of teaching were found to be comparable on the same scale. As the study ends, we discover that, no new technique can be substituted for time tested techniques of teaching and learning. The ideal method would be incorporating newer multimedia techniques into traditional classes.

  20. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology.

    Science.gov (United States)

    Shivakumarswamy, Udasimath; Arakeri, Surekha U; Karigowdar, Mahesh H; Yelikar, Br

    2012-01-01

    The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS) method. To compare the morphological features of the CS method with those of the cell block (CB) method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the 'z test' was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer's χ(2)test was used to identify the additional yield for malignancy by the CB method. Cellularity and additional yield for malignancy was 15% more by the CB method. The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  1. Interphase Chromosome Profiling: A Method for Conventional Banded Chromosome Analysis Using Interphase Nuclei.

    Science.gov (United States)

    Babu, Ramesh; Van Dyke, Daniel L; Dev, Vaithilingam G; Koduru, Prasad; Rao, Nagesh; Mitter, Navnit S; Liu, Mingya; Fuentes, Ernesto; Fuentes, Sarah; Papa, Stephen

    2018-02-01

    - Chromosome analysis on bone marrow or peripheral blood samples fails in a small proportion of attempts. A method that is more reliable, with similar or better resolution, would be a welcome addition to the armamentarium of the cytogenetics laboratory. - To develop a method similar to banded metaphase chromosome analysis that relies only on interphase nuclei. - To label multiple targets in an equidistant fashion along the entire length of each chromosome, including landmark subtelomere and centromere regions. Each label so generated by using cloned bacterial artificial chromosome probes is molecularly distinct with unique spectral characteristics, so the number and position of the labels can be tracked to identify chromosome abnormalities. - Interphase chromosome profiling (ICP) demonstrated results similar to conventional chromosome analysis and fluorescence in situ hybridization in 55 previously studied cases and obtained useful ICP chromosome analysis results on another 29 cases in which conventional methods failed. - ICP is a new and powerful method to karyotype peripheral blood and bone marrow aspirate preparations without reliance on metaphase chromosome preparations. It will be of particular value for cases with a failed conventional analysis or when a fast turnaround time is required.

  2. Evaluation of stream discharges measurement using radioisotope and conventional method at Sungai Weng catchment area, Kedah

    International Nuclear Information System (INIS)

    Nazrul Hizam Yusoff and Wan Zakaria Wan MuhdTahir

    2006-01-01

    A number of discharge measurements using radioisotope and current metering techniques at selected streams in Sg. Weng Experimental Catchment were conducted by MINT and JPS gauging teams starting from 2003-2005. This study aims to prepare stage-discharge relationships or rating curves of the selected streams during variable flow conditions. The rating curve of the stream is one of the important parameters and usually appraised in certain routine operations of hydrological studies. It may be used in the planning of water resources management and flood control scheme. The radioisotope method employed in this study involved the injection of short-lived radioisotope tracer, that is, technetium-99m ( 99m Tc having its half-life ∼ 6.023 hrs) which was supplied from a high activity technetium generator (55.5 Gbq). Measurement of stream discharges were concurrently undertaken by JPS staff using a current meter type 0TT-C2 mounted on a wading rod at selected gauging stations for comparison purposes. Methodologies from the two methods of discharge measurements, comparison of results and identifying the uncertainties (errors) in performing the measurement during low, medium and high turbulent flows were explained in this paper. Generally, the entire results of streamflow data (2003-2005) measured by both methods during low flows (Q 3 /s) exhibit almost comparable values to each other. However, for moderate flows (1.0 m 3 /s 3 /s), the different in gauging results are slightly higher using radioisotope method ( i.e. Q isotope > Q current meter and may goes up to 40%) , and during high turbulent flows (Q>6.0 m 3 /s) the radioisotope method presented more than 40% higher discharge values as compared to the measurement made by the conventional current-meter. Observation made on site anticipated that inaccurate gauging data measured by conventional means during high flow and turbulent conditions are expected. The average estimated measurement error associated with isotope method

  3. Evaluation of positional plagiocephaly: Conventional anthropometric measurement versus laser scanning method.

    Science.gov (United States)

    Nahles, Susanne; Klein, Martin; Yacoub, Anke; Neyer, Julia

    2018-01-01

    The incidence of plagiocephaly has increased in the 25 years since the "Back to Sleep" campaign in 1991 to prevent sudden infant death. Plagiocephaly is not considered to be a pathological condition. It is more of an esthetic impairment and could have potentially negative psychological or psychosocial consequences; therefore, treatment is recommended. The aim of this study is to compare conventional anthropometry and laser scanning - two different measurement methods - as diagnostic instruments for plagiocephaly. The present study also tests the measurement time of both methods and whether one method is easier on the patient than the other. A total of 44 children (21 girls, 23 boys) with a mean age of 8.8 months were involved in the present study. Of all patients, the following parameters were routinely evaluated using a standard protocol with the conventional anthropometric method and the scan method: head circumference, head length, head width, head diagonals, and distances ex-t. Furthermore, the time required to obtain measurements and the behavior of the children during measurement were documented. For statistical analysis, a t-test and a Wilcoxon test were used to analyze differences between the two methods. The results for head circumference showed a mean of 441.5 mm for the anthropometric measurements and 441.6 mm for the scan method, with no significant difference between the two methods. A significant difference was found regarding the head width, head length, diagonals, and distance ex-t. The measurement process using the scan method needed a mean of 579.6 s in contrast to the manual anthropometric method, which required a mean time of 180.5 s. In comparison with the conventional anthropometric method, measurements made with a 3D laser scanner yield inconsistent results. Moreover, the current state of technology of 3D cephalometry has no advantages compared with the conventional anthropometric method. Disadvantages worth mentioning appear to be the

  4. Specific surface area evaluation method by using scanning electron microscopy

    International Nuclear Information System (INIS)

    Petrescu, Camelia; Petrescu, Cristian; Axinte, Adrian

    2000-01-01

    Ceramics are among the most interesting materials for a large category of applications, including both industry and health. Among the characteristic of the ceramic materials, the specific surface area is often difficult to evaluate.The paper presents a method of evaluation for the specific surface area of two ceramic powders by means of scanning electron microscopy measurements and an original method of computing the specific surface area.Cumulative curves are used to calculate the specific surface area under assumption that the values of particles diameters follow a normal logarithmic distribution. For two powder types, X7R and NPO the results are the following: - for the density ρ (g/cm 2 ), 5.5 and 6.0, respectively; - for the average diameter D bar (μm), 0.51 and 0.53, respectively; - for σ, 1.465 and 1.385, respectively; - for specific surface area (m 2 /g), 1.248 and 1.330, respectively. The obtained results are in good agreement with the values measured by conventional methods. (authors)

  5. Comparison of Different Recruitment Methods for Sexual and Reproductive Health Research: Social Media-Based Versus Conventional Methods.

    Science.gov (United States)

    Motoki, Yoko; Miyagi, Etsuko; Taguri, Masataka; Asai-Sato, Mikiko; Enomoto, Takayuki; Wark, John Dennis; Garland, Suzanne Marie

    2017-03-10

    Prior research about the sexual and reproductive health of young women has relied mostly on self-reported survey studies. Thus, participant recruitment using Web-based methods can improve sexual and reproductive health research about cervical cancer prevention. In our prior study, we reported that Facebook is a promising way to reach young women for sexual and reproductive health research. However, it remains unknown whether Web-based or other conventional recruitment methods (ie, face-to-face or flyer distribution) yield comparable survey responses from similar participants. We conducted a survey to determine whether there was a difference in the sexual and reproductive health survey responses of young Japanese women based on recruitment methods: social media-based and conventional methods. From July 2012 to March 2013 (9 months), we invited women of ages 16-35 years in Kanagawa, Japan, to complete a Web-based questionnaire. They were recruited through either a social media-based (social networking site, SNS, group) or by conventional methods (conventional group). All participants enrolled were required to fill out and submit their responses through a Web-based questionnaire about their sexual and reproductive health for cervical cancer prevention. Of the 243 participants, 52.3% (127/243) were recruited by SNS, whereas 47.7% (116/243) were recruited by conventional methods. We found no differences between recruitment methods in responses to behaviors and attitudes to sexual and reproductive health survey, although more participants from the conventional group (15%, 14/95) chose not to answer the age of first intercourse compared with those from the SNS group (5.2%, 6/116; P=.03). No differences were found between recruitment methods in the responses of young Japanese women to a Web-based sexual and reproductive health survey. ©Yoko Motoki, Etsuko Miyagi, Masataka Taguri, Mikiko Asai-Sato, Takayuki Enomoto, John Dennis Wark, Suzanne Marie Garland. Originally

  6. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    OpenAIRE

    A Pourkhalili; M Mirlohi; E Rahimi; M Hojatoleslami

    2012-01-01

    Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying a...

  7. Optimized method for manufacturing large aspheric surfaces

    Science.gov (United States)

    Zhou, Xusheng; Li, Shengyi; Dai, Yifan; Xie, Xuhui

    2007-12-01

    Aspheric optics are being used more and more widely in modern optical systems, due to their ability of correcting aberrations, enhancing image quality, enlarging the field of view and extending the range of effect, while reducing the weight and volume of the system. With optical technology development, we have more pressing requirement to large-aperture and high-precision aspheric surfaces. The original computer controlled optical surfacing (CCOS) technique cannot meet the challenge of precision and machining efficiency. This problem has been thought highly of by researchers. Aiming at the problem of original polishing process, an optimized method for manufacturing large aspheric surfaces is put forward. Subsurface damage (SSD), full aperture errors and full band of frequency errors are all in control of this method. Lesser SSD depth can be gained by using little hardness tool and small abrasive grains in grinding process. For full aperture errors control, edge effects can be controlled by using smaller tools and amendment model with material removal function. For full band of frequency errors control, low frequency errors can be corrected with the optimized material removal function, while medium-high frequency errors by using uniform removing principle. With this optimized method, the accuracy of a K9 glass paraboloid mirror can reach rms 0.055 waves (where a wave is 0.6328μm) in a short time. The results show that the optimized method can guide large aspheric surface manufacturing effectively.

  8. Surface wave velocity tracking by bisection method

    International Nuclear Information System (INIS)

    Maeda, T.

    2005-01-01

    Calculation of surface wave velocity is a classic problem dating back to the well-known Haskell's transfer matrix method, which contributes to solutions of elastic wave propagation, global subsurface structure evaluation by simulating observed earthquake group velocities, and on-site evaluation of subsurface structure by simulating phase velocity dispersion curves and/or H/V spectra obtained by micro-tremor observation. Recently inversion analysis on micro-tremor observation requires efficient method of generating many model candidates and also stable, accurate, and fast computation of dispersion curves and Raleigh wave trajectory. The original Haskell's transfer matrix method has been improved in terms of its divergence tendency mainly by the generalized transmission and reflection matrix method with formulation available for surface wave velocity; however, root finding algorithm has not been fully discussed except for the one by setting threshold to the absolute value of complex characteristic functions. Since surface wave number (reciprocal to the surface wave velocity multiplied by frequency) is a root of complex valued characteristic function, it is intractable to use general root finding algorithm. We will examine characteristic function in phase plane to construct two dimensional bisection algorithm with consideration on a layer to be evaluated and algorithm for tracking roots down along frequency axis. (author)

  9. Comparison of Concept Mapping and Conventional Teaching Methods on Critical Thinking Skills of Nursing Students

    Directory of Open Access Journals (Sweden)

    Masoumeh Delaram

    2017-06-01

    Full Text Available Background and Objective: Development of critical thinking and practical skills has remained a serious and considerable challenge throughout the nursing educational system in Iran. Conventional methods of teaching such as lectures as the dominant method used in higher education system is a passive style which ignores critical thinking. Therefore, the aim of this study was to compare the effect of instruction by Concept-Mapping and conventional Method on critical thinking skills of nursing students. Materials and Methods:This quasi-experimental study was carried out on 70 nursing students of Tehran Nursing and Midwifery schoolwho were selected through convenient sampling method, then were divided randomly into the two equal Experimental and Control groups. Educational content was presented in the form of Concept-Mapping in the Experimental group and Lecture,Demonstration and Practicalexercises in the control group. Data collection included a demographic information and California Critical Thinking Skills (form B questionnairewhich was completed at the beginning and at the end of the fourth week of Instructional period. Data were analyzed using SPSS software (V: 21, descriptive and analytical Statistics; at the significant level P<0.05. Results: Before the intervention, the mean of critical thinking skill score was 9.71±2.66 in concept mapping group and 9.64 ± 2.14 in conventional group and the difference was not significant (P=0.121, but after the intervention, a significant difference was found between the intervention and conventionalgroup (15.20±2.71 vs 10.25±2.06, P=0.003. Conclusion: Using Concept mapping strategy in the education of nursing students may lead to developing critical thinking skills as one of the important missions of higher education. So it is recommended to usethis method in clinical nursing education.

  10. A method to determine the number of nanoparticles in a cluster using conventional optical microscopes

    International Nuclear Information System (INIS)

    Kang, Hyeonggon; Attota, Ravikiran; Tondare, Vipin; Vladár, András E.; Kavuri, Premsagar

    2015-01-01

    We present a method that uses conventional optical microscopes to determine the number of nanoparticles in a cluster, which is typically not possible using traditional image-based optical methods due to the diffraction limit. The method, called through-focus scanning optical microscopy (TSOM), uses a series of optical images taken at varying focus levels to achieve this. The optical images cannot directly resolve the individual nanoparticles, but contain information related to the number of particles. The TSOM method makes use of this information to determine the number of nanoparticles in a cluster. Initial good agreement between the simulations and the measurements is also presented. The TSOM method can be applied to fluorescent and non-fluorescent as well as metallic and non-metallic nano-scale materials, including soft materials, making it attractive for tag-less, high-speed, optical analysis of nanoparticles down to 45 nm diameter

  11. MAXILLARY INCISORS CHANGES DURING SPACE CLOSURE WITH CONVENTIONAL AND SKELETAL ANCHORAGE METHODS: A SYSTEMATIC REVIEW

    Directory of Open Access Journals (Sweden)

    Yasas Shri Nalaka JAYARATNE

    2017-12-01

    Full Text Available Purpose: The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. Materials and Methods: The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Results: Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. Conclusion: More RCT’s that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  12. Ergonomic evaluation of conventional and improved methods of aonla pricking with women workers.

    Science.gov (United States)

    Rai, Arpana; Gandhi, Sudesh; Sharma, D K

    2012-01-01

    Conventional and improved methods of aonla pricking were evaluated ergonomically on an experiment conducted for 20 minute with women workers. The working heart rate, energy expenditure rate, total cardiac cost of work and physiological cost of work with conventional tools varied from 93-102 beats.min-1, 6-7.5 kJ.min-1, 285-470 beats, 14 -23 beats.min-1 while with machine varied from 96-105 beats.min-1, 6.5-8 kJ.min-1 , 336-540 beats, 16-27 beats.min-1 respectively. OWAS score for conventional method was 2 indicating corrective measures in near future while with machine was 1 indicating no corrective measures. Result of Nordic Musculoskeletal Questionnaire revealed that subjects complaint of pain in back, neck, right shoulder and right hand due to unnatural body posture and repetitive movement with hand tool. Moreover pricking was carried out in improper lighting conditions (200-300 lux) resulting into finger injuries from sharp edges of hand tool, whereas with machine no such problems were observed. Output with machine increased thrice than hand pricking in a given time. Machine was found useful in terms of saving time, increased productivity, enhanced safety and comfort as involved improved posture, was easy to handle and operate, thus increasing efficiency of the worker leading to better quality of life.

  13. Genetic improvement of olive (Olea europaea L.) by conventional and in vitro biotechnology methods.

    Science.gov (United States)

    Rugini, E; Cristofori, V; Silvestri, C

    2016-01-01

    In olive (Olea europaea L.) traditional methods of genetic improvement have up to now produced limited results. Intensification of olive growing requires appropriate new cultivars for fully mechanized groves, but among the large number of the traditional varieties very few are suitable. High-density and super high-density hedge row orchards require genotypes with reduced size, reduced apical dominance, a semi-erect growth habit, easy to propagate, resistant to abiotic and biotic stresses, with reliably high productivity and quality of both fruits and oil. Innovative strategies supported by molecular and biotechnological techniques are required to speed up novel hybridisation methods. Among traditional approaches the Gene Pool Method seems a reasonable option, but it requires availability of widely diverse germplasm from both cultivated and wild genotypes, supported by a detailed knowledge of their genetic relationships. The practice of "gene therapy" for the most important existing cultivars, combined with conventional methods, could accelerate achievement of the main goals, but efforts to overcome some technical and ideological obstacles are needed. The present review describes the benefits that olive and its products may obtain from genetic improvement using state of the art of conventional and unconventional methods, and includes progress made in the field of in vitro techniques. The uses of both traditional and modern technologies are discussed with recommendations. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Toxoplasmosis: The value of molecular methods in diagnosis compared to conventional methods

    Directory of Open Access Journals (Sweden)

    Zineb Tlamçani

    2013-06-01

    Full Text Available Toxoplasmosis is a parasitic infection due to Toxoplasma gondii an obligate intracellular protozoan parasite. It is considerateone of the most common parasite worldwide. The contamination of the parasite is generally occurred via consumptionof infected food or water or, undercooked contaminated meat. Toxoplasma gondii infection may lead to seriousillness when the organism is contracted while pregnancy or when it is reactivated in immune-suppressed persons.Diagnosis of toxoplasmosis in humans is elaborated using various techniques such as detection of anti-Toxoplasmaantibodies, mouse inoculation, histological revelation of tachyzoites in tissue sections or smears of body fluid, but thedetection of Toxoplasma gondii DNA by molecular methods has revolutionized prenatal diagnosis of congenital toxoplasmosisand in immunocompromised patients. In this paper we will discuss the parasite and different methods ofdiagnosis including the usefulness of molecular methods. J Microbiol Infect Dis 2013; 3(2: 93-99Key words: Toxoplamosis, Toxoplasma gondii, diagnosis

  15. Computational method for free surface hydrodynamics

    International Nuclear Information System (INIS)

    Hirt, C.W.; Nichols, B.D.

    1980-01-01

    There are numerous flow phenomena in pressure vessel and piping systems that involve the dynamics of free fluid surfaces. For example, fluid interfaces must be considered during the draining or filling of tanks, in the formation and collapse of vapor bubbles, and in seismically shaken vessels that are partially filled. To aid in the analysis of these types of flow phenomena, a new technique has been developed for the computation of complicated free-surface motions. This technique is based on the concept of a local average volume of fluid (VOF) and is embodied in a computer program for two-dimensional, transient fluid flow called SOLA-VOF. The basic approach used in the VOF technique is briefly described, and compared to other free-surface methods. Specific capabilities of the SOLA-VOF program are illustrated by generic examples of bubble growth and collapse, flows of immiscible fluid mixtures, and the confinement of spilled liquids

  16. Comparison of Tooth Color Change After Bleaching With Conventional and Different Light-Activated Methods.

    Science.gov (United States)

    Shahabi, Sima; Assadian, Hadi; Mahmoudi Nahavandi, Alireza; Nokhbatolfoghahaei, Hanieh

    2018-01-01

    Introduction: The demand for esthetic dental treatments is increasing in recent years mainly due to improved oral hygiene and better maintenance of oral health and teeth in older individuals. Bleaching of discolored anterior teeth is the most popular among esthetic dental treatments. Even individuals with sound teeth and adequate esthetics seek to have whiter teeth in the anterior region. The aim of this study was to evaluate tooth color changes following conventional in-office bleaching techniques compared to light-activated methods using different light sources. Methods: Seventy sound anterior teeth (devoided of caries and/or fracture), extracted for periodontal and orthodontic reasons were selected and allocated to 7 groups: (A) control, (B) conventional bleaching (C) LED-activated bleaching, (D) KTP laser-activated bleaching, (E) diode laser-activated bleaching, (F) Nd:YAG laser-activated bleaching and (G) CO2 laser-activated bleaching. Colorimetric evaluation was carried out before and after treatment using a spectrophotoradiometer. Data were analyzed by one- and two-way analysis of variance (ANOVA) as well as multiple comparison methods. Results: The results showed that all bleaching procedures were effective in reducing the yellowness index. However, the KTP laser-activated bleaching was significantly more effective than the other techniques in 95% confidence level. It was also seen that CO2 laser activated method has outperformed groups E, F and G and the conventional bleaching without light activation was not effective at all and represented similar results with the control group. Furthermore, the groups E and G had almost the same results in decreasing the yellowness index. Conclusion: The results showed that all bleaching techniques were effective however, the KTP laser-activated bleaching was significantly more efficient, closely followed by the CO2 laser-activated bleaching technique.

  17. Strategy for identification & characterization of Bartonella henselae with conventional & molecular methods

    Directory of Open Access Journals (Sweden)

    Kavita Diddi

    2013-01-01

    Full Text Available Background & objectives: Bartonella henselae is a fastidious gram-negative bacterium usually causing self limiting infections in immunocompetent individuals but often causes potentially life threatening infection, such as bacillary angiomatosis in immunocompromised patients. Both diagnosis of infections and research into molecular mechanisms of pathogenesis have been hindered by lack of appropriate and reliable diagnostic techniques. We undertook this study to standardize methods to characterize B. henselae in clinical samples to diagnose Bartonella infection correctly. Methods: B. henselae ATCC 49882 strain was procured from American type culture collection, USA. This strain was revived and maintained in the laboratory, and identification and characterization of this strain was done by conventional and molecular techniques, which included culture on various media, staining by different methods including electron microscopy, biochemical analysis by conventional methods and API, polymerase chain reaction (PCR for amplification of citrate synthase gene followed by restriction fragment length polymorphism (RFLP. Results: This organism was biochemically inert due to slow growth and generated unique identification code with API. The amplification of the citrate-synthase gene with primers yielded a 381 bp product followed by specific RFLP profile for B. henselae. Interpretation & conclusions: Bartonella is fastidious and fragile organism and should be handled carefully. Extra effort and careful observation are required to isolate and characterize this organism.

  18. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions

    OpenAIRE

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-01-01

    STATEMENT OF PROBLEM: Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. PURPOSE: The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. MATERIAL AND METHODS: Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsilox...

  19. A Comparison of Surface Acoustic Wave Modeling Methods

    Science.gov (United States)

    Wilson, W. c.; Atkinson, G. M.

    2009-01-01

    Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method a first order model, and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices.

  20. New method to design stellarator coils without the winding surface

    Science.gov (United States)

    Zhu, Caoxiang; Hudson, Stuart R.; Song, Yuntao; Wan, Yuanxi

    2018-01-01

    Finding an easy-to-build coils set has been a critical issue for stellarator design for decades. Conventional approaches assume a toroidal ‘winding’ surface, but a poorly chosen winding surface can unnecessarily constrain the coil optimization algorithm, This article presents a new method to design coils for stellarators. Each discrete coil is represented as an arbitrary, closed, one-dimensional curve embedded in three-dimensional space. A target function to be minimized that includes both physical requirements and engineering constraints is constructed. The derivatives of the target function with respect to the parameters describing the coil geometries and currents are calculated analytically. A numerical code, named flexible optimized coils using space curves (FOCUS), has been developed. Applications to a simple stellarator configuration, W7-X and LHD vacuum fields are presented.

  1. Reinforcing the role of the conventional C-arm--a novel method for simplified distal interlocking.

    Science.gov (United States)

    Windolf, Markus; Schroeder, Josh; Fliri, Ladina; Dicht, Benno; Liebergall, Meir; Richards, R Geoff

    2012-01-25

    shot to screw tightened) was on average 22% reduced by guided freehand (p = 0.018). In an experimental setting, the newly developed guided freehand technique for distal interlocking has proven to markedly reduce radiation exposure when compared to the conventional freehand technique. The method utilizes established clinical workflows and does not require cost intensive add-on devices or extensive training. The underlying principle carries potential to assist implant positioning in numerous other applications within orthopedics and trauma from screw insertions to placement of plates, nails or prostheses.

  2. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods.

    Science.gov (United States)

    Alavi, Shiva; Kachuie, Marzie

    2017-01-01

    This study was conducted to assess the hardness of orthodontic brackets produced by metal injection molding (MIM) and conventional methods and different orthodontic wires (stainless steel, nickel-titanium [Ni-Ti], and beta-titanium alloys) for better clinical results. A total of 15 specimens from each brand of orthodontic brackets and wires were examined. The brackets (Elite Opti-Mim which is produced by MIM process and Ultratrimm which is produced by conventional brazing method) and the wires (stainless steel, Ni-Ti, and beta-titanium) were embedded in epoxy resin, followed by grinding, polishing, and coating. Then, X-ray energy dispersive spectroscopy (EDS) microanalysis was applied to assess their elemental composition. The same specimen surfaces were repolished and used for Vickers microhardness assessment. Hardness was statistically analyzed with Kruskal-Wallis test, followed by Mann-Whitney test at the 0.05 level of significance. The X-ray EDS analysis revealed different ferrous or co-based alloys in each bracket. The maximum mean hardness values of the wires were achieved for stainless steel (SS) (529.85 Vickers hardness [VHN]) versus the minimum values for beta-titanium (334.65 VHN). Among the brackets, Elite Opti-Mim exhibited significantly higher VHN values (262.66 VHN) compared to Ultratrimm (206.59 VHN). VHN values of wire alloys were significantly higher than those of the brackets. MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  3. Maxillary incisors changes during space closure with conventional and skeletal anchorage methods: a systematic review.

    Science.gov (United States)

    Jayaratne, Yasas Shri Nalaka; Uribe, Flavio; Janakiraman, Nandakumar

    2017-01-01

    The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes) and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration) were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. More RCT's that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  4. Reinforcing the role of the conventional C-arm - a novel method for simplified distal interlocking

    Directory of Open Access Journals (Sweden)

    Windolf Markus

    2012-01-01

    Full Text Available Abstract Background The common practice for insertion of distal locking screws of intramedullary nails is a freehand technique under fluoroscopic control. The process is technically demanding, time-consuming and afflicted to considerable radiation exposure of the patient and the surgical personnel. A new concept is introduced utilizing information from within conventional radiographic images to help accurately guide the surgeon to place the interlocking bolt into the interlocking hole. The newly developed technique was compared to conventional freehand in an operating room (OR like setting on human cadaveric lower legs in terms of operating time and radiation exposure. Methods The proposed concept (guided freehand, generally based on the freehand gold standard, additionally guides the surgeon by means of visible landmarks projected into the C-arm image. A computer program plans the correct drilling trajectory by processing the lens-shaped hole projections of the interlocking holes from a single image. Holes can be drilled by visually aligning the drill to the planned trajectory. Besides a conventional C-arm, no additional tracking or navigation equipment is required. Ten fresh frozen human below-knee specimens were instrumented with an Expert Tibial Nail (Synthes GmbH, Switzerland. The implants were distally locked by performing the newly proposed technique as well as the conventional freehand technique on each specimen. An orthopedic resident surgeon inserted four distal screws per procedure. Operating time, number of images and radiation time were recorded and statistically compared between interlocking techniques using non-parametric tests. Results A 58% reduction in number of taken images per screw was found for the guided freehand technique (7.4 ± 3.4 (mean ± SD compared to the freehand technique (17.6 ± 10.3 (p p = 0.001. Operating time per screw (from first shot to screw tightened was on average 22% reduced by guided freehand (p = 0

  5. Computational efficiency for the surface renewal method

    Science.gov (United States)

    Kelley, Jason; Higgins, Chad

    2018-04-01

    Measuring surface fluxes using the surface renewal (SR) method requires programmatic algorithms for tabulation, algebraic calculation, and data quality control. A number of different methods have been published describing automated calibration of SR parameters. Because the SR method utilizes high-frequency (10 Hz+) measurements, some steps in the flux calculation are computationally expensive, especially when automating SR to perform many iterations of these calculations. Several new algorithms were written that perform the required calculations more efficiently and rapidly, and that tested for sensitivity to length of flux averaging period, ability to measure over a large range of lag timescales, and overall computational efficiency. These algorithms utilize signal processing techniques and algebraic simplifications that demonstrate simple modifications that dramatically improve computational efficiency. The results here complement efforts by other authors to standardize a robust and accurate computational SR method. Increased speed of computation time grants flexibility to implementing the SR method, opening new avenues for SR to be used in research, for applied monitoring, and in novel field deployments.

  6. A comparison of methods for demonstrating artificial bone lesions; conventional versus computer tomography

    International Nuclear Information System (INIS)

    Heller, M.; Wenk, M.; Jend, H.H.

    1984-01-01

    Conventional tomography (T) and computer tomography (CT) were used for examining 97 artificial bone lesions at various sites. The purpose of the study was to determine how far CT can replace T in the diagnosis of skeletal abnormalities. The results have shown that modern CT, particularly in its high resolution form, equals T and provides additional information (substrate of a lesion, its relationship to neighbouring tissues, simultaneous demonstration of soft tissue etc.). These cannot be shown successfully by T. It follows that CT is indicated as the primary method of examination for lesions of the facial skeleton, skull base, spine, pelvis and, to some extent, extremities. (orig.) [de

  7. Radiation exposure in X-ray angiography and comparisons between digital and conventional methods of imaging

    International Nuclear Information System (INIS)

    Schaberg, J.

    1987-01-01

    The more recent developments and techniques in the field of angiography are examined for associated radiation exposure risks for patients and investigators and then compared to the conventional methods of angiography. It could be shown that digital subtraction angiography is generally associated with a lesser risk of somatic exposure of the patient, provided that the equipment used offers an adjustable useful-beam range and focus. The fact that above-table X-ray tubes are now generally replaced with X-ray systems installed under the examination table permits the relatively high doses, to which investigators are exposed during angiography, to be reduced by a factor of 3. (DG) [de

  8. Review of conventional and novel food processing methods on food allergens.

    Science.gov (United States)

    Vanga, Sai Kranthi; Singh, Ashutosh; Raghavan, Vijaya

    2017-07-03

    With the turn of this century, novel food processing techniques have become commercially very important because of their profound advantages over the traditional methods. These novel processing methods tend to preserve the characteristic properties of food including their organoleptic and nutritional qualities better when compared with the conventional food processing methods. During the same period of time, there is a clear rise in the populations suffering from food allergies, especially infants and children. Though, this fact is widely attributed to the changing livelihood of population in both developed and developing nations and to the introduction of new food habits with advent of novel foods and new processing techniques, their complete role is still uncertain. Under the circumstance, it is very important to understand the structural changes in the protein as food is processed to comprehend whether the specific processing technique (conventional and novel) is increasing or mitigating the allergenicity. Various modern means are now being employed to understand the conformational changes in the protein which can affect the allergenicity. In this review, the processing effects on protein structure and allergenicity are discussed along with the insinuations of recent studies and techniques for establishing a platform to investigate future pathway to reduce or eliminate allergenicity in the population.

  9. Characterization and stability studies of a novel liposomal cyclosporin A prepared using the supercritical fluid method: comparison with the modified conventional Bangham method

    Directory of Open Access Journals (Sweden)

    Karn PR

    2013-01-01

    Full Text Available Pankaj Ranjan Karn,1,3 Wonkyung Cho,1,3 Hee-Jun Park,1,3 Jeong-Sook Park,3 Sung-Joo Hwang1,21Yonsei Institute of Pharmaceutical Sciences, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 2College of Pharmacy, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 3College of Pharmacy, Chungnam National University, Yuseong-gu, Daejeon, Republic of KoreaAbstract: A novel method to prepare cyclosporin A encapsulated liposomes was introduced using supercritical fluid of carbon dioxide (SCF-CO2 as an antisolvent. To investigate the strength of the newly developed SCF-CO2 method compared with the modified conventional Bangham method, particle size, zeta potential, and polydispersity index (PDI of both liposomal formulations were characterized and compared. In addition, entrapment efficiency (EE and drug loading (DL characteristics were analyzed by reversed-phase high-performance liquid chromatography. Significantly larger particle size and PDI were revealed from the conventional method, while EE (% and DL (% did not exhibit any significant differences. The SCF-CO2 liposomes were found to be relatively smaller, multilamellar, and spherical with a smoother surface as determined by transmission electron microscopy. SCF-CO2 liposomes showed no significant differences in their particle size and PDI after more than 3 months, whereas conventional liposomes exhibited significant changes in their particle size. The initial yield (%, EE (%, and DL (% of SCF-CO2 liposomes and conventional liposomes were 90.98 ± 2.94, 92.20 ± 1.36, 20.99 ± 0.84 and 90.72 ± 2.83, 90.24 ± 1.37, 20.47 ± 0.94, respectively, which changed after 14 weeks to 86.65 ± 0.30, 87.63 ± 0.72, 18.98 ± 0.22 and 75.04 ± 8.80, 84.59 ± 5.13, 15.94 ± 2.80, respectively. Therefore, the newly developed SCF-CO2 method could be a better alternative compared with the conventional method and may provide a promising approach for large-scale production of liposomes

  10. Analysis 'in vivo' of the employ of the Er:YAG laser and conventional method to remove carious tissue

    International Nuclear Information System (INIS)

    Ribeiro, Rafael Cardoso

    2002-01-01

    The aim of this study was to evaluate the removal of carious tissue employing the use of Er:YAG laser in comparison with the conventional burr rotary instrument. The wavelength of this laser is 2,64 μm and have a good absorption by the water and hydroxyapatite present in dental hard tissue. For this purpose were selected 24 molar teeth with occlusal carious, which were divided in random in two groups. For enamel, the laser energy used was in the interval from 250 mJ to 400 mJ, and the frequency range from 2 Hz to 4 Hz; for the dentine the energy laser range was from 150 mJ to 200 mJ and the laser frequency was in the range from 2 Hz to 6 Hz. For the evaluation of the results was used a questionaire to critical evaluation of the professional and another one to evaluation of the patient. The results have shown that the Er:YAG laser is able to remove carious enamel and dentin, without cause crunch or fracture and the irradiated surface was creasy. The patients reported greatest comfort when the cavity preparation was done with the Er:YAG laser than the conventional burr and all the patients treated reported prefer to future treatments the use of the Er:YAG laser. In conclusion, for the critical evaluation of the professional the treatment with the Er:YAG laser is a safe and effective method, and for the critical evaluation of the patient the treatment is one alternative more comfortable than the conventional method to remove caries. (author)

  11. Exposure to radiation through the residual activity of waste treated by conventional methods

    International Nuclear Information System (INIS)

    Deckert, A.; Hoppe, G.; John, T.; Thierfeldt, S.

    1993-01-01

    Data obtained by questionnaires provided information on the type, amount, nuclide vector and maximum permissible value of low-level radioactive residues that occur in nuclear installations of due to industrial, scientific and medical uses of radioactive materials and are officially released to be disposed of by conventional methods. The general legal background of waste disposal methods, in particular the official regulations surrounding the waste disposal law, were described. On this basis, parameters and maximum radioactive burdens were specifically defined for garbage dumps for refuse from private households and those for building rubbish. Investigations were carried out into exposure paths that may have a role in the radioactive doses taken up by personnel (inhalation) or the general population (ingestion) through contaminated water. The radiation dose attributable to those exposure paths were expressed in relation to a specific unit activity of waste (1 bq/G). A dose of 10 μ Sv/r was taken as a standard to define a threshold value for each individual nuclide released for conventional waste disposal. It appears reasonable that such values are determined for groups of nuclides. (HP) [de

  12. Extraction and comparison of proteins from natural rubber latex by conventional and ionizing radiation methods

    International Nuclear Information System (INIS)

    Rogero, Sizue O.; Spencer, Patrick J.; Campos, Vania E.; Lusvarghi, Fabio M.; Higa, Olga Z.

    1997-01-01

    Several proteins in natural rubber latex (NRL) have been assigned to be significant allergens. It is known that proteins submitted to ionizing radiation suffer denaturation and immunochemical modification resulting in low antigenic reactivity. The aim of this study was to extract and compare water extractable proteins from NRL films vulcanized by conventional and by ionizing radiation methods. SDS-polyacrylamide gel electrophoresis (SDS--PAGE) and high pressure liquid chromatography (HPLC) showed a diffuse protein band of about 14 KDa, which we believe is rubber elongation factor (REF), in both eluates, but smaller in latex film vulcanized by ionizing radiation. REF has been suggested to be a major latex allergen. These data suggest that ionizing radiation vulcanization could be an useful method for the production of NRL goods with low antigenicity. (author). 8 refs., 2 figs., 1 tab

  13. Intestinal preparation for colon enema with fosfo-soda fleet versus the conventional method

    International Nuclear Information System (INIS)

    Vecchioli Caldazza, A.; Celi, G.; De Franco, A.; Parrella, A.; Minordi, L.M.; Marano, P.

    1999-01-01

    The authors evaluate the possible optimization of a well-tolerated and versatile method of intestinal preparation able to adequately free the lumen and consequently improve diagnostic results with a lower risk of prolonged hospital stay for incorrectly prepared patients. They examined 40 patients, namely 20 men and 20 women referred to the Institute of radiology of the 'Sacro Cuore' Catholic University of Rome (Italy), Gastrointestinal tract unit, to undergo double contrast colonic enema. The statistical analysis of all data was performed with Wilcoxon test. Intestinal preparation with fosfo-soda fleet appeared to be definitely better than the conventional method relative to tolerance, while providing similarly satisfactory data relative to the other parameters [it

  14. Recent advances in conventional and contemporary methods for remediation of heavy metal-contaminated soils.

    Science.gov (United States)

    Sharma, Swati; Tiwari, Sakshi; Hasan, Abshar; Saxena, Varun; Pandey, Lalit M

    2018-04-01

    Remediation of heavy metal-contaminated soils has been drawing our attention toward it for quite some time now and a need for developing new methods toward reclamation has come up as the need of the hour. Conventional methods of heavy metal-contaminated soil remediation have been in use for decades and have shown great results, but they have their own setbacks. The chemical and physical techniques when used singularly generally generate by-products (toxic sludge or pollutants) and are not cost-effective, while the biological process is very slow and time-consuming. Hence to overcome them, an amalgamation of two or more techniques is being used. In view of the facts, new methods of biosorption, nanoremediation as well as microbial fuel cell techniques have been developed, which utilize the metabolic activities of microorganisms for bioremediation purpose. These are cost-effective and efficient methods of remediation, which are now becoming an integral part of all environmental and bioresource technology. In this contribution, we have highlighted various augmentations in physical, chemical, and biological methods for the remediation of heavy metal-contaminated soils, weighing up their pros and cons. Further, we have discussed the amalgamation of the above techniques such as physiochemical and physiobiological methods with recent literature for the removal of heavy metals from the contaminated soils. These combinations have showed synergetic effects with a many fold increase in removal efficiency of heavy metals along with economic feasibility.

  15. Surface analytical methods in nuclear technology

    International Nuclear Information System (INIS)

    Baumgaertner, F.

    1985-06-01

    Application of SEM-EDX, AES, XPS are exemplarily demonstrated for highly radioactive materials with ionizing dose rates of about 1 Sv near the surface. The samples studied are aerosols from the high level waste vitrification process, postprecipitation in a pretreated fuel solution and emulsifying sludge from a solvent extraction process. The results of the chemical composition differentiated down to microscopic level reveal much more information about the history of a sample than those available from the integral macro-methods analysing. Elucidication of chemical composition and body structure in micrometer level may give insight into the origin and generation processes of samples under investigation. (orig.)

  16. Surface water ponding on clayey soils managed by conventional and conservation tillage in boreal conditions

    Directory of Open Access Journals (Sweden)

    L. ALAKUKKU

    2008-12-01

    Full Text Available Surface water ponding and crop hampering due to soil wetness was monitored in order to evaluate the effects of conservation tillage practices and perennial grass cover on soil infiltrability for five years in situ in gently sloping clayey fields. Thirteen experimental areas, each having three experimental fields, were established in southern Finland. The fields belonged to: autumn mouldboard ploughing (AP, conservation tillage (CT and perennial grass in the crop rotation (PG. In the third year, direct drilled (DD fields were established in five areas. Excluding PG, mainly spring cereals were grown in the fields. Location and surface area of ponded water (in the spring and autumn as well as hampered crop growth (during June-July were determined in each field by using GPS devices and GIS programs. Surface water ponding or crop hampering occurred when the amount of rainfall was clearly greater than the long-term average. The mean of the relative area of the ponded surface water, indicating the risk of surface runoff, and hampered crop growth was larger in the CT fields than in the AP fields. The differences between means were, however, not statistically significant. Complementary soil physical measurements are required to investigate the reasons for the repeated surface water ponding.;

  17. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Je Hyun; Shim, Chang Ho [Dept. of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of); Kim, Sung Hyun [Nuclear Fuel Cycle Waste Treatment Research Division, Research Reactor Institute, Kyoto University, Osaka (Japan); Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo [Ionizing Radiation Center, Nuclear Fuel Cycle Waste Treatment Research Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho [Ionizing Radiation Center, Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2016-12-15

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers.

  18. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    International Nuclear Information System (INIS)

    Kim, Je Hyun; Shim, Chang Ho; Kim, Sung Hyun; Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo; Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho

    2016-01-01

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers

  19. SURFACE LAYER ACCRETION IN CONVENTIONAL AND TRANSITIONAL DISKS DRIVEN BY FAR-ULTRAVIOLET IONIZATION

    International Nuclear Information System (INIS)

    Perez-Becker, Daniel; Chiang, Eugene

    2011-01-01

    Whether protoplanetary disks accrete at observationally significant rates by the magnetorotational instability (MRI) depends on how well ionized they are. Disk surface layers ionized by stellar X-rays are susceptible to charge neutralization by small condensates, ranging from ∼0.01 μm sized grains to angstrom-sized polycyclic aromatic hydrocarbons (PAHs). Ion densities in X-ray-irradiated surfaces are so low that ambipolar diffusion weakens the MRI. Here we show that ionization by stellar far-ultraviolet (FUV) radiation enables full-blown MRI turbulence in disk surface layers. Far-UV ionization of atomic carbon and sulfur produces a plasma so dense that it is immune to ion recombination on grains and PAHs. The FUV-ionized layer, of thickness 0.01-0.1 g cm -2 , behaves in the ideal magnetohydrodynamic limit and can accrete at observationally significant rates at radii ∼> 1-10 AU. Surface layer accretion driven by FUV ionization can reproduce the trend of increasing accretion rate with increasing hole size seen in transitional disks. At radii ∼<1-10 AU, FUV-ionized surface layers cannot sustain the accretion rates generated at larger distance, and unless turbulent mixing of plasma can thicken the MRI-active layer, an additional means of transport is needed. In the case of transitional disks, it could be provided by planets.

  20. Measuring serotonin synthesis: from conventional methods to PET tracers and their (pre)clinical implications

    Energy Technology Data Exchange (ETDEWEB)

    Visser, Anniek K.D.; Waarde, Aren van; Willemsen, Antoon T.M. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); Bosker, Fokko J. [University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Luiten, Paul G.M. [University of Groningen, Center for Behavior and Neurosciences, Department of Molecular Neurobiology, Haren (Netherlands); Boer, Johan A. den [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Kema, Ido P. [University of Groningen, University Medical Center Groningen, Department of Laboratory Medicine, Groningen (Netherlands); Dierckx, Rudi A.J.O. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University Hospital Ghent, Department of Nuclear Medicine, Ghent (Belgium)

    2011-03-15

    The serotonergic system of the brain is complex, with an extensive innervation pattern covering all brain regions and endowed with at least 15 different receptors (each with their particular distribution patterns), specific reuptake mechanisms and synthetic processes. Many aspects of the functioning of the serotonergic system are still unclear, partially because of the difficulty of measuring physiological processes in the living brain. In this review we give an overview of the conventional methods of measuring serotonin synthesis and methods using positron emission tomography (PET) tracers, more specifically with respect to serotonergic function in affective disorders. Conventional methods are invasive and do not directly measure synthesis rates. Although they may give insight into turnover rates, a more direct measurement may be preferred. PET is a noninvasive technique which can trace metabolic processes, like serotonin synthesis. Tracers developed for this purpose are {alpha}-[{sup 11}C]methyltryptophan ([{sup 11}C]AMT) and 5-hydroxy-L-[{beta}-{sup 11}C]tryptophan ([{sup 11}C]5-HTP). Both tracers have advantages and disadvantages. [{sup 11}C]AMT can enter the kynurenine pathway under inflammatory conditions (and thus provide a false signal), but this tracer has been used in many studies leading to novel insights regarding antidepressant action. [{sup 11}C]5-HTP is difficult to produce, but trapping of this compound may better represent serotonin synthesis. AMT and 5-HTP kinetics are differently affected by tryptophan depletion and changes of mood. This may indicate that both tracers are associated with different enzymatic processes. In conclusion, PET with radiolabelled substrates for the serotonergic pathway is the only direct way to detect changes of serotonin synthesis in the living brain. (orig.)

  1. Effects of blending of desalinated and conventionally treated surface water on iron corrosion and its release from corroding surfaces and pre-existing scales.

    Science.gov (United States)

    Liu, Haizhou; Schonberger, Kenneth D; Peng, Ching-Yu; Ferguson, John F; Desormeaux, Erik; Meyerhofer, Paul; Luckenbach, Heidi; Korshin, Gregory V

    2013-07-01

    This study examined effects of blending desalinated water with conventionally treated surface water on iron corrosion and release from corroding metal surfaces and pre-existing scales exposed to waters having varying fractions of desalinated water, alkalinities, pH values and orthophosphate levels. The presence of desalinated water resulted in markedly decreased 0.45 μm-filtered soluble iron concentrations. However, higher fractions of desalinated water in the blends were also associated with more fragile corroding surfaces, lower retention of iron oxidation products and release of larger iron particles in the bulk water. SEM, XRD and XANES data showed that in surface water, a dense layer of amorphous ferrihydrite phase predominated in the corrosion products. More crystalline surface phases developed in the presence of desalinated water. These solid phases transformed from goethite to lepidocrocite with increased fraction of desalinated water. These effects are likely to result from a combination of chemical parameters, notably variations of the concentrations of natural organic matter, calcium, chloride and sulfate when desalinated and conventionally treated waters are blended. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Effect of autoclaving on the surfaces of TiN -coated and conventional nickel-titanium rotary instruments.

    Science.gov (United States)

    Spagnuolo, G; Ametrano, G; D'Antò, V; Rengo, C; Simeone, M; Riccitiello, F; Amato, M

    2012-12-01

    To evaluate the effects of repeated autoclave sterilization cycles on surface topography of conventional nickel-titanium ( NiTi ) and titanium nitride ( TiN )-coated rotary instruments. A total of 60 NiTi rotary instruments, 30 ProTaper (Dentsply Maillefer) and 30 TiN -coated AlphaKite (Komet/Gebr. Brasseler), were analysed. Instruments were evaluated in the as-received condition and after 1, 5 and 10 sterilization cycles. After sterilization, the samples were observed using scanning electron microscope (SEM), and surface chemical analysis was performed on each instrument with energy dispersive X-ray spectroscopy (EDS). Moreover, the samples were analysed by atomic force microscopy (AFM), and roughness average (Ra) and the root mean square value (RMS) of the scanned surface profiles were recorded. Data were analysed by means of anova followed by Tukey's test. Scanning electron microscope observations revealed the presence of pitting and deep milling marks in all instruments. EDS analysis confirmed that both types of instruments were composed mainly of nickel and titanium, whilst AlphaKite had additional nitride. After multiple autoclave sterilization cycles, SEM examinations revealed an increase in surface alterations, and EDS values indicated changes in chemical surface composition in all instruments. Ra and RMS values of ProTaper significantly increased after 5 (P = 0.006) and 10 cycles (P = 0.002) with respect to the as-received instruments, whilst AlphaKite showed significant differences compared with the controls after 10 cycles (P = 0.03). Multiple autoclave sterilization cycles modified the surface topography and chemical composition of conventional and TiN -coated NiTi rotary instruments. © 2012 International Endodontic Journal.

  3. Synthesis of novel chalcone derivatives by conventional and microwave irradiation methods and their pharmacological activities

    Directory of Open Access Journals (Sweden)

    Mohammed Rayees Ahmad

    2016-09-01

    Full Text Available Chalcones are abundant in edible plants and are considered to be the precursors of flavonoids and isoflavonoids. Chalcones belong to an important class of flavonoids, which may be prepared by Claisen–Schmidt condensation. They possess a wide range of biological activities and industrial applications. The cytotoxicity against tumour cell lines may be the result of disruption of the cell cycle, inhibition of angiogenesis, interference with p53-MDM2 interaction, mitochondrial uncoupling or induction of apoptosis. Chalcones are synthesized by conventional and microwave assisted synthesis methods. By microwave assisted synthesis, a considerable increase in the reaction rate has been observed and that too, with better yields. The compounds have been screened for cytotoxic activity and antioxidant activity.

  4. SURFACE LAYER ACCRETION IN TRANSITIONAL AND CONVENTIONAL DISKS: FROM POLYCYCLIC AROMATIC HYDROCARBONS TO PLANETS

    International Nuclear Information System (INIS)

    Perez-Becker, Daniel; Chiang, Eugene

    2011-01-01

    'Transitional' T Tauri disks have optically thin holes with radii ∼>10 AU, yet accrete up to the median T Tauri rate. Multiple planets inside the hole can torque the gas to high radial speeds over large distances, reducing the local surface density while maintaining accretion. Thus multi-planet systems, together with reductions in disk opacity due to grain growth, can explain how holes can be simultaneously transparent and accreting. There remains the problem of how outer disk gas diffuses into the hole. Here it has been proposed that the magnetorotational instability (MRI) erodes disk surface layers ionized by stellar X-rays. In contrast to previous work, we find that the extent to which surface layers are MRI-active is limited not by ohmic dissipation but by ambipolar diffusion, the latter measured by Am: the number of times a neutral hydrogen molecule collides with ions in a dynamical time. Simulations by Hawley and Stone showed that Am ∼ 100 is necessary for ions to drive MRI turbulence in neutral gas. We calculate that in X-ray-irradiated surface layers, Am typically varies from ∼10 -3 to 1, depending on the abundance of charge-adsorbing polycyclic aromatic hydrocarbons, whose properties we infer from Spitzer observations. We conclude that ionization of H 2 by X-rays and cosmic rays can sustain, at most, only weak MRI turbulence in surface layers 1-10 g cm -2 thick, and that accretion rates in such layers are too small compared to observed accretion rates for the majority of disks.

  5. Evaluation of osteoporosis using conventional radiographic methods and dual energy x-ray absorptiometry

    International Nuclear Information System (INIS)

    Anburajan, M.

    2001-01-01

    In India, conventional radiographs play a major part in evaluating osteoporosis since advanced bone densitometers are expensive and not widely available. Our aim in this study was to investigate the usefulness of conventional radiographic methods, viz., clavicle and metacarpal radiogrammetry, quantitative vertebral morphometry, Singh's index, hip geometry compared to a sophisticated method, viz., DXA for studying osteoporosis in south Indian men (n=663) and women (n=741). This study provides data on BMD of the proximal femur in normal south Indian females. In women, aged above 65 years, BMD of femoral neck, trochanter, and Ward's triangle decreased by 0.90%, 0.84%, and 1.66% per annum, respectively. In 45 pre- and post-menopausal women without fractures, total hip BMD correlated significantly ( p 2 =0.47), medial cortical thickness of the femoral shaft (r 2 =0.38) and neck (r 2 =0.29), combined cortical thickness (CCT) and %CCT of the clavicle (r 2 =0.54 each), and the second metacarpal (r 2 =0.51 and r 2 =0.53, respectively). On comparing variables studied for osteoporotic women with corresponding values in the premenopausal group, the average difference in SD from the mean was greatest for clavicle radiogrammetry (-3.7 SD for %CCT of the clavicle). An empirical formula for predicting total hip BMD with good sensitivity was derived from a multiple linear regression equation involving three independent variables, viz., CCT, %CCT of the clavicle (measured from the chest radiograph) and the patient's age. This author's equation, with modified weightings, has 82% sensitivity and 94% specificity and a positive and negative predictive value of 88% and 91% respectively. A chest radiograph in combination with the formula would serve as a readily available, inexpensive tool for assessing post-menopausal osteoporosis, especially in developing countries

  6. System Response Analysis and Model Order Reduction, Using Conventional Method, Bond Graph Technique and Genetic Programming

    Directory of Open Access Journals (Sweden)

    Lubna Moin

    2009-04-01

    Full Text Available This research paper basically explores and compares the different modeling and analysis techniques and than it also explores the model order reduction approach and significance. The traditional modeling and simulation techniques for dynamic systems are generally adequate for single-domain systems only, but the Bond Graph technique provides new strategies for reliable solutions of multi-domain system. They are also used for analyzing linear and non linear dynamic production system, artificial intelligence, image processing, robotics and industrial automation. This paper describes a unique technique of generating the Genetic design from the tree structured transfer function obtained from Bond Graph. This research work combines bond graphs for model representation with Genetic programming for exploring different ideas on design space tree structured transfer function result from replacing typical bond graph element with their impedance equivalent specifying impedance lows for Bond Graph multiport. This tree structured form thus obtained from Bond Graph is applied for generating the Genetic Tree. Application studies will identify key issues and importance for advancing this approach towards becoming on effective and efficient design tool for synthesizing design for Electrical system. In the first phase, the system is modeled using Bond Graph technique. Its system response and transfer function with conventional and Bond Graph method is analyzed and then a approach towards model order reduction is observed. The suggested algorithm and other known modern model order reduction techniques are applied to a 11th order high pass filter [1], with different approach. The model order reduction technique developed in this paper has least reduction errors and secondly the final model retains structural information. The system response and the stability analysis of the system transfer function taken by conventional and by Bond Graph method is compared and

  7. The use of design of experiments for the evaluation of the production of surface rich activated carbon from sewage sludge via microwave and conventional pyrolysis

    International Nuclear Information System (INIS)

    Simões dos Reis, Glaydson; Wilhelm, Michaela; Silva, Thamires Canuto de Almeida; Rezwan, Kurosch; Sampaio, Carlos Hoffmann; Lima, Eder Claudio; Guelli Ulson de Souza, Selene M.A.

