Alterations of the TP53 Gene in Gastric and Esophageal Carcinogenesis
Directory of Open Access Journals (Sweden)
Marilanda Ferreira Bellini
2012-01-01
Full Text Available TP53 genes is one of more important tumor suppressor gene, which acts as a potent transcription factor with fundamental role in the maintenance of genetic stability. The development of esophageal and gastric cancers is a multistep process resulting in successive accumulation of genetic alterations that culminates in the malignant transformation. Thus, this study highlights the participation of the main genetic alterations of the TP53 gene in esophageal and gastric carcinogenesis. Among these changes, high frequency of TP53 mutations, loss of heterozygosity (LOH, overexpression of the p53 protein, and consequently loss of p53 function, which would be early events in esophageal and gastric cancers, as well as an important biomarker of the prognosis and treatment response. Furthermore, Single Nucleotide Polymorphisms (SNPs of TP53 have been implicated in the development and prognosis of several cancers, mainly TP53 codon 72 polymorphism whose role has been extensively studied in relation to susceptibility for esophageal and gastric cancer development.
DEFF Research Database (Denmark)
Silveira, Cássia G T; Oliveira, Fábio M; Valera, Elvis T
2009-01-01
Myelodysplastic syndrome (MDS) is a rare hematological malignancy in children. It was performed FISH analysis in 19 pediatric MDS patients to investigate deletions involving the PPARgamma and TP53 genes. Significant losses in the PPARgamma gene and deletions in the tumor suppressor gene TP53 were...
Mutations in TP53 tumor suppressor gene in wood dust-related sinonasal cancer
DEFF Research Database (Denmark)
Holmila, Reetta; Bornholdt, Jette; Heikkilä, Pirjo
2010-01-01
The causal role of work-related exposure to wood dust in the development of sinonasal cancer has long been established by numerous epidemiologic studies. To study molecular changes in these tumors, we analyzed TP53 gene mutations in 358 sinonasal cancer cases with or without occupational exposure...... affected the ORs only slightly. Smoking did not influence the occurrence of TP53 mutation; however, it was associated with multiple mutations (p = 0.03). As far as we are aware, this is the first study to demonstrate a high prevalence of TP53 mutation-positive cases in a large collection of sinonasal...... cancers with data on occupational exposure. Our results indicate that mutational mechanisms, in particular TP53 mutations, are associated with work-related exposure to wood dust in sinonasal cancer....
Clinical Impact of TP53 Gene Mutations in Diffuse Large B-Cell Lymphoma (DLBCL)
DEFF Research Database (Denmark)
Young, Ken H; Patten, Nancy; Truong, Sim
2009-01-01
Mutations of the TP53 tumor suppressor gene are associated with a poor clinical outcome in DLBCL patients treated with CHOP. The impact of TP53 mutations on clinical outcome of DLBCL patients treated with Rituxan-CHOP has not been comprehensively analyzed. The purpose of this study was to analyze...
TP53 Mutations in Nonsmall Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Akira Mogi
2011-01-01
Full Text Available The tumor suppressor gene TP53 is frequently mutated in human cancers. Abnormality of the TP53 gene is one of the most significant events in lung cancers and plays an important role in the tumorigenesis of lung epithelial cells. Human lung cancers are classified into two major types, small cell lung cancer (SCLC and nonsmall cell lung cancer (NSCLC. The latter accounts for approximately 80% of all primary lung cancers, and the incidence of NSCLC is increasing yearly. Most clinical studies suggest that NSCLC with TP53 alterations carries a worse prognosis and may be relatively more resistant to chemotherapy and radiation. A deep understanding of the role of TP53 in lung carcinogenesis may lead to a more reasonably targeted clinical approach, which should be exploited to enhance the survival rates of patients with lung cancer. This paper will focus on the role of TP53 in the molecular pathogenesis, epidemiology, and therapeutic strategies of TP53 mutation in NSCLC.
Siddamalla, Swapna; Reddy, Tumu Venkat; Govatati, Suresh; Guruvaiah, Praveen; Deenadayal, Mamata; Shivaji, Sisinthy; Bhanoori, Manjula
2018-05-24
Polycystic Ovary Syndrome (PCOS) is a heterogeneous multifactorial endocrine metabolic disorder. In addition to hyperandrogenism, acne, hirsutism, obesity, oligoanovulation and infertility, insulin resistance is also a common feature in women of PCOS. Tumor suppressor genes (TSGs) perform essential function in the maintenance of genomic stability and regulatory pathways influencing the activity of several replication and transcription factors. The main aim of this study was to investigate the association of Single Nucleotide Polymorphisms of TP53, BRCA1and BRCA2 genes with the susceptibility to PCOS in South Indian women. Present study investigated association between TP53 gene (rs1042522 G/C), BRCA1 (rs71361504 -/GTT, rs3092986 T/C) and BRCA2 (rs206118 A/G) and, SNPs and PCOS risk. Genotyping of TSGs was carried out on DNA from PCOS patients (n = 110) and controls (n = 130) of South Indian origin by polymerase chain reaction (PCR) and confirmed by sequencing analysis. The genotype frequency and allele distributions of cases and controls were analyzed using Fisher's exact test. Haplotype frequencies for multiple loci and the standardized disequilibrium coefficient (D') for pair wise linkage disequilibrium (LD) were assessed by Haploview Software. Significant increase in frequencies ofTP53 (rs1042522 G/C), BRCA1 (rs71361504 -/GTT, rs3092986 T/C) genotypes and alleles in patients compared to controls. In addition, the frequency of the C/T (P = 0.002) and A/C (P = 0.012) haplotype was also significantly elevated in patients. But BRCA2 (rs206118 A/G) did not show significant association with PCOS. The TP53 and BRCA1 may constitute an inheritable risk factor for PCOS in South Indian women. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Momoko Ishimine
2018-01-01
Full Text Available Irinotecan (CPT-11 is an anticancer prodrug that is activated by the carboxylesterase CES2 and has been approved for the treatment of many types of solid tumors, including colorectal cancer. Recent studies with cell lines show that CES2 expression is regulated by the tumor suppressor protein p53. However, clinical evidence for this regulatory mechanism in cancer is lacking. In this study, we examined the relationship between TP53 gene status and CES2 expression in human colorectal cancer. Most colorectal cancer specimens (70%; 26 of 37 showed lower CES2 mRNA levels (≥1.5-fold lower than the adjacent normal tissue, and only 30% (12 of 37 showed similar (<1.5-fold lower or higher CES2 mRNA levels. However, TP53 gene sequencing revealed no relationship between CES2 downregulation and TP53 mutational status. Moreover, while colorectal cancer cells expressing wild-type p53 exhibited p53-dependent upregulation of CES2, PRIMA-1MET, a drug that restores the transcriptional activity of mutant p53, failed to upregulate CES2 expression in cells with TP53 missense mutations. These results, taken together, suggest that CES2 mRNA expression is decreased in human colorectal cancer independently of p53.
TP53 mutations in clinically normal mucosa adjacent to oral carcinomas
DEFF Research Database (Denmark)
Thode, Christenze; Bilde, Anders; von Buchwald, Christian
2010-01-01
BACKGROUND: The tumour-suppressor protein p53 often accumulates in histologically normal epithelium adjacent to oral squamous cell carcinomas (OSCC). We investigated whether this was associated with mutations in TP53, the gene for p53, and might implicate impending malignancy. METHODS: Specimens...... products were separated by denatured gradient gel electrophoresis. Fragments with a deviant DGEE pattern were sequenced. RESULTS: TP53 mutations were found in six of 18 tumours. Fourteen specimens contained histologically normal mucosa adjacent to the tumour; 13 of these showed small clusters of p53...
CNPY2 promoted the proliferation of renal cell carcinoma cells and increased the expression of TP53
International Nuclear Information System (INIS)
Taniguchi, Hidefumi; Ito, Saya; Ueda, Takashi; Morioka, Yukako; Kayukawa, Naruhiro; Ueno, Akihisa; Nakagawa, Hideo; Fujihara, Atsuko; Ushijima, So; Kanazawa, Motohiro; Hongo, Fumiya; Ukimura, Osamu
2017-01-01
Renal cell carcinoma (RCC) is the most common type of kidney cancer. However, the mechanisms underlying the progression of the disease are not well understood. The data in this report suggest that canopy FGF signaling regulator 2 (CNPY2) is a promoter of RCC progression. We found that CNPY2 significantly promoted growth of RCC cells and upregulated TP53 gene expression. Although TP53 is widely known as a tumor suppressor, in RCC TP53 promoted tumor cell growth. A typical p53 target gene, CDKN1A, was upregulated by both p53 and CNPY2 in RCC cells, suggesting that CNPY2 increased the expression level of TP53. Consistent with these results, CNPY2 and TP53 expression levels were positively correlated in RCC patients. These findings suggested that CNPY2 promoted cancer cell growth in RCC through regulating TP53 gene expression. - Highlights: • CNPY2 promoted growth of renal cell carcinoma (RCC) cells. • TP53 expression levels were increased by CNPY2 in RCC cells. • Growth of RCC cells was promoted by TP53. • CNPY2 expression positively correlated with TP53 expression in RCC patients.
Low Prevalence of TP53 Mutations and MDM2 Amplifications in Pediatric Rhabdomyosarcoma
Directory of Open Access Journals (Sweden)
Simona Ognjanovic
2012-01-01
Full Text Available The tumor suppressor gene TP53 is the most commonly mutated gene in human cancer. The reported prevalence of mutations in rhabdomyosarcoma (RMS varies widely, with recent larger studies suggesting that TP53 mutations in pediatric RMS may be extremely rare. Overexpression of MDM2 also attenuates p53 function. We have performed TP53 mutation/MDM2 amplification analyses in the largest series analyzed thus far, including DNA isolated from 37 alveolar and 38 embryonal RMS tumor samples obtained from the Cooperative Human Tissue Network (CHTN. Available samples were frozen tumor tissues (N=48 and histopathology slides. TP53 mutations in exons 4–9 were analyzed by direct sequencing in all samples, and MDM2 amplification analysis was performed by differential PCR on a subset of 22 samples. We found only one sample (1/75, 1.3% carrying a TP53 mutation at codon 259 (p.D259Y and no MDM2 amplification. Two SNPs in the TP53 pathway, associated with accelerated tumor onset in germline TP53 mutation carriers, (TP53 SNP72 (rs no. 1042522 and MDM2 SNP309 (rs no. 2279744, were not found to confer earlier tumor onset. In conclusion, we confirm the extremely low prevalence of TP53 mutations/MDM2 amplifications in pediatric RMS (1.33% and 0%, respectively. The possible inactivation of p53 function by other mechanisms thus remains to be elucidated.
Kucab, Jill E; Zwart, Edwin P; van Steeg, Harry; Luijten, Mirjam; Schmeiser, Heinz H; Phillips, David H; Arlt, Volker M
2016-03-01
3-Nitrobenzanthrone (3-NBA) is a highly mutagenic compound and possible human carcinogen found in diesel exhaust. 3-NBA forms bulky DNA adducts following metabolic activation and induces predominantly G:CT:A transversions in a variety of experimental systems. Here we investigated the influence of nucleotide excision repair (NER) on 3-NBA-induced mutagenesis of the human tumour suppressor gene TP53 and the reporter gene lacZ. To this end we utilised Xpa -knockout (Xpa-Null) human TP53 knock-in (Hupki) embryo fibroblasts (HUFs). As Xpa is essential for NER of bulky DNA adducts, we hypothesized that DNA adducts induced by 3-NBA would persist in the genomes of Xpa-Null cells and lead to an increased frequency of mutation. The HUF immortalisation assay was used to select for cells harbouring TP53 mutations following mutagen exposure. We found that Xpa-Null Hupki mice and HUFs were more sensitive to 3-NBA treatment than their wild-type (Xpa-WT) counterparts. However, following 3-NBA treatment and immortalisation, a similar frequency of TP53-mutant clones arose from Xpa-WT and Xpa-Null HUF cultures. In cells from both Xpa genotypes G:CT:A transversion was the predominant TP53 mutation type and mutations exhibited bias towards the non-transcribed strand. Thirty-two percent of 3-NBA-induced TP53 mutations occurred at CpG sites, all of which are hotspots for mutation in smokers' lung cancer (codons 157, 158, 175, 245, 248, 273, 282). We also examined 3-NBA-induced mutagenesis of an integrated lacZ reporter gene in HUFs, where we again observed a similar mutant frequency in Xpa-WT and Xpa-Null cells. Our findings suggest that 3-NBA-DNA adducts may evade removal by global genomic NER; the persistence of 3-NBA adducts in DNA may be an important factor in its mutagenicity. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Sonkin, Dmitriy
2015-01-01
eLife digest Damaged cells in the human body can develop into tumors if left unchecked. TP53 (also called p53) is a protein that normally helps to repair or eliminate these damaged cells and prevent tumors from forming. About half of all cancerous tumors have mutations that prevent TP53 from working. In tumors with normal TP53 (called TP53 wild type tumors), another protein that acts to keep TP53 in check is often overly active. This overactive protein (called MDM2) prevents TP53 from suppres...
Directory of Open Access Journals (Sweden)
Tao Lu
2017-01-01
Full Text Available Tp53, a stress response gene, is involved in diverse cell death pathways and its activation is implicated in the pathogenesis of Parkinson's disease. However, whether the neuronal Tp53 protein plays a direct role in regulating dopaminergic (DA neuronal cell death or neuronal terminal damage in different neurotoxicant models is unknown. In our recent studies, in contrast to the global inhibition of Tp53 function by pharmacological inhibitors and in traditional Tp53 knock-out mice, we examined the effects of DA-specific Tp53 gene deletion after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and methamphetamine exposure. Our data suggests that the Tp53 gene might be involved in both neuronal apoptosis and neuronal terminal damage caused by different neurotoxicants. Additional results from other studies also suggest that as a master regulator of many pathways that regulate apoptosis and synaptic terminal damage, it is possible that Tp53 may function as a signaling hub to integrate different signaling pathways to mediate distinctive target pathways. Tp53 protein as a signaling hub might be able to evaluate the microenvironment of neurons, assess the forms and severities of injury incurred, and determine whether apoptotic cell death or neuronal terminal degeneration occurs. Identification of the precise mechanisms activated in distinct neuronal damage caused by different forms and severities of injuries might allow for development of specific Tp53 inhibitors or ways to modulate distinct downstream target pathways involved.
van den Broek, Alexandra J.; Broeks, Annegien; Horlings, Hugo M.; Canisius, Sander V. M.; Braaf, Linde M.; Langerød, Anita; van't Veer, Laura J.; Schmidt, Marjanka K.
2011-01-01
The tumor suppressor gene TP53 and its regulator MDM2 are both important players in the DNA-damage repair "TP53 response pathway". Common germline polymorphisms in these genes may affect outcome in patients with tumors characterized by additional somatic changes in the same or a related pathway. To
Phylogenetic analysis of human Tp53 gene using computational ...
African Journals Online (AJOL)
The TP53 gene encoding p53 protein is involved in regulating a series of pathways. New discoveries about the function and control of p53 are still in progress and it is hoped to develop better therapeutics and diagnostics by exploiting this system. Evolutionary studies are of prime importance in the field of biological ...
Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy
Directory of Open Access Journals (Sweden)
Christian Bressy
2017-06-01
Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.
Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.
Directory of Open Access Journals (Sweden)
Simon Leuchs
Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.
Gaining insights into the codon usage patterns of TP53 gene across eight mammalian species.
Directory of Open Access Journals (Sweden)
Tarikul Huda Mazumder
Full Text Available TP53 gene is known as the "guardian of the genome" as it plays a vital role in regulating cell cycle, cell proliferation, DNA damage repair, initiation of programmed cell death and suppressing tumor growth. Non uniform usage of synonymous codons for a specific amino acid during translation of protein known as codon usage bias (CUB is a unique property of the genome and shows species specific deviation. Analysis of codon usage bias with compositional dynamics of coding sequences has contributed to the better understanding of the molecular mechanism and the evolution of a particular gene. In this study, the complete nucleotide coding sequences of TP53 gene from eight different mammalian species were used for CUB analysis. Our results showed that the codon usage patterns in TP53 gene across different mammalian species has been influenced by GC bias particularly GC3 and a moderate bias exists in the codon usage of TP53 gene. Moreover, we observed that nature has highly favored the most over represented codon CTG for leucine amino acid but selected against the ATA codon for isoleucine in TP53 gene across all mammalian species during the course of evolution.
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
Pediatric oncologist willingness to offer germline TP53 testing in osteosarcoma.
Shaul, Eliana; Roth, Michael; Lo, Yungtai; Geller, David S; Hoang, Bang; Yang, Rui; Malkin, David; Gorlick, Richard; Gill, Jonathan
2018-03-15
Li-Fraumeni syndrome (LFS) is a cancer predisposition syndrome caused by mutations in the tumor-suppressor gene TP53. Osteosarcoma is a sentinel cancer in LFS. Prior studies using Sanger sequencing platforms have demonstrated that 3% of individuals with osteosarcoma harbor a mutation in TP53. New data from next-generation sequencing have demonstrated that 3.8% of patients with osteosarcoma have a known pathogenic variant, and an additional 5.7% carry exonic variants of unknown significance in TP53. Pediatric oncologists were e-mailed an anonymous 18-question survey assessing their willingness to offer TP53 germline testing to a child with osteosarcoma with or without a family history, and they were evaluated for changes in their choices with the prior data and the new data. One hundred seventy-seven pediatric oncologists (22%) responded to the survey. Respondents were more likely to offer TP53 testing to a patient with a positive family history (77.4% vs 12.4%; P offer TP53 testing once they were provided with the new data (25.4% vs 12.4%; P = .0038). The proportion of providers who responded that they were unsure increased significantly when they were presented with the new data (25.4% vs 10.2%; P = .0002). Potential implications for other family members and the possibility that surveillance imaging would detect new malignancies at an earlier stage were important factors influencing a provider's decision to offer TP53 testing. Recent data increase the proportion of providers willing to offer testing, and this suggests concern on the part of pediatric oncologists that variants of unknown significance may be disease-defining in rare cancers. Cancer 2018;124:1242-50. © 2018 American Cancer Society. © 2018 American Cancer Society.
Kashofer, Karl; Regauer, Sigrid
2017-08-01
This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.
Fischer, Martin; Grossmann, Patrick; Padi, Megha; DeCaprio, James A
2016-07-27
Cell cycle (CC) and TP53 regulatory networks are frequently deregulated in cancer. While numerous genome-wide studies of TP53 and CC-regulated genes have been performed, significant variation between studies has made it difficult to assess regulation of any given gene of interest. To overcome the limitation of individual studies, we developed a meta-analysis approach to identify high confidence target genes that reflect their frequency of identification in independent datasets. Gene regulatory networks were generated by comparing differential expression of TP53 and CC-regulated genes with chromatin immunoprecipitation studies for TP53, RB1, E2F, DREAM, B-MYB, FOXM1 and MuvB. RNA-seq data from p21-null cells revealed that gene downregulation by TP53 generally requires p21 (CDKN1A). Genes downregulated by TP53 were also identified as CC genes bound by the DREAM complex. The transcription factors RB, E2F1 and E2F7 bind to a subset of DREAM target genes that function in G1/S of the CC while B-MYB, FOXM1 and MuvB control G2/M gene expression. Our approach yields high confidence ranked target gene maps for TP53, DREAM, MMB-FOXM1 and RB-E2F and enables prediction and distinction of CC regulation. A web-based atlas at www.targetgenereg.org enables assessing the regulation of any human gene of interest. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
TLR4 has a TP53-dependent dual role in regulating breast cancer cell growth
Haricharan, Svasti; Brown, Powel
2015-01-01
This study fundamentally alters our understanding of how TLR4 drives breast cancer. Although TLR4 was previously considered a tumor promoter, we demonstrate a complex, TP53-dependent role for TLR4 in regulating tumor growth. TP53 is a tumor suppressor commonly inactivated across cancer types. In TP53 wild-type cancer cells, TLR4 activation causes secretion of IFN-γ into the microenvironment, resulting in induction of p21 and inhibition of cell growth. Conversely, TLR4 activation in TP53 mutan...
Klug, Stefanie J.; Ressing, Meike; Koenig, Jochem; Abba, Martin C.; Agorastos, Theodoros; Brenna, Sylvia M. F.; Ciotti, Marco; Das, B. R.; Del Mistro, Annarosa; Dybikowska, Aleksandra; Giuliano, Anna R.; Gudleviciene, Zivile; Gyllensten, Ulf; Haws, Andrea L. F.; Helland, Aslaug; Herrington, C. Simon; Hildesheim, Alan; Humbey, Olivier; Jee, Sun H.; Kim, Jae Weon; Madeleine, Margaret M.; Menczer, Joseph; Ngan, Hextan Y. S.; Nishikawa, Akira; Niwa, Yoshimitsu; Pegoraro, Rosemary; Pillai, M. R.; Ranzani, Gulielmina; Rezza, Giovanni; Rosenthal, Adam N.; Roychoudhury, Susanta; Saranath, Dhananjaya; Schmitt, Virginia M.; Sengupta, Sharmila; Settheetham-Ishida, Wannapa; Shirasawa, Hiroshi; Snijders, Peter J. F.; Stoler, Mark H.; Suarez-Rincon, Angel E.; Szarka, Krisztina; Tachezy, Ruth; Ueda, Masatsugu; van der Zee, Ate G. J.; Doeberitz, Magnus von Knebel; Wu, Ming-Tsang; Yamashita, Tsuyoshi; Zehbe, Ingeborg; Blettner, Maria
Background Cervical cancer is caused primarily by human papillomaviruses (HPV). The polymorphism rs1042522 at codon 72 of the TP53 tumour-suppressor gene has been investigated as a genetic cofactor. More than 80 studies were done between 1998 and 2006, after it was initially reported that women who
TP53 gene status affects survival in advanced mycosis fungoides
Directory of Open Access Journals (Sweden)
Gitte Wooler
2016-11-01
Full Text Available TP53 is frequently mutated in different types of neoplasms including leukemia and lymphomas. Mutations of TP53 have also been reported in mycosis fungoides (MF, the most common type of cutaneous lymphoma. However, little is known about the frequency, spectrum of mutations and their prognostic significance in MF. In this study we have optimized the protocol for Sanger sequencing of TP53 using DNA extracted from archival paraffin-embedded biopsies. Of 19 samples from patients with stage IIB MF or higher, 31% harboured mutations in TP53. Overall survival of the patients with mutated TP53 was significantly shorter than median survival in the age- and stage-matched patients treated in our Institution. Distribution of mutations was heterogenous in TP53 exons, however C>T transitions were common suggesting the causal role of ultraviolet radiation. We propose that TP53 mutation status would be useful for risk stratification of patients with advanced MF.
A polymorphism (rs1042522) in TP53 gene is a risk factor for Down Syndrome in Sicilian mothers.
Salemi, Michele; Barone, Concetta; Salluzzo, Maria Grazia; Giambirtone, Mariaconcetta; Scillato, Francesco; Galati Rando, Rosanna; Romano, Carmelo; Morale, Maria Concetta; Ridolfo, Federico; Romano, Corrado
2017-11-01
Trisomy 21 is the most frequent genetic cause of intellectual disability. Tumor Protein 53 (TP53) gene down-regulation triggers chromosomal instability. A TP53 gene polymorphism c.215G > C (rs1042522) is associated with accumulation of aneuploid cells. We analyzed the TP53 c.215G > C (rs1042522) polymorphism in Sicilian mothers of subjects with Down Syndrome (DS) within a case-control study. Nucleotide polymorphism was detected by pyrosequencing technology. The distribution of TP53 c.215G > C polymorphism showed significant difference between mothers of subjects with DS and controls. Our data show that TP53 c.215G > C polymorphism is a risk factor for DS in Sicilian mothers.
Directory of Open Access Journals (Sweden)
Magali Olivier
2007-02-01
Full Text Available
The tumor suppressor gene TP53 is frequently inactivated by gene mutations in many types of human sporadic cancers, and inherited TP53 mutations predispose to a wide spectrum of early-onset tumors (Li-Fraumeni et Li-Fraumenilike Syndromes. All TP53 gene variations (somatic and germline mutations, as well as polymorphisms that are reported in the scientific literature or in SNP databases are compiled in the IARC TP53 Database. This database provides structured data and analysis tools to study mutation patterns in human cancers and cell-lines and to investigate the clinical impact of mutations. It contains annotations related to the clinical and pathological characteristics of tumors, as well as the demographics and carcinogen exposure of patients. The IARC TP53 web site (53.iarc.fr/">http://www-p53.iarc.fr/ provides a search interface for the core database and includes a comprehensive user guide, a slideshow on TP53 mutations in human cancer, protocols and references for sequencing TP53 gene, and links to relevant publications and bioinformatics databases. The database interface allows download of entire data sets and propose various tools for the selection, analysis and downloads of specific sets of data according to user's query.
Recently, new annotations on the functional properties of mutant p53 proteins have been integrated in this database. Indeed, the most frequent TP53 alterations observed in cancers (75% are missense mutations that result in the production of a mutant protein that differ from the wildtype by one single amino-acid. The characterization of the biological activities of these mutant proteins is thus very important. Over the last ten years, a great amount of systematic data has been generated from experimental assays performed in
Dong, Zhiyong; Zheng, Longzhi; Liu, Weimin; Wang, Cunchuan
2018-01-01
The relationship between TP53 codon 72 Pro/Arg gene polymorphism and colorectal cancer risk in Asians is still controversial, and this bioinformatics analysis and meta-analysis was performed to assess the associations. The association studies were identified from PubMed, and eligible reports were included. RevMan 5.3.1 software, Oncolnc, cBioPortal, and Oncomine online tools were used for statistical analysis. A random/fixed effects model was used in meta-analysis. The data were reported as risk ratios or mean differences with corresponding 95% CI. We confirmed that TP53 was associated with colorectal cancer, the alteration frequency of TP53 was 53% mutation and 7% deep deletion, and TP53 mRNA expression was different in different types of colorectal cancer based on The Cancer Genome Atlas database. Then, 18 studies were included that examine the association of TP53 codon 72 gene polymorphism with colorectal cancer risk in Asians. The meta-analysis indicated that TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asian population, but Arg/Arg genotype was not (Pro allele: odds ratios [OR]=1.20, 95% CI: 1.06 to 1.35, P =0.003; Pro/Pro genotype: OR=1.39, 95% CI: 1.15 to 1.69, P =0.0007; Arg/Arg genotype: OR=0.86, 95% CI: 0.74 to 1.00, P =0.05). Interestingly, in the meta-analysis of the controls from the population-based studies, we found that TP53 codon 72 Pro/Arg gene polymorphism was associated with colorectal cancer risk (Pro allele: OR=1.33, 95% CI: 1.15 to 1.55, P =0.0002; Pro/Pro genotype: OR=1.61, 95% CI: 1.28 to 2.02, P colorectal cancer, but the different value levels of mRNA expression were not associated with survival rate of colon and rectal cancer. TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asians.
Alterations in tumour suppressor gene p53 in human gliomas from ...
Indian Academy of Sciences (India)
Unknown
Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.
Directory of Open Access Journals (Sweden)
Sarah A. Hansen
2016-10-01
Full Text Available Somatic mutations in the Tp53 tumor suppressor gene are the most commonly seen genetic alterations in cancer, and germline mutations in Tp53 predispose individuals to a variety of early-onset cancers. Development of appropriate translational animal models that carry mutations in Tp53 and recapitulate human disease are important for drug discovery, biomarker development and disease modeling. Current Tp53 mouse and rat models have significant phenotypic and genetic limitations, and often do not recapitulate certain aspects of human disease. We used a marker-assisted speed congenic approach to transfer a well-characterized Tp53-mutant allele from an outbred rat to the genetically inbred Fischer-344 (F344 rat to create the F344-Tp53tm1(EGFP-PacQly/Rrrc (F344-Tp53 strain. On the F344 genetic background, the tumor spectrum shifted, with the primary tumor types being osteosarcomas and meningeal sarcomas, compared to the hepatic hemangiosarcoma and lymphoma identified in the original outbred stock model. The Fischer model is more consistent with the early onset of bone and central nervous system sarcomas found in humans with germline Tp53 mutations. The frequency of osteosarcomas in F344-Tp53 homozygous and heterozygous animals was 57% and 36%, respectively. Tumors were highly representative of human disease radiographically and histologically, with tumors found primarily on long bones with frequent pulmonary metastases. Importantly, the rapid onset of osteosarcomas in this promising new model fills a current void in animal models that recapitulate human pediatric osteosarcomas and could facilitate studies to identify therapeutic targets.
Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui
2018-06-13
Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.
p53 tumor suppressor gene: significance in neoplasia - a review
International Nuclear Information System (INIS)
Alam, J.M.
2000-01-01
p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)
Directory of Open Access Journals (Sweden)
Zahra Shajani-Yi
2018-03-01
Full Text Available The tumor suppressor gene TP53 is the most frequently mutated gene in human cancer. It encodes p53, a DNA-binding transcription factor that regulates multiple genes involved in DNA repair, metabolism, cell cycle arrest, apoptosis, and senescence. TP53 is associated with human cancer by mutations that lead to a loss of wild-type p53 function as well as mutations that confer alternate oncogenic functions that enable them to promote invasion, metastasis, proliferation, and cell survival. Identifying the discrete TP53 mutations in tumor cells may help direct therapies that are more effective. In this study, we identified the frequency of individual TP53 mutations in patients with colon adenocarcinoma (48%, non–small cell lung carcinoma (NSCLC (36%, and glioma/glioblastoma (28% at our institution using next-generation sequencing. We also identified the occurrence of somatic mutations in numerous actionable genes including BRAF, EGFR, KRAS, IDH1, and PIK3CA that occurred concurrently with these TP53 mutations. Of the 480 tumors examined that contained one or more mutations in the TP53 gene, 219 were colon adenocarcinomas, 215 were NSCLCs, and 46 were gliomas/glioblastomas. Among the patients positive for TP53 mutations diagnosed with colon adenocarcinoma, 50% also showed at least one mutation in pathogenic genes of which 14% were BRAF, 33% were KRAS, and 3% were NRAS. Forty-seven percent of NSCLC patients harboring TP53 mutations also had a mutation in at least one actionable pathogenic variant with the following frequencies: BRAF: 4%, EGFR: 10%, KRAS: 28%, and PIK3CA: 4%. Fifty-two percent of patients diagnosed with glioma/glioblastoma with a positive TP53 mutation had at least one concurrent mutation in a known pathogenic gene of which 9% were CDKN2A, 41% were IDH1, and 11% were PIK3CA.
Association of the germline TP53 R337H mutation with breast cancer in southern Brazil
International Nuclear Information System (INIS)
Assumpção, Juliana G; Zeferino, Luiz Carlos; Dufloth, Rozany M; Brandalise, Silvia Regina; Yunes, José Andres; Seidinger, Ana Luíza; Mastellaro, Maria José; Ribeiro, Raul C; Zambetti, Gerard P; Ganti, Ramapriya; Srivastava, Kumar; Shurtleff, Sheila; Pei, Deqing
2008-01-01
The germline TP53-R337H mutation is strongly associated with pediatric adrenocortical tumors (ACT) in southern Brazil; it has low penetrance and limited tissue specificity in most families and therefore is not associated with Li-Fraumeni syndrome. However, other tumor types, mainly breast cancer, have been observed in carriers of several unrelated kindreds, raising the possibility that the R337H mutation may also contribute to breast tumorigenesis in a genetic background-specific context. We conducted a case-control study to determine the prevalence of the R337H mutation by sequencing TP53 exon 10 in 123 women with breast cancer and 223 age- and sex-matched control subjects from southern Brazil. Fisher's test was used to compare the prevalence of the R337H. The R337H mutation was found in three patients but in none of the controls (p = 0.0442). Among the carriers, two had familial history of cancer meeting the Li-Fraumeni-like criteria. Remarkably, tumors in each of these three cases underwent loss of heterozygosity by eliminating the mutant TP53 allele rather than the wild-type allele. Polymorphisms were identified within the TP53 (R72P and Ins16) and MDM2 (SNP309) genes that may further diminish TP53 tumor suppressor activity. These results demonstrate that the R337H mutation can significantly increase the risk of breast cancer in carriers, which likely depends on additional cooperating genetic factors. These findings are also important for understanding how low-penetrant mutant TP53 alleles can differentially influence tumor susceptibility
National Research Council Canada - National Science Library
Blackburn, Anneke
2002-01-01
The TP53 tumor suppressor gene is defective in the majority of sporadic breast cancers, and breast cancer is the most frequent tumor type in women with Li-Fraumeni syndrome who inherit germline mutations in TP53...
National Research Council Canada - National Science Library
Smith, Sallie
2004-01-01
The TP53 tumor suppressor gene is defective in the majority of sporadic breast cancers, and breast cancer is the most frequent tumor type in women with Li-Fraumeni syndrome and bear germline mutations in TP53...
DEFF Research Database (Denmark)
Dufour, Annika; Palermo, Giuseppe; Zellmeier, Evelyn
2013-01-01
In chronic lymphocytic leukemia (CLL) patients, disruptions of the TP53 tumor suppressor pathway by 17p13 deletion (del17p), somatic TP53 mutations, or downregulation of microRNA-34a have been associated with a poor prognosis. So far, the impact of the various TP53 defects has not been evaluated ...
Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba
2016-02-01
Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Shao Yan Lau
2017-12-01
Full Text Available Background: Li-Fraumeni Syndrome (LFS is caused by a mutation in the TP53 tumour suppressor gene. This rare hereditary condition predisposes individuals to an increased risk of cancers including breast cancer in women at a relatively young age, which accounts for nearly 25%–30% of all LFS‑associated cancers. Studies have shown that breast tumours in women with a germline TP53 deleterious variants are associated with a human epidermal growth factor receptor 2 (HER2-positive phenotype. Taken together, this study aimed to investigate the contribution of germline TP53 variants and its association with tumour HER-2 status in a cohort of young women with breast cancer. Methods: From 2002 to 2017, 4048 women with breast cancer treated at University Malaya Medical Centre or Sime Darby Medical Centre participated in the Malaysian Breast Cancer Genetics Study. Of which, 87 patients were diagnosed before 30 years of age. All patients were analysed for germline TP53 single nucleotide variants, small insertions or deletions by amplicon‑based targeted sequencing and validated by Sanger sequencing. DNA from patients who tested negative for sequencing were subsequently evaluated for the presence of TP53 exon deletions or duplications by multiplex ligation‑dependent probe amplification. HER-2 status of breast tumours was defined by immunohistochemistry, fluorescence in situ hybridisation and/or silver in situ hybridisation. Results: 5 distinct TP53 variants were detected in 5 individuals. 3 out of 5 TP53 variants were classified as frameshift mutations, one nonsense mutation and one in-frame duplication. Variants in other genes were detected in 17 individuals. No large genomic rearrangements were detected in the remaining 65 sequencing-negative patients. The assessment of HER-2 status will be presented. Conclusions: Our results suggest that alterations in TP53 gene were identified in approximately 5.7% (5/87 of this cohort of young women with breast
Association of the germline TP53 R337H mutation with breast cancer in southern Brazil
Directory of Open Access Journals (Sweden)
Srivastava Kumar
2008-12-01
Full Text Available Abstract Background The germline TP53-R337H mutation is strongly associated with pediatric adrenocortical tumors (ACT in southern Brazil; it has low penetrance and limited tissue specificity in most families and therefore is not associated with Li-Fraumeni syndrome. However, other tumor types, mainly breast cancer, have been observed in carriers of several unrelated kindreds, raising the possibility that the R337H mutation may also contribute to breast tumorigenesis in a genetic background-specific context. Methods We conducted a case-control study to determine the prevalence of the R337H mutation by sequencing TP53 exon 10 in 123 women with breast cancer and 223 age- and sex-matched control subjects from southern Brazil. Fisher's test was used to compare the prevalence of the R337H. Results The R337H mutation was found in three patients but in none of the controls (p = 0.0442. Among the carriers, two had familial history of cancer meeting the Li-Fraumeni-like criteria. Remarkably, tumors in each of these three cases underwent loss of heterozygosity by eliminating the mutant TP53 allele rather than the wild-type allele. Polymorphisms were identified within the TP53 (R72P and Ins16 and MDM2 (SNP309 genes that may further diminish TP53 tumor suppressor activity. Conclusion These results demonstrate that the R337H mutation can significantly increase the risk of breast cancer in carriers, which likely depends on additional cooperating genetic factors. These findings are also important for understanding how low-penetrant mutant TP53 alleles can differentially influence tumor susceptibility.
TP53 codon 72 polymorphism as a risk factor for cardiovascular disease in a Brazilian population
Directory of Open Access Journals (Sweden)
M.A.C. Smith
2007-11-01
Full Text Available TP53, a tumor suppressor gene, has a critical role in cell cycle, apoptosis and cell senescence and participates in many crucial physiological and pathological processes. Identification of TP53 polymorphism in older people and age-related diseases may provide an understanding of its physiology and pathophysiological role as well as risk factors for complex diseases. TP53 codon 72 (TP53:72 polymorphism was investigated in 383 individuals aged 66 to 97 years in a cohort from a Brazilian Elderly Longitudinal Study. We investigated allele frequency, genotype distribution and allele association with morbidities such as cardiovascular disease, type II diabetes, obesity, neoplasia, low cognitive level (dementia, and depression. We also determined the association of this polymorphism with serum lipid fractions and urea, creatinine, albumin, fasting glucose, and glycated hemoglobin levels. DNA was isolated from blood cells, amplified by PCR using sense 5'-TTGCCGTCCCAAGCAATGGATGA-3' and antisense 5'-TCTGGGAAGGGACAGAAGATGAC-3' primers and digested with the BstUI enzyme. This polymorphism is within exon 4 at nucleotide residue 347. Descriptive statistics, logistic regression analysis and Student t-test using the multiple comparison test were used. Allele frequencies, R (Arg = 0.69 and P (Pro = 0.31, were similar to other populations. Genotype distributions were within Hardy-Weinberg equilibrium. This polymorphism did not show significant association with any age-related disease or serum variables. However, R allele carriers showed lower HDL levels and a higher frequency of cardiovascular disease than P allele subjects. These findings may help to elucidate the physiopathological role of TP53:72 polymorphism in Brazilian elderly people.
Directory of Open Access Journals (Sweden)
Pamela Valva
2009-02-01
Full Text Available Mutations in the gene TP53, which codifies the tumor suppressor protein p53, are found in about 50% of tumors. These mutations can occur not only at somatic level, but also in germline. Pediatric cancer patients, mostly with additional family history of malignancy, should be considered as potential TP53 germline mutation carriers. Germline TP53 mutations and polymorphisms have been widely studied to determine their relation with different tumors' pathogenesis. Our aim was to analyze the occurrence frequency of germline TP53 mutations and polymorphisms and to relate these to tumor development in a pediatric series. Peripheral blood mononuclear cell samples from 26 children with solid tumors [PST] and 21 pediatric healthy donors [HD] were analyzed for germline mutations and polymorphisms in TP53 gene spanning from exon 5 to 8 including introns 5 and 7. These PCR amplified fragments were sequenced to determine variations. A heterozygous mutation at codon 245 was found in 1/26 PST and 0/21 HD. Comparative polymorphisms distribution, at position 14181 and 14201(intron 7, between HD and PST revealed a trend of association (p= 0.07 with cancer risk. HD group disclosed a similar polymorphism distribution as published data for Caucasian and Central/South American populations. This is the first study about TP53 variant frequency and distribution in healthy individuals and cancer patients in Argentina.El gen que codifica para la proteína supresora de tumor p53 (TP53 se encuentra mutado en aproximadamente el 50% de los tumores. Estas mutaciones pueden presentarse como somáticas o en línea germinal. Los niños con tumores, sobre todo aquellos con historia familiar de enfermedad oncológica, deben considerarse potenciales portadores de mutaciones en línea germinal. Las mutaciones de TP53 y los polimorfismos son estudiados para determinar su relación con la patogénesis de diferentes tumores. El objetivo del trabajo fue analizar la frecuencia de
Molecular Characterization of TP53 Gene in Human Populations Exposed to Low-Dose Ionizing Radiation
Directory of Open Access Journals (Sweden)
Igor Brasil-Costa
2013-01-01
Full Text Available Ionizing radiation, such as that emitted by uranium, may cause mutations and consequently lead to neoplasia in human cells. The TP53 gene acts to maintain genomic integrity and constitutes an important biomarker of susceptibility. The present study investigated the main alterations observed in exons 4, 5, 6, 7, and 8 of the TP53 gene and adjacent introns in Amazonian populations exposed to radioactivity. Samples were collected from 163 individuals. Occurrence of the following alterations was observed: (i a missense exchange in exon 4 (Arg72Pro; (ii 2 synonymous exchanges, 1 in exon 5 (His179His, and another in exon 6 (Arg213Arg; (iii 4 intronic exchanges, 3 in intron 7 (C → T at position 13.436; C → T at position 13.491; T → G at position 13.511 and 1 in intron 8 (T → G at position 13.958. Alteration of codon 72 was found to be an important risk factor for cancer development (P=0.024; OR=6.48; CI: 1.29–32.64 when adjusted for age and smoking. Thus, TP53 gene may be an important biomarker for carcinogenesis susceptibility in human populations exposed to ionizing radiation.
TLR4 has a TP53-dependent dual role in regulating breast cancer cell growth.
Haricharan, Svasti; Brown, Powel
2015-06-23
Breast cancer is a leading cause of cancer-related death, and it is important to understand pathways that drive the disease to devise effective therapeutic strategies. Our results show that Toll-like receptor 4 (TLR4) drives breast cancer cell growth differentially based on the presence of TP53, a tumor suppressor. TP53 is mutationally inactivated in most types of cancer and is mutated in 30-50% of diagnosed breast tumors. We demonstrate that TLR4 activation inhibits growth of TP53 wild-type cells, but promotes growth of TP53 mutant breast cancer cells by regulating proliferation. This differential effect is mediated by changes in tumor cell cytokine secretion. Whereas TLR4 activation in TP53 mutant breast cancer cells increases secretion of progrowth cytokines, TLR4 activation in TP53 wild-type breast cancer cells increases type I IFN (IFN-γ) secretion, which is both necessary and sufficient for mediating TLR4-induced growth inhibition. This study identifies a novel dichotomous role for TLR4 as a growth regulator and a modulator of tumor microenvironment in breast tumors. These results have translational relevance, demonstrating that TP53 mutant breast tumor growth can be suppressed by pharmacologic TLR4 inhibition, whereas TLR4 inhibitors may in fact promote growth of TP53 wild-type tumors. Furthermore, using data generated by The Cancer Genome Atlas consortium, we demonstrate that the effect of TP53 mutational status on TLR4 activity may extend to ovarian, colon, and lung cancers, among others, suggesting that the viability of TLR4 as a therapeutic target depends on TP53 status in many different tumor types.
Apsalikov, Bakytbek; Manambaeva, Zukhra; Ospanov, Erlan; Massabayeva, Meruyert; Zhabagin, Kuantkan; Zhagiparova, Zhanar; Maximov, Vladymir; Voropaeva, Elena; Apsalikov, Kazbek; Belikhina, Tatiana; Abdrahmanov, Ramil; Cherepkova, Elena; Tanatarov, Sayat; Massadykov, Adilzhan; Urazalina, Naylia
2016-01-01
Frequencies of polymorphisms of genes BRCA1 and TP53 in breast cancer (BC) patients with a BC family history and radiation history were assessed and compared in the Semey region of Kazakhstan. The study included 60 women directly irradiated by the activities of the Semipalatinsk test site with a calculated effective equivalent dose of 500 mSv and their first generation descendants (group BC+Her+Exp); 65 women with family BC and absence of radiological history - the effective equivalent dose due to anthropogenic sources not exceeding 50 mSv (group BC+Her-Exp). The comparison group consisted of 65 women patients with breast cancer without family and radiological history (BC-Her-Exp). The control group comprised 60 women without breast cancer and without family and radiological history (nonBC). We carried out the genotyping of the polymorphisms c.2311T>C, c.4308T>C and 5382insC of the BRCA1 gene and rs1042522 of the TP53 gene. The frequency of the polymorphism c.2311T>C was significantly higher in patients of the group BC+Her+Exp than in healthy women, and of the polymorphism 5382insC in BC+Her+Exp compared to all other groups. The frequency of the rs1042522 polymorphism of TP53 was significantly higher in all groups of patients with breast cancer compared with the control group. Differences between groups of women with breast cancer were significant only in BC+Her+Exp vs. BC+Her-Exp. Combinations of polymorphisms of the genes BRCA1 and TP53 predominated in women with a family and radiological history.
TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells
Directory of Open Access Journals (Sweden)
Nikolett Sándor
2015-10-01
Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.
Directory of Open Access Journals (Sweden)
Camila S. Hamú
2007-12-01
Full Text Available A leucemia mielóide crônica (LMC é uma doença proliferativa do sistema hematopoiético, caracterizada pela expansão clonal de uma célula-tronco primitiva e pluripotente denominada stem cell. Este tipo de leucemia está associado, em 90% dos casos, à translocação t(9;22(q34;q11. Essa alteração cromossômica estrutural codifica para uma proteína quimérica BCR-ABL, que confere às células leucêmicas uma alta resistência à morte, independente do agente indutor desse processo. A proteína p53 é uma reguladora transcricional induzida por danos no DNA, fato que resulta na parada do ciclo celular com conseqüente ativação de mecanismos de reparo ou mesmo na indução à apoptose. As mutações no gene TP53 são as alterações genéticas mais comuns em tumores malignos humanos. O presente estudo teve como objetivo genotipar e determinar a freqüência alélica do polimorfismo do TP53 no códon 72 (arginina - Arg e prolina - Pro, em pacientes com suspeita de LMC, pela Reação em Cadeia da Polimerase. Desta forma, os resultados indicaram que 73,4% (23/30 dos pacientes apresentaram homozigose para arginina (Arg/Arg e 26,6% (7/30 heterozigose (Arg/Pro. Não foi encontrado nenhum paciente homozigoto para prolina (Pro/Pro. Os resultados obtidos sugerem que o polimorfismo do gene TP53 no códon 72 não é um fator de risco importante para a iniciação, promoção e progressão da LMC.Chronic myeloid leukemia (CML is a proliferative disorder of the hematopoietic system characterized by clonal expansion of a primitive and pluripotent stem cell. In this type of leukemia, up to 90% of all cases is associated to a specific chromosomal translocation, t(9;22(q34;q11. The genomic alteration results in a chimeric protein, BCR-ABL, that confers a high resistance leukemia cells to death, independent of the induction mechanism of this process. Protein p53 is a transcriptional factor expressed after DNA damage which ceases cell cycle progression and
International Nuclear Information System (INIS)
Soto, José Luis; Cabrera, Carmen M; Serrano, Salvio; López-Nevot, Miguel Ángel
2005-01-01
The role of genes involved in the control of progression from the G1 to the S phase of the cell cycle in melanoma tumors in not fully known. The aim of our study was to analyse mutations in TP53, CDKN1A, CDKN2A, and CDKN2B genes in melanoma tumors and melanoma cell lines We analysed 39 primary and metastatic melanomas and 9 melanoma cell lines by single-stranded conformational polymorphism (SSCP). The single-stranded technique showed heterozygous defects in the TP53 gene in 8 of 39 (20.5%) melanoma tumors: three new single point mutations in intronic sequences (introns 1 and 2) and exon 10, and three new single nucleotide polymorphisms located in introns 1 and 2 (C to T transition at position 11701 in intron 1; C insertion at position 11818 in intron 2; and C insertion at position 11875 in intron 2). One melanoma tumor exhibited two heterozygous alterations in the CDKN2A exon 1 one of which was novel (stop codon, and missense mutation). No defects were found in the remaining genes. These results suggest that these genes are involved in melanoma tumorigenesis, although they may be not the major targets. Other suppressor genes that may be informative of the mechanism of tumorigenesis in skin melanomas should be studied
Energy Technology Data Exchange (ETDEWEB)
Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)
2015-04-28
Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.
Badal, Brateil; Solovyov, Alexander; Di Cecilia, Serena; Chan, Joseph Minhow; Chang, Li-Wei; Iqbal, Ramiz; Aydin, Iraz T.; Rajan, Geena S.; Chen, Chen; Abbate, Franco; Arora, Kshitij S.; Tanne, Antoine; Gruber, Stephen B.; Johnson, Timothy M.; Fullen, Douglas R.; Phelps, Robert; Bhardwaj, Nina; Bernstein, Emily; Ting, David T.; Brunner, Georg; Schadt, Eric E.; Greenbaum, Benjamin D.; Celebi, Julide Tok
2017-01-01
BACKGROUND. Melanoma is a heterogeneous malignancy. We set out to identify the molecular underpinnings of high-risk melanomas, those that are likely to progress rapidly, metastasize, and result in poor outcomes. METHODS. We examined transcriptome changes from benign states to early-, intermediate-, and late-stage tumors using a set of 78 treatment-naive melanocytic tumors consisting of primary melanomas of the skin and benign melanocytic lesions. We utilized a next-generation sequencing platform that enabled a comprehensive analysis of protein-coding and -noncoding RNA transcripts. RESULTS. Gene expression changes unequivocally discriminated between benign and malignant states, and a dual epigenetic and immune signature emerged defining this transition. To our knowledge, we discovered previously unrecognized melanoma subtypes. A high-risk primary melanoma subset was distinguished by a 122-epigenetic gene signature (“epigenetic” cluster) and TP53 family gene deregulation (TP53, TP63, and TP73). This subtype associated with poor overall survival and showed enrichment of cell cycle genes. Noncoding repetitive element transcripts (LINEs, SINEs, and ERVs) that can result in immunostimulatory signals recapitulating a state of “viral mimicry” were significantly repressed. The high-risk subtype and its poor predictive characteristics were validated in several independent cohorts. Additionally, primary melanomas distinguished by specific immune signatures (“immune” clusters) were identified. CONCLUSION. The TP53 family of genes and genes regulating the epigenetic machinery demonstrate strong prognostic and biological relevance during progression of early disease. Gene expression profiling of protein-coding and -noncoding RNA transcripts may be a better predictor for disease course in melanoma. This study outlines the transcriptional interplay of the cancer cell’s epigenome with the immune milieu with potential for future therapeutic targeting. FUNDING
IDH1/IDH2 but Not TP53 Mutations Predict Prognosis in Bulgarian Glioblastoma Patients
Directory of Open Access Journals (Sweden)
Gergana Stancheva
2014-01-01
Full Text Available Mutations in genes encoding isocitrate dehydrogenase isoforms 1 (IDH1 and 2 (IDH2 have been associated with good prognosis for patients with brain neoplasias and have been commonly found together with mutated TP53 gene. To determine the prevalence of IDH1, IDH2, and TP53 mutations and their impact on overall survival 106 glioblastoma patients were analysed. IDH1 mutations were detected in 13 and IDH2 mutation in one patient. Two homozygous samples with R132H mutation in IDH1 gene and a novel aberration K129R in IDH2 gene were found. Sixty-four percent of IDH1/IDH2 mutated tumours harboured also a mutation in TP53 gene. Genetic aberrations in TP53 were present in 37 patients. Statistical analysis of the impact of the studied factors on the overall survival showed that the mutations in IDH1/IDH2, but not the ones in TP53, were associated with longer survival. Also, the impact of age on prognosis was confirmed. This is the first comprehensive study on glioblastomas in Bulgaria. Our results suggest that IDH1/IDH2 but not TP53 mutations together with other prognostic factors such as age might be applied in clinical practice for prediction of outcome in patients with glioblastomas.
Limited importance of the dominant-negative effect of TP53 missense mutations
International Nuclear Information System (INIS)
Stoczynska-Fidelus, Ewelina; Liberski, Pawel P; Rieske, Piotr; Szybka, Malgorzata; Piaskowski, Sylwester; Bienkowski, Michal; Hulas-Bigoszewska, Krystyna; Banaszczyk, Mateusz; Zawlik, Izabela; Jesionek-Kupnicka, Dorota; Kordek, Radzislaw
2011-01-01
Heterozygosity of TP53 missense mutations is related to the phenomenon of the dominant-negative effect (DNE). To estimate the importance of the DNE of TP53 mutations, we analysed the percentage of cancer cases showing a single heterozygous mutation of TP53 and searched for a cell line with a single heterozygous mutation of this gene. This approach was based on the knowledge that genes with evident DNE, such as EGFR and IDH1, represent nearly 100% of single heterozygous mutations in tumour specimens and cell lines. Genetic analyses (LOH and sequencing) performed for early and late passages of several cell lines originally described as showing single heterozygous TP53 mutations (H-318, G-16, PF-382, MOLT-13, ST-486 and LS-123). Statistical analysis of IARC TP53 and SANGER databases. Genetic analyses of N-RAS, FBXW7, PTEN and STR markers to test cross-contamination and cell line identity. Cell cloning, fluorescence-activated cell sorting and SSCP performed for the PF-382 cell line. A database study revealed TP53 single heterozygous mutations in 35% of in vivo (surgical and biopsy) samples and only 10% of cultured cells (in vitro), although those numbers appeared to be overestimated. We deem that published in vivo TP53 mutation analyses are not as rigorous as studies in vitro, and we did not find any cell line showing a stable, single heterozygous mutation. G16, PF-382 and MOLT-13 cells harboured single heterozygous mutations temporarily. ST-486, H-318 and LS-123 cell lines were misclassified. Specific mutations, such as R175H, R273H, R273L or R273P, which are reported in the literature to exert a DNE, showed the lowest percentage of single heterozygous mutations in vitro (about 5%). We suggest that the currently reported percentage of TP53 single heterozygous mutations in tumour samples and cancer cell lines is overestimated. Thus, the magnitude of the DNE of TP53 mutations is questionable. This scepticism is supported by database investigations showing that retention
TP53 codon 72 polymorphism in pigmentary phenotypes
Indian Academy of Sciences (India)
2012-01-20
Jan 20, 2012 ... pigmentation by acting as a transcription factor for other genes that are ... skin phototype I-II, burns after exposure to UVR and the development of .... morphisms of TP53 codon 72 with breast carcinoma risk: evidence from ...
Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.
1993-01-01
Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
International Nuclear Information System (INIS)
Shao Guoguang; Liu Linlin; Xu Chuanjie
2005-01-01
Objective: To study the association of polymorphism in TP53 gene with the susceptibility and radiation sensitivity of non-small-cell-lung cancer (NSCLC) of the population in the North of China. Methods: Using RFLP-PCR assays, TP53 genotypes were detected by amplifying DNA fragments with sequence specific primers and digested by FnuD II enzyme in 88 patients with NSCLC as well as 112 healthy controls. Results: The C/C allele frequency was significantly higher in NSCLC patients than that in the healthy controls (χ 2 =5.65, P=0.017). The C/C genotype frequency was significantly higher in NSCLC patients than that of the healthy controls (χ 2 =9.33, P=0.0023). The risk of C/C homozygotes in NSCLC patients was about 2.7 times against G/G homozygotes with odds ratio of 2.43(95% CI=1.32-4.51). Conclusion: In the population in the North of China, TP53 C/C genotype is closely associated with the susceptibility of NSCLC. There is no significant relationship between the polymorphism in TP53 gene and radiation sensitivity in NSCLC. (authors)
Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef
2005-07-01
To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.
Suda, Tetsuji; Yoshihara, Mitsuyo; Nakamura, Yoshiyasu; Sekiguchi, Hironobu; Godai, Ten-I; Sugano, Nobuhiro; Tsuchida, Kazuhito; Shiozawa, Manabu; Sakuma, Yuji; Tsuchiya, Eiju; Kameda, Yoichi; Akaike, Makoto; Matsukuma, Shoichi; Miyagi, Yohei
2011-07-01
MDM4, a homolog of MDM2, is considered a key negative regulator of p53. Gene amplification of MDM4 has been identified in a variety of tumors. MDM2 or MDM4 gene amplification is only associated with the wild-type TP53 gene in retinoblastomas, thus the amplification of the two genes is mutually exclusive. Previously, we demonstrated that MDM2 amplification and TP53 alteration were not mutually exclusive in colorectal cancer, and we identified a subset of colorectal cancer patients without alterations in either the TP53 or the MDM2 gene. In this study, we investigated the gene amplification status of MDM4 in the same set of colorectal cancer cases. Unexpectedly, MDM4 amplification was rare, detected in only 1.4% (3 out of 211) of colorectal cancer cases. All the three gene-amplified tumors also harbored TP53-inactivating mutations. This contradicts the simple mutually exclusive relationship observed in retinoblastomas. Surprisingly, two of the three MDM4-amplified tumors also demonstrated MDM2 amplification. Paradoxically, the MDM4 protein levels were decreased in the tumor tissue of the gene-amplified cases compared with levels in the matched normal mucosa. We speculate that MDM4 might play a role in colorectal carcinogenesis that is not limited to negative regulation of p53 in combination with MDM2. The functional significance of MDM4 is still unclear and further studies are needed.
Directory of Open Access Journals (Sweden)
Mariana Maschietto
Full Text Available The presence of diffuse anaplasia in Wilms tumours (DAWT is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information.We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32 and gene expression (n = 36 arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling.From the 40 cases, 22 (55% had TP53 mutations (2 detected only after deep-sequencing, 20 of which also had 17p loss (91%; 18 (45% cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25 had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR, 3.89; 95% confidence interval (CI, 1.26-16.0 and death (p = 0.04, HR, 4.95; 95% CI, 1.36-31.7 compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03. These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes.This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker.
Maschietto, Mariana; Williams, Richard D; Chagtai, Tasnim; Popov, Sergey D; Sebire, Neil J; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R; Grundy, Paul; Dome, Jeffrey S; Pritchard-Jones, Kathy
2014-01-01
The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26-16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36-31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker.
Energy Technology Data Exchange (ETDEWEB)
Billet, Sylvain; Paget, Vincent [Universite Lille Nord de France, Lille (France); Unite de Chimie Environnementale et Interactions sur le Vivant, Maison de la Recherche en Environnement Industriel, Universite du Littoral Cote d' Opale, Dunkerque (France); GRECAN, Universite de Caen Basse-Normandie et Centre Regional de Lutte Contre le Cancer Francois Baclesse, Caen (France); Garcon, Guillaume; Verdin, Anthony; Shirali, Pirouz [Universite Lille Nord de France, Lille (France); Unite de Chimie Environnementale et Interactions sur le Vivant, Maison de la Recherche en Environnement Industriel, Universite du Littoral Cote d' Opale, Dunkerque (France); Andre, Veronique; Heutte, Natacha; Sichel, Francois [GRECAN, Universite de Caen Basse-Normandie et Centre Regional de Lutte Contre le Cancer Francois Baclesse, Caen (France)
2012-01-15
Environmental exposure to fine airborne particulate matter (PM 2.5) is thought to be responsible for cardiopulmonary diseases, including lung cancer. However, the mechanisms of action potentially involved in PM{sub 2.5} toxicity are not yet fully described. Mutations in the TP53 gene are the most common alterations in human solid tumors. TP53 mutational patterns have sometimes been linked to carcinogen exposure. The purpose of this study was to determine the mutations that alter the functionality of this transcription factor in a model of human epithelial lung cells (A549) exposed to the fine particulate fraction (PM{sub 2.5}) of an atmospheric aerosol sampled under urban and industrial influences. PM{sub 2.5} was collected in Dunkerque City by cascade impaction. Its physicochemical characterization revealed the presence of many inorganic and organic compounds, including some that are known for their toxicity. The search for mutations altering the functionality of the P53 protein was performed 72 h after exposure of A549 cells to PM{sub 2.5} at its lethal concentration at 50% (LC{sub 50}, 118.60 {mu}g/mL = 31.63 {mu}g/cm{sup 2}), using the Functional Analysis of Separated Alleles in Yeast (FASAY). Sixteen mutations altering P53 function were detected after A549 cells exposure to the collected PM{sub 2.5}: eight deletions of one or two nucleotides and eight nucleotide substitutions, mainly transitions A > G and G > A. These mutations are described in the literature as possibly caused by endogenous mechanisms, such as oxidative stress. This kind of alteration can be induced by metal content of the PM{sub 2.5}, as well as by metabolic activation of the organic compounds coated onto its surface. Involvement of oxidative stress in TP53 mutations was confirmed by the detection of an oxidative DNA adduct, 8-hydroxy-2'-deoxyguanosine (8-OHdG), in A549 cells exposed to the collected PM. (authors)
TP53 dysfunction in CLL: Implications for prognosis and treatment.
Te Raa, Gera D; Kater, Arnon P
2016-03-01
Despite the availability of novel targeted agents, TP53 defects remain the most important adverse prognostic factor in chronic lymphocytic leukemia (CLL). Detection of deletion of TP53 locus (17p deletion) by fluorescent in situ hybridization (FISH) has become standard and performed prior to every line of treatment as the incidence dramatically increases as relapses occur. As monoallelic mutations of TP53 equally affect outcome, novel methods are being developed to improve detection of TP53 defects and include next-generation sequencing (NGS) and functional assays. TP53 defects highly affect outcome of immunochemotherapy but also alter response durations of tyrosine kinase inhibitors. Although BCR-targeting agents and Bcl-2-inhibitos have achieved durable responses in some patients with TP53 defects, long-term follow-up is currently lacking. In this review biological and clinical consequences of TP53 dysfunction as well as applicability of currently available methods to detect TP53 defects are described. In addition, proposed novel therapeutic strategies specifically for patients with TP53 dysfunction are discussed. In summary, the only curative treatment option for TP53-defective CLL is still allogeneic hematopoietic stem cell transplantation. Other treatment strategies such as rationale combinations of agents with different (TP53 independent) targets, including kinase inhibitors and inhibitors of anti-apoptotic molecules but also immunomodulatory agents need to be further explored. Copyright © 2016 Elsevier Ltd. All rights reserved.
Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?
International Nuclear Information System (INIS)
Blackburn, Anneke C; Jerry, D Joseph
2002-01-01
The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer
Knockdown of HSPA9 induces TP53-dependent apoptosis in human hematopoietic progenitor cells.
Directory of Open Access Journals (Sweden)
Tuoen Liu
Full Text Available Myelodysplastic syndromes (MDS are the most common adult myeloid blood cancers in the US. Patients have increased apoptosis in their bone marrow cells leading to low peripheral blood counts. The full complement of gene mutations that contribute to increased apoptosis in MDS remains unknown. Up to 25% of MDS patients harbor and acquired interstitial deletion on the long arm of chromosome 5 [del(5q], creating haploinsufficiency for a large set of genes including HSPA9. Knockdown of HSPA9 in primary human CD34+ hematopoietic progenitor cells significantly inhibits growth and increases apoptosis. We show here that HSPA9 knockdown is associated with increased TP53 expression and activity, resulting in increased expression of target genes BAX and p21. HSPA9 protein interacts with TP53 in CD34+ cells and knockdown of HSPA9 increases nuclear TP53 levels, providing a possible mechanism for regulation of TP53 by HSPA9 haploinsufficiency in hematopoietic cells. Concurrent knockdown of TP53 and HSPA9 rescued the increased apoptosis observed in CD34+ cells following knockdown of HSPA9. Reduction of HSPA9 below 50% results in severe inhibition of cell growth, suggesting that del(5q cells may be preferentially sensitive to further reductions of HSPA9 below 50%, thus providing a genetic vulnerability to del(5q cells. Treatment of bone marrow cells with MKT-077, an HSPA9 inhibitor, induced apoptosis in a higher percentage of cells from MDS patients with del(5q compared to non-del(5q MDS patients and normal donor cells. Collectively, these findings indicate that reduced levels of HSPA9 may contribute to TP53 activation and increased apoptosis observed in del(5q-associated MDS.
Genetic variation in the TP53 pathway and bladder cancer risk. a comprehensive analysis.
Directory of Open Access Journals (Sweden)
Silvia Pineda
Full Text Available Germline variants in TP63 have been consistently associated with several tumors, including bladder cancer, indicating the importance of TP53 pathway in cancer genetic susceptibility. However, variants in other related genes, including TP53 rs1042522 (Arg72Pro, still present controversial results. We carried out an in depth assessment of associations between common germline variants in the TP53 pathway and bladder cancer risk.We investigated 184 tagSNPs from 18 genes in 1,058 cases and 1,138 controls from the Spanish Bladder Cancer/EPICURO Study. Cases were newly-diagnosed bladder cancer patients during 1998-2001. Hospital controls were age-gender, and area matched to cases. SNPs were genotyped in blood DNA using Illumina Golden Gate and TaqMan assays. Cases were subphenotyped according to stage/grade and tumor p53 expression. We applied classical tests to assess individual SNP associations and the Least Absolute Shrinkage and Selection Operator (LASSO-penalized logistic regression analysis to assess multiple SNPs simultaneously.Based on classical analyses, SNPs in BAK1 (1, IGF1R (5, P53AIP1 (1, PMAIP1 (2, SERINPB5 (3, TP63 (3, and TP73 (1 showed significant associations at p-value≤0.05. However, no evidence of association, either with overall risk or with specific disease subtypes, was observed after correction for multiple testing (p-value≥0.8. LASSO selected the SNP rs6567355 in SERPINB5 with 83% of reproducibility. This SNP provided an OR = 1.21, 95%CI 1.05-1.38, p-value = 0.006, and a corrected p-value = 0.5 when controlling for over-estimation.We found no strong evidence that common variants in the TP53 pathway are associated with bladder cancer susceptibility. Our study suggests that it is unlikely that TP53 Arg72Pro is implicated in the UCB in white Europeans. SERPINB5 and TP63 variation deserve further exploration in extended studies.
Directory of Open Access Journals (Sweden)
Shadia Muhammad Ihlaseh
2007-02-01
Full Text Available INTRODUÇÃO: Microdissecção e captura a laser (MCL é uma técnica de desenvolvimento recente que permite a coleta de células individuais ou pequeno conjunto de células para análise molecular. Atualmente, no Brasil, há raros microscópios para MCL, de modo que a divulgação dos procedimentos inerentes a essa técnica é oportuna para destacar seu amplo potencial para diagnóstico e investigação. OBJETIVO: Este trabalho descreve a padronização dos procedimentos de MCL e de extração de DNA de material fixado em formalina e incluído em parafina. MATERIAL E MÉTODOS: Foram estudados o éxon 8 do gene TP53 e o gene da ciclofilina em amostras de tecido normal e de neoplasias de fígado e rim provenientes de modelo de carcinogênese química induzida em rato. A extração do DNA foi comprovada por reação em cadeia da polimerase (nested-PCR. RESULTADOS: Foram padronizados os procedimentos de preparo dos cortes histológicos, de microdissecção e captura a laser e de obtenção de seqüências gênicas pela reação de nested-PCR para tecidos incluídos em parafina. Obtivemos amplificação de 48,3% das amostras para o éxon 8 do gene TP53 e 51,7% para o gene da ciclofilina. Considerando pelo menos um dos dois segmentos gênicos, foram amplificadas 79,3% das amostras. DISCUSSÃO E CONCLUSÃO: A extração de DNA de tecidos fixados em formalina e incluídos em parafina e a técnica de nested-PCR foram adequadamente padronizadas para produtos gênicos de interesse, obtidos de material coletado por MCL. Esses procedimentos podem ser úteis para a obtenção de seqüências de DNA de arquivos para análise molecular.BACKGORUND: Laser-capture micro-dissection (LCM is a recently developed procedure that provides single cells or specific cell groups for molecular analysis. Currently, there are few LCM systems in Brazil, in such a way that it is necessary to disseminate the technical procedures inherent to the methodology, and also to
Paget, Vincent; Lechevrel, Mathilde; André, Véronique; Le Goff, Jérémie; Pottier, Didier; Billet, Sylvain; Garçon, Guillaume; Shirali, Pirouz; Sichel, François
2012-01-01
Mutations in the TP53 gene are the most common alterations in human tumours. TP53 mutational patterns have sometimes been linked to carcinogen exposure. In hepatocellular carcinoma, a specific G>T transversion on codon 249 is classically described as a fingerprint of aflatoxin B1 exposure. Likewise G>T transversions in codons 157 and 158 have been related to tobacco exposure in human lung cancers. However, controversies remain about the interpretation of TP53 mutational pattern in tumours as the fingerprint of genotoxin exposure. By using a functional assay, the Functional Analysis of Separated Alleles in Yeast (FASAY), the present study depicts the mutational pattern of TP53 in normal human fibroblasts after in vitro exposure to well-known carcinogens: benzo[a]pyrene, aflatoxin B1 and acetaldehyde. These in vitro patterns of mutations were then compared to those found in human tumours by using the IARC database of TP53 mutations. The results show that the TP53 mutational patterns found in human tumours can be only partly ascribed to genotoxin exposure. A complex interplay between the functional impact of the mutations on p53 phenotype and the cancer natural history may affect these patterns. However, our results strongly support that genotoxins exposure plays a major role in the aetiology of the considered cancers. PMID:22319594
Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.
Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens
2005-04-01
The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.
Bilateral wilms tumor with TP53-related anaplasia.
Popov, Sergey D; Vujanic, Gordan M; Sebire, Neil J; Chagtai, Tasnim; Williams, Richard; Vaidya, Sucheta; Pritchard-Jones, Kathy
2013-01-01
Wilms tumor (WT) with diffuse anaplasia has an unfavorable prognosis and is often (>70%) associated with mutations in the TP53 gene. Although most WTs are unilateral, 5-10% are bilateral, and they are almost always present with nephrogenic rests. The latter are considered a precursor of WT. Two cases of bilateral WTs with nephroblastomatosis, in which anaplastic changes were detected over a period of time, were analyzed using clinical, radiological, histopathological, and molecular-genetic data. TP53 was analyzed by direct sequencing of its full coding sequence and intron-exon boundaries in 11 fragments. DNA was extracted from paraffin-embedded or frozen specimens. High-resolution genomic copy number profiling was carried out by UCL Genomics on the Affymetrix Human Mapping 250K Nsp or Genome-Wide Human SNP Array 6.0 platform. Both cases demonstrated a strong association between the appearance of anaplastic clones and TP53 mutations. Synchronous ganglioneuroma was diagnosed in one case. Our cases are unique as they represent a long disease history and demonstrate the difficulties in managing rare cases of bilateral WT with anaplasia. These cases also emphasize the practical importance of modern molecular-genetic techniques and their clinical application. Moreover, they highlight the issue of the adequate sampling needed in order to gather comprehensive, efficient, and sufficient information about genetic events in a single tumor.
Bioinformatics and phylogenetic analysis of human Tp73 gene ...
African Journals Online (AJOL)
The Tp73 gene encoding p73 protein belongs to the Tp53 gene family and it functions in the initiation of cell-cycle arrest or apoptosis and also involves in regulating a series of pathways including breast cancer, neuroblastoma and cholorectal cancer. New discoveries about the control and function of p73 are still in progress ...
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...
Hede, Sanna-Maria; Hansson, Inga; Afink, Gijs B.; Eriksson, Anna; Nazarenko, Inga; Andrae, Johanna; Genove, Guillem; Westermark, Bengt; Nistér, Monica
2009-01-01
Glioblastomas are the most common and malignant astrocytic brain tumors in human adults. The tumor suppressor gene TP53 is commonly mutated and/or lost in astrocytic brain tumors and the TP53 alterations are often found in combination with excessive growth factor signaling via PDGF/PDGFRalpha. Here,
Mutation screening of the TP53 gene by temporal temperature gradient gel electrophoresis.
Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise
2005-01-01
A protocol for detection of mutations in the TP53 gene using temporal temperature gradient gel electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques denaturing gradient gel electrophoresis (DGGE) and constant denaturant gel electrophoresis (CDGE) and eliminates some of the problems. The result is a rapid and sensitive screening technique that is robust and easily set up in smaller laboratory environments.
Mutation screening of the TP53 gene by temporal temperature gel electrophoresis (TTGE).
Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise
2014-01-01
A protocol for detection of mutations in the TP53 gene using temporal temperature gradient electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques, denaturing gradient gel electrophoresis and constant denaturant gel electrophoresis, and eliminates some of the problems. The result is a rapid and sensitive screening technique which is robust and easily set up in smaller laboratory environments.
DEFF Research Database (Denmark)
Stecher, Chalotte Willemann; Grønbaek, Kirsten; Hasle, Henrik
2008-01-01
A 20-month-old boy presented with precocious puberty due to a Leydig cell tumor, and at the age of 6 years with a primitive neuroectodermal brain-tumor (PNET). A novel splice site mutation of the TP53-gene, likely to be associated with a nonfunctional protein, was found in the proband, his father...
PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene
Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan
2009-01-01
Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…
Mutations and polymorphisms in TP53 gene--an overview on the role in colorectal cancer
Czech Academy of Sciences Publication Activity Database
Naccarati, Alessio; Poláková, Veronika; Pardini, Barbara; Vodičková, Ludmila; Hemminki, K.; Kumar, R.; Vodička, Pavel (ed.)
2012-01-01
Roč. 27, č. 2 (2012), s. 211-218 ISSN 0267-8357 R&D Projects: GA ČR GP305/09/P194; GA ČR GAP304/10/1286 Grant - others:GA UK(CZ) GA96908/B/2008 Institutional research plan: CEZ:AV0Z50390512 Keywords : TP53 mutations * TP53 polymorphisms * cancer risk Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.500, year: 2012
Ooms, Ariadne H A G; Gadd, Samantha; Gerhard, Daniela S; Smith, Malcolm A; Guidry Auvil, Jaime M; Meerzaman, Daoud; Chen, Qing-Rong; Hsu, Chih Hao; Yan, Chunhua; Nguyen, Cu; Hu, Ying; Ma, Yussanne; Zong, Zusheng; Mungall, Andrew J; Moore, Richard A; Marra, Marco A; Huff, Vicki; Dome, Jeffrey S; Chi, Yueh-Yun; Tian, Jing; Geller, James I; Mullighan, Charles G; Ma, Jing; Wheeler, David A; Hampton, Oliver A; Walz, Amy L; van den Heuvel-Eibrink, Marry M; de Krijger, Ronald R; Ross, Nicole; Gastier-Foster, Julie M; Perlman, Elizabeth J
2016-11-15
To investigate the role and significance of TP53 mutation in diffusely anaplastic Wilms tumors (DAWTs). All DAWTs registered on National Wilms Tumor Study-5 (n = 118) with available samples were analyzed for TP53 mutations and copy loss. Integrative genomic analysis was performed on 39 selected DAWTs. Following analysis of a single random sample, 57 DAWTs (48%) demonstrated TP53 mutations, 13 (11%) copy loss without mutation, and 48 (41%) lacked both [defined as TP53-wild-type (wt)]. Patients with stage III/IV TP53-wt DAWTs (but not those with stage I/II disease) had significantly lower relapse and death rates than those with TP53 abnormalities. In-depth analysis of a subset of 39 DAWTs showed seven (18%) to be TP53-wt: These demonstrated gene expression evidence of an active p53 pathway. Retrospective pathology review of TP53-wt DAWT revealed no or very low volume of anaplasia in six of seven tumors. When samples from TP53-wt tumors known to contain anaplasia histologically were available, abnormal p53 protein accumulation was observed by immunohistochemistry. These data support the key role of TP53 loss in the development of anaplasia in WT, and support its significant clinical impact in patients with residual anaplastic tumor following surgery. These data also suggest that most DAWTs will show evidence of TP53 mutation when samples selected for the presence of anaplasia are analyzed. This suggests that modifications of the current criteria to also consider volume of anaplasia and documentation of TP53 aberrations may better reflect the risk of relapse and death and enable optimization of therapeutic stratification. Clin Cancer Res; 22(22); 5582-91. ©2016 AACR. ©2016 American Association for Cancer Research.
Valproic acid treatment response in vitro is determined by TP53 status in medulloblastoma.
Mascaro-Cordeiro, Bruna; Oliveira, Indhira Dias; Tesser-Gamba, Francine; Pavon, Lorena Favaro; Saba-Silva, Nasjla; Cavalheiro, Sergio; Dastoli, Patrícia; Toledo, Silvia Regina Caminada
2018-05-22
Histone deacetylate inhibitors (HDACi), as valproic acid (VA), have been reported to enhance efficacy and to prevent drug resistance in some tumors, including medulloblastoma (MB). In the present study, we investigated VA role, combined to cisplatin (CDDP) in cell viability and gene expression of MB cell lines. Dose-response curve determined IC 50 values for each treatment: (1) VA single, (2) CDDP single, and (3) VA and CDDP combined. Cytotoxicity and flow cytometry evaluated cell viability after exposure to treatments. Quantitative PCR evaluated gene expression levels of AKT, CTNNB1, GLI1, KDM6A, KDM6B, NOTCH2, PTCH1, and TERT, before and after treatment. Besides, we performed next-generation sequencing (NGS) for PTCH1, TERT, and TP53 genes. The most effective treatment to reduce viability was combined for D283MED and ONS-76; and CDDP single for DAOY cells (p AKT genes were overexpressed after treatments with VA. D283MED and ONS-76 cells presented variants in TERT and PTCH1, respectively and DAOY cell line presented a TP53 mutation. MB tumors belonging to SHH molecular subgroup, with TP53 MUT , would be the ones that present high risk in relation to VA use during the treatment, while TP53 WT MBs can benefit from VA therapy, both SHH and groups 3 and 4. Our study shows a new perspective about VA action in medulloblastoma cells, raising the possibility that VA may act in different patterns. According to the genetic background of MB cell, VA can stimulate cell cycle arrest and apoptosis or induce resistance to treatment via signaling pathways activation.
Identification of TP53 as an Acute Lymphocytic Leukemia Susceptibility Gene Through Exome Sequencing
Powell, Bradford C.; Jiang, Lichun; Muzny, Donna M.; Treviño, Lisa R.; Dreyer, ZoAnn E.; Strong, Louise C.; Wheeler, David A.; Gibbs, Richard A.; Plon, Sharon E.
2014-01-01
Although acute lymphocytic leukemia (ALL) is the most common childhood cancer, genetic predisposition to ALL remains poorly understood. Whole-exome sequencing was performed in an extended kindred in which five individuals had been diagnosed with leukemia. Analysis revealed a nonsense variant of TP53 which has been previously reported in families with sarcomas and other typical Li Fraumeni syndrome-associated cancers but never in a familial leukemia kindred. This unexpected finding enabled identification of an appropriate sibling bone marrow donor and illustrates that exome sequencing will reveal atypical clinical presentations of even well-studied genes. PMID:23255406
Directory of Open Access Journals (Sweden)
Selda Aydin
Full Text Available In the Balkan and Taiwan, the relationship between exposure to aristolochic acid and risk of urothelial neoplasms was inferred from the A>T genetic hallmark in TP53 gene from malignant cells. This study aimed to characterize the TP53 mutational spectrum in urothelial cancers consecutive to Aristolochic Acid Nephropathy in Belgium. Serial frozen tumor sections from female patients (n=5 exposed to aristolochic acid during weight-loss regimen were alternatively used either for p53 immunostaining or laser microdissection. Tissue areas with at least 60% p53-positive nuclei were selected for microdissecting sections according to p53-positive matching areas. All areas appeared to be carcinoma in situ. After DNA extraction, mutations in the TP53 hot spot region (exons 5-8 were identified using nested-PCR and sequencing. False-negative controls consisted in microdissecting fresh-frozen tumor tissues both from a patient with a Li-Fraumeni syndrome who carried a p53 constitutional mutation, and from KRas mutated adenocarcinomas. To rule out false-positive results potentially generated by microdissection and nested-PCR, a phenacetin-associated urothelial carcinoma and normal fresh ureteral tissues (n=4 were processed with high laser power. No unexpected results being identified, molecular analysis was pursued on malignant tissues, showing at least one mutation in all (six different mutations in two patients, with 13/16 exonic (nonsense, 2; missense, 11 and 3/16 intronic (one splice site mutations. They were distributed as transitions (n=7 or transversions (n=9, with an equal prevalence of A>T and G>T (3/16 each. While current results are in line with A>T prevalence previously reported in Balkan and Taiwan studies, they also demonstrate that multiple mutations in the TP53 hot spot region and a high frequency of G>T transversion appear as a complementary signature reflecting the toxicity of a cumulative dose of aristolochic acid ingested over a short period
Ooms, Ariadne H.A.G.; Gadd, Samantha; Gerhard, Daniela S.; Smith, Malcolm A.; Guidry Auvil, Jaime M.; Meerzaman, Daoud; Chen, Qing-Rong; Hsu, Chih Hao; Yan, Chunhua; Nguyen, Cu; Hu, Ying; Ma, Yussanne; Zong, Zusheng; Mungall, Andrew J.; Moore, Richard A.; Marra, Marco A.; Huff, Vicki; Dome, Jeffrey S.; Chi, Yueh-Yun; Tian, Jing; Geller, James I.; Mullighan, Charles G.; Ma, Jing; Wheeler, David A.; Hampton, Oliver A.; Walz, Amy L.; van den Heuvel-Eibrink, Marry M.; de Krijger, Ronald R.; Ross, Nicole; Gastier-Foster, Julie M.; Perlman, Elizabeth J.
2016-01-01
Purpose To investigate the role and significance of TP53 mutation in diffusely anaplastic Wilms tumor (DAWT). Experimental Design All DAWTs registered on National Wilms Tumor Study-5 (n=118) with available samples were analyzed for TP53 mutations and copy loss. Integrative genomic analysis was performed on 39 selected DAWTs. Results Following analysis of a single random sample, 57 DAWT (48%) demonstrated TP53 mutations, 13(11%) copy loss without mutation, and 48(41%) lacked both (defined as TP53-wildtype (wt)). Patients with Stage III/IV TP53-wt DAWTs (but not those with Stage I/II disease) had significantly lower relapse and death rates than those with TP53 abnormalities. In-depth analysis of a subset of 39 DAWT showed 7(18%) to be TP53-wt: these demonstrated gene expression evidence of an active p53 pathway. Retrospective pathology review of TP53-wt DAWT revealed no or very low volume of anaplasia in 6/7 tumors. When samples from TP53-wt tumors known to contain anaplasia histologically were available, abnormal p53 protein accumulation was observed by immunohistochemistry. Conclusion These data support the key role of TP53 loss in the development of anaplasia in WT, and support its significant clinical impact in patients with residual anaplastic tumor following surgery. These data also suggest that most DAWTs will show evidence of TP53 mutation when samples selected for the presence of anaplasia are analyzed. This suggests that modifications of the current criteria to also consider volume of anaplasia and documentation of TP53 aberrations may better reflect the risk of relapse and death and enable optimization of therapeutic stratification. PMID:27702824
Targeting the p53 Pathway in Ewing Sarcoma
Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.
2011-01-01
The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471
RITA displays anti-tumor activity in medulloblastomas independent of TP53 status.
Gottlieb, Aline; Althoff, Kristina; Grunewald, Laura; Thor, Theresa; Odersky, Andrea; Schulte, Marc; Deubzer, Hedwig E; Heukamp, Lukas; Eggert, Angelika; Schramm, Alexander; Schulte, Johannes H; Künkele, Annette
2017-04-25
Current therapy of medulloblastoma, the most common malignant brain tumor of childhood, achieves 40-70% survival. Secondary chemotherapy resistance contributes to treatment failure, where TP53 pathway dysfunction plays a key role. MDM2 interaction with TP53 leads to its degradation. Reactivating TP53 functionality using small-molecule inhibitors, such as RITA, to disrupt TP53-MDM2 binding may have therapeutic potential. We show here that RITA decreased viability of all 4 analyzed medulloblastoma cell lines, regardless of TP53 functional status. The decrease in cell viability was accompanied in 3 of the 4 medulloblastoma cell lines by accumulation of TP53 protein in the cells and increased CDKN1A expression. RITA treatment in mouse models inhibited medulloblastoma xenograft tumor growth. These data demonstrate that RITA treatment reduces medulloblastoma cell viability in both in vitro and in vivo models, and acts independently of cellular TP53 status, identifying RITA as a potential therapeutic agent to treat medulloblastoma.
Xie, Xiaolei; Le, Li; Fan, Yanxin; Lv, Lin; Zhang, Junjie
2012-07-01
Mitoribosome in mammalian cells is responsible for synthesis of 13 mtDNA-encoded proteins, which are integral parts of four mitochondrial respiratory chain complexes (I, III, IV and V). ERAL1 is a nuclear-encoded GTPase important for the formation of the 28S small mitoribosomal subunit. Here, we demonstrate that knockdown of ERAL1 by RNA interference inhibits mitochondrial protein synthesis and promotes reactive oxygen species (ROS) generation, leading to autophagic vacuolization in HeLa cells. Cells that lack ERAL1 expression showed a significant conversion of LC3-I to LC3-II and an enhanced accumulation of autophagic vacuoles carrying the LC3 marker, all of which were blocked by the autophagy inhibitor 3-MA as well as by the ROS scavenger NAC. Inhibition of mitochondrial protein synthesis either by ERAL1 siRNA or chloramphenicol (CAP), a specific inhibitor of mitoribosomes, induced autophagy in HTC-116 TP53 (+/+) cells, but not in HTC-116 TP53 (-/-) cells, indicating that tumor protein 53 (TP53) is essential for the autophagy induction. The ROS elevation resulting from mitochondrial protein synthesis inhibition induced TP53 expression at transcriptional levels by enhancing TP53 promoter activity, and increased TP53 protein stability by suppressing TP53 ubiquitination through MAPK14/p38 MAPK-mediated TP53 phosphorylation. Upregulation of TP53 and its downstream target gene DRAM1, but not CDKN1A/p21, was required for the autophagy induction in ERAL1 siRNA or CAP-treated cells. Altogether, these data indicate that autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri
2014-12-24
TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.
TP53 mutation spectrum in smokers and never smoking lung cancer patients
Directory of Open Access Journals (Sweden)
Ann Rita Halvorsen
2016-05-01
Full Text Available AbstractBackground: TP53 mutations are among the most common mutations found in lung cancers, identified as an independent prognostic factor in many types of cancers. The purpose of this study was to investigate the frequency and prognostic impact of TP53 mutations in never-smokers and in different histological subtypes of lung cancer.Methods: We analysed tumour tissue from 394 non-small cell carcinomas including adenocarcinomas (n=229, squamous cell carcinomas (n=112, large cell carcinomas (n=30 and others (n=23 for mutations in TP53 by the use of Sanger sequencing (n=394 and next generation sequencing (n=100. Results: TP53 mutations were identified in 47.2% of the samples, with the highest frequency (65% of mutations among squamous cell carcinomas. Among never-smokers, 36% carried a TP53 mutation, identified as a significant independent negative prognostic factor in this subgroup. For large cell carcinomas, a significantly prolonged progression free survival was found for those carrying a TP53 mutation. In addition, the frequency of frameshift mutations was doubled in squamous cell carcinomas (20.3% compared to adenocarcinomas (9.1%.Conclusion: TP53 mutation patterns differ between the histological subgroups of lung cancers, as also influenced by smoking history. This indicates that the histological subtypes in lung cancer are genetically different, and that smoking-induced TP53 mutations may have a different biological impact than TP53 mutations occurring in never-smokers.
Defects in mitophagy promote redox-driven metabolic syndrome in the absence of TP53INP1.
Seillier, Marion; Pouyet, Laurent; N'Guessan, Prudence; Nollet, Marie; Capo, Florence; Guillaumond, Fabienne; Peyta, Laure; Dumas, Jean-François; Varrault, Annie; Bertrand, Gyslaine; Bonnafous, Stéphanie; Tran, Albert; Meur, Gargi; Marchetti, Piero; Ravier, Magalie A; Dalle, Stéphane; Gual, Philippe; Muller, Dany; Rutter, Guy A; Servais, Stéphane; Iovanna, Juan L; Carrier, Alice
2015-06-01
The metabolic syndrome covers metabolic abnormalities including obesity and type 2 diabetes (T2D). T2D is characterized by insulin resistance resulting from both environmental and genetic factors. A genome-wide association study (GWAS) published in 2010 identified TP53INP1 as a new T2D susceptibility locus, but a pathological mechanism was not identified. In this work, we show that mice lacking TP53INP1 are prone to redox-driven obesity and insulin resistance. Furthermore, we demonstrate that the reactive oxygen species increase in TP53INP1-deficient cells results from accumulation of defective mitochondria associated with impaired PINK/PARKIN mitophagy. This chronic oxidative stress also favors accumulation of lipid droplets. Taken together, our data provide evidence that the GWAS-identified TP53INP1 gene prevents metabolic syndrome, through a mechanism involving prevention of oxidative stress by mitochondrial homeostasis regulation. In conclusion, this study highlights TP53INP1 as a molecular regulator of redox-driven metabolic syndrome and provides a new preclinical mouse model for metabolic syndrome clinical research. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
International Nuclear Information System (INIS)
Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo
2003-01-01
The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Rejane Mattar
2004-01-01
Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea
Vang, Russell; Levine, Douglas A; Soslow, Robert A; Zaloudek, Charles; Shih, Ie-Ming; Kurman, Robert J
2016-01-01
The Cancer Genome Atlas has reported that 96% of ovarian high-grade serous carcinomas (HGSCs) have TP53 somatic mutations suggesting that mutation of this gene is a defining feature of this neoplasm. In the current study, 5 gynecologic pathologists independently evaluated hematoxylin and eosin slides of 14 available cases from The Cancer Genome Atlas classified as HGSC that lacked a TP53 mutation. The histologic diagnoses rendered by these pathologists and the accompanying molecular genetic data are the subject of this report. Only 1 case (Case 5), which contained a homozygous deletion of TP53, had unanimous interobserver agreement for a diagnosis of pure HGSC. In 1 case (Case 3), all 5 observers (100%) rendered a diagnosis of HGSC; however, 3 observers (60%) noted that the histologic features were not classic for HGSC and suggested this case may have arisen from a low-grade serous carcinoma (arisen from an alternate pathway compared with the usual HGSC). In 2 cases (Cases 4 and 12), only 3 observers (60%) in each case, respectively, interpreted it as having a component of HGSC. In the remaining 10 (71%) of tumors (Cases 1, 2, 6-11, 13, and 14), the consensus diagnosis was not HGSC, with individual diagnoses including low-grade serous carcinoma, high-grade endometrioid carcinoma, HGSC, metastatic carcinoma, clear cell carcinoma, atypical proliferative (borderline) serous tumor, and adenocarcinoma, not otherwise specified. Therefore, 13 (93%) of the tumors (Cases 1-4 and 6-14) were either not a pure HGSC or represented a diagnosis other than HGSC, all with molecular results not characteristic of HGSC. Accordingly, our review of the TP53 wild-type HGSCs reported in The Cancer Genome Atlas suggests that 100% of de novo HGSCs contain TP53 somatic mutations or deletions, with the exception of the rare HGSCs that develop from a low-grade serous tumor precursor. We, therefore, propose that lack of molecular alterations of TP53 are essentially inconsistent with the
International Nuclear Information System (INIS)
Giacomazzi, Juliana; Hainaut, Pierre; Ashton-Prolla, Patricia; Selistre, Simone; Duarte, Juliana; Ribeiro, Jorge Pinto; Vieira, Paulo JC; Souza Macedo, Gabriel de; Rossi, Cristina; Czepielewski, Mauro; Netto, Cristina Brinkmann Oliveira
2013-01-01
Adrenocortical carcinomas (ACCs) are among the most common childhood cancers occurring in infants affected with the Li-Fraumeni and Li- Fraumeni-like (LFS/LFL) syndromes, which are caused by dominant germline mutations in the TP53 gene. In Brazil, a particular mutation, occurring in the tetramerisation domain of the gene, p.R337H, is exceedingly common due to a founder effect and is strongly associated with ACC. In this report, we describe the phenotype and long-term clinical follow-up of a female child diagnosed with ACC and homozygous for the TP53 p.R337H founder mutation. At age 11 months, the patient was diagnosed with a virilising anaplastic adrenal cortical tumour, which was completely excised without disturbing the adrenal capsule. Family history was consistent with an LFL tumour pattern, and genotyping identified the TP53 p.R337H mutation in both alleles in genomic DNA from lymphocytes and fibroblasts. Haplotype analysis confirmed the occurrence of the mutation in the same founder haplotype previously described in other Brazilian patients. No other germline or somatic TP53 mutations or rearrangements were identified. At age 9 years, the child was asymptomatic and had no evidence of endocrine derangements. Full body and brain magnetic resonance imaging (MRI) failed to detect any suspicious proliferative lesions, and cardiopulmonary exercise testing results were within the normal reference for the child’s age, ruling out a major exercise capacity deficiency. This is the first clinical and aerobic functional capacity documentation of a patient who carries two mutant TP53 alleles and no wild-type allele. Our results support the hypothesis that TP53 p.R337H, the most common TP53 mutation ever described in any population, is a conditional mutant. Furthermore, our observations over a long period of clinical follow-up suggest that TP53 p.R337H homozygotes do not have a more severe disease phenotype than do heterozygote carriers of the same mutation. Patients with
International Nuclear Information System (INIS)
L’Abbate, Alberto; Tagliafico, Enrico; Minoia, Carla; De Tullio, Giacoma; Guarini, Attilio; Testoni, Nicoletta; Agostinelli, Claudio; Storlazzi, Clelia Tiziana; Lo Cunsolo, Crocifissa; Macrì, Ettore; Iuzzolino, Paolo; Mecucci, Cristina; Doglioni, Claudio; Coco, Michelina; Muscarella, Lucia Anna; Salati, Simona
2014-01-01
The progression of low-risk del(5q) myelodysplastic syndrome to acute myeloid leukemia is increased when associated with mutations of TP53, or with additional chromosomal abnormalities. However, to date the prognostic impact and molecular consequences of these rearrangements were poorly investigated. Single additional alterations to del(5q) by balanced chromosome rearrangements were rarely found in myelodysplasia. In particular, balanced alterations involving TP63 and FOXP1 genes were never reported in the literature. Here we report on a 79-year woman with an aggressive form of myelodysplastic syndrome with del(5q), no TP53 mutation, and a novel complex rearrangement of chromosome 3 in bone marrow cells. Our results revealed that the FOXP1 and TP63 genes were both relocated along chromosome 3. Strikingly, immunohistochemistry analysis showed altered protein levels, disclosing that this rearrangement triggered the expression of FOXP1 and TP63 genes. FOXP1 was also found activated in other patients with myelodysplasia and acute myeloid leukemia, showing that it is an important, recurrent event. We document an apparent role of FOXP1 and TP63, up to now poorly documented, in the progression of MDS in our patient who is lacking mutations in the TP53 tumor suppressor gene normally associated with poor outcome in myelodysplastic syndrome with 5q-. Finally, our results may suggest a possible broader role of FOXP1 in the pathogenesis and progression of myelodysplasia and acute myeloid leukemia
Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.
1996-01-01
Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type
Gleber-Netto, Frederico O; Zhao, Mei; Trivedi, Sanchit; Wang, Jiping; Jasser, Samar; McDowell, Christina; Kadara, Humam; Zhang, Jiexin; Wang, Jing; William, William N; Lee, J Jack; Nguyen, Minh Ly; Pai, Sara I; Walline, Heather M; Shin, Dong M; Ferris, Robert L; Carey, Thomas E; Myers, Jeffrey N; Pickering, Curtis R
2018-01-01
Human immunodeficiency virus-infected individuals (HIVIIs) have a higher incidence of head and neck squamous cell carcinoma (HNSCC), and clinical and histopathological differences have been observed in their tumors in comparison with those of HNSCC patients without a human immunodeficiency virus (HIV) infection. The reasons for these differences are not clear, and molecular differences between HIV-related HNSCC and non-HIV-related HNSCC may exist. This study compared the mutational patterns of HIV-related HNSCC and non-HIV-related HNSCC. The DNA of 20 samples of HIV-related HNSCCs and 32 samples of non-HIV-related HNSCCs was sequenced. DNA libraries covering exons of 18 genes frequently mutated in HNSCC (AJUBA, CASP8, CCND1, CDKN2A, EGFR, FAT1, FBXW7, HLA-A, HRAS, KEAP1, NFE2L2, NOTCH1, NOTCH2, NSD1, PIK3CA, TGFBR2, TP53, and TP63) were prepared and sequenced on an Ion Personal Genome Machine sequencer. DNA sequencing data were analyzed with Ion Reporter software. The human papillomavirus (HPV) status of the tumor samples was assessed with in situ hybridization, the MassARRAY HPV multiplex polymerase chain reaction assay, and p16 immunostaining. Mutation calls were compared among the studied groups. HIV-related HNSCC revealed a distinct pattern of mutations in comparison with non-HIV-related HNSCC. TP53 mutation frequencies were significantly lower in HIV-related HNSCC. Mutations in HIV+ patients tended to be TpC>T nucleotide changes for all mutated genes but especially for TP53. HNSCC in HIVIIs presents a distinct pattern of genetic mutations, particularly in the TP53 gene. HIV-related HNSCC may have a distinct biology, and an effect of the HIV virus on the pathogenesis of these tumors should not be ruled out. Cancer 2018;124:84-94. © 2017 American Cancer Society. © 2017 American Cancer Society.
Prisecaru, V I
2004-01-01
A new approach to the integration of results from a modular, complex biological systems analysis of nonlinear dynamics in cell cycling network transformations that are leading to carcinogenesis is proposed. Carcinogenesis is a complex process that involves dynamically inter-connected biomolecules in the intercellular, membrane, cytosolic, nuclear and nucleolar compartments that form numerous inter-related pathways referred to as networks. One such network module contains the cell cyclins whose functions are essential to cell cycling and division. Cyclins are proteins that also link to several critical pro-apoptotic and other cell cycling/division components, such as: c-Myc, p27, the tumor suppressor gene TP53 and its product-- the p53 protein with key roles in controlling DNA repair, inducing apoptosis and activating p21 (which can depress cell cyclins if activated), mdm2(with its biosynthesis activated by p53 and also, in its turn, inhibiting p53), p21, the Thomsen-Friedenreich antigen(T- antigen),Rb,Bax, Ba...
Sequential mutations in Notch1, Fbxw7, and Tp53 in radiation-induced mouse thymic lymphomas.
Jen, Kuang-Yu; Song, Ihn Young; Banta, Karl Luke; Wu, Di; Mao, Jian-Hua; Balmain, Allan
2012-01-19
T-cell acute lymphoblastic lymphomas commonly demonstrate activating Notch1 mutations as well as mutations or deletions in Fbxw7. However, because Fbxw7 targets Notch1 for degradation, genetic alterations in these genes are expected to be mutually exclusive events in lymphomagenesis. Previously, by using a radiation-induced Tp53-deficient mouse model for T-cell acute lymphoblastic lymphoma, we reported that loss of heterozygosity at the Fbxw7 locus occurs frequently in a Tp53-dependent manner. In the current study, we show that these thymic lymphomas also commonly exhibit activating Notch1 mutations in the proline-glutamic acid-serine-threonine (PEST) domain. Moreover, concurrent activating Notch1 PEST domain mutations and single-copy deletions at the Fbxw7 locus occur with high frequency in the same individual tumors, indicating that these changes are not mutually exclusive events. We further demonstrate that although Notch1 PEST domain mutations are independent of Tp53 status, they are completely abolished in mice with germline Fbxw7 haploinsufficiency. Therefore, Notch1 PEST domain mutations only occur when Fbxw7 expression levels are intact. These data suggest a temporal sequence of mutational events involving these important cancer-related genes, with Notch1 PEST domain mutations occurring first, followed by Fbxw7 deletion, and eventually by complete loss of Tp53.
TP53 dysfunction in CLL: Implications for prognosis and treatment
te Raa, Gera D.; Kater, Arnon P.
2016-01-01
Despite the availability of novel targeted agents, TP53 defects remain the most important adverse prognostic factor in chronic lymphocytic leukemia (CLL). Detection of deletion of TP53 locus (17p deletion) by fluorescent in situ hybridization (FISH) has become standard and performed prior to every
International Nuclear Information System (INIS)
Kuo, Kung-Kai; Chen, Yi-Ling; Chen, Lih-Ren; Li, Chien-Feng; Lan, Yu-Hsuan; Chang, Fang-Rong; Wu, Yang-Chang; Shiue, Yow-Ling
2011-01-01
The objective was to investigate the upstream apoptotic mechanisms that were triggered by a styrylpyrone derivative, goniothalamin (GTN), in tumor protein p53 (TP53)-positive and -negative hepatocellular carcinoma (HCC)-derived cells. Effects of GTN were evaluated by the flow cytometry, alkaline comet assay, immunocytochemistry, small-hairpin RNA interference, mitochondria/cytosol fractionation, quantitative reverse transcription-polymerase chain reaction, immunoblotting analysis and caspase 3 activity assays in two HCC-derived cell lines. Results indicated that GTN triggered phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, also known as NOXA)-mediated apoptosis via TP53-dependent and -independent pathways. In TP53-positive SK-Hep1 cells, GTN furthermore induced TP53 transcription-dependent and -independent apoptosis. After GTN treatment, accumulation of reactive oxygen species, formation of DNA double-strand breaks, transactivation of TP53 and/or PMAIP1 gene, translocation of TP53 and/or PMAIP1 proteins to mitochondria, release of cytochrome c from mitochondria, cleavage of caspases and induction of apoptosis in both cell lines were sustained. GTN might represent a novel class of anticancer drug that induces apoptosis in HCC-derived cells through PMAIP1 transactivation regardless of the status of TP53 gene. - Highlights: → Goniothalamin (GTN) induced apoptosis in hepatocellular carcinomas-derived cells. → The apoptosis induced by GTN is PMAIP1-dependent, regardless of TP53 status. → The apoptosis induced by GTN might be TP53 transcription-dependent or -independent. → GTN-induced apoptosis is mitochondria- and caspases-mediated.
Essers, P B; Klasson, T D; Pereboom, T C; Mans, D A; Nicastro, M; Boldt, K; Giles, R H; MacInnes, A W
2015-01-01
Functional loss of the von Hippel-Lindau (VHL) tumor suppressor protein (pVHL), which is part of an E3-ubiquitin ligase complex, initiates most inherited and sporadic clear-cell renal cell carcinomas (ccRCC). Genetic inactivation of the TP53 gene in ccRCC is rare, suggesting that an alternate
Hesse, Robert G; Kouklis, Gayle K; Ahituv, Nadav; Pomerantz, Jason H
2015-01-01
The control of proliferation and differentiation by tumor suppressor genes suggests that evolution of divergent tumor suppressor repertoires could influence species’ regenerative capacity. To directly test that premise, we humanized the zebrafish p53 pathway by introducing regulatory and coding sequences of the human tumor suppressor ARF into the zebrafish genome. ARF was dormant during development, in uninjured adult fins, and during wound healing, but was highly expressed in the blastema during epimorphic fin regeneration after amputation. Regenerative, but not developmental signals resulted in binding of zebrafish E2f to the human ARF promoter and activated conserved ARF-dependent Tp53 functions. The context-dependent activation of ARF did not affect growth and development but inhibited regeneration, an unexpected distinct tumor suppressor response to regenerative versus developmental environments. The antagonistic pleiotropic characteristics of ARF as both tumor and regeneration suppressor imply that inducing epimorphic regeneration clinically would require modulation of ARF –p53 axis activation. DOI: http://dx.doi.org/10.7554/eLife.07702.001 PMID:26575287
Kulasekararaj, Austin G; Smith, Alexander E; Mian, Syed A; Mohamedali, Azim M; Krishnamurthy, Pramila; Lea, Nicholas C; Gäken, Joop; Pennaneach, Coralie; Ireland, Robin; Czepulkowski, Barbara; Pomplun, Sabine; Marsh, Judith C; Mufti, Ghulam J
2013-03-01
This study aimed to determine the incidence/prognostic impact of TP53 mutation in 318 myelodysplastic syndrome (MDS) patients, and to correlate the changes to cytogenetics, single nucleotide polymorphism array karyotyping and clinical outcome. The median age was 65 years (17-89 years) and median follow-up was 45 months [95% confidence interval (CI) 27-62 months]. TP53 mutations occurred in 30 (9.4%) patients, exclusively in isolated del5q (19%) and complex karyotype (CK) with -5/5q-(72%), correlated with International Prognostic Scoring System intermediate-2/high, TP53 protein expression, higher blast count and leukaemic progression. Patients with mutant TP53 had a paucity of mutations in other genes implicated in myeloid malignancies. Median overall survival of patients with TP53 mutation was shorter than wild-type (9 versus 66 months, P disappearance of the mutant clone or emergence of new clones, suggesting an early occurrence of TP53 mutations. A reduction in mutant clone correlated with response to 5-azacitidine, however clones increased in non-responders and persisted at relapse. The adverse impact of TP53 persists after adjustment for cytogenetic risk and is of practical importance in evaluating prognosis. The relatively common occurrence of these mutations in two different prognostic spectrums of MDS, i.e. isolated 5q- and CK with -5/5q-, possibly implies two different mechanistic roles for TP53 protein. © 2013 Crown copyright. This article is published with the permission of the Controller of HMSO and the Queen's Printer for Scotland.
Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas
Directory of Open Access Journals (Sweden)
Ming-Fu eChiang
2013-03-01
Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.
International Nuclear Information System (INIS)
Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang
2006-01-01
HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties
Nongenotoxic p53 activation protects cells against S-phase-specific chemotherapy
DEFF Research Database (Denmark)
Kranz, Dominique; Dobbelstein, Matthias
2006-01-01
Mutations in the tumor suppressor gene TP53 represent the most frequent genetic difference between tumor cells and normal cells. Here, we have attempted to turn this difference into an advantage for normal cells during therapy. Using the Mdm2 antagonist nutlin-3, we first activated p53 in U2OS an...... a killer to a protector of cells, with the potential to reduce unwanted side effects of chemotherapy....
Martzoukos, Yannis; Papavlasopoulos, Sozon; Poulos, Marios; Syrrou, Maria
2017-01-01
In recent years there has been an increasingly amount of data stored in biomedical Databases due to the breakthroughs in biology and bioinformatics, biomedical information is growing exponentially making efficient information retrieval from scientist more and more challenging. New Scientific fields as Bioinformatics seem to be the tool needed to extract scientifically important data based on experimental results and information provided by papers and journals. In this paper we are going to implement a custom made IT system in order to find connections between genes in the breast cancer pathways such the BRCA1 with the electrical energy in the human brain with UGDH gene via the TP53 tumor gene. The proposed system will be able to identify the appearance of each gene ID and compare the coexistence of two genes in PubMed articles/papers. The final system could become a useful tool against the struggle of scientists and medical professionals in the near future.
High resolution melting for mutation scanning of TP53 exons 5–8
International Nuclear Information System (INIS)
Krypuy, Michael; Dobrovic, Alexander; Ahmed, Ahmed Ashour; Etemadmoghadam, Dariush; Hyland, Sarah J; Australian Ovarian Cancer Study Group; Fazio, Anna de; Fox, Stephen B; Brenton, James D; Bowtell, David D
2007-01-01
p53 is commonly inactivated by mutations in the DNA-binding domain in a wide range of cancers. As mutant p53 often influences response to therapy, effective and rapid methods to scan for mutations in TP53 are likely to be of clinical value. We therefore evaluated the use of high resolution melting (HRM) as a rapid mutation scanning tool for TP53 in tumour samples. We designed PCR amplicons for HRM mutation scanning of TP53 exons 5 to 8 and tested them with DNA from cell lines hemizygous or homozygous for known mutations. We assessed the sensitivity of each PCR amplicon using dilutions of cell line DNA in normal wild-type DNA. We then performed a blinded assessment on ovarian tumour DNA samples that had been previously sequenced for mutations in TP53 to assess the sensitivity and positive predictive value of the HRM technique. We also performed HRM analysis on breast tumour DNA samples with unknown TP53 mutation status. One cell line mutation was not readily observed when exon 5 was amplified. As exon 5 contained multiple melting domains, we divided the exon into two amplicons for further screening. Sequence changes were also introduced into some of the primers to improve the melting characteristics of the amplicon. Aberrant HRM curves indicative of TP53 mutations were observed for each of the samples in the ovarian tumour DNA panel. Comparison of the HRM results with the sequencing results revealed that each mutation was detected by HRM in the correct exon. For the breast tumour panel, we detected seven aberrant melt profiles by HRM and subsequent sequencing confirmed the presence of these and no other mutations in the predicted exons. HRM is an effective technique for simple and rapid scanning of TP53 mutations that can markedly reduce the amount of sequencing required in mutational studies of TP53
Radiosensitivity and TP 53, EGFR amplification and LOH10 analysis of primary glioma cell cultures
International Nuclear Information System (INIS)
Gerlach, B.; Harder, A.H.; Slotman, B.J.; Sminia, P.; Hulsebos, T.J.M.; Leenstra, S.; Peter Vandertop, W.; Hartmann, K.A.