    2016-01-01

    Highlights: • Using of DOE for preparation of AC by conventional and microwave pyrolysis. • The significant parameters in producing activated carbon were investigated. • Conventional pyrolysis AC had better textural development than microwave AC. • Temperature and holding time had significant influence on the S_B_E_T. • Reduction of production cost of activated carbon. - Abstract: Experimental design and response surface methodology were used for the preparation and comparison of activated carbon produced from sewage sludge by two types of pyrolysis: conventional furnace and microwave. The preparation method was performed following a full fractional factorial design (2"3), including pyrolysis temperature or power radiation, holding time and chemical activation agent, and specific surface area (S_B_E_T) of prepared activated carbon. The influence of these factors on the S_B_E_T of obtained carbon was investigated using an analysis of variance. Samples made by conventional pyrolysis showed overall higher S_B_E_T values than samples synthesised by the microwave method. The optimum parameters for the preparation of activated carbon using the conventional pyrolysis have been identified as: pyrolysis temperature of 500 °C, holding time of 15 min, and a ratio of ZnCl_2:sludge of 0.5. Microwave pyrolysis is found to be optimal when operating at 980 W for 12 min. Under these conditions, S_B_E_T values of 679 and 501 m"2g"−"1, respectively, have been obtained. The analysis of nitrogen adsorption/desorption isotherms revealed the presence of micro and mesopores in the activated carbon. The most important significant factor, according statistical analysis, in the variance in S_B_E_T for the conventional pyrolysis samples were the pyrolysis temperature and interaction between pyrolysis temperature, holding time and ratio of ZnCl_2:sludge were the most important factors. The highest impact parameters for the microwave method were found for the interaction

  8. Sample mounting and transfer for coupling an ultrahigh vacuum variable temperature beetle scanning tunneling microscope with conventional surface probes

    International Nuclear Information System (INIS)

    Nafisi, Kourosh; Ranau, Werner; Hemminger, John C.

    2001-01-01

    We present a new ultrahigh vacuum (UHV) chamber for surface analysis and microscopy at controlled, variable temperatures. The new instrument allows surface analysis with Auger electron spectroscopy, low energy electron diffraction, quadrupole mass spectrometer, argon ion sputtering gun, and a variable temperature scanning tunneling microscope (VT-STM). In this system, we introduce a novel procedure for transferring a sample off a conventional UHV manipulator and onto a scanning tunneling microscope in the conventional ''beetle'' geometry, without disconnecting the heating or thermocouple wires. The microscope, a modified version of the Besocke beetle microscope, is mounted on a 2.75 in. outer diameter UHV flange and is directly attached to the base of the chamber. The sample is attached to a tripod sample holder that is held by the main manipulator. Under UHV conditions the tripod sample holder can be removed from the main manipulator and placed onto the STM. The VT-STM has the capability of acquiring images between the temperature range of 180--500 K. The performance of the chamber is demonstrated here by producing an ordered array of island vacancy defects on a Pt(111) surface and obtaining STM images of these defects

  9. The surface analysis methods; Les methodes d`analyse des surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Deville, J.P. [Institut de Physique et Chimie, 67 - Strasbourg (France)

    1998-11-01

    Nowadays, there are a lot of surfaces analysis methods, each having its specificity, its qualities, its constraints (for instance vacuum) and its limits. Expensive in time and in investment, these methods have to be used deliberately. This article appeals to non specialists. It gives some elements of choice according to the studied information, the sensitivity, the use constraints or the answer to a precise question. After having recalled the fundamental principles which govern these analysis methods, based on the interaction between radiations (ultraviolet, X) or particles (ions, electrons) with matter, two methods will be more particularly described: the Auger electron spectroscopy (AES) and x-rays photoemission spectroscopy (ESCA or XPS). Indeed, they are the most widespread methods in laboratories, the easier for use and probably the most productive for the analysis of surface of industrial materials or samples submitted to treatments in aggressive media. (O.M.) 11 refs.

  10. Calculation method of rate and area of sedimentation, by non-conventional mathematical process of data treatment

    International Nuclear Information System (INIS)

    Cota, P.L.

    1987-01-01

    The used methods for calculating the rate and area of sedimentation are based in techniques of graphical resolution. The solution of the problem by a mathematical resolution, using computational methods, is more fast and more accuracy. The comparison between the results from this methods and the conventional method is shown. (E.G.) [pt

  11. Conventional and whitening toothpastes: cytotoxicity, genotoxicity and effect on the enamel surface.

    Science.gov (United States)

    Camargo, Samira Esteves Afonso; Jóias, Renata Pilli; Santana-Melo, Gabriela Fátima; Ferreira, Lara Tolentino; El Achkar, Vivian Narana Ribeiro; Rode, Sigmar de Mello

    2014-12-01

    To evaluate the cytotoxicity and genotoxicity of whitening and common toothpastes, and the surface roughness of tooth enamel submitted to brushing with both toothpastes. Samples of whitening toothpastes [Colgate Whitening (CW) and Oral-B Whitening (OBW)] and regular (non-whitening) toothpastes (Colgate and Oral-B) were extracted in culture medium. Gingival human fibroblasts (FMM-1) were placed in contact with different dilutions of culture media that had been previously exposed to such materials, and the cytotoxicity was evaluated using the MTT assay. The genotoxicity was assessed by the micronucleus formation assay in Chinese hamster fibroblasts (V79). The cell survival rate and micronuclei number were assessed before and after exposure to the toothpaste extracts. For the surface roughness evaluation, 20 bovine tooth specimens, divided into four groups according to toothpastes, were submitted to 10,000 brushing cycles. The results were analyzed using the Mann-Whitney U and two-way ANOVA tests (P whitening toothpastes showed the highest numbers of micronuclei compared to the untreated control (UC) (P enamel surface (P whitening toothpastes and Oral-B were cytotoxic to the cells. The whitening toothpastes were more genotoxic to cells in vitro than the common toothpastes, and genotoxicity was more pronounced in the OBW toothpaste.

  12. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    Directory of Open Access Journals (Sweden)

    A Pourkhalili

    2012-05-01

    Full Text Available Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying and roasting methods according to the cooking routine and tradition in Iranian society, in terms of temperature and time. Proximate compositions (moisture, lipid, ash and protein in the raw and cooked meat were determined using the standard methods of analysis. Moreover, weight loss was measured after each treatment. Lipid oxidation parameters such as peroxide value, conjugated diene and TBARS indices were measured in the raw and cooked samples. Evaluation of lipid oxidation parameters showed that peroxide value was significantly decreased in all cooked samples. In contrast, conjugated diene value was significantly increased in the fried and grilled samples (p

  13. Conventional and molecular methods used in the detection and subtyping of Yersinia enterocolitica in food.

    Science.gov (United States)

    Petsios, Stefanos; Fredriksson-Ahomaa, Maria; Sakkas, Hercules; Papadopoulou, Chrissanthy

    2016-11-21

    Yersinia enterocolitica is an important foodborne pathogen, but the prevalence in food is underestimated due to drawbacks in the detection methods. Problems arise from the low concentration of pathogenic strains present in food samples, similarities with other Enterobacteriaceae and Y. enterocolitica-like species and the heterogeneity of Y. enterocolitica as it comprises both pathogenic and non-pathogenic isolates. New rapid, cost-effective and more sensitive culture media and molecular techniques have been developed to overcome the drawbacks of conventional culture methods. Recent molecular subtyping methods have been applied to Y. enterocolitica strains to track infection sources and to investigate phylogenetic relationships between different Yersinia strains. Further application of modern subtyping tools such as WGS in a variety of bioserotypes, and comparison with other members of the genus will help to better understanding of the virulence determinants of pathogenic Y. enterocolitica, its mechanisms to cope in the host environments, and can contribute to the development of more specific detection and typing strategies.

  14. Comparison of digital radiography and apex locator with the conventional method in root length determination of primary teeth

    Directory of Open Access Journals (Sweden)

    I E Neena

    2011-01-01

    Full Text Available Aim: The purpose of this study was to compare the Working length in primary teeth endodontics using intra oral digital radiovisiography and apex locator with conventional method for accuracy. Materials and Methods: This in vivo study was conducted on 30 primary teeth which were indicated for pulpectomy in the patients of the age group of 5-11 years All experimental teeth had adequate remaining tooth structure for rubber dam isolation and radiographicaly visible canals. Endodontic treatment was required due to irreversible pulpitis or pulp necrosis. A standardized intraoral periapical radiograph of the tooth was taken using conventional method by paralleling technique. The distance between the source and the tooth, tooth and the films were standardized using X-ray positioning device. During the pulpectomy procedure, the working length was determined by digital radiograph and apex locator. The measurements were then compared with the conventional method of root canal measurement technique for accuracy Result: From the results obtained we can conclude that Working length determined in primary molars using digital radiography and Apex locator did not show any significant difference in the mean working length measurements when compared with the conventional radiographic method. Conclusions: Apex locator is comparable to conventional radiograph in determining the working length without radiation in the primary teeth. Intraoral digital radiography is the safest method in determining the working length with significant reduction in radiation exposure.Hence, both the techniques can be safely used as alternatives to conventional radiographic methods in determining working length in primary teeth.

  15. Results of the study of entrance surface dose from conventional examinations in diagnostic radiology

    International Nuclear Information System (INIS)

    Martinez, A.; Jova, L.; Carrazana, J.; Diaz, E.; Mora, R. de la; Guevara, C.; Fleitas, I.

    2001-01-01

    The wide diffusion of X-ray diagnostic together with the quick development and expansion that has come with experiencing the technology in this practice, has motivated the emission of recommendations in the Basic Safety Standards of the IAEA for the establishment of guidance levels for different radiological examinations in each country that allow the optimization of the medical exposure. Considering the above-mentioned and the existence in Cuba in a great number of conventional X-ray equipment, with an average of over 10 years of use which influences directly on the patient dose, in 1999, an investigation began in the country on the patient exposure in this practice. This work shows the first results of measurements carried out in 9 major hospitals of several provinces of the country. The doses were evaluated in the examinations of lumbar spine AP, lumbar spine LAT, thorax PA, skull AP and skull LAT. The determination of the doses in these examinations was carried out by 'in-vivo' measurements on the patients, placing in the center of the irradiation field TLD of LiF. The distributions obtained in the studies are compared with the guidance levels that is shown in the Basic Safety Standards of the IAEA. (author)

  16. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A. [Science Applications International Corp., McLean, VA (United States)

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods` power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V&V (determined by ratings of a system`s complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole.

  17. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    International Nuclear Information System (INIS)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A.

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole

  18. Slope failures in surface mines, methods of studying landslides

    Energy Technology Data Exchange (ETDEWEB)

    Flisiak, J; Korman, S; Mazurek, J

    1977-01-01

    This paper presents a review of methods of measuring landslide fissures, displacement of ground surface points in the landslide area and of points inside the landslide. An analysis of the landslide process is given, stressing various stages and phases of a landslide. Studies carried out by the Institute of Mining Geomechanics of the Technical University of Mining and Metallurgy in Cracow are evaluated. The studies concentrated on the final state of slopes in brown coal surface mines after a landslide occurs. The necessity of developing an apparatus for continuous recording of displacements of points on a landslide surface is stressed. An apparatus developed by the Institute and used for continuous measuring and recording of displacements is described. The apparatus is used to measure displacements of points during the initial phase of a landslide and during the phase of the largest displacements. The principle of the system consists in locating a number of observation points on the ground and a slope. The points are connected among themselves by flexible connectors. The connectors are equipped with potentiometric transmitters which transform the relative displacements into electric pulses. These pulses are recorded by a conventional recording apparatus. (55 refs.) (In Polish)

  19. "Effect of nano-filled surface coating agent on fluoride release from conventional glass ionomer cement: an in vitro trial".

    Science.gov (United States)

    Tiwari, S; Nandlal, B

    2013-01-01

    To overcome the drawbacks of glass ionomer cement of sensitivity to initial desiccation and moisture contamination the use of surface coating agent is recommended. The search in this area led to invent of use of nanofillers in surface coating agent, but its effect on fluoride release is not clear. The aim of this study is to evaluate and compare the fluoride release from conventional glass ionomer cement with and without surface coating agent. This in vitro study comprised of total 80 samples (40 samples of each with and without surface coating). Specimens were prepared, G coat plus was applied and light cured. Fluoride release of the sample was measured every 24 h for 7 days and weekly from 7th to 21 st day using Sension4 pH/ISE/MV Meter. Descriptive Statistics, Repeated Measure ANOVA, Paired Sample t-test, Independent Sample t-test, Scheffe post hoc test. Mean values clearly reveal a significant decrease in the fluoride release from day 1 to day 21 for both groups. Non-coated group released significantly more fluoride than surface coated group (Pagent will reduce the amount of fluoride released into oral environment as compared to non-coated group and at the same time releasing fluoride into surrounding cavity walls to create zones of inhibition into the cavity floor to help internal remineralization.

  20. Comparison of porcelain bond strength of different metal frameworks prepared by using conventional and recently introduced fabrication methods.

    Science.gov (United States)

    Kaleli, Necati; Saraç, Duygu

    2017-07-01

    Most studies evaluating dental laser sintering systems have focused on the marginal accuracy of the restorations. However, the bond strength at the metal-ceramic interface is another important factor that affects the survival of restorations, and currently, few studies focus on this aspect. The purpose of this in vitro study was to compare the porcelain bond strength of cobalt-chromium (Co-Cr) metal frameworks prepared by using the conventional lost-wax technique, milling, direct metal laser sintering (DMLS), and laser cusing, a direct process powder-bed system. A total of 96 metal frameworks (n=24 in each group) were prepared by using conventional lost-wax (group C), milling (group M), DMLS (group LS), and direct process powder-bed (group LC) methods according to International Organization for Standardization standard ISO 9693-1. After porcelain application, a 3-point bend test was applied to each specimen by using a universal testing machine. Data were statistically analyzed using 1-way ANOVA and Tukey honest significant difference tests (α=.05). Failure types at the metal-ceramic interfaces were examined using stereomicroscopy. Additionally, 1 specimen from each group was prepared for scanning electron microscopy analysis to evaluate the surface topography of metal frameworks. The mean bond strength was 38.08 ±3.82 MPa for group C, 39.29 ±3.51 MPa for group M, 40.73 ±3.58 MPa for group LS, and 41.24 ±3.75 MPa for group LC. Statistically significant differences were observed among the 4 groups (P=.016). All groups, except for LS, exhibited adhesive and mixed type bond failure. Both of the laser sintering methods were found to be successful in terms of metal-ceramic bond strength. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  1. Osseointegration of implants with dendrimers surface characteristics installed conventionally or with Piezosurgery®. A comparative study in the dog.

    Science.gov (United States)

    Bengazi, Franco; Lang, Niklaus P; Canciani, Elena; Viganò, Paolo; Velez, Joaquin Urbizo; Botticelli, Daniele

    2014-01-01

    The first aim of the present experiment was to compare bone healing at implants installed in recipient sites prepared with conventional drills or a piezoelectric device. The second aim was to compare implant osseointegration onto surfaces with and without dendrimers coatings. Six Beagles dogs were used in this study. Five implants with two different surfaces, three with a ZirTi(®) surface (zirconia sand blasted, acid etched), and two with a ZirTi(®)-modified surface with dendrimers of phosphoserine and polylysine were installed in the right side of the mandible. In the most anterior region (P2, P3), two recipient sites were prepared with drills, and one implant ZirTi(®) surface and one coated with dendrimers implants were installed at random. In the posterior region (P4 and M1), three recipient sites were randomly prepared: two sites with a Piezosurgery(®) instrument and one site with drill and two ZirTi(®) surface and one coated with dendrimers implants installed. Three months after the surgery, the animals were sacrificed for histological analysis. No complications occurred during the healing period. Three implants were found not integrated and were excluded from analysis. However, n = 6 was obtained. The distance IS-B at the buccal aspect was 2.2 ± 0.8 and 1.8 ± 0.5 mm, while IS-C was 1.5 ± 0.9 and 1.4 ± 0.6 mm at the Piezosurgery(®) and drill groups, respectively. Similar values were obtained between the dendrimers-coated and ZirTi(®) surface implants. The BIC% values were higher at the drill (72%) compared to the Piezosurgery(®) (67%) sites. The BIC% were also found to be higher at the ZirTi(®) (74%) compared to the dendrimers-coated (65%) implants, the difference being statistically significant. This study has revealed that oral implants may osseointegrate equally well irrespective of whether their bed was prepared utilizing conventional drills with abundant cooling or Piezosurgery(®). Moreover, the surface coating of implants with dendrimers

  2. Structural characterization of humic-like substances with conventional and surface-enhanced spectroscopic techniques

    Science.gov (United States)

    Carletti, Paolo; Roldán, Maria Lorena; Francioso, Ornella; Nardi, Serenella; Sanchez-Cortes, Santiago

    2010-10-01

    Emission-excitation, synchronous fluorescence spectroscopy and surface-enhanced Raman scattering (SERS) combined with surface-enhanced fluorescence (SEF) were applied to aqueous solutions of a humic-like substance (HLS) extracted from earthworm faeces. All measurements were acquired in a wide range of pH (4-12) and analysed by the linear regression analysis. Diffuse Reflectance Infrared Fourier Transform (DRIFT) spectra were also acquired to assist in the structural characterization of this HLS. The emission and excitation spectra allowed the identification of two main fluorophores in the analysed sample. Moreover, a close correlation between fluorescence intensities of each fluorophore with pH variation was observed. SERS and SEF, in agreement with the fluorescence spectroscopy, showed that the HLS at low pH values exists in an aggregated and coiled molecular structure while it is dispersed and uncoiled at alkaline conditions. The obtained spectra also evidenced that different conditions modify the functional groups exposed to the surrounding aqueous environment.

  3. Screening for depression in epilepsy clinics. A comparison of conventional and visual-analog methods.

    Science.gov (United States)

    Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj

    2012-10-01

    Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS

  4. Artificial neural networks versus conventional methods for boiling water reactor stability monitoring

    International Nuclear Information System (INIS)

    Hagen, T.H.J.J. van der

    1995-01-01

    The application of an artificial neural network (ANN) for boiling water reactor (BWR) stability monitoring was studied. A three-layer perceptron was trained on synthetic autocorrelation functions to estimate the decay ratio and the resonance frequency from measured neutron noise. Training of the ANN was improved by adding noise to the training patterns and by applying nonconventional error definitions in the generalized delta rule. The performance of the developed ANN was compared with those of conventional stability monitoring techniques. Explicit care was taken for generating unbiased test data. It is found that the trained ANN is capable of monitoring the stability of the Dodewaard BWR for four specific cases. By comparing properties such as the false alarm ratio, the alarm failure ratio, and the average time to alarm, it is shown that it performs worse than model-based methods in stability monitoring of exact second-order systems but that it is more robust (better resistant to corruptions of the input data and to deviations of the system at issue from an exact second-order system) than other methods. The latter explains its good performance on the Dodewaard BWR and is promising for the application of an ANN for stability monitoring of other reactors and for other operating conditions

  5. Treatment of waste water by a combined technique of radiation and conventional method

    International Nuclear Information System (INIS)

    Sakumoto, A.; Miyata, T.

    1984-01-01

    Treatment of waste water by radiation in combination with a conventional method such as biological oxidation, coagulation with Fe 2 (SO 4 ) 3 , and ozonation has been studied for reducing necessary dose. Ethylene glycol ethers, polyoxyethylene n-nonyl phenyl ether (NPE), polyvinyl alcohol (PVA), ethylene glycol, phenol, and oxalic acid were used as a model pollutant. The combined use of radiation and biological oxidation markedly improved the removal of TOC in aqueous oxygenated solution of ethylene glycol ethers. The combined use of radiation and coagulation had remarkable effects on the reduction of TOC in aqueous deoxygenated solution of NPE or PVA. The simultaneous use of radiation and ozone gave a synergistic effect on oxidative degradation of organic pollutants. The synergistic effect was suggested to arise from chain reactions having a powerful oxidizing agent (OH radical). The rate of TOC removal by the process depended on dose rate. Aqueous solution of 150 mg/l oxalic acid was treated by the combined use of electron beams and ozone using a new type of irradiation vessel to reduce TOC with G(-TOC) of 87 at 2.3 x 10 7 rad/h. The simultaneous use of radiation and ozone is superior to the removal of TOC by other combined methods and can be applied irrespective of the type of organic matter. (author)

  6. Method for surface treatment by electron beams

    International Nuclear Information System (INIS)

    Panzer, S.; Doehler, H.; Bartel, R.; Ardenne, T. von.

    1985-01-01

    The invention has been aimed at simplifying the technology and saving energy in modifying surfaces with the aid of electron beams. The described beam-object geometry allows to abandon additional heat treatments. It can be used for surface hardening

  7. A rigorous assessment of tree height measurements obtained using airborne LIDAR and conventional field methods.

    Science.gov (United States)

    Hans-Erik Andersen; Stephen E. Reutebuch; Robert J. McGaughey

    2006-01-01

    Tree height is an important variable in forest inventory programs but is typically time-consuming and costly to measure in the field using conventional techniques. Airborne light detection and ranging (LIDAR) provides individual tree height measurements that are highly correlated with field-derived measurements, but the imprecision of conventional field techniques does...

  8. Correlation and agreement of a digital and conventional method to measure arch parameters.

    Science.gov (United States)

    Nawi, Nes; Mohamed, Alizae Marny; Marizan Nor, Murshida; Ashar, Nor Atika

    2018-01-01

    The aim of the present study was to determine the overall reliability and validity of arch parameters measured digitally compared to conventional measurement. A sample of 111 plaster study models of Down syndrome (DS) patients were digitized using a blue light three-dimensional (3D) scanner. Digital and manual measurements of defined parameters were performed using Geomagic analysis software (Geomagic Studio 2014 software, 3D Systems, Rock Hill, SC, USA) on digital models and with a digital calliper (Tuten, Germany) on plaster study models. Both measurements were repeated twice to validate the intraexaminer reliability based on intraclass correlation coefficients (ICCs) using the independent t test and Pearson's correlation, respectively. The Bland-Altman method of analysis was used to evaluate the agreement of the measurement between the digital and plaster models. No statistically significant differences (p > 0.05) were found between the manual and digital methods when measuring the arch width, arch length, and space analysis. In addition, all parameters showed a significant correlation coefficient (r ≥ 0.972; p digital and manual measurements. Furthermore, a positive agreement between digital and manual measurements of the arch width (90-96%), arch length and space analysis (95-99%) were also distinguished using the Bland-Altman method. These results demonstrate that 3D blue light scanning and measurement software are able to precisely produce 3D digital model and measure arch width, arch length, and space analysis. The 3D digital model is valid to be used in various clinical applications.

  9. Conventional Treatment of Surface Water Using Moringa Oleifera Seeds Extract as a Primary Coagulant

    Directory of Open Access Journals (Sweden)

    Suleyman A. Muyibi, Ahmed Hissein M Birima, Thamer A. Mohammed

    2012-10-01

    Full Text Available The present study involved the use of a model pilot scale water treatment plant to treat turbid surface water from a stream using processed Moringa oleifera seed with 25 % w/w oil extracted as primary coagulant. The water treatment plant was made up of four unit operations: coagulation, flocculation, sedimentation, and filtration (rapid sand filter. Test runs were carried out for three hours per run over a three-month period with turbidities ranging from 18 to 261 NTU. The turbidity, pH, and alkalinity as well as the filter head loss were measured every 30 minutes during the experimental runs. Average turbidity removal of up to 96 % at an effective doses of 20 and 30 mg/l of oil extracted M. oleifera for low (< 50 NTU and moderate turbidity (< 100 NTU water respectively was observed doses 50 – 80 mg/l for high turbidity (> 100 NTU water. M. oleifera seed extract was found to have no significant effect on pH or alkalinity of the water. The residual turbidities measured during most of the test runs satisfied the Malaysian Guideline for Drinking Water Supplies. Key Words: Moringa oleifera, primary coagulant, coagulation, pilot plant, filtration.

  10. Ultrasound-assisted extraction of natural antioxidants from the flower of Limonium sinuatum: Optimization and comparison with conventional methods.

    Science.gov (United States)

    Xu, Dong-Ping; Zheng, Jie; Zhou, Yue; Li, Ya; Li, Sha; Li, Hua-Bin

    2017-02-15

    Natural antioxidants are widely used as dietary supplements or food additives. An optimized method of ultrasound-assisted extraction (UAE) was proposed for the effective extraction of antioxidants from the flowers of Limonium sinuatum and evaluated by response surface methodology. In this study, ethanol concentration, ratio of solvent to solid, ultrasonication time and temperature were investigated and optimized using a central composite rotatable design. The optimum extraction conditions were as follows: ethanol concentration, 60%; ratio of solvent to solid, 56.9:1mL/g; ultrasonication time, 9.8min; and temperature, 40°C. Under the optimal UAE conditions, the experimental values (483.01±15.39μmolTrolox/gDW) matched with those predicted (494.13μmolTrolox/gDW) within a 95% confidence level. In addition, the antioxidant activities of UAE were compared with those of conventional maceration and Soxhlet extraction methods, and the ultrasound-assisted extraction could give higher yield of antioxidants and markedly reduce the extraction time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. A simple gold nanoparticle-mediated immobilization method to fabricate highly homogeneous DNA microarrays having higher capacities than those prepared by using conventional techniques

    International Nuclear Information System (INIS)

    Jung, Cheulhee; Mun, Hyo Young; Li, Taihua; Park, Hyun Gyu

    2009-01-01

    A simple, highly efficient immobilization method to fabricate DNA microarrays, that utilizes gold nanoparticles as the mediator, has been developed. The fabrication method begins with electrostatic attachment of amine-modified DNA to gold nanoparticles. The resulting gold-DNA complexes are immobilized on conventional amine or aldehyde functionalized glass slides. By employing gold nanoparticles as the immobilization mediator, implementation of this procedure yields highly homogeneous microarrays that have higher binding capacities than those produced by conventional methods. This outcome is due to the increased three-dimensional immobilization surface provided by the gold nanoparticles as well as the intrinsic effects of gold on emission properties. This novel immobilization strategy gives microarrays that produce more intense hybridization signals for the complementary DNA. Furthermore, the silver enhancement technique, made possible only in the case of immobilized gold nanoparticles on the microarrays, enables simple monitoring of the integrity of the immobilized DNA probe.

  12. Limitations of the Conventional Phase Advance Method for Constant Power Operation of the Brushless DC Motor

    International Nuclear Information System (INIS)

    Lawler, J.S.

    2001-01-01

    The brushless dc motor (BDCM) has high-power density and efficiency relative to other motor types. These properties make the BDCM well suited for applications in electric vehicles provided a method can be developed for driving the motor over the 4 to 6:1 constant power speed range (CPSR) required by such applications. The present state of the art for constant power operation of the BDCM is conventional phase advance (CPA)[1]. In this paper, we identify key limitations of CPA. It is shown that the CPA has effective control over the developed power but that the current magnitude is relatively insensitive to power output and is inversely proportional to motor inductance. If the motor inductance is low, then the rms current at rated power and high speed may be several times larger than the current rating. The inductance required to maintain rms current within rating is derived analytically and is found to be large relative to that of BDCM designs using high-strength rare earth magnets. Th us, the CPA requires a BDCM with a large equivalent inductance

  13. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Ghoos, Y.; Brunser, O.; Lawson, F.; Muzeke, A.; Ndjaye, M.F.

    2000-01-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, 13 CO 2 and H 2 breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  14. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Ghoos, Y [UZ Gasthuisberg, Gastrointestinal Pathophysiology, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile); Lawson, F [Clinique Padre Pio, Cotonou (Benin); Muzeke, A [Faculte de Medicine, University of Kinshasa, Kinshasa (Congo); Ndjaye, M F [Cercle Senegalais Gastroenterologie, Dakar (Senegal)

    2000-07-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, {sup 13}CO{sub 2} and H{sub 2} breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  15. Evaluation of various conventional methods for sampling weeds in potato and spinach crops

    Directory of Open Access Journals (Sweden)

    David Jamaica

    2014-04-01

    Full Text Available This study aimed to evaluate (at an exploratory level, some of the different conventional sampling designs in a section of a potato crop and in a commercial crop of spinach. Weeds were sampled in a 16 x 48 m section of a potato crop with a set grid of 192 sections. The cover and density of the weeds were registered in squares of from 0.25 to 64 m². The results were used to create a database that allowed for the simulation of different sampling designs: variables and square size. A second sampling was carried out with these results in a spinach crop of 1.16 ha with a set grid of 6 x 6 m cells, evaluating the cover in 4 m² squares. Another database was created with this information, which was used to simulate other sampling designs such as distribution and quantity of sampling squares. According to the obtained results, a good method for approximating the quantity of squares for diverse samples is 10-12 squares (4 m² for richness per ha and 18 or more squares for abundance per hectare. This square size is optimal since it allows for a sampling of more area without losing sight of low-profile species, with the cover variable best representing the abundance of the weeds.

  16. A non-conventional watershed partitioning method for semi-distributed hydrological modelling: the package ALADHYN

    Science.gov (United States)

    Menduni, Giovanni; Pagani, Alessandro; Rulli, Maria Cristina; Rosso, Renzo

    2002-02-01

    The extraction of the river network from a digital elevation model (DEM) plays a fundamental role in modelling spatially distributed hydrological processes. The present paper deals with a new two-step procedure based on the preliminary identification of an ideal drainage network (IDN) from contour lines through a variable mesh size, and the further extraction of the actual drainage network (AND) from the IDN using land morphology. The steepest downslope direction search is used to identify individual channels, which are further merged into a network path draining to a given node of the IDN. The contributing area, peaks and saddles are determined by means of a steepest upslope direction search. The basin area is thus partitioned into physically based finite elements enclosed by irregular polygons. Different methods, i.e. the constant and variable threshold area methods, the contour line curvature method, and a topologic method descending from the Hortonian ordering scheme, are used to extract the ADN from the IDN. The contour line curvature method is shown to provide the most appropriate method from a comparison with field surveys. Using the ADN one can model the hydrological response of any sub-basin using a semi-distributed approach. The model presented here combines storm abstraction by the SCS-CN method with surface runoff routing as a geomorphological dispersion process. This is modelled using the gamma instantaneous unit hydrograph as parameterized by river geomorphology. The results are implemented using a project-oriented software facility for the Analysis of LAnd Digital HYdrological Networks (ALADHYN).

  17. Comparison of the lysis centrifugation method with the conventional blood culture method in cases of sepsis in a tertiary care hospital.

    Science.gov (United States)

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-07-01

    Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Two hundred nonduplicate blood cultures from cases of sepsis were analyzed using two blood culture methods concurrently for recovery of bacteria from patients diagnosed clinically with sepsis - the conventional blood culture method using trypticase soy broth and the lysis centrifugation method using saponin by centrifuging at 3000 g for 30 minutes. Overall bacteria recovered from 200 blood cultures were 17.5%. The conventional blood culture method had a higher yield of organisms, especially Gram positive cocci. The lysis centrifugation method was comparable with the former method with respect to Gram negative bacilli. The sensitivity of lysis centrifugation method in comparison to conventional blood culture method was 49.75% in this study, specificity was 98.21% and diagnostic accuracy was 89.5%. In almost every instance, the time required for detection of the growth was earlier by lysis centrifugation method, which was statistically significant. Contamination by lysis centrifugation was minimal, while that by conventional method was high. Time to growth by the lysis centrifugation method was highly significant (P value 0.000) as compared to time to growth by the conventional blood culture method. For the diagnosis of sepsis, combination of the lysis centrifugation method and the conventional blood culture method with trypticase soy broth or biphasic media is advocable, in order to achieve faster recovery and a better yield of microorganisms.

  18. Nowcasting Surface Meteorological Parameters Using Successive Correction Method

    National Research Council Canada - National Science Library

    Henmi, Teizi

    2002-01-01

    The successive correction method was examined and evaluated statistically as a nowcasting method for surface meteorological parameters including temperature, dew point temperature, and horizontal wind vector components...

  19. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens

    2000-01-01

    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....

  20. Effects of Environmental Surface Modification Methods on Physical Properties of Hemp Fibers

    Directory of Open Access Journals (Sweden)

    Nigar MERDAN

    2017-11-01

    Full Text Available In this study, hemp fibers have been pre-treated with laccase enzyme in different concentrations (1%, 2% and 3% w/v for different durations using conventional, ultrasonic energy and microwave energy methods. Weight loss (%, tensile strength, elongation (%, whiteness (%, and surface topography (SEM properties of pre-treated hemp fibers were investigated. After processing with laccase enzyme, the energy consumptions of these three methods were compared. Best results have been obtained in 20 minutes with the conventional method, 5 minutes with the ultrasonic energy method, and 1 minute with the microwave energy method. With laccase enzyme, microwave treated hemp fibers were improved after 3 minutes treatment. SEM results have also proved the improved physical properties and color changes due to the rough surface structure. DOI: http://dx.doi.org/10.5755/j01.ms.23.4.17469

  1. Evaluation of surface and shallow depth dose reductions using a Superflab bolus during conventional and advanced external beam radiotherapy.

    Science.gov (United States)

    Yoon, Jihyung; Xie, Yibo; Zhang, Rui

    2018-03-01

    The purpose of this study was to evaluate a methodology to reduce scatter and leakage radiations to patients' surface and shallow depths during conventional and advanced external beam radiotherapy. Superflab boluses of different thicknesses were placed on top of a stack of solid water phantoms, and the bolus effect on surface and shallow depth doses for both open and intensity-modulated radiotherapy (IMRT) beams was evaluated using thermoluminescent dosimeters and ion chamber measurements. Contralateral breast dose reduction caused by the bolus was evaluated by delivering clinical postmastectomy radiotherapy (PMRT) plans to an anthropomorphic phantom. For the solid water phantom measurements, surface dose reduction caused by the Superflab bolus was achieved only in out-of-field area and on the incident side of the beam, and the dose reduction increased with bolus thickness. The dose reduction caused by the bolus was more significant at closer distances from the beam. Most of the dose reductions occurred in the first 2-cm depth and stopped at 4-cm depth. For clinical PMRT treatment plans, surface dose reductions using a 1-cm Superflab bolus were up to 31% and 62% for volumetric-modulated arc therapy and 4-field IMRT, respectively, but there was no dose reduction for Tomotherapy. A Superflab bolus can be used to reduce surface and shallow depth doses during external beam radiotherapy when it is placed out of the beam and on the incident side of the beam. Although we only validated this dose reduction strategy for PMRT treatments, it is applicable to any external beam radiotherapy and can potentially reduce patients' risk of developing radiation-induced side effects. © 2018 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  2. System and method for free-boundary surface extraction

    KAUST Repository

    Algarni, Marei

    2017-10-26

    A method of extracting surfaces in three-dimensional data includes receiving as inputs three-dimensional data and a seed point p located on a surface to be extracted. The method further includes propagating a front outwardly from the seed point p and extracting a plurality of ridge curves based on the propagated front. A surface boundary is detected based on a comparison of distances between adjacent ridge curves and the desired surface is extracted based on the detected surface boundary.

  3. A combination of small bowel imaging methods: conventional enteroclysis with complementary magnetic resonance enteroclysis

    Energy Technology Data Exchange (ETDEWEB)

    Akman, C. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Korman, U. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)]. E-mail: ugurk9@istanbul.edu.tr; Oguet, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Kurugoglu, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Urger, E. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Ulus, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Esen, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Tasci, I. [Department of Surgery, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)

    2005-07-01

    AIM: The aim of this prospective study was to evaluate the overall findings of conventional enteroclysis (CE) with complementary magnetic resonance enteroclysis (MRE) in small bowel disease. METHODS: The study included 32 patients referred from various clinical departments, with known or suspected small bowel disease and abnormalities on CE. Immediately after CE, true fast imaging with steady-state precession (true FISP), and unenhanced and gadolinium-enhanced T1-weighted fast low-angle shot (FLASH) sequences with fat saturation were obtained. Mucosal, mural and luminal changes of the small bowel were evaluated by each technique. In addition, bowel wall thickening, bowel wall enhancement and perienteric changes were assessed by MRE. The radiological findings obtained were evaluated together as a combination, and the role of MRE in the determination of the activity and complications of the small bowel disease was assessed. Radiological findings were correlated with clinical evaluation and follow-up in all cases, including endoscopy in 14 cases and surgery in 5 cases. RESULTS: MRE provided important supplementary mural and extramural information, including degree of pathological wall thickness, mural enhancement pattern associated with disease activity, perivisceral collection, abscess formation, mesenteric fibrofatty proliferation, lymphadenopathy and increase in perienteric vascularity. Short strictures were not revealed on MRE; however, for patients with a history of abdominal malignancy, MRE helped characterize the level of any obstruction and the extent of the disease. CONCLUSION: We recommend MRE for patients who have findings of advanced inflammatory bowel disease or neoplasm on CE examination. The combination of these two techniques can provide important information on the degree and extent of the disorder.

  4. Mapping three-dimensional surface deformation by combining multiple-aperture interferometry and conventional interferometry: Application to the June 2007 eruption of Kilauea Volcano, Hawaii

    Science.gov (United States)

    Jung, H.-S.; Lu, Z.; Won, J.-S.; Poland, Michael P.; Miklius, Asta

    2011-01-01

    Surface deformation caused by an intrusion and small eruption during June 17-19, 2007, along the East Rift Zone of Kilauea Volcano, Hawaii, was three-dimensionally reconstructed from radar interferograms acquired by the Advanced Land Observing Satellite (ALOS) phased-array type L-band synthetic aperture radar (SAR) (PALSAR) instrument. To retrieve the 3-D surface deformation, a method that combines multiple-aperture interferometry (MAI) and conventional interferometric SAR (InSAR) techniques was applied to one ascending and one descending ALOS PALSAR interferometric pair. The maximum displacements as a result of the intrusion and eruption are about 0.8, 2, and 0.7 m in the east, north, and up components, respectively. The radar-measured 3-D surface deformation agrees with GPS data from 24 sites on the volcano, and the root-mean-square errors in the east, north, and up components of the displacement are 1.6, 3.6, and 2.1 cm, respectively. Since a horizontal deformation of more than 1 m was dominantly in the north-northwest-south-southeast direction, a significant improvement of the north-south component measurement was achieved by the inclusion of MAI measurements that can reach a standard deviation of 3.6 cm. A 3-D deformation reconstruction through the combination of conventional InSAR and MAI will allow for better modeling, and hence, a more comprehensive understanding, of the source geometry associated with volcanic, seismic, and other processes that are manifested by surface deformation.

  5. A volume-based method for denoising on curved surfaces

    KAUST Repository

    Biddle, Harry; von Glehn, Ingrid; Macdonald, Colin B.; Marz, Thomas

    2013-01-01

    We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

  6. A volume-based method for denoising on curved surfaces

    KAUST Repository

    Biddle, Harry

    2013-09-01

    We demonstrate a method for removing noise from images or other data on curved surfaces. Our approach relies on in-surface diffusion: we formulate both the Gaussian diffusion and Perona-Malik edge-preserving diffusion equations in a surface-intrinsic way. Using the Closest Point Method, a recent technique for solving partial differential equations (PDEs) on general surfaces, we obtain a very simple algorithm where we merely alternate a time step of the usual Gaussian diffusion (and similarly Perona-Malik) in a small 3D volume containing the surface with an interpolation step. The method uses a closest point function to represent the underlying surface and can treat very general surfaces. Experimental results include image filtering on smooth surfaces, open surfaces, and general triangulated surfaces. © 2013 IEEE.

  7. Evaluation of the surface roughness of three heat-cured acrylic denture base resins with different conventional lathe polishing techniques: A comparative study.

    Science.gov (United States)

    Rao, Duggineni Chalapathi; Kalavathy, N; Mohammad, H S; Hariprasad, A; Kumar, C Ravi

    2015-01-01

    Surface roughness promotes adhesion and colonization of denture plaque. Therefore, it is important to know the effects of polishing and finishing on the surface roughness of various acrylic resin materials. To evaluate and compare the effects of different conventional lathe polishing techniques on heat cured acrylic resins in producing surface roughness. Three different commercially available heat-cured acrylic resin materials namely DPI, Meliodent and Trevalon Hi were selected. 30 Specimens of each acrylic material (30 x 3 = 90, 10 x 60 x 2mm) were prepared and divided into 5 groups, each group consisted of 6 Nos. of specimens per material(6x3=18) and were grouped as Group A(unfinished), Group B (finished), Group C (Polishing Paste), Group D (Polishing Cake) and Group E (Pumice and Gold rouge). The resulted surface roughness (μm) was measured using Perthometer and observed under Scanning Electron Microscope. The values obtained were subjected statistical analyses. Among the materials tested, better results were obtained with Trevalon Hi followed by Meliodent and DPI. Among the polishing methods used, superior results were obtained with universal polishing paste followed by polishing cake; Pumice and Gold rouge. Although Pumice and Gold rouge values produced greater roughness value, they were well within the threshold value of 0.2 mm.

  8. Surface analysis methods in materials science

    CERN Document Server

    Sexton, Brett; Smart, Roger

    1992-01-01

    The idea for this book stemmed from a remark by Philip Jennings of Murdoch University in a discussion session following a regular meeting of the Australian Surface Science group. He observed that a text on surface analysis and applica­ tions to materials suitable for final year undergraduate and postgraduate science students was not currently available. Furthermore, the members of the Australian Surface Science group had the research experience and range of coverage of sur­ face analytical techniques and applications to provide a text for this purpose. A of techniques and applications to be included was agreed at that meeting. The list intended readership of the book has been broadened since the early discussions, particularly to encompass industrial users, but there has been no significant alter­ ation in content. The editors, in consultation with the contributors, have agreed that the book should be prepared for four major groups of readers: - senior undergraduate students in chemistry, physics, metallur...

  9. Application of the B.F.S. Method to Metallic Surfaces: Surface Alloys and Alloy Surfaces

    International Nuclear Information System (INIS)

    Bozzolo, Gullermo

    1997-01-01

    These notes introduce the BFS (Bozzolo-Ferrante-Smith) method for alloys, in the framework of what is available today in terms of computationally efficient and physically sound techniques for modeling of atomic systems. The BFS method belongs to the family of semi-empirical methods, which aim to balance scientific rigour with practical applications. The goal is to provide a tool that aids in the process of material analysis and development, supplementing the experimental work which by itself has limitations in terms of time, money, technology and human resources. One of the main advantages of the BFS method, basically tailored to assist in the problem of alloy design, is that it is easily applicable to the analysis of surface structure, with a satisfactory degree of accuracy. In these notes, first the role of semiempirical methods among the available tools for atomistic simulations is reviewed, followed by a description of the BFS method and a simple application in order to understand the operational procedure, and conclude reviewing some of the topics of current interest where techniques such as the BFS method play an important role in furthering the understanding os fundamental issues

  10. Comparison of Land, Water, and Energy Requirements of Lettuce Grown Using Hydroponic vs. Conventional Agricultural Methods.

    Science.gov (United States)

    Barbosa, Guilherme Lages; Gadelha, Francisca Daiane Almeida; Kublik, Natalya; Proctor, Alan; Reichelm, Lucas; Weissinger, Emily; Wohlleb, Gregory M; Halden, Rolf U

    2015-06-16

    The land, water, and energy requirements of hydroponics were compared to those of conventional agriculture by example of lettuce production in Yuma, Arizona, USA. Data were obtained from crop budgets and governmental agricultural statistics, and contrasted with theoretical data for hydroponic lettuce production derived by using engineering equations populated with literature values. Yields of lettuce per greenhouse unit (815 m2) of 41 ± 6.1 kg/m2/y had water and energy demands of 20 ± 3.8 L/kg/y and 90,000 ± 11,000 kJ/kg/y (±standard deviation), respectively. In comparison, conventional production yielded 3.9 ± 0.21 kg/m2/y of produce, with water and energy demands of 250 ± 25 L/kg/y and 1100 ± 75 kJ/kg/y, respectively. Hydroponics offered 11 ± 1.7 times higher yields but required 82 ± 11 times more energy compared to conventionally produced lettuce. To the authors' knowledge, this is the first quantitative comparison of conventional and hydroponic produce production by example of lettuce grown in the southwestern United States. It identified energy availability as a major factor in assessing the sustainability of hydroponics, and it points to water-scarce settings offering an abundance of renewable energy (e.g., from solar, geothermal, or wind power) as particularly attractive regions for hydroponic agriculture.

  11. Effect of Chemistry Triangle Oriented Learning Media on Cooperative, Individual and Conventional Method on Chemistry Learning Result

    Science.gov (United States)

    Latisma D, L.; Kurniawan, W.; Seprima, S.; Nirbayani, E. S.; Ellizar, E.; Hardeli, H.

    2018-04-01

    The purpose of this study was to see which method are well used with the Chemistry Triangle-oriented learning media. This quasi experimental research involves first grade of senior high school students in six schools namely each two SMA N in Solok city, in Pasaman and two SMKN in Pariaman. The sampling technique was done by Cluster Random Sampling. Data were collected by test and analyzed by one-way anova and Kruskall Wallish test. The results showed that the high school students in Solok learning taught by cooperative method is better than the results of student learning taught by conventional and Individual methods, both for students who have high initial ability and low-ability. Research in SMK showed that the overall student learning outcomes taught by conventional method is better than the student learning outcomes taught by cooperative and individual methods. Student learning outcomes that have high initial ability taught by individual method is better than student learning outcomes that are taught by cooperative method and for students who have low initial ability, there is no difference in student learning outcomes taught by cooperative, individual and conventional methods. Learning in high school in Pasaman showed no significant difference in learning outcomes of the three methods undertaken.

  12. VOLATILE CONSTITUENTS OF GINGER OIL PREPARED ACCORDING TO IRANIAN TRADITIONAL MEDICINE AND CONVENTIONAL METHOD: A COMPARATIVE STUDY.

    Science.gov (United States)

    Shirooye, Pantea; Mokaberinejad, Roshanak; Ara, Leila; Hamzeloo-Moghadam, Maryam

    2016-01-01

    Herbal medicines formulated as oils were believed to possess more powerful effects than their original plants in Iranian Traditional Medicine (ITM). One of the popular oils suggested for treatment of various indications was ginger oil. In the present study, to suggest a more convenient method of oil preparation (compared to the traditional method), ginger oil has been prepared according to both the traditional and conventional maceration methods and the volatile oil constituents have been compared. Ginger oil was obtained in sesame oil according to both the traditional way and the conventional (maceration) methods. The volatile oil of dried ginger and both oils were obtained by hydro-distillation and analyzed by gas chromatography/mass spectroscopy. Fifty five, fifty nine and fifty one components consisting 94 %, 94 % and 98 % of the total compounds were identified in the volatile oil of ginger, traditional and conventional oils, respectively. The most dominant compounds of the traditional and conventional oils were almost similar; however they were different from ginger essential oil which has also been to possess limited amounts of anti-inflammatory components. It was concluded that ginger oil could be prepared through maceration method and used for indications mentioned in ITM.

  13. Surface control alloy substrates and methods of manufacture therefor

    Energy Technology Data Exchange (ETDEWEB)

    Fritzemeier, Leslie G. (Mendon, MA); Li, Qi (Marlborough, MA); Rupich, Martin W. (Framingham, MA); Thompson, Elliott D. (Coventry, RI); Siegal, Edward J. (Malden, MA); Thieme, Cornelis Leo Hans (Westborough, MA); Annavarapu, Suresh (Brookline, MA); Arendt, Paul N. (Los Alamos, NM); Foltyn, Stephen R. (Los Alamos, NM)

    2004-05-04

    Methods and articles for controlling the surface of an alloy substrate for deposition of an epitaxial layer. The invention includes the use of an intermediate layer to stabilize the substrate surface against oxidation for subsequent deposition of an epitaxial layer.

  14. Manufacturing and characterization of ceramic pigment Zn1-xFexCr2O4 by synthetic non conventional methods

    International Nuclear Information System (INIS)

    Nieves, Leidy Johana Jaramillo; Baena, Oscar Jaime Restrepo

    2012-01-01

    The ceramic pigment with structure Zn 1-x Fe x Cr 2 O 4 (x = 0, 0.5, 1) was synthesized by non conventional methods of coprecipitation assisted by ultrasound and milling of high energy. This pigment was characterized by XRD, XRF, SEM, UV-VIS spectrophotometry and CIELab colorimetry. The aim of this work was studied two alternative methods to the traditional method of synthesis, evaluating the pigment properties, varying the stoichiometry, such as structure, composition, morphology and colorimetric coordinates. The results showed that is possible to obtain the desired crystalline structure at temperatures below 1000 ° C in both cases, also expected hues are obtained according to each stoichiometry, which shows the advantages of using methods non conventional when produce these pigments, since it has a higher controlling the composition, stoichiometry and is obtained at temperatures below compared with traditional ceramic method

  15. Treatment of children with Helicobacter infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, P F [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); Lawson, W [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); De Maio, G; Andriulli, A [Ospedale Casa Sollievo della Sofferenza, San Giovanni Rotondo (Italy); Ghoos, Y [Lab. Digestie Absoptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    There is a large interest about Heliobacter pylori infection in childhood nowadays. The prevalence of infection is very high in developing countries and this is extremely correlated to the living conditions with consequences on the future health of children. Contamination mode is not well known but environment factors are involved. We used {sup 13}C Urea Breath Test to assess the prevalence rate in beninese asymptomatic children aged 7-11 years old (about 86%). We evaluated the influence of either conventional or probiotics therapy in eradicating Hp infection and some relationships with growth parameters. We concluded that conventional therapy or use of probiotics might improve infection status and probably influence growth factors in childhood. (author)

  16. Method for Pre-Conditioning a Measured Surface Height Map for Model Validation

    Science.gov (United States)

    Sidick, Erkin

    2012-01-01

    This software allows one to up-sample or down-sample a measured surface map for model validation, not only without introducing any re-sampling errors, but also eliminating the existing measurement noise and measurement errors. Because the re-sampling of a surface map is accomplished based on the analytical expressions of Zernike-polynomials and a power spectral density model, such re-sampling does not introduce any aliasing and interpolation errors as is done by the conventional interpolation and FFT-based (fast-Fourier-transform-based) spatial-filtering method. Also, this new method automatically eliminates the measurement noise and other measurement errors such as artificial discontinuity. The developmental cycle of an optical system, such as a space telescope, includes, but is not limited to, the following two steps: (1) deriving requirements or specs on the optical quality of individual optics before they are fabricated through optical modeling and simulations, and (2) validating the optical model using the measured surface height maps after all optics are fabricated. There are a number of computational issues related to model validation, one of which is the "pre-conditioning" or pre-processing of the measured surface maps before using them in a model validation software tool. This software addresses the following issues: (1) up- or down-sampling a measured surface map to match it with the gridded data format of a model validation tool, and (2) eliminating the surface measurement noise or measurement errors such that the resulted surface height map is continuous or smoothly-varying. So far, the preferred method used for re-sampling a surface map is two-dimensional interpolation. The main problem of this method is that the same pixel can take different values when the method of interpolation is changed among the different methods such as the "nearest," "linear," "cubic," and "spline" fitting in Matlab. The conventional, FFT-based spatial filtering method used to

  17. Comparative study on flow rate measurement by nuclear and conventional methods in selected rivers at Ulu Langat district, Selangor

    Energy Technology Data Exchange (ETDEWEB)

    Wan Mohamad Tahir, Wan Zakaria; Mohamad, Daud; Hamzah, Abdul Razak; Yusuf, Johari Mohamad; Aziz Wan Mohamad, Wan Abdul

    1986-06-01

    A radiotracer technique using Tc-99 to measure flows of small rivers was introduced in Malaysia. Three rivers in the Ulu Langat District were selected for a comparative study on flow rate determination by conventional and radioisotope methods. Radioisotopic approach, comprising injection procedures, calibration, mixing length and safety aspects are discussed. The results measured by radioisotope method are compared to the Drainage and Irrigation Department's (DID's) discharge curves data collected from 1980 to 1982 which is calibrated using a current meter. The results are comparable and fall within the range obtained by conventional method. Related to this study, a comprehensive work on stream gauging of moderate and high flow rates using both methods is proposed to be carried out directly.