2002-01-01
Aim: Determination of in-vitro radiosensitivity and genetic alterations of cell cultures derived from human glioma biopsy tissue and established glioma cell lines. Material and Methods: Fresh brain tumor specimens of six patients were processed to early passage cell cultures. In addition the cell lines D 384 and Gli 6 were used. Cell cultures were irradiated with doses from 2 to 10 Gy. Following irradiation, cell survival was determined by clonogenic assay and survival curves were generated. The surviving fractions after 2 Gy (SF2) and 4 Gy (SF4) were used as radiosensitivity parameters. Genetic analysis included determination of the mutational and loss of heterozygosity (LOH) status of TP 53 (exons 5-8), the LOH 10- and epidermal growth factor receptor gene (EGFR) amplification status. Results: The SF2 and SF4 values ranged from 0.54 to 0.88 (mean: 0.70) and from 0.13 to 0.52 (mean: 0.32), respectively. Genetic alterations were found in the Gli 6 cell line and in two primary cell cultures. The genetic profile of Gli 6 showed LOH but no TP 53 mutation, complete LOH 10 and no EGFR amplification. The VU 15 cell culture showed TP 53 mutation but no LOH 10 or EGFR amplification, while VU 24 showed incomplete LOH 10, EGFR amplification and no TP 53 mutation. In the other four cell cultures and D 384 cell line no genetic alterations were diagnosed. Histopathological classification of glioblastoma multiforme and/or genetic alterations resulted in lower radiosensitivity. Conclusion: In this small series of early passage glioma cell cultures low radiosensitivity and alterations in cell regulatory genes were seen. Further testing of biological behavior in larger series of patient-derived material is ongoing. (orig.)
Ardighieri, Laura; Mori, Luigi; Conzadori, Sara; Bugatti, Mattia; Falchetti, Marcella; Donzelli, Carla Maria; Ravaggi, Antonella; Odicino, Franco E; Facchetti, Fabio
2016-07-01
Pelvic carcinosarcomas (PCSs) are rare aggressive biphasic tumors that localize in the ovary, fallopian tube, or peritoneum and present frequently as bilateral disease. We undertook a morphological, p53 immunohistochemical and TP53 gene mutational analysis study in a single institution cohort of 16 PCSs in order to investigate the nature of bilateral tumors and to shed light on their origin and pathogenesis. Of the 16 patients, 10 presented with bilateral disease, 6 with a carcinosarcoma in both adnexa, and the remaining cases with a carcinosarcoma in one adnexum and a carcinoma in the opposite. The carcinoma component showed high-grade serous features in 13/16 of cases (81 %). In 10 patients (63 %), a serous tubal intraepithelial carcinoma (STIC) was found, in one case bilateral, making a total of 11 STICs. STIC was found only in cases with a carcinoma component with high-grade serous features. All 10 bilateral tumors and all 11 PCS-associated STICs showed a similar p53 immunostaining pattern. At mutation analysis of the TP53 gene, all five bilateral PCS contained an identical mutation in both localizations. Furthermore, a TP53 mutation was found in 8 of 10 STICs, with an identical mutation in the associated PCS. The finding of similar p53 immunostaining in all bilateral cases and identical TP53 mutations in most PCS-associated STIC provides evidence for a clonal relation between these neoplastic lesions, supporting a metastatic nature of bilateral PCS and suggesting that they have an extraovarian origin in a STIC.
Fayazfar, H; Afshar, A; Dolati, M; Dolati, A
2014-07-11
For the first time, a new platform based on electrochemical growth of Au nanoparticles on aligned multi-walled carbon nanotubes (A-MWCNT) was developed for sensitive lable-free DNA detection of the TP53 gene mutation, one of the most popular genes in cancer research. Electrochemical impedance spectroscopy (EIS) was used to monitor the sequence-specific DNA hybridization events related to TP53 gene. Compared to the bare Ta or MWCNT/Ta electrodes, the synergistic interactions of vertically aligned MWCNT array and gold nanoparticles at modified electrode could improve the density of the probe DNA attachment and resulting the sensitivity of the DNA sensor greatly. Using EIS, over the extended DNA concentration range, the change of charge transfer resistance was found to have a linear relationship in respect to the logarithm of the complementary oligonucleotides sequence concentrations in the wide range of 1.0×10(-15)-1.0×10(-7)M, with a detection limit of 1.0×10(-17)M (S/N=3). The prepared sensor also showed good stability (14 days), reproducibility (RSD=2.1%) and could be conveniently regenerated via dehybridization in hot water. The significant improvement in sensitivity illustrates that combining gold nanoparticles with the on-site fabricated aligned MWCNT array represents a promising platform for achieving sensitive biosensor for fast mutation screening related to most human cancer types. Copyright © 2014. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Tierney, L.A.; Johnson, N.F.; Lechner, J.F.
1994-01-01
Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins
TP53 and ATM mRNA expression in skin and skeletal muscle after low-level laser exposure.
Guedes de Almeida, Luciana; Sergio, Luiz Philippe da Silva; de Paoli, Flavia; Mencalha, Andre Luiz; da Fonseca, Adenilson de Souza
2017-08-01
Low-level lasers are widespread in regenerative medicine, but the molecular mechanisms involved in their biological effects are not fully understood, particularly those on DNA stability. Therefore, this study aimed to investigate mRNA expression of genes related to DNA genomic stability in skin and skeletal muscle tissue from Wistar rats exposed to low-level red and infrared lasers. For this, TP53 (Tumor Protein 53) and ATM (Ataxia Telangiectasia Mutated gene) mRNA expressions were evaluated by real-time quantitative PCR (RT-qPCR) technique 24 hours after low-level red and infrared laser exposure. Our data showed that relative TP53 mRNA expression was not significantly altered in both tissues exposed to lasers. For ATM, relative mRNA expression in skin tissue was not significantly altered, but in muscle tissue, laser exposure increased relative ATM mRNA expression. Low-level red and infrared laser radiations alter ATM mRNA expression related to DNA stability in skeletal muscle tissue.
Overexpressed TP73 induces apoptosis in medulloblastoma
International Nuclear Information System (INIS)
Castellino, Robert C; De Bortoli, Massimiliano; Lin, Linda L; Skapura, Darlene G; Rajan, Jessen A; Adesina, Adekunle M; Perlaky, Laszlo; Irwin, Meredith S; Kim, John YH
2007-01-01
Medulloblastoma is the most common malignant brain tumor of childhood. Children who relapse usually die of their disease, which reflects resistance to radiation and/or chemotherapy. Improvements in outcome require a better understanding of the molecular basis of medulloblastoma growth and treatment response. TP73 is a member of the TP53 tumor suppressor gene family that has been found to be overexpressed in a variety of tumors and mediates apoptotic responses to genotoxic stress. In this study, we assessed expression of TP73 RNA species in patient tumor specimens and in medulloblastoma cell lines, and manipulated expression of full-length TAp73 and amino-terminal truncated ΔNp73 to assess their effects on growth. We analyzed medulloblastoma samples from thirty-four pediatric patients and the established medulloblastoma cell lines, Daoy and D283MED, for expression of TP73 RNA including the full-length transcript and the 5'-terminal variants that encode the ΔNp73 isoform, as well as TP53 RNA using quantitative real time-RTPCR. Protein expression of TAp73 and ΔNp73 was quantitated with immunoblotting methods. Clinical outcome was analyzed based on TP73 RNA and p53 protein expression. To determine effects of overexpression or knock-down of TAp73 and ΔNp73 on cell cycle and apoptosis, we analyzed transiently transfected medulloblastoma cell lines with flow cytometric and TUNEL methods. Patient medulloblastoma samples and cell lines expressed full-length and 5'-terminal variant TP73 RNA species in 100-fold excess compared to non-neoplastic brain controls. Western immunoblot analysis confirmed their elevated levels of TAp73 and amino-terminal truncated ΔNp73 proteins. Kaplan-Meier analysis revealed trends toward favorable overall and progression-free survival of patients whose tumors display TAp73 RNA overexpression. Overexpression of TAp73 or ΔNp73 induced apoptosis under basal growth conditions in vitro and sensitized them to cell death in response to
Overexpressed TP73 induces apoptosis in medulloblastoma
Directory of Open Access Journals (Sweden)
Perlaky Laszlo
2007-07-01
Full Text Available Abstract Background Medulloblastoma is the most common malignant brain tumor of childhood. Children who relapse usually die of their disease, which reflects resistance to radiation and/or chemotherapy. Improvements in outcome require a better understanding of the molecular basis of medulloblastoma growth and treatment response. TP73 is a member of the TP53 tumor suppressor gene family that has been found to be overexpressed in a variety of tumors and mediates apoptotic responses to genotoxic stress. In this study, we assessed expression of TP73 RNA species in patient tumor specimens and in medulloblastoma cell lines, and manipulated expression of full-length TAp73 and amino-terminal truncated ΔNp73 to assess their effects on growth. Methods We analyzed medulloblastoma samples from thirty-four pediatric patients and the established medulloblastoma cell lines, Daoy and D283MED, for expression of TP73 RNA including the full-length transcript and the 5'-terminal variants that encode the ΔNp73 isoform, as well as TP53 RNA using quantitative real time-RTPCR. Protein expression of TAp73 and ΔNp73 was quantitated with immunoblotting methods. Clinical outcome was analyzed based on TP73 RNA and p53 protein expression. To determine effects of overexpression or knock-down of TAp73 and ΔNp73 on cell cycle and apoptosis, we analyzed transiently transfected medulloblastoma cell lines with flow cytometric and TUNEL methods. Results Patient medulloblastoma samples and cell lines expressed full-length and 5'-terminal variant TP73 RNA species in 100-fold excess compared to non-neoplastic brain controls. Western immunoblot analysis confirmed their elevated levels of TAp73 and amino-terminal truncated ΔNp73 proteins. Kaplan-Meier analysis revealed trends toward favorable overall and progression-free survival of patients whose tumors display TAp73 RNA overexpression. Overexpression of TAp73 or ΔNp73 induced apoptosis under basal growth conditions in vitro and
Bladder-like graphical representation of p53 gene alterations in some human cancers
International Nuclear Information System (INIS)
Helal, N.L.; Dorrah, M.; LI, C.
2005-01-01
the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer
Directory of Open Access Journals (Sweden)
Luke A. Wiley
2011-07-01
We previously found that lenses lacking the Acvr1 gene, which encodes a bone morphogenetic protein (BMP receptor, had abnormal proliferation and cell death in epithelial and cortical fiber cells. We tested whether the tumor suppressor protein p53 (encoded by Trp53 affected this phenotype. Acvr1 conditional knockout (Acvr1CKO mouse fiber cells had increased numbers of nuclei that stained for p53 phosphorylated on serine 15, an indicator of p53 stabilization and activation. Deletion of Trp53 rescued the Acvr1CKO cell death phenotype in embryos and reduced Acvr1-dependent apoptosis in postnatal lenses. However, deletion of Trp53 alone increased the number of fiber cells that failed to withdraw from the cell cycle. Trp53CKO and Acvr1;Trp53DCKO (double conditional knockout, but not Acvr1CKO, lenses developed abnormal collections of cells at the posterior of the lens that resembled posterior subcapsular cataracts. Cells from human posterior subcapsular cataracts had morphological and molecular characteristics similar to the cells at the posterior of mouse lenses lacking Trp53. In Trp53CKO lenses, cells in the posterior plaques did not proliferate but, in Acvr1;Trp53DCKO lenses, many cells in the posterior plaques continued to proliferate, eventually forming vascularized tumor-like masses at the posterior of the lens. We conclude that p53 protects the lens against posterior subcapsular cataract formation by suppressing the proliferation of fiber cells and promoting the death of any fiber cells that enter the cell cycle. Acvr1 acts as a tumor suppressor in the lens. Enhancing p53 function in the lens could contribute to the prevention of steroid- and radiation-induced posterior subcapsular cataracts.
Chemical Variations on the p53 Reactivation Theme
Directory of Open Access Journals (Sweden)
Carlos J. A. Ribeiro
2016-05-01
Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.
Czech Academy of Sciences Publication Activity Database
Suchánková, Jana; Legartová, Soňa; Růčková, E.; Vojtešek, B.; Kozubek, Stanislav; Bártová, Eva
2017-01-01
Roč. 148, č. 3 (2017), s. 239-255 ISSN 0948-6143 R&D Projects: GA ČR GBP302/12/G157; GA MŠk 7F14369 Institutional support: RVO:68081707 Keywords : p53 tumor-suppressor * double-strand breaks * nuclear topography Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Cell biology Impact factor: 2.553, year: 2016
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
International Nuclear Information System (INIS)
Ohnishi, Takeo
1997-01-01
I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)
International Nuclear Information System (INIS)
Shinohara, Asano; Sakano, Shigeru; Hinoda, Yuji; Nishijima, Jun; Kawai, Yoshihisa; Misumi, Taku; Nagao, Kazuhiro; Hara, Takahiko; Matsuyama, Hideyasu
2009-01-01
Platinum-based chemoradiotherapy (CRT) as bladder conservation therapy has shown promising results for muscle-invasive bladder cancer. However, CRT might diminish survival as a result of the delay in cystectomy for some patients with non-responding bladder tumors. Because the p53 tumor suppression pathway, including its MDM2 counterpart, is important in chemotherapy- and radiotherapy-associated effects, functional polymorphisms in the TP53 and MDM2 genes could influence the response to treatment and the prognosis following CRT. We investigated associations between two such polymorphisms, and p53 overexpression, and response or survival in bladder cancer patients treated with CRT. The study group comprised 96 patients who underwent CRT for transitional cell carcinoma of the bladder. Single nucleotide polymorphisms (SNPs) in TP53 (codon 72, arginine>proline) and MDM2 (SNP3O9, T>G) were genotyped using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP), and nuclear expression levels of p53 were examined using immunohistochemistry. None of the genotypes or p53 overexpression was significantly associated with response to CRT. However, patients with MDM2 T/G+G/G genotypes had improved cancer-specific survival rates after CRT (P=0.009). In multivariate analysis, the MDM2 T/G+G/G genotypes, and more than two of total variant alleles in TP53 and MDM2, were independently associated with improved cancer-specific survival (P=0.031 and P=0.015, respectively). In addition, MDM2 genotypes were significantly associated with cystectomy-free survival (P=0.030). These results suggest that the TP53 and MDM2 genotypes might be useful prognostic factors following CRT in bladder cancer, helping patient selection for bladder conservation therapy. (author)
Directory of Open Access Journals (Sweden)
Markowska Janina
2008-01-01
Full Text Available Abstract Background Taxane-platinum therapy (TP has replaced platinum-based therapy (PC or PAC, DNA damaging chemotherapy in the postoperative treatment of ovarian cancer patients; however, it is not always effective. TP53 protein plays a differential role in response to DNA-damaging agents and taxanes. We sought to define profiles of patients who benefit the most from TP and also of those who can be treated with PC. Methods We compared the effectiveness of PC/PAC (n = 253 and TP (n = 199 with respect to tumor TP53 accumulation in ovarian cancer patients with FIGO stage IIB-IV disease; this was a non-randomized retrospective study. Immunohistochemical analysis was performed on 452 archival tumors; univariate and multivariate analysis by the Cox's and logistic regression models was performed in all patients and in subgroups with [TP53(+] and without TP53 accumulation [TP53(-]. Results The advantage of taxane-platinum therapy over platinum-based therapy was seen in the TP53(+, and not in the TP53(- group. In the TP53(+ group taxane-platinum therapy enhanced the probability of complete remission (p = .018, platinum sensitivity (p = .014, platinum highly sensitive response (p = .038 and longer survival (OS, p = .008. Poor tumor differentiation diminished the advantage from taxane-platinum therapy in the TP53(+ group. In the TP53(- group PC/PAC was at least equally efficient as taxane-platinum therapy and it enhanced the chance of platinum highly sensitive response (p = .010. However, in the TP53(- group taxane-platinum therapy possibly diminished the risk of death in patients over 53 yrs (p = .077. Among factors that positively interacted with taxane-platinum therapy in some analyses were endometrioid and clear cell type, FIGO III stage, bulky residual tumor, more advanced age of patient and moderate tumor differentiation. Conclusion Our results suggest that taxane-platinum therapy is particularly justified in patients with TP53(+ tumors or older
Arnhold, Viktor; Schmelz, Karin; Proba, Jutta; Winkler, Annika; Wünschel, Jasmin; Toedling, Joern; Deubzer, Hedwig E.; Künkele, Annette; Eggert, Angelika; Schulte, Johannes H.; Hundsdoerfer, Patrick
2018-01-01
Fewer than 50% of patients with high-risk neuroblastoma survive five years after diagnosis with current treatment protocols. Molecular targeted therapies are expected to improve survival. Although MDM2 has been validated as a promising target in preclinical models, no MDM2 inhibitors have yet entered clinical trials for neuroblastoma patients. Toxic side effects, poor bioavailability and low efficacy of the available MDM2 inhibitors that have entered phase I/II trials drive the development of novel MDM2 inhibitors with an improved risk-benefit profile. We investigated the effect of the novel MDM2 small molecular inhibitor, DS-3032b, on viability, proliferation, senescence, migration, cell cycle arrest and apoptosis in a panel of six neuroblastoma cell lines with different TP53 and MYCN genetic backgrounds, and assessed efficacy in a murine subcutaneous model for high-risk neuroblastoma. Re-analysis of existing expression data from 476 primary neuroblastomas showed that high-level MDM2 expression correlated with poor patient survival. DS-3032b treatment enhanced TP53 target gene expression and induced G1 cell cycle arrest, senescence and apoptosis. CRISPR-mediated MDM2 knockout in neuroblastoma cells mimicked DS-3032b treatment. TP53 signaling was selectively activated by DS-3032b in neuroblastoma cells with wildtype TP53, regardless of the presence of MYCN amplification, but was significantly reduced by TP53 mutations or expression of a dominant-negative TP53 mutant. Oral DS-3032b administration inhibited xenograft tumor growth and prolonged mouse survival. Our in vitro and in vivo data demonstrate that DS-3032b reactivates TP53 signaling even in the presence of MYCN amplification in neuroblastoma cells, to reduce proliferative capacity and cause cytotoxicity. PMID:29416773
Sex reversal in zebrafish fancl mutants is caused by Tp53-mediated germ cell apoptosis.
Directory of Open Access Journals (Sweden)
Adriana Rodríguez-Marí
2010-07-01
Full Text Available The molecular genetic mechanisms of sex determination are not known for most vertebrates, including zebrafish. We identified a mutation in the zebrafish fancl gene that causes homozygous mutants to develop as fertile males due to female-to-male sex reversal. Fancl is a member of the Fanconi Anemia/BRCA DNA repair pathway. Experiments showed that zebrafish fancl was expressed in developing germ cells in bipotential gonads at the critical time of sexual fate determination. Caspase-3 immunoassays revealed increased germ cell apoptosis in fancl mutants that compromised oocyte survival. In the absence of oocytes surviving through meiosis, somatic cells of mutant gonads did not maintain expression of the ovary gene cyp19a1a and did not down-regulate expression of the early testis gene amh; consequently, gonads masculinized and became testes. Remarkably, results showed that the introduction of a tp53 (p53 mutation into fancl mutants rescued the sex-reversal phenotype by reducing germ cell apoptosis and, thus, allowed fancl mutants to become fertile females. Our results show that Fancl function is not essential for spermatogonia and oogonia to become sperm or mature oocytes, but instead suggest that Fancl function is involved in the survival of developing oocytes through meiosis. This work reveals that Tp53-mediated germ cell apoptosis induces sex reversal after the mutation of a DNA-repair pathway gene by compromising the survival of oocytes and suggests the existence of an oocyte-derived signal that biases gonad fate towards the female developmental pathway and thereby controls zebrafish sex determination.
DEFF Research Database (Denmark)
Farooqui, Mohammed Z H; Valdez, Janet; Martyr, Sabrina
2015-01-01
BACKGROUND: Patients with chronic lymphocytic leukaemia (CLL) with TP53 aberrations respond poorly to first-line chemoimmunotherapy, resulting in early relapse and short survival. We investigated the safety and activity of ibrutinib in previously untreated and relapsed or refractory CLL with TP53...... aberrations. METHODS: In this investigator-initiated, single-arm phase 2 study, we enrolled eligible adult patients with active CLL with TP53 aberrations at the National Institutes of Health Clinical Center (Bethesda, MD, USA). Patients received 28-day cycles of ibrutinib 420 mg orally once daily until...... in one (2%) patient. INTERPRETATION: The activity and safety profile of single-agent ibrutinib in CLL with TP53 aberrations is encouraging and supports its consideration as a novel treatment option for patients with this high-risk disease in both first-line and second-line settings. FUNDING: Intramural...
Tumor suppressors: enhancers or suppressors of regeneration?
Pomerantz, Jason H.; Blau, Helen M.
2013-01-01
Tumor suppressors are so named because cancers occur in their absence, but these genes also have important functions in development, metabolism and tissue homeostasis. Here, we discuss known and potential functions of tumor suppressor genes during tissue regeneration, focusing on the evolutionarily conserved tumor suppressors pRb1, p53, Pten and Hippo. We propose that their activity is essential for tissue regeneration. This is in contrast to suggestions that tumor suppression is a trade-off for regenerative capacity. We also hypothesize that certain aspects of tumor suppressor pathways inhibit regenerative processes in mammals, and that transient targeted modification of these pathways could be fruitfully exploited to enhance processes that are important to regenerative medicine. PMID:23715544
Molecular biology III - Oncogenes and tumor suppressor genes
International Nuclear Information System (INIS)
Giaccia, Amato J.
1996-01-01
Purpose: The purpose of this course is to introduce to radiation oncologists the basic concepts of tumorigenesis, building on the information that will be presented in the first and second part of this series of lectures. Objective: Our objective is to increase the current understanding of radiation oncologists with the process of tumorigenesis, especially focusing on genes that are altered in many tumor types that are potential candidates for novel molecular strategies. As strategies to treat cancer of cancer are becoming more sophisticated, it will be important for both the practitioner and academician to develop a basic understanding of the function of cancer 'genes'. This will be the third in a series of refresher courses that are meant to address recent advances in Cancer Biology in a way that both clinicians without previous knowledge of molecular biology or experienced researchers will find interesting. The lecture will begin with a basic overview of tumorigenesis; methods of detecting chromosome/DNA alterations, approaches used to isolate oncogenes and tumor suppressor genes, and their role in cell killing by apoptosis. Special attention will be given to oncogenes and tumor suppressor genes that are modulated by ionizing radiation and the tumor microenvironment. We will relate the biology of oncogenes and tumor suppressor genes to basic aspects of radiation biology that would be important in clinical practice. Finally, we will review recent studies on the prognostic significance of p53 mutations and apoptosis in tumor specimens. The main point of this lecture is to relate both researcher and clinician what are the therapeutic ramifications of oncogene and tumor suppressor gene mutations found in human neoptasia
Diffuse large B-cell lymphoma with combined TP53 mutation and MIR34A> methylation
DEFF Research Database (Denmark)
Asmar, Fazila; Hother, Christoffer; Kulosman, Gorjan
2014-01-01
and MIR34A methylation ("double hit") and these patients have an exceedingly poor prognosis with a median survival of 9.4 months (Phit") influence on survival. The TP53/MIR34A "double-hit" is an independent...... negative prognostic factor for survival (P=0.0002). In 2 DLBCL-cell lines with both TP53 mutation and promoter methylation of MIR34A, miR34A-5p is upregulated by 5-aza-2'deoxycytidine. Thus, the TP53/MIR34A "double hit" characterizes a very aggressive subgroup of DLBCL, which may be treatable...
Munne, Pauliina M.; Gu, Yuexi; Tumiati, Manuela; Gao, Ping; Koopal, Sonja; Uusivirta, Sanna; Sawicki, Janet; Wei, Gong-Hong; Kuznetsov, Sergey G.
2014-04-01
Multiple observations suggest a cell type-specific role for TP53 in mammary epithelia. We developed an in vitro assay, in which primary mouse mammary epithelial cells (mMECs) progressed from lumenal to basal-like phenotypes based on expression of Krt18 or ΔNp63, respectively. Such transition was markedly delayed in Trp53-/- mMECs suggesting that Trp53 is required for specification of the basal, but not lumenal cells. Evidence from human basal-like cell lines suggests that TP53 may support the activity of ΔNp63 by preventing its translocation from nucleoplasm into nucleoli. In human lumenal cells, activation of TP53 by inhibiting MDM2 or BRCA1 restored the nucleoplasmic expression of ΔNp63. Trp53-/- mMECs eventually lost epithelial features resulting in upregulation of MDM2 and translocation of ΔNp63 into nucleoli. We propose that TP63 may contribute to TP53-mediated oncogenic transformation of epithelial cells and shed light on tissue- and cell type-specific biases observed for TP53-related cancers.
Directory of Open Access Journals (Sweden)
Alicja Sznarkowska
2010-08-01
Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.
A meta-analysis of the relationship between FGFR3 and TP53 mutations in bladder cancer.
Neuzillet, Yann; Paoletti, Xavier; Ouerhani, Slah; Mongiat-Artus, Pierre; Soliman, Hany; de The, Hugues; Sibony, Mathilde; Denoux, Yves; Molinie, Vincent; Herault, Aurélie; Lepage, May-Linda; Maille, Pascale; Renou, Audrey; Vordos, Dimitri; Abbou, Claude-Clément; Bakkar, Ashraf; Asselain, Bernard; Kourda, Nadia; El Gaaied, Amel; Leroy, Karen; Laplanche, Agnès; Benhamou, Simone; Lebret, Thierry; Allory, Yves; Radvanyi, François
2012-01-01
TP53 and FGFR3 mutations are the most common mutations in bladder cancers. FGFR3 mutations are most frequent in low-grade low-stage tumours, whereas TP53 mutations are most frequent in high-grade high-stage tumours. Several studies have reported FGFR3 and TP53 mutations to be mutually exclusive events, whereas others have reported them to be independent. We carried out a meta-analysis of published findings for FGFR3 and TP53 mutations in bladder cancer (535 tumours, 6 publications) and additional unpublished data for 382 tumours. TP53 and FGFR3 mutations were not independent events for all tumours considered together (OR = 0.25 [0.18-0.37], p = 0.0001) or for pT1 tumours alone (OR = 0.47 [0.28-0.79], p = 0.0009). However, if the analysis was restricted to pTa tumours or to muscle-invasive tumours alone, FGFR3 and TP53 mutations were independent events (OR = 0.56 [0.23-1.36] (p = 0.12) and OR = 0.99 [0.37-2.7] (p = 0.35), respectively). After stratification of the tumours by stage and grade, no dependence was detected in the five tumour groups considered (pTaG1 and pTaG2 together, pTaG3, pT1G2, pT1G3, pT2-4). These differences in findings can be attributed to the putative existence of two different pathways of tumour progression in bladder cancer: the CIS pathway, in which FGFR3 mutations are rare, and the Ta pathway, in which FGFR3 mutations are frequent. TP53 mutations occur at the earliest stage of the CIS pathway, whereas they occur would much later in the Ta pathway, at the T1G3 or muscle-invasive stage.
Fetal colon cell line FHC exhibits tumorigenic phenotype, complex karyotype, and TP53 gene mutation
Czech Academy of Sciences Publication Activity Database
Souček, Karel; Jirsová, Pavla; Brázdová, Marie; Hýžďalová, Martina; Kočí, Lenka; Vydra, D.; Trojanec, R.; Pernicová, Zuzana; Lentvorská, L.; Hajdúch, M.; Hofmanová, Jiřina; Kozubík, Alois
2010-01-01
Roč. 197, č. 2 (2010), s. 107-116 ISSN 0165-4608 R&D Projects: GA MŠk ME 919; GA ČR(CZ) GA204/07/0834; GA ČR(CZ) GA204/08/1560; GA AV ČR(CZ) 1QS500040507; GA MZd NS9600 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : colon epithelial cells * TP53 * MYC Subject RIV: BO - Biophysics Impact factor: 1.551, year: 2010
International Nuclear Information System (INIS)
Li, Yanli; Su, Jia; Cai, Lin; Yu, Shunzhang; Zhang, Zuo-Feng; Mu, Lina; Chang, Shen-Chih; Niu, Rungui; Liu, Li; Crabtree-Ide, Christina R; Zhao, Baoxing; Shi, Jianping; Han, Xiaoyou; Li, Jiawei
2013-01-01
A pathway-based genotyping analysis suggested rs2078486 was a novel TP53 SNP, but very few studies replicate this association. TP53 rs1042522 is the most commonly studied SNP, but very few studies examined its potential interaction with environmental factors in relation to lung cancer risk. This study aims to examine associations between two TP53 single-nucleotide polymorphisms (SNPs) (rs2078486, rs1042522), their potential interaction with environmental factors and risk of lung cancer. A case–control study was conducted in Taiyuan, China. Unconditional logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (95% CIs). Multiplicative and additive interactions between TP53 SNPs and lifestyle factors were evaluated. Variant TP53 rs2078486 SNP was significantly associated with elevated lung cancer risk among smokers (OR: 1.70, 95% CI: 1.08 - 2.67) and individuals with high indoor air pollution exposure (OR: 1.51, 95% CI: 1.00-2.30). Significant or borderline significant multiplicative and additive interactions were found between TP53 rs2078486 polymorphism with smoking and indoor air pollution exposure. The variant genotype of TP53 SNP rs1042522 significantly increased lung cancer risk in the total population (OR: 1.57, 95% CI: 1.11-2.21), but there was no evidence of heterogeneity among individuals with different lifestyle factors. This study confirmed that TP53 rs2078486 SNP is potentially a novel TP53 SNP that may affect lung cancer risk. Our study also suggested potential synergetic effects of TP53 rs2078486 SNP with smoking and indoor air pollution exposure on lung cancer risk
Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres
International Nuclear Information System (INIS)
Ji, Qing; Hao, Xinbao; Meng, Yang; Zhang, Min; DeSano, Jeffrey; Fan, Daiming; Xu, Liang
2008-01-01
MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be
Extremely high Tp53 mutation load in esophageal squamous cell carcinoma in Golestan Province, Iran.
Directory of Open Access Journals (Sweden)
Behnoush Abedi-Ardekani
Full Text Available BACKGROUND: Golestan Province in northeastern Iran has one of the highest incidences of esophageal squamous cell carcinoma (ESCC in the world with rates over 50 per 100,000 person-years in both sexes. We have analyzed TP53 mutation patterns in tumors from this high-risk geographic area in search of clues to the mutagenic processes involved in causing ESCC. METHODOLOGY/PRINCIPAL FINDINGS: Biopsies of 119 confirmed ESCC tumor tissue from subjects enrolled in a case-control study conducted in Golestan Province were analyzed by direct sequencing of TP53 exons 2 through 11. Immunohistochemical staining for p53 was carried out using two monoclonal antibodies, DO7 and 1801. A total of 120 TP53 mutations were detected in 107/119 cases (89.9%, including 11 patients with double or triple mutations. The mutation pattern was heterogeneous with infrequent mutations at common TP53 "hotspots" but frequent transversions potentially attributable to environmental carcinogens forming bulky DNA adducts, including 40% at bases known as site of mutagenesis by polycyclic aromatic hydrocarbons (PAHs. Mutations showed different patterns according to the reported temperature of tea consumption, but no variation was observed in relation to ethnicity, tobacco or opium use, and alcoholic beverage consumption or urban versus rural residence. CONCLUSION/SIGNIFICANCE: ESCC tumors in people from Golestan Province show the highest rate of TP53 mutations ever reported in any cancer anywhere. The heterogeneous mutation pattern is highly suggestive of a causative role for multiple environmental carcinogens, including PAHs. The temperature and composition of tea may also influence mutagenesis.
A meta-analysis of the relationship between FGFR3 and TP53 mutations in bladder cancer.
Directory of Open Access Journals (Sweden)
Yann Neuzillet
Full Text Available TP53 and FGFR3 mutations are the most common mutations in bladder cancers. FGFR3 mutations are most frequent in low-grade low-stage tumours, whereas TP53 mutations are most frequent in high-grade high-stage tumours. Several studies have reported FGFR3 and TP53 mutations to be mutually exclusive events, whereas others have reported them to be independent. We carried out a meta-analysis of published findings for FGFR3 and TP53 mutations in bladder cancer (535 tumours, 6 publications and additional unpublished data for 382 tumours. TP53 and FGFR3 mutations were not independent events for all tumours considered together (OR = 0.25 [0.18-0.37], p = 0.0001 or for pT1 tumours alone (OR = 0.47 [0.28-0.79], p = 0.0009. However, if the analysis was restricted to pTa tumours or to muscle-invasive tumours alone, FGFR3 and TP53 mutations were independent events (OR = 0.56 [0.23-1.36] (p = 0.12 and OR = 0.99 [0.37-2.7] (p = 0.35, respectively. After stratification of the tumours by stage and grade, no dependence was detected in the five tumour groups considered (pTaG1 and pTaG2 together, pTaG3, pT1G2, pT1G3, pT2-4. These differences in findings can be attributed to the putative existence of two different pathways of tumour progression in bladder cancer: the CIS pathway, in which FGFR3 mutations are rare, and the Ta pathway, in which FGFR3 mutations are frequent. TP53 mutations occur at the earliest stage of the CIS pathway, whereas they occur would much later in the Ta pathway, at the T1G3 or muscle-invasive stage.
Directory of Open Access Journals (Sweden)
Zhen Wang
Full Text Available To investigate the clinicopathological characteristics, human papillomavirus (HPV infection, p53 expression, and TP53 mutations in oropharyngeal squamous cell carcinoma (OPSCC and determine their utility as prognostic predictors in a primarily eastern Chinese population.The HPV infection status was tested via p16INK4A immunohistochemistry and validated using PCR, reverse blot hybridization and in situ hybridization (ISH in 188 OPSCC samples. p53 expression levels and TP53 gene mutations were assessed through immunohistochemistry and sequencing, respectively. Clinicopathological characteristics and follow-up information were collected. Overall survival was estimated using the Log-rank test.Overall, 22 of the 188 OPSCC samples were associated with HPV infection. HPV16 was identified in all 22 samples, whereas no samples were positive for HPV18. All 22 HPV-associated OPSCC samples were p53 negative and lacked TP53 mutations. HPV16 positivity, female patients, non-smokers, and patients with histological grade I and stage N0 diseases showed better overall survival (p = 0.009, 0.003, 0.048, 0.009, and 0.004, respectively. No significant differences in overall survival between smoking and non-smoking patients were observed in the HPV-associated OPSCC group. Patients without mutations in TP53 exons 5-8 had better prognoses (p = 0.031 among the 43 sequenced specimens. Multivariate analysis indicated that HPV16 infection status (p = 0.011, histological grade (p = 0.017, and N stage (p = 0.019 were independent prognostic factors for patients with OPSCC.Distinct from the situation in Europe and America, for the patients with OPSCC in this study, HPV16 infection was relatively low, although it was still the most important independent prognostic predictor for the disease. In addition to the high smoking and drinking rate in this population, HPV16 infection and TP53 dysfunction appear to be two distinct pathogens for OPSCC patients in the eastern Chinese
Wang, Zhen; Xia, Rong-Hui; Ye, Dong-Xia; Li, Jiang
2016-01-01
To investigate the clinicopathological characteristics, human papillomavirus (HPV) infection, p53 expression, and TP53 mutations in oropharyngeal squamous cell carcinoma (OPSCC) and determine their utility as prognostic predictors in a primarily eastern Chinese population. The HPV infection status was tested via p16INK4A immunohistochemistry and validated using PCR, reverse blot hybridization and in situ hybridization (ISH) in 188 OPSCC samples. p53 expression levels and TP53 gene mutations were assessed through immunohistochemistry and sequencing, respectively. Clinicopathological characteristics and follow-up information were collected. Overall survival was estimated using the Log-rank test. Overall, 22 of the 188 OPSCC samples were associated with HPV infection. HPV16 was identified in all 22 samples, whereas no samples were positive for HPV18. All 22 HPV-associated OPSCC samples were p53 negative and lacked TP53 mutations. HPV16 positivity, female patients, non-smokers, and patients with histological grade I and stage N0 diseases showed better overall survival (p = 0.009, 0.003, 0.048, 0.009, and 0.004, respectively). No significant differences in overall survival between smoking and non-smoking patients were observed in the HPV-associated OPSCC group. Patients without mutations in TP53 exons 5-8 had better prognoses (p = 0.031) among the 43 sequenced specimens. Multivariate analysis indicated that HPV16 infection status (p = 0.011), histological grade (p = 0.017), and N stage (p = 0.019) were independent prognostic factors for patients with OPSCC. Distinct from the situation in Europe and America, for the patients with OPSCC in this study, HPV16 infection was relatively low, although it was still the most important independent prognostic predictor for the disease. In addition to the high smoking and drinking rate in this population, HPV16 infection and TP53 dysfunction appear to be two distinct pathogens for OPSCC patients in the eastern Chinese population.
Directory of Open Access Journals (Sweden)
Andrzej Wincewicz
2017-02-01
Full Text Available Here we review prognostic and predictive aspects of mutated TP53 in Wilms’ tumor biology on the basis of the morphological report and molecular analysis of adult nephroblastoma (diffuse blastemal pattern of a 37-year-old man. Among quite different proteins, TP53 affects expression of several genes such as hypoxia inducible proteins GLUT1 and EPO as well as multidrug resistance (MDR mediated by P-glycoprotein (Pgp/MDR1 and multidrug-resistant related protein (MRP1, with certain clinical implications. TP53 mutation was found both in our primary tumor (c.746G>T p.R249M frequency 92% and in nodal metastasis (c.746G>T p.R249M frequency 90%, and the common polymorphism p.P72R in the same gene was revealed with frequency of about 97% in both primary tumor and metastatic disease with appliance of NGS technology (IonTorrent – LifeTechnology using Ion AmpliSeq Cancer Hotspot Panel v2.
Svobodova, Karla; Zemanova, Zuzana; Lhotska, Halka; Novakova, Milena; Podskalska, Lucie; Belickova, Monika; Brezinova, Jana; Sarova, Iveta; Izakova, Silvia; Lizcova, Libuse; Berkova, Adela; Siskova, Magda; Jonasova, Anna; Cermak, Jaroslav; Michalova, Kyra
2016-03-01
Complex karyotypes are seen in approximately 20% of patients with myelodysplastic syndromes (MDS) and are associated with a high risk of transformation to acute myeloid leukemia and poor outcomes in patients. Copy number neutral loss of heterozygosity (CN-LOH, i.e., both copies of a chromosomal pair or their parts originate from one parent) might contribute to increased genomic instability in the bone-marrow cells of patients with MDS. The pathological potential of CN-LOH, which arises as a clonal aberration in a proportion of somatic cells, consists of tumor suppressor gene and oncogene homozygous mutations. The aim of our study was to evaluate the frequency of CN-LOH at 17p in bone-marrow cells of newly diagnosed MDS patients with complex chromosomal aberrations and to assess its correlation with mutations in the TP53 gene (17p13.1). CN-LOH was detected in 40 chromosomal regions in 21 (29%) of 72 patients analyzed. The changes in 27 of the 40 regions identified were sporadic. The most common finding was CN-LOH of the short arm of chromosome 17, which was detected in 13 (18%) of 72 patients. A mutational analysis confirmed the homozygous mutation of TP53 in all CN-LOH 17p patients, among which two frameshift mutations are not registered in the International Agency for Research on Cancer TP53 Database. CN-LOH 17p correlated with aggressive disease (median overall survival 4 months) and was strongly associated with a complex karyotype in the cohort studied, which might cause rapid disease progression in high-risk MDS. No other CN-LOH region previously recorded in MDS or AML patients (1p, 4q, 7q, 11q, 13q, 19q, 21q) was detected in our cohort of patients with complex karyotype examined at the diagnosis of MDS. The LOH region appeared to be balanced (i.e., with no DNA copy number change) when examined with conventional and molecular cytogenetic methods. Therefore, a microarray that detects single-nucleotide polymorphisms is an ideal method with which to identify and
International Nuclear Information System (INIS)
Godai, Ten-i; Sakuma, Yuji; Tsuchiya, Eiju; Kameda, Yoichi; Akaike, Makoto; Miyagi, Yohei; Suda, Tetsuji; Sugano, Nobuhiro; Tsuchida, Kazuhito; Shiozawa, Manabu; Sekiguchi, Hironobu; Sekiyama, Akiko; Yoshihara, Mitsuyo; Matsukuma, Shoichi
2009-01-01
Although postoperative chemotherapy is widely accepted as the standard modality for Dukes' stage C or earlier stage colorectal cancer (CRC) patients, biomarkers to predict those who may benefit from the therapy have not been identified. Previous in vitro and clinical investigations reported that CRC patients with wild-type p53 gene (TP53)-tumors benefit from 5-fluorouracil (5-FU) based chemotherapy, while those with mutated TP53-tumors do not. However, these studies evaluated the mutation-status of TP53 by immunohistochemistry with or without single-strand conformation polymorphism, and the mutation frequency was different from study to study. In addition, the polymorphic status at p53 codon 72, which results in arginine or proline residues (R72P) and is thought to influence the function of the protein significantly, was not examined. To evaluate the significance of the TP53 mutation as a molecular marker to predict the prognosis of CRC patients, especially those who received postoperative chemotherapy, we examined the mutation by direct sequencing from fresh CRC tumors and evaluated the R72P polymorphism of the mutated TP53 by a combined mutant allele- and polymorphic allele-specific polymerase chain reaction (PCR). The TP53 mutation occurred in 147 (70%) of 211 Japanese CRC tumors. The mutation was observed in 93 (63%) tumors on the R72 allele and in 54 (37%) tumors on the P72 allele. Although the alterations to TP53 have no prognostic significance for CRC patients overall, we found that Dukes' stage C CRC patients who did not receive postoperative chemotherapy and carried the mutated TP53-R72 showed significantly longer survival times than those with the mutated TP53-P72 when evaluated by overall survival (p = 0.012). Using a combined mutant allele- and polymorphic allele-specific PCR, we defined the codon 72 polymorphic status of the TP53 mutated allele in Japanese CRC patients. We raised a possibility that Dukes' stage C colorectal cancer
The Neuronal Ischemic Tolerance Is Conditioned by the Tp53 Arg72Pro Polymorphism.
Ramos-Araque, Maria E; Rodriguez, Cristina; Vecino, Rebeca; Cortijo Garcia, Elisa; de Lera Alfonso, Mercedes; Sanchez Barba, Mercedes; Colàs-Campàs, Laura; Purroy, Francisco; Arenillas, Juan F; Almeida, Angeles; Delgado-Esteban, Maria
2018-04-23
Cerebral preconditioning (PC) confers endogenous brain protection after stroke. Ischemic stroke patients with a prior transient ischemic attack (TIA) may potentially be in a preconditioned state. Although PC has been associated with the activation of pro-survival signals, the mechanism by which preconditioning confers neuroprotection is not yet fully clarified. Recently, we have described that PC-mediated neuroprotection against ischemic insult is promoted by p53 destabilization, which is mediated by its main regulator MDM2. Moreover, we have previously described that the human Tp53 Arg72Pro single nucleotide polymorphism (SNP) controls susceptibility to ischemia-induced neuronal apoptosis and governs the functional outcome of patients after stroke. Here, we studied the contribution of the human Tp53 Arg72Pro SNP on PC-induced neuroprotection after ischemia. Our results showed that cortical neurons expressing the Pro72-p53 variant exhibited higher PC-mediated neuroprotection as compared with Arg72-p53 neurons. PC prevented ischemia-induced nuclear and cytosolic p53 stabilization in Pro72-p53 neurons. However, PC failed to prevent mitochondrial p53 stabilization, which occurs in Arg72-p53 neurons after ischemia. Furthermore, PC promoted neuroprotection against ischemia by controlling the p53/active caspase-3 pathway in Pro72-p53, but not in Arg72-p53 neurons. Finally, we found that good prognosis associated to TIA within 1 month prior to ischemic stroke was restricted to patients harboring the Pro72 allele. Our findings demonstrate that the Tp53 Arg72Pro SNP controls PC-promoted neuroprotection against a subsequent ischemic insult by modulating mitochondrial p53 stabilization and then modulates TIA-induced ischemic tolerance.
Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.
Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K
2010-12-01
Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.
Rhabdomyosarcoma-associated renal cell carcinoma: a link with constitutional Tp53 mutation.
LENUS (Irish Health Repository)
Curry, Sarah
2012-02-01
The 2004 World Health Organization classification includes the new entity "neuroblastoma-associated renal cell carcinoma." The pathogenetic link between these entities is unknown as yet. The patient reported herein developed renal cell carcinoma after anaplastic embryonal rhabdomyosarcoma, a previously unknown association. The 2nd malignancy developed very soon after the 1st one, prompting concern for inherent cancer predisposition rather than a therapy-induced 2nd malignancy. A variety of features raised suspicion for Tp53 mutation, and indeed a pathogenic germline Tp53 mutation was identified in this child, despite a negative family history for Li-Fraumeni syndrome. Consideration of underlying predisposition is advocated in the context of rapid evolution of 2nd childhood malignancy.
Directory of Open Access Journals (Sweden)
Tayebeh Hamzehloie
2012-03-01
Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.
Microbial Regulation of p53 Tumor Suppressor.
Directory of Open Access Journals (Sweden)
Alexander I Zaika
2015-09-01
Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.
Braakhuis, B.J.M.; Rietbergen, M.M.; Buijze, M.; Snijders, P.J.F.; Bloemena, E.; Brakenhoff, R.H.; Leemans, C.R.
2014-01-01
Objective Little is known about the molecular carcinogenesis of oral squamous cell carcinoma (OSCC) in young adult patients. The aim of this study was to investigate the detailed TP53 mutation and human papilloma virus (HPV) status of OSCC in patients, younger than 45 years. Methods TP53 mutations
International Nuclear Information System (INIS)
Michel, Pierre; Magois, Karine; Robert, Valerie; Chiron, Anne; Lepessot, Florence; Bodenant, Corinne; Roque, Isabelle; Seng, Sok H.; Frebourg, Thierry; Paillot, Bernard
2002-01-01
Purpose: The aim of this study was to evaluate biologic factors on survival and clinical response after definitive concomitant chemoradiotherapy (CRT) in patients with esophageal squamous cell carcinoma (ESCC). Methods and Materials: TP53 protein hyperexpression (immunochemistry [IHC]) and functional assay (FA) of TP53, measuring the ability of TP53 to transactivate p21 and bax reporter systems, were performed in patients with ESCC treated by CRT. The impact of parameters studied on survival and clinical response to CRT was assessed. Results: Thirty-eight patients with ESCC were included. TP53 alterations were detected in 84.2% of cases with FA. All TP53 mutations abolished the transactivation of p21 and bax reporter systems. After CRT, complete response rate was 55.3%. The median survival of the population was 17.5 months. Serum albumin (p=0.002), weight loss <10% (p=0.005), and response to treatment (p<0.001) were significantly linked with survival. TP53 alteration in FA was not significantly predictive of response to CRT (p=0.132) nor survival (p=0.154). Conclusions: Our results suggest that wild-type TP53 in ESCC could be associated with good response to definitive CRT. However, the small rate of ESCC with wild-type TP53 suggests that systematic determination of TP53 status is not appropriate for the management of the ESCC population
Li, Yanli; Chang, Shen-Chih; Niu, Rungui; Liu, Li; Crabtree-Ide, Christina R; Zhao, Baoxing; Shi, Jianping; Han, Xiaoyou; Li, Jiawei; Su, Jia; Cai, Lin; Yu, Shunzhang; Zhang, Zuo-Feng; Mu, Lina
2013-01-01
Abstract Background A pathway-based genotyping analysis suggested rs2078486 was a novel TP53 SNP, but very few studies replicate this association. TP53 rs1042522 is the most commonly studied SNP, but very few studies examined its potential interaction with environmental factors in relation to lung cancer risk. This study aims to examine associations between two TP53 single-nucleotide polymorphisms (SNPs) (rs2078486, rs1042522), their potential interac...
Wegert, Jenny; Vokuh, Christian; Ziegler, Barbara; Ernestus, Karen; Leuschner, Ivo; Furtwängler, Rhoikos; Graf, Norbert; Gessler, Manfred
2018-01-01
TP53 mutations have been associated with anaplasia in Wilms tumour, which conveys a high risk for relapse and fatal outcome. Nevertheless, TP53 alterations have been reported in no more than 60% of anaplastic tumours, and recent data have suggested their presence in tumours that do not fulfil the criteria for anaplasia, questioning the clinical utility of TP53 analysis. Therefore, we characterized the TP53 status in 84 fatal cases of Wilms tumour, irrespective of histological subtype. We iden...
Wegert, Jenny; Vokuhl, Christian; Ziegler, Barbara; Ernestus, Karen; Leuschner, Ivo; Furtwängler, Rhoikos; Graf, Norbert; Gessler, Manfred
2017-01-01
Abstract TP53 mutations have been associated with anaplasia in Wilms tumour, which conveys a high risk for relapse and fatal outcome. Nevertheless, TP53 alterations have been reported in no more than 60% of anaplastic tumours, and recent data have suggested their presence in tumours that do not fulfil the criteria for anaplasia, questioning the clinical utility of TP53 analysis. Therefore, we characterized the TP53 status in 84 fatal cases of Wilms tumour, irrespective of histological subtype...
Ooms, Ariadne H A G; Gadd, Samantha; Gerhard, Daniela S.; Smith, Malcolm A.; Guidry Auvil, Jaime M.; Meerzaman, Daoud; Chen, Qing Rong; Hsu, Chih Hao; Yan, Chunhua; Nguyen, Cu; Hu, Ying; Ma, Yussanne; Zong, Zusheng; Mungall, Andrew J.; Moore, Richard A.; Marra, Marco A.; Huff, Vicki; Dome, Jeffrey S.; Chi, Yueh Yun; Tian, Jing; Geller, James I.; Mullighan, Charles G.; Ma, Jing; Wheeler, David A.; Hampton, Oliver A.; Walz, Amy L.; Van Den Heuvel-Eibrink, Marry M.; De Krijger, Ronald R.; Ross, Nicole; Gastier-Foster, Julie M.; Perlman, Elizabeth J.
2016-01-01
Purpose: To investigate the role and significance of TP53 mutation in diffusely anaplastic Wilms tumors (DAWTs). Experimental Design: All DAWTs registered on National Wilms Tumor Study-5 (n = 118) with available samples were analyzed for TP53 mutations and copy loss. Integrative genomic analysis was
Wegert, Jenny; Vokuhl, Christian; Ziegler, Barbara; Ernestus, Karen; Leuschner, Ivo; Furtwängler, Rhoikos; Graf, Norbert; Gessler, Manfred
2017-10-01
TP53 mutations have been associated with anaplasia in Wilms tumour, which conveys a high risk for relapse and fatal outcome. Nevertheless, TP53 alterations have been reported in no more than 60% of anaplastic tumours, and recent data have suggested their presence in tumours that do not fulfil the criteria for anaplasia, questioning the clinical utility of TP53 analysis. Therefore, we characterized the TP53 status in 84 fatal cases of Wilms tumour, irrespective of histological subtype. We identified TP53 alterations in at least 90% of fatal cases of anaplastic Wilms tumour, and even more when diffuse anaplasia was present, indicating a very strong if not absolute coupling between anaplasia and deregulation of p53 function. Unfortunately, TP53 mutations do not provide additional predictive value in anaplastic tumours since the same mutation rate was found in a cohort of non-fatal anaplastic tumours. When classified according to tumour stage, patients with stage I diffuse anaplastic tumours still had a high chance of survival (87%), but this rate dropped to 26% for stages II-IV. Thus, volume of anaplasia or possible spread may turn out to be critical parameters. Importantly, among non-anaplastic fatal tumours, 26% had TP53 alterations, indicating that TP53 screening may identify additional cases at risk. Several of these non-anaplastic tumours fulfilled some criteria for anaplasia, for example nuclear unrest, suggesting that such partial phenotypes should be under special scrutiny to enhance detection of high-risk tumours via TP53 screening. A major drawback is that these alterations are secondary changes that occur only later in tumour development, leading to striking intratumour heterogeneity that requires multiple biopsies and analysis guided by histological criteria. In conclusion, we found a very close correlation between histological signs of anaplasia and TP53 alterations. The latter may precede development of anaplasia and thereby provide diagnostic value
Directory of Open Access Journals (Sweden)
Jian Chen
Full Text Available Retinoblastoma binding protein 6 (RBBP6 plays an important role in chaperone-mediated ubiquitination and interacts with TP53 in carcinogenesis. However, the clinicopathologic significance of RBBP6 expression in colon cancer is unknown; in particular, the prognostic value of RBBP6 combined with TP53 expression has not been explored. Therefore, quantitative real-time PCR and western blot analyses were performed to detect RBBP6 expression in colon cancer tissues. RBBP6 and TP53 expression were assessed by immunohistochemistry in a tissue microarray format, in which the primary colon cancer tissue was paired with noncancerous tissue. Tissue specimens were obtained from 203 patients. We found that RBBP6 was overexpressed in colon tumorous tissues and was significantly associated with clinical stage, depth of tumor invasion, lymph node metastasis (LNM, distant metastasis, and histologic grade. Further studies revealed that a corresponding correlation between RBBP6 overexpression and mutant TP53 was evident in colon cancer (r = 0.450; P<0.001. RBBP6 expression was an independent prognostic factor for overall survival (OS and disease free survival (DFS. Interestingly, patients with tumors that had both RBBP6 overexpression and mutant TP53 protein accumulation relapsed and died within a significantly short period after surgery (P<0.001. Multivariate analysis showed that patients with LNM and patients with both RBBP6- and TP53-positive tumors had extremely poor OS (HR 6.75; 95% CI 2.63-17.35; P<0.001 and DFS (HR 8.08; 95% CI 2.80-23.30; P<0.001. These clinical findings indicate that the assessment of both RBBP6 and mutant TP53 expression will be helpful in predicting colon cancer prognosis.