  18. Synthesis of biocompatible surfaces by nanotechnology methods

    OpenAIRE

    Alekhin , A. ,; Boleiko , G. ,; Gudkova , S. ,; Markeev , A. ,; Sigarev , A. ,; Toknova , V. ,; Kirilenko , A. ,; Lapshin , R. ,; Kozlov , E. ,; Tetyukhin , D. ,

    2010-01-01

    International audience; The modification of the surface of low-density polyethylene (LDPE) and polyurethane (PU) by means of the pulsed ion-plasma deposition of nanostructural carbon coatings at 20–60°C has been studied. The effect of this low-temperature treatment on the biocompatibility of the LDPE and PU has been assessed. Optimum technological parameters for the formation of mosaic carbon nanostructures with a thickness of 0.3–15 nm and a cluster lateral size of 10–500 nm are determined. ...

  19. An Alternative to Conventional Rock Fragmentation Methods Using SCDA: A Review

    Directory of Open Access Journals (Sweden)

    Radhika Vidanage De Silva

    2016-11-01

    Full Text Available Global energy and material consumption are expected to rise in exponential proportions during the next few decades, generating huge demands for deep earth energy (oil/gas recovery and mineral processing. Under such circumstances, the continuation of existing methods in rock fragmentation in such applications is questionable due to the proven adverse environmental impacts associated with them. In this regard; the possibility of using more environmentally friendly options as Soundless Chemical Demolition Agents (SCDAs play a vital role in replacing harmful conventional rock fragmentation techniques for gas; oil and mineral recovery. This study reviews up to date research on soundless cracking demolition agent (SCDA application on rock fracturing including its limitations and strengths, possible applications in the petroleum industry and the possibility of using existing rock fragmentation models for SCDA-based rock fragmentation; also known as fracking. Though the expansive properties of SCDAs are currently used in some demolition works, the poor usage guidelines available reflect the insufficient research carried out on its material’s behavior. SCDA is a cementitious powdery substance with quicklime (CaO as its primary ingredient that expands upon contact with water; which results in a huge expansive pressure if this CaO hydration reaction occurs in a confined condition. So, the mechanism can be used for rock fragmentation by injecting the SCDA into boreholes of a rock mass; where the resulting expansive pressure is sufficient to create an effective fracture network in the confined rock mass around the borehole. This expansive pressure development, however, dependent on many factors, where formation water content creates a negative influence on this due to required greater degree of hydration under greater water contents and temperature creates a positive influence by accelerating the reaction. Having a precise understanding of the fracture

  20. Effect of amaranth dye on the growth and properties of conventional and SR method grown KAP single crystals

    Science.gov (United States)

    Babu Rao, G.; P., Rajesh; Ramasamy, P.

    2018-04-01

    The 0.1 mol% amaranth added KAP single crystals were grown from aqueous solutions by both slow evaporation solution technique and Sankaranarayanan-Ramasamy method. The single crystal having dimension of 45 mm length and 12 mm diameter was grown with growth rate of 1.5 mm/day using SR method. 87 % transmittance is obtained for SR method grown amaranth added KAP single crystal. The high intense luminescence at 661 nm is obtained from amaranth added conventional and SR method grown KAP single crystal. The amaranth added KAP single crystal possesses good mechanical and laser damage threshold stability.

  1. Surface structure analysis by means of Rutherford scattering: methods to study surface relaxation

    International Nuclear Information System (INIS)

    Turkenburg, W.C.; Soszka, W.; Saris, F.W.; Kersten, H.H.; Colenbrander, B.G.

    1976-01-01

    The use of Rutherford backscattering for structural analysis of single crystal surfaces is reviewed, and a new method is introduced. With this method, which makes use of the channeling and blocking phenomenon of light ions of medium energy, surface atoms can be located with a precision of 0.02 A. This is demonstrated in a measurement of surface relaxation for the Cu(110) surface. (Auth.)

  2. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  3. Method of predicting surface deformation in the form of sinkholes

    Energy Technology Data Exchange (ETDEWEB)

    Chudek, M.; Arkuszewski, J.

    1980-06-01

    Proposes a method for predicting probability of sinkhole shaped subsidence, number of funnel-shaped subsidences and size of individual funnels. The following factors which influence the sudden subsidence of the surface in the form of funnels are analyzed: geologic structure of the strata between mining workings and the surface, mining depth, time factor, and geologic disolocations. Sudden surface subsidence is observed only in the case of workings situated up to a few dozen meters from the surface. Using the proposed method is explained with some examples. It is suggested that the method produces correct results which can be used in coal mining and in ore mining. (1 ref.) (In Polish)

  4. Recent characterization of steel by surface analysis methods

    International Nuclear Information System (INIS)

    Suzuki, Shigeru

    1996-01-01

    Surface analysis methods, such as Auger electron spectroscopy, X-ray photoelectron spectroscopy, secondary ion mass spectrometry, glow discharge optical emission spectrometry and so on, have become indispensable to characterize surface and interface of many kinds of steel. Although a number of studies on characterization of steel by these methods have been carried out, several problems still remain in quantification and depth profiling. Nevertheless, the methods have provided essential information on the concentration and chemical state of elements at the surface and interface. Recent results on characterization of oxide layers, coated films, etc. on the surface of steel are reviewed here. (author). 99 refs

  5. [A comparative study of blood culture conventional method vs. a modified lysis/centrifugation technique for the diagnosis of fungemias].

    Science.gov (United States)

    Santiago, Axel Rodolfo; Hernández, Betsy; Rodríguez, Marina; Romero, Hilda

    2004-12-01

    The purpose of this work was to compare the efficacy of blood culture conventional method vs. a modified lysis/centrifugation technique. Out of 450 blood specimens received in one year, 100 where chosen for this comparative study: 60 from patients with AIDS, 15 from leukemic patients, ten from febrile neutropenic patients, five from patients with respiratory infections, five from diabetics and five from septicemic patients. The specimens were processed, simultaneously, according to the above mentioned methodologies with daily inspections searching for fungal growth in order to obtain the final identification of the causative agent. The number (40) of isolates recovered was the same using both methods, which included; 18 Candida albicans (45%), ten Candida spp. (25%), ten Histoplasma capsulatum (25%), and two Cryptococcus neoformans (5%). When the fungal growth time was compared by both methods, growth was more rapid when using the modified lysis/centrifugation technique than when using the conventional method. Statistical analysis revealed a significant difference (pcentrifugation technique showed to be more efficacious than the conventional one, and therefore the implementation of this methodology is highly recommended for the isolation of fungi from blood.

  6. Structural and electrical properties of copper-nickel-aluminum alloys obtained by conventional powder metallurgy method

    International Nuclear Information System (INIS)

    Monteiro, Waldemar A.; Carrio, Juan A.G.; Silveira, C.R. da; Pertile, H.K.S.

    2009-01-01

    This work looked for to search out systematically, in scale of laboratory, copper-nickel-aluminum alloys (Cu-Ni-Al) with conventional powder metallurgy processing, in view of the maintenance of the electric and mechanical properties with the intention of getting electric connectors of high performance or high mechanical damping. After cold uniaxial pressing (1000 kPa), sintering (780 deg C) and convenient homogenization treatments (500 deg C for different times) under vacuum (powder metallurgy), the obtained Cu-Ni-Al alloys were characterized by optical microscopy, electrical conductivity, Vickers hardness. X rays powder diffraction data were collected for the sintered samples in order to a structural and microstructural analysis. The comparative analysis is based on the sintered density, hardness, macrostructures and microstructures of the samples. (author)

  7. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  8. Comparison of the Lysis Centrifugation Method with the Conventional Blood Culture Method in Cases of Sepsis in a Tertiary Care Hospital

    OpenAIRE

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-01-01

    Introduction : Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. Objectives: To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Materials and Methods: Two hundred ...

  9. Modern methods of studying surfaces and their application to glasses

    International Nuclear Information System (INIS)

    Rauschenbach, B.; Haehnert, M.

    1977-05-01

    In the works are demonstrated modern methods for study of solid surfaces and its use of glasses. Study of the interaction of ions, electrons and photons with the glass surface provides information about the composition of the surface and its structure on an atomic scale. A qualitative analysis of a surface can be made with the aid of the Auger electron spectroscopy (AES) and the electron spectroscopy for chemical analysis (ESCA) and with the ion scattering (ISS and RBS) and the secondary ion mass spectrometry (SIMS). The structure of a surface can be studied by means of ion scattering and low-energy electron diffraction (LEED) and the topography of a surface by means of scanning electron microscopy (SEM). The ellipsometry is generally confined to measuring the thickness of very thin layers. The application these methods to the glass surfaces is demonstrated on series of examples. (author)

  10. Mercury Distribution in the Deûle River (Northern France) Measured by the Diffusive Gradients in Thin Films Technique and Conventional Methods.

    Science.gov (United States)

    Diviš, Pavel; Kadlecová, Milada; Ouddane, Baghdad

    2016-05-01

    The distribution of mercury in surface water and in sediment from Deûle River in Northern France was studied by application of conventional sampling methods and by diffusive gradients in thin films technique (DGT). Concentration of total dissolved mercury in surface water was 20.8 ± 0.8 ng l(-1). The particulate mercury concentration was 6.2 ± 0.6 µg g(-1). The particulate mercury was accumulated in sediment (9.9 ± 2.3 mg kg(-1)), and it was transformed by methylating bacteria to methylmercury, mainly in the first 2-cm layer of the sediment. Total dissolved concentration of mercury in sediment pore water obtained by application of centrifugation extraction was 17.6 ± 4.1 ng l(-1), and it was comparable with total dissolved pore water mercury concentration measured by DGT probe containing Duolite GT-73 resin gel (18.2 ± 4.3 ng l(-1)), taking the sediment heterogeneity and different principles of the applied methods into account. By application of two DGT probes with different resin gels specific for mercury, it was found that approximately 30% of total dissolved mercury in sediment pore water was present in labile forms easy available for biota. The resolution of mercury DGT depth profiles was 0.5 cm, which allows, unlike conventional techniques, to study the connection of the geochemical cycle of mercury with geochemical cycles of iron and manganese.

  11. SELECTION OF NON-CONVENTIONAL MACHINING PROCESSES USING THE OCRA METHOD

    Directory of Open Access Journals (Sweden)

    Miloš Madić

    2015-04-01

    Full Text Available Selection of the most suitable nonconventional machining process (NCMP for a given machining application can be viewed as multi-criteria decision making (MCDM problem with many conflicting and diverse criteria. To aid these selection processes, different MCDM methods have been proposed. This paper introduces the use of an almost unexplored MCDM method, i.e. operational competitiveness ratings analysis (OCRA method for solving the NCMP selection problems. Applicability, suitability and computational procedure of OCRA method have been demonstrated while solving three case studies dealing with selection of the most suitable NCMP. In each case study the obtained rankings were compared with those derived by the past researchers using different MCDM methods. The results obtained using the OCRA method have good correlation with those derived by the past researchers which validate the usefulness of this method while solving complex NCMP selection problems.

  12. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods

    Directory of Open Access Journals (Sweden)

    Shiva Alavi

    2017-01-01

    Conclusion: MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  13. Sliding surface searching method for slopes containing a potential weak structural surface

    Directory of Open Access Journals (Sweden)

    Aijun Yao

    2014-06-01

    Full Text Available Weak structural surface is one of the key factors controlling the stability of slopes. The stability of rock slopes is in general concerned with set of discontinuities. However, in soft rocks, failure can occur along surfaces approaching to a circular failure surface. To better understand the position of potential sliding surface, a new method called simplex-finite stochastic tracking method is proposed. This method basically divides sliding surface into two parts: one is described by smooth curve obtained by random searching, the other one is polyline formed by the weak structural surface. Single or multiple sliding surfaces can be considered, and consequently several types of combined sliding surfaces can be simulated. The paper will adopt the arc-polyline to simulate potential sliding surface and analyze the searching process of sliding surface. Accordingly, software for slope stability analysis using this method was developed and applied in real cases. The results show that, using simplex-finite stochastic tracking method, it is possible to locate the position of a potential sliding surface in the slope.

  14. Comparison of a radiometric method (BACTEC) and conventional culture media for recovery of mycobacteria from smear-negative specimens

    International Nuclear Information System (INIS)

    Morgan, M.A.; Horstmeier, C.D.; DeYoung, D.R.; Roberts, G.D.

    1983-01-01

    The BACTEC system and three conventional media (Middlebrook 7H10, selective Middlebrook 7H11 [S7H11], and Lowenstein-Jensen [LJ] were compared for their mean recovery times and recovery rates of mycobacteria from acid-fast, smear-negative clinical specimens. Of the 71 smear-negative, culture-positive specimens recovered from 2,165 submitted smear-negative cultures, the BACTEC system detected 71.8%, compared with 88.7% for the conventional three-medium system. When media were individually compared, BACTEC medium (Middlebrook 7H12) was more successful in recovering mycobacteria (71.8%) than was LJ (62%), Middlebrook medium 7H10 (55.9%), or Middlebrook S7H11 medium (52.1%). Middlebrook 7H11 medium containing sodium selenate was also evaluated and did not increase the recovery rate or decrease the recovery time of mycobacterial species when compared with LJ, Middlebrook 7H10, S7H11, and 7H12 media. The mean detection time for the BACTEC system was less than that by conventional methods for the seven species of mycobacteria recovered. Detection times for Mycobacterium tuberculosis on the BACTEC system and conventional cultural systems were 13.7 and 26.3 days, respectively

  15. Synthesis of hydroxyapatite nanorods for application in water defluoridation and optimization of process variables: Advantage of ultrasonication with precipitation method over conventional method.

    Science.gov (United States)

    Mehta, Dhiraj; Mondal, Poonam; Saharan, Virendra Kumar; George, Suja

    2017-07-01

    This research work presents the synthesis of hydroxyapatite (Hap) nanorods for defluoridation of drinking water by using both conventional (CM) and ultrasonication with precipitation (USPM) methods. Calcium nitrate was reacted with potassium phosphate in presence of ammonia for controlled pH to synthesize Hap nanorods, which was characterized using FTIR, XRD, SEM, TG-DTA, and TEM/EDS for determining its phase composition, structural and thermal decomposition behavior. When USPM method was used for synthesis, the yield of the Hap nanorods was improved from 83.24±1.0% to 90.2±1.0%, and complete phase transformation occurred with formation of elongated Hap nanorods. Effects of process parameters such as solution pH, contact time and adsorbent dose were studied through response surface methodology (RSM). A simple quadratic model was developed using Central Composite Design (CCD) and optimum parameters for fluoride adsorption process were determined to be pH 7, contact time 3h and adsorbent dose 7g/L for maximum removal capacity. Fluoride removal efficiency was predicted to be 93.64% which was very close to the experimental value obtained at 92.86% using ultrasonically prepared Hap. Fluoride adsorption isotherms fitted the Freundlich isotherm with an adsorption capacity of 1.49mg/g, while the kinetic studies revealed that the process followed pseudo-second order model. The treated water quality parameters such as residual fluoride, calcium leached, total hardness and alkalinity was investigated, and it was observed that all these parameters were within the permissible limits as per WHO and BIS standards. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Comparative Analysis of Conventional Method with Activity Based Costing in PT Mulia Sejati Gallery

    OpenAIRE

    Erena, Irma Nadia; Gani, Engelwati

    2016-01-01

    The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data ana...

  17. Comparison of methods used to estimate conventional undiscovered petroleum resources: World examples

    Science.gov (United States)

    Ahlbrandt, T.S.; Klett, T.R.

    2005-01-01

    Various methods for assessing undiscovered oil, natural gas, and natural gas liquid resources were compared in support of the USGS World Petroleum Assessment 2000. Discovery process, linear fractal, parabolic fractal, engineering estimates, PETRIMES, Delphi, and the USGS 2000 methods were compared. Three comparisons of these methods were made in: (1) the Neuquen Basin province, Argentina (different assessors, same input data); (2) provinces in North Africa, Oman, and Yemen (same assessors, different methods); and (3) the Arabian Peninsula, Arabian (Persian) Gulf, and North Sea (different assessors, different methods). A fourth comparison (same assessors, same assessment methods but different geologic models), between results from structural and stratigraphic assessment units in the North Sea used only the USGS 2000 method, and hence compared the type of assessment unit rather than the method. In comparing methods, differences arise from inherent differences in assumptions regarding: (1) the underlying distribution of the parent field population (all fields, discovered and undiscovered), (2) the population of fields being estimated; that is, the entire parent distribution or the undiscovered resource distribution, (3) inclusion or exclusion of large outlier fields; (4) inclusion or exclusion of field (reserve) growth, (5) deterministic or probabilistic models, (6) data requirements, and (7) scale and time frame of the assessment. Discovery process, Delphi subjective consensus, and the USGS 2000 method yield comparable results because similar procedures are employed. In mature areas such as the Neuquen Basin province in Argentina, the linear and parabolic fractal and engineering methods were conservative compared to the other five methods and relative to new reserve additions there since 1995. The PETRIMES method gave the most optimistic estimates in the Neuquen Basin. In less mature areas, the linear fractal method yielded larger estimates relative to other methods

  18. METHODS FOR THE REPRESENTATION OF THE HELICOIDAL SURFACE

    Directory of Open Access Journals (Sweden)

    SCURTU Liviu-Iacob

    2017-05-01

    Full Text Available In this paper there are presented the graphical methods to determine the parameters of an helicoidal stairs. The first part of this paper shows the used methods to generate the helicoidal curves using descriptive geometry methods. It has represented the state of the art of the generation of a helical surface studies. The second part of this study shows the helical stairs surface representation using descriptive geometry methods. For the representation of the helicoidal stairs are used two projections, the front and top view. A method of the stairs representation is solved using CAD modelling dedicated software. Following the helical surface representation in both methods, has been achieved a comparative study by using two representation methods. Conclusions about these two representation methods are presented in the end of this paper.

  19. Teaching Dental Students to Understand the Temporomandibular Joint Using MRI: Comparison of Conventional and Digital Learning Methods.

    Science.gov (United States)

    Arús, Nádia A; da Silva, Átila M; Duarte, Rogério; da Silveira, Priscila F; Vizzotto, Mariana B; da Silveira, Heraldo L D; da Silveira, Heloisa E D

    2017-06-01

    The aims of this study were to evaluate and compare the performance of dental students in interpreting the temporomandibular joint (TMJ) with magnetic resonance imaging (MRI) scans using two learning methods (conventional and digital interactive learning) and to examine the usability of the digital learning object (DLO). The DLO consisted of tutorials about MRI and anatomic and functional aspects of the TMJ. In 2014, dental students in their final year of study who were enrolled in the elective "MRI Interpretation of the TMJ" course comprised the study sample. After exclusions for nonattendance and other reasons, 29 of the initial 37 students participated in the study, for a participation rate of 78%. The participants were divided into two groups: a digital interactive learning group (n=14) and a conventional learning group (n=15). Both methods were assessed by an objective test applied before and after training and classes. Aspects such as support and training requirements, complexity, and consistency of the DLO were also evaluated using the System Usability Scale (SUS). A significant between-group difference in the posttest results was found, with the conventional learning group scoring better than the DLO group, indicated by mean scores of 9.20 and 8.11, respectively, out of 10. However, when the pretest and posttest results were compared, both groups showed significantly improved performance. The SUS score was 89, which represented a high acceptance of the DLO by the users. The students who used the conventional method of learning showed superior performance in interpreting the TMJ using MRI compared to the group that used digital interactive learning.

  20. Determination of in vitro susceptibility of Mycobacterium tuberculosis to cephalosporins by radiometric and conventional methods

    International Nuclear Information System (INIS)

    Heifets, L.B.; Iseman, M.D.; Cook, J.L.; Lindholm-Levy, P.J.; Drupa, I.

    1985-01-01

    Among eight cephalosporins and cephamycins tested in preliminary in vitro screening against Mycobacterium tuberculosis, the most promising for further study was found to be ceforanide, followed by ceftizoxime, cephapirin, and cefotaxime. Moxalactam, cefoxitin, cefamandole, and cephalothin were found to be not active enough against M. tuberculosis to be considered for further in vitro studies. The antibacterial activity of various ceforanide concentrations was investigated by three methods: (i) the dynamics of radiometric readings (growth index) in 7H12 broth; (ii) the number of CFU in the same medium; and (iii) the proportion method on 7H11 agar plates. There was a good correlation among the results obtained with these methods. The MIC for most strains ranged from 6.0 to 25.0 micrograms/ml. The BACTEC radiometric method is a reliable, rapid, and convenient method for preliminary screening and determination of the level of antibacterial activity of drugs not commonly used against M. tuberculosis

  1. Comparative study of age estimation using dentinal translucency by digital and conventional methods

    Science.gov (United States)

    Bommannavar, Sushma; Kulkarni, Meena

    2015-01-01

    Introduction: Estimating age using the dentition plays a significant role in identification of the individual in forensic cases. Teeth are one of the most durable and strongest structures in the human body. The morphology and arrangement of teeth vary from person-to-person and is unique to an individual as are the fingerprints. Therefore, the use of dentition is the method of choice in the identification of the unknown. Root dentin translucency is considered to be one of the best parameters for dental age estimation. Traditionally, root dentin translucency was measured using calipers. Recently, the use of custom built software programs have been proposed for the same. Objectives: The present study describes a method to measure root dentin translucency on sectioned teeth using a custom built software program Adobe Photoshop 7.0 version (Adobe system Inc, Mountain View California). Materials and Methods: A total of 50 single rooted teeth were sectioned longitudinally to derive a 0.25 mm uniform thickness and the root dentin translucency was measured using digital and caliper methods and compared. The Gustafson's morphohistologic approach is used in this study. Results: Correlation coefficients of translucency measurements to age were statistically significant for both the methods (P < 0.125) and linear regression equations derived from both methods revealed better ability of the digital method to assess age. Conclusion: The custom built software program used in the present study is commercially available and widely used image editing software. Furthermore, this method is easy to use and less time consuming. The measurements obtained using this method are more precise and thus help in more accurate age estimation. Considering these benefits, the present study recommends the use of digital method to assess translucency for age estimation. PMID:25709325

  2. Evaluation of surface sampling method performance for Bacillus Spores on clean and dirty outdoor surfaces.

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Mollye C.; Einfeld, Wayne; Boucher, Raymond M.; Brown, Gary Stephen; Tezak, Matthew Stephen

    2011-06-01

    Recovery of Bacillus atrophaeous spores from grime-treated and clean surfaces was measured in a controlled chamber study to assess sampling method performance. Outdoor surfaces investigated by wipe and vacuum sampling methods included stainless steel, glass, marble and concrete. Bacillus atrophaeous spores were used as a surrogate for Bacillus anthracis spores in this study designed to assess whether grime-coated surfaces significantly affected surface sampling method performance when compared to clean surfaces. A series of chamber tests were carried out in which known amounts of spores were allowed to gravitationally settle onto both clean and dirty surfaces. Reference coupons were co-located with test coupons in all chamber experiments to provide a quantitative measure of initial surface concentrations of spores on all surfaces, thereby allowing sampling recovery calculations. Results from these tests, carried out under both low and high humidity conditions, show that spore recovery from grime-coated surfaces is the same as or better than spore recovery from clean surfaces. Statistically significant differences between method performance for grime-coated and clean surfaces were observed in only about half of the chamber tests conducted.

  3. Estimating surface acoustic impedance with the inverse method.

    Science.gov (United States)

    Piechowicz, Janusz

    2011-01-01

    Sound field parameters are predicted with numerical methods in sound control systems, in acoustic designs of building and in sound field simulations. Those methods define the acoustic properties of surfaces, such as sound absorption coefficients or acoustic impedance, to determine boundary conditions. Several in situ measurement techniques were developed; one of them uses 2 microphones to measure direct and reflected sound over a planar test surface. Another approach is used in the inverse boundary elements method, in which estimating acoustic impedance of a surface is expressed as an inverse boundary problem. The boundary values can be found from multipoint sound pressure measurements in the interior of a room. This method can be applied to arbitrarily-shaped surfaces. This investigation is part of a research programme on using inverse methods in industrial room acoustics.

  4. Consumer acceptance and aroma characterization of navy bean (Phaseolus vulgaris) powders prepared by extrusion and conventional processing methods.

    Science.gov (United States)

    Szczygiel, Edward J; Harte, Janice B; Strasburg, Gale M; Cho, Sungeun

    2017-09-01

    Food products produced with bean ingredients are gaining in popularity among consumers due to the reported health benefits. Navy bean (Phaseolus vulgaris) powder produced through extrusion can be considered as a resource-efficient alternative to conventional methods, which often involve high water inputs. Therefore, navy bean powders produced with extrusion and conventional methods were assessed for the impact of processing on consumer liking in end-use products and odor-active compounds. Consumer acceptance results reveal significant differences in flavor, texture and overall acceptance scores of several products produced with navy bean powder. Crackers produced with extruded navy bean powder received higher hedonic flavor ratings than those produced with commercial navy bean powder (P < 0.001). GC-O data showed that the commercial powder produced through conventional processing had much greater contents of several aliphatic aldehydes commonly formed via lipid oxidation, such as hexanal, octanal and nonanal with descriptors of 'grassy', 'nutty', 'fruity', 'dusty', and 'cleaner', compared to the extruded powder. Extrusion processed navy bean powders were preferred over commercial powders for certain navy bean powder applications. This is best explained by substantial differences in aroma profiles of the two powders that may have been caused by lipid oxidation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  5. Prospective, Double-Blind Evaluation of Umbilicoplasty Techniques Using Conventional and Crowdsourcing Methods

    NARCIS (Netherlands)

    Veldhuisen, C.L. Van; Kamali, P.; Wu, W.; Becherer, B.E.; Sinno, H.H.; Ashraf, A.A.; Ibrahim, A.M.S.; Tobias, A.; Lee, B.T.; Lin, S.J.

    2017-01-01

    BACKGROUND: Umbilical reconstruction is an important component of deep inferior epigastric perforator (DIEP) flap breast reconstruction. This study evaluated the aesthetics of three different umbilical reconstruction techniques during DIEP flap breast reconstruction. METHODS: From January to April

  6. An overview on the conventional and nonconventional methods for manufacturing the metallic glasses

    Directory of Open Access Journals (Sweden)

    Axinte Eugen

    2017-01-01

    Full Text Available Metallic glasses (MGs, first discovered in 1959 at Caltech are currently among the most studied metallic materials. MGs called also glassy metals, amorphous metals, liquid metals, are considered to be among the materials of the future. The “classic” methods for industrialization of MGs are : end-casting in copper molds and protected environment, die forging , atomization for obtaining MG powder ,selective laser melting , imprinting in molds, thermoplastic shaping in the super-cooled temperature region. These methods are suitable for producing high value-added precision components but the problems still exists: expensive tools, limited lifetime of tools and the occurring of crystallization. Actually methods (thermoplastic shaping, casting and die forging are limited by the low flexibility of production and by higher costs of tools and accessories. More suitable methods are greatly desired to machine MGs for their wider applications.

  7. Treatment of children with Helicobacter pylori infection and malabsorption syndrome with probiotics: Comparison with conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Ndiaye, M F; Mbengue, M; Mbaye, P S; Diouf, S [Societe Senegalaise de Gasto-enterologie et d' hepatologie, Dakar (Senegal); Ghoos, Y [Labo. Digestie Absorptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    Helicobacter pylori infection is one of the most common bacterial infection (82 %) in Senegal where malnutrition is common in children (25 %). Our aims were to definite prevalence of H. pylori, to determine the relationship between Hp infection and undernourishment and to verify the efficiency of treatment with probiotic. In some studies a positive effect of Saccharomyces boulardii has been demonstrated against H. pylori. We have included healthy children 7 to 10 years of age. 108 out of 129 (84%) were H. pylori-positive by breath-test. Two groups were randomised. Group A was treated with ten days' standard triple therapy (Omeprazole 1 mg Kg/day in single day gift, Amoxycillin 50 mg/kg/two times per day and Clarithromycin 250 mg two times per day). Group B received probiotic (250 mg of Saccharomyces boulardii with 5g Inulin three times per day) for 3 months. Evaluation of treatment was done one month after the end of therapy. Seventy one children out of 110 (64.5%) had digestive symptoms in their medical history. The main signs were recurrent abdominal pain in 64 cases. BMI were less than 18.50 in all the children with H. pylori infection without other nutritional abnormaly. Eight children were eradicated after treatment seven in the group under conventional treatment (58%) and one in the group under probiotics (6%). We concluded that prevalence of H. pylori infection is very high in young children as of the 7 years' age in urban as in rural environments. Symptoms are not specific. No significant difference in the nutritional state is observed between H. pylori-positive and H. pylori-negative children. Treatment by probiotics does not seem to give efficient results for eradication of H. pylori. (author)

  8. Study of the magnetic microstructure of high-coercivity sintered SmCo5 permanent magnets with the conventional Bitter pattern technique and the colloid-SEM method

    International Nuclear Information System (INIS)

    Szmaja, Witold

    2007-01-01

    The magnetic microstructure of high-coercivity sintered SmCo 5 permanent magnets was studied with the conventional Bitter pattern technique, and also for the first time with the colloid-scanning electron microscopy (colloid-SEM) method. Both techniques were supported by digital image acquisition, enhancement and analysis. Thanks to this, it was possible to obtain high-contrast and clear images of the magnetic microstructure and to analyze them in detail, and consequently also to achieve improvements over earlier results. In the thermally demagnetized state the grains were composed of magnetic domains. On the surface perpendicular to the alignment axis, the main domains forming a maze pattern and surface reverse spikes were observed. Investigations on the surface parallel to the alignment axis, especially by the colloid-SEM technique, provided a detailed insight into the orientation of grains. The alignment of grains was good, but certainly not perfect; there were also strongly misaligned grains, although generally very rare. In most cases the domain structures within grains were independent of their neighbors, but in some cases (not so rare) the domain walls were observed to continue through the grain boundaries, indicating significant magnetostatic interaction between neighboring grains. Studies of the behavior of the magnetic microstructure under the influence of an external magnetic field, performed for the first time on the surface parallel to the alignment axis (with the conventional Bitter pattern method), showed that the domain walls move easily within the grains and that the magnetization reversal mechanism is mainly related to the nucleation and growth of reverse domains, i.e. that sintered SmCo 5 magnets are nucleation-dominated systems. Groupwise magnetization reversal of adjacent magnetically coupled grains was observed, an unfavorable effect for high-coercivity magnets. Images obtained by the colloid-SEM technique and the conventional Bitter pattern

  9. Conventional methods fail to measure cp(omega) of glass-forming liquids

    DEFF Research Database (Denmark)

    Christensen, Tage Emil; Olsen, Niels Boye; Dyre, Jeppe

    2007-01-01

    thermal-wave method does not measure the isobaric frequency-dependent specific heat cp(omega). This method rather measures a "longitudinal" frequency-dependent specific heat, a quantity defined and detailed here that is in between cp(omega) and cV(omega). This result means that no reliable wide......-frequency measurements of cp(omega) on liquids approaching the calorimetric glass transition exist. We briefly discuss consequences for experiment....

  10. Detection of Staphylococcus aureus among coagulase positive staphylococci from animal origin based on conventional and molecular methods

    Directory of Open Access Journals (Sweden)

    Nikolina Velizarova Rusenova

    2017-03-01

    Full Text Available The present study aimed to detect Staphylococcus aureus (S. aureus among other coagulase positive staphylococci from animal origin by using conventional methods (biochemical tests and latex agglutination and a molecular method, based on the nuc gene, as the gold standard and to assess the usefulness of these methods. For this purpose, total of 344 staphylococcal isolates were collected and analysed. A total of 156 isolates suspicious for S. aureus were detected by a conventional biochemical method – 88 from cows, 18 from goats, 7 from pigs, 17 from poultry, 7 from rabbits and 19 from dogs. The majority of S. aureus strains gave typical biochemical reactions with the exception of 30 (19.2% and 25 (16% that were VP negative and weak positive in fermenting mannitol, respectively. Twelve strains were found to be non-haemolytic (7.7% and four strains did not ferment trehalose (2.6%. Other staphylococci were identified as S. pseudintermedius (n = 103, S. hyicus (n = 23 and the rest were coagulase-negative staphylococci. Latex agglutination test resulted in rapid positive reactions with S. aureus with exception of 5 strains (3.2% from cow mastitis milk. Positive agglutination reactions were also established with S. pseudintermedius, and S. hyicus. PCR confirmed all strains that were preliminary identified as S. aureus by amplification of 270 bp fragment of nuc gene specific for this species. The atypical reactions in certain strains established in this study have shown that the precise detection of S. aureus from animal origin should be done by combination of conventional and molecular methods.

  11. Effects of conventional ozonation and electro-peroxone pretreatment of surface water on disinfection by-product formation during subsequent chlorination.

    Science.gov (United States)

    Mao, Yuqin; Guo, Di; Yao, Weikun; Wang, Xiaomao; Yang, Hongwei; Xie, Yuefeng F; Komarneni, Sridhar; Yu, Gang; Wang, Yujue

    2018-03-01

    The electro-peroxone (E-peroxone) process is an emerging ozone-based electrochemical advanced oxidation process that combines conventional ozonation with in-situ cathodic hydrogen peroxide (H 2 O 2 ) production for oxidative water treatment. In this study, the effects of the E-peroxone pretreatment on disinfection by-product (DBP) formation from chlorination of a synthetic surface water were investigated and compared to conventional ozonation. Results show that due to the enhanced transformation of ozone (O 3 ) to hydroxyl radicals (OH) by electro-generated H 2 O 2 , the E-peroxone process considerably enhanced dissolved organic carbon (DOC) abatement and significantly reduced bromate (BrO 3 - ) formation compared to conventional ozonation. However, natural organic matter (NOM) with high UV 254 absorbance, which is the major precursors of chlorination DBPs, was less efficiently abated during the E-peroxone process than conventional ozonation. Consequently, while both conventional ozonation and the E-peroxone process substantially reduced the formation of DBPs (trihalomethanes and haloacetic acids) during post-chlorination, higher DBP concentrations were generally observed during chlorination of the E-peroxone pretreated waters than conventional ozonation treated. In addition, because of conventional ozonation or the E-peroxone treatment, DBPs formed during post-chlorination shifted to more brominated species. The overall yields of brominated DBPs exhibited strong correlations with the bromide concentrations in water. Therefore, while the E-peroxone process can effectively suppress bromide transformation to bromate, it may lead to higher formation of brominated DBPs during post-chlorination compared to conventional ozonation. These results suggest that the E-peroxone process can lead to different DBP formation and speciation during water treatment trains compared to conventional ozonation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Comparative Analysis Of Conventional Method With Activity Based Costing In PT Mulia Sejati Gallery

    Directory of Open Access Journals (Sweden)

    Irma Nadia Erena

    2016-09-01

    Full Text Available The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data analysis. The results achieved are massive distortion between the calculations using traditional systems and activity based costing system. The conclusions of the whole thesis are activity-based costing system is considered more relevant than traditional systems that are currently used by the company.

  13. A Level Set Discontinuous Galerkin Method for Free Surface Flows

    DEFF Research Database (Denmark)

    Grooss, Jesper; Hesthaven, Jan

    2006-01-01

    We present a discontinuous Galerkin method on a fully unstructured grid for the modeling of unsteady incompressible fluid flows with free surfaces. The surface is modeled by embedding and represented by a levelset. We discuss the discretization of the flow equations and the level set equation...

  14. Method for Surface Scanning in Medical Imaging and Related Apparatus

    DEFF Research Database (Denmark)

    2015-01-01

    A method and apparatus for surface scanning in medical imaging is provided. The surface scanning apparatus comprises an image source, a first optical fiber bundle comprising first optical fibers having proximal ends and distal ends, and a first optical coupler for coupling an image from the image...

  15. Comparison of accuracies of an intraoral spectrophotometer and conventional visual method for shade matching using two shade guide systems.

    Science.gov (United States)

    Parameswaran, Vidhya; Anilkumar, S; Lylajam, S; Rajesh, C; Narayan, Vivek

    2016-01-01

    This in vitro study compared the shade matching abilities of an intraoral spectrophotometer and the conventional visual method using two shade guides. The results of previous investigations between color perceived by human observers and color assessed by instruments have been inconclusive. The objectives were to determine accuracies and interrater agreement of both methods and effectiveness of two shade guides with either method. In the visual method, 10 examiners with normal color vision matched target control shade tabs taken from the two shade guides (VITAPAN Classical™ and VITAPAN 3D Master™) with other full sets of the respective shade guides. Each tab was matched 3 times to determine repeatability of visual examiners. The spectrophotometric shade matching was performed by two independent examiners using an intraoral spectrophotometer (VITA Easyshade™) with five repetitions for each tab. Results revealed that visual method had greater accuracy than the spectrophotometer. The spectrophotometer; however, exhibited significantly better interrater agreement as compared to the visual method. While VITAPAN Classical shade guide was more accurate with the spectrophotometer, VITAPAN 3D Master shade guide proved better with visual method. This in vitro study clearly delineates the advantages and limitations of both methods. There were significant differences between the methods with the visual method producing more accurate results than the spectrophotometric method. The spectrophotometer showed far better interrater agreement scores irrespective of the shade guide used. Even though visual shade matching is subjective, it is not inferior and should not be underrated. Judicious combination of both techniques is imperative to attain a successful and esthetic outcome.

  16. A Predictive-Control-Based Over-Modulation Method for Conventional Matrix Converters

    DEFF Research Database (Denmark)

    Zhang, Guanguan; Yang, Jian; Sun, Yao

    2018-01-01

    To increase the voltage transfer ratio of the matrix converter and improve the input/output current performance simultaneously, an over-modulation method based on predictive control is proposed in this paper, where the weighting factor is selected by an automatic adjusting mechanism, which is able...... to further enhance the system performance promptly. This method has advantages like the maximum voltage transfer ratio can reach 0.987 in the experiments; the total harmonic distortion of the input and output current are reduced, and the losses in the matrix converter are decreased. Moreover, the specific...

  17. A continuous surface reconstruction method on point cloud captured from a 3D surface photogrammetry system

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wenyang [Department of Bioengineering, University of California, Los Angeles, California 90095 (United States); Cheung, Yam; Sabouri, Pouya; Arai, Tatsuya J.; Sawant, Amit [Department of Radiation Oncology, University of Texas Southwestern, Dallas, Texas 75390 (United States); Ruan, Dan, E-mail: druan@mednet.ucla.edu [Department of Bioengineering, University of California, Los Angeles, California 90095 and Department of Radiation Oncology, University of California, Los Angeles, California 90095 (United States)

    2015-11-15

    Purpose: To accurately and efficiently reconstruct a continuous surface from noisy point clouds captured by a surface photogrammetry system (VisionRT). Methods: The authors have developed a level-set based surface reconstruction method on point clouds captured by a surface photogrammetry system (VisionRT). The proposed method reconstructs an implicit and continuous representation of the underlying patient surface by optimizing a regularized fitting energy, offering extra robustness to noise and missing measurements. By contrast to explicit/discrete meshing-type schemes, their continuous representation is particularly advantageous for subsequent surface registration and motion tracking by eliminating the need for maintaining explicit point correspondences as in discrete models. The authors solve the proposed method with an efficient narrowband evolving scheme. The authors evaluated the proposed method on both phantom and human subject data with two sets of complementary experiments. In the first set of experiment, the authors generated a series of surfaces each with different black patches placed on one chest phantom. The resulting VisionRT measurements from the patched area had different degree of noise and missing levels, since VisionRT has difficulties in detecting dark surfaces. The authors applied the proposed method to point clouds acquired under these different configurations, and quantitatively evaluated reconstructed surfaces by comparing against a high-quality reference surface with respect to root mean squared error (RMSE). In the second set of experiment, the authors applied their method to 100 clinical point clouds acquired from one human subject. In the absence of ground-truth, the authors qualitatively validated reconstructed surfaces by comparing the local geometry, specifically mean curvature distributions, against that of the surface extracted from a high-quality CT obtained from the same patient. Results: On phantom point clouds, their method

  18. Performance evaluation of sea surface simulation methods for target detection

    Science.gov (United States)

    Xia, Renjie; Wu, Xin; Yang, Chen; Han, Yiping; Zhang, Jianqi

    2017-11-01

    With the fast development of sea surface target detection by optoelectronic sensors, machine learning has been adopted to improve the detection performance. Many features can be learned from training images by machines automatically. However, field images of sea surface target are not sufficient as training data. 3D scene simulation is a promising method to address this problem. For ocean scene simulation, sea surface height field generation is the key point to achieve high fidelity. In this paper, two spectra-based height field generation methods are evaluated. Comparison between the linear superposition and linear filter method is made quantitatively with a statistical model. 3D ocean scene simulating results show the different features between the methods, which can give reference for synthesizing sea surface target images with different ocean conditions.

  19. Alternative sintering methods compared to conventional thermal sintering for inkjet printed silver nanoparticle ink

    NARCIS (Netherlands)

    Niittynen, J.; Abbel, R.; Mäntysalo, M.; Perelaer, J.; Schubert, U.S.; Lupo, D.

    2014-01-01

    In this contribution several alternative sintering methods are compared to traditional thermal sintering as high temperature and long process time of thermal sintering are increasing the costs of inkjet-printing and preventing the use of this technology in large scale manufacturing. Alternative

  20. A comparison of new and conventional methods for quantification of tooth color

    NARCIS (Netherlands)

    Burgt, van der T.P.; Bosch, ten J.J.; Borsboom, P.C.F.; Kortsmit, W.J.P.M.

    1990-01-01

    Tooth color is caused by volume reflection, that is, passage of incident light through the tooth followed by backward emergence. This passage is concurrent with sideward displacement of photons that, in effect, influences the result of usual instrumental methods of determining tooth color. This

  1. Near infrared spectrometry for faecal fat measurement: comparison with conventional gravimetric and titrimetric methods.

    Science.gov (United States)

    Benini, L; Caliari, S; Guidi, G C; Vaona, B; Talamini, G; Vantini, I; Scuro, L A

    1989-01-01

    This investigation was aimed at comparing a new method for measuring faecal fat excretion, carried out with a semi-automated instrument by using near infrared analysis (NIRA), with the traditional titrimetric (Van de Kamer) and gravimetric (Sobel) methods. Near infrared analysis faecal fat was assayed on the three day stool collection from 118 patients (68 chronic pancreatitis, 19 organic diseases of the gastrointestinal tract, 19 alcoholic liver disease, 12 functional gastrointestinal disorders). A strict linear correlation was found between NIRA and both the titrimetric (r = 0.928, p less than 0.0001) and the gravimetric (r = 0.971, p less than 0.0001) methods. On homogenised faeces, a mean coefficient of variation of 2.1 (SD 1.71)% was found. Before homogenisation (where a mean coefficient of variation of 7% was found) accurate results were obtained when the mean of five measurements was considered. In conclusion, the assay of faecal fat excretion by the near infrared reflessometry appears a simple, rapid and reliable method for measuring steatorrhoea. PMID:2583563

  2. Rapid descriptive sensory methods – Comparison of Free Multiple Sorting, Partial Napping, Napping, Flash Profiling and conventional profiling

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Meinert, Lene

    2012-01-01

    is a modal restriction of Napping to specific sensory modalities, directing sensation and still allowing a holistic approach to products. The new methods are compared to Flash Profiling, Napping and conventional descriptive sensory profiling. Evaluations are performed by several panels of expert assessors......Two new rapid descriptive sensory evaluation methods are introduced to the field of food sensory evaluation. The first method, free multiple sorting, allows subjects to perform ad libitum free sortings, until they feel that no more relevant dissimilarities among products remain. The second method...... are applied for the graphical validation and comparisons. This allows similar comparisons and is applicable to single-block evaluation designs such as Napping. The partial Napping allows repetitions on multiple sensory modalities, e.g. appearance, taste and mouthfeel, and shows the average...

  3. A continuous surface reconstruction method on point cloud captured from a 3D surface photogrammetry system.

    Science.gov (United States)

    Liu, Wenyang; Cheung, Yam; Sabouri, Pouya; Arai, Tatsuya J; Sawant, Amit; Ruan, Dan

    2015-11-01

    To accurately and efficiently reconstruct a continuous surface from noisy point clouds captured by a surface photogrammetry system (VisionRT). The authors have developed a level-set based surface reconstruction method on point clouds captured by a surface photogrammetry system (VisionRT). The proposed method reconstructs an implicit and continuous representation of the underlying patient surface by optimizing a regularized fitting energy, offering extra robustness to noise and missing measurements. By contrast to explicit/discrete meshing-type schemes, their continuous representation is particularly advantageous for subsequent surface registration and motion tracking by eliminating the need for maintaining explicit point correspondences as in discrete models. The authors solve the proposed method with an efficient narrowband evolving scheme. The authors evaluated the proposed method on both phantom and human subject data with two sets of complementary experiments. In the first set of experiment, the authors generated a series of surfaces each with different black patches placed on one chest phantom. The resulting VisionRT measurements from the patched area had different degree of noise and missing levels, since VisionRT has difficulties in detecting dark surfaces. The authors applied the proposed method to point clouds acquired under these different configurations, and quantitatively evaluated reconstructed surfaces by comparing against a high-quality reference surface with respect to root mean squared error (RMSE). In the second set of experiment, the authors applied their method to 100 clinical point clouds acquired from one human subject. In the absence of ground-truth, the authors qualitatively validated reconstructed surfaces by comparing the local geometry, specifically mean curvature distributions, against that of the surface extracted from a high-quality CT obtained from the same patient. On phantom point clouds, their method achieved submillimeter

  4. Method for atmospheric pressure reactive atom plasma processing for surface modification

    Science.gov (United States)

    Carr, Jeffrey W [Livermore, CA

    2009-09-22

    Reactive atom plasma processing can be used to shape, polish, planarize and clean the surfaces of difficult materials with minimal subsurface damage. The apparatus and methods use a plasma torch, such as a conventional ICP torch. The workpiece and plasma torch are moved with respect to each other, whether by translating and/or rotating the workpiece, the plasma, or both. The plasma discharge from the torch can be used to shape, planarize, polish, and/or clean the surface of the workpiece, as well as to thin the workpiece. The processing may cause minimal or no damage to the workpiece underneath the surface, and may involve removing material from the surface of the workpiece.

  5. Evaluation of head and neck cancer with 18F-FDG PET: a comparison with conventional methods

    International Nuclear Information System (INIS)

    Kresnik, E.; Mikosch, P.; Gallowitsch, H.J.; Heinisch, M.; Unterweger, O.; Kumnig, G.; Gomez, I.; Lind, P.; Kogler, D.; Wieser, S.; Gruenbacher, G.; Raunik, W.

    2001-01-01

    The aim of this study was to evaluate the usefulness of 18 F-FDG PET in the diagnosis and staging of primary and recurrent malignant head and neck tumours in comparison with conventional imaging methods [including ultrasonography, radiography, computed tomography (CT) and magnetic resonance imaging (MRI)], physical examination, panendoscopy and biopsies in clinical routine. A total of 54 patients (13 female, 41 male, age 61.3±12 years) were investigated retrospectively. Three groups were formed. In group I, 18 F-FDG PET was performed in 15 patients to detect unknown primary cancers. In group II, 24 studies were obtained for preoperative staging of proven head and neck cancer. In group III, 18 F-FDG PET was used in 15 patients to monitor tumour recurrence after radiotherapy and/or chemotherapy. In all patients, imaging was obtained at 70 min after the intravenous administration of 180 MBq 18 F-FDG. In 11 of the 15 patients in group I, the primary cancer could be found with 18 F-FDG, yielding a detection rate of 73.3%. In 4 of the 15 patients, CT findings were also suggestive of the primary cancer but were nonetheless equivocal. In these patients, 18 F-FDG showed increased 18 F-FDG uptake by the primary tumour, which was confirmed by histology. One patient had recurrence of breast carcinoma that could not be detected with 18 F-FDG PET, but was detected by CT. In three cases, the primary cancer could not be found with any imaging method. Among the 24 patients in group II investigated for staging purposes, 18 F-FDG PET detected a total of 13 local and three distant lymph node metastases, whereas the conventional imaging methods detected only nine local and one distant lymph node metastases. The results of 18 F-FDG PET led to an upstaging in 5/24 (20.8%) patients. The conventional imaging methods were false positive in 5/24 (20.8%). There was one false positive result using 18 F-FDG PET. Among the 15 patients of group III with suspected recurrence after radiotherapy

  6. MANIKIN DEMONSTRATION IN TEACHING CONSERVATIVE MANAGEMENT OF POSTPARTUM HAEMORRHAGE: A COMPARISON WITH CONVENTIONAL METHODS

    Directory of Open Access Journals (Sweden)

    Sathi Mangalam Saraswathi

    2016-07-01

    Full Text Available BACKGROUND Even though there are many innovative methods to make classes more interesting and effective, in my department, topics are taught mainly by didactic lectures. This study attempts to compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of post-partum haemorrhage. OBJECTIVE To compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of postpartum haemorrhage. MATERIALS AND METHODS This is an observational study. Eighty four ninth-semester MBBS students posted in Department of Obstetrics and Gynaecology, Government Medical College, Kottayam were selected. They were divided into 2 groups by lottery method. Pre-test was conducted for both groups. Group A was taught by manikin demonstration. Group B was taught by didactic lecture. Feedback response from the students collected after demonstration class was analysed. Post-test was conducted for both the groups after one week. Gain in knowledge of both the groups were calculated from pre-test and post-test scores and compared by Independent sample t test. RESULTS The mean gain in knowledge in group A was 6.4 when compared to group B which is 4.3 and the difference was found to be statistically significant. All of the students in group A felt satisfied and more confident after the class and wanted more topics to be taken by demonstration. CONCLUSION Manikin demonstration class is more effective in teaching conservative management of post-partum haemorrhage and this method can be adopted to teach similar topics in clinical subjects.

  7. Dry matter genotypes of Cynodon by microwave and conventional oven methods

    Directory of Open Access Journals (Sweden)

    Euclides Reuter de Oliveira

    2013-02-01

    Full Text Available The aimed of this work was to comparing the drying process in a microwave oven and forced air ventilation, as well as their effects on the chemical composition of different genotypes of the genus Cynodon (Tifton 85, Jiggs, Russell, Tifton 68 and Vaquero collected at different ages cutting (28, 48, 63 and 79 days. The experimental design was a randomized block in a split-plot design, with 4 replicates. There was no difference (P>0.05 between the methods analyzed on the chemical composition of the genotypes studied. Increasing age cutoff negatively influenced (P<0.05 the crude protein content of the different plant parts. A significant increase (P<0.05 of dry matter, neutral detergent fiber, acid detergent fiber and dry matter production was observed with increasing age cut. The use of the microwave oven is a quick and precise method obtain the dry matter content of the fodder showing efficiency similar to the method of drying in an oven with forced air circulation. The genotypes showed better chemical composition results when handled at age 28 days.

  8. Comparison of conventional and bio-treated methods as dust suppressants.

    Science.gov (United States)

    Naeimi, Maryam; Chu, Jian

    2017-10-01

    Dust is an environmental, geotechnical, health, and economical hazard. Fugitive dust emanating along transportation systems such as roads, railways, and airports especially can have significant impacts on health, safety, material loss, cost of maintenance, and interfere with the facilities. Quantitative studies on the effectiveness of the proper dust palliatives and their environmental impact have been studied with a number of biological and chemical methods. The objective of this study was to establish a method for using the microbial Induced calcium carbonate precipitation (MICP) approach to reduce the percent of mass loss against erosive force of wind regarding to the concentration and characteristics of aggregate used, climate, and traffic amounts. The results of this study showed that the required precipitation for dust control of sand by 70% is less than 15 g CaCO 3 /m 2 between sand grains in bio-treated sand. The wind tunnel test results of this study also indicate that the effectiveness of the bio-treatment method for dust control depends on many variables, such as the percent of precipitated calcium carbonate and tensile strength.

  9. Comparison of conventional versus Hybrid knife peroral endoscopic myotomy methods for esophageal achalasia: a case-control study.

    Science.gov (United States)

    Tang, Xiaowei; Gong, Wei; Deng, Zhiliang; Zhou, Jieqiong; Ren, Yutang; Zhang, Qiang; Chen, Zhenyu; Jiang, Bo

    2016-01-01

    Peroral endoscopic myotomy (POEM) has been developed to treat achalasia as a novel less invasive modality. We aimed to compare the efficacy and safety of conventional knife versus Hybrid knife (HK) during POEM procedure. Between June 2012 and July 2014, 31 patients underwent POEM using HK in our department (HK group), and 36 patients underwent POEM using conventional method (injection needle and triangular tip [TT] knife, TT group). Procedure-related parameters, symptom relief, adverse events were compared between two groups. There were no significant differences in the age, sex and other baseline characteristics between the two groups. The mean procedural time was significantly shorter in HK group than TT group (53.0 ± 17.2 vs. 67.6 ± 28.4 min, p = 0.015). The mean frequency of devices exchange was 4.7 ± 1.7 in HK group and 10.9 ± 1.8 in TT group (p = 0.000). No serious adverse events occurred postoperatively in both groups. At one-year follow-up, a total of 94% treatment success was achieved in all patients (93.5% in HK group and 94.4% in TT group, p = 0.877). HK in POEM can shorten the procedural time, and achieve similar treatment success compared to conventional TT knife.

  10. Has the ThinPrep method of cervical screening maintained its improvement over conventional smears in terms of specimen adequacy?

    LENUS (Irish Health Repository)

    Treacy, A

    2009-04-01

    Liquid-based cytology (LBC) has replaced conventional smear assessment in many centers over recent years. In our laboratory this transfer took place in 1999. At that time we performed a split sample study comparing the conventional method of cervical smear evaluation with the ThinPrep system. This split sample study identified a dramatic improvement in specimen adequacy with LBC. While 11% of conventional preparations were reported as unsatisfactory and almost 9% were reported as suboptimal, evaluation of the same cases using LBC saw this combined figure reduced to 2.3%. AIM: To evaluate whether this dramatic fall in unsatisfactory smears has been maintained with the use of LBC. The database for all smears reported for 2005 (100% LBC) was interrogated. The number of unsatisfactory reports was calculated. The reason for an unsatisfactory report was recorded for each case. The overall unsatisfactory rate was compared with that reported in the 1999 split sample study. A total of 41,312 smear tests were reported in 2005. 1,342 (3.25%) were reported as unsatisfactory. Our findings support the ongoing value of LBC in a routine cervical screening laboratory in terms of continuing to maintain a low rate of unsatisfactory smears.

  11. Exploring the Leishmania Hydrophilic Acylated Surface Protein B (HASPB) Export Pathway by Live Cell Imaging Methods.

    Science.gov (United States)

    MacLean, Lorna; Price, Helen; O'Toole, Peter

    2016-01-01

    Leishmania major is a human-infective protozoan parasite transmitted by the bite of the female phlebotomine sand fly. The L. major hydrophilic acylated surface protein B (HASPB) is only expressed in infective parasite stages suggesting a role in parasite virulence. HASPB is a "nonclassically" secreted protein that lacks a conventional signal peptide, reaching the cell surface by an alternative route to the classical ER-Golgi pathway. Instead HASPB trafficking to and exposure on the parasite plasma membrane requires dual N-terminal acylation. Here, we use live cell imaging methods to further explore this pathway allowing visualization of key events in real time at the individual cell level. These methods include live cell imaging using fluorescent reporters to determine the subcellular localization of wild type and acylation site mutation HASPB18-GFP fusion proteins, fluorescence recovery after photobleaching (FRAP) to analyze the dynamics of HASPB in live cells, and live antibody staining to detect surface exposure of HASPB by confocal microscopy.

  12. Laser method of acoustical emission control from vibrating surfaces

    Science.gov (United States)

    Motyka, Zbigniew

    2013-01-01

    For limitation of the noise in environment, the necessity occurs of determining and location of sources of sounds emitted from surfaces of many machines and devices, assuring in effect the possibility of suitable constructional changes implementation, targeted at decreasing of their nuisance. In the paper, the results of tests and calculations are presented for plane surface sources emitting acoustic waves. The tests were realized with the use of scanning laser vibrometer which enabled remote registration and the spectral analysis of the surfaces vibrations. The known hybrid digital method developed for determination of sound wave emission from such surfaces divided into small finite elements was slightly modified by distinguishing the phase correlations between such vibrating elements. The final method being developed may find use in wide range of applications for different forms of vibrations of plane surfaces.

  13. A GPU-based mipmapping method for water surface visualization

    Science.gov (United States)

    Li, Hua; Quan, Wei; Xu, Chao; Wu, Yan

    2018-03-01

    Visualization of water surface is a hot topic in computer graphics. In this paper, we presented a fast method to generate wide range of water surface with good image quality both near and far from the viewpoint. This method utilized uniform mesh and Fractal Perlin noise to model water surface. Mipmapping technology was enforced to the surface textures, which adjust the resolution with respect to the distance from the viewpoint and reduce the computing cost. Lighting effect was computed based on shadow mapping technology, Snell's law and Fresnel term. The render pipeline utilizes a CPU-GPU shared memory structure, which improves the rendering efficiency. Experiment results show that our approach visualizes water surface with good image quality at real-time frame rates performance.

  14. Life Cycle Assessment and Water Footprint of Hydrogen Production Methods: From Conventional to Emerging Technologies

    Directory of Open Access Journals (Sweden)

    Andi Mehmeti

    2018-02-01

    Full Text Available A common sustainability issue, arising in production systems, is the efficient use of resources for providing goods or services. With the increased interest in a hydrogen (H2 economy, the life-cycle environmental performance of H2 production has special significance for assisting in identifying opportunities to improve environmental performance and to guide challenging decisions and select between technology paths. Life cycle impact assessment methods are rapidly evolving to analyze multiple environmental impacts of the production of products or processes. This study marks the first step in developing process-based streamlined life cycle analysis (LCA of several H2 production pathways combining life cycle impacts at the midpoint (17 problem-oriented and endpoint (3 damage-oriented levels using the state-of-the-art impact assessment method ReCiPe 2016. Steam reforming of natural gas, coal gasification, water electrolysis via proton exchange membrane fuel cell (PEM, solid oxide electrolyzer cell (SOEC, biomass gasification and reforming, and dark fermentation of lignocellulosic biomass were analyzed. An innovative aspect is developed in this study is an analysis of water consumption associated with H2 production pathways by life-cycle stage to provide a better understanding of the life cycle water-related impacts on human health and natural environment. For water-related scope, Water scarcity footprint (WSF quantified using Available WAter REmaining (AWARE method was applied as a stand-alone indicator. The paper discusses the strengths and weaknesses of each production pathway, identify the drivers of environmental impact, quantify midpoint environmental impact and its influence on the endpoint environmental performance. The findings of this study could serve as a useful theoretical reference and practical basis to decision-makers of potential environmental impacts of H2 production systems.

  15. Identification of Burkholderia spp. in the Clinical Microbiology Laboratory: Comparison of Conventional and Molecular Methods

    Science.gov (United States)

    van Pelt, Cindy; Verduin, Cees M.; Goessens, Wil H. F.; Vos, Margreet C.; Tümmler, Burkhard; Segonds, Christine; Reubsaet, Frans; Verbrugh, Henri; van Belkum, Alex

    1999-01-01

    Cystic fibrosis (CF) predisposes patients to bacterial colonization and infection of the lower airways. Several species belonging to the genus Burkholderia are potential CF-related pathogens, but microbiological identification may be complicated. This situation is not in the least due to the poorly defined taxonomic status of these bacteria, and further validation of the available diagnostic assays is required. A total of 114 geographically diverse bacterial isolates, previously identified in reference laboratories as Burkholderia cepacia (n = 51), B. gladioli (n = 14), Ralstonia pickettii (n = 6), B. multivorans (n = 2), Stenotrophomonas maltophilia (n = 3), and Pseudomonas aeruginosa (n = 11), were collected from environmental, clinical, and reference sources. In addition, 27 clinical isolates putatively identified as Burkholderia spp. were recovered from the sputum of Dutch CF patients. All isolates were used to evaluate the accuracy of two selective growth media, four systems for biochemical identification (API 20NE, Vitek GNI, Vitek NFC, and MicroScan), and three different PCR-based assays. The PCR assays amplify different parts of the ribosomal DNA operon, either alone or in combination with cleavage by various restriction enzymes (PCR-restriction fragment length polymorphism [RFLP] analysis). The best system for the biochemical identification of B. cepacia appeared to be the API 20NE test. None of the biochemical assays successfully grouped the B. gladioli strains. The PCR-RFLP method appeared to be the optimal method for accurate nucleic acid-mediated identification of the different Burkholderia spp. With this method, B. gladioli was also reliably classified in a separate group. For the laboratory diagnosis of B. cepacia, we recommend parallel cultures on blood agar medium and selective agar plates. Further identification of colonies with a Burkholderia phenotype should be performed with the API 20NE test. For final confirmation of species identities, PCR

  16. Accuracy and precision of 3 intraoral scanners and accuracy of conventional impressions: A novel in vivo analysis method.

    Science.gov (United States)

    Nedelcu, R; Olsson, P; Nyström, I; Rydén, J; Thor, A

    2018-02-01

    To evaluate a novel methodology using industrial scanners as a reference, and assess in vivo accuracy of 3 intraoral scanners (IOS) and conventional impressions. Further, to evaluate IOS precision in vivo. Four reference-bodies were bonded to the buccal surfaces of upper premolars and incisors in five subjects. After three reference-scans, ATOS Core 80 (ATOS), subjects were scanned three times with three IOS systems: 3M True Definition (3M), CEREC Omnicam (OMNI) and Trios 3 (TRIOS). One conventional impression (IMPR) was taken, 3M Impregum Penta Soft, and poured models were digitized with laboratory scanner 3shape D1000 (D1000). Best-fit alignment of reference-bodies and 3D Compare Analysis was performed. Precision of ATOS and D1000 was assessed for quantitative evaluation and comparison. Accuracy of IOS and IMPR were analyzed using ATOS as reference. Precision of IOS was evaluated through intra-system comparison. Precision of ATOS reference scanner (mean 0.6 μm) and D1000 (mean 0.5 μm) was high. Pairwise multiple comparisons of reference-bodies located in different tooth positions displayed a statistically significant difference of accuracy between two scanner-groups: 3M and TRIOS, over OMNI (p value range 0.0001 to 0.0006). IMPR did not show any statistically significant difference to IOS. However, deviations of IOS and IMPR were within a similar magnitude. No statistical difference was found for IOS precision. The methodology can be used for assessing accuracy of IOS and IMPR in vivo in up to five units bilaterally from midline. 3M and TRIOS had a higher accuracy than OMNI. IMPR overlapped both groups. Intraoral scanners can be used as a replacement for conventional impressions when restoring up to ten units without extended edentulous spans. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Evaluation of purity with its uncertainty value in high purity lead stick by conventional and electro-gravimetric methods.

    Science.gov (United States)

    Singh, Nahar; Singh, Niranjan; Tripathy, S Swarupa; Soni, Daya; Singh, Khem; Gupta, Prabhat K

    2013-06-26

    A conventional gravimetry and electro-gravimetry study has been carried out for the precise and accurate purity determination of lead (Pb) in high purity lead stick and for preparation of reference standard. Reference materials are standards containing a known amount of an analyte and provide a reference value to determine unknown concentrations or to calibrate analytical instruments. A stock solution of approximate 2 kg has been prepared after dissolving approximate 2 g of Pb stick in 5% ultra pure nitric acid. From the stock solution five replicates of approximate 50 g have been taken for determination of purity by each method. The Pb has been determined as PbSO4 by conventional gravimetry, as PbO2 by electro gravimetry. The percentage purity of the metallic Pb was calculated accordingly from PbSO4 and PbO2. On the basis of experimental observations it has been concluded that by conventional gravimetry and electro-gravimetry the purity of Pb was found to be 99.98 ± 0.24 and 99.97 ± 0.27 g/100 g and on the basis of Pb purity the concentration of reference standard solutions were found to be 1000.88 ± 2.44 and 1000.81 ± 2.68 mg kg-1 respectively with 95% confidence level (k = 2). The uncertainty evaluation has also been carried out in Pb determination following EURACHEM/GUM guidelines. The final analytical results quantifying uncertainty fulfills this requirement and gives a measure of the confidence level of the concerned laboratory. Gravimetry is the most reliable technique in comparison to titremetry and instrumental method and the results of gravimetry are directly traceable to SI unit. Gravimetric analysis, if methods are followed carefully, provides for exceedingly precise analysis. In classical gravimetry the major uncertainties are due to repeatability but in electro-gravimetry several other factors also affect the final results.

  18. In situ surface roughness measurement using a laser scattering method

    Science.gov (United States)

    Tay, C. J.; Wang, S. H.; Quan, C.; Shang, H. M.

    2003-03-01

    In this paper, the design and development of an optical probe for in situ measurement of surface roughness are discussed. Based on this light scattering principle, the probe which consists of a laser diode, measuring lens and a linear photodiode array, is designed to capture the scattered light from a test surface with a relatively large scattering angle ϕ (=28°). This capability increases the measuring range and enhances repeatability of the results. The coaxial arrangement that incorporates a dual-laser beam and a constant compressed air stream renders the proposed system insensitive to movement or vibration of the test surface as well as surface conditions. Tests were conducted on workpieces which were mounted on a turning machine that operates with different cutting speeds. Test specimens which underwent different machining processes and of different surface finish were also studied. The results obtained demonstrate the feasibility of surface roughness measurement using the proposed method.

  19. Comparison of conventional and nuclear-medical examination methods in the field of nephro-urology

    International Nuclear Information System (INIS)

    Pfannenstiel, P.

    1975-07-01

    Main part of this study is a further simplification of the 131 I-hippuran total body clearance, a method which was first described by Oberhausen (1968). As a result of the study the clearance can now be calculated with only one scintillation detector after i.v. injection of 131 I-hippuran. Essential for this simplification is the exact localisation of the detector at the right or left shoulder region of the patient. The unilateral clearance is calculated from the total body clearance in conjunction with the simultaneously registered isotope renogram. This method was routinely applied to 4,138 patients during November 15th 1971 and March 31st 1975. In special groups of patients sequential renal studies with the gamma-camera, renal rectilinear scans, xenon-133-washout curves from the kidneys and radioimmuno-assays of angiotensin were performed for comparison. All data were analysed in view of other clinical and radiological data. Recommendations for rational procedures in diagnosis and control of therapy of the most common nephro-urological disorders were derived from a joint study of 16 hospitals analysing 1,979 cases. (orig.) [de

  20. Comparison of conventional culture methods and two commercial enzyme immunoassays for detection of Salmonella in porcine fecal samples and cecal contents

    DEFF Research Database (Denmark)

    Wegener, Henrik Caspar; Baggesen, Dorte Lau

    1997-01-01

    Two commercial enzyme immunoassays, designated EIA-1 and EIA-2, for the detection of salmonella in feces and cecal contents were compared to conventional culture methods. Out of 362 cecal content samples, 35 were positive by EIA-1 and 30 were positive by EIA-2 and conventional methods. Out of 189...

  1. Comparison of Polyacetylene Content in Organically and Conventionally Grown Carrots Using a Fast Ultrasonic Liquid Extraction Method

    DEFF Research Database (Denmark)

    Søltoft, Malene; Eriksen, Morten Rosbjørn; Träger, Anne Wibe Brændholt

    2010-01-01

    deviations (RSDs) of 2.3−3.6%], and recovery (93% of falcarindiol) of the polyacetylenes. The applicability of the method was documented by comparative analyses of carrots grown organically or conventionally in a 2 year field trial study. The average concentrations of falcarindiol, falcarindiol-3-acetate......, and falcarinol in year 1 were 222, 30, and 94 μg of falcarindiol equiv/g of dry weight, respectively, and 3−15% lower in year 2. The concentrations were not significantly influenced by the growth system, but a significant year−year variation was observed for falcarindiol-3-acetate....

  2. Kinetics study of hydrochlorothiazide lactose liquid state interaction using conventional isothermal arrhenius method under basic and neutral conditions

    Directory of Open Access Journals (Sweden)

    Faranak Ghaderi

    Full Text Available ABSTRACT The Maillard reaction of hydrochlorothiazide (HCTZ and lactose has been previously demonstrated in pharmaceutical formulations. In this study, the activation energy of - hydrohlorothiazide and lactose interaction in the liquid state was ascertained under basic and neutral conditions. Conventional isothermal High Performance Liquid Chromatography (HPLC technique was employed to ascertain the kinetic parameters using Arrhenius method. Results: The activation energy obtained was 82.43 and 100.28 kJ/mol under basic and neutral conditions, respectively. Consequently, it can be inferred that Maillard reaction is significantly affected by pH, which can be used as a control factor whenever the reaction potentially occurs.

  3. Facile Method for Fabricating Superhydrophobic Surface on Magnesium

    Energy Technology Data Exchange (ETDEWEB)

    Han, Mun Hee; Park, Yeon Hwa; Hyun, June Won; Ahn, Yong Hyun [Dankook Univ., Yongin (Korea, Republic of)

    2010-04-15

    In conclusion, we have developed a simple and inexpensive method for fabricating a superhydrophobic surface of magnesium by metal deposition and stearic acid coating. We fabricated a superhydrophobic surface on magnesium by nickel deposition and surface coating of stearic acid. The fabricated surfaces were stable against acidic and basic solutions. In recent times, technologies based on the imitation of nature have attracted considerable attention. Lotus leaves are known for their self-cleaning effect. The micrometer-scale papillae structure and the epicuticular wax on the lotus leaf contribute to this effect. In a manner similar to the self-cleaning property of lotus leaves, the wettability of solid surfaces is of great interest in daily life and industry.1-4 Wettability is controlled by both the geometrical structure of a surface and a low surface energy material coating. A superhydrophobic surface is satisfied with a water contact angle of more than 150 .deg. and a sliding angle of less than 10 .deg. On such a surface, a water drop has a perfectly spherical shape and it easily rolls off and removes deposited contaminants. A superhydrophobic surface thus protects a material from contamination, fogging, and snow deposition.

  4. Neutron activation analysis of archaeological artifacts using the conventional relative method: a realistic approach for analysis of large samples

    International Nuclear Information System (INIS)

    Bedregal, P.S.; Mendoza, A.; Montoya, E.H.; Cohen, I.M.; Universidad Tecnologica Nacional, Buenos Aires; Oscar Baltuano

    2012-01-01

    A new approach for analysis of entire potsherds of archaeological interest by INAA, using the conventional relative method, is described. The analytical method proposed involves, primarily, the preparation of replicates of the original archaeological pottery, with well known chemical composition (standard), destined to be irradiated simultaneously, in a well thermalized external neutron beam of the RP-10 reactor, with the original object (sample). The basic advantage of this proposal is to avoid the need of performing complicated effect corrections when dealing with large samples, due to neutron self shielding, neutron self-thermalization and gamma ray attenuation. In addition, and in contrast with the other methods, the main advantages are the possibility of evaluating the uncertainty of the results and, fundamentally, validating the overall methodology. (author)

  5. Expanded image database of pistachio x-ray images and classification by conventional methods

    Science.gov (United States)

    Keagy, Pamela M.; Schatzki, Thomas F.; Le, Lan Chau; Casasent, David P.; Weber, David

    1996-12-01

    In order to develop sorting methods for insect damaged pistachio nuts, a large data set of pistachio x-ray images (6,759 nuts) was created. Both film and linescan sensor images were acquired, nuts dissected and internal conditions coded using the U.S. Grade standards and definitions for pistachios. A subset of 1199 good and 686 insect damaged nuts was used to calculate and test discriminant functions. Statistical parameters of image histograms were evaluated for inclusion by forward stepwise discrimination. Using three variables in the discriminant function, 89% of test set nuts were correctly identified. Comparable data for 6 human subjects ranged from 67 to 92%. If the loss of good nuts is held to 1% by requiring a high probability to discard a nut as insect damaged, approximately half of the insect damage present in clean pistachio nuts may be detected and removed by x-ray inspection.

  6. Comparison of E-test with other conventional susceptibility testing methods for ciprofloxacin and gentamicin against gram negative enteric bacilli.

    Science.gov (United States)

    Ogbolu, D O; Terry-Alli, O A; Daini, O A; Olabiyi, F A; Igharo, E A

    2012-06-01

    Increasing antibiotic resistance in Gram negative bacteria has led to the need for a faster and reliable method for determining antimicrobial susceptibility testing. In a resource poor setting like ours, it's also important to look for methods that will be clinically and economically beneficial to the patient. This study was aimed at evaluating the Epsilometer test (E-test) and conventional methods for determining antimicrobial susceptibility of isolates of Gram-negative enteric bacteria to ciprofloxacin and gentamicin. Disc diffusion, E-test, broth dilution and agar dilution methods were performed on 54 bacterial isolates. Using the E-test, 88.9% of bacterial isolates were resistant to ciprofloxacin, 92.6% were resistant using broth microdilution, 96.3% were resistant using agar dilution and 72.2% were resistant using disc diffusion. Minimum inhibitory concentration (MIC50) of isolates for gentamicin showed significant difference for all the techniques (p 0.05). Both E-test and broth dilution methods showed high levels of agreement (p > 0.05), there were low levels of agreement between E-test and agar dilution method (p < 0.05), especially at MIC50. The E-test can therefore be considered a reliable method to determine antimicrobial susceptibility testing and it gives results which are at least as accurate as those obtained by the broth dilution method.

  7. Hybrid of Natural Element Method (NEM with Genetic Algorithm (GA to find critical slip surface

    Directory of Open Access Journals (Sweden)

    Shahriar Shahrokhabadi

    2014-06-01

    Full Text Available One of the most important issues in geotechnical engineering is the slope stability analysis for determination of the factor of safety and the probable slip surface. Finite Element Method (FEM is well suited for numerical study of advanced geotechnical problems. However, mesh requirements of FEM creates some difficulties for solution processing in certain problems. Recently, motivated by these limitations, several new Meshfree methods such as Natural Element Method (NEM have been used to analyze engineering problems. This paper presents advantages of using NEM in 2D slope stability analysis and Genetic Algorithm (GA optimization to determine the probable slip surface and the related factor of safety. The stress field is produced under plane strain condition using natural element formulation to simulate material behavior analysis utilized in conjunction with a conventional limit equilibrium method. In order to justify the preciseness and convergence of the proposed method, two kinds of examples, homogenous and non-homogenous, are conducted and results are compared with FEM and conventional limit equilibrium methods. The results show the robustness of the NEM in slope stability analysis.

  8. A METHOD FOR POST-TREATMENT OF AN ARTICLE WITH A METALLIC SURFACE AS WELL AS A TREATMENT SOLUTION TO BE USED IN THE METHOD

    DEFF Research Database (Denmark)

    1993-01-01

    A method and a treatment solution for post-treatment of an article with a metallic surface, where the metallic surface is made of one or more metals of a standard oxidation potential within the range -2.5 to +0.5 V. A thin coating is formed on the metallic surface by a treatment with an aqueous...... conditions where the metal surface is maintained at a potential within the range of -600 and -1800 mV/nhe. A corrosion-protecting and/or decorative effect is obtained which can be compared with the effect obtained by conventional chromate treatment, and which avoids the environmental and toxicologic...

  9. Seismic data enhancement with Common Reflection Surface (CRS) stack method

    Energy Technology Data Exchange (ETDEWEB)

    Baykulov, M.; Brink, H.J.; Gajewski, D.; Yoon, Mi-Kyung [Hamburg Univ. (Germany). Inst. fuer Geophysik

    2008-10-23

    We present the results of partial stacking of prestack seismic reflection data based on the kinematic wavefield attributes computed during the automatic CRS stack. The resulting CRS supergathers are more regularised and have better signal to noise ratio compared to original CMP gathers. The improved data can be used in any conventional processing tool instead of the original data, providing enhanced images of better quality. The CRS supergather method is especially suited for low fold seismic reflection data. Application of the new method to synthetic and real low fold data shows a clear improvement of seismograms as well as time and depth-migrated sections. (orig.)

  10. The Second Zambian National Tuberculosis Drug Resistance survey - a comparison of conventional and molecular methods.

    Science.gov (United States)

    Kapata, Nathan; Mbulo, Grace; Cobelens, Frank; de Haas, Petra; Schaap, Ab; Mwamba, Pike; Mwanza, Winnie; Muvwimi, Mweemba; Muyoyeta, Monde; Moyo, Maureen; Mulenga, Lutinala; Grobusch, Martin P; Godfrey-Faussett, Peter; Ayles, Helen

    2015-11-01

    The prevalence of MDR-TB in Zambia was estimated to be 1.8% in 2001. A second drug resistance survey was conducted in 2008 to determine trends; the use of the Genotype MTBDRplus assay was applied to compare results to the gold standard. A two-stage cluster sampling, with health facilities as primary sampling units. Processed sputum specimens were inoculated on solid media for culture; heat-inactivated bacterial suspensions from sputum samples were tested on a commercial line probe assay for the identification of rifampicin and isoniazid resistance. A total of 917 patients with TB were enrolled and 883 (96.3%) analysed. A total of 574 (65%) had LJ results and 824 (93.3%) had results from MTBDRplus assay. The median age was 32, and 63.3% were males. MDR-TB according to LJ-based DST was 1.1% (CI 0.1-2.4) whereas according to MDTBDRplus assay was 1.6% (CI 0.6-2.6). Isoniazid monoresistance in new cases was 2.4% (CI 0.613-4.26) based on LJ results and 5.0% (CI 3.2-6.7) based on the MTBDRplus; in retreatment cases, it was 4.4% (CI 0.3-8.6) and 2.40% (CI <0.1-5.1) on LJ and MTBDRplus, respectively. Rifampicin monoresistance in new cases was 0.1% (CI <0.1-0.4) based on LJ and 0.6% (CI 0.01-1.1) based on the MTBDRplus; in retreatment cases, it was 0% (CI 0-3.8) and 1.8% (CI <0.1-4.0) on LJ and MTBDRplus, respectively. There were no XDR-TB cases found and no association between MDR-TB and HIV. There was no increase in MDR-TB prevalence in Zambia from 2001 to 2008; results from the two methods were similar. Molecular methods were quicker and simpler to use. © 2015 John Wiley & Sons Ltd.

  11. Response surface methodology: A non-conventional statistical tool to maximize the throughput of Streptomyces species biomass and their bioactive metabolites.

    Science.gov (United States)

    Latha, Selvanathan; Sivaranjani, Govindhan; Dhanasekaran, Dharumadurai

    2017-09-01

    Among diverse actinobacteria, Streptomyces is a renowned ongoing source for the production of a large number of secondary metabolites, furnishing immeasurable pharmacological and biological activities. Hence, to meet the demand of new lead compounds for human and animal use, research is constantly targeting the bioprospecting of Streptomyces. Optimization of media components and physicochemical parameters is a plausible approach for the exploration of intensified production of novel as well as existing bioactive metabolites from various microbes, which is usually achieved by a range of classical techniques including one factor at a time (OFAT). However, the major drawbacks of conventional optimization methods have directed the use of statistical optimization approaches in fermentation process development. Response surface methodology (RSM) is one of the empirical techniques extensively used for modeling, optimization and analysis of fermentation processes. To date, several researchers have implemented RSM in different bioprocess optimization accountable for the production of assorted natural substances from Streptomyces in which the results are very promising. This review summarizes some of the recent RSM adopted studies for the enhanced production of antibiotics, enzymes and probiotics using Streptomyces with the intention to highlight the significance of Streptomyces as well as RSM to the research community and industries.

  12. Effect of the irradiation of bacteria upon their survival rate during conventional methods of meat preservation

    International Nuclear Information System (INIS)

    Szczawinska, M.

    1981-01-01

    The purpose of this paper is to define the effect of irradiation upon the survival rate of non-sporing bacteria (Staphylococcus aureus, Salmonella typhimurium, Escherichia coli, Pseudomonas fluorescens) during basic methods of meat preservation. The bacteria were irradiated in broth by X-rays at a dose that destroyed about 90% of the bacteria (D 10 ). The survival rate of unirradiated and irradiated bacteria during cooling and freezing, in solutions of sodium chloride, nitrates and liquid smoke, was defined. The number of microorganisms was determined directly after irradiation as well as 1, 3, 7, 14, 21 and 28 days after irradiation. The effect of irradiation upon heat resistance of the examined species of bacteria was also defined. The microorganisms were heated in broth, at 70 0 C for 1, 2 and 5 minutes. The obtained results were subjected to statistical analysis. On the basis of the research results, a faster dying rate of irradiated populations of S. aureus and E. coli during any type of preservation treatment, the lack of any reaction to irradiation regarding the survival rate of S. typhimurium, and the lack of any effect of irradiation upon the rate of deterioration of P. fluorescens during freezing and storage in a solution with 10% addition of NaCI, were observed. On the other hand, a pronounced effect of irradiation upon the lowering of the heat resistance of the bacteria, as well as delayed growth in other variants of the experiment, was determined. (author)

  13. Modified prepubic TVT-obturator tape procedure versus the conventional method: a preliminary study.

    Science.gov (United States)

    Long, Cheng-Yu; Wu, Ming-Ping; Wang, Chiu-Lin; Lin, Kun-Ling; Liu, Cheng-Min; Wu, Shu-Hui; Juan, Yung-Shun

    2013-12-01

    To compare the efficacy and safety of the modified prepubic tension-free vaginal tape-obturator (PTVT-O) system procedure with the original TVT-O methods. One hundred and ninety women with urodynamic stress incontinence (USI) were included in this study (93 cases in the TVT-O group and 97 in the PTVT-O group). Clinical assessments before and one year after surgery included urinalyses, 1-h pad tests, urodynamic studies, and a personal interview with the overactive bladder symptom score (OABSS) questionnaire. There were no differences between the two groups in mean age, parity, menopausal status, mean operative time and subjective cure rates (P>0.05), but the efficacy of surgery (cure and improvement) in the PTVT-O group was significantly higher than that in the TVT-O group (P=0.038). Complication rates and visual analog scale (VAS) scores were found to be similar (P>0.05). OABSS decreased significantly after surgery in both groups (P0.05). Our modified procedure is a safe and effective treatment for female USI. It has an advantage over the original TVT-O with better surgical efficacy and comparable postoperative pain, although the follow-up times in this study are different. Copyright © 2013. Published by Elsevier Ireland Ltd.

  14. Use of non-conventional cell disruption method for extraction of proteins from black yeasts

    Directory of Open Access Journals (Sweden)

    Maja eLeitgeb

    2016-04-01

    Full Text Available The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2 by varying pressure at fixed temperature (35 °C. The black yeasts cell walls were disrupted and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV-Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2 treated cells. The advantages of the proposed method are in a simple use which is also possible for heat sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions.

  15. Use of Non-Conventional Cell Disruption Method for Extraction of Proteins from Black Yeasts

    Science.gov (United States)

    Čolnik, Maja; Primožič, Mateja; Knez, Željko; Leitgeb, Maja

    2016-01-01

    The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum, and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2) by varying pressure at fixed temperature (35°C). The black yeasts cell walls were disrupted, and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase, and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV–Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2-treated cells. The advantages of the proposed method are in a simple use, which is also possible for heat-sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions. PMID:27148527

  16. Free-surface viscous flow solution methods for ship hydrodynamics

    NARCIS (Netherlands)

    Wackers, J.; Koren, B.; Raven, H.C.; Ploeg, van der A.; Starke, A.R.; Deng, G.; Queutey, P.; Visonneau, M.; Hino, T.; Ohashi, K.

    2011-01-01

    The simulation of viscous free-surface water flow is a subject that has reached a certain maturity and is nowadays used in industrial applications, like the simulation of the flow around ships. While almost all methods used are based on the Navier-Stokes equations, the discretisation methods for the

  17. Familiarity Vs Trust: A Comparative Study of Domain Scientists' Trust in Visual Analytics and Conventional Analysis Methods.

    Science.gov (United States)

    Dasgupta, Aritra; Lee, Joon-Yong; Wilson, Ryan; Lafrance, Robert A; Cramer, Nick; Cook, Kristin; Payne, Samuel

    2017-01-01

    Combining interactive visualization with automated analytical methods like statistics and data mining facilitates data-driven discovery. These visual analytic methods are beginning to be instantiated within mixed-initiative systems, where humans and machines collaboratively influence evidence-gathering and decision-making. But an open research question is that, when domain experts analyze their data, can they completely trust the outputs and operations on the machine-side? Visualization potentially leads to a transparent analysis process, but do domain experts always trust what they see? To address these questions, we present results from the design and evaluation of a mixed-initiative, visual analytics system for biologists, focusing on analyzing the relationships between familiarity of an analysis medium and domain experts' trust. We propose a trust-augmented design of the visual analytics system, that explicitly takes into account domain-specific tasks, conventions, and preferences. For evaluating the system, we present the results of a controlled user study with 34 biologists where we compare the variation of the level of trust across conventional and visual analytic mediums and explore the influence of familiarity and task complexity on trust. We find that despite being unfamiliar with a visual analytic medium, scientists seem to have an average level of trust that is comparable with the same in conventional analysis medium. In fact, for complex sense-making tasks, we find that the visual analytic system is able to inspire greater trust than other mediums. We summarize the implications of our findings with directions for future research on trustworthiness of visual analytic systems.

  18. Surface Enrichment by Conventional and Polymerizable Sulfated Nonylphenol Ethoxylate Emulsifiers in Water-Based Pressure-Sensitive Adhesive

    Science.gov (United States)

    Jilin Zhang; Yuxi Zhao; Matthew R. Dubay; Steven J. Severtson; Larry E. Gwin; Carl J. Houtman

    2013-01-01

    Comparisons of properties are made for pressure-sensitive adhesives (PSAs) generated via emulsion polymerization using both conventional and reactive emulsifiers. The emulsifiers are ammonium salts of sulfated nonylphenol ethoxylates with similar chemical structures and hydrophilic−lipophilic balances. The polymerizable surfactant possesses a reactive double...

  19. Conventional methods and emerging wastewater polishing technologies for palm oil mill effluent treatment: a review.

    Science.gov (United States)

    Liew, Wai Loan; Kassim, Mohd Azraai; Muda, Khalida; Loh, Soh Kheang; Affam, Augustine Chioma

    2015-02-01

    The Malaysian palm oil industry is a major revenue earner and the country is ranked as one of the largest producers in the world. However, growth of the industry is synonymous with a massive production of agro-industrial wastewater. As an environmental protection and public health concern, the highly polluting palm oil mill effluent (POME) has become a major attention-grabber. Hence, the industry is targeting for POME pollution abatement in order to promote a greener image of palm oil and to achieve sustainability. At present, most palm oil mills have adopted the ponding system for treatment. Due to the successful POME pollution abatement experiences, Malaysia is currently planning to revise the effluent quality standards towards a more stringent discharge limits. Hence, the current trend of POME research focuses on developing tertiary treatment or polishing systems for better effluent management. Biotechnologically-advanced POME tertiary (polishing) technologies as well as other physicochemical methods are gaining much attention as these processes are the key players to push the industry towards the goal of environmental sustainability. There are still ongoing treatment technologies being researched and the outcomes maybe available in a while. However, the research completed so far are compiled herein and reported for the first time to acquire a better perspective and insight on the subject with a view of meeting the new standards. To this end, the most feasible technology could be the combination of advanced biological processes (bioreactor systems) with extended aeration, followed by solids separation prior to discharge. Chemical dosing is favoured only if effluent of higher quality is anticipated. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Brunser, O; Cruchet, S; Gotteland, M; Verbeke, S [Gastroenterology Unit, Institute of Nutrition and Food Technology (INTA), University of Chile, Santiago (Chile)

    2000-07-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The {sup 13}C-urea breath test ({sup 13}C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the {sup 13}C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics.

  1. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Brunser, O.; Cruchet, S.; Gotteland, M.; Verbeke, S.

    2000-01-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The 13 C-urea breath test ( 13 C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the 13 C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics

  2. Supercritical CO2 Extracts and Volatile Oil of Basil (Ocimum basilicum L. Comparison with Conventional Methods

    Directory of Open Access Journals (Sweden)

    José Coelho

    2018-03-01

    Full Text Available Interest in new products from aromatic plants as medical and nutritional compounds is increasing. The aim of this work was to apply different extraction methods, including the use of supercritical carbon dioxide extraction, and to test the antioxidant activity of basil (Ocimum basilicum L. extracts. In vitro efficacy assessments were performed using enzymatic assays. Essential oil obtained by hydrodistillation and volatile oil obtained from supercritical fluid extraction were analyzed by gas chromatography to quantify components. The total phenolic content in the extracts ranged from 35.5 ± 2.9 to 85.3 ± 8.6 mg of gallic acid equivalents and the total flavonoid content ranged from 35.5 ± 2.9 to 93.3 ± 3.9 micromole catechin equivalents per gram of dry weight of extract. All the extracts showed an antioxidant activity with 2,2-diphenyl-1-picrylhydrazyl (DPPH, 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS, and the reducing power test. Extracts obtained from methanol had a higher antioxidant capacity per the DPPH test results (IC50 = 3.05 ± 0.36 mg/mL and the reducing power test assay 306.8 ± 21.8 μmol of trolox equivalents per gram of extract (TE/g compared with ethanolic or supercritical fluid extracts. However, using the ABTS assay, the extract obtained by supercritical fluid extraction had a higher antioxidant capacity with an IC50 of 1.74 ± 0.05 mg/mL. Finally, the examined extracts showed practically no acetylcholinesterase (AChE inhibitory capacity and a slight inhibitory activity against tyrosinase.

  3. Quantifying Uncertainty in Near Surface Electromagnetic Imaging Using Bayesian Methods

    Science.gov (United States)

    Blatter, D. B.; Ray, A.; Key, K.

    2017-12-01

    Geoscientists commonly use electromagnetic methods to image the Earth's near surface. Field measurements of EM fields are made (often with the aid an artificial EM source) and then used to infer near surface electrical conductivity via a process known as inversion. In geophysics, the standard inversion tool kit is robust and can provide an estimate of the Earth's near surface conductivity that is both geologically reasonable and compatible with the measured field data. However, standard inverse methods struggle to provide a sense of the uncertainty in the estimate they provide. This is because the task of finding an Earth model that explains the data to within measurement error is non-unique - that is, there are many, many such models; but the standard methods provide only one "answer." An alternative method, known as Bayesian inversion, seeks to explore the full range of Earth model parameters that can adequately explain the measured data, rather than attempting to find a single, "ideal" model. Bayesian inverse methods can therefore provide a quantitative assessment of the uncertainty inherent in trying to infer near surface conductivity from noisy, measured field data. This study applies a Bayesian inverse method (called trans-dimensional Markov chain Monte Carlo) to transient airborne EM data previously collected over Taylor Valley - one of the McMurdo Dry Valleys in Antarctica. Our results confirm the reasonableness of previous estimates (made using standard methods) of near surface conductivity beneath Taylor Valley. In addition, we demonstrate quantitatively the uncertainty associated with those estimates. We demonstrate that Bayesian inverse methods can provide quantitative uncertainty to estimates of near surface conductivity.

  4. Comparison of conventional methods for diagnosis of visceral leishmaniasis in children of the Center-West Region of Brazil

    Directory of Open Access Journals (Sweden)

    Yvone M. Brustoloni

    Full Text Available In Brazil, sophisticated techniques currently employed for diagnosis of visceral leishmaniasis, such as polymerase chain reaction-based assays, are only available in major research centers, whereas conventional methods are still used in many areas where the disease occurs. In the state of Mato Grosso do Sul, in the country's Center-West Region, visceral leishmaniasis has recently emerged in many cities, and duration of the disease, from the onset of symptoms to diagnosis, has been short. Considering that results of diagnostic tests may depend on the phase of the disease, we compared direct examination of bone marrow aspirates (BMAs, BMA culture, and serology by Indirect Immunofluorescence Antibody Test (IFAT for diagnosis in children, according to time of evolution (30 days and to spleen size ( 5 cm at admission. Duration of the illness did not interfere with test positivity: direct smear examination and IFAT were positive in more than 80% of patients, as was culture in around 60%. Results of positive microscopy, however, where predominant in patients with larger spleens. Thanks to the association of traditional techniques, only a few patients had to begin a treatment trial without confirming the diagnosis. Conventional methods for diagnosis of visceral leishmaniasis are still indispensable in our region, and training professionals in basic techniques should be incremented. The highest sensitivity in laboratory diagnosis among the cases investigated was that obtained with a combination of BMA direct examination and IFAT, nearing 100%.

  5. An Optimization Method for Virtual Globe Ocean Surface Dynamic Visualization

    Directory of Open Access Journals (Sweden)

    HUANG Wumeng

    2016-12-01

    Full Text Available The existing visualization method in the virtual globe mainly uses the projection grid to organize the ocean grid. This special grid organization has the defects in reflecting the difference characteristics of different ocean areas. The method of global ocean visualization based on global discrete grid can make up the defect of the projection grid method by matching with the discrete space of the virtual globe, so it is more suitable for the virtual ocean surface simulation application.But the available global discrete grids method has many problems which limiting its application such as the low efficiency of rendering and loading, the need of repairing grid crevices. To this point, we propose an optimization for the global discrete grids method. At first, a GPU-oriented multi-scale grid model of ocean surface which develops on the foundation of global discrete grids was designed to organize and manage the ocean surface grids. Then, in order to achieve the wind-drive wave dynamic rendering, this paper proposes a dynamic wave rendering method based on the multi-scale ocean surface grid model to support real-time wind field updating. At the same time, considering the effect of repairing grid crevices on the system efficiency, this paper presents an efficient method for repairing ocean surface grid crevices based on the characteristics of ocean grid and GPU technology. At last, the feasibility and validity of the method are verified by the comparison experiment. The experimental results show that the proposed method is efficient, stable and fast, and can compensate for the lack of function of the existing methods, so the application range is more extensive.

  6. Optical description and design method with annularly stitched aspheric surface.

    Science.gov (United States)

    Cheng, De-Wen; Chen, Xue-Jiao; Xu, Chen; Hu, Yuan; Wang, Yong-Tian

    2015-12-01

    The relentless pressure for designs with new optical functions, small volume, and light weight has greatly increased the importance of aspheric surfaces. In this paper, we propose an annularly stitched aspheric surface (ASAS) description method to increase the freedom and flexibility of imaging system design. The rotationally symmetric ASAS consists of a circular central zone and one or more annular zones. Two neighboring zones are constrained to have the same derivatives on their joint curve, and this means the ASAS is C1 continuous. This finding is proved and verified by the mathematical deduction of the surface formulas. Two optimization strategies and two design methods with the C1 continuous constraints are also discussed. This surface can greatly facilitate the design and even achieve some previously impossible designs without increasing the fabrication difficulty. Two different systems with the proposed ASAS are optimized and the results are presented. The design results verified the practicability of the ASAS.

  7. Experimental Method for Measuring Dust Load on Surfaces in Rooms

    DEFF Research Database (Denmark)

    Lengweiler, Philip; Nielsen, Peter V.; Moser, Alfred

    A new experimental setup to investigate the physical process of dust deposition and resuspension on and from surfaces is introduced. Dust deposition can reduce the airborne dust concentration considerably. As a basis for developing methods to eliminate dust-related problems in rooms, there is a n......A new experimental setup to investigate the physical process of dust deposition and resuspension on and from surfaces is introduced. Dust deposition can reduce the airborne dust concentration considerably. As a basis for developing methods to eliminate dust-related problems in rooms......, there is a need for better understanding of the mechanism of dust deposition and resuspension. With the presented experimental setup, the dust load on surfaces in a channel can be measured as a function of the environmental and surface conditions and the type of particles under controlled laboratory conditions....

  8. Multiscale Finite Element Methods for Flows on Rough Surfaces

    KAUST Repository

    Efendiev, Yalchin

    2013-01-01

    In this paper, we present the Multiscale Finite Element Method (MsFEM) for problems on rough heterogeneous surfaces. We consider the diffusion equation on oscillatory surfaces. Our objective is to represent small-scale features of the solution via multiscale basis functions described on a coarse grid. This problem arises in many applications where processes occur on surfaces or thin layers. We present a unified multiscale finite element framework that entails the use of transformations that map the reference surface to the deformed surface. The main ingredients of MsFEM are (1) the construction of multiscale basis functions and (2) a global coupling of these basis functions. For the construction of multiscale basis functions, our approach uses the transformation of the reference surface to a deformed surface. On the deformed surface, multiscale basis functions are defined where reduced (1D) problems are solved along the edges of coarse-grid blocks to calculate nodalmultiscale basis functions. Furthermore, these basis functions are transformed back to the reference configuration. We discuss the use of appropriate transformation operators that improve the accuracy of the method. The method has an optimal convergence if the transformed surface is smooth and the image of the coarse partition in the reference configuration forms a quasiuniform partition. In this paper, we consider such transformations based on harmonic coordinates (following H. Owhadi and L. Zhang [Comm. Pure and Applied Math., LX(2007), pp. 675-723]) and discuss gridding issues in the reference configuration. Numerical results are presented where we compare the MsFEM when two types of deformations are used formultiscale basis construction. The first deformation employs local information and the second deformation employs a global information. Our numerical results showthat one can improve the accuracy of the simulations when a global information is used. © 2013 Global-Science Press.

  9. NON-CONVENTIONAL MACHINING PROCESSES SELECTION USING MULTI-OBJECTIVE OPTIMIZATION ON THE BASIS OF RATIO ANALYSIS METHOD

    Directory of Open Access Journals (Sweden)

    MILOŠ MADIĆ

    2015-11-01

    Full Text Available The role of non-conventional machining processes (NCMPs in today’s manufacturing environment has been well acknowledged. For effective utilization of the capabilities and advantages of different NCMPs, selection of the most appropriate NCMP for a given machining application requires consideration of different conflicting criteria. The right choice of the NCMP is critical to the success and competitiveness of the company. As the NCMP selection problem involves consideration of different conflicting criteria, of different relative importance, the multi-criteria decision making (MCDM methods are very useful in systematical selection of the most appropriate NCMP. This paper presents the application of a recent MCDM method, i.e., the multi-objective optimization on the basis of ratio analysis (MOORA method to solve NCMP selection which has been defined considering different performance criteria of four most widely used NCMPs. In order to determine the relative significance of considered quality criteria a pair-wise comparison matrix of the analytic hierarchy process was used. The results obtained using the MOORA method showed perfect correlation with those obtained by the technique for order preference by similarity to ideal solution (TOPSIS method which proves the applicability and potentiality of this MCDM method for solving complex NCMP selection problems.

  10. Comparison of INSURE method with conventional mechanical ventilation after surfactant administration in preterm infants with respiratory distress syndrome: therapeutic challenge.

    Directory of Open Access Journals (Sweden)

    Fatemeh Sadat Nayeri

    2014-08-01

    Full Text Available Administration of endotracheal surfactant is potentially the main treatment for neonates suffering from RDS (Respiratory Distress Syndrome, which is followed by mechanical ventilation. Late and severe complications may develop as a consequence of using mechanical ventilation. In this study, conventional methods for treatment of RDS are compared with surfactant administration, use of mechanical ventilation for a brief period and NCPAP (Nasal Continuous Positive Airway Pressure, (INSURE method ((Intubation, Surfactant administration and extubation. A randomized clinical trial study was performed, including all newborn infants with diagnosed RDS and a gestational age of 35 weeks or less, who were admitted in NICU of Valiasr hospital. The patients were then divided randomly into two CMV (Conventional Mechanical Ventilation and INSURE groups. Surfactant administration and consequent long-term mechanical ventilation were done in the first group (CMV group. In the second group (INSURE group, surfactant was administered followed by a short-term period of mechanical ventilation. The infants were then extubated, and NCPAP was embedded. The comparison included crucial duration of mechanical ventilation and oxygen therapy, IVH (Intraventricular Hemorrhage, PDA (Patent Ductus Arteriosus, air-leak syndromes, BPD (Broncho-Pulmonary Dysplasia and mortality rate. The need for mechanical ventilation in 5th day of admission was 43% decreased (P=0.005 in INSURE group in comparison to CMV group. A decline (P=0.01 in the incidence of IVH and PDA was also achieved. Pneumothorax, chronic pulmonary disease and mortality rates, were not significantly different among two groups. (P=0.25, P=0.14, P=0.25, respectively. This study indicated that INSURE method in the treatment of RDS decreases the need for mechanical ventilation and oxygen-therapy in preterm neonates. Moreover, relevant complications as IVH and PDA were observed to be reduced. Thus, it seems rationale to

  11. Surface modification of austenitic steel by various glow-discharge nitriding methods

    Directory of Open Access Journals (Sweden)

    Tomasz Borowski

    2015-09-01

    Full Text Available Recent years have seen intensive research on modifying glow-discharge nitriding processes. One of the most commonly used glow-discharge methods includes cathodic potential nitriding (conventional method, and active screen plasma nitriding. Each of these methods has a number of advantages. One very important, common feature of these techniques is full control of the microstructure, chemical and phase composition, thickness and the surface topography of the layers formed. Another advantage includes the possibility of nitriding such materials as: austenitic steels or nickel alloys, i.e. metallic materials which do not diffuse nitrogen as effectively as ferritic or martensitic steels. However, these methods have some disadvantages as well. In the case of conventional plasma nitriding, engineers have to deal with the edge effect, which makes it difficult to use this method for complexly shaped components. In turn, in the case of active screen plasma nitriding, the problem disappears. A uniform, smooth layer forms, but is thinner, softer and is not as resistant to friction compared to layers formed using the conventional method. Research is also underway to combine these methods, i.e. use an active screen in conventional plasma nitriding at cathodic potential. However, there is a lack of comprehensive data presenting a comparison between these three nitriding processes and the impact of pulsating current on the formation of the microstructure and functional properties of austenitic steel surfaces. The article presents a characterisation of nitrided layers produced on austenitic X2CrNiMo17-12-2 (AISI 316L stainless steel in the course of glow-discharge nitriding at cathodic potential, at plasma potential and at cathodic potential incorporating an active screen. All processes were carried out at 440 °C under DC glow-discharge conditions and in 100 kHz frequency pulsating current. The layers were examined in terms of their microstructure, phase and

  12. Lightweight hull surface self-design vertical parameterization method based on NURBS

    Directory of Open Access Journals (Sweden)

    ZHANG Yanru

    2017-10-01

    Full Text Available [Objectives] At present, conventional design is limited to parent ship design space, and cannot drive ship hull design using as few parameters as possible. In order to solve the above problems, [Methods] by combining the draught function with NURBS, a ship hull surface self-design method based on vertical parameterization is proposed. In this method, the waterline is designated as the basic design unit; the bottom flat end line, designed waterline, stem and stern contours, side flat end line and maximum section line are designated as the characteristic constraints of the ship hull; and the draught function values corresponding to the characteristic parameters are designated as the design objectives. In this way, a waterline approximation model is built, and an evolutionary algorithm can be used to solve the approximation model. Finally, the ship hull surface is generated on the basis of the waterline using the NURBS skinning technique.[Results] The design examples of the characteristic curves of the full-scale ship hull surface indicate the practicable and advanced nature of this method.[Conclusions] The hull surface can be designed with as little data as possible using this method, making it much more suitable for the self-design of new ship forms.

  13. Calculation of the uncertainty associated to the result of entrance surface air kerma for conventional radiology patients

    International Nuclear Information System (INIS)

    Blanco, D.; Mora, P.; Khoury, H.; Fabri, D.; Leyton, F.; Cardenas, J.; Blanco, S.; Kodlulovich, S.; Roas, N.; Benavente, T.; Ortiz Lopez, P.; Ramirez, R.

    2008-01-01

    Radiation doses from diagnostic radiology are the largest contribution to the collective dose and the use of guidance (reference levels) has proven to be a tool for optimization of protection. Recently, with the support of the International Atomic Energy Agency (IAEA), eight countries of the Latin-American region have been working together on a programme to test methodologies for determining preliminary values of guidance levels for X-ray chest, lumbar spine and breast examinations. The approach used was to obtain entrance surface air kerma from measurements of X-ray tube outputs, corrected for distance and backscatter and later for real exposure parameters used with patients. For quality control, some of these values for a reduced number of patients were compared with direct TLD measurements directly placed on the patient during exposure. Given the number of parameters involved in the two methods, relatively large differences are deemed to be found in the comparison. The only way of deciding if measurements and calculations are outliers, for example, due to a systematic error or a mistake, is to compare these differences with the combined uncertainty. The aim of this paper is to present (in a detailed way) the methodology used in the pilot program ARCAL LXXV, the analyses of data performed within the survey and the estimated uncertainty. The parameters analyzed were: precision of the readings, positioning of the detector, reproducibility of the mAs and kV, long term stability of the instrument, radiation quality, kerma rate, radiation incidence, field size and field homogeneity, calibration factor of the equipment, temperature and pressure measurement, X-ray tube output curve adjustment, backscatter factor and focus-patient distance. The combined standard uncertainty for Ke in chest radiography in adult patients of standard complexion, was 12%, and the expanded uncertainty (k=2) was 24%. (author)

  14. Polymer surface modification using UV treatment for attachment of natamycin and the potential applications for conventional food cling wrap (LDPE)

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joongmin, E-mail: shinj@uwstout.edu [Engineering and Technology, University of Wisconsin-Stout, Menomonie, WI, 54751 (United States); Liu, Xiaojing [Mechanical and Electronic Engineering, Wuhan University of Technology, Wuhan (China); Chikthimmah, Naveen [Food Science and Technology, University of Wisconsin-Stout, Menomonie, WI, 54751 (United States); Lee, Youn Suk [Department of Packaging, Yonsei University, Gangwon 220-710 (Korea, Republic of)

    2016-11-15

    Highlights: • The study suggests an optimized method for UV-induced antimicrobial agents grafting on LDPE. • The study evaluated the effective of various solvents for acrylic acid and natamycin grafting on LDPE. • The study investigated chemical and mechanical property changes by various times of UV light treatments. • Natamycin grafted film demonstrated antifungal function against mold and yeast. - Abstract: The purpose of this study was to develop an active non-migratory antifungal Low Density Polyethylene (LDPE) polymer for use in food packaged applications. The functional acrylic acid monomer was grafted on the LDPE film surface by photo-initiated graft polymerization using Ultra Violet light irradiation (from 0 to 5 min). Natamycin, an antifungal agent, was applied to the treated film to bind with the pendent functional groups and were evaluated its performance against mold and yeast. The grafted amounts were determined by gravimetric measurement and dye absorbance. Attenuated Total Reflectance/Fourier Transfer Infrared Spectroscopy, scanning electron microscopy, mechanical strength test was used to characterize film properties. The antifungal efficacy of the film was evaluated with Saccharomyces cerevisiae and Penicillium chrysogenum on growth media and fresh cut cantaloupe. The amounts of the grafted group were increased with the longer ultraviolet exposure time. The amount of the grafted natamycin on the treated film was up to 49.87 μg/cm{sup 2}, and the film inhibited mycelium formation of P. chrysogenum spores by over 60%. Due to the thickness of the film (less than 12.25 μm), long time UV exposure decrease the film’s mechanical strength. The application of such non-migratory active packaging film represents a promising approach to maintaining food quality with reduced additive.