DEFF Research Database (Denmark)
Munch-Petersen, Helga D; Asmar, Fazila; Dimopoulos, Konstantinos
2016-01-01
regimens (high-dose methotrexate/whole brain radiation therapy, 6.0 months, or no therapy, 0.83 months), P hotspot/direct DNA contact mutations. CCT-treated patients with PCNSL harboring a hotspot/direct DNA contact MUT......-TP53 (n = 9) had a significantly worse OS and progression free survival (PFS) compared to patients with non-hotspot/non-direct DNA contact MUT-TP53 or wild-type TP53 (median PFS 4.6 versus 18.2 or 45.7 months), P = 0.041 and P = 0.00076, respectively. Multivariate Cox regression analysis confirmed...... that hotspot/direct DNA contact MUT-TP53 was predictive of poor outcome in CCT-treated PCNSL patients, P = 0.012 and P = 0.008; HR: 1.86 and 1.95, for OS and PFS, respectively. MIR34A, MIR34B/C, and DAPK promoter methylation were detected in 53/93 (57.0 %), 80/84 (95.2 %), and 70/75 (93.3 %) of the PCNSL...
International Nuclear Information System (INIS)
Lawton, Colleen A.; Grignon, David; Caplan, Richard; Sarkar, Fazlul; Forman, Jeffrey; Mesic, John; Fu, Karen K.; Abrams, Ross
1995-01-01
Purpose/Objective: The purpose of this study is to establish the effect of the abnormal expression of the P-53 suppressor gene on the results of locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation. Materials and Methods: Patients evaluated were part of a RTOG phase III multi-institutional trial. This trial assessed the value of pre-radiation therapy androgen ablation on patients with locally advanced disease (bulky stage B and stage C). Of the 471 patients registered, pre-treatment pathological material was available for 129 patients. P-53 status was determined immunohistochemically utilizing a commercially available antibody (D07). Clinical endpoints evaluated were overall survival and development of metastases. Results: Twenty-three of the 129 patients had abnormal expression of the P-53 suppressor gene. Presence of this abnormal expression significantly correlated with lower overall survival (p=0.03) and the development of distant metastases (p=0.03). Abnormal expression of the P-53 gene was an independent prognostic indicator when evaluated against clinical stage and Gleason score. Conclusion: This data from patients entered on a phase III multi-institutional, randomized clinical trial shows that abnormal P-53 suppressor gene expression as determined immunohistochemically is an independent predictor of poorer survival and the development of distant metastases in patients with locally advanced adenocarcinoma of the prostate treated with radiation therapy with or without pre-radiation therapy androgen ablation
Directory of Open Access Journals (Sweden)
Dirce Maria Carraro
Full Text Available Germline mutations in BRCA1, BRCA2 and TP53 genes have been identified as one of the most important disease-causing issues in young breast cancer patients worldwide. The specific defective biological processes that trigger germline mutation-associated and -negative tumors remain unclear. To delineate an initial portrait of Brazilian early-onset breast cancer, we performed an investigation combining both germline and tumor analysis. Germline screening of the BRCA1, BRCA2, CHEK2 (c.1100delC and TP53 genes was performed in 54 unrelated patients <35 y; their tumors were investigated with respect to transcriptional and genomic profiles as well as hormonal receptors and HER2 expression/amplification. Germline mutations were detected in 12 out of 54 patients (22% [7 in BRCA1 (13%, 4 in BRCA2 (7% and one in TP53 (2% gene]. A cancer familial history was present in 31.4% of the unrelated patients, from them 43.7% were carriers for germline mutation (37.5% in BRCA1 and in 6.2% in the BRCA2 genes. Fifty percent of the unrelated patients with hormone receptor-negative tumors carried BRCA1 mutations, percentage increasing to 83% in cases with familial history of cancer. Over-representation of DNA damage-, cellular and cell cycle-related processes was detected in the up-regulated genes of BRCA1/2-associated tumors, whereas cell and embryo development-related processes were over-represented in the up-regulated genes of BRCA1/2-negative tumors, suggesting distinct mechanisms driving the tumorigenesis. An initial portrait of the early-onset breast cancer patients in Brazil was generated pointing out that hormone receptor-negative tumors and positive familial history are two major risk factors for detection of a BRCA1 germline mutation. Additionally, the data revealed molecular factors that potentially trigger the tumor development in young patients.
International Nuclear Information System (INIS)
Kringen, Pedro; Wang, Yun; Dumeaux, Vanessa; Kristensen, Gunnar; Borresen-Dale, Anne-Lise; Dorum, Anne
2005-01-01
Ovarian carcinomas from 30 BRCA1 germ-line carriers of two distinct high penetrant founder mutations, 20 carrying the 1675delA and 10 the 1135insA, and 100 sporadic cases were characterized for somatic mutations in the TP53 gene. We analyzed differences in relation to BRCA1 germline status, TP53 status, survival and age at diagnosis, as previous studies have not been conclusive. DNA was extracted from paraffin embedded formalin fixed tissues for the familial cases, and from fresh frozen specimen from the sporadic cases. All cases were treated at our hospital according to protocol. Mutation analyses of exon 2 – 11 were performed using TTGE, followed by sequencing. Survival rates for BRCA1-familial cases with TP53 mutations were not significantly lower than for familial cases without TP53 mutations (p = 0.25, RR = 1.64, 95% CI [0.71–3.78]). Median age at diagnosis for sporadic (59 years) and familial (49 years) cases differed significantly (p < 0.001) with or without TP53 mutations. Age at diagnosis between the two types of familial carriers were not significantly different, with median age of 47 for 1675delA and 52.5 for 1135insA carriers (p = 0.245). For cases ≥50 years at diagnosis, a trend toward longer survival for sporadic over familial cases was observed (p = 0.08). The opposite trend was observed for cases <50 years at diagnosis. There do not seem to be a protective advantage for familial BRCA1 carriers without TP53 mutations over familial cases with TP53 mutations. However, there seem to be a trend towards initial advantage in survival for familial cases compared to sporadic cases diagnosed before the age of 50 both with and without TP53 mutations. However, this trend diminishes over time and for cases diagnosed ≥50 years the sporadic cases show a trend towards an advantage in survival over familial cases. Although this data set is small, if confirmed, this may be a link in the evidence that the differences in ovarian cancer survival reported, are
Directory of Open Access Journals (Sweden)
Ranjan Chrisanthar
Full Text Available BACKGROUND: TP53 mutations have been associated with resistance to anthracyclines but not to taxanes in breast cancer patients. The MDM2 promoter single nucleotide polymorphism (SNP T309G increases MDM2 activity and may reduce wild-type p53 protein activity. Here, we explored the predictive and prognostic value of TP53 and CHEK2 mutation status together with MDM2 SNP309 genotype in stage III breast cancer patients receiving paclitaxel or epirubicin monotherapy. EXPERIMENTAL DESIGN: Each patient was randomly assigned to treatment with epirubicin 90 mg/m(2 (n = 109 or paclitaxel 200 mg/m(2 (n = 114 every 3rd week as monotherapy for 4-6 cycles. Patients obtaining a suboptimal response on first-line treatment requiring further chemotherapy received the opposite regimen. Time from last patient inclusion to follow-up censoring was 69 months. Each patient had snap-frozen tumor tissue specimens collected prior to commencing chemotherapy. PRINCIPAL FINDINGS: While TP53 and CHEK2 mutations predicted resistance to epirubicin, MDM2 status did not. Neither TP53/CHEK2 mutations nor MDM2 status was associated with paclitaxel response. Remarkably, TP53 mutations (p = 0.007 but also MDM2 309TG/GG genotype status (p = 0.012 were associated with a poor disease-specific survival among patients having paclitaxel but not patients having epirubicin first-line. The effect of MDM2 status was observed among individuals harbouring wild-type TP53 (p = 0.039 but not among individuals with TP53 mutated tumors (p>0.5. CONCLUSION: TP53 and CHEK2 mutations were associated with lack of response to epirubicin monotherapy. In contrast, TP53 mutations and MDM2 309G allele status conferred poor disease-specific survival among patients treated with primary paclitaxel but not epirubicin monotherapy.
International Nuclear Information System (INIS)
Deocaris, Custer C.
2004-01-01
Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
p53 regulates cytoskeleton remodeling to suppress tumor progression.
Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko
2015-11-01
Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.
International Nuclear Information System (INIS)
Fallai, Carlo; Perrone, Federica; Licitra, Lisa; Pilotti, Silvana; Locati, Laura; Bossi, Paolo; Orlandi, Ester; Palazzi, Mauro; Olmi, Patrizia
2009-01-01
Purpose: To study the prognostic value of the TP53 mutation and human papilloma virus (HPV) status in oropharyngeal squamous cell carcinoma (OPSCC). Methods and materials: The TP53 mutation and HPV status were analyzed in 78 cases of locoregionally advanced OPSCC. The possible correlation of these factors with locoregiownal control, relapse-free survival, disease-specific survival, and overall survival (OS) was also investigated. Results: Of these 78 cases, 22 had disruptive and 22 had non-disruptive (silent) TP53 mutations; the remaining 34 cases had wild-type (WT) TP53. HPV 16 DNA was found in 9 cases (11%), but all HPV-positive (HPV+) cases carried a functional p53 protein, except for 1 case that had a silent mutation. HPV+ patients fared better than HPV-negative (HPV-) patients in terms of all survival parameters, with highly statistically significant differences between the groups. Specifically, no distant metastases were observed in the HPV+ patients, whereas they occurred in 17% of the HPV- patients. However, no difference was observed between the WT TP53 and mutation group, even when this was analyzed in terms of disruptive and non-disruptive mutations. Regardless, treatment with chemotherapy nearly doubled the 5-year OS rates, both in the mutation (42% vs. 22%) and WT (30 vs. 16%) group, but only the mutation group showed improvement in all survival parameters. In addition, the second tumor-free 5-year survival rate was 72% in HPV- cases, but no second tumors were observed in HPV+ and WT p53 cases. Conclusions: Patients with HPV+ OPSCC have an excellent prognosis after radiochemotherapy, but cisplatin-based chemotherapy may not confer a satisfactory outcome, especially in WT cases, thereby justifying the additional or alternative use of taxanes and epidermal growth factor receptors inhibitors. Uncommon distant metastases and second tumors in the HPV+ group may be cause for clinicians to review the follow-up policies in these patients.
Directory of Open Access Journals (Sweden)
Xin Cai
Full Text Available Lung cancer is the most common malignancy and the leading cause of cancer deaths worldwide. While smoking is by far the leading cause of lung cancer, other environmental and genetic factors influence the development and progression of the cancer. Since unique mutations patterns have been observed in individual cancer samples, identification and characterization of the distinctive lung cancer molecular profile is essential for developing more effective, tailored therapies. Until recently, personalized DNA sequencing to identify genetic mutations in cancer was impractical and expensive. The recent technological advancements in next-generation DNA sequencing, such as the semiconductor-based Ion Torrent sequencing platform, has made DNA sequencing cost and time effective with more reliable results. Using the Ion Torrent Ampliseq Cancer Panel, we sequenced 737 loci from 45 cancer-related genes to identify genetic mutations in 76 human lung cancer samples. The sequencing analysis revealed missense mutations in KRAS, EGFR, and TP53 genes in the breast cancer samples of various histologic types. Thus, this study demonstrates the necessity of sequencing individual human cancers in order to develop personalized drugs or combination therapies to effectively target individual, breast cancer-specific mutations.
Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer
International Nuclear Information System (INIS)
Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko
2015-01-01
Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer
Saya, Sibel; Killick, Emma; Thomas, Sarah; Taylor, Natalie; Bancroft, Elizabeth K; Rothwell, Jeanette; Benafif, Sarah; Dias, Alexander; Mikropoulos, Christos; Pope, Jenny; Chamberlain, Anthony; Gunapala, Ranga; Izatt, Louise; Side, Lucy; Walker, Lisa; Tomkins, Susan; Cook, Jackie; Barwell, Julian; Wiles, Vicki; Limb, Lauren; Eccles, Diana; Leach, Martin O; Shanley, Susan; Gilbert, Fiona J; Hanson, Helen; Gallagher, David; Rajashanker, Bala; Whitehouse, Richard W; Koh, Dow-Mu; Sohaib, S Aslam; Evans, D Gareth; Eeles, Rosalind A
2017-07-01
In the United Kingdom, current screening guidelines for TP53 germline mutation carriers solely recommends annual breast MRI, despite the wide spectrum of malignancies typically seen in this group. This study sought to investigate the role of one-off non-contrast whole-body MRI (WB MRI) in the screening of asymptomatic TP53 mutation carriers. 44 TP53 mutation carriers and 44 population controls were recruited. Scans were read by radiologists blinded to participant carrier status. The incidence of malignancies diagnosed in TP53 mutation carriers against general population controls was calculated. The incidences of non-malignant relevant disease and irrelevant disease were measured, as well as the number of investigations required to determine relevance of findings. In TP53 mutation carriers, 6 of 44 (13.6, 95% CI 5.2-27.4%) participants were diagnosed with cancer during the study, all of which would be considered life threatening if untreated. Two were found to have two primary cancers. Two participants with cancer had abnormalities on the MRI which were initially thought to be benign (a pericardial cyst and a uterine fibroid) but transpired to be sarcomas. No controls were diagnosed with cancer. Fifteen carriers (34.1, 95% CI 20.5-49.9%) and seven controls (15.9, 95% CI 6.7-30.1%) underwent further investigations following the WB MRI for abnormalities that transpired to be benign (p = 0.049). The cancer detection rate in this group justifies a minimum baseline non-contrast WB MRI in germline TP53 mutation carriers. This should be adopted into national guidelines for management of adult TP53 mutation carriers in addition to the current practice of contrast enhanced breast MRI imaging.
Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.
2009-01-01
Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229
Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.
2012-01-01
During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738
DEFF Research Database (Denmark)
Schildkraut, Joellen M; Goode, Ellen L; Clyde, Merlise A
2009-01-01
The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829...
SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53
International Nuclear Information System (INIS)
Milner, J.; Gamble, J.
1985-01-01
The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T
The p53 gene with emphasis on its paralogues in mosquitoes
Directory of Open Access Journals (Sweden)
Tien-Huang Chen
2017-12-01
Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival
Braakhuis, B J M; Rietbergen, M M; Buijze, M; Snijders, P J F; Bloemena, E; Brakenhoff, R H; Leemans, C R
2014-09-01
Little is known about the molecular carcinogenesis of oral squamous cell carcinoma (OSCC) in young adult patients. The aim of this study was to investigate the detailed TP53 mutation and human papilloma virus (HPV) status of OSCC in patients, younger than 45 years. TP53 mutations were determined with direct sequencing on paraffin-embedded carcinoma tissue from 31 young patients and compared with two older age OSCC reference groups: one from the same institute (N = 87) and an independent one (N = 675). Biologically active tumour HPV was detected by p16-immunohistochemistry followed by a HPV-DNA GP5 + /6 + -PCR. HPV16 was present in one OSCC (3%). TP53 mutations were found in 14 (45%) OSCC: five were missense and nine resulted in a truncated protein. Six of these latter were insertions or deletions of one or more nucleotides leading to frameshift, one was at a splice site and two resulted in a stop codon. The percentage of truncating mutations (64% of all mutations) was higher than that observed in the institute's reference group (44%, P = 0.23) and in the independent reference group (24%, P = 0.002). This study shows that TP53 mutations are common in OSCC of young adult patients; infection with biologically active HPV is rare. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Effect of p53 genotype on gene expression profiles in murine liver
International Nuclear Information System (INIS)
Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.
2008-01-01
The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs
Directory of Open Access Journals (Sweden)
Lisa K. Mullany
2015-10-01
Full Text Available Evolutionary Action analyses of The Cancer Gene Atlas data sets show that many specific p53 missense and gain-of-function mutations are selectively overrepresented and functional in high-grade serous ovarian cancer (HGSC. As homozygous alleles, p53 mutants are differentially associated with specific loss of heterozygosity (R273; chromosome 17; copy number variation (R175H; chromosome 9; and up-stream, cancer-related regulatory pathways. The expression of immune-related cytokines was selectively related to p53 status, showing for the first time that specific p53 mutants impact, and are related to, the immune subtype of ovarian cancer. Although the majority (31% of HGSCs exhibit loss of heterozygosity, a significant number (24% maintain a wild-type (WT allele and represent another HGSC subtype that is not well defined. Using human and mouse cell lines, we show that specific p53 mutants differentially alter endogenous WT p53 activity; target gene expression; and responses to nutlin-3a, a small molecular that activates WT p53 leading to apoptosis, providing “proof of principle” that ovarian cancer cells expressing WT and mutant alleles represent a distinct ovarian cancer subtype. We also show that siRNA knock down of endogenous p53 in cells expressing homozygous mutant alleles causes apoptosis, whereas cells expressing WT p53 (or are heterozygous for WT and mutant p53 alleles are highly resistant. Therefore, despite different gene regulatory pathways associated with specific p53 mutants, silencing mutant p53 might be a suitable, powerful, global strategy for blocking ovarian cancer growth in those tumors that rely on mutant p53 functions for survival. Knowing p53 mutational status in HGSC should permit new strategies tailored to control this disease.
Directory of Open Access Journals (Sweden)
Maher Kurdi
2014-01-01
Full Text Available Background. The synchronous development of two primary brain tumors of distinct cell of origin in close proximity or in contact with each other is extremely rare. We present the first case of collision tumor with two histological distinct tumors. Case Presentation. A 54-year-old woman presented with progressive atypical left facial pain and numbness for 8 months. MRI of the brain showed left middle cranial fossa heterogeneous mass extending into the infratemporal fossa. At surgery, a distinct but intermingled intra- and extradural tumor was demonstrated which was completely removed through left orbitozygomatic-temporal craniotomy. Histopathological examination showed that the tumor had two distinct components: malignant nerve sheath tumor of the trigeminal nerve and temporal lobe anaplastic astrocytoma. Proliferative activity and expressed tumor protein 53 (TP53 gene mutations were demonstrated in both tumors. Conclusions. We describe the first case of malignant trigeminal nerve sheath tumor (MTNST and anaplastic astrocytoma in collision and discuss the possible hypothesis of this rare occurrence. We propose that MTNST, with TP53 mutation, have participated in the formation of anaplastic astrocytoma, or vice versa.
Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...
African Journals Online (AJOL)
The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
Lin, Jiaying; Lu, Jiaqi; Wang, Chao; Xue, Xiaohong
2017-01-01
Epithelial-mesenchymal transition (EMT), TP53, and Podoplanin have been implicated in the tumorigenesis and metastasis of human cancers. Nevertheless, the clinical significance of these markers in cancer patients is still not clear. In this study, we sought to determine the prognostic values of Vimentin, TP53, and Podoplanin in patients with cervical cancer. Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot analysis were performed to determine the messenger RNA and protein expression levels of Vimentin, TP53, and Podoplanin, respectively, in cervical squamous cell carcinoma and adjacent normal cervical tissues. Additionally, the expression levels of Podoplanin were also measured in 130 cervical cancer patients (FIGO stages Ib1-IIa2) using immunohistochemistry (IHC) staining. The mRNA expression levels of Vimentin, TP53, and Podoplanin were considerably elevated in cervical cancer tissues, compared with those in the adjacent normal cervical tissues. Additionally, the protein expression levels of Vimentin were closely correlated with the age of onset (P = 0.007), lymph node metastasis (P = 0.007), lymphatic invasion (P = 0.024), disease recurrence (P < 0.001), and the clinical prognosis of patients with cervical cancer (P < 0.001). Our multivariate analysis also suggests that Vimentin is an independent marker for survival in cervical cancer patients. Furthermore, the expression levels of Vimentin are negatively correlated with the proliferation marker Ki67 expression. Our data show that Vimentin can serve as an independent prognostic marker for cervical cancer patients with primary surgery. Registration number ChiCTR-TRC-06000236 Registered 15 December 2006.
Wang, Zhen; Xia, Rong-Hui; Ye, Dong-Xia; Li, Jiang
2016-01-01
Objectives To investigate the clinicopathological characteristics, human papillomavirus (HPV) infection, p53 expression, and TP53 mutations in oropharyngeal squamous cell carcinoma (OPSCC) and determine their utility as prognostic predictors in a primarily eastern Chinese population. Methods The HPV infection status was tested via p16INK4A immunohistochemistry and validated using PCR, reverse blot hybridization and in situ hybridization (ISH) in 188 OPSCC samples. p53 expression levels and TP...
Directory of Open Access Journals (Sweden)
Nyiraneza Christine
2012-06-01
Full Text Available Abstract Background It has been suggested that inactivation of p14ARF, a tumor suppressor central to regulating p53 protein stability through interaction with the MDM2 oncoprotein, abrogates p53 activity in human tumors retaining the wild-type TP53 gene. Differences in expression of tumor suppressor genes are frequently associated with cancer. We previously reported on a pattern of restricted p53 immunohistochemical overexpression significantly associated with microsatellite instability (MSI, low TP53 mutation frequency, and MDM2 overexpression in colorectal cancers (CRCs. In this study, we investigated whether p14ARF alterations could be a mechanism for disabling the p53 pathway in this subgroup of CRCs. Results Detailed maps of the alterations in the p14ARF gene were determined in a cohort of 98 CRCs to detect both nucleotide and copy-number changes. Methylation-specific PCR combined with bisulfite sequencing was used to evaluate the prevalence and distribution of p14ARF methylation. p14ARF alterations were then correlated with MSI status, TP53 mutations, and immunohistochemical expression of p53 and MDM2. The frequency of p14ARF mutations was extremely low (1/98; 1%, whereas coexistence of methylated and unmethylated alleles in both tumors and normal colon mucosa was common (91/98; 93%. Only seven of ninety-eight tumors (7% had a distinct pattern of methylation compared with normal colon mucosa. Evaluation of the prevalence and distribution of p14ARF promoter methylation in a region containing 27 CpG sites in 35 patients showed a range of methylated CpG sites in tumors (0 to 25 (95% CI 1 to 13 versus 0 to 17 (95% CI 0 to 2 in adjacent colon mucosa (P = 0.004. Hypermethylation of the p14ARF promoter was significantly correlated with the restricted p53 overexpression pattern (P = 0.03, and MDM2 overexpression (P = 0.02, independently of MSI phenotype. Although no significant correlation between p14ARF methylation and TP53 mutational
Preclinical efficacy of the MDM2 inhibitor RG7112 in MDM2 amplified and TP53 wild-type glioblastomas
Verreault, Maite; Schmitt, Charlotte; Goldwirt, Lauriane; Pelton, Kristine; Haidar, Samer; Levasseur, Camille; Guehennec, Jeremy; Knoff, David; Labussiere, Marianne; Marie, Yannick; Ligon, Azra H.; Mokhtari, Karima; Hoang-Xuan, Khe; Sanson, Marc; Alexander, Brian M; Wen, Patrick Y.; Delattre, Jean-Yves; Ligon, Keith L.; Idbaih, Ahmed
2016-01-01
Rationale p53 pathway alterations are key molecular events in glioblastoma (GBM). MDM2 inhibitors increase expression and stability of p53 and are presumed to be most efficacious in patients with TP53 wild-type and MDM2-amplified cancers. However, this biomarker hypothesis has not been tested in patients or patient-derived models for GBM. Methods We performed a preclinical evaluation of RG7112 MDM2 inhibitor, across a panel of 36 patient-derived GBM cell lines (PDCLs), each genetically characterized according to their P53 pathway status. We then performed a pharmacokinetic (PK) profiling of RG7112 distribution in mice and evaluated the therapeutic activity of RG7112 in orthotopic and subcutaneous GBM models. Results MDM2-amplified PDCLs were 44 times more sensitive than TP53 mutated lines that showed complete resistance at therapeutically attainable concentrations (avg. IC50 of 0.52 μM vs 21.9 μM). MDM4 amplified PDCLs were highly sensitive but showed intermediate response (avg. IC50 of 1.2 μM), whereas response was heterogeneous in TP53 wild-type PDCLs with normal MDM2/4 levels (avg. IC50 of 7.7 μM). In MDM2-amplified lines, RG7112 restored p53 activity inducing robust p21 expression and apoptosis. PK profiling of RG7112-treated PDCL intracranial xenografts demonstrated that the compound significantly crosses the blood-brain and the blood-tumor barriers. Most importantly, treatment of MDM2-amplified/TP53 wild-type PDCL-derived model (subcutaneous and orthotopic) reduced tumor growth, was cytotoxic, and significantly increased survival. Conclusion These data strongly support development of MDM2 inhibitors for clinical testing in MDM2-amplified GBM patients. Moreover, significant efficacy in a subset of non-MDM2 amplified models suggests that additional markers of response to MDM2 inhibitors must be identified. PMID:26482041
Energy Technology Data Exchange (ETDEWEB)
Cuneo, Kyle C., E-mail: kcuneo@umich.edu; Morgan, Meredith A.; Davis, Mary A.; Parcels, Leslie A.; Parcels, Joshua; Karnak, David; Ryan, Caila; Liu, Na; Maybaum, Jonathan; Lawrence, Theodore S.
2016-06-01
Purpose: Wee1 kinase inhibitors are effective radiosensitizers in cells lacking a G{sub 1} checkpoint. In this study we examined the potential effect of Wee1 kinase inhibition on inducing replication stress in hepatocellular carcinoma (HCC). Methods and Materials: Five independent datasets from the Oncomine database comparing gene expression in HCC compared to normal tissue were combined and specific markers associated with Wee1 sensitivity were analyzed. We then performed a series of in vitro experiments to study the effect of Wee1 inhibition on irradiated HCC cell lines with varying p53 mutational status. Clonogenic survival assays and flow cytometry using anti-γH2AX and phospho-histone H3 antibodies with propidium iodide were performed to study the effect of AZD1775 on survival, cell cycle, and DNA repair. Additionally, nucleoside enriched medium was used to examine the effect of altering nucleotide pools on Wee1 targeted radiation sensitization. Results: Our analysis of the Oncomine database found high levels of CDK1 and other cell cycle regulators indicative of Wee1 sensitivity in HCC. In our in vitro experiments, treatment with AZD1775 radiosensitized and chemosensitized Hep3B, Huh7, and HepG2 cell lines and was associated with delayed resolution of γH2AX foci and the induction of pan-nuclear γH2AX staining. Wee1 inhibition attenuated radiation-induced G{sub 2} arrest in the Hep3B (TP53 null) and Huh7 (TP53 mutant) cell lines but not in the TP53 wild-type cell line HepG2. Supplementation with nucleosides reversed the radiation-sensitizing effect of AZD1775 and reduced the amount of cells with pan-nuclear γH2AX staining after radiation. Conclusions: Radiation sensitization with Wee1 inhibition occurs in cells regardless of their p53 mutational status. In this study we show for the first time that replication stress via the overconsumption of nucleotides plays an important role in AZD1775-induced radiation sensitization.
The expanding regulatory universe of p53 in gastrointestinal cancer [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Andrew Fesler
2016-04-01
Full Text Available Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs. Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
Directory of Open Access Journals (Sweden)
Napapat Amornwichet
Full Text Available BACKGROUND AND PURPOSE: To understand the mechanisms involved in the strong killing effect of carbon-ion beam irradiation on cancer cells with TP53 tumor suppressor gene deficiencies. MATERIALS AND METHODS: DNA damage responses after carbon-ion beam or X-ray irradiation in isogenic HCT116 colorectal cancer cell lines with and without TP53 (p53+/+ and p53-/-, respectively were analyzed as follows: cell survival by clonogenic assay, cell death modes by morphologic observation of DAPI-stained nuclei, DNA double-strand breaks (DSBs by immunostaining of phosphorylated H2AX (γH2AX, and cell cycle by flow cytometry and immunostaining of Ser10-phosphorylated histone H3. RESULTS: The p53-/- cells were more resistant than the p53+/+ cells to X-ray irradiation, while the sensitivities of the p53+/+ and p53-/- cells to carbon-ion beam irradiation were comparable. X-ray and carbon-ion beam irradiations predominantly induced apoptosis of the p53+/+ cells but not the p53-/- cells. In the p53-/- cells, carbon-ion beam irradiation, but not X-ray irradiation, markedly induced mitotic catastrophe that was associated with premature mitotic entry with harboring long-retained DSBs at 24 h post-irradiation. CONCLUSIONS: Efficient induction of mitotic catastrophe in apoptosis-resistant p53-deficient cells implies a strong cancer cell-killing effect of carbon-ion beam irradiation that is independent of the p53 status, suggesting its biological advantage over X-ray treatment.
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming
2016-01-01
Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and ‘primary peritoneal’ (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. PMID:21990067
International Nuclear Information System (INIS)
Wang, Quan; Wei, Feng; Lv, Guoyue; Li, Chunsheng; Liu, Tongjun; Hadjipanayis, Costas G; Zhang, Guikai; Hao, Chunhai; Bellail, Anita C
2013-01-01
There is growing evidence indicating the insulin-like growth factor 1 receptor (IGF-1R) plays a critical role in the progression of human colorectal carcinomas. IGF-1R is an attractive drug target for the treatment of colon cancer. Picropodophyllin (PPP), of the cyclolignan family, has recently been identified as an IGF-1R inhibitor. The aim of this study is to determine the therapeutic response and mechanism after colorectal carcinoma treatment with PPP. Seven colorectal carcinoma cell lines were treated with PPP. Following treatment, cells were analyzed for growth by a cell viability assay, sub-G1 apoptosis by flow cytometry, caspase cleavage and activation of AKT and extracellular signal-regulated kinase (ERK) by western blot analysis. To examine the in vivo therapeutic efficacy of PPP, mice implanted with human colorectal carcinoma xenografts underwent PPP treatment. PPP treatment blocked the phosphorylation of IGF-1R, AKT and ERK and inhibited the growth of TP53 wild-type but not mutated colorectal carcinoma cell lines. The treatment of PPP also induced apoptosis in TP53 wild-type cells as evident by the presence of sub-G1 cells and the cleavage of caspase-9, caspase-3, DNA fragmentation factor-45 (DFF45), poly (ADP-ribose) polymerase (PARP), and X-linked inhibitor of apoptosis protein (XIAP). The loss of BAD phosphorylation in the PPP-treated TP53 wild type cells further suggested that the treatment induced apoptosis through the BAD-mediated mitochondrial pathway. In contrast, PPP treatment failed to induce the phosphorylation of AKT and ERK and caspase cleavage in TP53 mutated colorectal carcinoma cell lines. Finally, PPP treatment suppressed the growth of xenografts derived from TP53 wild type but not mutated colorectal carcinoma cells. We report the association of TP53 mutations with the resistance of treatment of colorectal carcinoma cells in culture and in a xenograft mouse model with the IGF-1R inhibitor PPP. TP53 mutations often occur in colorectal
van Oosterwijk, J G; van Ruler, M A J H; Briaire-de Bruijn, I H; Herpers, B; Gelderblom, H; van de Water, B; Bovée, J V M G
2013-01-01
Background: Chondrosarcomas are malignant cartilage-forming tumours of bone. Because of their resistance to conventional chemotherapy and radiotherapy, currently no treatment strategies exist for unresectable and metastatic chondrosarcoma. Previously, PI3K/AKT/GSK3β and Src kinase pathways were shown to be activated in chondrosarcoma cell lines. Our aim was to investigate the role of these kinases in chemoresistance and migration in chondrosarcoma in relation to TP53 mutation status. Methods: We used five conventional and three dedifferentiated chondrosarcoma cell lines and investigated the effect of PI3K/AKT/GSK3β pathway inhibition (enzastaurin) and Src pathway inhibition (dasatinib) in chemoresistance using WST assay and live cell imaging with AnnexinV staining. Immunohistochemistry on tissue microarrays (TMAs) containing 157 cartilaginous tumours was performed for Src family members. Migration assays were performed with the RTCA xCelligence System. Results: Src inhibition was found to overcome chemoresistance, to induce apoptosis and to inhibit migration. Cell lines with TP53 mutations responded better to combination therapy than wild-type cell lines (P=0.002). Tissue microarray immunohistochemistry confirmed active Src (pSrc) signalling, with Fyn being most abundantly expressed (76.1%). Conclusion: These results strongly indicate Src family kinases, in particular Fyn, as a potential target for the treatment of inoperable and metastatic chondrosarcomas, and to sensitise for doxorubicin especially in the presence of TP53 mutations. PMID:23922104
Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4
Directory of Open Access Journals (Sweden)
Ravshan Burikhanov
2014-01-01
Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
Reiling, Erwin; Speksnijder, Ewoud N; Pronk, Amanda C M; van den Berg, Sjoerd A A; Neggers, Silvia J W; Rietbroek, Ilma; van Steeg, Harry; Dollé, Martijn E T
2014-02-13
Variation in TP53 has been associated with cancer. The pro-allele of a TP53 polymorphism in codon 72 (rs1042522) has been associated with longevity. Recently, we showed that the same allele might be involved in preservation of glucose metabolism, body composition and blood pressure during ageing. Here, we assessed glucose tolerance and body composition in mice carrying the human polymorphism. Our data do not support the previous findings in humans, suggesting that this polymorphism does not play a major role in development of glucose metabolism and body composition during ageing. Alternatively, the mouse model may not be suitable to validate these rs1042522-associated traits up to the age tested.
Isoform-specific interactions of the von Hippel-Lindau tumor suppressor protein
Minervini, Giovanni; Mazzotta, Gabriella M.; Masiero, Alessandro; Sartori, Elena; Corr?, Samantha; Potenza, Emilio; Costa, Rodolfo; Tosatto, Silvio C. E.
2015-01-01
Deregulation of the von Hippel-Lindau tumor suppressor protein (pVHL) is considered one of the main causes for malignant renal clear-cell carcinoma (ccRCC) insurgence. In human, pVHL exists in two isoforms, pVHL19 and pVHL30 respectively, displaying comparable tumor suppressor abilities. Mutations of the p53 tumor suppressor gene have been also correlated with ccRCC insurgence and ineffectiveness of treatment. A recent proteomic analysis linked full length pVHL30 with p53 pathway regulation t...
Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming
2012-02-01
Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and 'primary peritoneal' (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Le Bris, Yannick; Struski, Stéphanie; Guièze, Romain; Rouvellat, Caroline; Prade, Naïs; Troussard, Xavier; Tournilhac, Olivier; Béné, Marie C; Delabesse, Eric; Ysebaert, Loïc
2017-12-01
Chronic lymphocytic leukemia (CLL) is a lymphoproliferative disorder of remarkable heterogeneity as demonstrated by cytogenetics and molecular analyses. Complex karyotype (CK), TP53 deletions and/or mutations (TP53 disruption), IGVH mutational status, and, more recently, recurrent somatic mutations have been identified as prognostic markers in CLL. On a cohort of 110 patients with CLL treated with first-line fludarabin, cyclophosphamide, and rituximab treatment compared with 33 untreated (watch and wait) patients with CLL, we report more frequent complex karyotypes (34 vs 15%; P = .05), unmutated IGHV (70 vs 21%; P < .0001), ATM deletion (25 vs 6%, P = .02), and NOTCH mutation (3 vs 17%, P = .04). Among treated patients, 39 relapsed during the follow-up period. These patients were characterized before treatment by a higher incidence of trisomy 12 (38 vs 11%, P < .001) and TP53 disruption (31 vs 4%, P = .0002). A significantly shorter 5-year overall survival was found for treated patients with CK (72.4 vs 85.8%; P = .007), unmutated IGHV (70 vs 100%; P = .04), or TP53 disruption (55.7 vs 82.7%; P < .0001). Three risk groups were defined based on the status of TP53 disruption or unmutated IGVH, which differed significantly in terms of 5-year overall survival. Moreover, the presence of CK impacted pejoratively 5-year overall survival and progression-free survival in all these 3 groups. Conventional karyotyping therefore appears to be of value, CK being an additional factor, undetectable in classical FISH, in patients with CLL at the stage when therapy becomes required. Copyright © 2016 John Wiley & Sons, Ltd.
Franken, N. A. P.; van Bree, C.; ten Cate, R.; van Oven, C. H.; Haveman, J.
2002-01-01
Repair of potentially lethal damage (PLD) was investigated in cells with functional G(1)-phase arrest with wild-type TP53 and wild-type RB and in cells in which G(1)-phase arrest was abrogated by inactivation of TP53 or RB. Confluent cultures of cells were plated for clonogenic survival assay either
Yan, Yulan; Wu, Renzheng; Li, Shaojing; He, Jinlong
2015-06-01
In the light of the relationship between the TP53 Arg72Pro (rs1042522) polymorphism and the risk of endometriosis remains inclusive or controversial. For better understanding of the effect of TP53 Arg72Pro polymorphism on endometriosis risk, we performed a meta-analysis. The relevant studies were identified through a search of PubMed, Web of Science, EMBASE, Ovid, Springer, China National Knowledge Infrastructure (CNKI), cqvip, Wanfang database, and Chinese Biomedical Literature (CBM) databases up to December, 2014. The association between the TP53 Arg72Pro polymorphism and endometriosis risk was pooled by conducted by odds ratios and 95% confidence intervals. A total of fifteen case-control studies with 2683 cases and 3335 controls were eventually identified. There was significant association between Arg72Pro polymorphism and endometriosis risk in all of the five models in overall populations (C vs. G: OR=1.32, 95%CI=1.14-1.53, p=0.00; CC vs. GG: OR=1.80, 95%CI=1.28-2.53, p=0.001; GC vs. GG: OR=1.52, 95%CI=1.22-1.88, p=0.00; CC vs. OR=1.32, 95%CI=1.05-1.66, p=0.016; CC/GC vs. GG: OR=1.59, 95%CI=1.26-2.00, p=0.00). In the sub-group analysis according to ethnicity, the results suggested that TP53 Arg72Pro polymorphism was not associated with endometriosis risk in Caucasians. However, the significant association was found in Asians and Mixed race (MIX) under the five models. The results of this meta-analysis suggest that the TP53 Arg72Pro polymorphism can increase the risk of endometriosis, especially among Asians and MIX populations. Considering the limited sample size and ethnicities included in the meta-analysis, further larger scaled and well-designed studies are needed to confirm our results. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Tumor hypoxia, p53, and prognosis in cervical cancers
International Nuclear Information System (INIS)
Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen
2001-01-01
Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p
Ruijs, M.W.G.; Verhoef, S.; Rookus, M.A.; Pruntel, R.; van der Hout, A.H.; Hogervorst, F.B.L.; Kluijt, I.; Sijmons, R.H.; Aalfs, C.M.; Wagner, A.; Ausems, M.G.E.M.; Hoogerbrugge, N.; van Asperen, C.J.; Gómez García, E.B.; Meijers-Heijboer, H.; ten Kate, L.P.; Menko, F.H.; van 't Veer, L.J.
2010-01-01
Background Li-Fraumeni syndrome (LFS) is a rare autosomal dominant cancer predisposition syndrome. Most families fulfilling the classical diagnostic criteria harbour TP53 germline mutations. However, TP53 germline mutations may also occur in less obvious phenotypes. As a result, different criteria
Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status
International Nuclear Information System (INIS)
Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki
2004-01-01
We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)
p53 as the focus of gene therapy: past, present and future.
Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani
2018-01-15
Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Biton, Jerome; Mansuet-Lupo, Audrey; Pécuchet, Nicolas; Alifano, Marco; Ouakrim, Hanane; Arrondeau, Jennifer; Boudou-Rouquette, Pascaline; Goldwasser, Francois; Leroy, Karen; Goc, Jeremy; Wislez, Marie; Germain, Claire; Laurent-Puig, Pierre; Dieu-Nosjean, Marie-Caroline; Cremer, Isabelle; Herbst, Ronald; Blons, Hélène F; Damotte, Diane
2018-05-15
By unlocking anti-tumor immunity, antibodies targeting programmed cell death 1 (PD-1) exhibit impressive clinical results in non-small cell lung cancer, underlining the strong interactions between tumor and immune cells. However, factors that can robustly predict long-lasting responses are still needed. We performed in depth immune profiling of lung adenocarcinoma using an integrative analysis based on immunohistochemistry, flow-cytometry and transcriptomic data. Tumor mutational status was investigated using next-generation sequencing. The response to PD-1 blockers was analyzed from a prospective cohort according to tumor mutational profiles and to PD-L1 expression, and a public clinical database was used to validate the results obtained. We showed that distinct combinations of STK11 , EGFR and TP53 mutations, were major determinants of the tumor immune profile (TIP) and of the expression of PD-L1 by malignant cells. Indeed, the presence of TP53 mutations without co-occurring STK11 or EGFR alterations ( TP53 -mut/ STK11 - EGFR -WT), independently of KRAS mutations, identified the group of tumors with the highest CD8 T cell density and PD-L1 expression. In this tumor subtype, pathways related to T cell chemotaxis, immune cell cytotoxicity, and antigen processing were up-regulated. Finally, a prolonged progression-free survival (PFS: HR=0.32; 95% CI, 0.16-0.63, p <0.001) was observed in anti-PD-1 treated patients harboring TP53 -mut/ STK11 - EGFR -WT tumors. This clinical benefit was even more remarkable in patients with associated strong PD-L1 expression. Our study reveals that different combinations of TP53 , EGFR and STK11 mutations , together with PD-L1 expression by tumor cells, represent robust parameters to identify best responders to PD-1 blockade. Copyright ©2018, American Association for Cancer Research.
The Ras effector RASSF2 is a novel tumor-suppressor gene in human colorectal cancer.
Akino, Kimishige; Toyota, Minoru; Suzuki, Hiromu; Mita, Hiroaki; Sasaki, Yasushi; Ohe-Toyota, Mutsumi; Issa, Jean-Pierre J; Hinoda, Yuji; Imai, Kohzoh; Tokino, Takashi
2005-07-01
Activation of Ras signaling is a hallmark of colorectal cancer (CRC), but the roles of negative regulators of Ras are not fully understood. Our aim was to address that question by surveying genetic and epigenetic alterations of Ras-Ras effector genes in CRC cells. The expression and methylation status of 6 RASSF family genes were examined using RT-PCR and bisulfite PCR in CRC cell lines and in primary CRCs and colorectal adenomas. Colony formation assays and flow cytometry were used to assess the tumor suppressor activities of RASSF1 and RASSF2. Immunofluorescence microscopy was used to determine the effect of altered RASSF2 expression on cell morphology. Mutations of K- ras , BRAF, and p53 were identified using single-strand conformation analysis and direct sequencing. Aberrant methylation and histone deacetylation of RASSF2 was associated with the gene's silencing in CRC. The activities of RASSF2, which were distinct from those of RASSF1, included induction of morphologic changes and apoptosis; moreover, its ability to prevent cell transformation suggests that RASSF2 acts as a tumor suppressor in CRC. Primary CRCs that showed K- ras /BRAF mutations also frequently showed RASSF2 methylation, and inactivation of RASSF2 enhanced K- ras -induced oncogenic transformation. RASSF2 methylation was also frequently identified in colorectal adenomas. RASSF2 is a novel tumor suppressor gene that regulates Ras signaling and plays a pivotal role in the early stages of colorectal tumorigenesis.
RET is a potential tumor suppressor gene in colorectal cancer
Luo, Yanxin; Tsuchiya, Karen D.; Park, Dong Il; Fausel, Rebecca; Kanngurn, Samornmas; Welcsh, Piri; Dzieciatkowski, Slavomir; Wang, Jianping; Grady, William M.
2012-01-01
Cancer arises as the consequence of mutations and epigenetic alterations that activate oncogenes and inactivate tumor suppressor genes. Through a genome-wide screen for methylated genes in colon neoplasms, we identified aberrantly methylated RET in colorectal cancer. RET, a transmembrane receptor tyrosine kinase and a receptor for the GDNF-family ligands, was one of the first oncogenes to be identified and has been shown to be an oncogene in thyroid cancer and pheochromocytoma. However, unexpectedly, we found RET is methylated in 27% of colon adenomas and in 63% of colorectal cancers, and now provide evidence that RET has tumor suppressor activity in colon cancer. The aberrant methylation of RET correlates with decreased RET expression, whereas the restoration of RET in colorectal cancer cell lines results in apoptosis. Furthermore, in support of a tumor suppressor function of RET, mutant RET has also been found in primary colorectal cancer. We now show that these mutations inactivate RET, which is consistent with RET being a tumor suppressor gene in the colon. These findings suggest that the aberrant methylation of RET and the mutational inactivation of RET promote colorectal cancer formation and that RET can serve as a tumor suppressor gene in the colon. Moreover, the increased frequency of methylated RET in colon cancers compared to adenomas suggests RET inactivation is involved in the progression of colon adenomas to cancer. PMID:22751117
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
Genetic and molecular analysis of radon-induced rat lung tumours
International Nuclear Information System (INIS)
Guilly, M.N.; Joubert, Ch.; Levalois, C.; Dano, L.; Chevillard, S.
2002-01-01
We have a model of radon-induced rat lung tumours, which allow us to analyse the cytogenetic and molecular alterations of the tumours. The aim is to better understand the mechanisms of radio-induced carcinogenesis and to define if it exists a specificity of radio-induced genetic alterations as compared to the genetic alterations found in the sporadic tumours. We have started our analysis by developing global cytogenetic and molecular approaches. We have shown that some alterations are recurrent. The genes that are potentially involved are the oncogene MET and the tumour suppressor Bene p16, which are also frequently altered in human lung tumours. Simultaneously, we have focussed our analysis by targeting the search of mutation in the tumour suppressor gene TP3. We have found that 8 of 39 tumours were mutated by deletion in the coding sequence of TP53. This high frequency of deletion, which is not observed in the human p53 mutation database could constitute a signature of radio-induced alterations. On this assumption, this type of alteration should not be only found on TP53 Bene but also in other suppressor genes which are inactivated by a mutation such as p16 for example. The work we are carrying out on radio-induced tumours among humans and animals is directed to this end. (author)
A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.
Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping
2018-05-23
PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.
Kazakov, Dmitry V; Ivan, Doina; Kutzner, Heinz; Spagnolo, Dominic V; Grossmann, Petr; Vanecek, Tomas; Sima, Radek; Kacerovska, Denisa; Shelekhova, Ksenia V; Denisjuk, Natalja; Hillen, Uwe; Kuroda, Naoto; Mukensnabl, Petr; Danis, Dusan; Michal, Michal
2009-05-01
, in 2 cases, a minority of the neoplastic cells (10%-20%) demonstrated nuclear staining, whereas the remaining 4 cases were negative. Of 9 specimens of hidradenocarcinoma studied for TP53 mutations, 2 harbored mutations, whereas the remaining 7 specimens showed the wild-type sequence. Of 11 specimens studied for translocation t(11;19), 2 cases harbored the translocation. It is concluded that cutaneous hidradenocarcinomas show some microscopic heterogeneity and comprise both low- and high-grade lesions that cytologically are similar to their benign counterpart, the hidradenoma. Within the spectrum of low-grade lesions, there seem to exist tumors almost indistinguishable from hidradenomas but still being capable of regional or distant metastasis. Similar to hidradenomas, hidradenocarcinomas show a t(11;19) translocation, but it is a significantly rarer event. Even rarer is the amplification of the Her2/neu gene. Of note is the relatively low frequency of TP53 mutations despite a high rate of p53 protein expression at the immunohistochemical level.
Sánchez-Castro, Judit; Marco-Betés, Víctor; Gómez-Arbonés, Xavier; García-Cerecedo, Tomás; López, Ricard; Talavera, Elisabeth; Fernández-Ruiz, Sara; Ademà, Vera; Marugan, Isabel; Luño, Elisa; Sanzo, Carmen; Vallespí, Teresa; Arenillas, Leonor; Marco Buades, Josefa; Batlle, Ana; Buño, Ismael; Martín Ramos, María Luisa; Blázquez Rios, Beatriz; Collado Nieto, Rosa; Vargas, Ma Teresa; González Martínez, Teresa; Sanz, Guillermo; Solé, Francesc
2015-01-01
Conventional G-banding cytogenetics (CC) detects chromosome 17 (chr17) abnormalities in 2% of patients with de novo myelodysplastic syndromes (MDS). We used CC and fluorescence in situ hybridization (FISH) (LSI p53/17p13.1) to assess deletion of 17p in 531 patients with de novo MDS from the Spanish Group of Hematological Cytogenetics. FISH detected - 17 or 17p abnormalities in 13 cases (2.6%) in whom no 17p abnormalities were revealed by CC: 0.9% of patients with a normal karyotype, 0% in non-informative cytogenetics, 50% of patients with a chr17 abnormality without loss of 17p and 4.7% of cases with an abnormal karyotype not involving chr17. Our results suggest that applying FISH of 17p13 to identify the number of copies of the TP53 gene could be beneficial in patients with a complex karyotype. We recommend using FISH of 17p13 in young patients with a normal karyotype or non-informative cytogenetics, and always in isolated del(17p).
Bogusz, Agata M
2017-01-01
Posttransplant lymphoproliferative disorders (PTLDs) are a diverse group of lymphoid or plasmacytic proliferations frequently driven by Epstein-Barr virus (EBV). EBV-negative PTLDs appear to represent a distinct entity. This report describes an unusual case of a 33-year-old woman that developed a monomorphic EBV-negative PTLD consistent with diffuse large B-cell lymphoma (DLBCL) 13 years after heart-lung transplant. Histological examination revealed marked pleomorphism of the malignant cells including nodular areas reminiscent of classical Hodgkin lymphoma (cHL) with abundant large, bizarre Hodgkin-like cells. By immunostaining, the malignant cells were immunoreactive for CD45, CD20, CD79a, PAX5, BCL6, MUM1, and p53 and negative for CD15, CD30, latent membrane protein 1 (LMP1), and EBV-encoded RNA (EBER). Flow cytometry demonstrated lambda light chain restricted CD5 and CD10 negative B-cells. Fluorescence in situ hybridization studies (FISH) were negative for cMYC , BCL2, and BCL6 rearrangements but showed deletion of TP53 and monosomy of chromosome 17. Next-generation sequencing studies (NGS) revealed numerous genetic alterations including 6 pathogenic mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53 (x2) genes and 30 variants of unknown significance (VOUS) in ABL1, ASXL1, ATM, BCOR, BCORL1, BRNIP3, CDH2, CDKN2A, DNMT3A, ETV6, EZH2, FBXW7, KIT, NF1, RUNX1, SETPB1, SF1, SMC1A, STAG2, TET2, TP53, and U2AF2.
Directory of Open Access Journals (Sweden)
Agata M. Bogusz
2017-01-01
Full Text Available Posttransplant lymphoproliferative disorders (PTLDs are a diverse group of lymphoid or plasmacytic proliferations frequently driven by Epstein-Barr virus (EBV. EBV-negative PTLDs appear to represent a distinct entity. This report describes an unusual case of a 33-year-old woman that developed a monomorphic EBV-negative PTLD consistent with diffuse large B-cell lymphoma (DLBCL 13 years after heart-lung transplant. Histological examination revealed marked pleomorphism of the malignant cells including nodular areas reminiscent of classical Hodgkin lymphoma (cHL with abundant large, bizarre Hodgkin-like cells. By immunostaining, the malignant cells were immunoreactive for CD45, CD20, CD79a, PAX5, BCL6, MUM1, and p53 and negative for CD15, CD30, latent membrane protein 1 (LMP1, and EBV-encoded RNA (EBER. Flow cytometry demonstrated lambda light chain restricted CD5 and CD10 negative B-cells. Fluorescence in situ hybridization studies (FISH were negative for cMYC, BCL2, and BCL6 rearrangements but showed deletion of TP53 and monosomy of chromosome 17. Next-generation sequencing studies (NGS revealed numerous genetic alterations including 6 pathogenic mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53(x2 genes and 30 variants of unknown significance (VOUS in ABL1, ASXL1, ATM, BCOR, BCORL1, BRNIP3, CDH2, CDKN2A, DNMT3A, ETV6, EZH2, FBXW7, KIT, NF1, RUNX1, SETPB1, SF1, SMC1A, STAG2, TET2, TP53, and U2AF2.
Energy Technology Data Exchange (ETDEWEB)
Deocaris, Custer C
2000-04-01
The p53 tumor suppressor is by far the most widely mutated gene in human cancers. p53 encodes a 53-kDa phosphoprotein, transcription-activator whose targets include genes and gene products that orchestrate genomic stability, cellular response to DNA damage, cell cycle progression apoptosis and aging (senescence). Analysis of the p53 gene profile has previously resulted in identifying several cancer-causative factors in the human setting, as well as, in creating a unique molecular profile of a tumor useful in the design of tailored-therapies for individual cancer patients. Our results in screening for p53 abnormalities in 140 Filipino patients with primary breast lesions confined from 1997-1998 in 5 major hospitals in Manila reveal that p53 plays an important role in the development and progression of breast cancer in at least 48% of all cases. Two methods of p53 analysis are employed, enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction-temporal temperature gradient electrophoresis (PCR-TTGE). Inter-comparisons of method exhibit 63.3% concordance in 21 fresh breast carcinoma samples, with ELISA demonstrating 14% false-positives and 10% false-negatives. Only mutations in exon 7 (p=0.063) in the tumor samples how significant correlation with abnormal cellular elevation of p53. PCR-TTGE screening in a large series of 140 patients show that most genetic lesions are localized in exons 5 (41% of the total cases) and 6 (27% of the total cases). No mutations are, however, detected in the transactivation (exons 2-4) and oligomerization (exons 10-11) domains. Invasive carcinomas (stages II and III) are characterized with more frequent and diverse genetic alterations compared with benign tumors, most significantly at exon 5B (p=0.066) and at independently multiple sites (p=0.066). Earlier-onset cases (age of diagnosis < 50 yrs), known to be more clinico-pathologically aggressive, are diagnosed harboring more frequent p53 mutations centered at exon 7 (p=0
International Nuclear Information System (INIS)
Deocaris, Custer C.