  15. Polymer surface modification using UV treatment for attachment of natamycin and the potential applications for conventional food cling wrap (LDPE)

    International Nuclear Information System (INIS)

    Shin, Joongmin; Liu, Xiaojing; Chikthimmah, Naveen; Lee, Youn Suk

    2016-01-01

    Highlights: • The study suggests an optimized method for UV-induced antimicrobial agents grafting on LDPE. • The study evaluated the effective of various solvents for acrylic acid and natamycin grafting on LDPE. • The study investigated chemical and mechanical property changes by various times of UV light treatments. • Natamycin grafted film demonstrated antifungal function against mold and yeast. - Abstract: The purpose of this study was to develop an active non-migratory antifungal Low Density Polyethylene (LDPE) polymer for use in food packaged applications. The functional acrylic acid monomer was grafted on the LDPE film surface by photo-initiated graft polymerization using Ultra Violet light irradiation (from 0 to 5 min). Natamycin, an antifungal agent, was applied to the treated film to bind with the pendent functional groups and were evaluated its performance against mold and yeast. The grafted amounts were determined by gravimetric measurement and dye absorbance. Attenuated Total Reflectance/Fourier Transfer Infrared Spectroscopy, scanning electron microscopy, mechanical strength test was used to characterize film properties. The antifungal efficacy of the film was evaluated with Saccharomyces cerevisiae and Penicillium chrysogenum on growth media and fresh cut cantaloupe. The amounts of the grafted group were increased with the longer ultraviolet exposure time. The amount of the grafted natamycin on the treated film was up to 49.87 μg/cm"2, and the film inhibited mycelium formation of P. chrysogenum spores by over 60%. Due to the thickness of the film (less than 12.25 μm), long time UV exposure decrease the film’s mechanical strength. The application of such non-migratory active packaging film represents a promising approach to maintaining food quality with reduced additive.

  16. 3D electric field calculation with surface charge method

    International Nuclear Information System (INIS)

    Yamada, S.

    1992-01-01

    This paper describes an outline and some examples of three dimensional electric field calculations with a computer code developed at NIRS. In the code, a surface charge method is adopted because of it's simplicity in the mesh establishing procedure. The charge density in a triangular mesh is assumed to distribute with a linear function of the position. The electric field distribution is calculated for a pair of drift tubes with the focusing fingers on the opposing surfaces. The field distribution in an acceleration gap is analyzed with a Fourier-Bessel series expansion method. The calculated results excellently reproduces the measured data with a magnetic model. (author)

  17. Comparison of optical design methods of freeform surfaces for imaging applications

    Science.gov (United States)

    Agócs, Tibor

    2015-09-01

    Optical systems based on freeform optical components offer many advantages over conventional systems in imaging applications, e.g. superior image quality, compact and lightweight designs. There are a few well established manufacturing method that can be used for the generation of freeform surfaces with low surface form error and low surface roughness, in the case of freeform mirrors e.g. diamond turning, nickel plating and post-polishing. Metrology is evolving rapidly, although developments are still needed in order to verify the manufactured surface with the necessary accuracy. Optical design methods of freeform surfaces are also lagging behind, many algorithms address non-imaging applications, but in the field of imaging (image-forming) only a few exists and works with various limitations. We compare the available techniques in freeform optical design for imaging and explore the advantages, disadvantages and boundary conditions of the different methods. We also intend to identify the most useful concepts and investigate how they can be embedded into commercially available optical design software.

  18. Designing Pulse Laser Surface Modification of H13 Steel Using Response Surface Method

    Science.gov (United States)

    Aqida, S. N.; Brabazon, D.; Naher, S.

    2011-01-01

    This paper presents a design of experiment (DOE) for laser surface modification process of AISI H13 tool steel in achieving the maximum hardness and minimum surface roughness at a range of modified layer depth. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 tool steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, overlap percentage and pulse repetition frequency (PRF). The response surface method with Box-Behnken design approach in Design Expert 7 software was used to design the H13 laser surface modification process. Metallographic study and image analysis were done to measure the modified layer depth. The modified surface roughness was measured using two-dimensional surface profilometer. The correlation of the three laser processing parameters and the modified surface properties was specified by plotting three-dimensional graph. The hardness properties were tested at 981 mN force. From metallographic study, the laser modified surface depth was between 37 μm and 150 μm. The average surface roughness recorded from the 2D profilometry was at a minimum value of 1.8 μm. The maximum hardness achieved was between 728 and 905 HV0.1. These findings are significant to modern development of hard coatings for wear resistant applications.

  19. Diffusion accessibility as a method for visualizing macromolecular surface geometry.

    Science.gov (United States)

    Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

    2015-10-01

    Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

  20. Strategies for Solving Potential Problems Associated with Laboratory Diffusion and Batch Experiments - Part 1: An Overview of Conventional Test Methods

    International Nuclear Information System (INIS)

    Zhang, M.; Takeda, M.; Nakajima, H.

    2006-01-01

    Laboratory diffusion testing as well as batch experiments are well established and widely adopted techniques for characterizing the diffusive and adsorptive properties of geological, geotechnical, and synthetic materials in both scientific and applied fields, including geological disposal of radioactive waste. Although several types of diffusion test, such as the through- diffusion test, in-diffusion test, out-diffusion test, and column test, are currently available, different methods may have different advantages and disadvantages. In addition, traditional methods may have limitations, such as the need for relatively long test times, cumbersome test procedures, and the possibility of errors due to differences between analytical assumptions and actual test conditions. Furthermore, traditional batch experiments using mineral powders are known to overestimate the sorption coefficient. In part 1 of this report, we present a brief overview of laboratory diffusion and batch experiments. The advantages, disadvantages, limitations, and/or potential problems associated with individual tests were compared and summarized. This comprehensive report will provide practical references for reviewing the results obtained from relevant experiments, especially from the viewpoint of regulation. To solve and/or eliminate the potential problems associated with conventional methods, and to obtain the diffusion coefficient and rock capacity factor from a laboratory test both rapidly and accurately, part 2 of this study discusses possible strategies involving the development of rigorous solutions to some relevant test methods, and sensitivity analyses for the related tests that may be helpful to judge the accuracy of the two parameters to be determined from individual tests. (authors)

  1. The comparison of assessment of pigeon semen motility and sperm concentration by conventional methods and the CASA system (HTM IVOS).

    Science.gov (United States)

    Klimowicz, M D; Nizanski, W; Batkowski, F; Savic, M A

    2008-07-01

    The aim of these experiments was to compare conventional, microscopic methods of evaluating pigeon sperm motility and concentration to those measured by computer-assisted sperm analysis (CASA system). Semen was collected twice a week from two groups of pigeons, each of 40 males (group I: meat-type breed; group II: fancy pigeon) using the lumbo-sacral and cloacal region massage method. Ejaculates collected in each group were diluted 1:100 in BPSE solution and divided into two equal samples. One sample was examined subjectively by microscope and the second one was analysed using CASA system. The sperm concentration was measured by CASA using the anti-collision (AC) system and fluorescent staining (IDENT). There were not any significant differences between the methods of evaluation of sperm concentration. High positive correlations in both groups were observed between the sperm concentration estimated by Thom counting chamber and AC (r=0.87 and r=0.91, respectively), and between the sperm concentration evaluated by Thom counting chamber and IDENT (r=0.85 and r=0.90, respectively). The mean values for CASA measurement of proportion of motile spermatozoa (MOT) and progressive movement (PMOT) were significantly lower than the values estimated subjectively in both groups of pigeons (pCASA system is very rapid, objective and sensitive method in detecting subtle motility characteristics as well as sperm concentration and is recommended for future research into pigeon semen.

  2. ''Augmented reality'' in conventional simulation by projection of 3-D structures into 2-D images. A comparison with virtual methods

    International Nuclear Information System (INIS)

    Deutschmann, H.; Nairz, O.; Zehentmayr, F.; Fastner, G.; Sedlmayer, F.; Steininger, P.; Kopp, P.; Merz, F.; Wurstbauer, K.; Kranzinger, M.; Kametriser, G.; Kopp, M.

    2008-01-01

    Background and purpose: in this study, a new method is introduced, which allows the overlay of three-dimensional structures, that have been delineated on transverse slices, onto the fluoroscopy from conventional simulators in real time. Patients and methods: setup deviations between volumetric imaging and simulation were visualized, measured and corrected for 701 patient isocenters. Results: comparing the accuracy to mere virtual simulation lacking additional X-ray imaging, a clear benefit of the new method could be shown. On average, virtual prostate simulations had to be corrected by 0.48 cm (standard deviation [SD] 0.38), and those of the breast by 0.67 cm (SD 0.66). Conclusion: the presented method provides an easy way to determine entity-specific safety margins related to patient setup errors upon registration of bony anatomy (prostate 0.9 cm for 90% of cases, breast 1.3 cm). The important role of planar X-ray imaging was clearly demonstrated. The innovation can also be applied to adaptive image-guided radiotherapy (IGRT) protocols. (orig.)

  3. Storage stability of margarines produced from enzymatically interesterified fats compared to those prepared by conventional methods - Chemical properties

    DEFF Research Database (Denmark)

    Zhang, Hong; Jacobsen, Charlotte; Pedersen, Lars Saaby

    2006-01-01

    margarines in a pilot plant. Storage stability studies were carried out at storage temperatures of 5 and 25øC for 12wk. Margarines from the enzymatically interesterified fats were compared to the margarines produced by the conventional methods (chemical interesterification and physical blending......In this study, four margarine hardstocks were produced, two from enzymatically interesterified fats at 80 and 100% conversion, one from chemically randomized fat and one from physically mixed fat. These four hardstocks, blended with 50% sunflower oil, were mainly used for the production of table...... interesterified fat had higher PV in weeks4, 8 and10 than the margarines produced from the enzymatically interesterified fats and the physically blended fat. These differences were not caused by different contents of tocopherols in the hardstocks. The differences between the processes for chemical and enzymatic...

  4. Method and Apparatus for Creating a Topography at a Surface

    Science.gov (United States)

    Adams, David P.; Sinclair, Michael B.; Mayer, Thomas M.; Vasile, Michael J.; Sweatt, William C.

    2008-11-11

    Methods and apparatus whereby an optical interferometer is utilized to monitor and provide feedback control to an integrated energetic particle column, to create desired topographies, including the depth, shape and/or roughness of features, at a surface of a specimen. Energetic particle columns can direct energetic species including, ions, photons and/or neutral particles to a surface to create features having in-plane dimensions on the order of 1 micron, and a height or depth on the order of 1 nanometer. Energetic processes can include subtractive processes such as sputtering, ablation, focused ion beam milling and, additive processes, such as energetic beam induced chemical vapor deposition. The integration of interferometric methods with processing by energetic species offers the ability to create desired topographies at surfaces, including planar and curved shapes.

  5. Multi-phase-field method for surface tension induced elasticity

    Science.gov (United States)

    Schiedung, Raphael; Steinbach, Ingo; Varnik, Fathollah

    2018-01-01

    A method, based on the multi-phase-field framework, is proposed that adequately accounts for the effects of a coupling between surface free energy and elastic deformation in solids. The method is validated via a number of analytically solvable problems. In addition to stress states at mechanical equilibrium in complex geometries, the underlying multi-phase-field framework naturally allows us to account for the influence of surface energy induced stresses on phase transformation kinetics. This issue, which is of fundamental importance on the nanoscale, is demonstrated in the limit of fast diffusion for a solid sphere, which melts due to the well-known Gibbs-Thompson effect. This melting process is slowed down when coupled to surface energy induced elastic deformation.

  6. Temperature sensitive surfaces and methods of making same

    Science.gov (United States)

    Liang, Liang [Richland, WA; Rieke, Peter C [Pasco, WA; Alford, Kentin L [Pasco, WA

    2002-09-10

    Poly-n-isopropylacrylamide surface coatings demonstrate the useful property of being able to switch charateristics depending upon temperature. More specifically, these coatings switch from being hydrophilic at low temperature to hydrophobic at high temperature. Research has been conducted for many years to better characterize and control the properties of temperature sensitive coatings. The present invention provides novel temperature sensitive coatings on articles and novel methods of making temperature sensitive coatings that are disposed on the surfaces of various articles. These novel coatings contain the reaction products of n-isopropylacrylamide and are characterized by their properties such as advancing contact angles. Numerous other characteristics such as coating thickness, surface roughness, and hydrophilic-to-hydrophobic transition temperatures are also described. The present invention includes articles having temperature-sensitve coatings with improved properties as well as improved methods for forming temperature sensitive coatings.

  7. Localized surface plasmon resonance mercury detection system and methods

    Science.gov (United States)

    James, Jay; Lucas, Donald; Crosby, Jeffrey Scott; Koshland, Catherine P.

    2016-03-22

    A mercury detection system that includes a flow cell having a mercury sensor, a light source and a light detector is provided. The mercury sensor includes a transparent substrate and a submonolayer of mercury absorbing nanoparticles, e.g., gold nanoparticles, on a surface of the substrate. Methods of determining whether mercury is present in a sample using the mercury sensors are also provided. The subject mercury detection systems and methods find use in a variety of different applications, including mercury detecting applications.

  8. Direct methods for surface X-ray diffraction

    International Nuclear Information System (INIS)

    Saldin, D. K.; Harder, R.; Shneerson, V. L.; Vogler, H.; Moritz, W.

    2000-01-01

    We develop of a direct method for surface X-ray diffraction that exploits the holographic feature of a known reference wave from the substrate. A Bayesian analysis of the optimal inference to be made from an incomplete data set suggests a maximum entropy algorithm that balances agreement with the data and other statistical considerations

  9. Response surface method to optimize the low cost medium for ...

    African Journals Online (AJOL)

    A protease producing Bacillus sp. GA CAS10 was isolated from ascidian Phallusia arabica, Tuticorin, Southeast coast of India. Response surface methodology was employed for the optimization of different nutritional and physical factors for the production of protease. Plackett-Burman method was applied to identify ...

  10. Surface sterilization method for reducing microbial contamination of ...

    African Journals Online (AJOL)

    An effective disinfection method for strawberry (Fragaria x ananassa Duch.) cv. Senga Sengana micropropagation using runner tips and nodal segments as explants was developed. The explants were surface sterilized with different sterilants for different durations. The present studies on the effect of different regimes of ...

  11. Assessment methods of injection moulded nano-patterned surfaces

    DEFF Research Database (Denmark)

    Menotti, S.; Bisacco, G.; Hansen, H. N.

    2014-01-01

    algorithm for feature recognition. To compare the methods, the mould insert and a number of replicated nano-patterned surfaces, injection moulded with an induction heating aid, were measured on nominally identical locations by means of an atomic force microscope mounted on a manual CMM....

  12. Surface zwitterionization: Effective method for preventing oral bacterial biofilm formation on hydroxyapatite surfaces

    Science.gov (United States)

    Lee, Myoungjin; Kim, Heejin; Seo, Jiae; Kang, Minji; Kang, Sunah; Jang, Joomyung; Lee, Yan; Seo, Ji-Hun

    2018-01-01

    In this study, we conducted surface zwitterionization of hydroxyapatite (HA) surfaces by immersing them in the zwitterionic polymer solutions to provide anti-bacterial properties to the HA surface. Three different monomers containing various zwitterionic groups, i.e., phosphorylcholine (PC), sulfobetaine (SB), and carboxybetaine (CB), were copolymerized with the methacrylic monomer containing a Ca2+-binding moiety, using the free radical polymerization method. As a control, functionalization of the copolymer containing the Ca2+-binding moiety was synthesized using a hydroxy group. The stable immobilization of the zwitterionic functional groups was confirmed by water contact angle analysis and X-ray photoelectron spectroscopy (XPS) measurement conducted after the sonication process. The zwitterionized HA surface showed significantly decreased protein adsorption, whereas the hydroxyl group-coated HA surface showed limited efficacy. The anti-bacterial adhesion property was confirmed by conducting Streptococcus mutans (S. mutans) adhesion tests for 6 h and 24 h. When furanone C-30, a representative anti-quorum sensing molecule for S. mutans, was used, only a small amount of bacteria adhered after 6 h and the population did not increase after 24 h. In contrast, zwitterionized HA surfaces showed almost no bacterial adhesion after 6 h and the effect was retained for 24 h, resulting in the lowest level of oral bacterial adhesion. These results confirm that surface zwitterionization is a promising method to effectively prevent oral bacterial adhesion on HA-based materials.

  13. A novel test method for quantifying surface tack of polypropylene compound surfaces

    Directory of Open Access Journals (Sweden)

    2011-11-01

    Full Text Available While adhesiveness is required for polymer surfaces in special applications, tacky surfaces are generally undesirable in many applications like automotive interior parts. The tackiness of polymer surface results from a combination of composition and additivation, and it can change significantly in natural or accelerated ageing. Since there is no established, uniform method to characterize surface tack, the major focus of the present work was on the development of an objective quantification method. A setup having a soft die tip attached to a standard tensile tester was developed aiming for correlation to the human sense of touch. Three different model thermoplastic polyolefin (TPO compound formulations based on a high-impact isotactic polypropylene (iPP composition with varying amounts and types of anti-scratch additives were used for these investigations. As the surface tack phenomenon is related to ageing and weathering, the material’s examination was also performed after various intervals of weathering. The developed method allows a fast assessment of the effect of polymer composition variations and different additive formulations on surface tack and gives identical rankings as the standardized haptic panel.

  14. Arthroscopic release using F and C method versus conventional open release method in the treatment of gluteal muscle contracture: a comparative study.

    Science.gov (United States)

    Rai, Saroj; Jin, Shengyang; Meng, Chunqing; Chaudhary, Nabin; Tamang, Nira; Wang, Xiaohong; Liu, Xianzhe; Wang, Hong; Yang, Shuhua

    2017-03-16

    Gluteal muscle contracture (GMC), a debilitating disease, usually starts in early childhood after variable dose of injections around the buttock, if left untreated it worsens gradually and persists throughout the life. Because the disease mostly affects adolescents and adults, there is always an aesthetic concerns. Purposeof the study was to introduce the arthroscopic F and C method of GMC release, and to compare its clinical efficiency with conventional open surgery in terms of clinical outcome, rate of complications, patient's satisfactions, and recurrence. Between Jan 2013 and July 2015, 75 patients received an arthroscopic release with F and C release method and 71 patients received conventional open release of GMC. Primary surgeries in 16 years or older patients were included in the study. Two groups were compared clinically using Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL), Hip Outcome Scores - Sports Subscale (HOS-Sports), Visual Analogue Scale (VAS), and Ye et al. evaluation criteria. No statistically significant differences were observed in Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL) (P = 0.078), Hip Outcome Scores - Sports Subscale (HOS-Sports) (P = 0.340), and Visual Analogue Scale (VAS) (P = 0.524) between the two groups. 74 (98.7%) patients in the arthroscopic surgery group had good to excellent results, whereas 69 (97.1%) patients in the conventional open surgery group had good to excellent results (P = 0.727). No statistically significant difference was observed in recurrence rate (P = 0.612). Statistically significant differences were observed in incision length, use of post-operative analgesia, post-operative off-bed activity, and hospital stay. Complications were significantly higher in the conventional open surgery group (n = 21) than in the arthroscopic surgery group (n = 10) (P = 0.016). More importantly, cosmetic satisfaction was 100% in arthroscopic release group

  15. The method of synthesizing of superhydrophobic surfaces by PECVD

    Science.gov (United States)

    Orazbayev, Sagi; Gabdullin, Maratbek; Ramazanov, Tlekkabul; Dosbolayev, Merlan; Zhunisbekov, Askar; Omirbekov, Dulat; Otarbay, Zhuldyz

    2018-03-01

    The aim of this work was to obtain superhydrophobic surfaces in a plasma medium. The experiment was carried out using the PECVD method in two different modes: constant and pulsing. The surface roughness was obtained by applying nanoparticles synthesized in plasma in a mixture of argon and methane. The resulting particles were deposited on the surface of silicon and glass materials. The contact angle increased linearly depending on the number of cycles, until it reached 160° at 150-160th cycles, after that the increase in cycles does not affect the contact angle, since the saturation process is in progress. Also the effect of the working gas composition on the hydrophobicity of the surface was studied. At low concentrations of methane (1%) only particles are synthesized in the working gas, and hydrophobicity is unstable, with an increase in methane concentration (7%) nanofilms are synthesized from nanoclusters, and surface hydrophobicity is relatively stable. In addition, a pulsing plasma mode was used to obtain superhydrophobic surfaces. The hydrophobicity of the sample showed that the strength of the nanofilm was stable in comparison with the sample obtained in the first mode, but the contact angle was lower. The obtained samples were examined using SEM, SPM, optical analysis, and their contact angles were determined.

  16. Comparative evaluation of the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods.

    Science.gov (United States)

    Devgan, Manish; Nanda, Arun; Ansari, Shahid Husain

    2013-09-01

    The aim of the present study was to assess the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods. Aqueous and ethanol extracts of Pterocarpus marsupium heartwood were prepared by conventional methods (infusion, decoction, maceration and percolation) and non conventional methods, such as ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE). The crude aqueous extracts were administered orally to both normal and alloxan induced male albino rats (Sprague-Dawley strain). The experimental set up consisted of 48 male albino rats divided into 6 groups: Normal control, diabetic control (sterile normal saline, 1 ml/100 g body weight), standard (gliclazide, 25 mg/1000g of body weight), groups 4-6 (crude aqueous percolation, optimized UAE and MAE extract, 250 mg/1000g of body weight). In acute treatment, the reduction of blood glucose level was statistically significant with the oral administration of UAE and percolation aqueous extracts to the hyperglycemic rats. In sub-acute treatment, the UAE aqueous extract led to consistent and statistically significant (p<0.001) reduction in the blood glucose levels. There was no abnormal change in body weight of the hyperglycemic animals after 10 days of administration of plant extracts and gliclazide. This study justifies the traditional claim and provides a rationale for the use of Pterocarpus marsupium to treat diabetes mellitus. The antidiabetic activity of Pterocarpus marsupium can be enhanced by extracting the heartwood by non conventional method of UAE.

  17. Advances in the Surface Renewal Flux Measurement Method

    Science.gov (United States)

    Shapland, T. M.; McElrone, A.; Paw U, K. T.; Snyder, R. L.

    2011-12-01

    The measurement of ecosystem-scale energy and mass fluxes between the planetary surface and the atmosphere is crucial for understanding geophysical processes. Surface renewal is a flux measurement technique based on analyzing the turbulent coherent structures that interact with the surface. It is a less expensive technique because it does not require fast-response velocity measurements, but only a fast-response scalar measurement. It is therefore also a useful tool for the study of the global cycling of trace gases. Currently, surface renewal requires calibration against another flux measurement technique, such as eddy covariance, to account for the linear bias of its measurements. We present two advances in the surface renewal theory and methodology that bring the technique closer to becoming a fully independent flux measurement method. The first advance develops the theory of turbulent coherent structure transport associated with the different scales of coherent structures. A novel method was developed for identifying the scalar change rate within structures at different scales. Our results suggest that for canopies less than one meter in height, the second smallest coherent structure scale dominates the energy and mass flux process. Using the method for resolving the scalar exchange rate of the second smallest coherent structure scale, calibration is unnecessary for surface renewal measurements over short canopies. This study forms the foundation for analysis over more complex surfaces. The second advance is a sensor frequency response correction for measuring the sensible heat flux via surface renewal. Inexpensive fine-wire thermocouples are frequently used to record high frequency temperature data in the surface renewal technique. The sensible heat flux is used in conjunction with net radiation and ground heat flux measurements to determine the latent heat flux as the energy balance residual. The robust thermocouples commonly used in field experiments

  18. Continuum damage mechanics method for fatigue growth of surface cracks

    International Nuclear Information System (INIS)

    Feng Xiqiao; He Shuyan

    1997-01-01

    With the background of leak-before-break (LBB) analysis of pressurized vessels and pipes in nuclear plants, the fatigue growth problem of either circumferential or longitudinal semi-elliptical surface cracks subjected to cyclic loading is studied by using a continuum damage mechanics method. The fatigue damage is described by a scalar damage variable. From the damage evolution equation at the crack tip, a crack growth equation similar to famous Paris' formula is derived, which shows the physical meaning of Paris' formula. Thereby, a continuum damage mechanics approach is developed to analyze the configuration evolution of surface cracks during fatigue growth

  19. The new fabrication method of standard surface sources

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Yasushi E-mail: yss.sato@aist.go.jp; Hino, Yoshio; Yamada, Takahiro; Matsumoto, Mikio

    2004-04-01

    We developed a new fabrication method for standard surface sources by using an inkjet printer with inks in which a radioactive material is mixed to print on a sheet of paper. Three printed test patterns have been prepared: (1) 100 mmx100 mm uniformity-test patterns, (2) positional-resolution test patterns with different widths and intervals of straight lines, and (3) logarithmic intensity test patterns with different radioactive intensities. The results revealed that the fabricated standard surface sources had high uniformity, high positional resolution, arbitrary shapes and a broad intensity range.

  20. A density gradient theory based method for surface tension calculations

    DEFF Research Database (Denmark)

    Liang, Xiaodong; Michelsen, Michael Locht; Kontogeorgis, Georgios

    2016-01-01

    The density gradient theory has been becoming a widely used framework for calculating surface tension, within which the same equation of state is used for the interface and bulk phases, because it is a theoretically sound, consistent and computationally affordable approach. Based on the observation...... that the optimal density path from the geometric mean density gradient theory passes the saddle point of the tangent plane distance to the bulk phases, we propose to estimate surface tension with an approximate density path profile that goes through this saddle point. The linear density gradient theory, which...... assumes linearly distributed densities between the two bulk phases, has also been investigated. Numerical problems do not occur with these density path profiles. These two approximation methods together with the full density gradient theory have been used to calculate the surface tension of various...

  1. Simulating condensation on microstructured surfaces using Lattice Boltzmann Method

    Science.gov (United States)

    Alexeev, Alexander; Vasyliv, Yaroslav

    2017-11-01

    We simulate a single component fluid condensing on 2D structured surfaces with different wettability. To simulate the two phase fluid, we use the athermal Lattice Boltzmann Method (LBM) driven by a pseudopotential force. The pseudopotential force results in a non-ideal equation of state (EOS) which permits liquid-vapor phase change. To account for thermal effects, the athermal LBM is coupled to a finite volume discretization of the temperature evolution equation obtained using a thermal energy rate balance for the specific internal energy. We use the developed model to probe the effect of surface structure and surface wettability on the condensation rate in order to identify microstructure topographies promoting condensation. Financial support is acknowledged from Kimberly-Clark.

  2. A case study comparing the use of laser induced fluorescence with cone penetrometer testing to more conventional screening methods

    International Nuclear Information System (INIS)

    Earley, K.; Rapp, K.

    1995-01-01

    Site assessments utilizing in-situ techniques to characterize subsurface stratigraphy and contaminant distribution are becoming more accepted and commonly used. Laser Induced Fluorescence (LIF) spectroscopy with Cone Penetrometer Test (CPT) is a new technology that provides real-time data on stratigraphy and petroleum hydrocarbons (PHCs) in the subsurface environment. Over the last two years, LIF technological advances have led to field equipment with improved durability, reduced bulk and weight, and the ability to integrate LIF systems with CPT equipment. The Rapid Optical Screening Tool (a Unisys registered trademark hereafter referred to as ROST) presents the development of an in-situ data collection system which couples state-of-the-art LIF technology with CPT. ROST/CPT technology has recently been utilized in a variety of field and soil conditions. These advances, along with the need for rapid in-situ information on the horizontal and vertical distribution of petroleum hydrocarbons (PHCs) have resulted in equipment that is now available for commercial applications. This paper presents a comparison of ROST/CPT to more conventional characterization methods at a manufacturing site in Nebraska. Various PHCs were stored in underground and above ground storage tanks across the site. One of these PHC spill areas consisting of a mixture of diesel fuel oil and kerosene was selected for a comparative study between various site assessment methods

  3. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    International Nuclear Information System (INIS)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-01-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm 3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  4. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    Science.gov (United States)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-06-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  5. Microstructural and Mechanical Properties of Porous 60NiTi Prepared by Conventional Press-and-sinter Method

    Directory of Open Access Journals (Sweden)

    Khanlari Khashayar

    2017-01-01

    Full Text Available An intermetallic nickel-titanium alloy, 60NiTi, comprised of approximately 60 wt.% Ni and 40 wt.% Ti, contains a broad combination of physical and mechanical properties such as high hardness, low elastic modulus, resistance to aqueous corrosion and good biocompatibility. These unique combinations make this alloy an attractive candidate for medical components such as implants and prosthesis, where biocompatible materials with high hardness and low stiffness are typically used. The conventional press-and-sinter method which represents the least complex, most flexible and economic powder metallurgy method was used to produce porous 60NiTi parts suitable for biomedical applications. The effect of sintering holding time on the microstructure and mechanical properties is investigated. The structure of the as sintered parts is quite porous which is beneficial based on the medical point of view. The ultimate compressive strength of the samples is higher than that of the compact human bone and can, therefore, meet the strength demand of implants for general bone replacement applications.

  6. Clinical outcomes for patients finished with the SureSmile™ method compared with conventional fixed orthodontic therapy

    Science.gov (United States)

    Alford, Timothy J.; Roberts, W. Eugene; Hartsfield, James K.; Eckert, George J.; Snyder, Ronald J.

    2016-01-01

    Objective Utilize American Board of Orthodontics (ABO) cast/radiographic evaluation (CRE) to compare a series of 63 consecutive patients, finished with manual wire bending (conventional) treatment, vs a subsequent series of 69 consecutive patients, finished by the same orthodontist using the SureSmile™ (SS) method. Materials and Methods Records of 132 nonextraction patients were scored by a calibrated examiner blinded to treatment mode. Age and discrepancy index (DI) between groups were compared by t-tests. A chi-square test was used to compare for differences in sex and whether the patient was treated using braces only (no orthopedic correction). Analysis of covariance tested for differences in CRE outcomes and treatment times, with sex and DI included as covariates. A logarithmic transformation of CRE outcomes and treatment times was used because their distributions were skewed. Significance was defined as P space closure; however, second-order root angulation (RA) was inferior. Conclusion SS patients were treated in less time to better CRE scores for first-order rotation (AR) and interproximal space closure (IC) but on the average, malocclusions were less complex and second order root alignment was inferior, compared with patients finished with manual wire bending. PMID:21261488

  7. Interrogating the Conventional Boundaries of Research Methods in Social Sciences: The Role of Visual Representation in Ethnography

    Directory of Open Access Journals (Sweden)

    Nel Glass

    2008-05-01

    Full Text Available The author will propose that the use of performative social science is a means to deliberately interrogate long held conventions of established research. The innovative role of visual art representation in data collection, analysis and public engagement with research will be discussed. Examples will be drawn from two postmodern feminist ethnographic research which investigated academic professional development, resilience, hope and optimism in the UK, US, Australia and New Zealand from 1997-2005. Artwork was initially created as data collection and digitalised as representation to intentionally validate the voices of research participants, the researcher and viewers of the work. The research participants and viewers were given opportunities to actively engage with the visual work. Artwork complimented two additional research methods: critical conversational interviewing and reflective journaling. This paper will address the ways inclusion of art methods contributed and deepened data representation. The role of crafting artwork in the field, the artistic changes that represented the complexity of data analysis and engagement with the work will be explored. It will be argued that the creation and engagement with artwork in research is an empowering and dynamic process for researchers and participants. It is an innovative means of representing intersubjectivity that results in reciprocity. URN: urn:nbn:de:0114-fqs0802509

  8. Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

    Science.gov (United States)

    Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

    2016-01-01

     Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

  9. [Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

    Science.gov (United States)

    Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

    2011-01-01

    The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  10. Full surface inspection methods regarding reinforcement corrosion of concrete structures

    International Nuclear Information System (INIS)

    Reichling, K.; Raupach, M.; Broomfield, J.; Gulikers, J.; L'Hostis, Valerie

    2013-01-01

    For reinforced concrete structures a localisation of all significant critical areas can only be done by a full surface inspection. The economic advantages are obvious: uncritical areas have not to be repaired expensively.The first step of the assessment should always be a visual inspection. The range of deterioration causes can be limited and the degree of deterioration may be estimated roughly. The inspection program can be adjusted to the requirements. By means of a full surface potential mapping areas with a high risk for chloride induced reinforcement corrosion can be localised, although no deteriorations are visually detectable at the concrete surface. In combination with concrete cover depth and resistivity measurements areas with corrosion promoting exposure conditions can be localised even if the reinforcement is not yet de-passivated. The following publication gives an overview about the essential full surface investigation methods to localise critical areas regarding corrosion of steel in concrete. The selection of methods is based on the inspection procedure given in reference 2. (authors)

  11. Comparison of optical methods for surface roughness characterization

    DEFF Research Database (Denmark)

    Feidenhans'l, Nikolaj Agentoft; Hansen, Poul Erik; Pilny, Lukas

    2015-01-01

    We report a study of the correlation between three optical methods for characterizing surface roughness: a laboratory scatterometer measuring the bi-directional reflection distribution function (BRDF instrument), a simple commercial scatterometer (rBRDF instrument), and a confocal optical profiler....... For each instrument, the effective range of spatial surface wavelengths is determined, and the common bandwidth used when comparing the evaluated roughness parameters. The compared roughness parameters are: the root-mean-square (RMS) profile deviation (Rq), the RMS profile slope (Rdq), and the variance...... of the scattering angle distribution (Aq). The twenty-two investigated samples were manufactured with several methods in order to obtain a suitable diversity of roughness patterns.Our study shows a one-to-one correlation of both the Rq and the Rdq roughness values when obtained with the BRDF and the confocal...

  12. Theoretical studies of potential energy surfaces and computational methods

    Energy Technology Data Exchange (ETDEWEB)

    Shepard, R. [Argonne National Laboratory, IL (United States)

    1993-12-01

    This project involves the development, implementation, and application of theoretical methods for the calculation and characterization of potential energy surfaces involving molecular species that occur in hydrocarbon combustion. These potential energy surfaces require an accurate and balanced treatment of reactants, intermediates, and products. This difficult challenge is met with general multiconfiguration self-consistent-field (MCSCF) and multireference single- and double-excitation configuration interaction (MRSDCI) methods. In contrast to the more common single-reference electronic structure methods, this approach is capable of describing accurately molecular systems that are highly distorted away from their equilibrium geometries, including reactant, fragment, and transition-state geometries, and of describing regions of the potential surface that are associated with electronic wave functions of widely varying nature. The MCSCF reference wave functions are designed to be sufficiently flexible to describe qualitatively the changes in the electronic structure over the broad range of geometries of interest. The necessary mixing of ionic, covalent, and Rydberg contributions, along with the appropriate treatment of the different electron-spin components (e.g. closed shell, high-spin open-shell, low-spin open shell, radical, diradical, etc.) of the wave functions, are treated correctly at this level. Further treatment of electron correlation effects is included using large scale multireference CI wave functions, particularly including the single and double excitations relative to the MCSCF reference space. This leads to the most flexible and accurate large-scale MRSDCI wave functions that have been used to date in global PES studies.

  13. Comparison of optical methods for surface roughness characterization

    International Nuclear Information System (INIS)

    Feidenhans’l, Nikolaj A; Hansen, Poul-Erik; Madsen, Morten H; Petersen, Jan C; Pilný, Lukáš; Bissacco, Giuliano; Taboryski, Rafael

    2015-01-01

    We report a study of the correlation between three optical methods for characterizing surface roughness: a laboratory scatterometer measuring the bi-directional reflection distribution function (BRDF instrument), a simple commercial scatterometer (rBRDF instrument), and a confocal optical profiler. For each instrument, the effective range of spatial surface wavelengths is determined, and the common bandwidth used when comparing the evaluated roughness parameters. The compared roughness parameters are: the root-mean-square (RMS) profile deviation (Rq), the RMS profile slope (Rdq), and the variance of the scattering angle distribution (Aq). The twenty-two investigated samples were manufactured with several methods in order to obtain a suitable diversity of roughness patterns.Our study shows a one-to-one correlation of both the Rq and the Rdq roughness values when obtained with the BRDF and the confocal instruments, if the common bandwidth is applied. Likewise, a correlation is observed when determining the Aq value with the BRDF and the rBRDF instruments.Furthermore, we show that it is possible to determine the Rq value from the Aq value, by applying a simple transfer function derived from the instrument comparisons. The presented method is validated for surfaces with predominantly 1D roughness, i.e. consisting of parallel grooves of various periods, and a reflectance similar to stainless steel. The Rq values are predicted with an accuracy of 38% at the 95% confidence interval. (paper)

  14. Novel titration method for surface-functionalised silica

    Energy Technology Data Exchange (ETDEWEB)

    Hofen, Kai; Weber, Siegfried [Department of Biotechnology, University of Applied Sciences, Mannheim (Germany); Chan, Chiu Ping Candace [School of Advanced Manufacturing and Mechanical Engineering, Mawson Institute, University of South Australia, Mawson Lakes Blvd, Mawson Lakes 5095 (Australia); Majewski, Peter, E-mail: peter.majewski@unisa.edu.au [School of Advanced Manufacturing and Mechanical Engineering, Mawson Institute, University of South Australia, Mawson Lakes Blvd, Mawson Lakes 5095 (Australia)

    2011-01-15

    This paper describes three inexpensive and fast analytical methods to characterise grafted particle surfaces. The reaction of silica with (3-aminopropyl)triethoxysilane, (3-mercaptopropyl)trimethoxysilane and N-(phosphonomethyl)iminodiacetic acid hydrate, respectively, leads to NH{sub 2}-, SO{sub 3}H- or COOH-functionalised silica, which were characterised by X-ray photoelectron spectrometry and titration in nonaqueous media as well as with two titration methods in a water-based environment. In the work presented, factors influencing the titrations are pointed out and solutions are presented to overcome these limiting factors are shown.

  15. Novel titration method for surface-functionalised silica

    International Nuclear Information System (INIS)

    Hofen, Kai; Weber, Siegfried; Chan, Chiu Ping Candace; Majewski, Peter

    2011-01-01

    This paper describes three inexpensive and fast analytical methods to characterise grafted particle surfaces. The reaction of silica with (3-aminopropyl)triethoxysilane, (3-mercaptopropyl)trimethoxysilane and N-(phosphonomethyl)iminodiacetic acid hydrate, respectively, leads to NH 2 -, SO 3 H- or COOH-functionalised silica, which were characterised by X-ray photoelectron spectrometry and titration in nonaqueous media as well as with two titration methods in a water-based environment. In the work presented, factors influencing the titrations are pointed out and solutions are presented to overcome these limiting factors are shown.

  16. Comparison on extraction yield of sennoside A and sennoside B from senna (Cassia angustifolia) using conventional and non conventional extraction techniques and their quantification using a validated HPLC-PDA detection method.

    Science.gov (United States)

    Dhanani, Tushar; Singh, Raghuraj; Reddy, Nagaraja; Trivedi, A; Kumar, Satyanshu

    2017-05-01

    Senna is an important medicinal plant and is used in many Ayurvedic formulations. Dianthraquinone glucosides are the main bioactive phytochemicals present in leaves and pods of senna. The extraction efficiency in terms of yield and composition of the extract of senna prepared using both conventional (cold percolation at room temperature and refluxing) and non conventional (ultrasound and microwave assisted solvent extraction as well as supercritical fluid extraction) techniques were compared in the present study. Also a rapid reverse phase HPLC-PDA detection method was developed and validated for the simultaneous determination of sennoside A and sennoside B in the different extracts of senna leaves. Ultrasound and microwave assisted solvent extraction techniques were more effective in terms of yield and composition of the extracts compared to cold percolation at room temperature and refluxing methods of extraction.

  17. Sectional localization of a small hepatocellular carcinoma in the right hepatic lobe by computed tomography: Comparison between the conventional and portal vein tracing methods

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Chun-Gao [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); The First Affiliated Hospital of Nanjing Medical University, Department of Interventional Radiology, Nanjing (China); Chung, Jin Wook; Hur, Saebeom; Lee, Myungsu; Kim, Hyo-Cheol; Jae, Hwan Jun; Yin, Yong-Hu; Kim, Young Il [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); Ahn, Sang-bu [Dongnam Institution of Radiological and Medical Sciences, Department of Radiology, Busan (Korea, Republic of); Cho, Baik Hwan [Chonbuk National University Hospital, Department of Radiology, Jeonju (Korea, Republic of)

    2016-12-15

    To compare the accuracy of the conventional and portal vein tracing methods in the right hepatic lobe in multidetector computed tomography (MDCT). This retrospective study included patients with hepatocellular carcinoma (HCC) lesions in the right hepatic lobe who underwent multiphasic MDCT and C-arm CT hepatic arteriography (C-arm CTHA) for chemoembolization. The accuracies of the conventional and portal vein tracing methods were evaluated using C-arm CTHA as the gold standard. A total of 147 patients with 205 HCC nodules were included. The C-arm CTHA could identify all the tumour-feeding arteries and consequently demonstrated that 120 lesions were located in the anterior section, 78 in the posterior section, and 7 in the border zone. The accuracy rates of conventional vs. portal vein tracing methods were 71.7 % vs. 98.3 % for the anterior section lesions, 67.9 % vs. 96.2 % for the posterior section, and 28.6 % vs. 57.1 % for the border zone. The portal vein tracing method was more accurate than the conventional method (P<0.001). The portal vein tracing method should be used for sectional localization of HCCs in the right lobe, because it predicts the location more accurately than the conventional method. (orig.)

  18. TWO METHODS FOR REMOTE ESTIMATION OF COMPLETE URBAN SURFACE TEMPERATURE

    Directory of Open Access Journals (Sweden)

    L. Jiang

    2017-09-01

    Full Text Available Complete urban surface temperature (TC is a key parameter for evaluating the energy exchange between the urban surface and atmosphere. At the present stage, the estimation of TC still needs detailed 3D structure information of the urban surface, however, it is often difficult to obtain the geometric structure and composition of the corresponding temperature of urban surface, so that there is still lack of concise and efficient method for estimating the TC by remote sensing. Based on the four typical urban surface scale models, combined with the Envi-met model, thermal radiant directionality forward modeling and kernel model, we analyzed a complete day and night cycle hourly component temperature and radiation temperature in each direction of two seasons of summer and winter, and calculated hemispherical integral temperature and TC. The conclusion is obtained by examining the relationship of directional radiation temperature, hemispherical integral temperature and TC: (1 There is an optimal angle of radiation temperature approaching the TC in a single observation direction when viewing zenith angle is 45–60°, the viewing azimuth near the vertical surface of the sun main plane, the average absolute difference is about 1.1 K in the daytime. (2 There are several (3–5 times directional temperatures of different view angle, under the situation of using the thermal radiation directionality kernel model can more accurately calculate the hemispherical integral temperature close to TC, the mean absolute error is about 1.0 K in the daytime. This study proposed simple and effective strategies for estimating TC by remote sensing, which are expected to improve the quantitative level of remote sensing of urban thermal environment.

  19. Quasimonochromatic x-ray computed tomography by the balanced filter method using a conventional x-ray source

    International Nuclear Information System (INIS)

    Saito, Masatoshi

    2004-01-01

    A quasimonochromatic x-ray computed tomography (CT) system utilizing balanced filters has recently been developed for acquiring quantitative CT images. This system consisted of basic components such as a conventional x-ray generator for radiography, a stage for mounting and rotating objects, and an x-ray line sensor camera. Metallic sheets of Er and Yb were used as the balanced filters for obtaining quasimonochromatic incident x rays that include the characteristic lines of the W Kα doublet from a tungsten target. The mean energy and energy width of the quasimonochromatic x rays were determined to be 59.0 and 1.9 keV, respectively, from x-ray spectroscopic measurements using a high-purity Ge detector. The usefulness of the present x-ray CT system was demonstrated by obtaining spatial distributions of the linear attenuation coefficients of three selected samples--a 20 cm diameter cylindrical water phantom, a 3.5 cm diameter aluminum rod, and a human head phantom. The results clearly indicate that this apparatus is surprisingly effective for estimating the distribution of the linear attenuation coefficients without any correction of the beam-hardening effect. Thus, implementing the balanced filter method on an x-ray CT scanner has promise in producing highly quantitative CT images

  20. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth#

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-01-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%). PMID:27604860

  1. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth.

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-09-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%).

  2. Comparison of Microleakage of Glass Ionomer Restoration in Primary Teeth Prepared by Er: YAG Laser and the Conventional Method

    Directory of Open Access Journals (Sweden)

    M. Ghandehari

    2012-01-01

    Full Text Available Objective: One of the main criteria in evaluating the restorative materials is the degree of microleakage. The aim of this study was to compare the microleakage of glass ionomer restored cavities prepared by Er:YAG laser or turbine and bur.Materials and Methods: Twenty extracted caries-free deciduous posterior teeth were selected for this study. The teeth were randomly divided into two groups for cavity preparation. Cavities in group one were prepared by high speed turbine and bur. In the second group, Er:YAG laser with a 3W output power, 300 mJ energy and 10 Hz frequency was used. Cavities were restored with GC Fuji II LC. After thermocycling, the samples were immersed into 0.5% methylene blue solution. They were sectioned for examination under optic microscope.Results: The Wilcoxon signed ranks test showed no significant difference between microleakage of the laser group and the conventional group (P>0.05.Conclusion: Er:YAG laser with its advantages in pediatric dentistry may be suggested as an alternative device for cavity preparation.Key Words: Er:YAG laser, Glass ionomer, Microleakage

  3. Detection of fungi by conventional methods and semi-nested PCR in patients with presumed fungal keratitis.

    Science.gov (United States)

    Haghani, I; Amirinia, F; Nowroozpoor-Dailami, K; Shokohi, T

    2015-06-01

    Fungal keratitis is a suppurative, ulcerative, and sight-threatening infection of the cornea that sometimes leads to blindness. The aims of this study were: recuperating facilities for laboratory diagnosis, determining the causative microorganisms, and comparing conventional laboratory diagnostic tools and semi-nested PCR. Sampling was conducted in patients with suspected fungal keratitis. Two corneal scrapings specimens, one for direct smear and culture and the other for semi- nested PCR were obtained. Of the 40 expected cases of mycotic keratitis, calcofluor white staining showed positivity in 25%, culture in 17.5%, KOH in 10%, and semi-nested PCR in 27.5%. The sensitivities of semi-nested PCR, KOH, and CFW were 57.1%, 28.5%, and 42% while the specificities were 78.7%, 94%, and 78.7%, respectively. The time taken for PCR assay was 4 to 8 hours, whereas positive fungal cultures took at least 5 to 7 days. Due to the increasing incidence of fungal infections in people with weakened immune systems, uninformed using of topical corticosteroids and improper use of contact lens, fast diagnosis and accurate treatment of keratomycosis seems to be essential . Therefore, according to the current study, molecular methods can detect mycotic keratitis early and correctly leading to appropriate treatment.

  4. Repairability of Compomers with Different Methods of Surface Conditioning

    Directory of Open Access Journals (Sweden)

    P.Samimi

    2005-06-01

    Full Text Available Statement of Problem: Considering the cost and amount of time and also the quantity of tooth loss in the process of cavity preparation, repair of the restoration instead of itsreplacement would be much more efficient.Purpose: The aim of this study was to determine the effect of different methods of surface conditioning on the shear bond strength of repaired compomers.Materials and Methods: Sixty blocks of compomer were prepared in acrylic molds and then they were randomly divided into five groups of 12. Group I (control groupreceived no treatment. The remaining samples were immersed in 37 ºC distilled water for one week, then the surfaces were roughened with a coarse diamond bur. Samples ineach group were prepared by different surface treatment and conditioning: In group II specimens were conditioned with 35% phosphoric acid for 20s. Specimens in group III were etched with 10% polyacrylic acid for 20s. In group IV 1.23% acidulated phosphatefluoride was applied for 30s, and compomer surfaces were sandblasted with 50μm Al2O3 powder in group V. After the initial preparations, all groups were treated with silane and resin before bonding of the second mix of compomer. Shear forces were applied with a universal testing machine at a cross-head speed of 5mm/min. The data were analyzed using one-way ANOVA and Duncan's multiple range tests.Results: The mean shear bond strengths and standard deviations (in parentheses for groups I to V were 31.56(10.86, 20.02(5.49, 17.74(7.34, 19.31(4.31 and 27.7(6.33MPa, respectively. The mean bond strengths for Groups I and V were significantly higher than that of the other groups (P<0.05.Conclusion: The results showed that among the surface treatments used in this study,sandblasting with alumina could be the best surface preparation method for repairing compomer restorations.

  5. POSITIONING ANALYSIS OF ISLAMIC BANK vis-àvis CONVENTIONAL BANK IN INDONESIA USING PARAMETRIC SFA AND DFA METHODS15

    Directory of Open Access Journals (Sweden)

    Ir Ascarya

    2014-03-01

    Full Text Available This study will measure and compare the efficiency of Conventional and Islamic banks in Indonesia using parametric approach stochastic frontier approach (SFA and distribution free approach (DFA. These measurements will provide comprehensive and robust results of efficiency of individual bank compare to its peer group. The results using parametric SFA show that in 2002, conventional banks (0.79 were slightly more efficient than Islamic banks (0.77, while in 2003, the efficiency of Islamic banks improved to 0.84 and the efficiency of conventional banks worsen to 0.76, so that Islamic banks have become more efficient than conventional banks. Conventional and Islamic banks have been improving and converged to the highest level of efficiency (1.00 since 2004. The DFA results show that conventional banks (0.89 are only slightly more efficient than Islamic banks (0.87. Conventional public bank (0.93 is the most efficient, while Islamic regional bank (0.84 is the least efficient. Moreover, efficient banks (conventional and Islamic do not always have lower OCOI (operating costs divided by operating income, while banks with better OCOI usually are more profitable (have better return on assets or ROA. Therefore, technically, Islamic banks have shown their readiness to compete head to head with their conventional counterparts. However, other aspects, such as, number of networks and branches, service quality, convenience, products and services provided, human resources, and pricing, should have become the next priorities for improvements.JEL Classification : C10, C33, G21, G28Keywords : Islamic Banking, Efficiency, Stochastic Frontier Approach, Distribution Free Approach

  6. Narrowing of the middle cerebral artery: artificial intelligence methods and comparison of transcranial color coded duplex sonography with conventional TCD.

    Science.gov (United States)

    Swiercz, Miroslaw; Swiat, Maciej; Pawlak, Mikolaj; Weigele, John; Tarasewicz, Roman; Sobolewski, Andrzej; Hurst, Robert W; Mariak, Zenon D; Melhem, Elias R; Krejza, Jaroslaw

    2010-01-01

    The goal of the study was to compare performances of transcranial color-coded duplex sonography (TCCS) and transcranial Doppler sonography (TCD) in the diagnosis of the middle cerebral artery (MCA) narrowing in the same population of patients using statistical and nonstatistical intelligent models for data analysis. We prospectively collected data from 179 consecutive routine digital subtraction angiography (DSA) procedures performed in 111 patients (mean age 54.17+/-14.4 years; 59 women, 52 men) who underwent TCD and TCCS examinations simultaneously. Each patient was examined independently using both ultrasound techniques, 267 M1 segments of MCA were assessed and narrowings were classified as 50% lumen reduction. Diagnostic performance was estimated by two statistical and two artificial neural networks (ANN) classification methods. Separate models were constructed for the TCD and TCCS sonographic data, as well as for detection of "any narrowing" and "severe narrowing" of the MCA. Input for each classifier consisted of the peak-systolic, mean and end-diastolic velocities measured with each sonographic method; the output was MCA narrowing. Arterial narrowings less or equal 50% of lumen reduction were found in 55 and >50% narrowings in 26 out of 267 arteries, as indicated by DSA. In the category of "any narrowing" the rate of correct assignment by all models was 82% to 83% for TCCS and 79% to 81% for TCD. In the diagnosis of >50% narrowing the overall classification accuracy remained in the range of 89% to 90% for TCCS data and 90% to 91% for TCD data. For the diagnosis of any narrowing, the sensitivity of the TCCS was significantly higher than that of the TCD, while for diagnosis of >50% MCA narrowing, sensitivity of the TCCS was similar to sensitivity of the TCD. Our study showed that TCCS outperforms conventional TCD in detection of diagnosis of >50% MCA narrowing. (E-mail: jaroslaw.krejza@uphs.upenn.edu).

  7. Conventional versus molecular methods for diagnosis of tuberculosis in a tertiary care center: A study from Punjab

    Directory of Open Access Journals (Sweden)

    Shavi Nagpal

    2016-01-01

    Full Text Available Background: A fast and accurate diagnosis is necessary to control and eliminate tuberculosis (TB. There have been various studies evaluating the efficacy of polymerase chain reaction (PCR testing in clinical practice. Most of these studies have found PCR as a useful tool to diagnose TB and more so for the extra-pulmonary cases. Aims and Objectives: The aim of the study was to evaluate the results of TB by real-time PCR versus the conventional methods of diagnosis in a tertiary care center in Punjab. Materials and Methods: This study was done in a tertiary care center of Punjab to look for the results of clinical samples tested for TB using PCR, Ziehl–Neelsen staining and culture on Lowenstein–Jensen medium. 16S rRNA gene was used for Mycobacterium tuberculosis detection in PCR. This study included all samples tested for TB from July 2015 to October 2015. Results: A total of 214 samples were tested for TB using smear microscopy, culture and PCR (including 194 [90.6%] extra-pulmonary and 20 [9.3%] pulmonary samples. These included 76 cerebrospinal fluid, 30 pleural fluid, 42 tissues, 17 ascitic fluid, 13 urine, 15 bronchoalveolar lavage (BAL, 16 pus, and 5 sputum samples. Smear microscopy was positive in a total of 4 samples out of 214 (1.8%, which included 2 sputum, 1 tissue, and 1 ascitic fluid samples, while culture was positive for 6 samples (2.8% which included 2 sputum, 1 pus, 1 BAL, 1 tissue, and 1 ascitic fluid sample. The TB PCR results were positive in a total of 71 (33.1% samples out of 214. In addition, three samples also tested positive for Mycobacteria other than TB. Conclusion: PCR is a very rapid and accurate diagnostic tool for early detection of TB in particularly for extrapulmonary TB.

  8. Non thermal plasma surface cleaner and method of use

    KAUST Repository

    Neophytou, Marios

    2017-09-14

    Described herein are plasma generation devices and methods of use of the devices. The devices can be used for the cleaning of various surfaces and/or for inhibiting or preventing the accumulation of particulates, such as dust, or moisture on various surfaces. The devices can be used to remove dust and other particulate contaminants from solar panels and windows, or to avoid or minimize condensation on various surfaces. In an embodiment a plasma generation device is provided. The plasma generation device can comprise: a pair of electrodes (1,2) positioned in association with a surface of a dielectric substrate (3). The pair of electrodes (1,2) can comprise a first electrode (1) and a second electrode (2). The first electrode and second electrode can be of different sizes, one of the electrodes being smaller than the other of the electrodes. The first electrode and second electrode can be separated by a distance and electrically connected to a voltage source (4,5).

  9. Non thermal plasma surface cleaner and method of use

    KAUST Repository

    Neophytou, Marios; Lacoste, Deanna A.; Kirkus, Mindaugas

    2017-01-01

    Described herein are plasma generation devices and methods of use of the devices. The devices can be used for the cleaning of various surfaces and/or for inhibiting or preventing the accumulation of particulates, such as dust, or moisture on various surfaces. The devices can be used to remove dust and other particulate contaminants from solar panels and windows, or to avoid or minimize condensation on various surfaces. In an embodiment a plasma generation device is provided. The plasma generation device can comprise: a pair of electrodes (1,2) positioned in association with a surface of a dielectric substrate (3). The pair of electrodes (1,2) can comprise a first electrode (1) and a second electrode (2). The first electrode and second electrode can be of different sizes, one of the electrodes being smaller than the other of the electrodes. The first electrode and second electrode can be separated by a distance and electrically connected to a voltage source (4,5).

  10. Surface charge method for molecular surfaces with curved areal elements I. Spherical triangles

    Science.gov (United States)

    Yu, Yi-Kuo

    2018-03-01

    Parametrizing a curved surface with flat triangles in electrostatics problems creates a diverging electric field. One way to avoid this is to have curved areal elements. However, charge density integration over curved patches appears difficult. This paper, dealing with spherical triangles, is the first in a series aiming to solve this problem. Here, we lay the ground work for employing curved patches for applying the surface charge method to electrostatics. We show analytically how one may control the accuracy by expanding in powers of the the arc length (multiplied by the curvature). To accommodate not extremely small curved areal elements, we have provided enough details to include higher order corrections that are needed for better accuracy when slightly larger surface elements are used.

  11. Investigation of synthetic aperture methods in ultrasound surface imaging using elementary surface types.

    Science.gov (United States)

    Kerr, W; Pierce, S G; Rowe, P

    2016-12-01

    Synthetic aperture imaging methods have been employed widely in recent research in non-destructive testing (NDT), but uptake has been more limited in medical ultrasound imaging. Typically offering superior focussing power over more traditional phased array methods, these techniques have been employed in NDT applications to locate and characterise small defects within large samples, but have rarely been used to image surfaces. A desire to ultimately employ ultrasonic surface imaging for bone surface geometry measurement prior to surgical intervention motivates this research, and results are presented for initial laboratory trials of a surface reconstruction technique based on global thresholding of ultrasonic 3D point cloud data. In this study, representative geometry artefacts were imaged in the laboratory using two synthetic aperture techniques; the Total Focusing Method (TFM) and the Synthetic Aperture Focusing Technique (SAFT) employing full and narrow synthetic apertures, respectively. Three high precision metallic samples of known geometries (cuboid, sphere and cylinder) which featured a range of elementary surface primitives were imaged using a 5MHz, 128 element 1D phased array employing both SAFT and TFM approaches. The array was manipulated around the samples using a precision robotic positioning system, allowing for repeatable ultrasound derived 3D surface point clouds to be created. A global thresholding technique was then developed that allowed the extraction of the surface profiles, and these were compared with the known geometry samples to provide a quantitative measure of error of 3D surface reconstruction. The mean errors achieved with optimised SAFT imaging for the cuboidal, spherical and cylindrical samples were 1.3mm, 2.9mm and 2.0mm respectively, while those for TFM imaging were 3.7mm, 3.0mm and 3.1mm, respectively. These results were contrary to expectations given the higher information content associated with the TFM images. However, it was

  12. Polymer surface modification using UV treatment for attachment of natamycin and the potential applications for conventional food cling wrap (LDPE)

    Science.gov (United States)

    Shin, Joongmin; Liu, Xiaojing; Chikthimmah, Naveen; Lee, Youn Suk

    2016-11-01

    The purpose of this study was to develop an active non-migratory antifungal Low Density Polyethylene (LDPE) polymer for use in food packaged applications. The functional acrylic acid monomer was grafted on the LDPE film surface by photo-initiated graft polymerization using Ultra Violet light irradiation (from 0 to 5 min). Natamycin, an antifungal agent, was applied to the treated film to bind with the pendent functional groups and were evaluated its performance against mold and yeast. The grafted amounts were determined by gravimetric measurement and dye absorbance. Attenuated Total Reflectance/Fourier Transfer Infrared Spectroscopy, scanning electron microscopy, mechanical strength test was used to characterize film properties. The antifungal efficacy of the film was evaluated with Saccharomyces cerevisiae and Penicillium chrysogenum on growth media and fresh cut cantaloupe. The amounts of the grafted group were increased with the longer ultraviolet exposure time. The amount of the grafted natamycin on the treated film was up to 49.87 μg/cm2, and the film inhibited mycelium formation of P. chrysogenum spores by over 60%. Due to the thickness of the film (less than 12.25 μm), long time UV exposure decrease the film's mechanical strength. The application of such non-migratory active packaging film represents a promising approach to maintaining food quality with reduced additive.

  13. Corrosion protection of ENIG surface finishing using electrochemical methods

    International Nuclear Information System (INIS)

    Bui, Q.V.; Nam, N.D.; Choi, D.H.; Lee, J.B.; Lee, C.Y.; Kar, A.; Kim, J.G.; Jung, S.B.

    2010-01-01

    Four types of thin film coating were carried out on copper for electronic materials by the electroless plating method at a pH range from 3 to 9. The coating performance was evaluated by electrochemical impedance spectroscopy and potentiodynamic polarization testing in a 3.5 wt.% NaCl solution. In addition, atomic force microscopy and X-ray diffraction were also used to analyze the coating surfaces. The electrochemical behavior of the coatings was improved using the electroless nickel plating solution of pH 5. The electroless nickel/immersion gold on the copper substrate exhibited high protective efficiency, charge transfer resistance and very low porosity, indicating an increase in corrosion resistance. Atomic force microscopy and X-ray diffraction analyses confirmed the surface uniformity and the formation of the crystalline-refined NiP {1 2 2} phase at pH 5.

  14. Apparatus and method for carbon fiber surface treatment

    Science.gov (United States)

    Paulauskas, Felix L; Sherman, Daniel M

    2014-06-03

    An apparatus and method for enhancing the surface energy and/or surface chemistry of carbon fibers involves exposing the fibers to direct or indirect contact with atmospheric pressure plasma generated using a background gas containing at least some oxygen or other reactive species. The fiber may be exposed directly to the plasma, provided that the plasma is nonfilamentary, or the fiber may be exposed indirectly through contact with gases exhausting from a plasma discharge maintained in a separate volume. In either case, the process is carried out at or near atmospheric pressure, thereby eliminating the need for vacuum equipment. The process may be further modified by moistening the fibers with selected oxygen-containing liquids before exposure to the plasma.

  15. Economic method for helical gear flank surface characterisation

    Science.gov (United States)

    Koulin, G.; Reavie, T.; Frazer, R. C.; Shaw, B. A.

    2018-03-01

    Typically the quality of a gear pair is assessed based on simplified geometric tolerances which do not always correlate with functional performance. In order to identify and quantify functional performance based parameters, further development of the gear measurement approach is required. Methodology for interpolation of the full active helical gear flank surface, from sparse line measurements, is presented. The method seeks to identify the minimum number of line measurements required to sufficiently characterise an active gear flank. In the form ground gear example presented, a single helix and three profile line measurements was considered to be acceptable. The resulting surfaces can be used to simulate the meshing engagement of a gear pair and therefore provide insight into functional performance based parameters. Therefore the assessment of the quality can be based on the predicted performance in the context of an application.

  16. An experimental method for making spectral emittance and surface temperature measurements of opaque surfaces

    International Nuclear Information System (INIS)

    Moore, Travis J.; Jones, Matthew R.; Tree, Dale R.; Daniel Maynes, R.; Baxter, Larry L.

    2011-01-01

    An experimental procedure has been developed to make spectral emittance and temperature measurements. The spectral emittance of an object is calculated using measurements of the spectral emissive power and of the surface temperature of the object obtained using a Fourier transform infrared (FTIR) spectrometer. A calibration procedure is described in detail which accounts for the temperature dependence of the detector. The methods used to extract the spectral emissive power and surface temperature from measured infrared spectra were validated using a blackbody radiator at known temperatures. The average error in the measured spectral emittance was 2.1% and the average difference between the temperature inferred from the recorded spectra and the temperature indicated on the blackbody radiator was 1.2%. The method was used to measure the spectral emittance of oxidized copper at various temperatures.

  17. The estimation of dynamic contact angle of ultra-hydrophobic surfaces using inclined surface and impinging droplet methods

    Science.gov (United States)

    Jasikova, Darina; Kotek, Michal

    2014-03-01

    The development of industrial technology also brings with optimized surface quality, particularly where there is contact with food. Application ultra-hydrophobic surface significantly reduces the growth of bacteria and facilitates cleaning processes. Testing and evaluation of surface quality are used two methods: impinging droplet and inclined surface method optimized with high speed shadowgraphy, which give information about dynamic contact angle. This article presents the results of research into new methods of measuring ultra-hydrophobic patented technology.

  18. Roman sophisticated surface modification methods to manufacture silver counterfeited coins

    Science.gov (United States)

    Ingo, G. M.; Riccucci, C.; Faraldi, F.; Pascucci, M.; Messina, E.; Fierro, G.; Di Carlo, G.

    2017-11-01

    By means of the combined use of X-ray photoelectron spectroscopy (XPS), optical microscopy (OM) and scanning electron microscopy (SEM) coupled with energy dispersive X-ray spectroscopy (EDS) the surface and subsurface chemical and metallurgical features of silver counterfeited Roman Republican coins are investigated to decipher some aspects of the manufacturing methods and to evaluate the technological ability of the Roman metallurgists to produce thin silver coatings. The results demonstrate that over 2000 ago important advances in the technology of thin layer deposition on metal substrates were attained by Romans. The ancient metallurgists produced counterfeited coins by combining sophisticated micro-plating methods and tailored surface chemical modification based on the mercury-silvering process. The results reveal that Romans were able systematically to chemically and metallurgically manipulate alloys at a micro scale to produce adherent precious metal layers with a uniform thickness up to few micrometers. The results converge to reveal that the production of forgeries was aimed firstly to save expensive metals as much as possible allowing profitable large-scale production at a lower cost. The driving forces could have been a lack of precious metals, an unexpected need to circulate coins for trade and/or a combinations of social, political and economic factors that requested a change in money supply. Finally, some information on corrosion products have been achieved useful to select materials and methods for the conservation of these important witnesses of technology and economy.

  19. Optimizing pressurized liquid extraction of microbial lipids using the response surface method.

    Science.gov (United States)

    Cescut, J; Severac, E; Molina-Jouve, C; Uribelarrea, J-L

    2011-01-21

    Response surface methodology (RSM) was used for the determination of optimum extraction parameters to reach maximum lipid extraction yield with yeast. Total lipids were extracted from oleaginous yeast (Rhodotorula glutinis) using pressurized liquid extraction (PLE). The effects of extraction parameters on lipid extraction yield were studied by employing a second-order central composite design. The optimal condition was obtained as three cycles of 15 min at 100°C with a ratio of 144 g of hydromatrix per 100 g of dry cell weight. Different analysis methods were used to compare the optimized PLE method with two conventional methods (Soxhlet and modification of Bligh and Dyer methods) under efficiency, selectivity and reproducibility criteria thanks to gravimetric analysis, GC with flame ionization detector, High Performance Liquid Chromatography linked to Evaporative Light Scattering Detector (HPLC-ELSD) and thin-layer chromatographic analysis. For each sample, the lipid extraction yield with optimized PLE was higher than those obtained with referenced methods (Soxhlet and Bligh and Dyer methods with, respectively, a recovery of 78% and 85% compared to PLE method). Moreover, the use of PLE led to major advantages such as an analysis time reduction by a factor of 10 and solvent quantity reduction by 70%, compared with traditional extraction methods. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Methods on estimation of the evaporation from water surface

    International Nuclear Information System (INIS)

    Trajanovska, Lidija; Tanushevska, Dushanka; Aleksovska, Nina

    2001-01-01

    The whole world water supply on the Earth is in close dependence on hydrological cycle connected with water circulation at Earth-Atmosphere route through evaporation, precipitation and water runoff. Evaporation exists worldwide where the atmosphere is unsatiated of water steam (when there is humidity in short supply) and it depends on climatic conditions in some regions. The purpose of this paper is to determine a method for estimation of evaporation of natural water surface in our areas, that means its determination as exact as possible. (Original)

  1. Measurement of annual dose on porcelain using surface TLD method

    International Nuclear Information System (INIS)

    Xia Junding; Wang Weida; Leung, P.L.

    2001-01-01

    In order to improve accuracy of TL authentication test for porcelain, a method of measurement of annual dose using ultrathin (CaSO 4 :Tm) dosage layer on porcelain was studied. The TLD was placed on the part of porcelain without glaze. A comparison of measurement of annual dose for surface TLD, inside TLD and alpha counting on porcelain was made. The results show that this technique is suitable for measuring annual dose and improving accuracy of TL authentication test for both porcelain and pottery

  2. Dumping convention

    International Nuclear Information System (INIS)

    Roche, P.

    1992-01-01

    Sea dumping of radioactive waste has, since 1983, been precluded under a moratorium established by the London Dumping Convention. Pressure from the nuclear industry to allow ocean dumping of nuclear waste is reported in this article. (author)

  3. Novel method for the simultaneous estimation of density and surface tension of liquids

    International Nuclear Information System (INIS)

    Thirunavukkarasu, G.; Srinivasan, G.J.

    2003-01-01

    The conventional Hare's apparatus generally used for the determination of density of liquids has been modified by replacing its vertical arms (glass tubes) with capillary tubes of 30 cm length and 0.072 cm diameter. When the columns of liquids are drawn through the capillary tubes with reduced pressure at the top of the liquid columns and kept at equilibrium with the atmospheric pressure acting on the liquid surface outside the capillary tubes, the downward pressure due to gravity of the liquid columns has to be coupled with the pressure arising due to the effect of surface tension of the liquids. A fresh expression for the density and surface tension of liquids has been arrived at while equating the pressure balancing system for the two individual liquid columns of the modified Hare's apparatus. The experimental results showed that the proposed method is precise and accurate in the simultaneous estimation of density and surface tension of liquids, with an error of less than 5%

  4. Methods To Identify Aptamers against Cell Surface Biomarkers

    Directory of Open Access Journals (Sweden)

    Frédéric Ducongé

    2011-09-01

    Full Text Available Aptamers are nucleic acid-based ligands identified through a process of molecular evolution named SELEX (Systematic Evolution of Ligands by Exponential enrichment. During the last 10-15 years, numerous aptamers have been developed specifically against targets present on or associated with the surface of human cells or infectious pathogens such as viruses, bacteria, fungi or parasites. Several of the aptamers have been described as potent probes, rivalling antibodies, for use in flow cytometry or microscopy. Some have also been used as drugs by inhibiting or activating functions of their targets in a manner similar to neutralizing or agonistic antibodies. Additionally, it is straightforward to conjugate aptamers to other agents without losing their affinity and they have successfully been used in vitro and in vivo to deliver drugs, siRNA, nanoparticles or contrast agents to target cells. Hence, aptamers identified against cell surface biomarkers represent a promising class of ligands. This review presents the different strategies of SELEX that have been developed to identify aptamers for cell surface-associated proteins as well as some of the methods that are used to study their binding on living cells.

  5. A new surface resistance measurement method with ultrahigh sensitivity

    International Nuclear Information System (INIS)

    Liang, Changnian.

    1993-01-01

    A superconducting niobium triaxial cavity has been designed and fabricated to study residual surface resistance of planar superconducting materials. The edge of a 25.4 mm or larger diameter sample in the triaxial cavity is located outside the strong field region. Therefore, the edge effects and possible losses between the thin film and the substrate have been minimized, ensuring that induced RF losses are intrinsic to the test material. The fundamental resonant frequency of the cavity is the same as the working frequency of CEBAF cavities. The cavity has a compact size compared to its TE 011 counterpart, which makes it more sensitive to the sample's loss. For even higher sensitivity, a calorimetry method has been used to measure the RF losses on the superconducting sample. At 2 K, a 2 μK temperature change can be resolved by using carbon resistor sensors. The temperature distribution caused by RF heating is measured by 16 carbon composition resistor sensors. A 0.05 μW heating power can be detected as such a resolution, which translates to a surface resistance of 0.02 nΩ at a surface magnetic field of 52 Oe. This is the most sensitive device for surface resistance measurements to date. In addition, losses due to the indium seal, coupling probes, field emission sites other than the sample, and all of the high field resonator surface, are excluded in the measurement. Surface resistance of both niobium and high-Tc superconducting thin films has been measured. A low R s of 35.2 μΩ was measured for a 25.4 mm diameter YBa 2 Cu 3 O 7 thin film at 1.5 GHz and at 2 K. The measurement result is the first result for a large area epitaxially grown thin film sample at such a low RF frequency. The abrupt disappearance of multipacting between two parallel plates has been observed and monitored with the 16 temperature mapping sensors. Field emission or some field dependent anomalous RF losses on the niobium plate have also been observed

  6. Implementation of surface hopping molecular dynamics using semiempirical methods

    International Nuclear Information System (INIS)

    Fabiano, E.; Keal, T.W.; Thiel, W.

    2008-01-01

    A molecular dynamics driver and surface hopping algorithm for nonadiabatic dynamics has been implemented in a development version of the MNDO semiempirical electronic structure package. The required energies, gradients and nonadiabatic couplings are efficiently evaluated on the fly using semiempirical configuration interaction methods. The choice of algorithms for the time evolution of the nuclear motion and quantum amplitudes is discussed, and different schemes for the computation of nonadiabatic couplings are analysed. The importance of molecular orbital tracking and electronic state following is underlined in the context of configuration interaction calculations. The method is applied to three case studies (ethylene, methaniminium ion, and methanimine) using the orthogonalization corrected OM2 Hamiltonian. In all three cases decay times and dynamics paths similar to high-level ab initio results are obtained

  7. Guidelines for the verification and validation of expert system software and conventional software: Volume 2, Survey and assessment of conventional software verification and validation methods Revision 1, Final report

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.H.; Hayes, J.E.; Mirsky, S.M.

    1995-05-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit Metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  8. A Method to Identify Flight Obstacles on Digital Surface Model

    Institute of Scientific and Technical Information of China (English)

    ZHAO Min; LIN Xinggang; SUN Shouyu; WANG Youzhi

    2005-01-01

    In modern low-altitude terrain-following guidance, a constructing method of the digital surface model (DSM) is presented in the paper to reduce the threat to flying vehicles of tall surface features for safe flight. The relationship between an isolated obstacle size and the intervals of vertical- and cross-section in the DSM model is established. The definition and classification of isolated obstacles are proposed, and a method for determining such isolated obstacles in the DSM model is given. The simulation of a typical urban district shows that when the vertical- and cross-section DSM intervals are between 3 m and 25 m, the threat to terrain-following flight at low-altitude is reduced greatly, and the amount of data required by the DSM model for monitoring in real time a flying vehicle is also smaller. Experiments show that the optimal results are for an interval of 12.5 m in the vertical- and cross-sections in the DSM model, with a 1:10 000 DSM scale grade.

  9. Comparison Of INAA Methods (Long Conventional, Cyclic And Pseudo-Cyclic) For The Determination Of Se In Biological Samples

    International Nuclear Information System (INIS)

    Sarheel, A.

    2004-01-01

    Selenium content in serum blood, sample were received from international comparison programme (SABC) has been determined by Cyclic irradiation, pseudo-cyclic irradiation and long irradiation conventional Instrumental neutron activation analysis through the 162 keV gamma ray of the 77m Se nuclide for both cyclic and pseudo-cyclic and 264 keV gamma ray of 75 Se nuclide for conventional (long irradiation). The CINAA involve irradiation of samples for 20 s, decay for 15 s and counting for 20 s, samples recycling four times to improve the precision. The PCINAA involve irradiation of samples for 20 s, decay for 20 s and counting for 30s, samples recycling four times day by day. The Conventional (long irradiation) involve irradiation of samples for 20 hr (1 week), decay for 4 weeks and counting for 20 hr. The accuracy has been evaluated by analyzing the certified reference materials. (Author)

  10. Comparison of different surface quantitative analysis methods. Application to corium

    International Nuclear Information System (INIS)

    Guilbaud, N.; Blin, D.; Perodeaud, Ph.; Dugne, O.; Gueneau, Ch.

    2000-01-01

    In case of a severe hypothetical accident in a pressurized water reactor, the reactor assembly melts partially or completely. The material formed, called corium, flows out and spreads at the bottom of the reactor. To limit and control the consequences of such an accident, the specifications of the O-U-Zr basic system must be known accurately. To achieve this goal, the corium mix was melted by electron bombardment at very high temperature (3000 K) followed by quenching of the ingot in the Isabel 1 evaporator. Metallographic analyses were then required to validate the thermodynamic databases set by the Thermo-Calc software. The study consists in defining an overall surface quantitative analysis method that is fast and reliable, in order to determine the overall corium composition. The analyzed ingot originated in a [U+Fe+Y+UO 2 +ZrO 2 ) mix, with a total mass of 2253.7 grams. Several successive heating with average power were performed before a very brief plateau at very high temperature, so that the ingot was formed progressively and without any evaporation liable to modify its initial composition. The central zone of the ingot was then analyzed by qualitative and quantitative global surface methods, to yield the volume composition of the analyzed zone. Corium sample analysis happens to be very complex because of the variety and number of elements present, and also because of the presence of oxygen in a heavy element like the uranium based matrix. Three different global quantitative surface analysis methods were used: global EDS analysis (Energy Dispersive Spectrometry), with SEM, global WDS analysis (Wavelength Dispersive Spectrometry) with EPMA, and coupling of image analysis with EDS or WDS point spectroscopic analyses. The difficulties encountered during the study arose from sample preparation (corium is very sensitive to oxidation), and the choice of acquisition parameters of the images and analyses. The corium sample studied consisted of two zones displaying

  11. Evaluation of Surface Treatment Methods on the Bond Strength of Zirconia Ceramics Systems, Resin Cements and Tooth Surface

    Directory of Open Access Journals (Sweden)

    Akkuş Emek

    2015-07-01

    Full Text Available Objectives: To compare the effects of airborne-particle abrasion (APA and tribochemical silica coating (TSC surface treatment methods on the shear bond strength of zirconia ceramics systems, resin cements and tooth surface

  12. Delta self-consistent field method to obtain potential energy surfaces of excited molecules on surfaces

    DEFF Research Database (Denmark)

    Gavnholt, Jeppe; Olsen, Thomas; Engelund, Mads

    2008-01-01

    is a density-functional method closely resembling standard density-functional theory (DFT), the only difference being that in Delta SCF one or more electrons are placed in higher lying Kohn-Sham orbitals instead of placing all electrons in the lowest possible orbitals as one does when calculating the ground......-state energy within standard DFT. We extend the Delta SCF method by allowing excited electrons to occupy orbitals which are linear combinations of Kohn-Sham orbitals. With this extra freedom it is possible to place charge locally on adsorbed molecules in the calculations, such that resonance energies can...... be estimated, which is not possible in traditional Delta SCF because of very delocalized Kohn-Sham orbitals. The method is applied to N2, CO, and NO adsorbed on different metallic surfaces and compared to ordinary Delta SCF without our modification, spatially constrained DFT, and inverse...

  13. Efficacious and safe orotracheal intubation for laboratory mice using slim torqueable guidewire-based technique: comparisons between a modified and a conventional method.

    Science.gov (United States)

    Su, Chieh-Shou; Lai, Hui-Chin; Wang, Chih-Yen; Lee, Wen-Lieng; Wang, Kuo-Yang; Yang, Ya-Ling; Wang, Li-Chun; Liu, Chia-Ning; Liu, Tsun-Jui

    2016-01-18

    Tracheal intubation of laboratory mice remains essential yet challenging for most researchers. The aim of this study was to investigate whether this procedure can be more efficiently and safely accomplished by a novel method using slim and torqueable guidewires to guide access to the trachea. This study was carried out in an animal laboratory affiliated to a tertiary medical center. Mice weighing 22 to 28 g were subjected to various open-chest experiments after being anesthetized with intraperitoneal ketamine (100 mg/kg) and lidocaine hydrochloride (10 mg/kg). The oropharyngeal cavity was opened with angled tissue forceps, and the trachea was transilluminated using an external light. The vocal cords were then crossed using either the Conventional method with a 38-mm-long, end-blunted stiff needle as a guide for insertion of a 22-gauge, 25-mm-long intravenous catheter into the trachea, or the Modified method utilizing using a 0.014-inch-thin torqueable wire as the guide to introduce an identical tube over it into the trachea. The epithelial integrity of the trachea was later examined histologically when the animals were sacrificed either immediately after the surgery or at 28 days post-surgery, depending on the corresponding research protocols. Orotracheal intubation was successfully completed in all mice using either the Conventional (N = 42) or the Modified method (N = 50). With the Modified method, intubation took less time (1.73 vs. 2.17 min, Modified vs. Conventional, p Conventional method. Histological analysis revealed a significantly lower incidence of immediate (0% vs. 39%, p Conventional method. Tracheal intubation for laboratory mice can be completed efficiently, safely and atraumatically using the proposed Modified method employing readily available inexpensive instruments.

  14. Determination of Consumers'Preferences for Conventional, Healthy and Organic Cucumbers in Isfahan City Using Choice Experiment Method

    Directory of Open Access Journals (Sweden)

    A. Sandoghi

    2016-03-01

    Full Text Available Introduction: Continuing growth in human population and consumptionmeans that the global demand for food will increase for at least another 40 years and that the world needs 70-100% more food by 2050. Environmental issues such as climate change, depletion of naturalresources and biodiversity loss increasingly threaten the welfare ofhuman civilization. Confronting these threats requires, among otherthings, behavioral changes in citizens, governments and companies.Farmers and other producers are responding to consumer concerns about pesticides by creating new marketing opportunities for products grown with environmentally sound practices. Environmental economists are increasingly interested in better understanding of how people cognitively organize their beliefs and attitudes towards environmental change in order to identify key motives and barriers that stimulate or prevent action.The purpose of the presentinvestigation is to evaluate the consumers’ preferences and factors affecting their choice for conventional, healthy and organic cucumbers in Isfahan, Iran. Materials and Methods: Data were collected on a sample of 230consumers in 2013 by using the proportionate stratification samplingmethod through face-to-face interviews based on a comprehensive structured questionnaire. Before the survey, the reliability and validity of the questionnaire were initially evaluated in a pre-test study, respectively, by using Cronbach’s alpha coefficient and Kaiser-Meyer-Olkin (KMO criteria. Individual preferences were uncovered in choice experiment method (CEM by a contingent ranking experiment. In a contingent ranking experiment, respondents are required to rank a set of alternative options, characterized by a number of attributes, which are offered at different levels across the options.Data were analyzed by multinomial logit models. The approach consists of modeling utility, that isto say the net benefit a consumer obtains from selecting a

  15. Comparison of parametric methods for modeling corneal surfaces

    Science.gov (United States)

    Bouazizi, Hala; Brunette, Isabelle; Meunier, Jean

    2017-02-01

    Corneal topography is a medical imaging technique to get the 3D shape of the cornea as a set of 3D points of its anterior and posterior surfaces. From these data, topographic maps can be derived to assist the ophthalmologist in the diagnosis of disorders. In this paper, we compare three different mathematical parametric representations of the corneal surfaces leastsquares fitted to the data provided by corneal topography. The parameters obtained from these models reduce the dimensionality of the data from several thousand 3D points to only a few parameters and could eventually be useful for diagnosis, biometry, implant design etc. The first representation is based on Zernike polynomials that are commonly used in optics. A variant of these polynomials, named Bhatia-Wolf will also be investigated. These two sets of polynomials are defined over a circular domain which is convenient to model the elevation (height) of the corneal surface. The third representation uses Spherical Harmonics that are particularly well suited for nearly-spherical object modeling, which is the case for cornea. We compared the three methods using the following three criteria: the root-mean-square error (RMSE), the number of parameters and the visual accuracy of the reconstructed topographic maps. A large dataset of more than 2000 corneal topographies was used. Our results showed that Spherical Harmonics were superior with a RMSE mean lower than 2.5 microns with 36 coefficients (order 5) for normal corneas and lower than 5 microns for two diseases affecting the corneal shapes: keratoconus and Fuchs' dystrophy.

  16. Biological methods used to assess surface water quality

    Directory of Open Access Journals (Sweden)

    Szczerbiñska Natalia

    2015-12-01

    Full Text Available In accordance with the guidelines of the Water Framework Directive 2000/60 (WFD, both ecological and chemical statuses determine the assessment of surface waters. The profile of ecological status is based on the analysis of various biological components, and physicochemical and hydromorphological indicators complement this assessment. The aim of this article is to present the biological methods used in the assessment of water status with a special focus on bioassay, as well as to provide a review of methods of monitoring water status. Biological test methods include both biomonitoring and bioanalytics. Water biomonitoring is used to assess and forecast the status of water. These studies aim to collect data on water pollution and forecast its impact. Biomonitoring uses organisms which are characterized by particular vulnerability to contaminants. Bioindicator organisms are algae, fungi, bacteria, larval invertebrates, cyanobacteria, macroinvertebrates, and fish. Bioanalytics is based on the receptors of contaminants that can be biologically active substances. In bioanalytics, biosensors such as viruses, bacteria, antibodies, enzymes, and biotests are used to assess degrees of pollution.

  17. Definition of a critical confining zone using surface geophysical methods

    International Nuclear Information System (INIS)

    Eddy-Dilek, C.A.; Hoekstra, P.; Harthill, N.; Blohm, M.; Phillips, D.R.

    1996-01-01

    Definition of the hydrogeologic framework in layered sediments of fluvial and deltaic origin is a difficult challenge for environmental characterization and remediation programs due to the lithologic and stratigraphic heterogeneities inherent in these settings. These heterogeneties often control contaminant transport and the effectiveness of remediation alternatives, Surface geophysical surveys can be cost-effective methods for characterization, but individual methods have inherent limitations in resolution and sensitivity. A synergistic approach, utilizing two geophysical survey methods was applied, to define and examine the nature and extent of a deep confining zone of regulatory importance, the Crouch Branch Confining Unit, in Coastal Plain sediments at the Savannah River Site. TDEM accurately maps the overall conductance (product of thickness and electrical conductivity) of a confining zone clay facies; from variation in conductance, changes in lithology of the conforming zone can be inferred. Shear wave seismic reflection surveys map the depth to the clay layers, and the clay layer thickness, but provides little information on the lithologic nature of the confining zone. Integrated interpretation of the combined data set (including all available borehole logs) allows for delineation of the lateral and vertical extent of clay-dominated zones, sand-dominated zones, key stratigraphic horizons, and erosional features associated with unconformities. This approach has resulted in the collection of critical information that will be used to optimize remedial system design, representing a significant cost savings to environmental restoration programs at the Savannah River Site

  18. Integral methods for shallow free-surface flows with separation

    DEFF Research Database (Denmark)

    Watanabe, S.; Putkaradze, V.; Bohr, Tomas

    2003-01-01

    eddy and separated flow. Assuming a variable radial velocity profile as in Karman-Pohlhausen's method, we obtain a system of two ordinary differential equations for stationary states that can smoothly go through the jump. Solutions of the system are in good agreement with experiments. For the flow down...... an inclined plane we take a similar approach and derive a simple model in which the velocity profile is not restricted to a parabolic or self-similar form. Two types of solutions with large surface distortions are found: solitary, kink-like propagating fronts, obtained when the flow rate is suddenly changed......, and stationary jumps, obtained, for instance, behind a sluice gate. We then include time dependence in the model to study the stability of these waves. This allows us to distinguish between sub- and supercritical flows by calculating dispersion relations for wavelengths of the order of the width of the layer....

  19. Standardization method for alpha and beta surface sources

    Energy Technology Data Exchange (ETDEWEB)

    Sahagia, M; Grigorescu, E L; Razdolescu, A C; Ivan, C [Institute of Physics and Nuclear Engineering, Institute of Atomic Physics, PO Box MG-6, R-76900 Bucharest, (Romania)

    1994-01-01

    The installation and method of standardization of large surface alpha and beta sources are presented. A multiwire, flow-type proportional counter and the associated electronics is used. The counter is placed in a lead-shield. The response of the system in (s[sup -1]/Bq) or (s[sup -1]/(particle x s[sup -1])) was determined for [sup 241] Am, [sup 239] Pu, [sup 147] Pm, [sup 204] Tl, [sup 90](Sr+Y) and [sup 137] Cs using standard sources with different dimensions, from some mm[sup 2] to 180 x 220 mm[sup 2]. The system was legally attested for expanded uncertainties of +7%. (Author).

  20. Exploring the 3D Surfaces with Modified Method of Steepest Descent

    Directory of Open Access Journals (Sweden)

    Wioletta GRZENDA

    2012-06-01

    Full Text Available Aim: To prove expediency of the steepest descent method to divide a given cloud of (Y, X1, X2 points into the spatial clusters with purpose to estimate a simple regression model Y = f(Z|X1,X2 at each cluster. Material and Method: The exemplary data sets {Y, X1, X2} were drawn randomly from assumed 3D surface: Y = f(X1,X2, and then a random noise was added to variable Y. A polynomial model Y = f(X1,X2 and a set of models Y = f(Z|X1,X2 were estimated separately, both under Akaike information criterion (AIC, and then compared with respect to their determination coefficients R-square, and the residuals’ distributions. Results: In the artificial data set studied, the both compared methods after several iterations can provide regression models of the quite similar quality. Conclusions: Because the proposed novel method seems to be more robust to outliers, and easier to graphical presentations and to intuitive understanding than the conventional way of building a regression model, the proposed novel method can be recommended to use by non-statisticians, especially in situation when, besides usual moderate noise, the sporadic but influential measurement errors can occur.

  1. Efficient Measurement of Shape Dissimilarity between 3D Models Using Z-Buffer and Surface Roving Method

    Directory of Open Access Journals (Sweden)

    In Kyu Park

    2002-10-01

    Full Text Available Estimation of the shape dissimilarity between 3D models is a very important problem in both computer vision and graphics for 3D surface reconstruction, modeling, matching, and compression. In this paper, we propose a novel method called surface roving technique to estimate the shape dissimilarity between 3D models. Unlike conventional methods, our surface roving approach exploits a virtual camera and Z-buffer, which is commonly used in 3D graphics. The corresponding points on different 3D models can be easily identified, and also the distance between them is determined efficiently, regardless of the representation types of the 3D models. Moreover, by employing the viewpoint sampling technique, the overall computation can be greatly reduced so that the dissimilarity is obtained rapidly without loss of accuracy. Experimental results show that the proposed algorithm achieves fast and accurate measurement of shape dissimilarity for different types of 3D object models.

  2. Response surface reconciliation method of bolted joints structure

    Directory of Open Access Journals (Sweden)

    Yunus Mohd Azmi

    2017-01-01

    Full Text Available Structural joining methods such as bolted joints are commonly used for the assembly of structural components due to their simplicity and easy maintenance. Understandably, the dynamic characteristic of bolted joined structure is mainly influenced by the properties of their joints such as preload on the bolts and joints stiffness which alter the measured dynamics response of the structure. Therefore, the need to include the local effect of the bolted joints into the numerical model of the bolted joined structure is vitally important in order to represent the model accurately. In this paper, a few types of connector elements that can be used to represent the bolted joints such as CBAR, CBEAM and CELAS have been investigated numerically and experimentally. The initial numerical results of these element connectors are compared with the experimental results in term of natural frequencies and mode shapes. The comparative evaluation of numerical and the experimental data are performed in order to provide some insights of inaccuracies in the numerical model due to invalid assumption in the numerical modelling such as geometry, material properties, and boundary conditions. The discrepancies between both results (numerical and experimental data are then corrected using the response surface reconciliation method (RSRM through which the finite element model is altered in order to provide closer agreement with the measured data so that it can be used for subsequence analysis.

  3. Rapid surface enhanced Raman scattering detection method for chloramphenicol residues

    Science.gov (United States)

    Ji, Wei; Yao, Weirong

    2015-06-01

    Chloramphenicol (CAP) is a widely used amide alcohol antibiotics, which has been banned from using in food producing animals in many countries. In this study, surface enhanced Raman scattering (SERS) coupled with gold colloidal nanoparticles was used for the rapid analysis of CAP. Density functional theory (DFT) calculations were conducted with Gaussian 03 at the B3LYP level using the 3-21G(d) and 6-31G(d) basis sets to analyze the assignment of vibrations. Affirmatively, the theoretical Raman spectrum of CAP was in complete agreement with the experimental spectrum. They both exhibited three strong peaks characteristic of CAP at 1104 cm-1, 1344 cm-1, 1596 cm-1, which were used for rapid qualitative analysis of CAP residues in food samples. The use of SERS as a method for the measurements of CAP was explored by comparing use of different solvents, gold colloidal nanoparticles concentration and absorption time. The method of the detection limit was determined as 0.1 μg/mL using optimum conditions. The Raman peak at 1344 cm-1 was used as the index for quantitative analysis of CAP in food samples, with a linear correlation of R2 = 0.9802. Quantitative analysis of CAP residues in foods revealed that the SERS technique with gold colloidal nanoparticles was sensitive and of a good stability and linear correlation, and suited for rapid analysis of CAP residue in a variety of food samples.

  4. Method for Qualification of Coatings Applied to Wet Surfaces

    Science.gov (United States)

    2009-12-16

    The field application of a pipeline repair or rehabilitation coating usually cannot wait until ambient conditions become optimal. In a humid environment, water can condense on the pipe surface because the pipe surface is usually cooler than the ambie...

  5. Ressonância magnética das vias lacrimais: estudo comparativo entre bobinas de superfície convencionais e microscópicas Magnetic resonance dacryocystography: comparison between conventional surface coils and microscopic coils

    Directory of Open Access Journals (Sweden)

    Luiz de Abreu Junior

    2008-08-01

    Full Text Available OBJETIVO: A ressonância magnética tem sido utilizada para avaliar as vias lacrimais, com vantagens em relação à dacriocistografia por raios-X. O objetivo deste trabalho é obter imagens de alta resolução utilizando bobinas de superfície microscópicas para avaliação de estruturas normais das vias lacrimais, comparando com o aspecto observado utilizando-se bobinas de superfície convencionais. MATERIAIS E MÉTODOS: Cinco voluntários assintomáticos, sem histórico de lacrimejamento, submeteram-se a ressonância magnética de alto campo, com bobinas de superfície (convencional e microscópica, com seqüência STIR após instilação de soro fisiológico. A identificação das estruturas anatômicas normais das vias lacrimais foi comparada utilizando-se as duas bobinas. Mediante uso de um sistema de escore, um valor médio de cada estrutura foi calculado por dois examinadores, consensualmente. RESULTADOS: Em 90% das vezes houve aumento do escore, atribuído à estrutura anatômica no estudo com a bobina microscópica. Em média, houve aumento de 1,17 ponto no escore, por estrutura anatômica visualizada, quando se utilizou a bobina microscópica. Observou-se, ainda, melhora subjetiva da relação sinal-ruído ao se utilizar a bobina microscópica. CONCLUSÃO: A dacriocistografia por ressonância magnética com bobinas microscópicas é um método adequado para o estudo das vias lacrimais, resultando em imagens de melhor qualidade quando comparada ao uso de bobinas de superfície convencionais.OBJECTIVE: Magnetic resonance imaging has been utilized in the evaluation of the lacrimal apparatus with some advantages over conventional dacryocystography. The present study was aimed at acquiring high-resolution images utilizing microscopic coils for evaluating typical structures of the lacrimal apparatus as compared with the findings observed with conventional surface coils. MATERIALS AND METHODS: Five asymptomatic volunteers with no history of

  6. [A comparative study between the Vitek YBC and Microscan Walk Away RYID automated systems with conventional phenotypic methods for the identification of yeasts of clinical interest].

    Science.gov (United States)

    Ferrara, Giuseppe; Mercedes Panizol, Maria; Mazzone, Marja; Delia Pequeneze, Maria; Reviakina, Vera

    2014-12-01

    The aim of this study was to compare the identification of clin- ically relevant yeasts by the Vitek YBC and Microscan Walk Away RYID automated methods with conventional phenotypic methods. One hundred and ninety three yeast strains isolated from clinical samples and five controls strains were used. All the yeasts were identified by the automated methods previously mentioned and conventional phenotypic methods such as carbohydrate assimilation, visualization of microscopic morphology on corn meal agar and the use of chromogenic agar. Variables were assessed by 2 x 2 contingency tables, McNemar's Chi square, the Kappa index, and concordance values were calculated, as well as major and minor errors for the automated methods. Yeasts were divided into two groups: (1) frequent isolation and (2) rare isolation. The Vitek YBC and Microscan Walk Away RYID systems were concordant in 88.4 and 85.9% respectively, when compared to conventional phenotypic methods. Although both automated systems can be used for yeasts identification, the presence of major and minor errors indicates the possibility of misidentifications; therefore, the operator of this equipment must use in parallel, phenotypic tests such as visualization of microscopic morphology on corn meal agar and chromogenic agar, especially against infrequently isolated yeasts. Automated systems are a valuable tool; however, the expertise and judgment of the microbiologist are an important strength to ensure the quality of the results.

  7. Surface harmonics method for two-dimensional time-dependent neutron transport problems of square-lattice nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Boyarinov, V. F.; Kondrushin, A. E.; Fomichenko, P. A. [National Research Centre Kurchatov Institute, Kurchatov Sq. 1, Moscow (Russian Federation)

    2013-07-01

    Time-dependent equations of the Surface Harmonics Method (SHM) have been derived from the time-dependent neutron transport equation with explicit representation of delayed neutrons for solving the two-dimensional time-dependent problems. These equations have been realized in the SUHAM-TD code. The TWIGL benchmark problem has been used for verification of the SUHAM-TD code. The results of the study showed that computational costs required to achieve necessary accuracy of the solution can be an order of magnitude less than with the use of the conventional finite difference method (FDM). (authors)

  8. Layer-by-Layer Method for the Synthesis and Growth of Surface Mounted Metal-Organic Frameworks (SURMOFs

    Directory of Open Access Journals (Sweden)

    Osama Shekhah

    2010-02-01

    Full Text Available A layer-by-layer method has been developed for the synthesis of metal-organic frameworks (MOFs and their deposition on functionalized organic surfaces. The approach is based on the sequential immersion of functionalized organic surfaces into solutions of the building blocks of the MOF, i.e., the organic ligand and the inorganic unit. The synthesis and growth of different types of MOFs on substrates with different functionalization, like COOH, OH and pyridine terminated surfaces, were studied and characterized with different surface characterization techniques. A controlled and highly oriented growth of very homogenous films was obtained using this method. The layer-by-layer method offered also the possibility to study the kinetics of film formation in more detail using surface plasmon resonance and quartz crystal microbalance. In addition, this method demonstrates the potential to synthesize new classes of MOFs not accessible by conventional methods. Finally, the controlled growth of MOF thin films is important for many applications like chemical sensors, membranes and related electrodes.

  9. Comparison of the quantitative dry culture methods with both conventional media and most probable number method for the enumeration of coliforms and Escherichia coli/coliforms in food.

    Science.gov (United States)

    Teramura, H; Sota, K; Iwasaki, M; Ogihara, H

    2017-07-01

    Sanita-kun™ CC (coliform count) and EC (Escherichia coli/coliform count), sheet quantitative culture systems which can avoid chromogenic interference by lactase in food, were evaluated in comparison with conventional methods for these bacteria. Based on the results of inclusivity and exclusivity studies using 77 micro-organisms, sensitivity and specificity of both Sanita-kun™ met the criteria for ISO 16140. Both media were compared with deoxycholate agar, violet red bile agar, Merck Chromocult™ coliform agar (CCA), 3M Petrifilm™ CC and EC (PEC) and 3-tube MPN, as reference methods, in 100 naturally contaminated food samples. The correlation coefficients of both Sanita-kun™ for coliform detection were more than 0·95 for all comparisons. For E. coli detection, Sanita-kun™ EC was compared with CCA, PEC and MPN in 100 artificially contaminated food samples. The correlation coefficients for E. coli detection of Sanita-kun™ EC were more than 0·95 for all comparisons. There were no significant differences in all comparisons when conducting a one-way analysis of variance (anova). Both Sanita-kun™ significantly inhibited colour interference by lactase when inhibition of enzymatic staining was assessed using 40 natural cheese samples spiked with coliform. Our results demonstrated Sanita-kun™ CC and EC are suitable alternatives for the enumeration of coliforms and E. coli/coliforms, respectively, in a variety of foods, and specifically in fermented foods. Current chromogenic media for coliforms and Escherichia coli/coliforms have enzymatic coloration due to breaking down of chromogenic substrates by food lactase. The novel sheet culture media which have film layer to avoid coloration by food lactase have been developed for enumeration of coliforms and E. coli/coliforms respectively. In this study, we demonstrated these media had comparable performance with reference methods and less interference by food lactase. These media have a possibility not only

  10. Towards non-conventional methods of designing register-based epidemiological studies: An application to pediatric research.

    Science.gov (United States)

    Gong, Tong; Brew, Bronwyn; Sjölander, Arvid; Almqvist, Catarina

    2017-07-01

    Various epidemiological designs have been applied to investigate the causes and consequences of fetal growth restriction in register-based observational studies. This review seeks to provide an overview of several conventional designs, including cohort, case-control and more recently applied non-conventional designs such as family-based designs. We also discuss some practical points regarding the application and interpretation of family-based designs. Definitions of each design, the study population, the exposure and the outcome measures are briefly summarised. Examples of study designs are taken from the field of low birth-weight research for illustrative purposes. Also examined are relative advantages and disadvantages of each design in terms of assumptions, potential selection and information bias, confounding and generalisability. Kinship data linkage, statistical models and result interpretation are discussed specific to family-based designs. When all information is retrieved from registers, there is no evident preference of the case-control design over the cohort design to estimate odds ratios. All conventional designs included in the review are prone to bias, particularly due to residual confounding. Family-based designs are able to reduce such bias and strengthen causal inference. In the field of low birth-weight research, family-based designs have been able to confirm a negative association not confounded by genetic or shared environmental factors between low birth weight and the risk of asthma. We conclude that there is a broader need for family-based design in observational research as evidenced by the meaningful contributions to the understanding of the potential causal association between low birth weight and subsequent outcomes.

  11. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A.

    Science.gov (United States)

    Wu, Lin; Li, Huijun; Tang, Tianle

    2017-01-24

    Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence) protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21) and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris . Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C), induction time (4 h, 5 h, 6 h and 7 h) and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L). The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very suitable for

  12. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A

    Directory of Open Access Journals (Sweden)

    Lin Wu

    2017-01-01

    Full Text Available Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21 and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris. Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C, induction time (4 h, 5 h, 6 h and 7 h and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L. The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very

  13. The environmental impact of coal technology: Politics and methods of achieving an international convention to protect the earth's atmosphere

    International Nuclear Information System (INIS)

    1992-01-01

    Particular attention will be paid to the following points during the international Round Table discussions: Technology transfer and political opportunities for the environmentally-compatible use of coal in developing and transitional countries who rely on coal to meet their energy needs. Supporting this challenge for the international community of coal-based energy conservation in these countries, particularly through development aid. To increasingly accept our collective responsibility for energy considerations and environmental effects, based on a better understanding of the countries' differing limits and obligations in achieving the goal of a convention to protect the earth's atmosphere. (orig.) [de

  14. Transfer of pharmacopoeial liquid chromatography reversedphase methods for determination of related compounds in diclofenac sodium and metamizole sodium from conventional to core-shell column

    Directory of Open Access Journals (Sweden)

    Katerina Brezovska

    2015-04-01

    Full Text Available Core-shell silica particles were developed as a new material for chromatographic stationary phases in order to provide fast and high efficiency separations of small and large molecules and complex samples, at pressures compatible with conventional HPLC equipment. The aim of our work was to show the applicability of the HPLC columns based on a core-shell technology for determination of related substances in diclofenac sodium and in metamizole sodium using the methods described in the corresponding monographs of the European pharmacopoeia. The obtained results have shown that the proposed methods can be successfully transferred on core shell column, with suitable adjustment of injection volume and flow rate. The advantage of using core-shell column is fast and highly efficient separation on conventional HPLC equipment with increased sensitivity of the method and high throughput of the analysis, providing enhanced lab productivity and reduced costs.

  15. A New Method Based on TOPSIS and Response Surface Method for MCDM Problems with Interval Numbers

    Directory of Open Access Journals (Sweden)

    Peng Wang

    2015-01-01

    Full Text Available As the preference of design maker (DM is always ambiguous, we have to face many multiple criteria decision-making (MCDM problems with interval numbers in our daily life. Though there have been some methods applied to solve this sort of problem, it is always complex to comprehend and sometimes difficult to implement. The calculation processes are always ineffective when a new alternative is added or removed. In view of the weakness like this, this paper presents a new method based on TOPSIS and response surface method (RSM for MCDM problems with interval numbers, RSM-TOPSIS-IN for short. The key point of this approach is the application of deviation degree matrix, which ensures that the DM can get a simple response surface (RS model to rank the alternatives. In order to demonstrate the feasibility and effectiveness of the proposed method, three illustrative MCMD problems with interval numbers are analysed, including (a selection of investment program, (b selection of a right partner, and (c assessment of road transport technologies. The contrast of ranking results shows that the RSM-TOPSIS-IN method is in good agreement with those derived by earlier researchers, indicating it is suitable to solve MCDM problems with interval numbers.

  16. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Directory of Open Access Journals (Sweden)

    Sung-Hye You

    2017-01-01

    Full Text Available Purpose The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL, for measuring the volume of parathyroid glands. Methods Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D and three-dimensional (3D methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. Results The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. Conclusion The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  17. Immobilization of glucoamylase on ceramic membrane surfaces modified with a new method of treatment utilizing SPCP-CVD.