2000-04-01
The p53 tumor suppressor is by far the most widely mutated gene in human cancers. p53 encodes a 53-kDa phosphoprotein, transcription-activator whose targets include genes and gene products that orchestrate genomic stability, cellular response to DNA damage, cell cycle progression apoptosis and aging (senescence). Analysis of the p53 gene profile has previously resulted in identifying several cancer-causative factors in the human setting, as well as, in creating a unique molecular profile of a tumor useful in the design of tailored-therapies for individual cancer patients. Our results in screening for p53 abnormalities in 140 Filipino patients with primary breast lesions confined from 1997-1998 in 5 major hospitals in Manila reveal that p53 plays an important role in the development and progression of breast cancer in at least 48% of all cases. Two methods of p53 analysis are employed, enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction-temporal temperature gradient electrophoresis (PCR-TTGE). Inter-comparisons of method exhibit 63.3% concordance in 21 fresh breast carcinoma samples, with ELISA demonstrating 14% false-positives and 10% false-negatives. Only mutations in exon 7 (p=0.063) in the tumor samples how significant correlation with abnormal cellular elevation of p53. PCR-TTGE screening in a large series of 140 patients show that most genetic lesions are localized in exons 5 (41% of the total cases) and 6 (27% of the total cases). No mutations are, however, detected in the transactivation (exons 2-4) and oligomerization (exons 10-11) domains. Invasive carcinomas (stages II and III) are characterized with more frequent and diverse genetic alterations compared with benign tumors, most significantly at exon 5B (p=0.066) and at independently multiple sites (p=0.066). Earlier-onset cases (age of diagnosis < 50 yrs), known to be more clinico-pathologically aggressive, are diagnosed harboring more frequent p53 mutations centered at exon 7 (p=0
TAF6delta controls apoptosis and gene expression in the absence of p53.
Directory of Open Access Journals (Sweden)
Emmanuelle Wilhelm
Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.
Energy Technology Data Exchange (ETDEWEB)
Fan, Yu [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Zhan, Qian [The Center for Clinical Molecular Medical Detection, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Xu, Hongying [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Li, Lili; Li, Chen [Cancer Epigenetics Laboratory, Department of Clinical Oncology, Sir YK Pao Center for Cancer and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong and CUHK Shenzhen Research Institute (Hong Kong); Xiao, Qian; Xiang, Shili; Hui, Tianli [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Xiang, Tingxiu, E-mail: larissaxiang@163.com [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Ren, Guosheng, E-mail: rengs726@126.com [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China)
2016-06-10
The KRAB–zinc-finger protein ZNF545 was recently identified as a potential suppressor gene in several tumors. However, the regulatory mechanisms of ZNF545 in tumorigenesis remain unclear. In this study, we investigated the expression and roles of ZNF545 in multiple myeloma (MM). ZNF545 was frequently downregulated in MM tissues compared with non-tumor bone marrow tissues. ZNF545 expression was silenced by promoter methylation in MM cell lines, and could be restored by demethylation treatment. ZNF545 methylation was detected in 28.3% of MM tissues, compared with 4.3% of normal bone marrow tissues. ZNF545 transcriptionally activated the p53 signaling pathway but had no effect on Akt in MM, whereas ectopic expression of ZNF545 in silenced cells suppressed their proliferation and induced apoptosis. We therefore identified ZNF545 as a novel tumor suppressor inhibiting tumor growth through activation of the p53 pathway in MM. Moreover, tumor-specific methylation of ZNF545 may represent an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. -- Highlights: •Downregulated ZNF545 in MM tissues and cell lines and ectopic expression of ZNF545 suppresses tumor growth. •Tumor-specific methylation of ZNF545 represents an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. •ZNF545 exerts its tumor suppressive effects via transcriptional activating p53 pathway.
International Nuclear Information System (INIS)
Fan, Yu; Zhan, Qian; Xu, Hongying; Li, Lili; Li, Chen; Xiao, Qian; Xiang, Shili; Hui, Tianli; Xiang, Tingxiu; Ren, Guosheng
2016-01-01
The KRAB–zinc-finger protein ZNF545 was recently identified as a potential suppressor gene in several tumors. However, the regulatory mechanisms of ZNF545 in tumorigenesis remain unclear. In this study, we investigated the expression and roles of ZNF545 in multiple myeloma (MM). ZNF545 was frequently downregulated in MM tissues compared with non-tumor bone marrow tissues. ZNF545 expression was silenced by promoter methylation in MM cell lines, and could be restored by demethylation treatment. ZNF545 methylation was detected in 28.3% of MM tissues, compared with 4.3% of normal bone marrow tissues. ZNF545 transcriptionally activated the p53 signaling pathway but had no effect on Akt in MM, whereas ectopic expression of ZNF545 in silenced cells suppressed their proliferation and induced apoptosis. We therefore identified ZNF545 as a novel tumor suppressor inhibiting tumor growth through activation of the p53 pathway in MM. Moreover, tumor-specific methylation of ZNF545 may represent an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. -- Highlights: •Downregulated ZNF545 in MM tissues and cell lines and ectopic expression of ZNF545 suppresses tumor growth. •Tumor-specific methylation of ZNF545 represents an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. •ZNF545 exerts its tumor suppressive effects via transcriptional activating p53 pathway.
Directory of Open Access Journals (Sweden)
Laxmidhar Das
Full Text Available Inhibition of carcinogenesis may be a consequence of attenuation of oxidative stress via activation of antioxidant defence system, restoration and stabilization of tumour suppressor proteins along with modulation of inflammatory mediators. Previously we have delineated significant role of curcumin during its long term effect in regulation of glycolytic pathway and angiogenesis, which in turn results in prevention of cancer via modulation of stress activated genes. Present study was designed to investigate long term effect of curcumin in regulation of Nrf2 mediated phase-II antioxidant enzymes, tumour suppressor p53 and inflammation under oxidative tumour microenvironment in liver of T-cell lymphoma bearing mice. Inhibition of Nrf2 signalling observed during lymphoma progression, resulted in down regulation of phase II antioxidant enzymes, p53 as well as activation of inflammatory signals. Curcumin potentiated significant increase in Nrf2 activation. It restored activity of phase-II antioxidant enzymes like GST, GR, NQO1, and tumour suppressor p53 level. In addition, curcumin modulated inflammation via upregulation of TGF-β and reciprocal regulation of iNOS and COX2. The study suggests that during long term effect, curcumin leads to prevention of cancer by inducing phase-II antioxidant enzymes via activation of Nrf2 signalling, restoration of tumour suppressor p53 and modulation of inflammatory mediators like iNOS and COX2 in liver of lymphoma bearing mice.
Análisis genético en APC, KRAS y TP53 en pacientes con cáncer de estómago y colon
Directory of Open Access Journals (Sweden)
K.A. Palacio-Rúa
2014-04-01
Conclusión: Las mutaciones en los genes APC, KRAS y TP53 fueron más comunes en el CCR que en el CE; nuestros resultados indican la existencia de diferentes vías genéticas en la carcinogénesis del CE y del CCR, y revelan una frecuencia de mutaciones particular en los pacientes colombianos estudiados, que podría estar influida por factores ambientales y étnicos, y el estilo de vida de esta población.
The potential for tumor suppressor gene therapy in head and neck cancer.
Birkeland, Andrew C; Ludwig, Megan L; Spector, Matthew E; Brenner, J Chad
2016-01-01
Head and neck squamous cell carcinoma remains a highly morbid and fatal disease. Importantly, genomic sequencing of head and neck cancers has identified frequent mutations in tumor suppressor genes. While targeted therapeutics increasingly are being investigated in head and neck cancer, the majority of these agents are against overactive/overexpressed oncogenes. Therapy to restore lost tumor suppressor gene function remains a key and under-addressed niche in trials for head and neck cancer. Recent advances in gene editing have captured the interest of both the scientific community and the public. As our technology for gene editing and gene expression modulation improves, addressing lost tumor suppressor gene function in head and neck cancers is becoming a reality. This review will summarize new techniques, challenges to implementation, future directions, and ethical ramifications of gene therapy in head and neck cancer.
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
Zhao, Yongzhong; Epstein, Richard J
2011-05-01
Familial tumor suppressor genes comprise two subgroups: caretaker genes (CTs) that repair DNA, and gatekeeper genes (GKs) that trigger cell death. Since GKs may also induce cell cycle delay and thus enhance cell survival by facilitating DNA repair, we hypothesized that the prosurvival phenotype of GKs could be selected during cancer progression, and we used a multivariable systems biology approach to test this. We performed multidimensional data analysis, non-negative matrix factorization and logistic regression to compare the features of GKs with those of their putative antagonists, the proto-oncogenes (POs), as well as with control groups of CTs and functionally unrelated congenital heart disease genes (HDs). GKs and POs closely resemble each other, but not CTs or HDs, in terms of gene structure (Pexpression level and breadth (Pimplied suggest a common functional attribute that is strongly negatively selected-that is, a shared phenotype that enhances cell survival. The counterintuitive finding of similar evolutionary pressures affecting GKs and POs raises an intriguing possibility: namely, that cancer microevolution is accelerated by an epistatic cascade in which upstream suppressor gene defects subvert the normal bifunctionality of wild-type GKs by constitutively shifting the phenotype away from apoptosis towards survival. If correct, this interpretation would explain the hitherto unexplained phenomenon of frequent wild-type GK (for example, p53) overexpression in tumors.
Alterations in the K-ras and p53 genes in rat lung tumors
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others
1997-06-01
Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.
International Nuclear Information System (INIS)
Cavallone, Luca; Arcand, Suzanna L; Maugard, Christine; Ghadirian, Parviz; Mes-Masson, Anne-Marie; Provencher, Diane; Tonin, Patricia N
2008-01-01
The TP53 polymorphisms Arg72Pro (Ex4+199 G>C) and Ins16 (IVS3+24 ins16) have been proposed to modify risk of breast cancer associated with germline BRCA1 and BRCA2 mutations. Allele frequencies of these polymorphisms were investigated to determine if they modify risk in BRCA mutation carriers in breast cancer cases drawn from French Canadian cancer families, a population shown to exhibit strong founder effects. The frequencies of the TP53 alleles, genotypes and haplotypes of 157 index breast cancer cases comprised of 42 BRCA1 mutation carriers, 57 BRCA2 mutation carriers, and 58 BRCA mutation-negative cases, where each case was drawn from independently ascertained families were compared. The effect of TP53 variants on the age of diagnosis was also investigated for these groups. The TP53 polymorphisms were also investigated in 112 women of French Canadian descent with no personal history of cancer. The BRCA mutation-positive groups had the highest frequency of homozygous carriers of the 72Pro allele compared with mutation-negative group. The TP53 polymorphisms exhibited linkage disequilibrium (p < 0.001), where the 72Arg and Ins16minus alleles occurred in strong disequilibrium. The highest frequency of carriers of Ins16minus-72Arg haplotype occurred in the BRCA mutation-negative groups. The BRCA1 mutation carriers homozygous for the 72Pro allele had the youngest ages of diagnosis of breast cancer. However none of these observations were statistically significant. In contrast, the BRCA2 mutation carriers homozygous for the 72Pro allele had a significantly older age of diagnosis of breast cancer (p = 0.018). Moreover, in this group, the mean age of diagnosis of breast cancer in carriers of the Ins16minus-72Arg haplotype was significantly younger than that of the individuals who did not this carry this haplotype (p = 0.009). We observed no significant association of breast cancer risk with TP53 genetic variants based on BRCA1/2 mutation carrier status. Although the
Directory of Open Access Journals (Sweden)
Edenir Inêz Palmero
2016-01-01
Full Text Available Abstract In Brazil, breast cancer is a public health care problem due to its high incidence and mortality rates. In this study, we investigated the prevalence of hereditary breast cancer syndromes (HBCS in a population-based cohort in Brazils southernmost capital, Porto Alegre. All participants answered a questionnaire about family history (FH of breast, ovarian and colorectal cancer and those with a positive FH were invited for genetic cancer risk assessment (GCRA. If pedigree analysis was suggestive of HBCS, genetic testing of the BRCA1, BRCA2, TP53, and CHEK2 genes was offered. Of 902 women submitted to GCRA, 214 had pedigrees suggestive of HBCS. Fifty of them underwent genetic testing: 18 and 40 for BRCA1/BRCA2 and TP53 mutation screening, respectively, and 7 for CHEK2 1100delC testing. A deleterious BRCA2 mutation was identified in one of the HBOC probands and the CHEK2 1100delC mutation occurred in one of the HBCC families. No deleterious germline alterations were identified in BRCA1 or TP53. Although strict inclusion criteria and a comprehensive testing approach were used, the suspected genetic risk in these families remains unexplained. Further studies in a larger cohort are necessary to better understand the genetic component of hereditary breast cancer in Southern Brazil.
Ifere, Godwin O.; Equan, Anita; Gordon, Kereen; Nagappan, Peri; Igietseme, Joseph U.; Ananaba, Godwin A.
2010-01-01
Background The purpose of our study was to show the distinction between the apoptotic and anti-proliferative signaling of phytosterols and cholesterol enrichment in prostate cancer cell lines, mediated by the differential transcription of caveolin-1, and N-myc downstream regulated gene1 (NDRG1), a pro-apoptotic androgen-regulated tumor suppressor. Methods PC-3 and DU145 cells were treated with sterols (cholesterol and phytosterols) for 72 h, followed by trypan blue dye exclusion measurement of necrosis and cell growth measured with a Coulter counter. Sterol induction of cell growth-suppressor gene expression was evaluated by mRNA transcription using RT-PCR, while cell cycle analysis was performed by FACS analysis. Altered expression of Ndrg1 protein was confirmed by Western blot analysis. Apoptosis was evaluated by real time RT-PCR amplification of P53, Bcl-2 gene and its related pro- and anti-apoptotic family members. Results Physiological doses (16 µM) of cholesterol and phytosterols were not cytotoxic in these cells. Cholesterol enrichment promoted cell growth (Pphytosterols significantly induced growth-suppression (Pphytosterols decreased mitotic subpopulations. We demonstrated for the first time that cholesterols concertedly attenuated the expression of caveolin-1(cav-1) and NDRG1 genes in both prostate cancer cell lines. Phytosterols had the opposite effect by inducing overexpression of cav-1, a known mediator of androgen-dependent signals that presumably control cell growth or apoptosis. Conclusions Cholesterol and phytosterol treatment differentially regulated the growth of prostate cancer cells and the expression of p53 and cav-1, a gene that regulates androgen-regulated signals. These sterols also differentially regulated cell cycle arrest, downstream pro-apoptotic androgen-regulated tumor-suppressor, NDRG1 suggesting that cav-1 may mediate pro-apoptotic NDRG1 signals. Elucidation of the mechanism for sterol modulation of growth and apoptosis signaling
DEFF Research Database (Denmark)
Burgdorf, Kristoffer Sølvsten; Grarup, Niels; Justesen, Johanne Marie
2011-01-01
2 diabetes in the Danish samples. However, for all nine variants the estimate of increase in type 2 diabetes risk was observed for the same allele as previously reported. In a meta-analysis of published and online data including 55,521 Europeans the G-allele of rs1042522 in TP53 showed significant...... replicated associations in meta-analyses. Furthermore, we evaluated the impact on diabetes-related intermediate traits in a population-based sample of middle-aged Danes. Methods: We genotyped nine lead variants in the seven genes in 4,973 glucose-tolerant and 3,612 type 2 diabetes Danish individuals. In meta...... association with type 2 diabetes (OR = 1.06 95% CI 1.02–1.11, p = 0.0032). No substantial associations with diabetes-related intermediary phenotypes were found. Conclusion: The G-allele of TP53 rs1042522 is associated with an increased prevalence of type 2 diabetes in a combined analysis of 55,521 Europeans....
Moonen, P.M.J.; Bakkers, J.M.J.E.; Kiemeney, L.A.L.M.; Schalken, J.A.; Melchers, W.J.G.; Witjes, J.A.
2007-01-01
OBJECTIVES: High-risk human papilloma virus (HPV) types stimulate degradation and deactivation of protein associated with the p53 tumour suppressor gene via the ubiquitin-dependent pathway. For a long time, changes of the p53 tumour suppressor gene have been correlated with poor clinical outcome in
Abstract We determined the TP53 and codon 12 KRAS mutations in lung tumors from 24 nonsmokers whose tumors were associated with exposure to smoky coal. Among any tumors studied previously, these showed the highest percentage of mutations that (a) were G -+ T transver...
miR-339-5p regulates the p53 tumor-suppressor pathway by targeting MDM2
DEFF Research Database (Denmark)
Jansson, M D; Djodji Damas, Nkerorema; Lees, M
2014-01-01
MicroRNAs (miRNAs) regulate many key cancer-relevant pathways and may themselves possess oncogenic or tumor-suppressor functions. Consequently, miRNA dysregulation has been shown to be a prominent feature in many human cancers. The p53 tumor suppressor acts as a negative regulator of cell prolife...... tumor cells. Furthermore, we show that a negative correlation between miR-339-5p and MDM2 expression exists in human cancer, implying that the interaction is important for cancer development.Oncogene advance online publication, 2 June 2014; doi:10.1038/onc.2014.130....
Hereditary Ovarian Cancer: Not Only BRCA 1 and 2 Genes
Directory of Open Access Journals (Sweden)
Angela Toss
2015-01-01
Full Text Available More than one-fifth of ovarian tumors have hereditary susceptibility and, in about 65–85% of these cases, the genetic abnormality is a germline mutation in BRCA genes. Nevertheless, several other suppressor genes and oncogenes have been associated with hereditary ovarian cancers, including the mismatch repair (MMR genes in Lynch syndrome, the tumor suppressor gene, TP53, in the Li-Fraumeni syndrome, and several other genes involved in the double-strand breaks repair system, such as CHEK2, RAD51, BRIP1, and PALB2. The study of genetic discriminators and deregulated pathways involved in hereditary ovarian syndromes is relevant for the future development of molecular diagnostic strategies and targeted therapeutic approaches. The recent development and implementation of next-generation sequencing technologies have provided the opportunity to simultaneously analyze multiple cancer susceptibility genes, reduce the delay and costs, and optimize the molecular diagnosis of hereditary tumors. Particularly, the identification of mutations in ovarian cancer susceptibility genes in healthy women may result in a more personalized cancer risk management with tailored clinical and radiological surveillance, chemopreventive approaches, and/or prophylactic surgeries. On the other hand, for ovarian cancer patients, the identification of mutations may provide potential targets for biologic agents and guide treatment decision-making.
Influence of anticancer drugs on interactions of tumor suppressor protein p53 with DNA
Czech Academy of Sciences Publication Activity Database
Pivoňková, Hana; Němcová, Kateřina; Brázdová, Marie; Kašpárková, Jana; Brabec, Viktor; Fojta, Miroslav
2005-01-01
Roč. 272, Suppl. 1 (2005), s. 562 ISSN 1474-3833. [FEBS Congress /30./ and IUBMB Conference /9./. 02.07.2005-07.07.2005, Budapest] R&D Projects: GA MZd(CZ) NC7574 Institutional research plan: CEZ:AV0Z50040507 Keywords : tumour suppressor protein p53 * anticancer drugs * interaction with DNA Subject RIV: BO - Biophysics
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2002-07-01
The p53 tumor suppressor is a tetrameric transcription factor that is post-translational modified at {approx}18 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review the posttranslational modifications to p53 and the pathways that produce them in response to both genotoxic and non-genotoxic stresses.
Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation
International Nuclear Information System (INIS)
Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY
1996-01-01
Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)
INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.
2003-01-01
Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy
Al-Shamsi, Humaid O.; Jones, Jeremy; Fahmawi, Yazan; Dahbour, Ibrahim; Tabash, Aziz; Abdel-Wahab, Reham; Abousamra, Ahmed O. S.; Shaw, Kenna R.; Xiao, Lianchun; Hassan, Manal M.; Kipp, Benjamin R.; Kopetz, Scott; Soliman, Amr S.; McWilliams, Robert R.; Wolff, Robert A.
2016-01-01
Background The frequency rates of mutations such as KRAS, NRAS, BRAF, and PIK3CA in colorectal cancer (CRC) differ among populations. The aim of this study was to assess mutation frequencies in the Arab population and determine their correlations with certain clinicopathological features. Methods Arab patients from the Arab Gulf region and a population of age- and sex-matched Western patients with CRC whose tumors were evaluated with next-generation sequencing (NGS) were identified and retrospectively reviewed. The mutation rates of KRAS, NRAS, BRAF, PIK3CA, TP53, and APC were recorded, along with clinicopathological features. Other somatic mutation and their rates were also identified. Fisher’s exact test was used to determine the association between mutation status and clinical features. Results A total of 198 cases were identified; 99 Arab patients and 99 Western patients. Fifty-two point seven percent of Arab patients had stage IV disease at initial presentation, 74.2% had left-sided tumors. Eighty-nine point two percent had tubular adenocarcinoma and 10.8% had mucinous adenocarcinoma. The prevalence rates of KRAS, NRAS, BRAF, PIK3CA, TP53, APC, SMAD, FBXW7 mutations in Arab population were 44.4%, 4%, 4%, 13.1%, 52.5%, 27.3%, 2% and 3% respectively. Compared to 48.4%, 4%, 4%, 12.1%, 47.5%, 24.2%, 11.1% and 0% respectively in matched Western population. Associations between these mutations and patient clinicopathological features were not statistically significant. Conclusions This is the first study to report comprehensive hotspot mutations using NGS in Arab patients with CRC. The frequency of KRAS, NRAS, BRAF, TP53, APC and PIK3CA mutations were similar to reported frequencies in Western population except SMAD4 that had a lower frequency and higher frequency of FBXW7 mutation. PMID:28078112
Directory of Open Access Journals (Sweden)
Arindam Datta
2016-06-01
Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
International Nuclear Information System (INIS)
Olafsen, Tove; Bruland, Oeyvind S.; Zalutsky, Michael R.; Sandlie, Inger
1995-01-01
Monoclonal antibodies TP-1 and TP-3 are of potential utility for the radioimmunodiagnosis of osteosarcoma in both human and canine patients. The V genes of these antibodies were cloned and sequenced and to facilitate radiolabeling of these proteins, the location of the lysine residues within these sequences have been determined. The V-domains of TP-1 contain a total of 12 lysines, 10 in the framework region and 2 in the CDR region, while the V-domains of TP-3 contain a total of 14 lysines, 11 in the framework region and 3 in the CDR regions. Using space-filling models, the availability of each lysine residue for radiolabeling, and potential interference with antigen binding was predicted
Energy Technology Data Exchange (ETDEWEB)
Olafsen, Tove; Bruland, Oeyvind S.; Zalutsky, Michael R.; Sandlie, Inger
1995-08-01
Monoclonal antibodies TP-1 and TP-3 are of potential utility for the radioimmunodiagnosis of osteosarcoma in both human and canine patients. The V genes of these antibodies were cloned and sequenced and to facilitate radiolabeling of these proteins, the location of the lysine residues within these sequences have been determined. The V-domains of TP-1 contain a total of 12 lysines, 10 in the framework region and 2 in the CDR region, while the V-domains of TP-3 contain a total of 14 lysines, 11 in the framework region and 3 in the CDR regions. Using space-filling models, the availability of each lysine residue for radiolabeling, and potential interference with antigen binding was predicted.
Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.
Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen
2017-10-15
Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
DEFF Research Database (Denmark)
Wu, Kui; Zhang, Xin; Li, Fuqiang
2015-01-01
significantly mutated genes are identified, including the most commonly mutated gene TP53 and novel mutation targets such as RHPN2, GLI3 and MRC2. TP53 mutations are furthermore significantly enriched in tumours from patients harbouring metastases. Genes regulating cytoskeleton remodelling processes are also...
Giant Subependymoma Developed in a Patient with Aniridia: Analyses of PAX6 and Tumor-relevant Genes
Maekawa, Motoko; Fujisawa, Hironori; Iwayama, Yoshimi; Tamase, Akira; Toyota, Tomoko; Osumi, Noriko; Yoshikawa, Takeo
2010-01-01
We observed an unusually large subependymoma in a female patient with congenital aniridia. To analyze the genetic mechanisms of tumorigenesis, we first examined the paired box 6 (PAX6) gene using both tumor tissue and peripheral lymphocytes. Tumor suppressor activity has been proposed for PAX6 in gliomas, in addition to its well-known role in the eye development. Using genomic quantitative PCR and loss of heterozygosity analysis, we identified hemizygous deletions in the 5′-region of PAX6. In lymphocytes, the deletion within PAX6 spanned from between exons 6 and 7 to the 5′-upstream region of the gene, but did not reach the upstream gene, RNC1, which is reported to be associated with tumors. The subependymoma had an additional de novo deletion spanning from the intron 4 to intron 6 of PAX6, although we could not completely determine whether these two deletions are on the same chromosome or not. We also examined other potentially relevant tumor suppressor genes: PTEN, TP53 and SOX2. However, we detected no exonic mutations or deletions in these genes. Collectively, we speculate that the defect in PAX6 may have contributed to the extremely large size of the subependymoma, due to a loss of tumor suppressor activity in glial cell lineage. PMID:20500513
Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model
International Nuclear Information System (INIS)
Tong, Ying; Smith, M.A.; Tucker, S.B.
1997-01-01
Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab
Davelaar, Akueni L.; Calpe, Silvia; Lau, Liana; Timmer, Margriet R.; Visser, Mike; ten Kate, Fiebo J.; Parikh, Kaushal B.; Meijer, Sybren L.; Bergman, Jacques J.; Fockens, Paul; Krishnadath, Kausilia K.
2015-01-01
Barrett's esophagus (BE) goes through a sequence of low grade dysplasia (LGD) and high grade dysplasia (HGD) to esophageal adenocarcinoma (EAC). The current gold standard for BE outcome prediction, histopathological staging, can be unreliable. TP53 abnormalities may serve as prognostic biomarkers.
Davelaar, Akueni L.; Calpe, Silvia; Lau, Liana; Timmer, Margriet R.; Visser, Mike; ten Kate, Fiebo J.; Parikh, Kaushal B.; Meijer, Sybren L.; Bergman, Jacques J.; Fockens, Paul; Krishnadath, Kausilia K.
2015-01-01
Barrett's esophagus (BE) goes through a sequence of low grade dysplasia (LGD) and high grade dysplasia (HGD) to esophageal adenocarcinoma (EAC). The current gold standard for BE outcome prediction, histopathological staging, can be unreliable. TP53 abnormalities may serve as prognostic biomarkers.
Liu, Dongjing; Schwender, Holger; Wang, Mengying; Wang, Hong; Wang, Ping; Zhu, Hongping; Zhou, Zhibo; Li, Jing; Wu, Tao; Beaty, Terri H
2018-03-01
Small ubiquitin-like modification, also known as sumoylation, is a crucial post-translational regulatory mechanisms involved in development of the lip and palate. Recent studies reported two sumoylation target genes, MSX1 and TP63, to have achieved genome-wide level significance in tests of association with nonsyndromic clefts. Here, we performed a candidate gene analysis considering gene-gene and gene-environment interaction for SUMO1, MSX1, and TP63 to further explore the etiology of nonsyndromic cleft lip with or without cleft palate (NSCL/P). A total of 130 single-nucleotide polymorphisms (SNPs) in or near SUMO1, MSX1, and TP63 was analyzed among 1,038 Asian NSCL/P trios ascertained through an international consortium. Conditional logistic regression models were used to explore gene-gene (G × G) and gene-environment (G × E) interaction involving maternal environmental tobacco smoke and multivitamin supplementation. Bonferroni correction was used for G × E analysis and permutation tests were used for G × G analysis. While transmission disequilibrium tests and gene-environment interaction analysis showed no significant results, we did find signals of gene-gene interaction between SNPs near MSX1 and TP63. Three pairwise interactions yielded significant p values in permutation tests (rs884690 and rs9290890 with p = 9.34 × 10 -5 and empirical p = 1.00 × 10 -4 , rs1022136 and rs4687098 with p = 2.41 × 10 -4 and empirical p = 2.95 × 10 -4 , rs6819546 and rs9681004 with p = 5.15 × 10 -4 and empirical p = 3.02 × 10 -4 ). Gene-gene interaction between MSX1 and TP63 may influence the risk of NSCL/P in Asian populations. Our study provided additional understanding of the genetic etiology of NSCL/P and underlined the importance of considering gene-gene interaction in the etiology of this common craniofacial malformation. © 2018 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Alfredo Maurício Batista De-Paula
2006-08-01
vias moleculares independentes.BACKGROUND: Oral carcinogenesis is a multistep process in which genetic events lead to the disruption of the normal regulatory pathways that control basic cellular functions. Epidermoid carcinoma of oral cavity (ECOC appears as a consequence of multiple molecular events induced by the effects of several carcinogens influenced by environmental factors against a background of genetic resistance or susceptibility. Consequent genetic damage affects many chromosomes and genes, and the accumulation of these changes seems to lead to ECOC. OBJECTIVES: The aim of the present study was to assess the clinical and morphological value of p53 and p16 immunolocalization at the invasive tumor front in a representative series of 35 routinely processed ECOC. MATERIAL AND METHODS: Samples of ECOC were investigated in this study. TNM system was employed for clinical staging and the invasive front grading system was employed for morphological grading of the lesions. Immunohistochemical technique in paraffin-embedded and formalin-fixed tissues was utilized to immunolocalization of p53 and p16 proteins. Counts were performed and submitted to specific statistical treatments. RESULTS: p53 and p16 immunolocalizations were detected in 63% and 66%, respectively, of 35 carcinomas studied. No correlation was found between p53 and p16 expressions and clinico-morphological parameters statistically analyzed. No correlation was found between the relationship p53/p16 expressions. CONCLUSION: p53 and p16 immunolocalization did not influence the clinico-morphological parameters analyzed in this study and apparently do not represent a molecular basis for the biologic significance of the invasive tumor front. Lack of a strong correlation between p53 and p16 immunolocalization suggests that both could participate in biological activities in the cell cycle control by independent molecular pathways.
NSAIDs modulate CDKN2A, TP53, and DNA content risk for progression to esophageal adenocarcinoma.
Directory of Open Access Journals (Sweden)
Patricia C Galipeau
2007-02-01
Full Text Available Somatic genetic CDKN2A, TP53, and DNA content abnormalities are common in many human cancers and their precursors, including esophageal adenocarcinoma (EA and Barrett's esophagus (BE, conditions for which aspirin and other nonsteroidal anti-inflammatory drugs (NSAIDs have been proposed as possible chemopreventive agents; however, little is known about the ability of a biomarker panel to predict progression to cancer nor how NSAID use may modulate progression. We aimed to evaluate somatic genetic abnormalities with NSAIDs as predictors of EA in a prospective cohort study of patients with BE.Esophageal biopsies from 243 patients with BE were evaluated at baseline for TP53 and CDKN2A (p16 alterations, tetraploidy, and aneuploidy using sequencing; loss of heterozygosity (LOH; methylation-specific PCR; and flow cytometry. At 10 y, all abnormalities, except CDKN2A mutation and methylation, contributed to EA risk significantly by univariate analysis, ranging from 17p LOH (relative risk [RR] = 10.6; 95% confidence interval [CI] 5.2-21.3, p < 0.001 to 9p LOH (RR = 2.6; 95% CI 1.1-6.0, p = 0.03. A panel of abnormalities including 17p LOH, DNA content tetraploidy and aneuploidy, and 9p LOH was the best predictor of EA (RR = 38.7; 95% CI 10.8-138.5, p < 0.001. Patients with no baseline abnormality had a 12% 10-y cumulative EA incidence, whereas patients with 17p LOH, DNA content abnormalities, and 9p LOH had at least a 79.1% 10-y EA incidence. In patients with zero, one, two, or three baseline panel abnormalities, there was a significant trend toward EA risk reduction among NSAID users compared to nonusers (p = 0.01. The strongest protective effect was seen in participants with multiple genetic abnormalities, with NSAID nonusers having an observed 10-y EA risk of 79%, compared to 30% for NSAID users (p < 0.001.A combination of 17p LOH, 9p LOH, and DNA content abnormalities provided better EA risk prediction than any single TP53, CDKN2A, or DNA content
Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines
DEFF Research Database (Denmark)
Liu, Ying; Bodmer, Walter F
2006-01-01
A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.
Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna
2018-03-01
Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Rivu, Sanzana Fareen; Apu, Mohd Nazmul Hasan; Shabnaz, Samia; Nahid, Noor Ahmed; Islam, Md Reazul; Al-Mamun, Mir Md Abdullah; Nahar, Zabun; Rabbi, Sikder Nahidul Islam; Ahmed, Maizbha Uddin; Islam, Mohammad Safiqul; Hasnat, Abul
2017-08-01
Till now no pharmacogenetic study of TP53 codon 72 (Arg72Pro) and CDH1 rs16260 (-160Ccolorectal cancer. So the aim of the study is to determine whether there is an elevated risk of colorectal cancer development with TP53 codon 72 and CDH1 rs16260 genetic polymorphism in Bangladeshi population for the first time. To investigate the association of these two SNPs, we conducted a case-control study with 288 colorectal cancer patients and 295 healthy volunteers by using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) method. We found an increased risk of association between Arg/Pro heterozygosity (adjusted OR=2.58, 95% CI=1.77-3.77, pcolorectal cancer predisposition. In case of CDH1 rs16260 polymorphism, C/A heterozygous and A/A mutant homozygous are significantly (pcolorectal cancer risk with adjusted OR of 1.94 and 2.63, respectively. The combined genotype of C/A and A/A was also found to be strongly associated with colorectal cancer risk compared to C/C genotype (adjusted OR=2.02, 95% CI=1.42-2.87, pcolorectal cancer development in Bangladeshi population. Copyright © 2017 Elsevier Ltd. All rights reserved.
Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.
Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi
2016-04-01
P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Directory of Open Access Journals (Sweden)
Walter Arancio
2015-01-01
Full Text Available It has been suggested that cancer stem cells (CSC may play a central role in oncogenesis, especially in undifferentiated tumours. Anaplastic thyroid carcinoma (ATC has characteristics suggestive of a tumour enriched in CSC. Previous studies suggested that the stem cell factor SOX2 has a preeminent hierarchical role in determining the characteristics of stem cells in SW1736 ATC cell line. In detail, silencing SOX2 in SW1736 is able to suppress the expression of the stem markers analysed, strongly sensitizing the line to treatment with chemotherapeutic agents. Therefore, in order to further investigate the role of SOX2 in ATC, a competing endogenous RNA (ceRNA analysis was conducted in order to isolate new functional partners of SOX2. Among the interactors, of particular interest are genes involved in the biogenesis of miRNAs (DICER1, RNASEN, and EIF2C2, in the control cell cycle (TP53, CCND1, and in mitochondrial activity (COX8A. The data suggest that stemness, microRNA biogenesis and functions, p53 regulatory network, cyclin D1, and cell cycle control, together with mitochondrial activity, might be coregulated.
Mastellaro, Maria J; Seidinger, Ana L; Kang, Guolian; Abrahão, Renata; Miranda, Eliana C M; Pounds, Stanley B; Cardinalli, Izilda A; Aguiar, Simone S; Figueiredo, Bonald C; Rodriguez-Galindo, Carlos; Brandalise, Silvia R; Yunes, José A; Barros-Filho, Antônio de A; Ribeiro, Raul C
2017-08-15
The tumor protein p53 (TP53) arginine-to-histidine mutation at codon 337 (R337H) predisposes children to adrenocortical tumors (ACTs) and, rarely, to other childhood tumors, but its impact on adult cancer remains undetermined. The objective of this study was to investigate the frequency and types of cancer in relatives of children with ACT who carry the TP53 R337H mutation. TP53 R337H testing was offered to relatives of probands with ACT. The parental lineage segregating the R337H mutation was identified in all families. The frequency and distribution of cancer types were compared according to R337H status. The authors' data also were compared with those publicly available for children with TP53 mutations other than R337H. The mean and median follow-up times for the probands with ACT were 11.2 years and 9.7 years (range, 3-32 years), respectively. During this time, cancer was diagnosed in 12 of 81 first-degree relatives (14.8%) carrying the R337H mutation but in only 1 of 94 noncarriers (1.1%; P = .0022). At age 45 years, the cumulative risk of cancer was 21% (95% confidence interval, 5%-33%) in carriers and 2% (95% confidence interval, 0%-4%) in noncarriers (P = .008). The frequency of cancer was higher in the R337H segregating lineages than in the nonsegregating lineages (249 of 1410 vs 66 of 984 individuals; P cancer were the most common types. TP53 R337H carriers have a lifelong predisposition to cancer with a bimodal age distribution: 1 peak, represented by ACT, occurs in the first decade of life, and another peak of diverse cancer types occurs in the fifth decade. The current findings have implications for genetic counseling and surveillance of R337H carriers. Cancer 2017;123:3150-58. © 2017 American Cancer Society. © 2017 American Cancer Society.
Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.
Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick
2003-08-01
Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its
Genomic instability--an evolving hallmark of cancer.
Negrini, Simona; Gorgoulis, Vassilis G; Halazonetis, Thanos D
2010-03-01
Genomic instability is a characteristic of most cancers. In hereditary cancers, genomic instability results from mutations in DNA repair genes and drives cancer development, as predicted by the mutator hypothesis. In sporadic (non-hereditary) cancers the molecular basis of genomic instability remains unclear, but recent high-throughput sequencing studies suggest that mutations in DNA repair genes are infrequent before therapy, arguing against the mutator hypothesis for these cancers. Instead, the mutation patterns of the tumour suppressor TP53 (which encodes p53), ataxia telangiectasia mutated (ATM) and cyclin-dependent kinase inhibitor 2A (CDKN2A; which encodes p16INK4A and p14ARF) support the oncogene-induced DNA replication stress model, which attributes genomic instability and TP53 and ATM mutations to oncogene-induced DNA damage.
DEFF Research Database (Denmark)
Møller, Michael Boe; Ino, Y; Gerdes, A M
1999-01-01
The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Møller, Michael B; Tzankov, Alexander
2013-01-01
MDM2 is a key negative regulator of the tumor suppressor p53, however, the prognostic significance of MDM2 overexpression in diffuse large B-cell lymphoma (DLBCL) has not been defined convincingly. In a p53 genetically-defined large cohort of de novo DLBCL patients treated with rituximab, cycloph...
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Wu, Lin; Visco, Carlo
2012-01-01
TP53 mutation is an independent marker of poor prognosis in patients with diffuse large B-cell lymphoma (DLBCL) treated with cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone (CHOP) therapy. However, its prognostic value in the rituximab immunochemotherapy era remains undefined. ...... for stratifying R-CHOP-treated patients into distinct prognostic subsets and has significant value in the design of future therapeutic strategies....
p53 and the pathogenesis of skin cancer
International Nuclear Information System (INIS)
Benjamin, Cara L.; Ananthaswamy, Honnavara N.
2007-01-01
The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients
Mitofusin-2 is a novel direct target of p53
International Nuclear Information System (INIS)
Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen
2010-01-01
Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.
Alsbeih, Ghazi A; Al-Harbi, Najla M; Bin Judia, Sara S; Khoja, Hatim A; Shoukri, Mohamed M; Tulbah, Asma M
2017-07-01
Cervical cancer is a predominantly human papillomavirus (HPV)-driven disease worldwide. However, its incidence is unexplainably low in western Asia, including Saudi Arabia. Using this paradigm, we investigated the role of HPV infection rate and host genetic predisposition in TP53 G72C single nucleotide polymorphism (SNP) presumed to affect cancer incidence. Patients treated between 1990 and 2012 were reviewed, and a series of 232 invasive cervical cancer cases were studied and compared with 313 matched controls without cancer. SNP was genotyped by way of direct sequencing. HPV linear array analysis was used to detect and genotype HPV in tumor samples. The incidence of cervical cancer revealed bimodal peaks at 42.5 years, with a slighter rebound at 60.8 years. Among all cases, 77% were HPV-positive and 16 HPV genotypes were detected-mostly genotypes 16 (75%) and 18 (9%)-with no difference by age, histology, or geographical region. Although the TP53 G72C genotype was not associated with overall cervical cancer risk, it was significantly associated with HPV positivity (odds ratio, 0.57; 95% confidence interval, 0.36-0.90; P = .016). Furthermore, the variant C allele was significantly overtransmitted in the population (P Cervical cancer incidence displays bimodal curve peaking at a young age with secondary rebound at older age. The combination of relative low HPV infection and variant TP53 72C allele overtransmission provide a plausible explanation for the low incidence of cervical cancer in our population. Therefore, HPV screening and host SNP genotyping may provide more relevant biomarkers to gauge the risk of developing cervical cancer. Cancer 2017;123:2459-66. © 2017 American Cancer Society. © 2017 The Authors. Cancer published by Wiley Periodicals, Inc. on behalf of American Cancer Society.
Czech Academy of Sciences Publication Activity Database
Paleček, Emil; Černocká, Hana; Ostatná, Veronika; Navrátilová, Lucie; Brázdová, Marie
2014-01-01
Roč. 828, MAY2014 (2014), s. 1-8 ISSN 0003-2670 R&D Projects: GA ČR(CZ) GAP301/11/2055; GA ČR(CZ) GA13-00956S; GA ČR(CZ) GA13-36108S Institutional support: RVO:68081707 Keywords : Deoxyribonucleic acid-protein binding * Tumor suppressor protein p53 * Electrochemical sensing Subject RIV: BO - Biophysics Impact factor: 4.513, year: 2014
Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors
International Nuclear Information System (INIS)
Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.
2010-01-01
Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)
DEFF Research Database (Denmark)
Dahlgaard, Katja; Troelsen, Jesper
2018-01-01
Several tumor suppressors possess gene regulatory activity. Here, we describe how promoter and promoter/enhancer reporter assays can be used to characterize a colorectal tumor suppressor proteins’ gene regulatory activity of possible target genes. In the first part, a bioinformatic approach...... of the quick and efficient In-Fusion cloning method, and how to carry out transient transfections of Caco-2 colon cancer cells with the produced luciferase reporter plasmids using polyethyleneimine (PEI). A plan describing how to set up and carry out the luciferase expression assay is presented. The luciferase...... to identify relevant gene regulatory regions of potential target genes is presented. In the second part, it is demonstrated how to prepare and carry out the functional assay. We explain how to clone the bioinformatically identified gene regulatory regions into luciferase reporter plasmids by the use...
Yang, Guan-Jun; Zhong, Hai-Jing; Ko, Chung-Nga; Wong, Suk-Yu; Vellaisamy, Kasipandi; Ye, Min; Ma, Dik-Lung; Leung, Chung-Hang
2018-03-06
The rhodium(iii) complex 1 was identified as a potent Wee1 inhibitor in vitro and in cellulo. It decreased Wee1 activity and unscheduled mitotic entry, and induced cell damage and death in TP53-mutated triple-negative breast cancer cells. 1 represents a promising scaffold for further development of more potent metal-based Wee1 antagonists.
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
Hormonal control of p53 and chemoprevention
International Nuclear Information System (INIS)
Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C
2002-01-01
Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer
Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna
2015-08-01
Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0-8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at lower doses whereas wild type cells only at higher doses. Secretion of IL-8 by TP53-/- control cells was many times lower than that by TP53+/+ but increased significantly after irradiation. Transcription of the NFκBIA was induced in irradiated TP53+/+ mainly, but in bystanders a higher level was observed in TP53-/- cells, suggesting that TP53 is required for induction of NFκB pathway after irradiation but another mechanism of activation must operate in
Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.
Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A
1990-11-30
Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.
Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan
2002-04-10
We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Gonzalez, Francisco; Loidi, Lourdes; Abalo-Lojo, Jose M
2017-01-01
Ankyloblepharon-ectodermal dysplasia-cleft lip/palate (AEC) syndrome is a disorder resulting from anomalous embryonic development of ectodermal tissues. There is evidence that AEC syndrome is caused by mutations in the TP63 gene, which encodes the p63 protein. This is an important regulatory protein involved in epidermal proliferation and differentiation. Genome sequencing was performed in DNA from peripheral blood leukocytes of a newborn with AEC syndrome and her parents. Variants were searched in all coding exons and intron-exon boundaries of the TP63 gene. A heterozygous missense variant (NM_003722.4:c.1063G>C (p.Asp355His) was found in the newborn patient. No variants were found in either of the parents. We identified a previously unreported variant in TP63 gene which seems to be involved in the somatic malformations found in the AEC syndrome. The absence of this variant in both parents suggests that the variant appeared de novo.
Directory of Open Access Journals (Sweden)
Fatma Ashour
2018-06-01
Full Text Available Background and Objectives: Breast cancer (BC is classified according to estrogen receptor (ER status into ER+ and ER− tumors. ER+ tumors have a worse response to chemotherapy compared to ER− tumors. BCL-2, TP53, BAX and NF-ΚB are involved in drug resistance in the ER+ tumors. Recently it was shown that Cancer Stem Cells (CSCs play an important role in drug resistance. In this study we tested the hypothesis that CSCs of the ER+ tumors resist drug through the overexpression of BCL-2, TP53, BAX and NF-ΚB. Methods: CSCs were isolated by anoikis resistance assay from MCF7 (ER+ and MDA-MB-231 (ER− cell lines. Isolated CSCs were treated with doxorubicin (DOX and the mRNA expression levels of BCL-2, TP53, BAX and NFKB were investigated by quantitative real time PCR (qPCR with and without treatment. Results: BCL-2, BAX and NF-ΚB showed decreased expression in MCF7 bulk cancer cells after DOX treatment whereas only BCL-2 and BAX showed decreased expression in MDA-MB-231 bulk cancer cells. Interestingly TP53 was the only gene showed a considerable increase in its expression in CSCs of the ER+ MCF7 cell line compared to bulk cancer cells. Moreover, TP53 was the only gene showing exceptionally higher level of expression in MCF7-CSCs compared to MDA-MB-231-CSCs. Conclusion: Our results suggest that CSCs in the ER+ cells escape the effect of DOX treatment by the elevation of p53 expression. Keywords: Breast cancer, Cancer Stem Cells, Drug resistance, Estrogen receptors
International Nuclear Information System (INIS)
Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna
2015-01-01
Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at
Energy Technology Data Exchange (ETDEWEB)
Widel, Maria, E-mail: maria.widel@polsl.pl [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Lalik, Anna; Krzywon, Aleksandra [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Poleszczuk, Jan [College of Inter-faculty Individual Studies in Mathematics and Natural Sciences, University of Warsaw, 93 Zwirki i Wigury Street, 02-089 Warsaw (Poland); Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida (United States); Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)
2015-08-15
Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at
Directory of Open Access Journals (Sweden)
Brett M. Lowenthal
2017-01-01
Full Text Available Medullary carcinoma has long been recognized as a subtype of colorectal cancer associated with microsatellite instability and Lynch syndrome. Gastric medullary carcinoma is a very rare neoplasm. We report a 67-year-old male who presented with a solitary gastric mass. Total gastrectomy revealed a well-demarcated, poorly differentiated carcinoma with an organoid growth pattern, pushing borders, and abundant peritumoral lymphocytic response. The prior cytology was cellular with immunohistochemical panel consistent with upper gastrointestinal/pancreaticobiliary origin. Overall, the histopathologic findings were consistent with gastric medullary carcinoma. A mismatch repair panel revealed a mismatch repair protein deficient tumor with loss of MLH1 and PMS2 expression. BRAF V600E immunostain (VE1 and BRAF molecular testing were negative, indicating a wild-type gene. Tumor sequencing of MLH1 demonstrated a wild-type gene, while our molecular panel identified TP53 c.817C>T (p.R273C mutation. These findings were compatible with a sporadic tumor. Given that morphologically identical medullary tumors often occur in Lynch syndrome, it is possible that mismatch repair loss is an early event in sporadic tumors with p53 mutation being a late event. Despite having wild-type BRAF, this tumor is sporadic and unrelated to Lynch syndrome. This case report demonstrates that coordinate ancillary studies are needed to resolve sporadic versus hereditary rare tumors.
A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.
Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R
2008-11-01
Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.
Ikegaki, Naohiko; Hicks, Sakeenah L; Regan, Paul L; Jacobs, Joshua; Jumbo, Amina S; Leonhardt, Payton; Rappaport, Eric F; Tang, Xao X
2014-01-01
Neuroblastoma is a common pediatric solid tumor that exhibits a striking clinical bipolarity: favorable and unfavorable. The survival rate of children with unfavorable neuroblastoma remains low among all childhood cancers. MYCN and MYC play a crucial role in determining the malignancy of unfavorable neuroblastomas, whereas high-level expression of the favorable neuroblastoma genes is associated with a good disease outcome and confers growth suppression of neuroblastoma cells. A small fraction of neuroblastomas harbors TP53 mutations at diagnosis, but a higher proportion of the relapse cases acquire TP53 mutations. In this study, we investigated the effect of S(+)-ibuprofen on neuroblastoma cell lines, focusing on the expression of the MYCN, MYC, AKT, p53 proteins and the favorable neuroblastoma genes in vitro as biomarkers of malignancy. Treatment of neuroblastoma cell lines with S(+)-ibuprofen resulted in a significant growth suppression. This growth effect was accompanied by a marked decrease in the expression of MYC, MYCN, AKT and an increase in p53 expression in neuroblastoma cell lines without TP53 mutation. In addition, S(+)-ibuprofen enhanced the expression of some favorable neuroblastoma genes (EPHB6, CD44) and genes involved in growth suppression and differentiation (EGR1, EPHA2, NRG1 and SEL1L). Gene expression profile and Ingenuity pathway analyses using TP53-mutated SKNAS cells further revealed that S(+)-ibuprofen suppressed molecular pathways associated with cell growth and conversely enhanced those of cell cycle arrest and the unfolded protein response. Collectively, these results suggest that S(+)-ibuprofen or its related compounds may have the potential for therapeutic and/or palliative use for unfavorable neuroblastoma.
Caceres, Gisela; McGraw, Kathy; Yip, Bon Ham; Pellagatti, Andrea; Johnson, Joseph; Zhang, Ling; Liu, Kenian; Zhang, Lan Min; Fulp, William J.; Lee, Ji-Hyun; Al Ali, Najla H.; Basiorka, Ashley; Smith, Larry J.; Daugherty, F. Joseph; Littleton, Neil; Wells, Richard A.; Sokol, Lubomir; Wei, Sheng; Komrokji, Rami S.; Boultwood, Jacqueline; List, Alan F.
2013-01-01
Stabilization of p53 in erythroid precursors in response to nucleosomal stress underlies the hypoplastic anemia in myelodysplastic syndromes (MDS) with chromosome 5q deletion [del(5q)]. We investigated whether cenersen, a clinically active 20-mer antisense oligonucleotide complementary to TP53 exon10, could suppress p53 expression and restore erythropoiesis in del(5q) MDS. Cenersen treatment of ribosomal protein S-14-deficient erythroblasts significantly reduced cellular p53 and p53-up-regulated modulator of apoptosis expression compared with controls, accompanied by a significant reduction in apoptosis and increased cell proliferation. In a two-stage erythroid differentiation assay, cenersen significantly suppressed nuclear p53 in bone marrow CD34+ cells isolated from patients with del(5q) MDS, whereas erythroid burst recovery increased proportionally to the magnitude of p53 suppression without evidence of del(5q) clonal suppression (r = −0.6; P = 0.005). To explore the effect of p53 suppression on erythropoiesis in vivo, dexamethasone, a glucocorticoid receptor-dependent p53 antagonist, was added to lenalidomide treatment in eight lower-risk, transfusion-dependent, del(5q) MDS patients with acquired drug resistance. Transfusion independence was restored in five patients accompanied by expansion of erythroid precursors and decreased cellular p53 expression. We conclude that targeted suppression of p53 could support effective erythropoiesis in lenalidomide-resistant del(5q) MDS. PMID:24043769
Directory of Open Access Journals (Sweden)
Hayder M. Al-kuraishy
2018-01-01
Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.
Van den Bossche, Jolien; Deben, Christophe; Op de Beeck, Ken; Deschoolmeester, Vanessa; Hermans, Christophe; De Pauw, Ines; Jacobs, Julie; Van Schil, Paul; Vermorken, Jan Baptist; Pauwels, Patrick; Peeters, Marc; Lardon, Filip; Wouters, An
2017-01-01
Background: Currently, prognosis of non-small cell lung cancer (NSCLC) patients is based on clinicopathological factors, including TNM stage. However, there are considerable differences in patient outcome within a similar staging group, even when patients received identical treatments. In order to improve prognostic predictions and to guide treatment options, additional parameters influencing outcome are required. Polo-like kinase 1 (Plk1), a master regulator of mitotic cell division and the DNA damage response, is considered as a new potential biomarker in this research area. While several studies reported Plk1 overexpression in a broad range of human malignancies, inconsistent results were published regarding the clinical significance hereof. A prognostic panel, consisting of Plk1 and additional biomarkers that are related to the Plk1 pathway, might further improve prediction of patient prognosis. Methods: In this study, we evaluated for the first time the prognostic value of Plk1 mRNA and protein expression in combination with the TP53 mutation status (next generation sequencing), induction of apoptotic cell death (immunohistochemistry for cleaved caspase 3) and hypoxia (immunohistochemistry for carbonic anhydrase IX (CA IX)) in 98 NSCLC adenocarcinoma patients. Results: Both Plk1 mRNA and protein expression and CA IX protein levels were upregulated in the majority of tumor samples. Plk1 mRNA and protein expression levels were higher in TP53 mutant samples, suggesting that Plk1 overexpression is, at least partially, the result of loss of functional p53 (<0.05). Interestingly, the outcome of patients with both Plk1 mRNA and CA IX protein overexpression, who also harbored a TP53 mutation, was much worse than that of patients with aberrant expression of only one of the three markers (p=0.001). Conclusion: The combined evaluation of Plk1 mRNA expression, CA IX protein expression and TP53 mutations shows promise as a prognostic panel in NSCLC patients. Moreover
International Nuclear Information System (INIS)
Haffty, Bruce G.; Goyal, Sharad; Kulkarni, Diptee; Green, Camille; Vazquez, Alexi; Schiff, Devora; Moran, Meena S.; Yang Qifeng; Ganesan, Shridar; Hirsfield, Kim M.