    Science.gov (United States)

    Ida; Matsuyama; Yamamoto

    2000-07-01

    Glucoamylase, as a model enzyme, was immobilized on a ceramic membrane modified by surface corona discharge induced plasma chemical process-chemical vapor deposition (SPCP-CVD). Characterizations of the immobilized enzyme were then discussed. Three kinds of ceramic membranes with different amounts of amino groups on the surface were prepared utilizing the SPCP-CVD method. Each with 1-time, 3-times and 5-times surface modification treatments and used for supports in glucoamylase immobilization. The amount of immobilized glucoamylase increased with the increase in the number of surface modification treatments and saturated to a certain maximum value estimated by a two-dimensional random packing. The operational stability of the immobilized glucoamylase also increased with the increase in the number of the surface treatment. It was almost the same as the conventional method, while the activity of immobilized enzyme was higher. The results indicated the possibility of designing the performance of the immobilized enzyme by controlling the amount of amino groups. The above results showed that the completely new surface modification method using SPCP was effective in modifying ceramic membranes for enzyme immobilization.

  18. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Science.gov (United States)

    Géczi, Gábor; Horváth, Márk; Kaszab, Tímea; Alemany, Gonzalo Garnacho

    2013-01-01

    Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values) of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other ways as well.

  19. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Directory of Open Access Journals (Sweden)

    Gábor Géczi

    Full Text Available Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other

  20. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto

    Science.gov (United States)

    Bond, Tiziana C.; Miles, Robin; Davidson, James C.; Liu, Gang Logan

    2014-07-22

    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  1. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto

    Science.gov (United States)

    Bond, Tiziana C; Miles, Robin; Davidson, James; Liu, Gang Logan

    2015-11-03

    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  2. Nanoscale array structures suitable for surface enhanced raman scattering and methods related thereto

    Science.gov (United States)

    Bond, Tiziana C.; Miles, Robin; Davidson, James C.; Liu, Gang Logan

    2015-07-14

    Methods for fabricating nanoscale array structures suitable for surface enhanced Raman scattering, structures thus obtained, and methods to characterize the nanoscale array structures suitable for surface enhanced Raman scattering. Nanoscale array structures may comprise nanotrees, nanorecesses and tapered nanopillars.

  3. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Energy Technology Data Exchange (ETDEWEB)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon [Dept. of Radiology, Korea University Anam Hospital, Seoul (Korea, Republic of); Suh, Sangil; Ryoo, In Seon; Seol, Hae Young [Dept. of Radiology, Korea University Guro Hospital, Seoul (Korea, Republic of); Lee, Young Hen; Seo, Hyung Suk [Dept. of Radiology, Korea University Ansan Hospital, Ansan (Korea, Republic of)

    2017-01-15

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  4. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    International Nuclear Information System (INIS)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon; Suh, Sangil; Ryoo, In Seon; Seol, Hae Young; Lee, Young Hen; Seo, Hyung Suk

    2017-01-01

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism

  5. EXPERIMENTAL COMPARISON OF THE AEROSOL METHOD OF DISINFECTION OF AIR AND SURFACES CONTAMINATED BY M. TUBERCULOSIS

    Directory of Open Access Journals (Sweden)

    V. V. Kuzin

    2018-01-01

    Full Text Available The objective of the study: to analyze efficiency of an aerosol method of M. tuberculosis deactivation in the air and on surfaces versus the conventional methods of the disinfectants' application.Subjects and Methods. The article describes the evaluation of efficiency of the aerosol method of M. tuberculosis, H37Rv strain, deactivation on surfaces (tested objects made of linoleum and in the air using the disinfectant of Green Dez based on chlorine dioxide versus deactivation through wiping and irrigation.The efficiency of disinfectant was tested by the device of 099С А4224 manufactured by Glas-Col, USA, using the air sampler of PU-1B, Russia.The Mobile Hygienic Center (MNC, Russia, was used for application of the disinfectant, wiping and irrigation was done using the disperser of Avtomaks AO-2, Russia.The bacterial aerosol was generated in the Glass-Col chamber with the concentration 5 ± 2.5 × 102 CFU/cm3, by spraying the suspension of M. tuberculosis, H37Rv strain. After that, the disinfectant spray was supplied to the chamber, where linoleum objects were placed horizontally on a variety of surfaces. In order to evaluate efficiency of surface treatment by wiping, the test objects were wiped with a tissue, soaked with the solution of Green Dez, based on consumption of 100-150 ml/m2. In 15, 30 and 60 minutes, the samples of inactivated M. tuberculosis aerosol were collected using an aspirator, chambers with test objects were closed and placed in the vent hood. To monitor efficiency of disinfection of the test object surfaces, the rinse blanks were done by wiping the surface with a sterile gauze wad, soaked with 0.5% of sodium thiosulfate solution.The samples of deactivated aerosol and rinse blanks from the surfaces of test objects were put into Petri dishes with Middlebrook 7H11 medium. The cultures were incubated in the thermostat at the temperature of 37 ± 1° C for 10-21 days, and the number of colonies was counted.Sterile water was used

  6. Surface modification method for reactor incore structural component

    International Nuclear Information System (INIS)

    Obata, Minoru; Sudo, Akira.

    1996-01-01

    A large number of metal or ceramic small spheres accelerated by pressurized air are collided against a surface of a reactor incore structures or a welded surface of the structural components, and then finishing is applied by polishing to form compression stresses on the surface. This can change residual stresses into compressive stress without increasing the strength of the surface. Accordingly, stress corrosion crackings of the incore structural components or welded portions thereof can be prevented thereby enabling to extend the working life of equipments. (T.M.)

  7. Optimization of ultrasound-assisted extraction to obtain mycosterols from Agaricus bisporus L. by response surface methodology and comparison with conventional Soxhlet extraction.

    Science.gov (United States)

    Heleno, Sandrina A; Diz, Patrícia; Prieto, M A; Barros, Lillian; Rodrigues, Alírio; Barreiro, Maria Filomena; Ferreira, Isabel C F R

    2016-04-15

    Ergosterol, a molecule with high commercial value, is the most abundant mycosterol in Agaricus bisporus L. To replace common conventional extraction techniques (e.g. Soxhlet), the present study reports the optimal ultrasound-assisted extraction conditions for ergosterol. After preliminary tests, the results showed that solvents, time and ultrasound power altered the extraction efficiency. Using response surface methodology, models were developed to investigate the favourable experimental conditions that maximize the extraction efficiency. All statistical criteria demonstrated the validity of the proposed models. Overall, ultrasound-assisted extraction with ethanol at 375 W during 15 min proved to be as efficient as the Soxhlet extraction, yielding 671.5 ± 0.5mg ergosterol/100 g dw. However, with n-hexane extracts with higher purity (mg ergosterol/g extract) were obtained. Finally, it was proposed for the removal of the saponification step, which simplifies the extraction process and makes it more feasible for its industrial transference. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Safety of type and screen method compared to conventional antiglobulin crossmatch procedures for compatibility testing in Indian setting

    Directory of Open Access Journals (Sweden)

    Chaudhary Rajendra

    2011-01-01

    Full Text Available Background: Over the past 30 years, pretransfusion tests have undergone considerable modification. In 1984, AABB recommended that the full cross match could be replaced by an abbreviated cross match in patients with negative antibody screen. However, before implementation of such a policy, issue regarding safety of T & S needs to be evaluated. Objectives: The aim of pretransfusion testing (PTT is to ensure that enough red blood cells (RBCs in the selected red cell components will survive when transfused. Results and Conclusion: We have, therefore in this study; evaluated safety of T & S procedure for PTT in comparison with conventional test tube cross match. The T & S procedure gave a safety of 91.6%. Also, the usefulness of the T & S was shown through the detection of unexpected antibodies in 0.75% (15 out of 2026 of cases.

  9. Comparing Amazon's Mechanical Turk Platform to Conventional Data Collection Methods in the Health and Medical Research Literature.

    Science.gov (United States)

    Mortensen, Karoline; Hughes, Taylor L

    2018-04-01

    The goal of this article is to conduct an assessment of the peer-reviewed primary literature with study objectives to analyze Amazon.com 's Mechanical Turk (MTurk) as a research tool in a health services research and medical context. Searches of Google Scholar and PubMed databases were conducted in February 2017. We screened article titles and abstracts to identify relevant articles that compare data from MTurk samples in a health and medical context to another sample, expert opinion, or other gold standard. Full-text manuscript reviews were conducted for the 35 articles that met the study criteria. The vast majority of the studies supported the use of MTurk for a variety of academic purposes. The literature overwhelmingly concludes that MTurk is an efficient, reliable, cost-effective tool for generating sample responses that are largely comparable to those collected via more conventional means. Caveats include survey responses may not be generalizable to the US population.

  10. An elemental concentration open source database for Hogdahl-Convention and Westcott-Formalism based on K0-INAA method in Malaysia

    International Nuclear Information System (INIS)

    Yavar, A.R.; Sukiman Sarmani; Tan, C.Y.; Rafie, N.N.; Lim, S.W.E.; Khoo, K.S.

    2012-01-01

    An electronic database has been developed and implemented for K 0 -INAA method in Malaysia. Databases are often developed according to national requirements. This database contains constant nuclear data for k 0 -INAA method. Hogdahl-convention and Westcott-formalism as 3 separate command user interfaces. It has been created using Microsoft Access 2007 under a Windows operating system. This database saves time and the quality of results can be assured when the calculation of neutron flux parameters and concentration of elements by k 0 -INAA method are utilised. An evaluation of the database was conducted by IAEA Soil7 where the results published which showed a high level of consistency. (Author)

  11. Comparison of the heat shock response induced by conventional heating and two methods of delivery of pulsed radiofrequency energy

    International Nuclear Information System (INIS)

    Laurence, J.A.; University of Sydney, NSW; McKenzie, D.R.; Veas, L.; French, P.W.

    2002-01-01

    Full text: In 2001, we published a (hypothetical) mechanism by which radiofrequency (RF) radiation from mobile phones could induce cancer, via the chronic induction of the heat shock response (HSR). This hypothesis provides the focus for our research. Other groups have reported induction of the HSR by RF at apparently non thermal levels. The aim of this study was to determine whether the HSR induced by RF is (a) truly non thermal and (b) quantitatively or qualitatively different from that induced by conventional heating of cells. A rat mast cell line, RBL-2H3, was chosen as the target RBL-2H3 cells were exposed in an air incubator at 41.1 deg C for 45 minutes and 75 minutes, and then returned to a 37 deg C incubator. Sham exposures were performed in the same air incubator at 37 deg C. Cells were exposed for 1 hour in the two pulsed RF exposure systems. The first was a converted 750W microwave oven that emits a short burst of 2.45GHz pulses at the start of each contiguous six minute period. This exposes cells to an average specific energy absorption rate (SAR) of 20W/kg. The second system was a TEM cell, which simulates. GSM pulses - the earner frequency is 0.9GHz pulse modulated at 217Hz. The SAR was approx 0.1W/kg. Both of these exposure systems are housed in incubators maintained at 37 deg C. Sham exposures were performed in the two systems with the same conditions but with no RF radiation present. Cell samples for the conventional heating and microwave exposures were taken 0, 2. 5, 5 and 20 hours after exposure, and expression of heat shock proteins hsp 110, 90, 70, 60 and 56 were determined by Western Blotting and compared between exposures

  12. Radiation induced diffusion as a method to protect surface

    International Nuclear Information System (INIS)

    Baumvol, I.J.R.

    1980-01-01

    Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

  13. Application of Taguchi method to optimization of surface roughness during precise turning of NiTi shape memory alloy

    Science.gov (United States)

    Kowalczyk, M.

    2017-08-01

    This paper describes the research results of surface quality research after the NiTi shape memory alloy (Nitinol) precise turning by the tools with edges made of polycrystalline diamonds (PCD). Nitinol, a nearly equiatomic nickel-titanium shape memory alloy, has wide applications in the arms industry, military, medicine and aerospace industry, and industrial robots. Due to their specific properties NiTi alloys are known to be difficult-to-machine materials particularly by using conventional techniques. The research trials were conducted for three independent parameters (vc, f, ap) affecting the surface roughness were analyzed. The choice of parameter configurations were performed by factorial design methods using orthogonal plan type L9, with three control factors, changing on three levels, developed by G. Taguchi. S/N ratio and ANOVA analyses were performed to identify the best of cutting parameters influencing surface roughness.

  14. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients

    OpenAIRE

    Meng-Ting Huang; Robert Kuo-Kuang Lee; Chung-Hao Lu; Ying-Jie Chen; Sheng-Hsiang Li; Yuh-Ming Hwu

    2015-01-01

    Objective: To evaluate if hyaluronic acid (HA)-bound spermatozoa surpassed conventional microscopy-selected spermatozoa in the status of sperm DNA integrity by acridine orange (AO) fluorescence staining. Materials and methods: Spermatozoa obtained from couples with indication for the intracytoplasmic sperm injection (ICSI) procedure due to male infertility (n = 34) and control males with normal sperm parameters (n = 12) were analyzed using AO fluorescence staining after density-gradient ce...

  15. Simplified method for preparation of concentrated exoproteins produced by Staphylococcus aureus grown on surface of cellophane bag containing liquid medium.

    Science.gov (United States)

    Ikigai, H; Seki, K; Nishihara, S; Masuda, S

    1988-01-01

    A simplified method for preparation of concentrated exoproteins including protein A and alpha-toxin produced by Staphylococcus aureus was successfully devised. The concentrated proteins were obtained by cultivating S. aureus organisms on the surface of a liquid medium-containing cellophane bag enclosed in a sterilized glass flask. With the same amount of medium, the total amount of proteins obtained by the method presented here was identical with that obtained by conventional liquid culture. The concentration of proteins obtained by the method, however, was high enough to observe their distinct bands stained on polyacrylamide gel electrophoresis. This method was considered quite useful not only for large-scale cultivation for the purification of staphylococcal proteins but also for small-scale study using the proteins. The precise description of the method was presented and its possible usefulness was discussed.

  16. Analytical methods for the characterization of surface finishing in bricks

    International Nuclear Information System (INIS)

    Nardini, I.; Zendri, E.; Biscontin, G.; Brunetin, A.

    2006-01-01

    The recent restoration works of Santo Stefano Church Facade (XV century) in Venice have shown traces variously saved of different kind of surface finishes. These finishes were found on the brick's surface both in the masonry and in the decorative elements. Different brick's surface and decorative tile samples were investigated using several techniques: optical microscopy, scanning electron-microscopy, thermal analysis, infrared spectroscopy and reflectance Fourier transform infrared microspectroscopy. The evaluation of the reached results was used to understand the decorative techniques and to recognize the material employed

  17. Contribution of surface analysis spectroscopic methods to the lubrication field

    International Nuclear Information System (INIS)

    Blanc, C.

    1979-01-01

    The analytical surface technics such as ESCA, AES and SIMS are tested to be applied to a particular lubrication field. One deals with a 100 C 6 steel surface innumered in tricresylphosphate at 110 0 C for 15 days. The nature of the first layers is studied after relevant solvant cleaning. An iron oxide layer is produced on the bearing surface, namely αFe 2 -O 3 . ESCA, AES and SIMS studies show an overlayer of iron phosphate. The exact nature of iron phosphate is not clearly established but the formation of a ferrous phosphate coating can be assumed from ESCA analysis [fr

  18. Religious versus Conventional Psychotherapy for Major Depression in Patients with Chronic Medical Illness: Rationale, Methods, and Preliminary Results

    Directory of Open Access Journals (Sweden)

    Harold G. Koenig

    2012-01-01

    Full Text Available This paper (1 reviews the physical and religious barriers to CBT that disabled medically ill-depressed patients face, (2 discusses research on the relationship between religion and depression-induced physiological changes, (3 describes an ongoing randomized clinical trial of religious versus secular CBT in chronically ill patients with mild-to-moderate major depression designed to (a overcome physical and religious barriers to CBT and (b compare the efficacy of religious versus secular CBT in relieving depression and improving immune and endocrine functions, and (4 presents preliminary results that illustrate the technical difficulties that have been encountered in implementing this trial. CBT is being delivered remotely via instant messaging, telephone, or Skype, and Christian, Jewish, Muslim, Buddhist, and Hindu versions of religious CBT are being developed. The preliminary results described here are particular to the technologies employed in this study and are not results from the CBT clinical trial whose findings will be published in the future after the study ends and data are analyzed. The ultimate goal is to determine if a psychotherapy delivered remotely that integrates patients’ religious resources improves depression more quickly than a therapy that ignores them, and whether religious CBT is more effective than conventional CBT in reversing depression-induced physiological changes.

  19. The usefulness of levin tube inserted drip infusion spiral CT: comparison with conventional method in subtotal gastrectomy patients

    International Nuclear Information System (INIS)

    Park, Young Jin; Kim, Young Hwan; Yoon, Jung Hee; Cha, Soon Joo; Kim, Jeong Sook; Kim, Sung Rok; Hur, Gham; Rhim, Hyun Chul

    1998-01-01

    The purpose of this study is to access the usefulness of newly designed Levin tube inserted drip infusion spiral CT for the evaluation of remnant stomach and anastomosis site in patients who have undergone subtotal gastrectomy for stomach cancer. A new technique named Levin tube inserted drip infusion spiral CT was used to prospectively study 23 patients. A 16Fr Levin tube was inserted into the remnant stomach; 500 ml of tap water was drip infused just before CT scanning and an additional 500 ml of water was infused during IV contrast injection. Water was infused by gravity, using a water bottle suspended at a height of 90 cm (Group A). The 31 patients who underwent conventional spiral CT scanning immediately after the divided ingestion of 900 ml diluted gastrografin were selected as a control group (Group B). The anatomic delineation of the anastomosis site was graded by two radiologists as excellent (3), good(2), fair (1) or poor (0). To evaluate the degree of distension, the maximal diameters of remnant stomach and the anastomosis site, and the thickness of the stomach wall, were also measured. In patients who had undergone subtobal gastrectomy, Levin tube inserted drip infusion spiral CT showed excellent anatomic delineation of the site of anastomosis and remnant stomach. We found that because it increases the distension of remnant stomach and the anastomosis site, this technique is effective for the evaluation of postoperative stomach. (author). 10 refs., 2 tabs., 3 figs

  20. Nonhazardous solvent composition and method for cleaning metal surfaces

    International Nuclear Information System (INIS)

    Googin, J.M.; Simandl, R.F.; Thompson, L.M.

    1993-01-01

    A solvent composition for displacing greasy and oily contaminants as well as water and/or aqueous residue from metallic surfaces, especially surfaces of radioactive materials so that such surfaces can be wiped clean of the displaced contaminants, water and/or aqueous residue. The solvent composition consists essentially of a blend of nonpolar aliphatic hydrocarbon solvent having a minimum flash point of about 140 F and 2 to 25 volume percent of a polar solvent having a flash point sufficiently high so as to provide the solvent composition with a minimum flash point of at least 140 F. The solvent composition is nonhazardous so that when it is used to clean the surfaces of radioactive materials the waste in the form of paper or cloth wipes, lab coats and the like used in the cleaning operation is not considered to be mixed waste composed of a hazardous solvent and a radioactive material

  1. A simple method to assess bacterial attachment to surfaces

    Digital Repository Service at National Institute of Oceanography (India)

    Sonak, S.; Bhosle, N.B.

    The crystal violet microplate adhension assay was modified to evaluate bacterial adhesion to metal and non-metal surfaces. Both viable cell count and the absorbance of the crystal violet stained cells attached to aluminium increased over the period...

  2. Method and coating composition for protecting and decontaminating surfaces

    Science.gov (United States)

    Overhold, D C; Peterson, M D

    1959-03-10

    A protective coating useful in the decontamination of surfaces exposed to radioactive substances is described. This coating is placed on the surface before use and is soluble in water, allowing its easy removal in the event decontamination becomes necessary. Suitable coating compositions may be prepared by mixing a water soluble carbohydrate such as sucrose or dextrin, together with a hygroscopic agent such as calcium chloride or zinc chloride.

  3. Investigation of composite electromagnetic scattering from ship-like target on the randomly rough sea surface using FDTD method

    International Nuclear Information System (INIS)

    Juan, Li; Li-Xin, Guo; Hao, Zeng; Xu-Biao, Han

    2009-01-01

    Composite electromagnetic scattering from a two-dimensional (2D) ship-like target on a one-dimensional sea surface is investigated by using the finite-difference time-domain (FDTD) method. A uniaxial perfectly matched layer is adopted for truncation of FDTD lattices. The FDTD updated equations can be used for the total computation domain by choosing the uniaxial parameters properly. To validate the proposed numerical technique, a 2D infinitely long cylinder over the sea surface is taken into account first. The variation of angular distribution of the scattering changing with incident angle is calculated. The results show good agreement with the conventional moment method. Finally, the influence of the incident angle, the polarization, and the size of the ship-like target on the composite scattering coefficient is discussed in detail. (classical areas of phenomenology)

  4. Comparison of type and frequency of chromosome aberrations by conventional and G-staining methods in Hiroshima atomic bomb survivors

    International Nuclear Information System (INIS)

    Ohtaki, Kazuo; Shimba, Hachiro; Sofuni, Toshio; Awa, A.A.

    1982-07-01

    Somatic chromosomes derived from cultured lymphocytes of 23 atomic bomb survivors of Hiroshima were analyzed to determine the type and frequency of radiation-induced structural aberrations, using in sequence the ordinary staining method (O-method) and the trypsin G-banding method (G-method). Of 896 cells examined, 342 were found to contain induced aberrations, including 31 cells in which the precise identification of the type of aberrations was not possible even by the G-method. The number of chromosome aberrations observed was 376 in the 311 cells where aberrant precise identification was possible. The majority (288 or 76.6%) were intra- or inter-chromosomal symmetric exchanges due to a two-break event, while only 24 were found to be asymmetric exchanges (dicentrics, rings, and interstitial deletions). Further, there were 28 aberrations showing acentric fragments and terminal deletions, and the remaining 36 were complex intra- and inter-chromosomal exchanges involving three or more breaks which result in insertions and double translocations. A comparative karyotype analysis of the same metaphases examined by the sequential 0- And G-methods was carried out independently on 361 aberrations, mostly of the symmetric type. It was found that 78 (21.6%) of the 361 were detected only by the G-method; among these were 14 paracentric inversions, 48 reciprocal interchanges of chromosome segments with either equal length (11) or unequal length (37), 14 minor deletions and 2 complex rearrangements, all of which were nevertheless judged to fall within the normal range of variation by theO-method. In contrast, 25 aberrations detected in O-method chromosomes which were overcontracted or twisted, were shown to have normal banding patterns by the G-method. (author)

  5. Method For Creating Corrosion Resistant Surface On An Aluminum Copper Alloy

    Science.gov (United States)

    Mansfeld, Florian B.; Wang, You; Lin, Simon H.

    1997-06-03

    A method for treating the surface of aluminum alloys hang a relatively high copper content is provided which includes the steps of removing substantially all of the copper from the surface, contacting the surface with a first solution containing cerium, electrically charging the surface while contacting the surface in an aqueous molybdate solution, and contacting the surface with a second solution containing cerium. The copper is substantially removed from the surface in the first step either by (i) contacting the surface with an acidic chromate solution or by (ii) contacting the surface with an acidic nitrate solution while subjecting the surface to an electric potential. The corrosion-resistant surface resulting from the invention is excellent, consistent and uniform throughout the surface. Surfaces treated by the invention may often be certified for use in salt-water services.

  6. Forensic Examination Using a Nondestructive Evaluation Method for Surface Metrology

    Science.gov (United States)

    Eisenmann, David J.; Chumbley, L. Scott

    2009-03-01

    The objective of this paper is to describe the use of a new technique of optical profilometry in a nondestructive, non-contact fashion for the comparison of two metallic surfaces, one hard and one soft. When brought in contact with one another, the harder material (i.e. the tool) will impress its surface roughness onto the softer. It is understood that the resulting set of impressions left from a tool tip act in a manner similar to a photographic negative, in that it leaves a reverse, or negative impression on the surface of a plate. If properly inverted and reversed, measurements from the softer material should be identical to the harder indenting object with regard to surface texture and roughness. This assumption is inherent in the area of forensics, where bullets, cartridge cases, and toolmarked surfaces from crime scenes are compared to similar marks made under controlled conditions in the forensic laboratory. This paper will examine the methodology used to compare two surfaces for similarities and dissimilarities, and comment on the applicability of this technique to other studies.

  7. Preparation of nickel and Ni_3Sn nanoparticles via extension of conventional citric acid and ethylene diamine tetraacetic acid mediated sol–gel method

    International Nuclear Information System (INIS)

    Li, Pingyun; Deng, Guodong; Guo, Xiaode; Liu, Hongying; Jiang, Wei; Li, Fengsheng

    2016-01-01

    This work aims to extend the application field of sol–gel process from conventional oxides, carbides, sulfides to metallic nanocrystalline materials. Metallic ions were coordinated with chelating agents of citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) in aqueous solution. Then the solutions were dried at 383 K, resulting in the formation of sol and gel. Heating treatments of dried gels were then carried out with protection of N_2 atmosphere. Ni and Ni_3Sn alloy nanoparticles were obtained by this sol–gel method in the range of 623–823 K. The as-prepared Ni and Ni_3Sn alloy nanoparticles have average grain sizes of 15 and 30 nm, and have face-centred-cubic (fcc) crystalline phase. Our results provide new insight into the application of conventional sol–gel method. - Graphical abstract: Sol–gel method is conventionally applied to prepare oxides, carbides, and sulfides. In this work, the application field of sol–gel method is extended to metallic nanoparticles. By using citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) mediated sol–gel method, metallic Ni (a and c) and Ni_3Sn (b and d) alloy nanoparticles can be prepared when the heating treatments are performed under N_2 protecting atmosphere. The Ni and Ni_3Sn nanoparticles have face-centered-cubic (fcc) crystalline phase and ultrafine grain sizes. Diffraction peaks of (110) superstructure reflection plane of Ni_3Sn nanoparticles can also be observed in Figure b, which can be considered as direct evidence of formation of alloy crystalline phase by performing this sol–gel method. - Highlights: • Ni and Ni_3Sn alloy nanoparticles have been prepared by sol–gel processes. • Citric acid and ethylene diamine tetraacetic acid were applied as chelating agent. • Diffraction peak of superstructure reflection plane of Ni_3Sn was detected by XRD. • A novel strategy for preparation of alloy nanoparticles has been presented.

  8. A simple method for the preparation of difficult 99mTc complexes using surface adsorbed stannous ions

    International Nuclear Information System (INIS)

    Maddalena, D.J.; Snowdon, G.M.; Pojer, P.M.

    1987-01-01

    A simple new technique where stannous tin is adsorbed on the inner surface of plastic tubing and used to reduce ( 99m Tc) pertechnetate prior to labelling radiopharmaceuticals, has been evaluated, using some lipophillic and metal containing ligands. Complexes formed using the technique had good labelling efficiency and behaved the same in rat biodistribution studies as those prepared using conventional labelling methods. The labelling efficiency of the ligands was not related to their lipophillicity suggesting that this technique may be useful for labelling lipophillic and other difficult ligands such as those containing metals, which are incompatible with free stannous ions in solution. (M.E.L.) [es

  9. Influence of various surface-conditioning methods on the bond strength of metal brackets to ceramic surfaces

    NARCIS (Netherlands)

    Schmage, P; Nergiz, [No Value; Herrmann, W; Ozcan, M; Nergiz, Ibrahim; �zcan, Mutlu

    With the increase in adult orthodontic treatment comes the need to find a reliable method for bonding orthodontic brackets onto metal or ceramic crowns and fixed partial dentures. In this study, shear bond strength and surface roughness tests were used to examine the effect of 4 different surface

  10. National implementation of the UNECE convention on long-range transboundary air pollution (effects). Pt. 1. Deposition loads: methods, modelling and mapping results, trends

    Energy Technology Data Exchange (ETDEWEB)

    Gauger, Thomas [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE); Stuttgart Univ. (Germany). Inst. of Navigation; Haenel, Hans-Dieter; Roesemann, Claus [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE)

    2008-09-15

    The report on the implementation of the UNECE convention on long-range transboundary air pollution Pt.1, deposition loads (methods, modeling and mapping results, trends) includes the following chapters: Introduction, deposition on air pollutants used for the input for critical loads in exceeding calculations, methods applied for mapping total deposition loads, mapping wet deposition, wet deposition mapping results, mapping dry deposition, dry deposition mapping results, cloud and fog mapping results, total deposition mapping results, modeling the air concentration of acidifying components and heavy metals, agricultural emissions of acidifying and eutrophying species.

  11. A novel surface cleaning method for chemical removal of fouling lead layer from chromium surfaces

    International Nuclear Information System (INIS)

    Gholivand, Kh.; Khosravi, M.; Hosseini, S.G.; Fathollahi, M.

    2010-01-01

    Most products especially metallic surfaces require cleaning treatment to remove surface contaminations that remain after processing or usage. Lead fouling is a general problem which arises from lead fouling on the chromium surfaces of bores and other interior parts of systems which have interaction with metallic lead in high temperatures and pressures. In this study, a novel chemical solution was introduced as a cleaner reagent for removing metallic lead pollution, as a fouling metal, from chromium surfaces. The cleaner aqueous solution contains hydrogen peroxide (H 2 O 2 ) as oxidizing agent of lead layer on the chromium surface and acetic acid (CH 3 COOH) as chelating agent of lead ions. The effect of some experimental parameters such as acetic acid concentration, hydrogen peroxide concentration and temperature of the cleaner solution during the operation on the efficiency of lead cleaning procedure was investigated. The results of scanning electron microscopy (SEM) showed that using this procedure, the lead pollution layer could be completely removed from real chromium surfaces without corrosion of the original surface. Finally, the optimum conditions for the complete and fast removing of lead pollution layer from chromium surfaces were proposed. The experimental results showed that at the optimum condition (acetic acid concentration 28% (V/V), hydrogen peroxide 8% (V/V) and temperature 35 deg. C), only 15-min time is needed for complete removal of 3 g fouling lead from a chromium surface.

  12. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  13. Group IV nanocrystals with ion-exchangeable surface ligands and methods of making the same

    Science.gov (United States)

    Wheeler, Lance M.; Nichols, Asa W.; Chernomordik, Boris D.; Anderson, Nicholas C.; Beard, Matthew C.; Neale, Nathan R.

    2018-01-09

    Methods are described that include reacting a starting nanocrystal that includes a starting nanocrystal core and a covalently bound surface species to create an ion-exchangeable (IE) nanocrystal that includes a surface charge and a first ion-exchangeable (IE) surface ligand ionically bound to the surface charge, where the starting nanocrystal core includes a group IV element.

  14. Comparison of conventional, model-based quantitative planar, and quantitative SPECT image processing methods for organ activity estimation using In-111 agents

    International Nuclear Information System (INIS)

    He, Bin; Frey, Eric C

    2006-01-01

    Accurate quantification of organ radionuclide uptake is important for patient-specific dosimetry. The quantitative accuracy from conventional conjugate view methods is limited by overlap of projections from different organs and background activity, and attenuation and scatter. In this work, we propose and validate a quantitative planar (QPlanar) processing method based on maximum likelihood (ML) estimation of organ activities using 3D organ VOIs and a projector that models the image degrading effects. Both a physical phantom experiment and Monte Carlo simulation (MCS) studies were used to evaluate the new method. In these studies, the accuracies and precisions of organ activity estimates for the QPlanar method were compared with those from conventional planar (CPlanar) processing methods with various corrections for scatter, attenuation and organ overlap, and a quantitative SPECT (QSPECT) processing method. Experimental planar and SPECT projections and registered CT data from an RSD Torso phantom were obtained using a GE Millenium VH/Hawkeye system. The MCS data were obtained from the 3D NCAT phantom with organ activity distributions that modelled the uptake of 111 In ibritumomab tiuxetan. The simulations were performed using parameters appropriate for the same system used in the RSD torso phantom experiment. The organ activity estimates obtained from the CPlanar, QPlanar and QSPECT methods from both experiments were compared. From the results of the MCS experiment, even with ideal organ overlap correction and background subtraction, CPlanar methods provided limited quantitative accuracy. The QPlanar method with accurate modelling of the physical factors increased the quantitative accuracy at the cost of requiring estimates of the organ VOIs in 3D. The accuracy of QPlanar approached that of QSPECT, but required much less acquisition and computation time. Similar results were obtained from the physical phantom experiment. We conclude that the QPlanar method, based

  15. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    Science.gov (United States)

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  16. Reducing Motional Decoherence in Ion Traps with Surface Science Methods

    Science.gov (United States)

    Haeffner, Hartmut

    2014-03-01

    Many trapped ions experiments ask for low motional heating rates while trapping the ions close to trapping electrodes. However, in practice small ion-electrode distances lead to unexpected high heating rates. While the mechanisms for the heating is still unclear, it is now evident that surface contamination of the metallic electrodes is at least partially responsible for the elevated heating rates. I will discuss heating rate measurements in a microfabricated surface trap complemented with basic surface science studies. We monitor the elemental surface composition of the Cu-Al alloy trap with an Auger spectrometer. After bake-out, we find a strong Carbon and Oxygen contamination and heating rates of 200 quanta/s at 1 MHz trap frequency. After removing most of the Carbon and Oxygen with Ar-Ion sputtering, the heating rates drop to 4 quanta/s. Interestingly, we still measure the decreased heating rate even after the surface oxidized from the background gas throughout a 40-day waiting time in UHV.

  17. Clinical comparative study between the use of lasers and conventional methods of diagnosis and treatment in deciduous teeth with presence of carious lesion

    International Nuclear Information System (INIS)

    Pulga, Fabiane Galvao

    2001-01-01

    The aim of this work was to evaluate the efficiency of deciduous tooth cavity preparation by the Er:YAG laser in comparison with the conventional burr rotary instrument. Besides, we have used the laser fluorescence technique (DIAGNOdent equipment) for diagnosis and compared it to the usual tactile and visual examination as well as X-ray diagnosis. For this purpose, 20 chronic occlusal carious deciduous molar teeth from children with the ages between 5 to 10 years old were selected. Selection was ma de according to visual inspection, X-ray periapical image and measures of the DIAGNOdent. For treatment the teeth were divided in two groups, 10 to be treated by the Er:YAG laser and 10 with conventional burr. For enamel, the laser energy used was in the interval from 200 to 300 mJ; for the dentine the range was from 100 mJ to 200 mJ. In both cases, the laser frequency was in the range from 2 to 4 Hz. The results have shown that the laser treatment was more accepted by the children than the conventional burro Clinical evaluation of the cavity preparation indicates that the Er:YAG laser treatment is recommend. The DIAGNOdent evaluation method was very effective for diagnosis of carious tissue for initial detection. After successful removal of the carious tissue, confirmed by visual inspection, the DIAGNOdent evaluation method was only effective for the treatment with conventional burro For evaluation of the tooth after cavity preparation with the Er:YAG laser, the measurements oscillate covering the full range of the equipment. Therefore, the use of the DIAGNOdent equipment is indicated only for initial caries diagnosis. (author)

  18. A new method of constructing scalar-flat Kaehler surfaces

    International Nuclear Information System (INIS)

    Kim, Jongsu; Pontecorvo, M.

    1993-10-01

    Building on the work of Donaldson-Friedman we present a geometric way of constructing anti-self-dual hermitian metrics on compact complex surfaces which is based on the relative complex deformations of singular 3-folds with divisors. Some of the consequences are that under a mild condition, fully described by LeBrun-Singer, any blow up of a scalar-flat Kaehler surface admits scalar-flat Kaehler metrics; this is used to prove that such extremal Kaehler metrics exists on an open dense subset of the moduli space of non-minimal ruled surfaces of genus g ≥ 2. Related results have been obtained by LeBrun-Singer. (author). 25 refs

  19. Method for Derivatization and Detection of Chemical Weapons Convention Related Sulfur Chlorides via Electrophilic Addition with 3-Hexyne.

    Science.gov (United States)

    Goud, D Raghavender; Pardasani, Deepak; Purohit, Ajay Kumar; Tak, Vijay; Dubey, Devendra Kumar

    2015-07-07

    Sulfur monochloride (S2Cl2) and sulfur dichloride (SCl2) are important precursors of the extremely toxic chemical warfare agent sulfur mustard and classified, respectively, into schedule 3.B.12 and 3.B.13 of the Chemical Weapons Convention (CWC). Hence, their detection and identification is of vital importance for verification of CWC. These chemicals are difficult to detect directly using chromatographic techniques as they decompose and do not elute. Until now, the use of gas chromatographic approaches to follow the derivatized sulfur chlorides is not reported in the literature. The electrophilic addition reaction of sulfur monochloride and sulfur dichloride toward 3-hexyne was explored for the development of a novel derivatization protocol, and the products were subjected to gas chromatography-mass spectrometric (GC-MS) analysis. Among various unsaturated reagents like alkenes and alkynes, symmetrical alkyne 3-hexyne was optimized to be the suitable derivatizing agent for these analytes. Acetonitrile was found to be the suitable solvent for the derivatization reaction. The sample preparation protocol for the identification of these analytes from hexane spiked with petrol matrix was also optimized. Liquid-liquid extraction followed by derivatization was employed for the identification of these analytes from petrol matrix. Under the established conditions, the detection and quantification limits are 2.6 μg/mL, 8.6 μg/mL for S2Cl2 and 2.3 μg/mL, 7.7 μg/mL for SCl2, respectively, in selected ion monitoring (SIM) mode. The calibration curve had a linear relationship with y = 0.022x - 0.331 and r(2) = 0.992 for the working range of 10 to 500 μg/mL for S2Cl2 and y = 0.007x - 0.064 and r(2) = 0.991 for the working range of 10 to 100 μg/mL for SCl2, respectively. The intraday RSDs were between 4.80 to 6.41%, 2.73 to 6.44% and interday RSDs were between 2.20 to 7.25% and 2.34 to 5.95% for S2Cl2 and SCl2, respectively.

  20. Effectiveness of two conventional methods for seismic retrofit of steel and RC moment resisting frames based on damage control criteria

    Science.gov (United States)

    Beheshti Aval, Seyed Bahram; Kouhestani, Hamed Sadegh; Mottaghi, Lida

    2017-07-01

    This study investigates the efficiency of two types of rehabilitation methods based on economic justification that can lead to logical decision making between the retrofitting schemes. Among various rehabilitation methods, concentric chevron bracing (CCB) and cylindrical friction damper (CFD) were selected. The performance assessment procedure of the frames is divided into two distinct phases. First, the limit state probabilities of the structures before and after rehabilitation are investigated. In the second phase, the seismic risk of structures in terms of life safety and financial losses (decision variables) using the recently published FEMA P58 methodology is evaluated. The results show that the proposed retrofitting methods improve the serviceability and life safety performance levels of steel and RC structures at different rates when subjected to earthquake loads. Moreover, these procedures reveal that financial losses are greatly decreased, and were more tangible by the application of CFD rather than using CCB. Although using both retrofitting methods reduced damage state probabilities, incorporation of a site-specific seismic hazard curve to evaluate mean annual occurrence frequency at the collapse prevention limit state caused unexpected results to be obtained. Contrary to CFD, the collapse probability of the structures retrofitted with CCB increased when compared with the primary structures.

  1. A comparison between the conventional manual ROI method and an automatic algorithm for semiquantitative analysis of SPECT studies

    International Nuclear Information System (INIS)

    Pagan, L; Novi, B; Guidarelli, G; Tranfaglia, C; Galli, S; Lucchi, G; Fagioli, G

    2011-01-01

    In this study, the performance of a free software for automatic segmentation of striatal SPECT brain studies (BasGanV2 - www.aimn.it) and a standard manual Region Of Interest (ROI) method were compared. The anthropomorphic Alderson RSD phantom, filled with solutions at different concentration of 123 I-FP-CIT with Caudate-Putamen to Background ratios between 1 and 8.7 and Caudate to Putamen ratios between 1 and 2, was imaged on a Philips-Irix triple head gamma camera. Images were reconstructed using filtered back-projection and processed with both BasGanV2, that provides normalized striatal uptake values on volumetric anatomical ROIs, and a manual method, based on average counts per voxel in ROIs drawn in a three-slice section. Caudate-Putamen/Background and Caudate/Putamen ratios obtained with the two methods were compared with true experimental ratios. Good correlation was found for each method; BasGanV2, however, has higher R index (BasGan R mean = 0.95, p mean = 0.89, p 123 I-FP-CIT SPECT data with, moreover, the advantage of the availability of a control subject's database.

  2. Long-term drug modification to the surface of mesenchymal stem cells by the avidin-biotin complex method.

    Science.gov (United States)

    Takayama, Yukiya; Kusamori, Kosuke; Hayashi, Mika; Tanabe, Noriko; Matsuura, Satoru; Tsujimura, Mari; Katsumi, Hidemasa; Sakane, Toshiyasu; Nishikawa, Makiya; Yamamoto, Akira

    2017-12-05

    Mesenchymal stem cells (MSCs) have various functions, making a significant contribution to tissue repair. On the other hand, the viability and function of MSCs are not lasting after an in vivo transplant, and the therapeutic effects of MSCs are limited. Although various chemical modification methods have been applied to MSCs to improve their viability and function, most of conventional drug modification methods are short-term and unstable and cause cytotoxicity. In this study, we developed a method for long-term drug modification to C3H10T1/2 cells, murine mesenchymal stem cells, without any damage, using the avidin-biotin complex method (ABC method). The modification of NanoLuc luciferase (Nluc), a reporter protein, to C3H10T1/2 cells by the ABC method lasted for at least 14 days in vitro without major effects on the cellular characteristics (cell viability, cell proliferation, migration ability, and differentiation ability). Moreover, in vivo, the surface Nluc modification to C3H10T1/2 cells by the ABC method lasted for at least 7 days. Therefore, these results indicate that the ABC method may be useful for long-term surface modification of drugs and for effective MSC-based therapy.

  3. Membrane mimetic surface functionalization of nanoparticles: Methods and applications

    Science.gov (United States)

    Weingart, Jacob; Vabbilisetty, Pratima; Sun, Xue-Long

    2013-01-01

    Nanoparticles (NPs), due to their size-dependent physical and chemical properties, have shown remarkable potential for a wide range of applications over the past decades. Particularly, the biological compatibilities and functions of NPs have been extensively studied for expanding their potential in areas of biomedical application such as bioimaging, biosensing, and drug delivery. In doing so, surface functionalization of NPs by introducing synthetic ligands and/or natural biomolecules has become a critical component in regards to the overall performance of the NP system for its intended use. Among known examples of surface functionalization, the construction of an artificial cell membrane structure, based on phospholipids, has proven effective in enhancing biocompatibility and has become a viable alternative to more traditional modifications, such as direct polymer conjugation. Furthermore, certain bioactive molecules can be immobilized onto the surface of phospholipid platforms to generate displays more reminiscent of cellular surface components. Thus, NPs with membrane-mimetic displays have found use in a range of bioimaging, biosensing, and drug delivery applications. This review herein describes recent advances in the preparations and characterization of integrated functional NPs covered by artificial cell membrane structures and their use in various biomedical applications. PMID:23688632

  4. Method for plasma surface treating and preparation of membrane layers

    NARCIS (Netherlands)

    1992-01-01

    The invention relates to an apparatus suitable for plasma surface treating (e.g. forming a membrane layer on a substrate) which comprises a plasma generation section (2) which is in communication via at least one plasma inlet means (4) (e.g. a nozzle) with an enclosed plasma treating section (3)

  5. A novel fabrication method for surface integration of metal structures into polymers (SIMSIP)

    Science.gov (United States)

    Carrion-Gonzalez, Hector

    Recently developed flexible electronics applications require that the thin metal films embedded on elastomer substrates also be flexible. These electronic systems are radically different in terms of performance and functionality than conventional silicon-based devices. A key question is whether the metal deposited on flexible films can survive large strains without rupture. Cumbersome macro-fabrication methods have been developed for functional and bendable electronics (e.g., interconnects) encapsulated between layers of polymer films. However, future electronic applications may require electronic flexible devices to be in intimate contact with curved surfaces (e.g., retinal implants) and to be robust enough to withstand large and repeated mechanical deformations. In this research, a novel technique for surface integration of metal structures into polymers (SIMSIP) was developed. Surface embedding, as opposed to placing metal on polymers, provides better adherence while leaving the surface accessible for contacts. This was accomplished by first fabricating the micro-scale metal patterns on a quartz or Teflon mother substrate, and then embedding them to a flexible polyimide thin film. The technique was successfully used to embed micro-metal structures of gold (Au), silver (Ag), and copper (Cu) into polyimide films without affecting the functional properties of the either the metals or the polymers. Experimental results confirm the successful surface-embedding of metal structures as narrow as 0.6 microm wide for different geometries commonly used in circuit design. Although similar approaches exist in literature, the proposed methodology provides a simpler and more reliable way of producing flexible circuits/electronics that is also suitable for high volume manufacturing. In order to demonstrate the flexibility of metal interconnects fabricated using the SIMSIP technique, multiple Au electrodes (5 microm and 2.5 microm wide) were tested using the X-theta bending

  6. Comparative evaluation of the efficacy of chemomechanical caries removal agent (Papacarie and conventional method of caries removal: An in vitro study

    Directory of Open Access Journals (Sweden)

    Jawa D

    2010-06-01

    Full Text Available Painless dentistry, minimal intervention and thus giving comfort, relief and solace and instill positive attitude toward dental treatments, are some of the factors justifying the specialty of pediatric dentistry. Thus, this in vitro study was undertaken to compare the efficacy of a new chemomechanical caries removal agent, Papacarie (Formula and Acao, with conventional slow-speed rotary instrument (bur. Papacarie is a new formulation and has the main active ingredient papain, an endoprotein with bactericidal, bacteriostatic and anti-inflammatory actions. Twenty extracted human molar teeth with deep dentine caries and no enamel coverage were selected for the study. After the preparation of the teeth and removal of the caries with the respective methods, they were decalcified, dehydrated and embedded in paraffin blocks for histologic studies. Serial sections of 5 μm thickness were examined for the presence of bacteria under light microscope. Though complete removal of caries was achieved significantly in both the methods, there was less marked destruction of dentinal tubules in chemomechanical caries removal method by Papacarie. Thus, Papacarie is recommended as an efficient, easy to perform, comfortable and less destructive solution for the patient seeking an alternative to the conventional method.

  7. Ex Vivo Comparison of Mtwo and RaCe Rotary File Systems in Root Canal Deviation: One File Only versus the Conventional Method.

    Science.gov (United States)

    Aminsobhani, Mohsen; Razmi, Hasan; Nozari, Solmaz

    2015-07-01

    Cleaning and shaping of the root canal system is an important step in endodontic therapy. New instruments incorporate new preparation techniques that can improve the efficacy of cleaning and shaping. The aim of this study was to compare the efficacy of Mtwo and RaCe rotary file systems in straightening the canal curvature using only one file or the conventional method. Sixty mesial roots of extracted human mandibular molars were prepared by RaCe and Mtwo nickel-titanium (NiTi) rotary files using the conventional and only one rotary file methods. The working length was 18 mm and the curvatures of the root canals were between 15-45°. By superimposing x-ray images before and after the instrumentation, deviation of the canals was assessed using Adobe Photoshop CS3 software. Preparation time was recorded. Data were analyzed using three-way ANOVA and Tukey's post hoc test. There were no significant differences between RaCe and Mtwo or between the two root canal preparation methods in root canal deviation in buccolingual and mesiodistal radiographs (P>0.05). Changes of root canal curvature in >35° subgroups were significantly more than in other subgroups with smaller canal curvatures. Preparation time was shorter in one file only technique. According to the results, the two rotary systems and the two root canal preparation methods had equal efficacy in straightening the canals; but the preparation time was shorter in one file only group.

  8. Estimate of Small Stiffness and Damping Ratio in Residual Soil Using Spectral Analysis of Surface Wave Method

    Directory of Open Access Journals (Sweden)

    Bawadi Nor Faizah

    2016-01-01

    Full Text Available Research in the important parameters for modeling the dynamic behavior of soils has led to rapid development of the small strain stiffness and damping ratio for use in the seismic method. It is because, the experimental determination of the damping ratio is problematic, especially for hard soils sample. Many researchers have proved that the surface wave method is a reliable tool to determine shear wave velocity and damping ratio profiles at a site with very small strains level. Surface wave methods based on Rayleigh waves propagation and the resulting attenuation curve can become erroneous when higher modes contribute to the soil’s response. In this study, two approaches has been used to determine the shear strain amplitude and damping ratio of residual soils at small strain level using Spectral Analysis of Surface Wave (SASW method. One is to derive shear strain amplitude from the frequency-response curve and the other is to derive damping ratio from travel-time data. Then, the results are compared to the conventional method.

  9. A Method of Retrieving BRDF from Surface-Reflected Radiance Using Decoupling of Atmospheric Radiative Transfer and Surface Reflection

    Directory of Open Access Journals (Sweden)

    Alexander Radkevich

    2018-04-01

    Full Text Available Bi-directional reflection distribution function (BRDF defines anisotropy of the surface reflection. It is required to specify the boundary condition for radiative transfer (RT modeling used in aerosol retrievals, cloud retrievals, atmospheric modeling, and other applications. Ground based measurements of reflected radiance draw increasing attention as a source of information about anisotropy of surface reflection. Derivation of BRDF from surface radiance requires atmospheric correction. This study develops a new method of retrieving BRDF on its whole domain, making it immediately suitable for further atmospheric RT modeling applications. The method is based on the integral equation relating surface-reflected radiance, BRDF, and solutions of two auxiliary atmosphere-only RT problems. The method requires kernel-based BRDF. The weights of the kernels are obtained with a quickly converging iterative procedure. RT modeling has to be done only one time before the start of iterative process.

  10. Efficacy of adding the Kinesio Taping method to guideline-endorsed conventional physiotherapy in patients with chronic nonspecific low back pain: a randomised controlled trial.

    Science.gov (United States)

    Added, Marco Aurélio Nemitalla; Costa, Leonardo Oliveira Pena; Fukuda, Thiago Yukio; de Freitas, Diego Galace; Salomão, Evelyn Cassia; Monteiro, Renan Lima; Costa, Lucíola da Cunha Menezes

    2013-10-24

    Chronic nonspecific low back pain is a significant health condition with high prevalence worldwide and it is associated with enormous costs to society. Clinical practice guidelines show that many interventions are available to treat patients with chronic low back pain, but the vast majority of these interventions have a modest effect in reducing pain and disability. An intervention that has been widespread in recent years is the use of elastic bandages called Kinesio Taping. Although Kinesio Taping has been used extensively in clinical practice, current evidence does not support the use of this intervention; however these conclusions are based on a small number of underpowered studies. Therefore, questions remain about the effectiveness of the Kinesio Taping method as an additional treatment to interventions, such as conventional physiotherapy, that have already been recommended by the current clinical practice guidelines in robust and high-quality randomised controlled trials. We aim to determine the effectiveness of the addition of the use of Kinesio Taping in patients with chronic nonspecific low back pain who receive guideline-endorsed conventional physiotherapy. One hundred and forty-eight patients will be randomly allocated to receive either conventional physiotherapy, which consists of a combination of manual therapy techniques, general exercises, and specific stabilisation exercises (Guideline-Endorsed Conventional Physiotherapy Group) or to receive conventional physiotherapy with the addition of Kinesio Taping to the lumbar spine (Conventional Physiotherapy plus Kinesio Taping Group) over a period of 5 weeks (10 sessions of treatment). Clinical outcomes (pain intensity, disability and global perceived effect) will be collected at baseline and at 5 weeks, 3 months, and 6 months after randomisation. We will also collect satisfaction with care and adverse effects after treatment. Data will be collected by a blinded assessor. All statistical analysis will be

  11. Analysis of Longitudinal Studies With Repeated Outcome Measures: Adjusting for Time-Dependent Confounding Using Conventional Methods.

    Science.gov (United States)

    Keogh, Ruth H; Daniel, Rhian M; VanderWeele, Tyler J; Vansteelandt, Stijn

    2018-05-01

    Estimation of causal effects of time-varying exposures using longitudinal data is a common problem in epidemiology. When there are time-varying confounders, which may include past outcomes, affected by prior exposure, standard regression methods can lead to bias. Methods such as inverse probability weighted estimation of marginal structural models have been developed to address this problem. However, in this paper we show how standard regression methods can be used, even in the presence of time-dependent confounding, to estimate the total effect of an exposure on a subsequent outcome by controlling appropriately for prior exposures, outcomes, and time-varying covariates. We refer to the resulting estimation approach as sequential conditional mean models (SCMMs), which can be fitted using generalized estimating equations. We outline this approach and describe how including propensity score adjustment is advantageous. We compare the causal effects being estimated using SCMMs and marginal structural models, and we compare the two approaches using simulations. SCMMs enable more precise inferences, with greater robustness against model misspecification via propensity score adjustment, and easily accommodate continuous exposures and interactions. A new test for direct effects of past exposures on a subsequent outcome is described.