2011-01-01
Purpose: TP53BP1 is a key component of radiation-induced deoxyribonucleic acid damage repair. The purpose of this study was to evaluate the significance of a known common single nucleotide polymorphism in this gene (rs560191) in patients treated with breast-conserving surgery and whole-breast irradiation (BCS + RT). Methods and Materials: The population consisted of 176 premenopausal women treated with BCS + RT (median follow-up, 12 years). Genomic deoxyribonucleic acid was processed by use of TaqMan assays. Each allele for rs560191 was either C or G, so each patient was therefore classified as CC, CG, or GG. Patients were grouped as GG if they were homozygous for the variant G allele or CC-CG if they carried at least one copy of the common C allele (CC or CG). Results: Of the 176 women, 124 (71%) were CC-CG and 52 (29%) were GG. The mean age was 44 years for GG vs. 38 years for CC-CG (p < 0.001). GG was more common in African-American women than white women (69% vs. 13%, p < 0.001) and more commonly estrogen receptor negative (70% vs. 49%, p = 0.02). There were no significant correlations of rs560191 with other critical variables. Despite the fact that GG patients were older, the 10-year rate of local relapses was higher (22% for GG vs. 12% for CC-CG, p = 0.04). Conclusions: This novel avenue of investigation of polymorphisms in radiation repair/response genes in patients treated with BCS + RT suggests a correlation to local relapse. Additional evaluation is needed to assess the biological and functional significance of these single nucleotide polymorphisms, and larger confirmatory validation studies will be required to determine the clinical implications.
Daher, Tamas; Tur, Mehmet Kemal; Brobeil, Alexander; Etschmann, Benjamin; Witte, Biruta; Engenhart-Cabillic, Rita; Krombach, Gabriele; Blau, Wolfgang; Grimminger, Friedrich; Seeger, Werner; Klussmann, Jens Peter; Bräuninger, Andreas; Gattenlöhner, Stefan
2018-06-01
In head and neck squamous cell carcinoma (HNSCC), the occurrence of concurrent lung malignancies poses a significant diagnostic challenge because metastatic HNSCC is difficult to discern from second primary lung squamous cell carcinoma (SCC). However, this differentiation is crucial because the recommended treatments for metastatic HNSCC and second primary lung SCC differ profoundly. We analyzed the origin of lung tumors in 32 patients with HNSCC using human papillomavirus (HPV) typing and targeted next generation sequencing of all coding exons of tumor protein 53 (TP53). Lung tumors were clearly identified as HNSCC metastases or second primary tumors in 29 patients, thus revealing that 16 patients had received incorrect diagnoses based on clinical and morphological data alone. The HPV typing and mutation analysis of all TP53 coding exons is a valuable diagnostic tool in patients with HNSCC and concurrent lung SCC, which can help to ensure that patients receive the most suitable treatment. © 2018 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong
2005-01-01
Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)
Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun
2010-01-01
A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072
International Nuclear Information System (INIS)
Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan
2010-01-01
Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC
Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas
Directory of Open Access Journals (Sweden)
Marta Mellai
2013-01-01
Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.
Directory of Open Access Journals (Sweden)
Rashid Mir
2016-01-01
Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.
Expression of the tumor suppressor genes NF2, 4.1B, and TSLC1 in canine meningiomas.
Dickinson, P J; Surace, E I; Cambell, M; Higgins, R J; Leutenegger, C M; Bollen, A W; LeCouteur, R A; Gutmann, D H
2009-09-01
Meningiomas are common primary brain tumors in dogs; however, little is known about the molecular genetic mechanisms involved in their tumorigenesis. Several tumor suppressor genes have been implicated in meningioma pathogenesis in humans, including the neurofibromatosis 2 (NF2), protein 4.1B (4.1 B), and tumor suppressor in lung cancer-1 (TSLC1) genes. We investigated the expression of these tumor suppressor genes in a series of spontaneous canine meningiomas using quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) (NF2; n = 25) and western blotting (NF2/merlin, 4.1B, TSLC1; n = 30). Decreased expression of 4.1B and TSLC1 expression on western blotting was seen in 6/30 (20%) and in 15/30 (50%) tumors, respectively, with 18/30 (60%) of meningiomas having decreased or absent expression of one or both proteins. NF2 gene expression assessed by western blotting and RT-PCR varied considerably between individual tumors. Complete loss of NF2 protein on western blotting was not seen, unlike 4.1B and TSLC1. Incidence of TSLC1 abnormalities was similar to that seen in human meningiomas, while perturbation of NF2 and 4.1B appeared to be less common than reported for human tumors. No association was observed between tumor grade, subtype, or location and tumor suppressor gene expression based on western blot or RT-PCR. These results suggest that loss of these tumor suppressor genes is a frequent occurrence in canine meningiomas and may be an early event in tumorigenesis in some cases. In addition, it is likely that other, as yet unidentified, genes play an important role in canine meningioma formation and growth.
International Nuclear Information System (INIS)
Petkova, Rumena; Chelenkova, Pavlina; Yemendzhiev, Husein; Tsekov, Iliya; Kalvatchev, Zlatko; Chakarov, Stoyan
2013-01-01
HPV infection is a major pathogenetic factor in cervical carcinoma as well as in many of the squamous cancers of head and neck and other epithelial cancers. Persistence of HPV DNA detectable by routine methods is considered to be a risk factor for advanced CIN and, in patients treated by surgery or non-surgical treatment modalities (radiotherapy, chemotherapy), HPV persistence is believed to be associated with increased risk for local recurrence. In terms of survival, however, it has been repeatedly proven that patients with cervical cancer and other HPV-associated cancers with detectable HPV DNA tend to have better outcomes than patients with HPV-negative tumours. The P72R polymorphism in the human TP53 gene has been contemplated as an independent phenotype modifier in cancers, especially the R allele which has been shown to confer higher pro-apoptotic properties to the resultant p53 protein. It has been demonstrated, however, that RR homozygotes were much more common in study groups with HPV-associated tumours than the other two genotypes and that the P allele in P/R heterozygotes was preferentially lost while the R allele was preferentially retained and mutated. It is possible that HPV-dependent carcinogenesis strictly relies on the presence of HPV and the expression of the E6 and E7 onco proteins only in the initial phases of transformation of infected cells (e.g. CIN). It may be associated with activation of latent HPV that would create a background of decreased control over the integrity of the genome of the host cell. The process can develop further by mechanisms independent of the presence of HPV and if the virus clears at some later point, that would not halt the already ongoing neoplastic transformation. Absence of HPV DNA in cervical tumours, whether before or after treatment, is not a reason to decrease vigilant monitoring and rule out the need for further treatment, as it may be quite possible that the TP53 gene of the infected cells has already been
Directory of Open Access Journals (Sweden)
Mi Jeong Kim
2016-09-01
Full Text Available The purpose of this study was to investigate the phytochemical compositions and antioxidant capacity, cell growth inhibition, and apoptosis induction in extracts of immature wheat bran. Immature wheat bran (IWB was obtained from immature wheat harvested 10 days earlier than mature wheat. The phytochemical compositions of bran extract samples were analyzed by ultra-high performance liquid chromatography. The total ferulic acid (3.09 mg/g and p-coumaric acid (75 µg/g in IWB were significantly higher than in mature wheat bran (MWB, ferulic acid: 1.79 mg/g; p-coumaric acid: 55 µg/g. The oxygen radical absorbance capacity (ORAC: 327 µM Trolox equivalents (TE/g and cellular antioxidant activity (CAA: 4.59 µM Quercetin equivalents (QE/g of the IWB were higher than those of the MWB (ORAC: 281 µM TE/g; CAA: 0.63 µM QE/g. When assessing cell proliferation, the IWB extracts resulted in the lowest EC50 values against HT-29 (18.9 mg/mL, Caco-2 (7.74 mg/mL, and HeLa cells (8.17 mg/mL among bran extract samples. Additionally, the IWB extracts increased the gene expression of p53 and PTEN (tumor suppressor genes in HT-29 cells, indicating inhibited cell growth and induced apoptosis through tumor suppressor genes.
miR-34 and p53: New Insights into a Complex Functional Relationship.
Directory of Open Access Journals (Sweden)
Francisco Navarro
Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.
Directory of Open Access Journals (Sweden)
Martel-Planche Ghislaine
2011-10-01
Full Text Available Abstract Background Squamous Cell Carcinoma of Esophagus is one of the most common malignancies in both men and women in eastern and south-eastern Africa. In Kenya, clinical observations suggest that this cancer is frequent in the Rift Valley area. However, so far, there has been no report on the molecular characteristics of esophageal squamous cell carcinoma (ESCC in this area. Results We have analyzed TP53 mutations, the presence of human papilloma virus (HPV DNA and expression of inflammation markers Cyclooxygenase 2 (Cox-2 and Nitrotyrosine (NTyR in 28 cases (13 males and 15 females of archived ESCC tissues collected at the Moi Teaching and Referral Hospital in Eldoret, Kenya. Eleven mutations were detected in TP53 exons 5 to 8 (39%. All ESCC samples were negative for HPV 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82. Immunohistochemical analysis of Cox-2 and NTyR showed a low proportion of positive cases (17.4% and 39.1%, respectively. No association between the above markers and suspected risk factors (alcohol or tobacco use, hot tea drinking, use of charcoal for cooking was found. Conclusion Our findings suggest that mechanisms of esophageal carcinogenesis in eastern Africa might be different from other parts of the world. Low prevalence of TP53 mutation compared with other intermediate or high incidence areas of the world highlights this hypothesis. Our data did not support a possible ole of HPV in this series of cases. Further studies are needed to assess and compare the molecular patterns of ESCC from Kenya with those of high-incidence areas such as China or Central Asia.
p53 in differentiation of thyroid cancer
International Nuclear Information System (INIS)
Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.
1993-01-01
P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)
Rheumatoid arthritis and p53: how oxidative stress might alter the course of inflammatory diseases
Tak, P. P.; Zvaifler, N. J.; Green, D. R.; Firestein, G. S.
2000-01-01
Oxidative stress at sites of chronic inflammation can cause permanent genetic changes. The development of mutations in the p53 tumor suppressor gene and other key regulatory genes could help convert inflammation into chronic disease in rheumatoid arthritis and other inflammatory disorders
The genetic alteration of p53 in esophageal cancer
Energy Technology Data Exchange (ETDEWEB)
Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1996-01-01
Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).
Harms, Paul W; Collie, Angela M B; Hovelson, Daniel H; Cani, Andi K; Verhaegen, Monique E; Patel, Rajiv M; Fullen, Douglas R; Omata, Kei; Dlugosz, Andrzej A; Tomlins, Scott A; Billings, Steven D
2016-03-01
Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin 20 (CK20) is expressed in ~95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small-cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (10 Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high-confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping genetic changes
Harms, Paul W.; Collie, Angela M. B.; Hovelson, Daniel H.; Cani, Andi K.; Verhaegen, Monique E.; Patel, Rajiv M.; Fullen, Douglas R.; Omata, Kei; Dlugosz, Andrzej A.; Tomlins, Scott A.; Billings, Steven D.
2016-01-01
Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin-20 (CK20) is expressed in approximately 95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (ten Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%)) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping
Bublik, Débora R.; Bursać, Slađana; Sheffer, Michal; Oršolić, Ines; Shalit, Tali; Tarcic, Ohad; Kotler, Eran; Mouhadeb, Odelia; Hoffman, Yonit; Fuchs, Gilad; Levin, Yishai; Volarević, Siniša; Oren, Moshe
2017-01-01
The microRNA miR-504 targets TP53 mRNA encoding the p53 tumor suppressor. miR-504 resides within the fibroblast growth factor 13 (FGF13) gene, which is overexpressed in various cancers. We report that the FGF13 locus, comprising FGF13 and miR-504, is transcriptionally repressed by p53, defining an additional negative feedback loop in the p53 network. Furthermore, we show that FGF13 1A is a nucleolar protein that represses ribosomal RNA transcription and attenuates protein synthesis. Importantly, in cancer cells expressing high levels of FGF13, the depletion of FGF13 elicits increased proteostasis stress, associated with the accumulation of reactive oxygen species and apoptosis. Notably, stepwise neoplastic transformation is accompanied by a gradual increase in FGF13 expression and increased dependence on FGF13 for survival (“nononcogene addiction”). Moreover, FGF13 overexpression enables cells to cope more effectively with the stress elicited by oncogenic Ras protein. We propose that, in cells in which activated oncogenes drive excessive protein synthesis, FGF13 may favor survival by maintaining translation rates at a level compatible with the protein quality-control capacity of the cell. Thus, FGF13 may serve as an enabler, allowing cancer cells to evade proteostasis stress triggered by oncogene activation. PMID:27994142
The prognostic value of p53 mutation in pediatric marrow hypoplasia
Directory of Open Access Journals (Sweden)
Sharaf Alzahraa EA
2011-06-01
Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.
Su, Dan; Wang, Xuting; Campbell, Michelle R.; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Bell, Douglas A.
2015-01-01
Cellular stresses activate the tumor suppressor p53 protein leading to selective binding to DNA response elements (REs) and gene transactivation from a large pool of potential p53 REs (p53REs). To elucidate how p53RE sequences and local chromatin context interact to affect p53 binding and gene transactivation, we mapped genome-wide binding localizations of p53 and H3K4me3 in untreated and doxorubicin (DXR)-treated human lymphoblastoid cells. We examined the relationships among p53 occupancy, ...
Battle Against Cancer: An Everlasting Saga of p53
Directory of Open Access Journals (Sweden)
Qian Hao
2014-12-01
Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Directory of Open Access Journals (Sweden)
Terry L. Levin, MD
2015-01-01
Full Text Available A 20-month-old female presented with respiratory distress and a right adrenal mass extending into the inferior vena cava and right atrium. The mass was initially thought to be neuroblastoma. Pathology later revealed adrenocortical carcinoma. Inferior vena cava extension is far more common in adrenocortical carcinoma than neuroblastoma, and its presence should prompt clinical and laboratory evaluation for an adrenocortical tumor. The genetic findings in TP53 associated with this disease are discussed.
Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.
Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M
2015-12-01
Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.
International Nuclear Information System (INIS)
Bavi, P.P.; Abubaker, Jehad A.; Jehan, Zeenath D.; Al-Jomah, Naif A.; Siraj, Abdul K.; Al-Harbi, Sayer R.; Atizado, Valerie L.; Uddin, S.; Al-Kuraya, Khawla S.; Abduljabbar, Alaa S.; Al-Homoud, Samar J.; Ashari, Luai H.; Al-Sanea, Nasser A.; Al-Dayel, Fouad H.
2008-01-01
Objective was to evaluate the overall incidence of microsatellite instability (MSI), hereditary non polyposis colorectal cancer and tumor suppressor gene (TP53) mutations in Saudi colorectal carcinomas. We studied the MSI pathway in Saudi colorectal cancers (CRC) from 179 unselected patients using 2 methods: MSI by polymerase chain reaction and immunohistochemistry detection of mutL homologs 1 and mutS homologs 2 proteins. The TP53 mutations were studied by sequencing exons 5, 6, 7 and 8. Of the 150 colorectal carcinomas analyzed for MSI, 16% of the tumors showed high level instability (MSI-H), 19.3% had low level instability (MSI-L) and the remaining 64% tumors were stable. Survival of the MSI-H group was better as compared to the MSI-L or microsatellite stable group (p=0.0217). In the MSI-H group, 48% were familial MSI tumors which could be attributable to the high incidence of consanguinity in the Saudi population. The TP53 mutations were found in 24% of the cases studied. A high production of familial MSI cases and a lower incidence of TP53 mutations are some of the hallmarks of the Saudi colorectal carcinomas which need to be explored further. (author)
CLCA2 as a p53-Inducible Senescence Mediator
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2012-02-01
Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.
Directory of Open Access Journals (Sweden)
Kallirroi Voudouri
2016-12-01
Full Text Available In this data article, the potential role of p53 tumor suppressor gene (p53 on the attachment ability of MCF-7 breast cancer cells was investigated. In our main article, “IGF-I/ EGF and E2 signaling crosstalk through IGF-IR conduit point affect breast cancer cell adhesion” (K. Voudouri, D. Nikitovic, A. Berdiaki, D. Kletsas, N.K. Karamanos, G.N. Tzanakakis, 2016 [1], we describe the key role of IGF-IR in breast cancer cell adhesion onto fibronectin (FN. p53 tumor suppressor gene is a principal regulator of cancer cell proliferation. Various data have demonstrated an association between p53 and IGF-IR actions on cell growth through its’ putative regulation of IGF-IR expression. According to our performed experiments, p53 does not modify IGF-IR expression and does not affect basal MCF-7 cells adhesion onto FN. Moreover, technical details about the performance of adhesion assay onto the FN substrate were provided.
Off and back-on again: a tumor suppressor's tale.
Acosta, Jonuelle; Wang, Walter; Feldser, David M
2018-06-01
Tumor suppressor genes play critical roles orchestrating anti-cancer programs that are both context dependent and mechanistically diverse. Beyond canonical tumor suppressive programs that control cell division, cell death, and genome stability, unexpected tumor suppressor gene activities that regulate metabolism, immune surveillance, the epigenetic landscape, and others have recently emerged. This diversity underscores the important roles these genes play in maintaining cellular homeostasis to suppress cancer initiation and progression, but also highlights a tremendous challenge in discerning precise context-specific programs of tumor suppression controlled by a given tumor suppressor. Fortunately, the rapid sophistication of genetically engineered mouse models of cancer has begun to shed light on these context-dependent tumor suppressor activities. By using techniques that not only toggle "off" tumor suppressor genes in nascent tumors, but also facilitate the timely restoration of gene function "back-on again" in disease specific contexts, precise mechanisms of tumor suppression can be revealed in an unbiased manner. This review discusses the development and implementation of genetic systems designed to toggle tumor suppressor genes off and back-on again and their potential to uncover the tumor suppressor's tale.
Todorovic Balint, Milena; Jelicic, Jelena; Mihaljevic, Biljana; Kostic, Jelena; Stanic, Bojana; Balint, Bela; Pejanovic, Nadja; Lucic, Bojana; Tosic, Natasa; Marjanovic, Irena; Stojiljkovic, Maja; Karan-Djurasevic, Teodora; Perisic, Ognjen; Rakocevic, Goran; Popovic, Milos; Raicevic, Sava; Bila, Jelena; Antic, Darko; Andjelic, Bosko; Pavlovic, Sonja
2016-01-01
The existence of a potential primary central nervous system lymphoma-specific genomic signature that differs from the systemic form of diffuse large B cell lymphoma (DLBCL) has been suggested, but is still controversial. We investigated 19 patients with primary DLBCL of central nervous system (DLBCL CNS) using the TruSeq Amplicon Cancer Panel (TSACP) for 48 cancer-related genes. Next generation sequencing (NGS) analyses have revealed that over 80% of potentially protein-changing mutations were located in eight genes (CTNNB1, PIK3CA, PTEN, ATM, KRAS, PTPN11, TP53 and JAK3), pointing to the potential role of these genes in lymphomagenesis. TP53 was the only gene harboring mutations in all 19 patients. In addition, the presence of mutated TP53 and ATM genes correlated with a higher total number of mutations in other analyzed genes. Furthermore, the presence of mutated ATM correlated with poorer event-free survival (EFS) (p = 0.036). The presence of the mutated SMO gene correlated with earlier disease relapse (p = 0.023), inferior event-free survival (p = 0.011) and overall survival (OS) (p = 0.017), while mutations in the PTEN gene were associated with inferior OS (p = 0.048). Our findings suggest that the TP53 and ATM genes could be involved in the molecular pathophysiology of primary DLBCL CNS, whereas mutations in the PTEN and SMO genes could affect survival regardless of the initial treatment approach. PMID:27164089
40 Years of Research Put p53 in Translation
Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques
2018-01-01
Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.
Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73
Directory of Open Access Journals (Sweden)
Lu Xin
2009-06-01
Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.
Directory of Open Access Journals (Sweden)
Thais Fernanda de Almeida Galatro
Full Text Available Inhibitor of DNA Binding 4 (ID4 is a member of the helix-loop-helix ID family of transcription factors, mostly present in the central nervous system during embryonic development, that has been associated with TP53 mutation and activation of SOX2. Along with other transcription factors, ID4 has been implicated in the tumorigenic process of astrocytomas, contributing to cell dedifferentiation, proliferation and chemoresistance. In this study, we aimed to characterize the ID4 expression pattern in human diffusely infiltrative astrocytomas of World Health Organization (WHO grades II to IV of malignancy (AGII-AGIV; to correlate its expression level to that of SOX2, SOX4, OCT-4 and NANOG, along with TP53 mutational status; and to correlate the results with the clinical end-point of overall survival among glioblastoma patients. Quantitative real time PCR (qRT-PCR was performed in 130 samples of astrocytomas for relative expression, showing up-regulation of all transcription factors in tumor cases. Positive correlation was found when comparing ID4 relative expression of infiltrative astrocytomas with SOX2 (r = 0.50; p<0.005, SOX4 (r = 0.43; p<0.005 and OCT-4 (r = 0.39; p<0.05. The results from TP53 coding exon analysis allowed comparisons between wild-type and mutated status only in AGII cases, demonstrating significantly higher levels of ID4, SOX2 and SOX4 in mutated cases (p<0.05. This pattern was maintained in secondary GBM and further confirmed by immunohistochemistry, suggesting a role for ID4, SOX2 and SOX4 in early astrocytoma tumorigenesis. Combined hyperexpression of ID4, SOX4 and OCT-4 conferred a much lower (6 months median survival than did hypoexpression (18 months. Because both ID4 alone and a complex of SOX4 and OCT-4 activate SOX2 transcription, it is possible that multiple activation of SOX2 impair the prognosis of GBM patients. These observational results of associated expression of ID4 with SOX4 and OCT-4 may be used as a
Expression of the p16{sup INK4a} tumor suppressor gene in rodent lung tumors
Energy Technology Data Exchange (ETDEWEB)
Swafford, D.S.; Tesfaigzi, J.; Belinsky, S.A.
1995-12-01
Aberrations on the short arm of chromosome 9 are among the earliest genetic changes in human cancer. p16{sup INK4a} is a candidate tumor suppressor gene that lies within human 9p21, a chromosome region associated with frequent loss of heterozygosity in human lung tumors. The p16{sup INK4a} protein functions as an inhibitor of cyclin D{sub 1}-dependent kinases that phosphorylate the retinoblastoma (Rb) tumor suppressor gene product enabling cell-cycle progression. Thus, overexpression of cyclin D{sub 1}, mutation of cyclin-dependent kinase genes, or loss of p16{sup INK4a} function, can all result in functional inactivation of Rb. Inactivation of Rb by mutation or deletion can result in an increase in p16{sup INK4a} transcription, suggesting that an increased p16{sup INK4a} expression in a tumor cell signals dysfunction of the pathway. The p16{sup (INK4a)} gene, unlike some tumor suppressor genes, is rarely inactivated by mutation. Instead, the expression of this gene is suppressed in some human cancers by hypermethylation of the CpG island within the first exon or by homozygous deletion: 686. Chromosome losses have been observed at 9p21 syntenic loci in tumors of the mouse and rat, two species often used as animal models for pulmonary carcinogenesis. Expression of p16{sup INK4a} is lost in some mouse tumor cell lines, often due to homozygous deletion. These observations indicate that p16{sup INK4a} dysfunction may play a role in the development of neoplasia in rodents as well as humans. The purpose of the current investigation was to define the extent to which p16{sup INK4a} dysfunction contributes to the development of rodent lung tumors and to determine the mechanism of inactivation of the gene. There is no evidence to suggest a loss of function of the p16{sup INK4a} tumor suppressor gene in these primary murine lung tumors by mutation, deletion, or methylation.
Analysis of a Novel 17q25 Cell Cycle Gene Homolog: Is it a Breast Tumor Suppressor Gene?
National Research Council Canada - National Science Library
Kalikin, Linda
2000-01-01
... of these molecular reagents into successful tools for the medical management of breast cancer. We hypothesize that a 350 kb region on 17q25 detected by our allelic imbalance studies harbors a novel breast tumor suppressor gene...
Mutant p53 - heat shock response oncogenic cooperation: a new mechanism of cancer cell survival
Directory of Open Access Journals (Sweden)
Evguenia eAlexandrova
2015-04-01
Full Text Available The main tumor suppressor function of p53 as a ‘guardian of the genome’ is to respond to cellular stress by transcriptional activation of apoptosis, growth arrest or senescence in damaged cells. Not surprisingly, mutations in the p53 gene are the most frequent genetic alteration in human cancers. Importantly, mutant p53 (mutp53 proteins not only lose their wild-type tumor suppressor activity, but also can actively promote tumor development. Two main mechanisms accounting for mutp53 proto-oncogenic activity are inhibition of the wild-type p53 in a dominant-negative fashion and gain of additional oncogenic activities known as gain-of-function (GOF. Here we discuss a novel mechanism of mutp53 GOF, which relies on its oncogenic cooperation with the heat shock machinery. This coordinated adaptive mechanism renders cancer cells more resistant to proteotoxic stress and provides both, a strong survival advantage to cancer cells and a promising means for therapeutic intervention.
Immunohistochemical analysis of P53 protein in odontogenic cysts
Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.
2010-01-01
The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493
Whole-genome analysis of a patient with early-stage small-cell lung cancer.
Han, J-Y; Lee, Y-S; Kim, B C; Lee, G K; Lee, S; Kim, E-H; Kim, H-M; Bhak, J
2014-12-01
We performed whole-genome sequencing (WGS) of a case of early-stage small-cell lung cancer (SCLC) to analyze the genomic features. WGS revealed a lot of single-nucleotide variations (SNVs), small insertion/deletions and chromosomal abnormality. Chromosomes 4p, 5q, 13q, 15q, 17p and 22q contained many block deletions. Especially, copy loss was observed in tumor suppressor genes RB1 and TP53, and copy gain in oncogene hTERT. Somatic mutations were found in TP53 and CREBBP. Novel nonsynonymous (ns) SNVs in C6ORF103 and SLC5A4 genes were also found. Sanger sequencing of the SLC5A4 gene in 23 independent SCLC samples showed another nsSNV in the SLC5A4 gene, indicating that nsSNVs in the SLC5A4 gene are recurrent in SCLC. WGS of an early-stage SCLC identified novel recurrent mutations and validated known variations, including copy number variations. These findings provide insight into the genomic landscape contributing to SCLC development.
International Nuclear Information System (INIS)
Vodusek, Ana Lina; Novakovic, Srdjan; Stegel, Vida; Jereb, Berta
2011-01-01
Some tumour suppressor genes (BRCA2) and mismatch repair genes (MSH2, MLH1) are correlated with an increased risk for male breast cancer. Our patient developed secondary breast cancer after the treatment for Hodgkin’s disease in childhood. DNA was isolated from the patients’ blood and screened for mutations, polymorphisms and variants in BRCA1, BRCA2, p53, CDKN2A, MLH1 and MSH2 genes. We found no mutations but common polymorphisms, and three variants in mismatch repair genes. Nucleotide variants c.2006-6T>C and p.G322D in MSH2 might be correlated with male breast cancer
Markowitz, Joseph; Chen, Ijen; Gitti, Rossi; Baldisseri, Donna M; Pan, Yongping; Udan, Ryan; Carrier, France; MacKerell, Alexander D; Weber, David J
2004-10-07
The binding of S100B to p53 down-regulates wild-type p53 tumor suppressor activity in cancer cells such as malignant melanoma, so a search for small molecules that bind S100B and prevent S100B-p53 complex formation was undertaken. Chemical databases were computationally searched for potential inhibitors of S100B, and 60 compounds were selected for testing on the basis of energy scoring, commercial availability, and chemical similarity clustering. Seven of these compounds bound to S100B as determined by steady state fluorescence spectroscopy (1.0 microM model of one such inhibitor, pentamidine, bound to Ca(2+)-loaded S100B was calculated using intermolecular NOE data between S100B and the drug, and indicates that pentamidine binds into the p53 binding site on S100B defined by helices 3 and 4 and loop 2 (termed the hinge region).
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri
2011-07-01
There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.
Directory of Open Access Journals (Sweden)
Gustavo Rassier Isolan
2005-12-01
Full Text Available As neoplasias astrocitárias correspondem a 60% dos tumores do sistema nervoso central, sendo o estudo da biologia molecular um importante passo para a compreensão da gênese e comportamento biológico destas doenças. As proteínas Ki-67, que é um marcador de proliferação celular, e p53, que é o produto do gene supressor de tumor de mesmo nome, são importantes marcadores tumorais. O objetivo deste estudo foi identificar e quantificar as proteínas Ki-67 e produto do gene supressor de tumor TP53 em diferentes graus de malignidade das neoplasias astrocitárias, bem como analisar suas relações com idade e sexo. Foram estudadas por imuno-histoquímica as proteínas Ki-67 e p53 em 47 pacientes com neoplasias astrocitárias ressecadas cirurgicamente, classificadas previamente e revisadas quanto ao grau de malignidade, de acordo com o proposto pela Organização Mundial da Saúde. Os núcleos celulares imunomarcados foram quantificados no programa Imagelab-softium pela razão paramétrica absoluta entre os núcleos de células positivas e o número total de células tumorais, sendo contadas 1000 células. O delineamento utilizado foi transversal não controlado. Para análise estatística as variáveis foram divididas em grupos, que para a Ki-67 foram ausente, 5% e para a p53 foram ausente (0, The astrocytic neoplasms respond by 60% of the central nervous system tumors, being the study of the molecular biology an important step for the understanding of the genesis and biological behavior of these diseases. The Ki-67 proteins, which are markers of the cellular proliferation, and p53, which is the product of the tumor suppressor gene TP53, are both important tumoral markers. This study intends to identify and quantify the Ki-67 and p53 proteins in astrocytic tumors of different grades of malignancy, as well as to analyze their relations with age and gender. Ki-67 and p53 proteins in 47 patients with surgically resected astrocytic neoplasms were
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus la...
International Nuclear Information System (INIS)
Hurtado, A M; Chen-Liang, T-H; Przychodzen, B; Hamedi, C; Muñoz-Ballester, J; Dienes, B; García-Malo, M D; Antón, A I; Arriba, F de; Teruel-Montoya, R; Ortuño, F J; Vicente, V; Maciejewski, J P; Jerez, A
2015-01-01
An increasing numbers of patients are being diagnosed with asymptomatic early-stage chronic lymphocytic leukemia (CLL), with no treatment indication at baseline. We applied a high-throughput deep-targeted analysis, especially designed for covering widely TP53 and ATM genes, in 180 patients with inactive disease at diagnosis, to test the independent prognostic value of CLL somatic recurrent mutations. We found that 40/180 patients harbored at least one acquired variant with ATM (n=17, 9.4%), NOTCH1 (n=14, 7.7%), TP53 (n=14, 7.7%) and SF3B1 (n=10, 5.5%) as most prevalent mutated genes. Harboring one ‘sub-Sanger' TP53 mutation granted an independent 3.5-fold increase of probability of needing treatment. Those patients with a double-hit ATM lesion (mutation+11q deletion) had the shorter median time to first treatment (17 months). We found that a genomic variable: TP53 mutations, most of them under the sensitivity of conventional techniques; a cell phenotypic factor: CD38-positive expression; and a classical marker as β2-microglobulin, remained as the unique independent predictors of outcome. The high-throughput determination of TP53 status, particularly in this set of patients frequently lacking high-risk chromosomal aberrations, emerges as a key step, not only for prediction modeling, but also for exploring mutation-specific therapeutic approaches and minimal residual disease monitoring
Directory of Open Access Journals (Sweden)
Al-achkar Walid
2012-08-01
Full Text Available Abstract Background The so-called Philadelphia (Ph chromosome is present in more than 90% of chronic myeloid leukemia (CML cases. It results in juxtaposition of the 5′ part of the BCR gene on chromosome 22 to the 3′ part of the ABL gene on chromosome 9. Since the majority of CML cases are currently treated with Imatinib, variant rearrangements in general have no specific prognostic significance, although the mechanisms involved in resistance to therapy have yet to be investigated. The T315I mutation within the abl-gene is the most frequent one associated with resistance to tyrosine kinase inhibitors. Results This study evaluated a Ph chromosome positive CML case resistant to imatinib mesylate. A dic(17;18, loss of TP53 gene, co-expression of b2a2 and b3a2 fusions transcript and a T315I mutation were found. Conclusions We reported here a novel case of a Ph chromosome positive CML with a secondary abnormality [dic(17;18], resulting to Glivec resistance but good response to nilotinib. The dic(17;18 might be a marker for poor prognosis in CML. Our finding indicated for an aggressive progression of the disease. The patient died under the treatment due to unknown reasons.
Xu, Guogang; Vogel, Kristine S; McMahan, C Alex; Herbert, Damon C; Walter, Christi A
2010-12-01
During the first wave of spermatogenesis, and in response to ionizing radiation, elevated mutant frequencies are reduced to a low level by unidentified mechanisms. Apoptosis is occurring in the same time frame that the mutant frequency declines. We examined the role of apoptosis in regulating mutant frequency during spermatogenesis. Apoptosis and mutant frequencies were determined in spermatogenic cells obtained from Bax-null or Trp53-null mice. The results showed that spermatogenic lineage apoptosis was markedly decreased in Bax-null mice and was accompanied by a significantly increased spontaneous mutant frequency in seminiferous tubule cells compared to that of wild-type mice. Apoptosis profiles in the seminiferous tubules for Trp53-null were similar to control mice. Spontaneous mutant frequencies in pachytene spermatocytes and in round spermatids from Trp53-null mice were not significantly different from those of wild-type mice. However, epididymal spermatozoa from Trp53-null mice displayed a greater spontaneous mutant frequency compared to that from wild-type mice. A greater proportion of spontaneous transversions and a greater proportion of insertions/deletions 15 days after ionizing radiation were observed in Trp53-null mice compared to wild-type mice. Base excision repair activity in mixed germ cell nuclear extracts prepared from Trp53-null mice was significantly lower than that for wild-type controls. These data indicate that BAX-mediated apoptosis plays a significant role in regulating spontaneous mutagenesis in seminiferous tubule cells obtained from neonatal mice, whereas tumor suppressor TRP53 plays a significant role in regulating spontaneous mutagenesis between postmeiotic round spermatid and epididymal spermatozoon stages of spermiogenesis.
Directory of Open Access Journals (Sweden)
Jorge Azofeifa
2004-09-01
Full Text Available The STR (AAAATn within intron 1 of the TP53 locus was screened in 17 populations from 3 main ethnic groups: Europeans, Asiatics, and Africans, and from the hybrid population of Costa Rica (1968 samples. Three alleles, 126/7 (bp/copies of the repeat, 131/8 and 136/9 were the most prevalent in all populations. Other alleles rarely reached frequencies of 10% or higher. Observed heterozygosities ranged between 0.351 and 0.829. Patterns of diversity fit well with both the geographic origin of the samples and the history of the populations screened. A statistical test suggests that single-step mutational events have been the main mechanism producing new alleles at this locus. Fixation indexes (R ST for this marker showed an effect of population subdivision on divergence only within the Asiatic group; they were insensitive at the level of major ethnic groups as well as within Africans and within Europeans. Rev. Biol. Trop. 52(3: 645-657. Epub 2004 Dic 15.Se estudió el polimorfismo del microsatélite (AAAATn del intrón 1 del gene TP53 en 17 poblaciones de 3 grupos étnicos: europeos, asiáticos, y africanos subsaharianos, así como de la población híbrida de Costa Rica (en total 1968 muestras. Tres alelos, 126/7 (pares de bases/ copias de la repetición, 131/8 y 136/9 fueron los más frecuentes en todas las poblaciones, aunque se observaron otros alelos usualmente a frecuencias menores al 10%. Las heterocigosis observadas variaron de 0.351 a 0.829. La distribución de la diversidad parece concordar con el origen geográfico de las muestras y con la historia de las poblaciones estudiadas. Una prueba estadística indica que el evento mutacional que más alelos nuevos produce en este marcador es el de un solo paso (expansión o contracción de una sola copia de la repetición. El índice de fijación R ST mostró los efectos de la subdivision de poblaciones sólo dentro del grupo de los asiáticos y mostró falta de sensibilidad cuando los grupos
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
Directory of Open Access Journals (Sweden)
Ge Q
2016-01-01
Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate
Directory of Open Access Journals (Sweden)
Yuen Yee Cheng
2017-01-01
Full Text Available Malignant pleural mesothelioma (MPM is associated with asbestos exposure. Asbestos can induce chronic inflammation which in turn can lead to silencing of tumour suppressor genes. Wnt signaling pathway can be affected by chronic inflammation and is aberrantly activated in many cancers including colon and MPM. SFRP genes are antagonists of Wnt pathway, and SFRPs are potential tumour suppressors in colon, gastric, breast, ovarian, and lung cancers and mesothelioma. This study investigated the expression and DNA methylation of SFRP genes in MPM cells lines with and without demethylation treatment. Sixty-six patient FFPE samples were analysed and have showed methylation of SFRP2 (56% and SFRP5 (70% in MPM. SFRP2 and SFRP5 tumour-suppressive activity in eleven MPM lines was confirmed, and long-term asbestos exposure led to reduced expression of the SFRP1 and SFRP2 genes in the mesothelium (MeT-5A via epigenetic alterations. Finally, DNA methylation of SFRPs is detectable in MPM patient plasma samples, with methylated SFRP2 and SFRP5 showing a tendency towards greater abundance in patients. These data suggested that SFRP genes have tumour-suppresive activity in MPM and that methylated DNA from SFRP gene promoters has the potential to serve as a biomarker for MPM patient plasma.
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Molecular studies on the function of tumor suppressor gene in gastrointestinal cancer
International Nuclear Information System (INIS)
Kim, You Cheoul
1993-01-01
Cancer of stomach, colon and liver are a group of the most common cancer in Korea. However, results with current therapeutic modalities are still unsatisfactory. The intensive efforts have been made to understand basic pathogenesis and to find better therapeutic tools for the treatment of this miserable disease. We studies the alteration of tumor suppressor gene in various Gastrointestinal cancer in Korea. Results showed that genetic alteration of Rb gene was in 83% of colorectal cancer. Our results suggest that genetic alteration of Rb gene is crucially involved in the tumorigenesis of colorectum in Korea. (Author)
Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R
2014-01-01
The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.
Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly.
Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm
2017-10-01
Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS complex, in 37 individuals from 32 families with GAMOS. CRISPR-Cas9 knockout in zebrafish and mice recapitulated the human phenotype of primary microcephaly and resulted in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibited cell proliferation, which human mutations did not rescue. Furthermore, knockdown of these genes impaired protein translation, caused endoplasmic reticulum stress, activated DNA-damage-response signaling, and ultimately induced apoptosis. Knockdown of OSGEP or TP53RK induced defects in the actin cytoskeleton and decreased the migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identified four new monogenic causes of GAMOS, describe a link between KEOPS function and human disease, and delineate potential pathogenic mechanisms.
Nuclear γ-tubulin associates with nucleoli and interacts with tumor suppressor protein C53.
Hořejší, Barbora; Vinopal, Stanislav; Sládková, Vladimíra; Dráberová, Eduarda; Sulimenko, Vadym; Sulimenko, Tetyana; Vosecká, Věra; Philimonenko, Anatoly; Hozák, Pavel; Katsetos, Christos D; Dráber, Pavel
2012-01-01
γ-Tubulin is assumed to be a typical cytosolic protein necessary for nucleation of microtubules from microtubule organizing centers. Using immunolocalization and cell fractionation techniques in combination with siRNAi and expression of FLAG-tagged constructs, we have obtained evidence that γ-tubulin is also present in nucleoli of mammalian interphase cells of diverse cellular origins. Immunoelectron microscopy has revealed γ-tubulin localization outside fibrillar centers where transcription of ribosomal DNA takes place. γ-Tubulin was associated with nucleolar remnants after nuclear envelope breakdown and could be translocated to nucleoli during mitosis. Pretreatment of cells with leptomycin B did not affect the distribution of nuclear γ-tubulin, making it unlikely that rapid active transport via nuclear pores participates in the transport of γ-tubulin into the nucleus. This finding was confirmed by heterokaryon assay and time-lapse imaging of photoconvertible protein Dendra2 tagged to γ-tubulin. Immunoprecipitation from nuclear extracts combined with mass spectrometry revealed an association of γ-tubulin with tumor suppressor protein C53 located at multiple subcellular compartments including nucleoli. The notion of an interaction between γ-tubulin and C53 was corroborated by pull-down and co-immunoprecipitation experiments. Overexpression of γ-tubulin antagonized the inhibitory effect of C53 on DNA damage G(2) /M checkpoint activation. The combined results indicate that aside from its known role in microtubule nucleation, γ-tubulin may also have nuclear-specific function(s). Copyright © 2011 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
McDonald, J.D.; Daneshvar, L.; Willert, J.R. [Univ. of California, San Franciso, CA (United States)] [and others
1994-09-01
Deletion mapping of a medulloblastoma tumor panel revealed loss of distal chromosome 17p13.3 sequences in tumors from 14 of 32 patients (44%). Of the 14 tumors showing loss of heterozygosity by restriction fragment length polymorphism analysis, 14 of 14 (100%) displayed loss of the telomeric marker p144-D6 (D17S34), while a probe for the ABR gene on 17p13.3 was lost in 7 of 8 (88%) informative cases. Using pulsed-field gel electrophoresis, we localized the polymorphic marker (VNTR-A) of the ABR gene locus to within 220 kb of the p144-D6 locus. A cosmid contig constructed in this region was used to demonstrate by fluorescence in situ hybridization that the ABR gene is oriented transcriptionally 5{prime} to 3{prime} toward the telomere. This report provides new physical mapping data for the ABR gene, which has not been previously shown to be deleted in medulloblastoma. These results provide further evidence for the existence of a second tumor suppressor gene distinct from p53 on distal chromosome 17p. 12 refs., 3 figs.
Dysfunctional p53 deletion mutants in cell lines derived from Hodgkin's lymphoma
DEFF Research Database (Denmark)
Feuerborn, Alexander; Moritz, Constanze; von Bonin, Frederike
2006-01-01
Classical Hodgkin's lymphoma (cHL) is a distinct malignancy of the immune system. Despite the progress made in the understanding of the pathology of cHL, the transforming events remain to be elucidated. It has been proposed that mutations in the TP53 gene in biopsy material as well as cell lines ...
Nagam, Srivani L S S; Katta, Saritha; Prasad, Vidudala V T S
2017-03-01
Reports on the association of TP53 polymorphisms with oral cancer are not only limited but also not specific to site and/or gender. Hence, we examined the effect of TP53 polymorphisms (EX4 215G>C, IVS3+40-41ins16 and IVS6+62G>A) on buccal mucosa cancer (BMC) and tongue cancer (TC) risk, survival of patients in relation to risk and clinical factors, gender wise (excepting for estimating hazards ratio [HR]), using Fisher's Exact Test, Kaplan-Meier analysis, and Cox-proportional hazards models. The exonic polymorphism increased BMC and TC risk in males by 2-4-fold. The IVS3+40-41ins16 was protective against BMC and TC in both genders, whereas IVS6+62G>A protected only males against TC. Genotype combinations and haplotypes which altered the risk of cancers in males and females were different. TC males, aged 40-44 years and females, aged 55-59 years survived better than BMC patients. The IVS3+40-41ins16 polymorphism differentially impacted survival of female patients exposed to tobacco. TC patients with EX4 215GC with lymphovascular spread (LVS) and metastasis exhibited higher HR while, patients with EX4 215CC and perineural invasion (PNI) showed lower HR. Impact of the intronic variants along with clinical parameters on survival and HR estimates varied between BMC and TC. Our bioinformatics analysis revealed the presence of CTCF binding site within TP53 gene. In conclusion, the polymorphisms altered risk and survival of BMC and TC in a gender specific manner, which varied with mode of tobacco and/or alcohol use. The current study, therefore underscores strong need for research, stratified by tumor site and gender. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Survivin inhibits anti-growth effect of p53 activated by aurora B
International Nuclear Information System (INIS)
Jung, Ji-Eun; Kim, Tae-Kyung; Lee, Joong-Seob; Oh, Se-Yeong; Kwak, Sungwook; Jin, Xun; Sohn, Jin-Young; Song, Min-Keun; Sohn, Young-Woo; Lee, Soo-Yeon; Pian, Xumin; Lee, Jang-Bo; Chung, Yong Gu; Choi, Young Ki; You, Seungkwon; Kim, Hyunggee
2005-01-01
Genomic instability and apoptosis evasion are hallmarks of cancer, but the molecular mechanisms governing these processes remain elusive. Here, we found that survivin, a member of the apoptosis-inhibiting gene family, and aurora B kinase, a chromosomal passenger protein, were co-overexpressed in the various glioblastoma cell lines and tumors. Notably, exogenous introduction of the aurora B in human BJ cells was shown to decrease cell growth and increase the senescence-associated β-galactosidase activity by activation of p53 tumor suppressor. However, aurora B overexpression failed to inhibit cell proliferation in BJ and U87MG cells transduced with dominant-negative p53 as well as in p53 -/- mouse astrocytes. Aurora B was shown to increase centrosome amplification in the p53 -/- astrocytes. Survivin was shown to induce anchorage-independent growth and inhibit anti-proliferation and drug-sensitive apoptosis caused by aurora B. Overexpression of both survivin and aurora B further accelerated the proliferation of BJ cells. Taken together, the present study indicates that survivin should accelerate tumorigenesis by inhibiting the anti-proliferative effect of p53 tumor suppressor that is activated by aurora B in normal and glioblastoma cells containing intact p53
Contribution to the investigation of the p53 in vivo and in vitro trans-activation activity
International Nuclear Information System (INIS)
Meiller, A.
2004-03-01
Among the body's defence mechanisms, the programmed cellular death or apoptosis is an important safeguard way which allows the body to get rid of the injured cells before they acquire steady genetic modifications leading to an anarchistic multiplication. As p53 tumor suppressor gene plays a predominant role within this process, this research report first presents the p53 protein, its structure, its activities as a transcription factor, its modifications and the implications on its functional activities, its biological activities, and describes the p53 intracellular rate regulation and the use of this protein in radiology, particularly in 'in vivo' investigations on irradiated mice. It also presents the p53 family. Then, the author reports experimental investigations on possible other genes which could be trans-activated by p53. A gene is identified as a new target gene. She also demonstrates a new p53 activation path induced by another member of the p53 family, the p73 alpha protein
The pathology of familial breast cancer: Immunohistochemistry and molecular analysis
International Nuclear Information System (INIS)
Osin, Pinchas P; Lakhani, Sunil R
1999-01-01
Extensive studies of BRCA1- and BRCA2-associated breast tumours have been carried out in the few years since the identification of these familial breast cancer predisposing genes. The morphological studies suggest that BRCA1 tumours differ from BRCA2 tumours and from sporadic breast cancers. Recent progress in immunohistochemistry and molecular biology techniques has enabled in-depth investigation of molecular pathology of these tumours. Studies to date have investigated issues such as steroid hormone receptor expression, mutation status of tumour suppressor genes TP53 and c-erbB2, and expression profiles of cell cycle proteins p21, p27 and cyclin D 1 . Despite relative paucity of data, strong evidence of unique biological characteristics of BRCA1-associated breast cancer is accumulating. BRCA1-associated tumours appear to show an increased frequency of TP53 mutations, frequent p53 protein stabilization and absence of imunoreactivity for steroid hormone receptors. Further studies of larger number of samples of both BRCA1- and BRCA2-associated tumours are necessary to clarify and confirm these observations
Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O
2011-08-01
The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.
The role of p53 molecule in radiation and hyperthermic therapies
International Nuclear Information System (INIS)
Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo
2003-01-01
In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)
Tumor Suppressor Genes within Common Fragile Sites Are Active Players in the DNA Damage Response.
Directory of Open Access Journals (Sweden)
Idit Hazan
2016-12-01
Full Text Available The role of common fragile sites (CFSs in cancer remains controversial. Two main views dominate the discussion: one suggests that CFS loci are hotspots of genomic instability leading to inactivation of genes encoded within them, while the other view proposes that CFSs are functional units and that loss of the encoded genes confers selective pressure, leading to cancer development. The latter view is supported by emerging evidence showing that expression of a given CFS is associated with genome integrity and that inactivation of CFS-resident tumor suppressor genes leads to dysregulation of the DNA damage response (DDR and increased genomic instability. These two viewpoints of CFS function are not mutually exclusive but rather coexist; when breaks at CFSs are not repaired accurately, this can lead to deletions by which cells acquire growth advantage because of loss of tumor suppressor activities. Here, we review recent advances linking some CFS gene products with the DDR, genomic instability, and carcinogenesis and discuss how their inactivation might represent a selective advantage for cancer cells.
International Nuclear Information System (INIS)
Popovic Hadzija, M.; Poljak Blazi, M.
1996-01-01
Proto-oncogenes are involved in growth, defferentiation and proliferation of normal cells, and in process of neoplastic transformation. In genome of normal cells, exist also tumor-suppressor genes, which contribute to cancer when they are inactivated. Those genes are target for carcinogenesis provoked by radiation. However, species specific genetic factors are important in determing which, if any, gene will be transformed by radiation. It is possible to presume that oncogenes are involved in the development of radioresistant phenotype of ML. Because of that, we examined the presence of c-myc protein in ML cells during the growth of ML and after the irradiation of these cells. Also, we examined the presence of tumor-suppressor protein p53, because inactivation or loss of p53 gene is in connection with transformation of cells. ML is strain specific for RFM mice. Spleen cells were tested 9 (nonterminal phase NTP) or 12 days (terminal phase TP) after inoculation of ML. Cells from NTP were also irradiate with x-rays or UV-light. C-myc protein expresse 74.98% spleen cells of healthy RFM mice. Wild type of p53 protein was detected in 60% of these cells, but mp53 was found in only 5.3% of cells. These results could be explained by the role of c-myc and p53 proteins in regulation of biologic processes. A few spleen cells of NTP expressed c-myc (15%) and mp53 (9.6%) proteins. But, in the same phase higher expressions of wp53 protein (30.5%) was found. On the other hand, the number of c-myc positive cells in TP of leukemia explanation lies in connection of c-myc protein and process of programmed cell death (apoptosis). During growth of ML the number of mp53 positive cells increased (to 47.8%), but wp53 positive cells decreased (to13.4%9). Both types of irradiation provoked strong activation of cellular c-myc gene in ML cells of NTP. We found about 95% c-myc positive cells after x-rays and 93% after UV-light
Boesten, L.S.M.; Zadelaar, A.S.M.; Nieuwkoop, A. van; Hu, L.; Teunisse, A.F.A.S.; Jochemsen, A.G.; Evers, B.; Water, B. van de; Gijbels, M.J.J.; Vlijmen, B.J.M. van; Havekes, L.M.; Winther, M.P.J. de
2009-01-01
The cellular composition of atherosclerotic lesions is determined by many factors including cell infiltration, proliferation and cell death. Tumor suppressor gene p53 has been shown to regulate both cell proliferation and cell death in many cell types. In the present study, we investigated the role
International Nuclear Information System (INIS)
Tierney, L.A.; Hahn, F.F.; Lechner, J.F.
1996-01-01
Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs
Genetic alterations in head and neck squamous cell carcinomas
Directory of Open Access Journals (Sweden)
Nagai M.A.
1999-01-01
Full Text Available The genetic alterations observed in head and neck cancer are mainly due to oncogene activation (gain of function mutations and tumor suppressor gene inactivation (loss of function mutations, leading to deregulation of cell proliferation and death. These genetic alterations include gene amplification and overexpression of oncogenes such as myc, erbB-2, EGFR and cyclinD1 and mutations, deletions and hypermethylation leading to p16 and TP53 tumor suppressor gene inactivation. In addition, loss of heterozygosity in several chromosomal regions is frequently observed, suggesting that other tumor suppressor genes not yet identified could be involved in the tumorigenic process of head and neck cancers. The exact temporal sequence of the genetic alterations during head and neck squamous cell carcinoma (HNSCC development and progression has not yet been defined and their diagnostic or prognostic significance is controversial. Advances in the understanding of the molecular basis of head and neck cancer should help in the identification of new markers that could be used for the diagnosis, prognosis and treatment of the disease.
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Rappsilber, Juri
2014-01-01
linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...
Ariffin, Hany; Hainaut, Pierre; Puzio-Kuter, Anna; Choong, Soo Sin; Chan, Adelyne Sue Li; Tolkunov, Denis; Rajagopal, Gunaretnam; Kang, Wenfeng; Lim, Leon Li Wen; Krishnan, Shekhar; Chen, Kok-Siong; Achatz, Maria Isabel; Karsa, Mawar; Shamsani, Jannah; Levine, Arnold J; Chan, Chang S
2014-10-28
The Li-Fraumeni syndrome (LFS) and its variant form (LFL) is a familial predisposition to multiple forms of childhood, adolescent, and adult cancers associated with germ-line mutation in the TP53 tumor suppressor gene. Individual disparities in tumor patterns are compounded by acceleration of cancer onset with successive generations. It has been suggested that this apparent anticipation pattern may result from germ-line genomic instability in TP53 mutation carriers, causing increased DNA copy-number variations (CNVs) with successive generations. To address the genetic basis of phenotypic disparities of LFS/LFL, we performed whole-genome sequencing (WGS) of 13 subjects from two generations of an LFS kindred. Neither de novo CNV nor significant difference in total CNV was detected in relation with successive generations or with age at cancer onset. These observations were consistent with an experimental mouse model system showing that trp53 deficiency in the germ line of father or mother did not increase CNV occurrence in the offspring. On the other hand, individual records on 1,771 TP53 mutation carriers from 294 pedigrees were compiled to assess genetic anticipation patterns (International Agency for Research on Cancer TP53 database). No strictly defined anticipation pattern was observed. Rather, in multigeneration families, cancer onset was delayed in older compared with recent generations. These observations support an alternative model for apparent anticipation in which rare variants from noncarrier parents may attenuate constitutive resistance to tumorigenesis in the offspring of TP53 mutation carriers with late cancer onset.