  12. New surface modification method of bio-titanium alloy by EB polishing

    International Nuclear Information System (INIS)

    Okada, Akira; Uno, Yoshiyuki; Iio, Atsuo; Fujiwara, Kunihiko; Doi, Kenji

    2008-01-01

    A new surface modification for bio-titanium alloy products by electron beam (EB) polishing is proposed. In this EB polishing method, high energy density EB can be irradiated without concentrating the beam. Therefore, large-area EB with a maximum diameter of 60 mm can be used for instantaneously melting or evaporating metal surface. Experimental results made it clear that surface characteristics, such as repellency, corrosion resistance and coefficient of friction could be improved simultaneously with the surface smoothing in a few minutes under a proper condition. Therefore, EB polishing method has a possibility of high efficient surface smoothing and surface modification process for bio-titanium alloy. (author)

  13. Comparing personal alpha dosimetry with the conventional area monitoring-time weighting methods of exposure estimation: a Canadian assessment

    International Nuclear Information System (INIS)

    Balint, A.B.; Viljoen, J.

    1988-01-01

    An experimental personal alpha dosimetry program for monitoring exposures of uranium mining facility workers in Canada has been completed. All licenced operating mining facilities were participating. Dosimetry techniques, description of dosimeters used by licences, performance and problems associated with the implementation of the programme as well as technical and administrative advantages and difficulties experienced are discussed. Area monitoring-time weighting methods used and results obtained to determine individual radon and thoron daughter exposure and exposure results generated by using dosimeters are assessed and compared

  14. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

    Science.gov (United States)

    Seo, K H; Valentin-Bon, I E; Brackett, R E

    2006-03-01

    Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

  15. Comparison of Vitek Matrix-assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry Versus Conventional Methods in Candida Identification.

    Science.gov (United States)

    Keçeli, Sema Aşkın; Dündar, Devrim; Tamer, Gülden Sönmez

    2016-02-01

    Candida species are generally identified by conventional methods such as germ tube or morphological appearance on corn meal agar, biochemical methods using API kits and molecular biological methods. Alternative to these methods, rapid and accurate identification methods of microorganisms called matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDİ-TOF MS) has recently been described. In this study, Candida identification results by API Candida kit, API 20C AUX kit and identifications on corn meal agar (CMA) are compared with the results obtained on Vitek-MS. All results were confirmed by sequencing internal transcribed spacer (ITS) regions of rDNA. Totally, 97 Candida strains were identified by germ tube test, CMA, API and Vitek-MS. Vitek-MS results were compatible with 74.2 % of API 20C AUX and 81.4 % of CMA results. The difference between the results of API Candida and API 20C AUX was detected. The ratio of discrepancy between Vitek-MS and API 20C AUX was 25.8 %. Candida species mostly identified as C. famata or C. tropicalis by and not compatible with API kits were identified as C. albicans by Vitek-MS. Sixteen Candida species having discrepant results with Vitek-MS, API or CMA were randomly chosen, and ITS sequence analysis was performed. The results of sequencing were compatible 56.2 % with API 20C AUX, 50 % with CMA and 93.7 % with Vitek-MS. When compared with conventional identification methods, MS results are more reliable and rapid for Candida identification. MS system may be used as routine identification method in clinical microbiology laboratories.

  16. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR.

    Science.gov (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane

    2017-10-01

    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  17. Analysis of multi lobe journal bearings with surface roughness using finite difference method

    Science.gov (United States)

    PhaniRaja Kumar, K.; Bhaskar, SUdaya; Manzoor Hussain, M.

    2018-04-01

    Multi lobe journal bearings are used for high operating speeds and high loads in machines. In this paper symmetrical multi lobe journal bearings are analyzed to find out the effect of surface roughnessduring non linear loading. Using the fourth order RungeKutta method, time transient analysis was performed to calculate and plot the journal centre trajectories. Flow factor method is used to evaluate the roughness and the finite difference method (FDM) is used to predict the pressure distribution over the bearing surface. The Transient analysis is done on the multi lobe journal bearings for threedifferent surface roughness orientations. Longitudinal surface roughness is more effective when compared with isotopic and traverse surface roughness.

  18. Prediction of postoperative pulmonary function. Preliminary comparison of single-breath dual-energy xenon CT with three conventional methods

    International Nuclear Information System (INIS)

    Yanagita, Hisami; Honda, Norinari; Nakayama, Mitsuo

    2013-01-01

    The purpose of this study was to assess the use of xenon ventilation maps (Xe-images) for predicting postoperative pulmonary function. After study approval by the institutional review board, written informed consent was obtained from 30 patients with lung tumors who underwent pre- and postoperative spirometry, pulmonary perfusion single photon emission computed tomography (SPECT) and dual-energy CT (80 kV and 140 kV/Sn) after single-breath inspiration of 35% xenon. Xe-images were calculated by three-material decomposition. Sum of pixel values of the part to be resected (A) and of the whole lung (B) on Xe-images or lung perfusion SPECT, and volumes or the number of segments of the part to be resected (A) and of the whole lung (B) on Xe-images were enumerated, respectively. We multiplied (1-A/B) by each preoperative value from spirometry for prediction. Predictions by each of the four methods were compared with postoperative values. Predicted values for vital capacity (VC), forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV 1 ) by the four methods regressed significantly with measured values (R 2 =0.56-0.77, p 1 with accuracy comparable to that of CT volumetry. (author)

  19. Integrated functional modeling method for NPP plant DiD risk monitor and its application for conventional PWR

    Energy Technology Data Exchange (ETDEWEB)

    Yoshikawa, Hidekazu; Yang, Ming; Zhang, Zhijian [Harbin Engineering University, Harbin (China)

    2014-08-15

    The development of a new risk monitor system is introduced in this paper, which can be applied not only to severe accident prevention in daily operation but also to serve as to mitigate the radiological hazard just after severe accident happens and long term management of post-severe accident consequences. The summary of the fundamental method is summarized on how to configure the Plant Defense in-Depth (Did) Risk Monitor by object-oriented software system based on functional modeling approach. Following the authors??preceding preliminary study for AP1000, the way of realizing the proposed method of configuring the plant Did risk monitor was investigated for a safety-enhanced Japanese PWR design to meet with the tight anti-severe accident requirements set by national regulation in Japan after Fukushima Daiichi accident. The result of this example practice of the presented preliminary study for Japanese PWR was for the level 4 of the Did in case of beyond design basis accident, that is, loss of all AC power + RCP seal LOCA, against the former case of AP1000 for level 3 Did in case of large LOCA.

  20. Clinical value of FDG hybrid-PET in staging and restaging of malignant lymphoma. Compared with conventional diagnostic methods

    International Nuclear Information System (INIS)

    Pichler, R.; Maschek, W.; Hatzl-Griesenhofer, M.; Huber, H.; Wimmer, G.; Wahl, G.; Fridrik, M.

    2000-01-01

    Aim of the present retrospective study was to validate the clinical value of F-18-FDG PET imaging in lymphoma patients with a dual head camera modified for coincidence detection. Staging before and after oncological treatment was compared with a conservative diagnostic approach. Methods: 48 patients (28 non-Hodgkin lymphoma, 20 Hodgkin's disease) received FDG-Hybrid-PET scans. Pretherapeutic staging was realized in 28 patients, 9 of them had control studies after they had completed therapy. Totally 29 persons were examined for posttherapeutic restaging. Computed tomography imaging and lymph node sonography was performed in all cases. Results were validated by clinical follow-up, in three cases a recidive was proven by biopsy. Results: CT and ultrasound detected 77 lesions in 28 patients compared with 100 visualized by PET, but this difference in pretherapeutic staging did not reach significance at p>0.05 by Fisher's t-test. Hybrid-PET obtained a sensitivity of 93%, a specifity of 79%, a positive of 82% and a negative predictive value of 92% for detection of residual disease. The values for CT+US were 87%, 64%, 72% and 88% respectively. Conclusion: FDG Hybrid-PET is as or even more accurate than standard morphologic diagnostic methods for prestaging in malignant lymphoma. Additionally, there is a substancial benefit for therapy monitoring of residual disease using coincidence detection PET with a 3/4-inch crystal gamma camera. (orig.) [de

  1. The orthogonal gradients method: A radial basis functions method for solving partial differential equations on arbitrary surfaces

    KAUST Repository

    Piret, Cécile

    2012-05-01

    Much work has been done on reconstructing arbitrary surfaces using the radial basis function (RBF) method, but one can hardly find any work done on the use of RBFs to solve partial differential equations (PDEs) on arbitrary surfaces. In this paper, we investigate methods to solve PDEs on arbitrary stationary surfaces embedded in . R3 using the RBF method. We present three RBF-based methods that easily discretize surface differential operators. We take advantage of the meshfree character of RBFs, which give us a high accuracy and the flexibility to represent the most complex geometries in any dimension. Two out of the three methods, which we call the orthogonal gradients (OGr) methods are the result of our work and are hereby presented for the first time. © 2012 Elsevier Inc.

  2. Comparison of conventional straight and swan-neck straight catheters inserted by percutaneous method for continuous ambulatory peritoneal dialysis: a single-center study.

    Science.gov (United States)

    Singh, Shivendra; Prakash, Jai; Singh, R G; Dole, P K; Pant, Pragya

    2015-10-01

    To evaluate the incidence of mechanical and infectious complications of conventional straight catheter (SC) versus swan-neck straight catheter (SNSC) implanted by percutaneous method. We retrospectively analyzed 45 catheter insertions being done by percutaneous method from January 1, 2011, to May 31, 2014. SC was inserted in 24 patients, and SNSC was inserted in 21 patients. Baseline characteristics for the two groups were similar with respect to age, sex and diabetic nephropathy as the cause for end-stage renal disease. Incidence of mechanical and infectious complications in SNSC group was found to be low as compared to the SC group and was statistically significant (1 in 11.6 patient months vs. 1 in 14.4 patient months, p = 0.02). Catheter migration was found to be the most common mechanical complication (20 %), and peritonitis was found to be the most common infectious complication in conventional SC group (27 episodes in 420 patient months vs. 11 episodes in 333 patient months, p = 0.03). The incidence of exit site and tunnel infection rates revealed no difference between the groups. SNSC insertion by percutaneous method is associated with low mechanical and infectious complications.

  3. A method of non-destructive quantitative analysis of the ancient ceramics with curved surface

    International Nuclear Information System (INIS)

    He Wenquan; Xiong Yingfei

    2002-01-01

    Generally the surface of the sample should be smooth and flat in XRF analysis, but the ancient ceramics and hardly match this condition. Two simple methods are put forward in fundamental method and empirical correction method of XRF analysis, so the analysis of little sample or the sample with curved surface can be easily completed

  4. Advances in surface wave methods: Cascaded MASW-SASW

    NARCIS (Netherlands)

    Westerhoff, R.S.; Brouwer, J.H.; Meekes, J.A.C.

    2005-01-01

    The application of the MASW method in areas that show strong lateral variations in subsurface properties is limited. Traditional SASW may yield a better lateral resolution but the dispersion curves (and thus the subsurface models) obtained with the method may be poor. The joint application of MASW

  5. Review of Electrical and Gravity Methods of Near-Surface ...

    African Journals Online (AJOL)

    USER

    ABSTRACT: The theory and practice of electrical and gravity methods of geophysics for groundwater exploration was reviewed with illustrations and data examples. With the goal of reducing cases of borehole/water-well failure attributed to the lack of the knowledge of the methods of geophysics for groundwater exploration ...

  6. Photoswitchable method for the ordered attachment of proteins to surfaces

    Science.gov (United States)

    Camarero, Julio A.; De Yoreo, James J.; Kwon, Youngeun

    2010-04-20

    Described herein is a method for the attachment of proteins to any solid support with control over the orientation of the attachment. The method is extremely efficient, not requiring the previous purification of the protein to be attached, and can be activated by UV-light. Spatially addressable arrays of multiple protein components can be generated by using standard photolithographic techniques.

  7. Photoswitchable method for the ordered attachment of proteins to surfaces

    Science.gov (United States)

    Camarero, Julio A [Livermore, CA; DeYoreo, James J [Clayton, CA; Kwon, Youngeun [Livermore, CA

    2011-07-05

    Described herein is a method for the attachment of proteins to any solid support with control over the orientation of the attachment. The method is extremely efficient, not requiring the previous purification of the protein to be attached, and can be activated by UV-light. Spatially addressable arrays of multiple protein components can be generated by using standard photolithographic techniques.

  8. Artificial Intelligence Mechanisms on Interactive Modified Simplex Method with Desirability Function for Optimising Surface Lapping Process

    Directory of Open Access Journals (Sweden)

    Pongchanun Luangpaiboon

    2014-01-01

    Full Text Available A study has been made to optimise the influential parameters of surface lapping process. Lapping time, lapping speed, downward pressure, and charging pressure were chosen from the preliminary studies as parameters to determine process performances in terms of material removal, lap width, and clamp force. The desirability functions of the-nominal-the-best were used to compromise multiple responses into the overall desirability function level or D response. The conventional modified simplex or Nelder-Mead simplex method and the interactive desirability function are performed to optimise online the parameter levels in order to maximise the D response. In order to determine the lapping process parameters effectively, this research then applies two powerful artificial intelligence optimisation mechanisms from harmony search and firefly algorithms. The recommended condition of (lapping time, lapping speed, downward pressure, and charging pressure at (33, 35, 6.0, and 5.0 has been verified by performing confirmation experiments. It showed that the D response level increased to 0.96. When compared with the current operating condition, there is a decrease of the material removal and lap width with the improved process performance indices of 2.01 and 1.14, respectively. Similarly, there is an increase of the clamp force with the improved process performance index of 1.58.

  9. Assessment of adiposity in psoriatic patients by dual energy X-ray absorptiometry compared to conventional methods*

    Science.gov (United States)

    Diniz, Michelle dos Santos; Bavoso, Nádia Couto; Kakehasi, Adriana Maria; Lauria, Márcio Weissheimer; Soares, Maria Marta Sarquis; Machado-Pinto, Jackson

    2016-01-01

    BACKGROUND Obesity is considered a chronic low-grade inflammatory disease that shares mediators of inflammation with psoriasis, such as TNF-α and IL-6. The relationship between these two conditions involves factors such as predisposition and response to therapy, in addition to an association with cardiovascular disease. OBJECTIVES The aim of the present study was to investigate the prevalence of adiposity as determined by body mass index (BMI), waist circumference (WC), and dual energy X-ray absorptiometry (DXA) evaluation in patients with psoriasis. METHODS BMI, WC and body composition by DXA were measured in 42 psoriatic patients without joint complaints and in 41 control patients using standard procedures. In the comparison between cases and controls, we used Pearson’s Χ2 test or Fisher’s exact test, and the nonparametric Mann-Whitney test. The difference between the diverse classification methods for obesity was evaluated using McNemar’s test. To test the level of agreement between those variables, we used the weighted kappa coefficient. RESULTS There was no difference in the prevalence of obesity among cases and controls. Both BMI and WC had low agreement with measures of body fat evaluated by DXA. With the use of DXA scanning, prevalence of overweight and obesity in patients with psoriasis was 83.3%, which constitutes a strong evidence of the need for intervention on this metabolic parameter. CONCLUSION Dual energy X-ray absorptiometry was more capable of identifying obesity compared with BMI and WC both in psoriatic and control patients. PMID:27192512

  10. Ernst Equation and Riemann Surfaces: Analytical and Numerical Methods

    International Nuclear Information System (INIS)

    Ernst, Frederick J

    2007-01-01

    metric tensor components. The first two chapters of this book are devoted to some basic ideas: in the introductory chapter 1 the authors discuss the concept of integrability, comparing the integrability of the vacuum Ernst equation with the integrability of nonlinear equations of Korteweg-de Vries (KdV) type, while in chapter 2 they describe various circumstances in which the vacuum Ernst equation has been determined to be relevant, not only in connection with gravitation but also, for example, in the construction of solutions of the self-dual Yang-Mills equations. It is also in this chapter that one of several equivalent linear systems for the Ernst equation is described. The next two chapters are devoted to Dmitry Korotkin's concept of algebro-geometric solutions of a linear system: in chapter 3 the structure of such solutions of the vacuum Ernst equation, which involve Riemann theta functions of hyperelliptic algebraic curves of any genus, is contrasted with the periodic structure of such solutions of the KdV equation. How such solutions can be obtained, for example, by solving a matrix Riemann-Hilbert problem and how the metric tensor of the associated spacetime can be evaluated is described in detail. In chapter 4 the asymptotic behaviour and the similarity structure of the general algebro-geometric solutions of the Ernst equation are described, and the relationship of such solutions to the perhaps more familiar multi-soliton solutions is discussed. The next three chapters are based upon the authors' own published research: in chapter 5 it is shown that a problem involving counter-rotating infinitely thin disks of matter can be solved in terms of genus two Riemann theta functions, while in chapter 6 the authors describe numerical methods that facilitate the construction of such solutions, and in chapter 7 three-dimensional graphs are displayed that depict all metrical fields of the associated spacetime. Finally, in chapter 8, the difficulties associated with

  11. The use of a phased-array surface coil and breath-holding in MRI of the liver. Comparison of conventional SE, fat-suppressed GRE, and TSE sequences

    International Nuclear Information System (INIS)

    Helmberger, T.; Holzknecht, N.; Lackerbauer, C.A.; Mueller-Lisse, U.; Schnarkowski, P.; Gauger, J.; Reiser, M.

    1995-01-01

    To determine the efficacy of fast MRI techniques using a taylored imaging design (breathhold and array-surface coil), conventional T1-, T2-weighted spin-echo (SE) sequences and breathhold gradient-echo (GRE) T1- and breathhold fast SE T2-weighted images were compared. 20 patients with proven focal liver lesions were studied on a 1.5 Tesla system. Conventional SE T1- und T2-weighted imaging, as well as GRE T1- and fast SE T2-weighted imaging was performed. Fast imaging was done during breathhold using an array-surface coil. For all sequences signal-to-noise ratios (S/N) and liver-to-lesion-contrast ratios (L/L) were measured and statistically compared. Regarding image quality parameters, S/N and L/L, there was no significant difference between the conventional and fast imaging techniques. However, GRE imaging was superior (84.8%) to conventional imaging for breathing and pulsation artifacts, while fast SE T2 imaging was equal regarding breathing artifacts, but superior (51.5%) regarding pulsation artifacts. The number of detected hepatic lesions was identical in all sequences. The fast MRI techniques demonstrated a superiority to conventional imaging regarding image quality and presence of artifacts. (orig.) [de

  12. A study on evaluating validity of SNR calculation using a conventional two region method in MR images applied a multichannel coil and parallel imaging technique

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kwan Woo; Son, Soon Yong [Dept. of Radiology, Asan Medical Center, Seoul (Korea, Republic of); Min, Jung Whan [Dept. of Radiological Technology, Shingu University, Sungnam (Korea, Republic of); Kwon, Kyung Tae [Dept. of Radiological Technology, Dongnam Health University, Suwon (Korea, Republic of); Yoo, Beong Gyu; Lee, Jong Seok [Dept. of Radiotechnology, Wonkwang Health Science University, Iksan (Korea, Republic of)

    2015-12-15

    The purpose of this study was to investigate the problems of a signal to noise ratio measurement using a two region measurement method that is conventionally used when using a multi-channel coil and a parallel imaging technique. As a research method, after calculating the standard SNR using a single channel head coil of which coil satisfies three preconditions when using a two region measurement method, we made comparisons and evaluations after calculating an SNR by using a two region measurement method of which method is problematic because it is used without considering the methods recommended by reputable organizations and the preconditions at the time of using a multi-channel coil and a parallel imaging technique. We found that a two region measurement method using a multi-channel coil and a parallel imaging technique shows the highest relative standard deviation, and thus shows a low degree of precision. In addition, we found out that the difference of SNR according to ROI location was very high, and thus a spatial noise distribution was not uniform. Also, 95% confidence interval through Blend-Altman plot is the widest, and thus the conformity degree with a two region measurement method using the standard single channel head coil is low. By directly comparing an AAPM method, which serves as a standard of a performance evaluation test of a magnetic resonance imaging device under the same image acquisition conditions, an NEMA method which can accurately determine the noise level in a signal region and the methods recommended by manufacturers of a magnetic resonance imaging device, there is a significance in that we quantitatively verified the inaccurate problems of a signal to noise ratio using a two region measurement method when using a multi-channel coil and a parallel imaging technique of which method does not satisfy the preconditions that researchers could overlook.

  13. A new method for background rejection with surface sensitive bolometers

    International Nuclear Information System (INIS)

    Nones, C.; Foggetta, L.; Giuliani, A.; Pedretti, M.; Salvioni, C.; Sangiorgio, S.

    2006-01-01

    We report the performance of three prototype TeO 2 macrobolometers, able to identify events due to energy deposited at the detector surface. This capability is obtained by thermally coupling thin active layers to the main absorber of the bolometer, and is proved by irradiating the detectors with alpha particles. This technique can be very useful in view of background study and reduction for the CUORE experiment, a next generation Double Beta Decay search based on TeO 2 macrobolometers and to be installed in the Laboratori Nazionali del Gran Sasso

  14. Soil bioengineering methods for abandoned mine land surface drainage channels

    Energy Technology Data Exchange (ETDEWEB)

    Sotir, R.B.; Simms, A.P.; Sweigard, R.J.; Hammer, P.; Graves, D.H.; Adkins, M. [Robbin B. Sotir & Associates, Marietta, GA (USA)

    1999-07-01

    Research to determine the suitability of soil bioengineering for slope stabilization at abandoned surface mining sites is described. The technology uses live woody plant material as a structural component, in this case live fascine with coir erosion control fabric made from coconut. A large water collection pond draining to nine channels on the slope below was constructed as a test site. The pond has drainage channels for testing at low, intermediate, and steep slope grades. Each group of three channels is composed of one riprap rock channel, one gabion channel, and one soil bioengineering channel. The channels will be tested summer 1999. 11 refs., 5 figs., 2 tabs., 8 photos.

  15. A study on modeling nitrogen dioxide concentrations using land-use regression and conventionally used exposure assessment methods

    Science.gov (United States)

    Choi, Giehae; Bell, Michelle L.; Lee, Jong-Tae

    2017-04-01

    The land-use regression (LUR) approach to estimate the levels of ambient air pollutants is becoming popular due to its high validity in predicting small-area variations. However, only a few studies have been conducted in Asian countries, and much less research has been conducted on comparing the performances and applied estimates of different exposure assessments including LUR. The main objectives of the current study were to conduct nitrogen dioxide (NO2) exposure assessment with four methods including LUR in the Republic of Korea, to compare the model performances, and to estimate the empirical NO2 exposures of a cohort. The study population was defined as the year 2010 participants of a government-supported cohort established for bio-monitoring in Ulsan, Republic of Korea. The annual ambient NO2 exposures of the 969 study participants were estimated with LUR, nearest station, inverse distance weighting, and ordinary kriging. Modeling was based on the annual NO2 average, traffic-related data, land-use data, and altitude of the 13 regularly monitored stations. The final LUR model indicated that area of transportation, distance to residential area, and area of wetland were important predictors of NO2. The LUR model explained 85.8% of the variation observed in the 13 monitoring stations of the year 2009. The LUR model outperformed the others based on leave-one out cross-validation comparing the correlations and root-mean square error. All NO2 estimates ranged from 11.3-18.0 ppb, with that of LUR having the widest range. The NO2 exposure levels of the residents differed by demographics. However, the average was below the national annual guidelines of the Republic of Korea (30 ppb). The LUR models showed high performances in an industrial city in the Republic of Korea, despite the small sample size and limited data. Our findings suggest that the LUR method may be useful in similar settings in Asian countries where the target region is small and availability of data is

  16. Evaluation of conventional and alternative monitoring methods for a recreational marine beach with nonpoint source of fecal contamination.

    Science.gov (United States)

    Shibata, Tomoyuki; Solo-Gabriele, Helena M; Sinigalliano, Christopher D; Gidley, Maribeth L; Plano, Lisa R W; Fleisher, Jay M; Wang, John D; Elmir, Samir M; He, Guoqing; Wright, Mary E; Abdelzaher, Amir M; Ortega, Cristina; Wanless, David; Garza, Anna C; Kish, Jonathan; Scott, Troy; Hollenbeck, Julie; Backer, Lorraine C; Fleming, Lora E

    2010-11-01

    The objectives of this work were to compare enterococci (ENT) measurements based on the membrane filter, ENT(MF) with alternatives that can provide faster results including alternative enterococci methods (e.g., chromogenic substrate (CS), and quantitative polymerase chain reaction (qPCR)), and results from regression models based upon environmental parameters that can be measured in real-time. ENT(MF) were also compared to source tracking markers (Staphylococcus aureus, Bacteroidales human and dog markers, and Catellicoccus gull marker) in an effort to interpret the variability of the signal. Results showed that concentrations of enterococci based upon MF (turbidity and tidal height. Enterococci by MF and CS were also inversely correlated with solar radiation but enterococci by qPCR was not. The regression model based on environmental variables provided fair qualitative predictions of enterococci by MF in real-time, for daily geometric mean levels, but not for individual samples. Overall, ENT(MF) was not significantly correlated with source tracking markers with the exception of samples collected during one storm event. The inability of the regression model to predict ENT(MF) levels for individual samples is likely due to the different sources of ENT impacting the beach at any given time, making it particularly difficult to to predict short-term variability of ENT(MF) for environmental parameters.

  17. Comparison of in-situ gamma ray spectrometry measurements with conventional methods in determination natural and artificial nuclides in soil

    International Nuclear Information System (INIS)

    Al-Masri, M. S.; Doubal, A. W.

    2010-12-01

    Two nuclear analytical techniques (In-Situ Gamma ray spectrometry and laboratory gamma ray spectrometry) for determination of natural and artificial radionuclides in soil have been validated. The first technique depends on determination of radioactivity content of representative samples of the studied soil after laboratory preparation, while the second technique is based on direct determination of radioactivity content of soil using in-situ gamma-ray spectrometer. Analytical validation parameter such as detection limits, repeatability, reproducibility in addition to measurement uncertainties were estimated and compared for both techniques. Comparison results have shown that the determination of radioactivity in soil should apply the two techniques together where each of techniques is characterized by its low detection limit and uncertainty suitable for defined application of measurement. Radioactive isotopes in various locations were determined using the two methods by measuring 40 k, 238 U,and 137 Cs. The results showed that there are differences in attenuation factors due to soil moisture content differences; wet weight corrections should be applied when the two techniques are compared. (author)

  18. Preparation and study of tramadol imprinted micro-and nanoparticles by precipitation polymerization: microwave irradiation and conventional heating method.

    Science.gov (United States)

    Seifi, Mahmoud; Hassanpour Moghadam, Maryam; Hadizadeh, Farzin; Ali-Asgari, Safa; Aboli, Jafar; Mohajeri, Seyed Ahmad

    2014-08-25

    In the present work a series of tramadole imprinted micro- and nanoparticles were prepared and study their recognition properties. Methacrylic acid (MAA), as a functional monomer, ethylene glycol dimethacrylate (EGDMA) as a cross-linker and different solvents (chloroform, toluene and acetonitrile (ACN)) were used for the preparation of molecularly imprinted polymers (MIPs) and non-imprinted polymers (NIPs). Several factors such as template/monomer molar ratio, volume of polymerization solvent, total monomers/solvent volume ratio, polymerization condition (heating or microwave irradiation) were also investigated. Particle size of the polymers, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FT-IR), rebinding, selectivity tests and release study were applied for evaluation of the polymers. The optimized polymers with smaller particle size and superior binding properties were obtained in acetonitrile under heating method. MIPA4 with a size of 42.6 nm and a binding factor (BF) of 6.79 was selected for selectivity and release tests. The polymerization was not successful in acetonitrile and toluene under microwave irradiation. The MIPA4 could selectively adsorb tramadol, compared to imipramine, naltrexone and gabapentin. The data showed that tramadol release from MIPA4 was significantly slower than that of its non-imprinted polymer. Therefore, MIP nanoparticles with high selectivity, binding capacity and ability to control tramadol release could be obtained in precipitation polymerization with optimized condition. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Clinical and anatomic pathology effects of serial blood sampling in rat toxicology studies, using conventional or microsampling methods.

    Science.gov (United States)

    Caron, Alexis; Lelong, Christine; Bartels, T; Dorchies, O; Gury, T; Chalier, Catherine; Benning, Véronique

    2015-08-01

    As a general practice in rodent toxicology studies, satellite animals are used for toxicokinetic determinations, because of the potential impact of serial blood sampling on toxicological endpoints. Besides toxicological and toxicokinetic determinations, blood samples obtained longitudinally from a same animal may be used for the assessment of additional parameters (e.g., metabolism, pharmacodynamics, safety biomarkers) to maximize information that can be deduced from rodents. We investigated whether removal of up to 6 × 200 μL of blood over 24h can be applied in GLP rat toxicology studies without affecting the scientific outcome. 8 week-old female rats (200-300 g) were dosed for up to 1 month with a standard vehicle and subjected or not (controls) to serial blood sampling for sham toxicokinetic/ancillary determinations, using miniaturized methods allowing collection of 6 × 50, 100 or 200 μL over 24h. In-life endpoints, clinical pathology parameters and histopathology of organs sensitive to blood volume reduction were evaluated at several time points after completion of sampling. In sampled rats, minimal and reversible changes in red blood cell mass (maximally 15%) and subtle variations in liver enzymes, fibrinogen and neutrophils were not associated with any organ/tissue macroscopic or microscopic correlate. Serial blood sampling (up to 6 × 200 μL over 24h) is compatible with the assessment of standard toxicity endpoints in adult rats. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Experimental innovations in surface science a guide to practical laboratory methods and instruments

    CERN Document Server

    Yates, John T

    2015-01-01

    This book is a new edition of a classic text on experimental methods and instruments in surface science. It offers practical insight useful to chemists, physicists, and materials scientists working in experimental surface science. This enlarged second edition contains almost 300 descriptions of experimental methods. The more than 50 active areas with individual scientific and measurement concepts and activities relevant to each area are presented in this book. The key areas covered are: Vacuum System Technology, Mechanical Fabrication Techniques, Measurement Methods, Thermal Control, Delivery of Adsorbates to Surfaces, UHV Windows, Surface Preparation Methods, High Area Solids, Safety. The book is written for researchers and graduate students.

  1. An alternative safer and cost effective surface sterilization method for ...

    African Journals Online (AJOL)

    user

    2013-10-30

    Oct 30, 2013 ... 110 countries and 50% of the production occurs in Brazil and India (FAO, 2008). ... capital formation, agriculture and other industries develop- ment, urbanization and ... Moreover, the method requires large nursery space: one.

  2. Using of the surface activation method for enhancement of machine realibility

    International Nuclear Information System (INIS)

    Postnikov, V.I.; Garbar, I.N.

    1979-01-01

    A surface activation method is described for controlling the wear of units and details, allowing one to measure the wear at continuous operation of the mechanism by any program. The main advantages of the surface activation method for the wear tests are shown. By means of that method it was possible to develop a simultaneous controlling conjugate detail wear, and a method of different-activity brands, as well as the method for repeated activation of details. Development of theory for the engineering and technology of engine wear control by the surface activation method allowed one to improve the efficiency and reduce the time of research in the field of friction and wear

  3. Definition of a critical confining zone using surface geophysical methods

    International Nuclear Information System (INIS)

    Eddy-Dilek, C.A.; Looney, B.B.; Hoekstra, P.; Harthill, N.; Blohm, M.; Phillips, D.R.

    1997-01-01

    Definition of the hydrologic framework in layered sediments of fluvial and deltaic origin is a difficult challenge for environmental characterization and remediation programs due to the lithologic and stratigraphic heterogeneities inherent in these settings. The authors set out to use complementary geophysical surveys to determine the nature and extent of a deep confining unit at the Savannah River Site, South Carolina. Time Domain Electromagnetic (TDEM) soundings were used to define the electrical conductance of the clayey confining unit (aquitard), and shear-wave reflection seismic was used to define the stratigraphic framework. Based on correlations with borehole geophysical logs and sieve data, the shear-wave seismic proved capable of defining relatively fine layering in the coastal plain sediments, the upper and lower surfaces of a critical confining unit, and erosional features on the surface of the confining unit. The TDEM surveys defined the presence or absence of the clay facies of the confining unit. Moreover, by constraining the interpretation of the TDEM data with the thickness of the confining unit derived from the seismic data, the authors mapped the extent of the unit, showing where the clay is thicker, where it probably was never deposited, and where it was eroded by downcutting channels. These results have significant implications on the design and optimization of remedial systems

  4. A surface refractive index scanning system and method

    DEFF Research Database (Denmark)

    2015-01-01

    The invention relates to a surface refractive index scanning system for characterization of a sample. The system comprises a grating device for holding or receiving the sample, the device comprising at least a first grating region having a first grating width along a transverse direction, and a s......The invention relates to a surface refractive index scanning system for characterization of a sample. The system comprises a grating device for holding or receiving the sample, the device comprising at least a first grating region having a first grating width along a transverse direction...... a grating period Λ2 in the longitudinal direction, where the longitudinal direction is orthogonal to the transverse direction. A grating period spacing ΔΛ = Λ1 - Λ2 is finite. Further, the first and second grating periods are chosen to provide optical resonances for light respectively in a first...... wavelength band and a second wavelength band, light is being emitted, transmitted, or reflected in an out-of-plane direction, wherein the first wavelength band and the second wavelength band are at least partially non-overlapping in wavelength. The system further comprises a light source for illuminating...

  5. Comparative evaluation of optical methods and conventional isotope techniques for the detection of insulin receptors in heterogenous cell systems

    International Nuclear Information System (INIS)

    Thun, C.

    1984-01-01

    The findings of studies using radioactively labelled (I-125) insulin to characterise its binding to various heterogenous cell systems had led to a classification of the relevant receptors with those of high affinity and low capacity or vice versa. This, in turn, raised questions as to the binding properties of each individual cell or cell material of a heterogenous nature. Apparently homogenous (lymphocytes) and heterogenous (blood and islet cells) cell populations were investigated on the basis of various techniques for the separate evaluation of individual cells, which were cytofluorometry using FITC insulin and the analysis of gold insulin under the electron microscope. For the association kinetics and equilibration analysis or affinity and receptor quantity a radioactive tracer and light microscope were used. Insulin was shown to bind to erythrocytes, reticulocytes, monocytes and lymphocytes and this result finds confirmation in the relevant literature. Furthermore, binding parameters could be determined for isolated islet cells. Cytofluorometry pointed to the fact that the insulin receptors of an apparently homogenous cell system differed in affinity and number and permitted the use of a multiple parameter procedure. Thus, it holds out promise as a method to be routinely used in the clinical diagnosis of binding parameters, without requiring previous separation procedures that are complicated or involve a loss of material. Transmission electron microscopy permitted conclusions to be drawn as to the type of cell to which insulin is attached. Owing to the use of gold insulin it was possible to throw some light on the factors determining the fate of membrane-bound insulin during its uptake into the cell. (TRV) [de

  6. Method and system for formation and withdrawal of a sample from a surface to be analyzed

    Science.gov (United States)

    Van Berkel, Gary J.; Kertesz, Vilmos

    2017-10-03

    A method and system for formation and withdrawal of a sample from a surface to be analyzed utilizes a collection instrument having a port through which a liquid solution is conducted onto the surface to be analyzed. The port is positioned adjacent the surface to be analyzed, and the liquid solution is conducted onto the surface through the port so that the liquid solution conducted onto the surface interacts with material comprising the surface. An amount of material is thereafter withdrawn from the surface. Pressure control can be utilized to manipulate the solution balance at the surface to thereby control the withdrawal of the amount of material from the surface. Furthermore, such pressure control can be coordinated with the movement of the surface relative to the port of the collection instrument within the X-Y plane.

  7. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  8. A new quantitative index of lobar air trapping in chronic obstructive pulmonary disease (COPD): Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Nagatani, Yukihiro, E-mail: yatsushi@belle.shiga-med.ac.jp [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Murata, Kiyoshi; Takahashi, Masashi; Nitta, Norihisa [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Nakano, Yasutaka [Division of Respiratory Medicine, Department of Internal Medicine, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Sonoda, Akinaga; Otani, Hideji [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Okabe, Hidetoshi [Department of Clinical Laboratory, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Ogawa, Emiko [Health Administration Center, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2015-05-15

    Highlights: • In the total lung field, AVI had excellent correlation with FEV{sub 1}/FVC. • AVI showed differences between three groups classified by the COPD severity. • In a lobe-based analysis, AVI did not mostly correlated with volume decrease ratio. • In a lobe-based analysis, coefficient of variation was relatively small in AVI. • In some lobes, AVI associated with the COPD severity despite respiratory level. - Abstract: Purpose: To determine the usefulness of newly-proposed index (attenuation–volume index, AVI: increase in mean value of lung attenuation (MVLA) divided by volume decrease ratio (VDR)) for quantitative assessment of lobar air trapping (LAT) using expiratory/inspiratory (E/I) computed tomography (CT) by minimizing influence of respiratory level. Materials and methods: Institutional review board approved study protocol. Twenty-one moderate or severe COPD (group A), 16 mild COPD (group B) and 26 normal volunteers (group C) underwent both E/I scans via 320-row CT and pulmonary functional test (PFT). Volume image data were automatically segmented into six lung lobes with minimal manual intervention. AVI, pixel index (PI), air trapping ratio (ATR) and relative volume change (RVC{sub 860–950}) were calculated in total lung (TL) and each lobe. Four indices in TL were correlated with both PFT result and VDR and those in TL and each lobe were compared between three groups. Results: Similar to ATR, AVI correlated with both FEV{sub 1}/FVC (r = 0.772, p < 0.01) and RV/TLC (r = −0.726, p < 0.01) and demonstrated a significant difference between three groups in both TL (group A: 1.69 ± 0.45, group B: 2.21 ± 0.45 and group C: 2.80 ± 0.44) and five lobes except for left lingular segment. In a lobe-based analysis regarding relationship with VDR, AVI was much less dependent than ATR, although regression lines of groups A and C were separated for AVI as well as ATR. Coefficient of variation of either PI or RVC{sub 860–950} was significantly

  9. Method for automatic localization of MR-visible markers using morphological image processing and conventional pulse sequences: feasibility for image-guided procedures.

    Science.gov (United States)

    Busse, Harald; Trampel, Robert; Gründer, Wilfried; Moche, Michael; Kahn, Thomas

    2007-10-01

    To evaluate the feasibility and accuracy of an automated method to determine the 3D position of MR-visible markers. Inductively coupled RF coils were imaged in a whole-body 1.5T scanner using the body coil and two conventional gradient echo sequences (FLASH and TrueFISP) and large imaging volumes up to (300 mm(3)). To minimize background signals, a flip angle of approximately 1 degrees was used. Morphological 2D image processing in orthogonal scan planes was used to determine the 3D positions of a configuration of three fiducial markers (FMC). The accuracies of the marker positions and of the orientation of the plane defined by the FMC were evaluated at various distances r(M) from the isocenter. Fiducial marker detection with conventional equipment (pulse sequences, imaging coils) was very reliable and highly reproducible over a wide range of experimental conditions. For r(M) method is found to be useful for image-guided procedures. (c) 2007 Wiley-Liss, Inc.

  10. Comparison of conventional full spine radiographs and fluoroscopic scanning method in young patients with idiopathic scoliosis; Vergleich von konventioneller Wirbelsaeulenganzaufnahme und fluoroskopischer Scan-Methode bei jungen Patienten mit idiopathischer Skoliose

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, J.; Kottke, R.; Claussen, C. [Abt. fuer Radiologische Diagnostik, Universitaetsklinikum Tuebingen (Germany); Kluba, T.; Niemeyer, T.; Hahnfeldt, T. [Klinik und Poliklinik fuer Orthopaedie, Universitaetsklinikum Tuebingen (Germany); Vonthein, R. [Inst. fuer Medizinische Biometrie, Universitaetsklinikum Tuebingen (Germany); Kamm, K.F. [Philips Medizin Systeme GmbH, Hamburg (Germany)

    2005-08-01

    Purpose: evaluation of low-dose full spine radiographs using fluoroscopic images for the assessment of the Cobb angle measurement in patients with scoliosis. Material and methods: twenty-one consecutive patients (aged 10-27 years, mean age 14 years) with a conventional full spine examination (film speed class 800) underwent a follow-up exam using digital pulsed fluoroscopy (Multi Diagnost 4, Philips Medical Systems, Eindhoven, The Netherlands). The mean follow-up was 9 months. During a synchronized scan with a C-arm speed of 4 cm/sec fluoroscopic images were stored with a pulsed frequency of 3 images per second. The single images were merged and reconstructed to one image with the software easy spine (Philips medical Systems, Eindhoven, The Netherlands). The corresponding dose-area product values (DAP) of both methods were compared. Three independent observers assessed Cobb angles and image quality for each technique. Results: the mean DAP values for conventional imaging was 94.9 cGy x cm{sup 2} and for fluoroscopy 7.8 cGy x cm{sup 2}, respectively. A significant dose reduction of 91.8% (CI 91% to 95%) was calculated. The average absolute angle difference between the observers was found to be 2.7 for conventional imaging and 2.4 for the fluoroscopic method. Interobserver standard deviation of 2.9 was lower than the 5.3 for conventional images. Image quality was better in the conventional images. Conclusion: using the scanning method, we could achieve a mean reduction of the radiation dose of 92%, while the accuracy of the Cobb angle measurements was comparable for both techniques despite of reduced image quality of digital fluoroscopy. (orig.)

  11. Validation of a laboratory method for evaluating dynamic properties of reconstructed equine racetrack surfaces.

    Directory of Open Access Journals (Sweden)

    Jacob J Setterbo

    Full Text Available Racetrack surface is a risk factor for racehorse injuries and fatalities. Current research indicates that race surface mechanical properties may be influenced by material composition, moisture content, temperature, and maintenance. Race surface mechanical testing in a controlled laboratory setting would allow for objective evaluation of dynamic properties of surface and factors that affect surface behavior.To develop a method for reconstruction of race surfaces in the laboratory and validate the method by comparison with racetrack measurements of dynamic surface properties.Track-testing device (TTD impact tests were conducted to simulate equine hoof impact on dirt and synthetic race surfaces; tests were performed both in situ (racetrack and using laboratory reconstructions of harvested surface materials. Clegg Hammer in situ measurements were used to guide surface reconstruction in the laboratory. Dynamic surface properties were compared between in situ and laboratory settings. Relationships between racetrack TTD and Clegg Hammer measurements were analyzed using stepwise multiple linear regression.Most dynamic surface property setting differences (racetrack-laboratory were small relative to surface material type differences (dirt-synthetic. Clegg Hammer measurements were more strongly correlated with TTD measurements on the synthetic surface than the dirt surface. On the dirt surface, Clegg Hammer decelerations were negatively correlated with TTD forces.Laboratory reconstruction of racetrack surfaces guided by Clegg Hammer measurements yielded TTD impact measurements similar to in situ values. The negative correlation between TTD and Clegg Hammer measurements confirms the importance of instrument mass when drawing conclusions from testing results. Lighter impact devices may be less appropriate for assessing dynamic surface properties compared to testing equipment designed to simulate hoof impact (TTD.Dynamic impact properties of race surfaces

  12. Evaluation of chemical surface treatment methods for mitigation of PWSCC

    International Nuclear Information System (INIS)

    Dame, C.; Marks, C.; Olender, A.; Farias, J.

    2015-01-01

    As part of its mission to propose innovative and safe technologies to mitigate Primary Water Stress Corrosion Cracking (PWSCC) in Pressurized Water Reactors (PWR), EPRI recently initiated a program to evaluate potential new chemical surface treatments that might delay the occurrence of PWSCC such that no failure of components would be observed during their lifetime. Among the initial screening of more than thirty technologies, seven were selected for a more detailed review. The selected technologies were: nickel and nickel alloy plating, organic inhibitors, chromium-based inhibitors, silicon carbide, titanium-based inhibitors, rare earth metal (REM)-based inhibitors and encapsulation. The conclusions of the review of these technologies were that two of them were worth pursuing, titanium-based and REM-based inhibitors, and that evaluating the radiological consequences of injecting these products in the primary system, as well as assessing their efficacy to mitigate PWSCC, should be prioritized as the next required steps in qualification for implementation. (authors)

  13. Precision Fit of Screw-Retained Implant-Supported Fixed Dental Prostheses Fabricated by CAD/CAM, Copy-Milling, and Conventional Methods.

    Science.gov (United States)

    de França, Danilo Gonzaga; Morais, Maria Helena; das Neves, Flávio D; Carreiro, Adriana Fonte; Barbosa, Gustavo As

    The aim of this study was to evaluate the effectiveness of fabrication methods (computer-aided design/computer-aided manufacture [CAD/CAM], copy-milling, and conventional casting) in the fit accuracy of three-unit, screw-retained fixed dental prostheses. Sixteen three-unit implant-supported screw-retained frameworks were fabricated to fit an in vitro model. Eight frameworks were fabricated using the CAD/CAM system, four in zirconia and four in cobalt-chromium. Four zirconia frameworks were fabricated using the copy-milled system, and four were cast in cobalt-chromium using conventional casting with premachined abutments. The vertical and horizontal misfit at the implant-framework interface was measured using scanning electron microscopy at ×250. The results for vertical misfit were analyzed using Kruskal-Wallis and Mann-Whitney tests. The horizontal misfits were categorized as underextended, equally extended, or overextended. Statistical analysis established differences between groups according to the chi-square test (α = .05). The mean vertical misfit was 5.9 ± 3.6 μm for CAD/CAM-fabricated zirconia, 1.2 ± 2.2 μm for CAD/CAM-fabricated cobalt-chromium frameworks, 7.6 ± 9.2 μm for copy-milling-fabricated zirconia frameworks, and 11.8 (9.8) μm for conventionally fabricated frameworks. The Mann-Whitney test revealed significant differences between all but the zirconia-fabricated frameworks. A significant association was observed between the horizontal misfits and the fabrication method. The percentage of horizontal misfits that were underextended and overextended was higher in milled zirconia (83.3%), CAD/CAM cobaltchromium (66.7%), cast cobalt-chromium (58.3%), and CAD/CAM zirconia (33.3%) frameworks. CAD/CAM-fabricated frameworks exhibit better vertical misfit and low variability compared with copy-milled and conventionally fabricated frameworks. The percentage of interfaces equally extended was higher when CAD/CAM and zirconia were used.

  14. Comparison of revegetation of a gas pipeline right-of-way in two forested wetland crossings involving conventional methods of pipeline installation and horizontal drilling, Nassau County, Florida

    Energy Technology Data Exchange (ETDEWEB)

    Van Dyke, G.D. [Trinity Christian Coll., Palos Heights, IL (United States). Dept. of Biology; Shem, L.M.; Zimmerman, R.E. [Argonne National Lab., IL (United States)

    1993-10-01

    One year after pipeline installation, vegetation in the right-of-way (ROW) was inventoried at two stream floodplain crossings in Nassau County, Florida. Both sites were forested wetlands composed of Acer rubrum, Fraxinus caroliniana, Liquidamber styraciflua, Nyssa ogecho, Quercus laurifolia, and Taxodium distichum, together with other wetland trees. Pipeline installation across the Brandy Branch floodplain was by conventional ditching and backfill methods. Installation across the Deep Creek floodplain was by horizontal drilling after clearcutting the ROW. The latter method left tree stumps, understory vegetation, and soil layers intact, except for disruptions caused by logging. According to the inventory, vegetation at the drilled site was more diverse (nearly twice as many species occurring in the ROW as at the trenched site) and more robust (no unvegetated exposed soil compared to 15% at the trenched site). Differences between the ROW vegetation at the two sites can be attributed to both site differences and installation technologies used.

  15. Review of Electrical and Gravity Methods of Near-Surface ...

    African Journals Online (AJOL)

    USER

    In every big city, dozen of new boreholes or hand-dug wells are .... This paper is a review of the electrical and gravity methods of ... audience/readership. II. ..... W. W. Northon and Company, New York. Butler ... McGraw Hill Books Co. New York ...

  16. The modal surface interpolation method for damage localization

    Science.gov (United States)

    Pina Limongelli, Maria

    2017-05-01

    The Interpolation Method (IM) has been previously proposed and successfully applied for damage localization in plate like structures. The method is based on the detection of localized reductions of smoothness in the Operational Deformed Shapes (ODSs) of the structure. The IM can be applied to any type of structure provided the ODSs are estimated accurately in the original and in the damaged configurations. If the latter circumstance fails to occur, for example when the structure is subjected to an unknown input(s) or if the structural responses are strongly corrupted by noise, both false and missing alarms occur when the IM is applied to localize a concentrated damage. In order to overcome these drawbacks a modification of the method is herein investigated. An ODS is the deformed shape of a structure subjected to a harmonic excitation: at resonances the ODS are dominated by the relevant mode shapes. The effect of noise at resonance is usually lower with respect to other frequency values hence the relevant ODS are estimated with higher reliability. Several methods have been proposed to reliably estimate modal shapes in case of unknown input. These two circumstances can be exploited to improve the reliability of the IM. In order to reduce or eliminate the drawbacks related to the estimation of the ODSs in case of noisy signals, in this paper is investigated a modified version of the method based on a damage feature calculated considering the interpolation error relevant only to the modal shapes and not to all the operational shapes in the significant frequency range. Herein will be reported the comparison between the results of the IM in its actual version (with the interpolation error calculated summing up the contributions of all the operational shapes) and in the new proposed version (with the estimation of the interpolation error limited to the modal shapes).

  17. The orthogonal gradients method: A radial basis functions method for solving partial differential equations on arbitrary surfaces

    KAUST Repository

    Piret, Cé cile

    2012-01-01

    Much work has been done on reconstructing arbitrary surfaces using the radial basis function (RBF) method, but one can hardly find any work done on the use of RBFs to solve partial differential equations (PDEs) on arbitrary surfaces. In this paper

  18. The calculation of surface free energy based on embedded atom method for solid nickel

    International Nuclear Information System (INIS)

    Luo Wenhua; Hu Wangyu; Su Kalin; Liu Fusheng

    2013-01-01

    Highlights: ► A new solution for accurate prediction of surface free energy based on embedded atom method was proposed. ► The temperature dependent anisotropic surface energy of solid nickel was obtained. ► In isotropic environment, the approach does not change most predictions of bulk material properties. - Abstract: Accurate prediction of surface free energy of crystalline metals is a challenging task. The theory calculations based on embedded atom method potentials often underestimate surface free energy of metals. With an analytical charge density correction to the argument of the embedding energy of embedded atom method, an approach to improve the prediction for surface free energy is presented. This approach is applied to calculate the temperature dependent anisotropic surface energy of bulk nickel and surface energies of nickel nanoparticles, and the obtained results are in good agreement with available experimental data.

  19. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    International Nuclear Information System (INIS)

    Koster, Marijke; Reijnders, Lucas; Oost, Nathalie R. van; Peijnenburg, Willie J.G.M.

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl 2 and 0.43 M HNO 3 , digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl 2 correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl 2 . A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C E (effective concentration) measured by a DGT-device, CaCl 2 extracted zinc and the zinc content in the pore water of all soils. The correlation with C E was not significant for lupine, neither for spiked soils, nor for field soils (p ≤ 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods

  20. Application of the gyroscopic method in subterranean orientation. Comparison with conventional methods. Aplicacion del metodo gyroscopic en la orientacion subterranea. Comparacion con los metodos convencionales

    Energy Technology Data Exchange (ETDEWEB)

    Saez Garcia, E.; Fuente Martin, P.L. (HUNOSA, Madrid (Spain))

    1988-01-01

    This entry tries to revise the most used method for the direction transition what with exterior and interior using plumbs in connected with vertical shaft coalmines. A technical and economic cooperation was also realized between the indicated method and the gyroscope.

  1. Computerized mappings of the cerebral cortex: a multiresolution flattening method and a surface-based coordinate system

    Science.gov (United States)

    Drury, H. A.; Van Essen, D. C.; Anderson, C. H.; Lee, C. W.; Coogan, T. A.; Lewis, J. W.

    1996-01-01

    We present a new method for generating two-dimensional maps of the cerebral cortex. Our computerized, two-stage flattening method takes as its input any well-defined representation of a surface within the three-dimensional cortex. The first stage rapidly converts this surface to a topologically correct two-dimensional map, without regard for the amount of distortion introduced. The second stage reduces distortions using a multiresolution strategy that makes gross shape changes on a coarsely sampled map and further shape refinements on progressively finer resolution maps. We demonstrate the utility of this approach by creating flat maps of the entire cerebral cortex in the macaque monkey and by displaying various types of experimental data on such maps. We also introduce a surface-based coordinate system that has advantages over conventional stereotaxic coordinates and is relevant to studies of cortical organization in humans as well as non-human primates. Together, these methods provide an improved basis for quantitative studies of individual variability in cortical organization.

  2. Experimental Study in Taguchi Method on Surface Quality Predication of HSM

    Science.gov (United States)

    Ji, Yan; Li, Yueen

    2018-05-01

    Based on the study of ball milling mechanism and machining surface formation mechanism, the formation of high speed ball-end milling surface is a time-varying and cumulative Thermos-mechanical coupling process. The nature of this problem is that the uneven stress field and temperature field affect the machined surface Process, the performance of the processing parameters in the processing interaction in the elastic-plastic materials produced by the elastic recovery and plastic deformation. The surface quality of machining surface is ch