The tumor suppressor Rb and its related Rbl2 genes are regulated by Utx histone demethylase
Energy Technology Data Exchange (ETDEWEB)
Terashima, Minoru; Ishimura, Akihiko; Yoshida, Masakazu [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan); Suzuki, Yutaka; Sugano, Sumio [Graduate School of Frontier Sciences, The University of Tokyo, Kashiwa 277-8561, Chiba (Japan); Suzuki, Takeshi, E-mail: suzuki-t@staff.kanazawa-u.ac.jp [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan)
2010-08-20
Research highlights: {yields} Utx increases expression of Rb and Rbl2 genes through its demethylase activity. {yields} Utx changes histone H3 methylation on the Rb and Rbl2 promoters. {yields} Utx induces decreased cell proliferation of mammalian primary cells. -- Abstract: Utx is a candidate tumor suppressor gene that encodes histone H3 lysine 27 (H3K27) demethylase. In this study, we found that ectopic expression of Utx enhanced the expression of retinoblastoma tumor suppressor gene Rb and its related gene Rbl2. This activation was dependent on the demethylase activity of Utx, and was suggested to contribute to the decreased cell proliferation induced by Utx. A chromatin immunoprecipitation assay showed that over-expressed Utx was associated with the promoter regions of Rb and Rbl2 resulting in the removal of repressive H3K27 tri-methylation and the increase in active H3K4 tri-methylation. Furthermore, siRNA-mediated knockdown of Utx revealed the recruitment of endogenous Utx protein on the promoters of Rb and Rbl2 genes. These results indicate that Rb and Rbl2 are downstream target genes of Utx and may play important roles in Utx-mediated cell growth control.
Role of natural antisense transcripts pertaining to tumor suppressor genes in human carcinomas
International Nuclear Information System (INIS)
Pelicci, G.; Pierotti, M.
2009-01-01
Overlapping transcripts in opposite orientations can potentially form perfect sense-antisense duplex RNA. Recently, several studies have revealed the extent of natural antisense transcripts (NATs) and their role in important biological phenomena also in higher organisms. In order to test the hypothesis that the function of NATs in man might represent an essential element in the regulation of gene expression, especially at transcriptional level, in this study we planned to look for, systematically examine, and characterize NATs belonging in the human genome to the tumour suppressor class of genes, so to identify physiological (and potentially pathological) modulators in this gene class
Xu-Monette, Z.Y.; Moller, M.B.; Tzankov, A.; Montes-Moreno, S.; Hu, W.; Manyam, G.C.; Kristensen, L.; Fan, L.; Visco, C.; Dybkaer, K.; Chiu, A.; Tam, W.; Zu, Y.; Bhagat, G.; Richards, K.L.; Hsi, E.D.; Choi, W.W.; Krieken, J.H.J.M. van; Huang, Q.; Huh, J.; Ai, W.; Ponzoni, M.; Ferreri, A.J.; Wu, L.; Zhao, X.; Bueso-Ramos, C.E.; Wang, S.A.; Go, R.S.; Li, Y.; Winter, J.N.; Piris, M.A.; Medeiros, L.J.; Young, K.H.
2013-01-01
MDM2 is a key negative regulator of the tumor suppressor p53, however, the prognostic significance of MDM2 overexpression in diffuse large B-cell lymphoma (DLBCL) has not been defined convincingly. In a p53 genetically-defined large cohort of de novo DLBCL patients treated with rituximab,
Madka, Venkateshwar; Mohammed, Altaf; Li, Qian; Zhang, Yuting; Kumar, Gaurav; Lightfoot, Stan; Wu, Xueru; Steele, Vernon; Kopelovich, Levy; Rao, Chinthalapally V
2015-01-01
Mutations of the tumor suppressor p53 and elevated levels of polyamines are known to play key roles in urothelial tumorigenesis. We investigated the inhibition of polyamines biosynthesis and the restoration of p53 signaling as a possible means of preventing muscle invasive urothelial tumors using DFMO, an ODC-inhibiting agent, and CP-31398 (CP), a p53 stabilizing agent. Transgenic UPII-SV40T male mice at 6weeks age (n=15/group) were fed control diet (AIN-76A) or experimental diets containing DFMO (1000 and 2000 ppm) or 150 ppm CP or both. At 40 weeks of age, all mice were euthanized and urinary bladders were evaluated to determine tumor weight and histopathology. Low-dose DFMO had a moderate significant inhibitory effect on tumor growth (38%, P0.05). CP at 150 ppm alone had a strong inhibitory effect on tumor growth by 80% (PCP (150 ppm) led to significant decrease in tumor weight (70%, PCP and DFMO appears to be a promising strategy for urothelial TCC prevention.
Sleep quality and methylation status of selected tumor suppressor genes among nurses and midwives.
Bukowska-Damska, Agnieszka; Reszka, Edyta; Kaluzny, Pawel; Wieczorek, Edyta; Przybek, Monika; Zienolddiny, Shanbeh; Peplonska, Beata
2018-01-01
Chronic sleep restriction may affect metabolism, hormone secretion patterns and inflammatory responses. Limited reports suggest also epigenetic effects, such as changes in DNA methylation profiles. The study aims to assess the potential association between poor sleep quality or sleep duration and the levels of 5-methylcytosine in the promoter regions of selected tumor suppressor genes. A cross-sectional study was conducted on 710 nurses and midwives aged 40-60 years. Data from interviews regarding sleep habits and potential confounders were used. The methylation status of tumor suppressor genes was determined via qMSP reactions using DNA samples derived from leucocytes. No significant findings were observed in the total study population or in the two subgroups of women stratified by the current system of work. A borderline significance association was observed between a shorter duration of sleep and an increased methylation level in CDKN2A among day working nurses and midwives. Further studies are warranted to explore this under-investigated topic.
DEFF Research Database (Denmark)
Offersen, Birgitte Vrou; Alsner, Jan; Olsen, Karen Ege
2008-01-01
: Tumour sections were stained for HER2, CD34, and MIB-1. HER2 scores were based on staining intensity, 3+ being considered HER2+. Angiogenesis was scored by the Chalkley method. MIB-1 was evaluated using systematic random sampling. PAI-1 was measured by ELISA. TP53 mutations were evaluated by DGGE...
Stodden, G R; Lindberg, M E; King, M L; Paquet, M; MacLean, J A; Mann, J L; DeMayo, F J; Lydon, J P; Hayashi, K
2015-05-07
Type II endometrial carcinomas (ECs) are estrogen independent, poorly differentiated tumors that behave in an aggressive manner. As TP53 mutation and CDH1 inactivation occur in 80% of human endometrial type II carcinomas, we hypothesized that mouse uteri lacking both Trp53 and Cdh1 would exhibit a phenotype indicative of neoplastic transformation. Mice with conditional ablation of Cdh1 and Trp53 (Cdh1(d/d)Trp53(d/d)) clearly demonstrate architectural features characteristic of type II ECs, including focal areas of papillary differentiation, protruding cytoplasm into the lumen (hobnailing) and severe nuclear atypia at 6 months of age. Further, Cdh1(d/d)Trp53(d/d) tumors in 12-month-old mice were highly aggressive, and metastasized to nearby and distant organs within the peritoneal cavity, such as abdominal lymph nodes, mesentery and peri-intestinal adipose tissues, demonstrating that tumorigenesis in this model proceeds through the universally recognized morphological intermediates associated with type II endometrial neoplasia. We also observed abundant cell proliferation and complex angiogenesis in the uteri of Cdh1(d/d)Trp53(d/d) mice. Our microarray analysis found that most of the genes differentially regulated in the uteri of Cdh1(d/d)Trp53(d/d) mice were involved in inflammatory responses. CD163 and Arg1, markers for tumor-associated macrophages, were also detected and increased in the uteri of Cdh1(d/d)Trp53(d/d) mice, suggesting that an inflammatory tumor microenvironment with immune cell recruitment is augmenting tumor development in Cdh1(d/d)Trp53(d/d) uteri. Further, inflammatory mediators secreted from CDH1-negative, TP53 mutant endometrial cancer cells induced normal macrophages to express inflammatory-related genes through activation of nuclear factor-κB signaling. These results indicate that absence of CDH1 and TP53 in endometrial cells initiates chronic inflammation, promotes tumor microenvironment development following the recruitment of macrophages
Eisenkraft, Arik; Pode-Shakked, Ben; Goldstein, Nurit; Shpirer, Zvi; van Bokhoven, Hans; Anikster, Yair
2015-01-01
Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish descent, in which the index patient presented with a persistent scalp skin lesion, dystrophic nails and light thin hair. Further evaluation revealed over 10 affected individuals in the kindred, over four generations, exhibiting varying degrees of ectodermal involvement. Analysis of the TP63 gene from four of the patients and from two healthy individuals of the same family was performed. Gene sequencing of the patients revealed a nonsense mutation leading to a premature termination codon (PTC) (p.Gln16X). The same mutation was found in all tested affected individuals in the family, but gave rise to marked phenotypic variability with minor clinical manifestations in some individuals, underscoring the clinical heterogeneity associated with the recently described PTC-causing mutations.
Identification of Genetic Susceptibility to Childhood Cancer through Analysis of Genes in Parallel
Plon, Sharon E.; Wheeler, David A.; Strong, Louise C.; Tomlinson, Gail E.; Pirics, Michael; Meng, Qingchang; Cheung, Hannah C.; Begin, Phyllis R.; Muzny, Donna M.; Lewis, Lora; Biegel, Jaclyn A.; Gibbs, Richard A.
2011-01-01
Clinical cancer genetic susceptibility analysis typically proceeds sequentially beginning with the most likely causative gene. The process is time consuming and the yield is low particularly for families with unusual patterns of cancer. We determined the results of in parallel mutation analysis of a large cancer-associated gene panel. We performed deletion analysis and sequenced the coding regions of 45 genes (8 oncogenes and 37 tumor suppressor or DNA repair genes) in 48 childhood cancer patients who also (1) were diagnosed with a second malignancy under age 30, (2) have a sibling diagnosed with cancer under age 30 and/or (3) have a major congenital anomaly or developmental delay. Deleterious mutations were identified in 6 of 48 (13%) families, 4 of which met the sibling criteria. Mutations were identified in genes previously implicated in both dominant and recessive childhood syndromes including SMARCB1, PMS2, and TP53. No pathogenic deletions were identified. This approach has provided efficient identification of childhood cancer susceptibility mutations and will have greater utility as additional cancer susceptibility genes are identified. Integrating parallel analysis of large gene panels into clinical testing will speed results and increase diagnostic yield. The failure to detect mutations in 87% of families highlights that a number of childhood cancer susceptibility genes remain to be discovered. PMID:21356188
A novel proapoptotic gene PANO encodes a post-translational modulator of the tumor suppressor p14ARF
Energy Technology Data Exchange (ETDEWEB)
Watari, Akihiro; Li, Yang; Higashiyama, Shinji; Yutsudo, Masuo, E-mail: yutsudo@biken.osaka-u.ac.jp
2012-02-01
The protein p14ARF is a known tumor suppressor protein controlling cell proliferation and survival, which mainly localizes in nucleoli. However, the regulatory mechanisms that govern its activity or expression remain unclear. Here, we report that a novel proapoptotic nucleolar protein, PANO, modulates the expression and activity of p14ARF in HeLa cells. Overexpression of PANO enhances the stability of p14ARF protein by protecting it from degradation, resulting in an increase in p14ARF expression levels. Overexpression of PANO also induces apoptosis under low serum conditions. This effect is dependent on the nucleolar localization of PANO and inhibited by knocking-down p14ARF. Alternatively, PANO siRNA treated cells exhibit a reduction in p14ARF protein levels. In addition, ectopic expression of PANO suppresses the tumorigenicity of HeLa cells in nude mice. These results indicate that PANO is a new apoptosis-inducing gene by modulating the tumor suppressor protein, p14ARF, and may itself be a new candidate tumor suppressor gene.
Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco
2017-07-01
We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.
Kehrmann, Angela; Truong, Ha; Repenning, Antje; Boger, Regina; Klein-Hitpass, Ludger; Pascheberg, Ulrich; Beckmann, Alf; Opalka, Bertram; Kleine-Lowinski, Kerstin
2013-01-01
The fusion between human tumorigenic cells and normal human diploid fibroblasts results in non-tumorigenic hybrid cells, suggesting a dominant role for tumor suppressor genes in the generated hybrid cells. After long-term cultivation in vitro, tumorigenic segregants may arise. The loss of tumor suppressor genes on chromosome 11q13 has been postulated to be involved in the induction of the tumorigenic phenotype of human papillomavirus (HPV)18-positive cervical carcinoma cells and their derived tumorigenic hybrid cells after subcutaneous injection in immunocompromised mice. The aim of this study was the identification of novel cellular genes that may contribute to the suppression of the tumorigenic phenotype of non-tumorigenic hybrid cells in vivo. We used cDNA microarray technology to identify differentially expressed cellular genes in tumorigenic HPV18-positive hybrid and parental HeLa cells compared to non-tumorigenic HPV18-positive hybrid cells. We detected several as yet unknown cellular genes that play a role in cell differentiation, cell cycle progression, cell-cell communication, metastasis formation, angiogenesis, antigen presentation, and immune response. Apart from the known differentially expressed genes on 11q13 (e.g., phosphofurin acidic cluster sorting protein 1 (PACS1) and FOS ligand 1 (FOSL1 or Fra-1)), we detected novel differentially expressed cellular genes located within the tumor suppressor gene region (e.g., EGF-containing fibulin-like extracellular matrix protein 2 (EFEMP2) and leucine rich repeat containing 32 (LRRC32) (also known as glycoprotein-A repetitions predominant (GARP)) that may have potential tumor suppressor functions in this model system of non-tumorigenic and tumorigenic HeLa x fibroblast hybrid cells. Copyright © 2013 Elsevier Inc. All rights reserved.
Wang, Zuoyun; Sun, Yihua; Gao, Bin; Lu, Yi; Fang, Rong; Gao, Yijun; Xiao, Tian; Liu, Xin-Yuan; Pao, William; Zhao, Yun; Chen, Haiquan; Ji, Hongbin
2014-01-01
Germline mutations are responsible for familial cancer syndromes which account for approximately 5-10% of all types of cancers. These mutations mainly occur at tumor suppressor genes or genome stability genes, such as DNA repair genes. Here we have identified a cancer predisposition family, in which eight members were inflicted with a wide spectrum of cancer including one diagnosed with lung cancer at 22years old. Sequencing analysis of tumor samples as well as histologically normal specimens identified two germline mutations co-existing in the familial cancer syndrome, the mutation of tumor suppressor gene P53 V157D and mismatch repair gene PMS2 R20Q. We further demonstrate that P53 V157D and/or PMS2 R20Q mutant promotes lung cancer cell proliferation. These two mutants are capable of promoting colony formation in soft agar as well as tumor formation in transgenic drosophila system. Collectively, these data have uncovered the important role of co-existing germline P53 and PMS2 mutations in the familial cancer syndrome development. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
National Research Council Canada - National Science Library
Lu, Jianrong; Leder, Philip
2005-01-01
Cancer develops through accumulation of multiple genetic mutations. Loss of tumor suppressor gene p53 and activation of oncogene Neu/ErbB2 are among the most frequent genetic alterations in human breast cancer...
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alfredo Ribeiro-Silva
2003-06-01
Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
A Physical Mechanism and Global Quantification of Breast Cancer.
Directory of Open Access Journals (Sweden)
Chong Yu
Full Text Available Initiation and progression of cancer depend on many factors. Those on the genetic level are often considered crucial. To gain insight into the physical mechanisms of breast cancer, we construct a gene regulatory network (GRN which reflects both genetic and environmental aspects of breast cancer. The construction of the GRN is based on available experimental data. Three basins of attraction, representing the normal, premalignant and cancer states respectively, were found on the phenotypic landscape. The progression of breast cancer can be seen as switching transitions between different state basins. We quantified the stabilities and kinetic paths of the three state basins to uncover the biological process of breast cancer formation. The gene expression levels at each state were obtained, which can be tested directly in experiments. Furthermore, by performing global sensitivity analysis on the landscape topography, six key genes (HER2, MDM2, TP53, BRCA1, ATM, CDK2 and four regulations (HER2⊣TP53, CDK2⊣BRCA1, ATM→MDM2, TP53→ATM were identified as being critical for breast cancer. Interestingly, HER2 and MDM2 are the most popular targets for treating breast cancer. BRCA1 and TP53 are the most important oncogene of breast cancer and tumor suppressor gene, respectively. This further validates the feasibility of our model and the reliability of our prediction results. The regulation ATM→MDM2 has been extensive studied on DNA damage but not on breast cancer. We notice the importance of ATM→MDM2 on breast cancer. Previous studies of breast cancer have often focused on individual genes and the anti-cancer drugs are mainly used to target the individual genes. Our results show that the network-based strategy is more effective on treating breast cancer. The landscape approach serves as a new strategy for analyzing breast cancer on both the genetic and epigenetic levels and can help on designing network based medicine for breast cancer.
The Inherited p53 Mutation in the Brazilian Population.
Achatz, Maria Isabel; Zambetti, Gerard P
2016-12-01
A common criticism of studying rare diseases is the often-limited relevance of the findings to human health. Here, we review ∼15 years of research into an unusual germline TP53 mutation (p.R337H) that began with its detection in children with adrenocortical carcinoma (ACC), a remarkably rare childhood cancer that is associated with poor prognosis. We have come to learn that the p.R337H mutation exists at a very high frequency in Southern and Southeastern Brazil, occurring in one of 375 individuals within a total population of ∼100 million. Moreover, it has been determined that carriers of this founder mutation display variable tumor susceptibility, ranging from isolated cases of pediatric ACC to Li-Fraumeni or Li-Fraumeni-like (LFL) syndromes, thus representing a significant medical issue for this country. Studying the biochemical and molecular consequences of this mutation on p53 tumor-suppressor activity, as well as the putative additional genetic alterations that cooperate with this mutation, is advancing our understanding of how p53 functions in tumor suppression in general. These studies, which originated with a rare childhood tumor, are providing important information for guiding genetic counselors and physicians in treating their patients and are already providing clinical benefit. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.
Directory of Open Access Journals (Sweden)
Mohammad Esmaeil Afzalpour
2016-11-01
Full Text Available Physical activity and diet are the most important modifiable determinants of cancer risk. The objective of this study was to examine the effect of intense intermittent training with and without taking vitamin E on expression of p53 and PTEN tumor suppressing genes in the prostate gland of male rats. For this purpose, 50 Sprague-Dawley male rats were randomly assigned into 5 groups: [1] control (CON, n = 10, [2] sham (S, n = 10, [3] intense intermittent training (IIT, n = 10, [4] intense intermittent training + vitamin E (IIT + VE, n = 10, [5] vitamin E (VE, n = 10. Protocol of this study was implemented for 6 days per week for 6 weeks, with observing the overload principle on the motorized treadmill. After implementing training protocol, expression rate of p53 and PTEN genes reduced significantly (p<0.000, p<0.031, respectively. Taking vitamin E with intermittent training caused significant reduction in p53 expression (p<0.013, while it caused significant increase in expression of PTEN (p<0.035. These results showed that intense intermittent training reduces expression of p53 and PTEN tumor suppressing genes and taking supplementation vitamin E along with this type of training could cause different effects in expression of these tumor suppressor genes.
ICan: an integrated co-alteration network to identify ovarian cancer-related genes.
Zhou, Yuanshuai; Liu, Yongjing; Li, Kening; Zhang, Rui; Qiu, Fujun; Zhao, Ning; Xu, Yan
2015-01-01
Over the last decade, an increasing number of integrative studies on cancer-related genes have been published. Integrative analyses aim to overcome the limitation of a single data type, and provide a more complete view of carcinogenesis. The vast majority of these studies used sample-matched data of gene expression and copy number to investigate the impact of copy number alteration on gene expression, and to predict and prioritize candidate oncogenes and tumor suppressor genes. However, correlations between genes were neglected in these studies. Our work aimed to evaluate the co-alteration of copy number, methylation and expression, allowing us to identify cancer-related genes and essential functional modules in cancer. We built the Integrated Co-alteration network (ICan) based on multi-omics data, and analyzed the network to uncover cancer-related genes. After comparison with random networks, we identified 155 ovarian cancer-related genes, including well-known (TP53, BRCA1, RB1 and PTEN) and also novel cancer-related genes, such as PDPN and EphA2. We compared the results with a conventional method: CNAmet, and obtained a significantly better area under the curve value (ICan: 0.8179, CNAmet: 0.5183). In this paper, we describe a framework to find cancer-related genes based on an Integrated Co-alteration network. Our results proved that ICan could precisely identify candidate cancer genes and provide increased mechanistic understanding of carcinogenesis. This work suggested a new research direction for biological network analyses involving multi-omics data.
Structure and stability insights into tumour suppressor p53 evolutionary related proteins.
Directory of Open Access Journals (Sweden)
Bruno Pagano
Full Text Available The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.
Inhibitor of differentiation 4 (Id4) is a potential tumor suppressor in prostate cancer
International Nuclear Information System (INIS)
Carey, Jason PW; Asirvatham, Ananthi J; Galm, Oliver; Ghogomu, Tandeih A; Chaudhary, Jaideep
2009-01-01
Inhibitor of differentiation 4 (Id4), a member of the Id gene family is also a dominant negative regulator of basic helix loop helix (bHLH) transcription factors. Some of the functions of Id4 appear to be unique as compared to its other family members Id1, Id2 and Id3. Loss of Id4 gene expression in many cancers in association with promoter hypermethylation has led to the proposal that Id4 may act as a tumor suppressor. In this study we provide functional evidence that Id4 indeed acts as a tumor suppressor and is part of a cancer associated epigenetic re-programming. Data mining was used to demonstrate Id4 expression in prostate cancer. Methylation specific polymerase chain reaction (MSP) analysis was performed to understand molecular mechanisms associated with Id4 expression in prostate cancer cell lines. The effect of ectopic Id4 expression in DU145 cells was determined by cell cycle analysis (3H thymidine incorporation and FACS), expression of androgen receptor, p53 and cyclin dependent kinase inhibitors p27 and p21 by a combination of RT-PCR, real time-PCR, western blot and immuno-cytochemical analysis. Id4 expression was down-regulated in prostate cancer. Id4 expression was also down-regulated in prostate cancer line DU145 due to promoter hyper-methylation. Ectopic Id4 expression in DU145 prostate cancer cell line led to increased apoptosis and decreased cell proliferation due in part by an S-phase arrest. In addition to S-phase arrest, ectopic Id4 expression in PC3 cells also resulted in prolonged G2/M phase. At the molecular level these changes were associated with increased androgen receptor (AR), p21, p27 and p53 expression in DU145 cells. The results suggest that Id4 acts directly as a tumor suppressor by influencing a hierarchy of cellular processes at multiple levels that leads to a decreased cell proliferation and change in morphology that is possibly mediated through induction of previously silenced tumor suppressors
Acrolein - a pulmonary hazard.
Bein, Kiflai; Leikauf, George D
2011-09-01
Acrolein is a respiratory irritant that can be generated during cooking and is in environmental tobacco smoke. More plentiful in cigarette smoke than polycyclic aromatic hydrocarbons (PAH), acrolein can adduct tumor suppressor p53 (TP53) DNA and may contribute to TP53-mutations in lung cancer. Acrolein is also generated endogenously at sites of injury, and excessive breath levels (sufficient to activate metalloproteinases and increase mucin transcripts) have been detected in asthma and chronic obstructive pulmonary disease (COPD). Because of its reactivity with respiratory-lining fluid or cellular macromolecules, acrolein alters gene regulation, inflammation, mucociliary transport, and alveolar-capillary barrier integrity. In laboratory animals, acute exposures have lead to acute lung injury and pulmonary edema similar to that produced by smoke inhalation whereas lower concentrations have produced bronchial hyperreactivity, excessive mucus production, and alveolar enlargement. Susceptibility to acrolein exposure is associated with differential regulation of cell surface receptor, transcription factor, and ubiquitin-proteasome genes. Consequent to its pathophysiological impact, acrolein contributes to the morbidly and mortality associated with acute lung injury and COPD, and possibly asthma and lung cancer. Copyright © 2011 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.
Generation of two modified mouse alleles of the Hic1 tumor suppressor gene
Czech Academy of Sciences Publication Activity Database
Pospíchalová, Vendula; Turečková, Jolana; Fafílek, Bohumil; Vojtěchová, Martina; Krausová, Michaela; Lukáš, Jan; Šloncová, Eva; Takacova, S.; Divoký, V.; Leprince, D.; Plachý, Jiří; Kořínek, Vladimír
2011-01-01
Roč. 49, č. 3 (2011), s. 142-151 ISSN 1526-954X R&D Projects: GA ČR(CZ) GA204/07/1567; GA ČR(CZ) GD204/09/H058 Institutional research plan: CEZ:AV0Z50520514 Keywords : Hypermethylated In Cancer 1 * Hic1 tumor suppressor * gene targeting Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.527, year: 2011
Eisenkraft, A.; Pode-Shakked, B.; Goldstein, N.; Shpirer, Z.; Bokhoven, H. van; Anikster, Y.
2015-01-01
Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish
Genomic Landscape Survey Identifies SRSF1 as a Key Oncodriver in Small Cell Lung Cancer.
Directory of Open Access Journals (Sweden)
Liyan Jiang
2016-04-01
Full Text Available Small cell lung cancer (SCLC is an aggressive disease with poor survival. A few sequencing studies performed on limited number of samples have revealed potential disease-driving genes in SCLC, however, much still remains unknown, particularly in the Asian patient population. Here we conducted whole exome sequencing (WES and transcriptomic sequencing of primary tumors from 99 Chinese SCLC patients. Dysregulation of tumor suppressor genes TP53 and RB1 was observed in 82% and 62% of SCLC patients, respectively, and more than half of the SCLC patients (62% harbored TP53 and RB1 mutation and/or copy number loss. Additionally, Serine/Arginine Splicing Factor 1 (SRSF1 DNA copy number gain and mRNA over-expression was strongly associated with poor survival using both discovery and validation patient cohorts. Functional studies in vitro and in vivo demonstrate that SRSF1 is important for tumorigenicity of SCLC and may play a key role in DNA repair and chemo-sensitivity. These results strongly support SRSF1 as a prognostic biomarker in SCLC and provide a rationale for personalized therapy in SCLC.
Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R
2002-08-15
Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage
Directory of Open Access Journals (Sweden)
Rolletschek Alexandra
2009-06-01
Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Kim, Sang-Soo; Rait, Antonina; Kim, Eric; Pirollo, Kathleen F; Chang, Esther H
2015-02-01
Development of temozolomide (TMZ) resistance contributes to the poor prognosis for glioblastoma multiforme (GBM) patients. It was previously demonstrated that delivery of exogenous wild-type tumor suppressor gene p53 via a tumor-targeted nanocomplex (SGT-53) which crosses the blood-brain barrier could sensitize highly TMZ-resistant GBM tumors to TMZ. Here we assessed whether SGT-53 could inhibit development of TMZ resistance. SGT-53 significantly chemosensitized TMZ-sensitive human GBM cell lines (U87 and U251), in vitro and in vivo. Furthermore, in an intracranial GBM tumor model, two cycles of concurrent treatment with systemically administered SGT-53 and TMZ inhibited tumor growth, increased apoptosis and most importantly, significantly prolonged median survival. In contrast TMZ alone had no significant effect on median survival compared to a single cycle of TMZ. These results suggest that combining SGT-53 with TMZ appears to limit development of TMZ resistance, prolonging its anti-tumor effect and could be a more effective therapy for GBM. Using human glioblastoma multiforma cell lines, this research team demonstrated that the delivery of exogenous wild-type tumor suppressor gene p53 via a tumor-targeted nanocomplex limited the development of temozolomide resistance and prolonged its anti-tumor effect, which may enable future human application of this or similar techniques. Copyright © 2015 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Nagasawa, T; Zhang, Q; Raghunath, P N
2006-01-01
To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...
International Nuclear Information System (INIS)
Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.
2014-01-01
Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach
Herr, D; Keck, C; Tempfer, C; Pietrowski, Detlef
2004-12-01
The ovarian corpus luteum plays a critical role in reproduction being the primary source of circulating progesterone. After ovulation the corpus luteum is build by avascular granulosa lutein cells through rapid vascularization regulated by gonadotropic hormones. The present study was performed to investigate whether this process might be influenced by the human chorionic gonadotropin (hCG)-dependent expression of different tumor suppressor genes and hypoxia dependent transcription factors. RNA was isolated from cultured granulosa lutein cells, transcribed into cDNA, and the transcript level of following genes were determined: RB-1, VHL, NF-1, NF-2, Wt-1, p53, APC, and hypoxia inducible factor-1 (HIF-1), -2, and -3alpha. Additionally, the influence of hCG on the expression of VHL, p53, and HIf2alpha were investigated. We demonstrate that in human granulosa lutein cells the tumor suppressor genes RB-1, VHL, NF-1, NF-2, Wt-1, p53, and APC and the hypoxia dependent transcription factors HIF-1alpha, -2alpha, and -3alpha are expressed. In addition, we showed that hCG regulates the expression of p53, VHL, and HIF-2alpha. Our results indicate that hCG may determine the growth and development of the corpus luteum by mediating hypoxic and apoptotic pathways in human granulosa lutein cells. Copyright 2004 Wiley-Liss, Inc.
P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors
International Nuclear Information System (INIS)
Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.
1999-01-01
Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy
Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid
2017-01-01
The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
KLF10, transforming growth factor-{beta}-inducible early gene 1, acts as a tumor suppressor
Energy Technology Data Exchange (ETDEWEB)
Song, Ki-Duk [Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921 (Korea, Republic of); Laboratory of Protein Engineering and Comparative Immunology, School of Agricultural Biotechnology, Seoul National University, Seoul 151-921 (Korea, Republic of); Kim, Duk-Jung [The Institute of Hankook Life Science, 7-9 Myungryun-dong, Jongno-gu, Seoul 110-521 (Korea, Republic of); Lee, Jong Eun [Department of Anatomy, College of Medicine, Yonsei University, Seoul 120-752 (Korea, Republic of); Yun, Cheol-Heui [Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921 (Korea, Republic of); Laboratory of Protein Engineering and Comparative Immunology, School of Agricultural Biotechnology, Seoul National University, Seoul 151-921 (Korea, Republic of); Lee, Woon Kyu, E-mail: wklee@inha.ac.kr [Laboratory of Developmental Genetics, School of Medicine, Inha University, Incheon 400-712 (Korea, Republic of); Brain Korea 21 Center for Advanced Medical Education, School of Medicine, Inha University, Incheon 400-712 (Korea, Republic of)
2012-03-09
Highlights: Black-Right-Pointing-Pointer KLF10{sup -/-} mice exhibited accelerated papilloma development after DMBA/TPA treatment. Black-Right-Pointing-Pointer KLF10{sup -/-} keratinocytes showed increased proliferation and apoptosis. Black-Right-Pointing-Pointer KLF10{sup -/-} MEFs yielded more colonies than wild-type one with H-Ras transfection. Black-Right-Pointing-Pointer KLF10 dose-dependently activated p21{sup WAF1/CIP1} transcription. Black-Right-Pointing-Pointer KLF10 is a tumor suppressor and that it targets p21{sup WAF1/CIP1} transcription. -- Abstract: Krueppel-like factor 10 (KLF10) has been suggested to be a putative tumor suppressor. In the present study, we generated KLF10 deficient mice to explore this hypothesis in vivo. KLF10 deficient mice exhibited increased predisposition to skin tumorigenesis and markedly accelerated papilloma development after DMBA/TPA treatment. On the other hand, KLF10 deficient keratinocytes showed increased proliferation and apoptosis. In colony formation assays after oncogenic H-Ras transfection, KLF10 deficient mouse embryonic fibroblasts (MEFs) yielded more colonies than wild-type MEFs. Furthermore, KLF10 dose-dependently activated p21{sup WAF1/CIP1} transcription, which was independent of p53 and Sp1 binding sites in p21{sup WAF1/CIP1} promoter. This study demonstrates that KLF10 is a tumor suppressor and that it targets p21{sup WAF1/CIP1} transcription.
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
International Nuclear Information System (INIS)
Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio
2010-01-01
The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)
DEFF Research Database (Denmark)
Mansouri, Larry; Grabowski, Pawel; Degerman, Sofie
2013-01-01
Most previous studies on telomere length (TL) in chronic lymphocytic leukemia (CLL) are based on referral cohorts including a high proportion of aggressive cases. Here, the impact of TL was analyzed in a population-based cohort of newly diagnosed CLL (n = 265) and in relation to other prognostic ...... markers. Short telomeres were particularly associated with high-risk genetic markers, such as NOTCH1, SF3B1, or TP53 aberrations, and predicted a short time to treatment (TTT) and overall survival (OS) (both P...
Prolonged Tp-e Interval, Tp-e/QT Ratio and Tp-e/QTc Ratio in Patients with Type 2 Diabetes Mellitus
Directory of Open Access Journals (Sweden)
Alptug Tokatli
2016-03-01
Full Text Available BackgroundType 2 diabetes mellitus (T2DM is associated with increased risk of malignant ventricular arrhythmias. Cardiac electrical inhomogeneity may be the leading cause of the increased arrhythmic risk in patients with T2DM. The peak and the end of the T wave (Tp-e interval and associated Tp-e/QT ratio are promising measures of ventricular repolarization indicating transmural dispersion of repolarization. The aim of this study was to assess ventricular repolarization in patients with T2DM by using Tp-e interval, Tp-e/QT ratio and Tp-e/corrected QT interval (QTc ratio.MethodsForty-three patients with T2DM and 43 healthy control subjects, matched by gender and age, were studied. All participants underwent electrocardiography (ECG recording. PR, RR and QT intervals represents the ECG intervals. These are not abbreviations. In all literature these ECG intervals are written like in this text. Tp-e intervals were measured from 12-lead ECG. Rate QTc was calculated by using the Bazett's formula. Tp-e/QT ratio and Tp-e/QTc ratio were also calculated.ResultsMean Tp-e interval was significantly prolonged in patients with T2DM compared to controls (79.4±10.3, 66.4±8.1 ms, respectively; P<0.001. We also found significantly higher values of Tp-e/QT ratio and Tp-e/QTc ratio in patients with diabetes than controls (0.21±0.03, 0.17±0.02 and 0.19±0.02, 0.16±0.02, respectively; P<0.001. There was no difference in terms of the other ECG parameters between the groups.ConclusionTp-e interval, Tp-e/QT ratio and Tp-e/QTc ratio were prolonged in patients with T2DM. We concluded that T2DM leads to augmentation of transmural dispersion of repolarization suggesting increased risk for ventricular arrhythmogenesis.
Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.
Directory of Open Access Journals (Sweden)
Kristina Kirschner
2015-03-01
Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.
Guerrero-Preston, Rafael; Michailidi, Christina; Marchionni, Luigi; Pickering, Curtis R.; Frederick, Mitchell J.; Myers, Jeffrey N.; Yegnasubramanian, Srinivasan; Hadar, Tal; Noordhuis, Maartje G.; Zizkova, Veronika; Fertig, Elana; Agrawal, Nishant; Westra, William; Koch, Wayne; Califano, Joseph; Velculescu, Victor E.; Sidransky, David
Tumor suppressor genes (TSGs) are commonly inactivated by somatic mutation and/or promoter methylation; yet, recent high-throughput genomic studies have not identified key TSGs inactivated by both mechanisms. We pursued an integrated molecular analysis based on methylation binding domain sequencing
Long Non-Coding RNAs Embedded in the Rb and p53 Pathways
Energy Technology Data Exchange (ETDEWEB)
Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish, E-mail: ashish.lal@nih.gov [Genetics Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 (United States)
2013-12-04
In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways.
Long Non-Coding RNAs Embedded in the Rb and p53 Pathways
International Nuclear Information System (INIS)
Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish
2013-01-01
In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways
Energy Technology Data Exchange (ETDEWEB)
Copp& #233; , Jean-Philippe; Patil, Christopher; Rodier, Francis; Sun, Yu; Munoz, Denise; Goldstein, Joshua; Nelson, Peter; Desprez, Pierre-Yves; Campisi, Judith
2008-10-24
Cellular senescence suppresses cancer by arresting cell proliferation, essentially permanently, in response to oncogenic stimuli, including genotoxic stress. We modified the use of antibody arrays to provide a quantitative assessment of factors secreted by senescent cells. We show that human cells induced to senesce by genotoxic stress secrete myriad factors associated with inflammation and malignancy. This senescence-associated secretory phenotype (SASP) developed slowly over several days and only after DNA damage of sufficient magnitude to induce senescence. Remarkably similar SASPs developed in normal fibroblasts, normal epithelial cells, and epithelial tumor cells after genotoxic stress in culture, and in epithelial tumor cells in vivo after treatment of prostate cancer patients with DNA-damaging chemotherapy. In cultured premalignant epithelial cells, SASPs induced an epithelial-mesenchyme transition and invasiveness, hallmarks of malignancy, by a paracrine mechanism that depended largely on the SASP factors interleukin (IL)-6 and IL-8. Strikingly, two manipulations markedly amplified, and accelerated development of, the SASPs: oncogenic RAS expression, which causes genotoxic stress and senescence in normal cells, and functional loss of the p53 tumor suppressor protein. Both loss of p53 and gain of oncogenic RAS also exacerbated the promalignant paracrine activities of the SASPs. Our findings define a central feature of genotoxic stress-induced senescence. Moreover, they suggest a cell-nonautonomous mechanism by which p53 can restrain, and oncogenic RAS can promote, the development of age-related cancer by altering the tissue microenvironment.
FATS is a transcriptional target of p53 and associated with antitumor activity
Directory of Open Access Journals (Sweden)
Zhang Xifeng
2010-09-01
Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.
Distinct pattern of p53 mutations in bladder cancer
DEFF Research Database (Denmark)
Spruck, C H; Rideout, W M; Olumi, A F
1993-01-01
A distinct mutational spectrum for the p53 tumor suppressor gene in bladder carcinomas was established in patients with known exposures to cigarette smoke. Single-strand conformational polymorphism analysis of exons 5 through 8 of the p53 gene showed inactivating mutations in 16 of 40 (40%) bladder...... tumors from smokers and 13 of 40 (33%) tumors from lifetime nonsmokers. Overall, 13 of the 50 (26%) total point mutations discovered in this and previous work were G:C-->C:G transversions, a relatively rare mutational type in human tumors. In six tumors, identical AGA (Arg)-->ACA (Thr) point mutations...... double mutations, four of which were tandem mutations on the same allele. No double mutations were found in tumors from nonsmoking patients. None of the mutations in smokers were G:C-->T:A transversions, which would be anticipated for exposure to the suspected cigarette smoke carcinogen 4-aminobiphenyl...
International Nuclear Information System (INIS)
Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.
2012-01-01
Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin
York, Dan; Higgins, Robert J.; LeCouteur, Richard A.; Joshi, Nikhil; Bannasch, Danika
2016-01-01
Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. PMID:27251041
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
Al-Hebshi, Nezar Noor; Li, Shiyong; Nasher, Akram Thabet; El-Setouhy, Maged; Alsanosi, Rashad; Blancato, Jan; Loffredo, Christopher
2016-07-15
The study sought to identify genetic aberrations driving oral squamous cell carcinoma (OSCC) development among users of shammah, an Arabian preparation of smokeless tobacco. Twenty archival OSCC samples, 15 of which with a history of shammah exposure, were whole-exome sequenced at an average depth of 127×. Somatic mutations were identified using a novel, matched controls-independent filtration algorithm. CODEX and Exomedepth coupled with a novel, Database of Genomic Variant-based filter were employed to call somatic gene-copy number variations. Significantly mutated genes were identified with Oncodrive FM and the Youn and Simon's method. Candidate driver genes were nominated based on Gene Set Enrichment Analysis. The observed mutational spectrum was similar to that reported by the TCGA project. In addition to confirming known genes of OSCC (TP53, CDKNA2, CASP8, PIK3CA, HRAS, FAT1, TP63, CCND1 and FADD) the analysis identified several candidate novel driver events including mutations of NOTCH3, CSMD3, CRB1, CLTCL1, OSMR and TRPM2, amplification of the proto-oncogenes FOSL1, RELA, TRAF6, MDM2, FRS2 and BAG1, and deletion of the recently described tumor suppressor SMARCC1. Analysis also revealed significantly altered pathways not previously implicated in OSCC including Oncostatin-M signalling pathway, AP-1 and C-MYB transcription networks and endocytosis. There was a trend for higher number of mutations, amplifications and driver events in samples with history of shammah exposure particularly those that tested EBV positive, suggesting an interaction between tobacco exposure and EBV. The work provides further evidence for the genetic heterogeneity of oral cancer and suggests shammah-associated OSCC is characterized by extensive amplification of oncogenes. © 2016 UICC.
Directory of Open Access Journals (Sweden)
Rems Miran
2009-08-01
Full Text Available Abstract Background Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC, it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. Methods We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. Results We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Conclusion Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin.
Directory of Open Access Journals (Sweden)
Hao Tang
2015-03-01
Full Text Available Both BRCA1 and Beclin 1 (BECN1 are tumor suppressor genes, which are in close proximity on the human chromosome 17q21 breast cancer tumor susceptibility locus and are often concurrently deleted. However, their importance in sporadic human breast cancer is not known. To interrogate the effects of BECN1 and BRCA1 in breast cancer, we studied their mRNA expression patterns in breast cancer patients from two large datasets: The Cancer Genome Atlas (TCGA (n = 1067 and the Molecular Taxonomy of Breast Cancer International Consortium (METABRIC (n = 1992. In both datasets, low expression of BECN1 was more common in HER2-enriched and basal-like (mostly triple-negative breast cancers compared to luminal A/B intrinsic tumor subtypes, and was also strongly associated with TP53 mutations and advanced tumor grade. In contrast, there was no significant association between low BRCA1 expression and HER2-enriched or basal-like subtypes, TP53 mutations or tumor grade. In addition, low expression of BECN1 (but not low BRCA1 was associated with poor prognosis, and BECN1 (but not BRCA1 expression was an independent predictor of survival. These findings suggest that decreased mRNA expression of the autophagy gene BECN1 may contribute to the pathogenesis and progression of HER2-enriched, basal-like, and TP53 mutant breast cancers.
Czech Academy of Sciences Publication Activity Database
Ullmannová-Benson, Veronika; Guan, M.; Zhou, X. G.; Tripathi, V.; Yang, V.; Zimonjic, D. B.; Popescu, C.
2009-01-01
Roč. 23, č. 2 (2009), s. 383-390 ISSN 0887-6924 Institutional research plan: CEZ:AV0Z50200510 Keywords : multiple myeloma * tumor suppressor gene * promoter methylation Subject RIV: EC - Immunology Impact factor: 8.296, year: 2009
Increased Arf/p53 activity in stem cells, aging and cancer.
Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander
2017-04-01
Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Inhibitor of differentiation 4 (Id4 is a potential tumor suppressor in prostate cancer
Directory of Open Access Journals (Sweden)
Carey Jason PW
2009-06-01
Full Text Available Abstract Background Inhibitor of differentiation 4 (Id4, a member of the Id gene family is also a dominant negative regulator of basic helix loop helix (bHLH transcription factors. Some of the functions of Id4 appear to be unique as compared to its other family members Id1, Id2 and Id3. Loss of Id4 gene expression in many cancers in association with promoter hypermethylation has led to the proposal that Id4 may act as a tumor suppressor. In this study we provide functional evidence that Id4 indeed acts as a tumor suppressor and is part of a cancer associated epigenetic re-programming. Methods Data mining was used to demonstrate Id4 expression in prostate cancer. Methylation specific polymerase chain reaction (MSP analysis was performed to understand molecular mechanisms associated with Id4 expression in prostate cancer cell lines. The effect of ectopic Id4 expression in DU145 cells was determined by cell cycle analysis (3H thymidine incorporation and FACS, expression of androgen receptor, p53 and cyclin dependent kinase inhibitors p27 and p21 by a combination of RT-PCR, real time-PCR, western blot and immuno-cytochemical analysis. Results Id4 expression was down-regulated in prostate cancer. Id4 expression was also down-regulated in prostate cancer line DU145 due to promoter hyper-methylation. Ectopic Id4 expression in DU145 prostate cancer cell line led to increased apoptosis and decreased cell proliferation due in part by an S-phase arrest. In addition to S-phase arrest, ectopic Id4 expression in PC3 cells also resulted in prolonged G2/M phase. At the molecular level these changes were associated with increased androgen receptor (AR, p21, p27 and p53 expression in DU145 cells. Conclusion The results suggest that Id4 acts directly as a tumor suppressor by influencing a hierarchy of cellular processes at multiple levels that leads to a decreased cell proliferation and change in morphology that is possibly mediated through induction of previously
Tumor-suppressor genes that escape from X-inactivation contribute to cancer sex bias.
Dunford, Andrew; Weinstock, David M; Savova, Virginia; Schumacher, Steven E; Cleary, John P; Yoda, Akinori; Sullivan, Timothy J; Hess, Julian M; Gimelbrant, Alexander A; Beroukhim, Rameen; Lawrence, Michael S; Getz, Gad; Lane, Andrew A
2017-01-01
There is a striking and unexplained male predominance across many cancer types. A subset of X-chromosome genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative 'escape from X-inactivation tumor-suppressor' (EXITS) genes, we examined somatic alterations from >4,100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) X-chromosome genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) harbored loss-of-function mutations more frequently in males (based on a false discovery rate < 0.1), in comparison to zero of 18,055 autosomal and PAR genes (Fisher's exact P < 0.0001). Male-biased mutations in genes that escape X-inactivation were observed in combined analysis across many cancers and in several individual tumor types, suggesting a generalized phenomenon. We conclude that biallelic expression of EXITS genes in females explains a portion of the reduced cancer incidence in females as compared to males across a variety of tumor types.
Evaluation of Tp-E Interval and Tp-E/QT Ratio in Patients with Aortic Stenosis.
Yayla, Çağrı; Bilgin, Murat; Akboğa, Mehmet Kadri; Gayretli Yayla, Kadriye; Canpolat, Uğur; Dinç Asarcikli, Lale; Doğan, Mehmet; Turak, Osman; Çay, Serkan; Özeke, Özcan; Akyel, Ahmet; Yeter, Ekrem; Aydoğdu, Sinan
2016-05-01
The risk of syncope and sudden cardiac death due to ventricular arrhythmias increased in patients with aortic stenosis (AS). Recently, it was shown that Tp-e interval, Tp-e/QT, and Tp-e/QTc ratio can be novel indicators for prediction of ventricular arrhythmias and mortality. We aimed to investigate the association between AS and ventricular repolarization using Tp-e interval and Tp-e/QT ratio. Totally, 105 patients with AS and 60 control subjects were enrolled to this study. The severity of AS was defined by transthoracic echocardiographic examination. Tp-e interval, Tp-e/QT, and Tp-e/QTc ratios were measured from the 12-lead electrocardiogram. Tp-e interval, Tp-e/QT, and Tp-e/QTc ratios were significantly increased in parallel to the severity of AS (P ratio had significant positive correlation with mean aortic gradient (r = 0.192, P = 0.049). In multivariate logistic regression analysis, Tp-e/QTc ratio and left ventricular mass were found to be independent predictors of severe AS (P = 0.03 and P = 0.04, respectively). Our study showed that Tp-e interval, Tp-e/QT, and Tp-e/QTc ratios were increased in patients with severe AS. Tp-e/QTc ratio and left ventricular mass were found as independent predictors of severe AS. © 2015 Wiley Periodicals, Inc.
P18 tumor suppressor gene and progression of oligodendrogliomas to anaplasia.
He, J; Hoang-Xuan, K; Marie, Y; Leuraud, P; Mokhtari, K; Kujas, M; Delattre, J Y; Sanson, M
2000-09-26
P18INK4C is a good candidate to be the tumor suppressor gene involved in oligodendrogliomas on 1p32. Loss of heterozygosity on 1p, mutation(s), homozygous deletion(s), and expression of p18 in 30 oligodendroglial tumors were investigated. Loss of heterozygosity on 1p was found in 15 tumors. A p18 mutation was found at an recurrence of an anaplastic oligodendroglioma, but not in the primary, low-grade tumor. No homozygous deletions were found and p18 was expressed in all cases. These results show that p18 alteration is involved in tumor progression in a subset of oligodendrogliomas.
Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun
2018-05-12
Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.
RPS6KA2, a putative tumour suppressor gene at 6q27 in sporadic epithelial ovarian cancer
DEFF Research Database (Denmark)
Bignone, P A; Lee, K Y; Liu, Y
2007-01-01
We had previously defined by allele loss studies a minimal region at 6q27 (between D6S264 and D6S297) to contain a putative tumour suppressor gene. The p90 ribosomal S6 kinase-3 gene (p90 Rsk-3, RPS6KA2) maps in this interval. It is a serine-threonine kinase that signals downstream of the mitogen...
Radiotherapy modulates expression of EGFR, ERCC1 and p53 in cervical cancer
Energy Technology Data Exchange (ETDEWEB)
Almeida, V.H. de; Melo, A.C. de; Nogueira-Rodrigues, A.; Pimenta-Inada, H.K.; Alves, F.G.; Moralez, G.; Thiago, L.S.; Ferreira, C.G.; Sternberg, C., E-mail: diretoriaexecutiva@sboc.org.br [Instituto Nacional de Câncer (INCA), Rio de Janeiro, RJ (Brazil); Meira, D.D. [Universidade Federal do Espírito Santo (UFES), Vitória, ES (Brazil); Pires, A.C. [Fonte Medicina Diagnóstica, Niterói, RJ (Brazil)
2018-02-01
Cervical cancer is a public health problem and the molecular mechanisms underlying radioresistance are still poorly understood. Here, we evaluated the modulation of key molecules involved in cell proliferation, cell cycle and DNA repair in cervical cancer cell lines (CASKI and C33A) and in malignant tissues biopsied from 10 patients before and after radiotherapy. The expression patterns of epidermal growth factor receptor (EGFR), excision repair cross-complementation group 1 (ERCC1) and p53 were evaluated in cancer cell lines by quantitative PCR and western blotting, and in human malignant tissues by immunohistochemistry. The mutation status of TP53 gene was evaluated by direct sequencing. Among cell lines, absent or weak modulations of EGFR, ERCC1 and p53 were observed after exposure to 1.8 Gy. Conversely, increased expressions of p53 (5/10 patients; P=0.0239), ERCC1 (5/10 patients; P=0.0294) and EGFR (4/10 patients; P=0.1773) were observed in malignant tissues after radiotherapy with the same radiation dose. TP53 mutations were found only in one patient. Here we show that a single dose of radiotherapy induced EGFR, ERCC1 and p53 expression in malignant tissues from cervical cancer patients but not in cancer cell lines, highlighting the gap between in vitro and in vivo experimental models. Studies on larger patient cohorts are needed to allow an interpretation that an up regulation of p53, EGFR and ERCC1 may be part of a radioresistance mechanism. (author)
Evolution of the HIV-1 nef gene in HLA-B*57 Positive Elite Suppressors
Directory of Open Access Journals (Sweden)
Siliciano Robert F
2010-11-01
Full Text Available Abstract Elite controllers or suppressors (ES are HIV-1 infected patients who maintain viral loads of gag and nef in HLA-B*57 positive ES. We previously showed evolution in the gag gene of ES which surprisingly was mostly due to synonymous mutations rather than non-synonymous mutation in targeted CTL epitopes. This finding could be the result of structural constraints on Gag, and we therefore examined the less conserved nef gene. We found slow evolution of nef in plasma virus in some ES. This evolution is mostly due to synonymous mutations and occurs at a rate similar to that seen in the gag gene in the same patients. The results provide further evidence of ongoing viral replication in ES and suggest that the nef and gag genes in these patients respond similarly to selective pressure from the host.
Gene trapping identifies a putative tumor suppressor and a new inducer of cell migration
International Nuclear Information System (INIS)
Guardiola-Serrano, Francisca; Haendeler, Judith; Lukosz, Margarete; Sturm, Karsten; Melchner, Harald von; Altschmied, Joachim
2008-01-01
Tumor necrosis factor alpha (TNFα) is a pleiotropic cytokine involved in apoptotic cell death, cellular proliferation, differentiation, inflammation, and tumorigenesis. In tumors it is secreted by tumor associated macrophages and can have both pro- and anti-tumorigenic effects. To identify genes regulated by TNFα, we performed a gene trap screen in the mammary carcinoma cell line MCF-7 and recovered 64 unique, TNFα-induced gene trap integration sites. Among these were the genes coding for the zinc finger protein ZC3H10 and for the transcription factor grainyhead-like 3 (GRHL3). In line with the dual effects of TNFα on tumorigenesis, we found that ZC3H10 inhibits anchorage independent growth in soft agar suggesting a tumor suppressor function, whereas GRHL3 strongly stimulated the migration of endothelial cells which is consistent with an angiogenic, pro-tumorigenic function
CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.
He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang
2015-03-01
Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.
International Nuclear Information System (INIS)
Metges, J.P.; Giroux, M.A.; Volant, A.; Morin, J.F.; Malhaire, J.P.; Gouerou, H.; Ferec, C.; Robaskiewicz, M.; Labat, J.P.
1997-01-01
The mutations of the TP 53 and MTS1 (p16) gene have been described in numerous neoplasms but their relation with a response to the treatment is still little described. The aim of this work was to evaluate the value of the p53 status(serology, immunohistochemistry and molecular biology) and of the MTS1 gene( protein p16) for the response to the pre surgery radio chemotherapy in a troop of patients suffering from esophagus epidermoid cancer. The p53 serology is positive in 40% of cases and is statistically associated to a bad response. The lost of alleles for MTS1 has been found in 20% of cases but non predictive to the response. A prospective study would be interesting. (N.C.)
International Nuclear Information System (INIS)
Yasuda, Takako; Nagata, Kento; Igarashi, Kento; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi; Kimori, Yoshitaka
2016-01-01
The tumor suppressor protein, p53, plays pivotal roles in regulating apoptosis and proliferation in the embryonic and adult central nervous system (CNS) following neuronal injuries such as those induced by ionizing radiation. There is increasing evidence that p53 negatively regulates the self-renewal of neural stem cells in the adult murine brain; however, it is still unknown whether p53 is essential for self-renewal in the injured developing CNS. Previously, we demonstrated that the numbers of apoptotic cells in medaka (Oryzias latipes) embryos decreased in the absence of p53 at 12-24 h after irradiation with 10-Gy gamma rays. Here, we used histology to examine the later morphological development of the irradiated medaka brain. In p53-deficient larvae, the embryonic brain possessed similar vacuoles in the brain and retina, although the vacuoles were much smaller and fewer than those found in wild-type embryos. At the time of hatching (6 days after irradiation), no brain abnormality was observed. In contrast, severe disorganized neuronal arrangements were still present in the brain of irradiated wild-type embryos. Our present results demonstrated that self-renewal of the brain tissue completed faster in the absence of p53 than wild type at the time of hatching because p53 reduces the acute severe neural apoptosis induced by irradiation, suggesting that p53 is not essential for tissue self-renewal in developing brain. (author)
Directory of Open Access Journals (Sweden)
Xiaohan Li
2011-01-01
Full Text Available Head and neck squamous cell carcinoma (HNSCC is the sixth most common cancer in the world. The evolution and progression of HNSCC are considered to result from multiple stepwise alterations of cellular and molecular pathways in squamous epithelium. Recently, inhibitor of growth gene (ING family consisting of five genes, ING1 to ING5, was identified as a new tumor suppressor gene family that was implicated in the downregulation of cell cycle and chromatin remodeling. In contrast, it has been shown that ING1 and ING2 play an oncogenic role in some cancers, this situation being similar to TGF-β. In HNSCC, the ING family has been reported to be downregulated, and ING translocation from the nucleus to the cytoplasm may be a critical event for carcinogenesis. In this paper, we describe our recent results and briefly summarize current knowledge regarding the biologic functions of ING in HNSCC.
Energy Technology Data Exchange (ETDEWEB)
Qiyue, Hu; Mingyue, Lun [Suzhou Medical Coll., JS (China)
1995-07-01
Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G{sub 1} phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM{sub 9} cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation.
International Nuclear Information System (INIS)
Hu Qiyue; Lun Mingyue
1995-07-01
Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G 1 phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM 9 cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation
Wu, B; Georgopoulos, C; Ang, D
1992-08-01
The grpE gene product is one of three Escherichia coli heat shock proteins (DnaK, DnaJ, and GrpE) that are essential for both bacteriophage lambda DNA replication and bacterial growth at all temperatures. In an effort to determine the role of GrpE and to identify other factors that it may interact with, we isolated multicopy suppressors of the grpE280 point mutation, as judged by their ability to reverse the temperature-sensitive phenotype of grpE280. Here we report the characterization of one of them, designated msgB. The msgB gene maps at approximately 53 min on the E. coli chromosome. The minimal gene possesses an open reading frame that encodes a protein with a predicted size of 41,269 M(r). This open reading frame was confirmed the correct one by direct amino-terminal sequence analysis of the overproduced msgB gene product. Genetic experiments demonstrated that msgB is essential for E. coli growth in the temperature range of 22 to 37 degrees C. Through a sequence homology search, MsgB was shown to be identical to N-succinyl-L-diaminopimelic acid desuccinylase (the dapE gene product), which participates in the diaminopimelic acid-lysine pathway involved in cell wall biosynthesis. Consistent with this finding, the msgB null allele mutant is viable only when the growth medium is supplemented with diaminopimelic acid. These results suggest that GrpE may have a previously unsuspected function(s) in cell wall biosynthesis in E. coli.
van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P
2005-06-10
To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.
Braun, Daniela A.; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A.; Schanze, Denny; Ashraf, Shazia; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I. Chiara; Sanchez-Ferras, Oraly; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E.; Pabst, Werner L.; Warejko, Jillian; Daga, Ankana; LeBerre, Tamara Basta; Matejas, Verena; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T.; Gipson, Patrick E.; Hsu, Chyong-Hsin; Kari, Jameela A.; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okasha; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth; Rump, Patrick; Schnur, Rhonda E.; Shiihara, Takashi; Sinha, Manish; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A.; Tsai, Wen-Hui; Tsai, Jeng-Daw; Vester, Udo; Viskochil, David H.; Vatanavicharn, Nithiwat; Waxler, Jessica L.; Wolf, Matthias T.F.; Wong, Sik-Nin; Poduri, Annapurna; Truglio, Gessica; Mane, Shrikant; Lifton, Richard P.; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Calleweart, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm
2018-01-01
Galloway-Mowat syndrome (GAMOS) is a severe autosomal-recessive disease characterized by the combination of early-onset steroid-resistant nephrotic syndrome (SRNS) and microcephaly with brain anomalies. To date, mutations of WDR73 are the only known monogenic cause of GAMOS and in most affected individuals the molecular diagnosis remains elusive. We here identify recessive mutations of OSGEP, TP53RK, TPRKB, or LAGE3, encoding the 4 subunits of the KEOPS complex in 33 individuals of 30 families with GAMOS. CRISPR/Cas9 knockout in zebrafish and mice recapitulates the human phenotype of microcephaly and results in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibits cell proliferation, which human mutations fail to rescue, and knockdown of either gene activates DNA damage response signaling and induces apoptosis. OSGEP and TP53RK molecularly interact and co-localize with the actin-regulating ARP2/3 complex. Furthermore, knockdown of OSGEP and TP53RK induces defects of the actin cytoskeleton and reduces migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identify 4 novel monogenic causes of GAMOS, describe the first link between KEOPS function and human disease, and delineate potential pathogenic mechanisms. PMID:28805828
Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer
Directory of Open Access Journals (Sweden)
Wen-Cheng Chung
2017-11-01
Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.
Tumor Suppressor Gene-Based Nanotherapy: From Test Tube to the Clinic
Directory of Open Access Journals (Sweden)
Manish Shanker
2011-01-01
Full Text Available Cancer is a major health problem in the world. Advances made in cancer therapy have improved the survival of patients in certain types of cancer. However, the overall five-year survival has not significantly improved in the majority of cancer types. Major challenges encountered in having effective cancer therapy are development of drug resistance by the tumor cells, nonspecific cytotoxicity, and inability to affect metastatic tumors by the chemodrugs. Overcoming these challenges requires development and testing of novel therapies. One attractive cancer therapeutic approach is cancer gene therapy. Several laboratories including the authors' laboratory have been investigating nonviral formulations for delivering therapeutic genes as a mode for effective cancer therapy. In this paper the authors will summarize their experience in the development and testing of a cationic lipid-based nanocarrier formulation and the results from their preclinical studies leading to a Phase I clinical trial for nonsmall cell lung cancer. Their nanocarrier formulation containing therapeutic genes such as tumor suppressor genes when administered intravenously effectively controls metastatic tumor growth. Additional Phase I clinical trials based on the results of their nanocarrier formulation have been initiated or proposed for treatment of cancer of the breast, ovary, pancreas, and metastatic melanoma, and will be discussed.
Tumor suppressor gene-based nanotherapy: from test tube to the clinic.
Shanker, Manish; Jin, Jiankang; Branch, Cynthia D; Miyamoto, Shinya; Grimm, Elizabeth A; Roth, Jack A; Ramesh, Rajagopal
2011-01-01
Cancer is a major health problem in the world. Advances made in cancer therapy have improved the survival of patients in certain types of cancer. However, the overall five-year survival has not significantly improved in the majority of cancer types. Major challenges encountered in having effective cancer therapy are development of drug resistance by the tumor cells, nonspecific cytotoxicity, and inability to affect metastatic tumors by the chemodrugs. Overcoming these challenges requires development and testing of novel therapies. One attractive cancer therapeutic approach is cancer gene therapy. Several laboratories including the authors' laboratory have been investigating nonviral formulations for delivering therapeutic genes as a mode for effective cancer therapy. In this paper the authors will summarize their experience in the development and testing of a cationic lipid-based nanocarrier formulation and the results from their preclinical studies leading to a Phase I clinical trial for nonsmall cell lung cancer. Their nanocarrier formulation containing therapeutic genes such as tumor suppressor genes when administered intravenously effectively controls metastatic tumor growth. Additional Phase I clinical trials based on the results of their nanocarrier formulation have been initiated or proposed for treatment of cancer of the breast, ovary, pancreas, and metastatic melanoma, and will be discussed.
P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability
International Nuclear Information System (INIS)
Mukh-Syaifudin
2006-01-01
Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and
Ottolini, Denis; Calì, Tito; Negro, Alessandro; Brini, Marisa
2013-06-01
DJ-1 was first identified as an oncogene. More recently, mutations in its gene have been found causative for autosomal recessive familial Parkinson disease. Numerous studies support the DJ-1 role in the protection against oxidative stress and maintenance of mitochondria structure; however, the mechanism of its protective function remains largely unknown. We investigated whether mitochondrial Ca(2+) homeostasis, a key parameter in cell physiology, could be a target for DJ-1 action. Here, we show that DJ-1 modulates mitochondrial Ca(2+) transients induced upon cell stimulation with an 1,4,5-inositol-tris-phosphate agonist by favouring the endoplasmic reticulum (ER)-mitochondria tethering. A reduction of DJ-1 levels results in mitochondria fragmentation and decreased mitochondrial Ca(2+) uptake in stimulated cells. To functionally couple these effects with the well-recognized cytoprotective role of DJ-1, we investigated its action in respect to the tumour suppressor p53. p53 overexpression in HeLa cells impairs their ability to accumulate Ca(2+) in the mitochondrial matrix, causes alteration of the mitochondrial morphology and reduces ER-mitochondria contact sites. Mitochondrial impairments are independent from Drp1 activation, since the co-expression of the dominant negative mutant of Drp1 failed to abolish them. DJ-1 overexpression prevents these alterations by re-establishing the ER-mitochondria tethering. Similarly, the co-expression of the pro-fusion protein Mitofusin 2 blocks the effects induced by p53 on mitochondria, confirming that the modulation of the ER-mitochondria contact sites is critical to mitochondria integrity. Thus, the impairment of ER-mitochondria communication, as a consequence of DJ-1 loss-of-function, may be detrimental for mitochondria-related processes and be at the basis of mitochondrial dysfunction observed in Parkinson disease.
Directory of Open Access Journals (Sweden)
Danielle B Ulanet
2010-08-01
Full Text Available The Arf tumor suppressor acts as a sensor of oncogenic signals, countering aberrant proliferation in large part via activation of the p53 transcriptional program, though a number of p53-independent functions have been described. Mounting evidence suggests that, in addition to promoting tumorigenesis via disruptions in the homeostatic balance between cell proliferation and apoptosis of overt cancer cells, genetic alterations leading to tumor suppressor loss of function or oncogene gain of function can also incite tumor development via effects on the tumor microenvironment. In a transgenic mouse model of multi-stage pancreatic neuroendocrine carcinogenesis (PNET driven by inhibition of the canonical p53 and Rb tumor suppressors with SV40 large T-antigen (Tag, stochastic progression to tumors is limited in part by a requirement for initiation of an angiogenic switch. Despite inhibition of p53 by Tag in this mouse PNET model, concomitant disruption of Arf via genetic knockout resulted in a significantly accelerated pathway to tumor formation that was surprisingly not driven by alterations in tumor cell proliferation or apoptosis, but rather via earlier activation of the angiogenic switch. In the setting of a constitutional p53 gene knockout, loss of Arf also accelerated tumor development, albeit to a lesser degree. These findings demonstrate that Arf loss of function can promote tumorigenesis via facilitating angiogenesis, at least in part, through p53-independent mechanisms.
Tumor suppressor genes are frequently methylated in lymph node metastases of breast cancers
Directory of Open Access Journals (Sweden)
Xu Jia
2010-07-01
Full Text Available Abstract Introduction Metastasis represents a major adverse step in the progression of breast carcinoma. Lymph node invasion is the most relevant prognostic factor; however little is known on the molecular events associated with lymph node metastasis process. This study is to investigate the status and role of methylation in lymph node metastatic tumors. Materials and methods Bisulfite pyrosequencing is used to screen 6 putative tumor suppressor genes (HIN-1, RASSF1A, RIL, CDH13, RARβ2 and E-cadherin in 38 pairs of primary breast tumors and lymph node metastases. Results We found that HIN-1, CDH13, RIL, RASSF1A and RARβ2 were frequently methylated both in primary and metastatic tissues (range: 55.3%~89.5%. E-cadherin was not frequently methylated in either setting (range: 18.4%~23.7%. The methylation status of HIN-1, CDH13, RIL, and RARβ2 in lymph nodes metastasis were correlated with that in primary tumors. The Pearson correlation values ranged from 0.624 to 0.472 (p values HIN-1 methylation and hormone status in metastatic lymph nodes. Hypermethylation of HIN-1 in metastasis lymph nodes was significantly associated with expression of ER (odds ratio, 1.070; P = 0.024 and with PR (odds ratio, 1.046; P = 0.026. Conclusions This study suggests that hypermethylation of tumor suppressor genes is extended from primary to metastatic tumors during tumor progression.
Nuclear localization signal of ING4 plays a key role in its binding to p53
International Nuclear Information System (INIS)
Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang
2005-01-01
ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53
Shchetynsky, Klementy; Diaz-Gallo, Lina-Marcella; Folkersen, Lasse; Hensvold, Aase Haj; Catrina, Anca Irinel; Berg, Louise; Klareskog, Lars; Padyukov, Leonid
2017-02-02
Here we integrate verified signals from previous genetic association studies with gene expression and pathway analysis for discovery of new candidate genes and signaling networks, relevant for rheumatoid arthritis (RA). RNA-sequencing-(RNA-seq)-based expression analysis of 377 genes from previously verified RA-associated loci was performed in blood cells from 5 newly diagnosed, non-treated patients with RA, 7 patients with treated RA and 12 healthy controls. Differentially expressed genes sharing a similar expression pattern in treated and untreated RA sub-groups were selected for pathway analysis. A set of "connector" genes derived from pathway analysis was tested for differential expression in the initial discovery cohort and validated in blood cells from 73 patients with RA and in 35 healthy controls. There were 11 qualifying genes selected for pathway analysis and these were grouped into two evidence-based functional networks, containing 29 and 27 additional connector molecules. The expression of genes, corresponding to connector molecules was then tested in the initial RNA-seq data. Differences in the expression of ERBB2, TP53 and THOP1 were similar in both treated and non-treated patients with RA and an additional nine genes were differentially expressed in at least one group of patients compared to healthy controls. The ERBB2, TP53. THOP1 expression profile was successfully replicated in RNA-seq data from peripheral blood mononuclear cells from healthy controls and non-treated patients with RA, in an independent collection of samples. Integration of RNA-seq data with findings from association studies, and consequent pathway analysis implicate new candidate genes, ERBB2, TP53 and THOP1 in the pathogenesis of RA.
International Nuclear Information System (INIS)
Brautigam, Chad A.; Deka, Ranjit K.; Norgard, Michael V.
2013-01-01
The soluble portion of TP0435, a putative periplasmic lipoprotein from the syphilis spirochete T. pallidum, has been purified and crystallized in a rhombohedral space group. A complete native data set has been collected to 2.4 Å resolution. Syphilis, caused by the bacterial spirochete Treponema pallidum, remains a prominent sexually transmitted infection worldwide. Despite sequencing of the genome of this obligate human pathogen 15 years ago, the functions of a large number of the gene products of T. pallidum are still unknown, particularly with respect to those of the organism’s periplasmic lipoproteins. To better understand their functions, a structural biology approach has been pursued. To this end, the soluble portion of the T. pallidum TP0435 lipoprotein (also known as Tp17) was cloned, hyper-expressed in Escherichia coli and purified to apparent homogeneity. The protein crystals obtained from this preparation diffracted to 2.4 Å resolution and had the symmetry of space group R3. In the hexagonal setting, the unit-cell parameters were a = b = 85.7, c = 85.4 Å
Directory of Open Access Journals (Sweden)
Ishrat Mahjabeen
Full Text Available Mitochondrial genes play important roles in cellular energy metabolism, free radical generation, and apoptosis. Dysregulation of these genes have long been suspected to contribute to the generation of reactive oxygen species (ROS, increased proliferation and progression of cancer. A family of orthologues of yeast silent information regulator 3 (SIRT3, 4 (SIRT4 and mitochondrial tumor suppressor 1 (MTUS1 are important mitochondrial tumor suppressor genes which play an important role in the progression of multiple cancers. However, their role in the development of oxidative stress, enhanced proliferation and progression of head and neck squamous cell carcinoma (HNSCC has not yet been studied. In this study we aimed to test the association between reduced mitochondrial tumor suppressor genes' activities and enhancement in tissue oxidative stress and cell proliferation in HNSCC cases. The expression of mitochondrial tumor suppressor genes (SIRT3, SIRT4 and MTUS1, mitochondrial DNA repair gene (OGG1-2a and a proliferation marker (Ki-67 was studied in a study cohort of 120 HNSCC patients and controls with reverse transcriptase polymerase chain reaction (RT-PCR and real-time PCR (qPCR in order to determine the potential prognostic significance of these genes. A statistically significant downregulation of SIRT3 (p<0.001, SIRT4 (p<0.0001, MTUS1 (p<0.002 and OGG1 (p<0.0001 was observed in HNSCC compared to control samples. Ki-67 was also overexpressed (p<0.0001 in HNSCC versus control samples. Additionally, to explore gene-gene relationship, we observed a positive spearmen correlation between SIRT3 versus SIRT4 (r = 0.523***, p<0.0001, SIRT3 versus MTUS1 (r = 0.273***, p<0.001, SIRT3 versus OGG1-2a (r = 0.213*, p<0.03, SIRT4 versus OGG1 (r = 0.338***, p<0.0001 and MTUS1 versus OGG1-2a (r = 0.215*, p<0.03 in HNSCC cases. A negative spearman correlation was observed between OGG1 versus Ki-67 (r = -0.224**, p<0.01 and OGG1-2a versus Ki-67 (r = -0.224**, p<0
Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R.; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J.; Almutairi, Bader; Etchevers, Heather C.; McConville, Carmel; Malik, Karim T. A.
2016-01-01
Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome‐wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome‐wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down‐regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest‐expressing tumors had reduced relapse‐free survival. Our functional studies showed that knock‐down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. PMID:27862318
van Es, J. M.; Polak, M. M.; van den Berg, F. M.; Ramsoekh, T. B.; Craanen, M. E.; Hruban, R. H.; Offerhaus, G. J.
1995-01-01
To determine the potential efficiency of molecular markers specific for neoplastic change--mutations of the K-ras oncogene and the p53 tumour suppressor gene--in diagnosing pancreatic carcinoma. Archival cytology samples obtained from 17 patients with established pancreatic carcinoma were assayed
Potential role of TRIM3 as a novel tumour suppressor in colorectal cancer (CRC) development.
Piao, Mei-Yu; Cao, Hai-Long; He, Na-Na; Xu, Meng-Que; Dong, Wen-Xiao; Wang, Wei-Qiang; Wang, Bang-Mao; Zhou, Bing
2016-01-01
Colorectal cancer (CRC) is the third leading cause of cancer-related mortality in the United States. Recent cancer genome-sequencing efforts and complementary functional studies have led to the identification of a collection of candidate 'driver' genes involved in CRC tumorigenesis. Tripartite motif (TRIM3) is recently identified as a tumour suppressor in glioblastoma but this tumour-suppressive function has not been investigated in CRC. In this study, we investigated the potential role of TRIM3 as a tumour suppressor in CRC development by manipulating the expression of TRIM3 in two authentic CRC cell lines, HCT116 and DLD1, followed by various functional assays, including cell proliferation, colony formation, scratch wound healing, soft agar, and invasion assays. Xenograft experiment was performed to examine in vivo tumour-suppressive properties of TRIM3. Small-interfering RNA (siRNA) mediated knockdown of TRIM3 conferred growth advantage in CRC cells. In contrast, overexpression of TRIM3 affected cell survival, cell migration, anchorage independent growth and invasive potential in CRC cells. In addition, TRIM3 was found to be down-regulated in human colon cancer tissues compared with matched normal colon tissues. Overexpression of TRIM3 significantly inhibited tumour growth in vivo using xenograft mouse models. Mechanistic investigation revealed that TRIM3 can regulate p53 protein level through its stabilisation. TRIM3 functions as a tumour suppressor in CRC progression. This tumour-suppressive function is exerted partially through regulation of p53 protein. Therefore, this protein may represent a novel therapeutic target for prevention or intervention of CRC.
CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.
He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu
2016-01-01
The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.
Tp-e interval and Tp-e/QT ratio in patients with celiac disease.
Demirtaş, K; Yayla, Ç; Yüksel, M; Açar, B; Ünal, S; Ertem, A G; Kaplan, M; Akpinar, M Y; Kiliç, Z M Y; Kayaçetin, E
2017-11-01
Celiac disease is a chronic immune-mediated disease of the small intestine. It has been known that dilated cardiomyopathy and ischemic coronary artery disease have become more frequent in patients with celiac disease. The aim of the study was to assess Tp-e interval and Tp-e/QT ratio in patients with celiac disease. This study was conducted at a single center in collaboration with gastroenterology and cardiology clinics. Between January 2014 and June 2015, a total of 76 consecutive patients were enrolled (38 patients with celiac disease and 38 control subjects). Tp-e interval, Tp-e/QT and Tp-e/QTc ratio were measured from the 12-lead electrocardiogram. Tp-e interval (64.2±11.0 vs. 44.5±6.0; pceliac disease than control subjects. There was a significant positive correlation between Tp-e/QTc ratio and disease duration in patients with celiac disease (r=0.480, p=0.003) and also there was a significant positive correlation between Tp-e/QTc ratio and erythrocyte sedimentation rate (r=0.434, pceliac disease. Whether these changes increase the risk of ventricular arrhythmia deserve further studies. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI). All rights reserved.
Directory of Open Access Journals (Sweden)
Iwona Szarejko
2013-06-01
Full Text Available Abscisic acid plays a pivotal role in the abiotic stress response in plants. Although great progress has been achieved explaining the complexity of the stress and ABA signaling cascade, there are still many questions to answer. Mutants are a valuable tool in the identification of new genes or new alleles of already known genes and in elucidating their role in signaling pathways. We applied a suppressor mutation approach in order to find new components of ABA and abiotic stress signaling in Arabidopsis. Using the abh1 (ABA hypersensitive 1 insertional mutant as a parental line for EMS mutagenesis, we selected several mutants with suppressed hypersensitivity to ABA during seed germination. Here, we present the response to ABA and a wide range of abiotic stresses during the seed germination and young seedling development of two suppressor mutants—soa2 (suppressor of abh1 hypersensitivity to ABA 2 and soa3 (suppressor of abh1 hypersensitivity to ABA 3. Generally, both mutants displayed a suppression of the hypersensitivity of abh1 to ABA, NaCl and mannitol during germination. Both mutants showed a higher level of tolerance than Columbia-0 (Col-0—the parental line of abh1 in high concentrations of glucose. Additionally, soa2 exhibited better root growth than Col-0 in the presence of high ABA concentrations. soa2 and soa3 were drought tolerant and both had about 50% fewer stomata per mm2 than the wild-type but the same number as their parental line—abh1. Taking into account that suppressor mutants had the same genetic background as their parental line—abh1, it was necessary to backcross abh1 with Landsberg erecta four times for the map-based cloning approach. Mapping populations, derived from the cross of abh1 in the Landsberg erecta background with each suppressor mutant, were created. Map based cloning in order to identify the suppressor genes is in progress.
Pan, Chieh-Yu; Tsai, Tsung-Yu; Su, Bor-Chyuan; Hui, Cho-Fat; Chen, Jyh-Yih
2017-01-01
that V. vulnificus disrupted the outer membranes of cells, resulting in the loss of cell shape and integrity. We examined whether TP3 and TP4 increased the membrane permeability of V. vulnificus by measuring the fluorescence resulting from the uptake of 1-N-phenyl-naphthylamine (NPN). Treating fish with TP3 and TP4 under different pH and temperature conditions did not significantly increase MIC values, suggesting that temperature and the acid-base environment do not affect AMP function. In addition, the qPCR results showed that TP3 and TP4 influence the expression of immune-responsive genes, including interleukin (IL)-1β, IL-6, and IL-8. In this study, we demonstrate that TP3 and TP4 show potential for development as drugs to combat fish bacterial infections in aquaculture. PMID:28085905
[Evaluation of the Performance of Two Kinds of Anti-TP Enzyme-Linked Immunosorbent Assay].
Gao, Nan; Huang, Li-Qin; Wang, Rui; Jia, Jun-Jie; Wu, Shuo; Zhang, Jing; Ge, Hong-Wei
2018-06-01
To evaluate the accuracy and precision of 2 kinds of anti-treponema pallidum (anti-TP) ELISA reagents in our laboratory for detecting the anti-TP in voluntary blood donors, so as to provide the data support for use of ELISA reagents after introduction of chemiluminescene immunoassay (CLIA). The route detection of anti-TP was performed by using 2 kinds of ELISA reagents, then 546 responsive positive samples detected by anti-TP ELISA were collected, and the infections status of samples confirmed by treponema pallidum particle agglutination (TPPA) test was identified. The confirmed results of responsive samples detected by 2 kinds of anti-TP ELISA reagents were compared, the accuracy of 2 kinds of anti-TP ELISA reagents was analyzed by drawing ROC and comparing area under curve (AUC), and precision of 2 kinds of anti-TP ELISA reagents was compared by statistical analysis of quality control data from 7.1 2016 to 6.30 2017. There were no statistical difference in confirmed positive rate of responsive samples and weak positive samples between 2 kinds of anti-TP ELISA reagents. The responsive samples detected by 2 kinds of anti-TP ELISA reagents accounted for 85.53%(467/546) of all responsive samples, the positive rate confirmed by TPPA test was 82.87%. 44 responsive samples detected by anti-TP ELISA reagent A and 35 responsive samples detected by anti-TP ELISA reagent B were confirmed to be negative by TPPA test. Comparison of AUC showed that the accuracy of 2 kinds of anti-TP ELISA reagents was more high, the difference between 2 reagents was not statistically significant. The coefficient of variation (CV) of anti-TP ELISA reagent A and B was 14.98% and 18.04% respectively, which met the precision requirement of ELISA test. The accuracy and precision of 2 kinds of anti-TP ELISA reagents used in our laboratory are similar, and using any one of anti-TP ELISA reagents all can satisfy the requirements of blood screening.
Directory of Open Access Journals (Sweden)
Kurahashi Hiroki
2011-08-01
Full Text Available Abstract Background It has been well documented that pre-eclampsia and unexplained fetal growth restriction (FGR have a common etiological background, but little is known about their linkage at the molecular level. The aim of this study was to further investigate the mechanisms underlying pre-eclampsia and unexplained FGR. Methods We analyzed differentially expressed genes in placental tissue from severe pre-eclamptic pregnancies (n = 8 and normotensive pregnancies with or (n = 8 without FGR (n = 8 using a microarray method. Results A subset of the FGR samples showed a high correlation coefficient overall in the microarray data from the pre-eclampsia samples. Many genes that are known to be up-regulated in pre-eclampsia are also up-regulated in FGR, including the anti-angiogenic factors, FLT1 and ENG, believed to be associated with the onset of maternal symptoms of pre-eclampsia. A total of 62 genes were found to be differentially expressed in both disorders. However, gene set enrichment analysis for these differentially expressed genes further revealed higher expression of TP53-downstream genes in pre-eclampsia compared with FGR. TP53-downstream apoptosis-related genes, such as BCL6 and BAX, were found to be significantly more up-regulated in pre-eclampsia than in FGR, although the caspases are expressed at equivalent levels. Conclusions Our current data indicate a common pathophysiology for FGR and pre-eclampsia, leading to an up-regulation of placental anti-angiogenic factors. However, our findings also suggest that it may possibly be the excretion of these factors into the maternal circulation through the TP53-mediated early-stage apoptosis of trophoblasts that leads to the maternal symptoms of pre-eclampsia.
Directory of Open Access Journals (Sweden)
John H Ludes-Meyers
2009-11-01
Full Text Available WWOX, the gene that spans the second most common human chromosomal fragile site, FRA16D, is inactivated in multiple human cancers and behaves as a suppressor of tumor growth. Since we are interested in understanding WWOX function in both normal and cancer tissues we generated mice harboring a conditional Wwox allele by flanking Exon 1 of the Wwox gene with LoxP sites. Wwox knockout (KO mice were developed by breeding with transgenic mice carrying the Cre-recombinase gene under the control of the adenovirus EIIA promoter. We found that Wwox KO mice suffered from severe metabolic defect(s resulting in growth retardation and all mice died by 3 wk of age. All Wwox KO mice displayed significant hypocapnia suggesting a state of metabolic acidosis. This finding and the known high expression of Wwox in kidney tubules suggest a role for Wwox in acid/base balance. Importantly, Wwox KO mice displayed histopathological and hematological signs of impaired hematopoiesis, leukopenia, and splenic atrophy. Impaired hematopoiesis can also be a contributing factor to metabolic acidosis and death. Hypoglycemia and hypocalcemia was also observed affecting the KO mice. In addition, bone metabolic defects were evident in Wwox KO mice. Bones were smaller and thinner having reduced bone volume as a consequence of a defect in mineralization. No evidence of spontaneous neoplasia was observed in Wwox KO mice. We have generated a new mouse model to inactivate the Wwox tumor suppressor gene conditionally. This will greatly facilitate the functional analysis of Wwox in adult mice and will allow investigating neoplastic transformation in specific target tissues.
International Nuclear Information System (INIS)
Matar, S.N.A.
2011-01-01
Colorectal cancer (CRC) is the second leading cause of cancer-related death in the Western world. In Egypt; there is an increasing incidence of the disease, especially among patients ≤40 years age. While CRC have been reported in low incidence rate in developing countries, it is the third most common tumor in male and the fifth common tumor in females in Egypt. Early diagnosis and surgical interference guarantee long survival of most CRC patients. Early diagnosis is impeded by the disease onset at young age and imprecise symptoms at the initial stages of the disease. As in most solid tumors, the malignant transformation of colonic epithelial cells is to arise through a multistep process during which they acquire genetic changes involving the activation of proto-oncogenes and the loss of tumor suppressor genes. Recently, a candidate tumor suppressor gene, KLF6, which is mapped to chromosome 10p, was found to be frequently mutated in a number of cancers. There are some evidences suggesting that the disruption of the functional activity of KLF6 gene products may be one of the early events in tumor genesis of the colon. The main objective of the present study was to detect mutational changes of KLF6 tumor suppressor gene and to study the loss of heterozygosity (LOH) markers at chromosome 10p15 (KLF6 locus) in colorectal lesions and colorectal cancer in Egyptian patients. The patients included in this study were 83 presented with different indications for colonoscopic examination. Selecting patients with colorectal pre-cancerous lesions or colorectal cancer was done according to the results of tissue biopsy from lesion and adjacent normal. The patients were classified into three main groups; (G I) Cancerous group, (G II) polyps group including patients with adenomatous polyps (AP), familial adenomatous polyps (FAP) and hyperplastic polyps (HP) and (G III) Inflammatory Bowel Diseases (IBD) including patients with ulcerative colitis (UC) and Crohn's disease (CD
Liu, Shu-Xia; Geng, Yi-Zhao; Yan, Shi-Wei
2017-06-01
Approximately half of all human cancers show normal TP53 gene expression but aberrant overexpression of MDM2 and/or MDMX. This fact suggests a promising cancer therapeutic strategy in targeting the interactions between p53 and MDM2/MDMX. To help realize the goal of developing effective inhibitors to disrupt the p53-MDM2/MDMX interaction, we systematically investigated the structural and interaction characteristics of p53 with inhibitors of its interactions with MDM2 and MDMX from an atomistic perspective using stochastic molecular dynamics simulations. We found that some specific α helices in the structures of MDM2 and MDMX play key roles in their binding to inhibitors, and that the hydrogen bond formed by the Trp23 residue of p53 with its counterpart in MDM2 or MDMX determines the dynamic competition processes of the disruption of the MDM2-p53 interaction and replacement of p53 from the MDM2-p53 complex in vivo. The results reported in this paper are expected to provide basic information for designing functional inhibitors and realizing new strategies of cancer gene therapy.
The effect of adenovirus-mediated gene expression of FHIT in small cell lung cancer cells
DEFF Research Database (Denmark)
Zandi, Roza; Xu, Kai; Poulsen, Hans S
2011-01-01
The candidate tumor suppressor fragile histidine traid (FHIT) is frequently inactivated in small cell lung cancer (SCLC). Mutations in the p53 gene also occur in the majority of SCLC leading to the accumulation of the mutant protein. Here we evaluated the effect of FHIT gene therapy alone...
'Cancer genes and their expression; blueprint to future improvements in radiation protection?'
International Nuclear Information System (INIS)
Paterson, M.C.
1996-01-01
The field of molecular oncology is reviewed, with some reference to the effects of ionizing radiation. There are three classes of cancer genes: oncogenes, tumor suppressor genes, and modulator genes. Proto-oncogenes control the synthesis of proteins which regulate cell division; these proto-oncogenes, of which about 100 have been identified, become oncogenes when damaged. Oncogenes are dominant. Only about a dozen tumor-suppressor genes have been identified; they are recessive. One example of a tumor suppressor gene is that producing p53 protein, which shuts down DNA replication temporarily to allow time for enzymatic repair of damage resulting from radiation or other damaging agents. Modulator genes are a heterogeneous class, including those genes that facilitate the destruction of pre-malignant cells by immune surveillance. Modulator genes also include those responsible for DNA repair. The study of DNA repair and its defects has made recent strides, and 12 participating enzymes have now been identified. It may soon be possible to monitor low-level radiation effects in individuals at the molecular level. Perhaps individuals will be monitored for their 'carcinogen exposure response' index, giving them the opportunity to adjust their lifestyles and occupations accordingly. 20 refs
Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.
Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C
2017-12-01
Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Alternative polyadenylation of tumor suppressor genes in small intestinal neuroendocrine tumors.
Rehfeld, Anders; Plass, Mireya; Døssing, Kristina; Knigge, Ulrich; Kjær, Andreas; Krogh, Anders; Friis-Hansen, Lennart
2014-01-01
The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3' untranslated regions. Additionally, APA can also produce mRNAs containing different 3'-terminal coding regions. Therefore, APA alters both the repertoire and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3' truncation of mRNA coding regions or 3' untranslated regions. Among these, 11 genes had been previously associated with cancer, with 4 genes being known tumor suppressors: DCC, PDZD2, MAGI1, and DACT2. We validated the APA in three out of three cases with quantitative real-time-PCR. Our findings suggest that changes of APA pattern in these 16 genes could be involved in the tumorigenesis of SI-NETs. Furthermore, they also point to APA as a new target for both diagnostic and treatment of SI-NETs. The identified genes with APA specific to the SI-NETs could be further tested as diagnostic markers and drug targets for disease prevention and treatment.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Towards linked open gene mutations data
2012-01-01
Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives
Towards linked open gene mutations data.
Zappa, Achille; Splendiani, Andrea; Romano, Paolo
2012-03-28
With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development.The publication of variation information as Linked Data opens new perspectives: the exploitation of SPARQL searches on
Gene expression in SK-Mel-28 human melanoma cells treated with the snake venom jararhagin.
Klein, Anelise; Capitanio, Juliana Silva; Maria, Durvanei Augusto; Ruiz, Itamar Romano Garcia
2011-01-01
Alternative approaches to improve the treatment of advanced melanomas are highly needed. The disintegrin domain of metalloproteinases binds integrin receptors on tumor cells, blocking migration, invasion, and metastatization. Previous studies showed that jararhagin, from the Bothrops jararaca snake venom, induces changes in the morphology and viability of SK-Mel-28 human melanoma cells, and decreases the number of metastases in mice injected with pre-treated cells. The purpose of this study was to evaluate the molecular effects of jararhagin on SK-Mel-28 cells and fibroblasts, concerning the expression of integrins, cadherins, caspases, and TP53 genes. Sub-toxic doses of jararhagin were administered to confluent cells. RT-PCR was performed following extraction of total RNA. Jararhagin treatments induced similar morphological alterations in both normal and tumor cells, with higher IC50 values for fibroblasts. Integrin genes were downregulated in untreated cells, except for ITGA6a,b, ITGAv, and ITGB3 which were highly expressed in SK-Mel-28. The integrin expression profiles were not affected by the toxin. However, jararhagin 30ng/μl upregulated genes TP53, CDKN1A, CDKN2A, CASP3, CASP5, CASP6, CASP8, and E-CDH in SK-Mel-28, and genes ITGB6, ITGB7, CASP3, TP53, and CDKN1B in fibroblasts. Appropriate jararhagin concentration can have apoptotic and suppressant effects on SK-Mel-28 cells, rather than on fibroblasts, and can be used to develop potential anti-cancer drugs. Copyright © 2010 Elsevier Ltd. All rights reserved.
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Directory of Open Access Journals (Sweden)
Paolo Kunderfranco
2010-05-01
Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly
Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm
2017-01-01
Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K
2017-01-01
The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Directory of Open Access Journals (Sweden)
Anup K Kundu
Full Text Available The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line.The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency.Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent.This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Pardo, F S; Hsu, D W; Zeheb, R; Efird, J T; Okunieff, P G; Malkin, D M
2004-11-01
Abnormalities of the p53 tumor-suppressor gene are found in a significant proportion of astrocytic brain tumours. We studied tumour specimens from 74 patients evaluated over 20 years at the Massachusetts General Hospital, where clinical outcome could be determined and sufficient pathologic material was available for immunostaining. p53 expression studies employed an affinity-purified p53 monoclonal antibody, whose specificity was verified in absorption studies and, in a minority of cases, a second antibody recognising a different epitope of p53. Significant overexpression of p53 protein was found in 48% of the 74 tumours included in this series and high levels of expression were associated with higher mortality from astrocytic tumours (Pexpression of p53 plays an important role in the pathobiology of these tumours. In a subset of 36 cases, coding regions of the p53 gene were completely sequenced via SSCP and direct DNA sequencing, revealing that overexpression of p53 protein is not always associated with point mutations in conserved exons of the p53 gene. Finally, we confirmed p53 protein expression in early-passage human glioma cell lines of known p53 mutational status and immunostaining scores. Although grade continues to be the strongest prognostic variable, the use of p53 staining as a prognostic indicator, in contrast to mutational DNA analyses, may be a useful adjunct in identifying patients at higher risk of treatment failure.
Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.
Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J
2006-04-01
p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.
Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma
International Nuclear Information System (INIS)
Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.
2014-01-01
Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)
Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.
Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles
2006-10-16
The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.
Directory of Open Access Journals (Sweden)
Xing Yin1
2017-06-01
Full Text Available Objective: To discuss the relationship of ultrasonic shear wave velocity (SWV with oncogene and tumor suppressor gene expression in primary liver cancer lesions as well as angiogenesis factor contents. Methods: 100 patients with primary liver cancer who underwent surgical treatment in our hospital between March 2014 and September 2016 were collected as observation group, and 50 healthy subjects who received physical examination in our hospital during the same period were collected as normal control group. The ultrasonic SWV levels of two groups of subjects were measured before the operation, and the observation groups were further divided into high SWV group and low SWV group, 50 cases in each group. Intraoperative tumor tissue samples were kept and fluorescence quantitative PCR was used to determine the mRNA expression of oncogenes and tumor suppressor genes. Enzymelinked immunosorbent assay was used to determine serum contents of angiogenesis factors in observation group before operation. Results: Hepatic ultrasonic SWV level in observation group was significantly higher than that in normal control group; proto-oncogene CK, Ki67, Gly-3, Survivin and Pokemon mRNA expression in tumor tissue of high SWV group were higher than those of low SWV group while tumor suppressor genes Tg737, p16, p27, PTEN and runx3 mRNA expression were lower than those of low SWV group; serum angiogenesis factors VEGF, MMP-9 and IGF-1R contents were higher than those in low SWV group. Conclusion: The hepatic ultrasonic SWV level increases in patients with primary liver cancer, and the SWV level is directly correlated with oncogene and tumor suppressor gene expression as well as angiogenesis factor contents.
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Tenekecioglu, Erhan; Karaagac, Kemal; Yontar, Osman Can; Agca, Fahriye Vatansever; Ozluk, Ozlem Arican; Tutuncu, Ahmet; Arslan, Burhan; Yilmaz, Mustafa
2015-06-01
Coronary slow flow (CSF) phenomenon is described by angiographically normal coronary arteries with delayed opacification of the distal vasculature. Several studies have suggested that the interval from the peak to the end of the electrocardiographic T wave (Tp-Te) may correspond to the transmural dispersion of the repolarization and that increased Tp-Te interval and Tp-Te/QT ratio are associated with malignant ventricular arrhythmias. The aim of this study was to evaluate the ventricular repolarization by using Tp-Te interval and Tp-Te/QT ratio in patients with CSF. This study included 50 CSF patients (40 male, mean age 48.6±12.5 years) and 40 control individuals (23 male, mean age 47.8±12.5 years). Tp-Te interval and Tp-Te/QT ratio were measured from the 12-lead electrocardiogram. These parameters were compared in groups. Baseline characteristics of the study groups were comparable. In electrocardiographic parameters analysis, QT and corrected QT were similar in CSF patients compared to the controls (357±35.2 vs 362±38.0 milliseconds and 419±25.8 vs 430±44.2 milliseconds, all p value >0.05). Tp-Te interval, Tp-Te/QT and Tp-Te/QTc ratio were significantly higher in CSF patients (85±13.7 vs 74±9.9 milliseconds and 0.24±0.03 vs 0.20±0.02 and 0.20±0.03 vs 0.17±0.02 all p value ratio are prolonged in patients with CSF.
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma
Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.
2012-01-01
Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009
Interaction between the Cockayne syndrome B and p53 proteins: implications for aging.
Frontini, Mattia; Proietti-De-Santis, Luca
2012-02-01
The CSB protein plays a role in the transcription coupled repair (TCR) branch of the nucleotide excision repair pathway. CSB is very often found mutated in Cockayne syndrome, a segmental progeroid genetic disease characterized by organ degeneration and growth failure. The tumor suppressor p53 plays a pivotal role in triggering senescence and apoptosis and suppressing tumorigenesis. Although p53 is very important to avoid cancer, its excessive activity can be detrimental for the lifespan of the organism. This is why a network of positive and negative feedback loops, which most likely evolved to fine-tune the activity of this tumor suppressor, modulate its induction and activation. Accordingly, an unbalanced p53 activity gives rise to premature aging or cancer. The physical interaction between CSB and p53 proteins has been known for more than a decade but, despite several hypotheses, nobody has been able to show the functional consequences of this interaction. In this review we resume recent advances towards a more comprehensive understanding of the critical role of this interaction in modulating p53’s levels and activity, therefore helping the system find a reasonable equilibrium between the beneficial and the detrimental effects of its activity. This crosstalk re-establishes the physiological balance towards cell proliferation and survival instead of towards cell death, after stressors of a broad nature. Accordingly, cells bearing mutations in the csb gene are unable to re-establish this physiological balance and to properly respond to some stress stimuli and undergo massive apoptosis.
Directory of Open Access Journals (Sweden)
Agnes C. Fett-Conte
2002-04-01
Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.
Regulation of Metabolic Activity by p53
Directory of Open Access Journals (Sweden)
Jessica Flöter
2017-05-01
Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.
DEFF Research Database (Denmark)
Gylvin, T; Nolsøe, R; Hansen, T
2004-01-01
Beta cell loss in Type 1 and Type 2 diabetes mellitus may result from apoptosis and necrosis induced by inflammatory mediators. The suppressor of cytokine signalling (SOCS)-3 is a natural inhibitor of cytokine signalling and also influences insulin signalling. SOCS3 could therefore be a candidate...... gene in the development of Type 1 and Type 2 diabetes mellitus....
Suppressors of DnaAATP imposed overinitiation in Escherichia coli
DEFF Research Database (Denmark)
Charbon, Godefroid; Riber, Leise; Cohen, Malene
2011-01-01
Chromosome replication in Escherichia coli is limited by the supply of DnaA associated with ATP. Cells deficient in RIDA (Regulatory Inactivation of DnaA) due to a deletion of the hda gene accumulate suppressor mutations (hsm) to counteract the overinitiation caused by an elevated DnaAATP level....... Eight spontaneous hda suppressor mutations were identified by whole-genome sequencing, and three of these were analysed further. Two mutations (hsm-2 and hsm-4) mapped in the dnaA gene and led to a reduced ability to initiate replication from oriC. One mutation (hsm-1) mapped to the seqA promoter...
p53-dependent non-coding RNA networks in chronic lymphocytic leukemia
Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.
2015-01-01
Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We
Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function
Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.
2011-01-01
The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107
TRIM65 negatively regulates p53 through ubiquitination
Energy Technology Data Exchange (ETDEWEB)
Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.
Directory of Open Access Journals (Sweden)
Mihai TOMA
2009-11-01
Full Text Available Inactivation of tumor suppressor genes p53 and DCC has been frequently observed in colorectal cancer. The aim of this case-control study was to test possible association between polymorphisms g.32008376A>G (rs714 of DCC gene and g.7175464A>G (rs1625895 of p53 gene and colorectal cancer risk in Romanian patients. We investigate these two polymorphisms by PCR-RFLP in individuals with colorectal cancer (n=120, M:W=74:46 and healthy persons (n=60, M:W=32:28. We observed that GG genotype of both genes confer protection for CRC (ORDCC 0.34, 95%CI 0.18-0.66, ORp53 0.28, 95%CI 0.14-0.55. The presence of DCC AA (OR 2.97, 95%CI 0.97-9.08 and p53 GA (OR 3.86, 95%CI 1.89-7.87 genotypes are associated with an increased risk for CRC. The alleles A of both markers are associated with the risk for disease (OR 2.87, 95%CI 1.49-5.50, respectively 3.54, 95%CI 1.81-6.91. We also observed that coinheritance of DCC GG genotype and p53 GG (OR 0.36 or p53 GA (OR 0.23 confer protection for CRC. These apparent discordant results obtained for the p53 gene may be the result of interaction with other markers or a selection bias. Our findings indicate that the p53 and DCC polymorphisms are associated with a risk of CRC in Romanian patients.
The combined status of ATM and p53 link tumor development with therapeutic response
DEFF Research Database (Denmark)
Jiang, Hai; Reinhardt, H Christian; Bartkova, Jirina
2009-01-01
commonly used by tumors to bypass early neoplastic checkpoints ultimately determine chemotherapeutic response and generate tumor-specific vulnerabilities that can be exploited with targeted therapies. Specifically, evaluation of the combined status of ATM and p53, two commonly mutated tumor suppressor...... genes, can help to predict the clinical response to genotoxic chemotherapies. We show that in p53-deficient settings, suppression of ATM dramatically sensitizes tumors to DNA-damaging chemotherapy, whereas, conversely, in the presence of functional p53, suppression of ATM or its downstream target Chk2...... actually protects tumors from being killed by genotoxic agents. Furthermore, ATM-deficient cancer cells display strong nononcogene addiction to DNA-PKcs for survival after DNA damage, such that suppression of DNA-PKcs in vivo resensitizes inherently chemoresistant ATM-deficient tumors to genotoxic...
International Nuclear Information System (INIS)
Hermann, R.M.; Fest, J.; Christiansen, H.; Hille, A.; Rave-Fraenk, M.; Nitsche, M.; Gruendker, C.; Viereck, V.; Jarry, H.; Schmidberger, H.
2007-01-01
Background and Purpose: Simultaneous radiotherapy with chemotherapy is a standard treatment for inoperable non-small cell lung cancer (NSCLC), but the clinical outcome still remains poor. To further intensify treatment, substances need to be identified, which increase the effect of radiation on tumor cells without further enhancing toxicity to normal tissue. Hormones have a different toxicity profile than radiation or cytostatic drugs. As NSCLC often express estrogen receptors (ERs), the combination of genistein or estradiol and radiation in vitro was investigated. Material and Methods: A549 NSCLC cells with an inducible expression of a mutated TP53 and fibroblasts of a male donor (DF-18) were examined. ER expression was immunocytologically confirmed in all studied cell lines. Clonogenic survival was measured after incubation of the cells with genistein or estradiol (0.01 μM and 10 μM as maximum clinically applicable dose) and irradiation with different doses (0-4 Gy). The differentiation state of fibroblasts after combined therapy was analyzed. Results: A549 cells expressing mutated TP53 were more radioresistant than TP53 wild-type cells. Incubation of nonfunctional TP53 cells with genistein or estradiol increased radiosensitivity in both tested concentrations. By contrast, radiosensitivity of A549 with wild-type TP53 and DF-18 was not altered by hormonal incubation. In DF-18 radiation induced growth arrest that was not increased by additional hormonal incubation. Conclusion: NSCLC cells with nonfunctional TP53 might be sensitized against radiation by genistein or estradiol. As genistein is better tolerable than estradiol in patients, additional studies are warranted to assess potential gains of this combination therapy
Ishibashi, Naoki; Himeno, Kohei; Masuda, Yoshimitsu; Perez, Rodney Honrada; Iwatani, Shun; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji
2014-01-01
Enterococcus faecium NKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA [ent53A], enkC [ent53C], enkD [ent53D], and enkZ [ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIaz and enkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies of enkT and ΔenkT mutant strains showed that enkT is responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRK mutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter. PMID:25149515
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
Roles of p53, MYC and HIF-1 in regulating glycolysis - the seventh hallmark of cancer.
Yeung, S J; Pan, J; Lee, M-H
2008-12-01
Despite diversity in genetic events in oncogenesis, cancer cells exhibit a common set of functional characteristics. Otto Warburg discovered that cancer cells have consistently higher rates of glycolysis than normal cells. The underlying mechanisms leading to the Warburg phenomenon include mitochondrial changes, upregulation of rate-limiting enzymes/proteins in glycolysis and intracellular pH regulation, hypoxia-induced switch to anaerobic metabolism, and metabolic reprogramming after loss of p53 function. The regulation of energy metabolism can be traced to a "triad" of transcription factors: c-MYC, HIF-1 and p53. Oncogenetic changes involve a nonrandom set of gene deletions, amplifications and mutations, and many oncogenes and tumor suppressor genes cluster along the signaling pathways that regulate c-MYC, HIF-1 and p53. Glycolysis in cancer cells has clinical implications in cancer diagnosis, treatment and interaction with diabetes mellitus. Many drugs targeting energy metabolism are in development. Future advances in technology may bring about transcriptome and metabolome-guided chemotherapy.
Mutual interactions between P53 and growth factors in cancer
Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE
1998-01-01
The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
Directory of Open Access Journals (Sweden)
Marwa H. Saied
2018-04-01
Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1
Evaluation of Tp-e interval and Tp-e/QT ratio in patients with ankylosing spondylitis.
Acar, Gurkan; Yorgun, Hikmet; Inci, Mehmet Fatih; Akkoyun, Murat; Bakan, Betul; Nacar, Alper Bugra; Dirnak, Imran; Cetin, Gozde Yildirim; Bozoglan, Orhan
2014-03-01
Ankylosing spondylitis (AS) is a chronic multi-systemic inflammatory rheumatic disorder. Several studies have suggested that the interval from the peak to the end of the electrocardiographic T wave (Tp-e) may correspond to the transmural dispersion of repolarization and that increased Tp-e interval and Tp-e/QT ratio are associated with malignant ventricular arrhythmias. The aim of this study was to evaluate ventricular repolarization by using Tp-e interval and Tp-e/QT ratio in patients with AS, and to assess the relation with inflammation. Sixty-two patients with AS and 50 controls were included. Tp-e interval and Tp-e/QT ratio were measured from a 12-lead electrocardiogram, and the Tp-e interval corrected for heart rate. The plasma level of high sensitive C-reactive protein (hsCRP) was measured. These parameters were compared between groups. In electrocardiographic parameters analysis, QT dispersion (QTd) and corrected QTd were significantly increased in AS patients compared to the controls (31.7 ± 9.6 vs 28.2 ± 7.4 and 35.8 ± 11.5 vs 30.6 ± 7.9 ms, P = 0.03 and P = 0.007, respectively). cTp-e interval and Tp-e/QT ratio were also significantly higher in AS patients (92.1 ± 10.2 vs 75.8 ± 8.4 and 0.22 ± 0.02 vs 0.19 ± 0.02 ms, all P values ratio were significantly correlated with hsCRP (r = 0.63, P ratio were increased in AS patients. These electrocardiographic ventricular repolarization indexes were significantly correlated with the plasma level of hsCRP.
Energy Technology Data Exchange (ETDEWEB)
Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
International Nuclear Information System (INIS)
Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying
2007-01-01
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
Sleijfer, S; Le, T. K. P.; de Jong, S.; Timmer-Bosscha, H; Withoff, S; Mulder, NH
Several studies suggest that tumor necrosis factor-alpha (TNF) is able to overcome drug resistance in tumors. Whether TNF is able to do so in tumor cell lines that are drug resistant due to a mutation in the tumor suppressor gene p53 is unclear. Therefore, we studied the in vitro cytotoxic effects