WorldWideScience

Sample records for suppressor gene encoding

  1. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    NARCIS (Netherlands)

    Choorapoikayil, S.; Kuiper, R.V.; de Bruin, A.; den Hertog, J.

    2012-01-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile.

  2. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Suma Choorapoikayil

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena+/−ptenb−/− or ptena−/−ptenb+/− are viable and fertile. ptena+/−ptenb−/− fish develop tumors at a relatively high incidence (10.2% and most tumors developed close to the eye (26/30. Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena−/−ptenb+/− fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena+/−ptenb−/− and ptena−/−ptenb+/− fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena+/−ptenb−/− zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  3. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma.

    Science.gov (United States)

    Choorapoikayil, Suma; Kuiper, Raoul V; de Bruin, Alain; den Hertog, Jeroen

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile. ptena(+/-)ptenb(-/-) fish develop tumors at a relatively high incidence (10.2%) and most tumors developed close to the eye (26/30). Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena(-/-)ptenb(+/-) fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena(+/-)ptenb(-/-) and ptena(-/-)ptenb(+/-) fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena(+/-)ptenb(-/-) zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  4. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

    2008-01-01

    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  5. Is the gene encoding Chibby implicated as a tumour suppressor in colorectal cancer ?

    International Nuclear Information System (INIS)

    Gad, Sophie; Teboul, David; Lièvre, Astrid; Goasguen, Nicolas; Berger, Anne; Beaune, Philippe; Laurent-Puig, Pierre

    2004-01-01

    A novel member of the Wnt signalling pathway, Chibby, was recently identified. This protein inhibits Wnt/β-catenin mediated transcriptional activation by competing with Lef-1 (the transcription factor and target of β-catenin) to bind to β-catenin. This suggests that Chibby could be a tumour suppressor protein. The C22orf2 gene coding Chibby is located on chromosome 22, a region recurrently lost in colorectal cancer. Activation of the Wnt pathway is a major feature of colorectal cancer and occurs through inactivation of APC or activation of β-catenin. All of this led us to analyse the possible implication of Chibby in colorectal carcinogenesis. First, 36 tumour and matched normal colonic mucosa DNA were genotyped with five microsatellite markers located on chromosome 22 to search for loss of heterozygosity. Then, mutation screening of the C22orf2 coding sequence and splice sites was performed in the 36 tumour DNA. Finally, expression of Chibby was analysed by quantitative RT-PCR on 10 patients, 4 with loss of heterozygosity (LOH) on chromosome 22. Loss of heterozygosity involving the C22orf2 region was detected in 11 out of 36 patients (30%). Sequencing analysis revealed a known variant, rs3747174, in exon 5: T321C leading to a silent amino acid polymorphism A107A. Allelic frequencies were 0.69 and 0.31 for T and C variants respectively. No other mutation was detected. Among the 10 patients studied, expression analysis revealed that Chibby is overexpressed in 2 tumours and underexpressed in 1. No correlations were found with 22q LOH status. As no somatic mutation was detected in C22orf2 in 36 colorectal tumour DNA, our results do not support the implication of Chibby as a tumour suppressor in colorectal carcinogenesis. This was supported by the absence of underexpression of Chibby among the tumour samples with 22q LOH. The implication of other Wnt pathway members remains to be identified to explain the part of colorectal tumours without mutation in APC and β-catenin

  6. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben

    2008-01-01

    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  7. The P0 gene of Sugarcane yellow leaf virus encodes an RNA silencing suppressor with unique activities

    International Nuclear Information System (INIS)

    Mangwende, Tichaona; Wang Mingli; Borth, Wayne; Hu, John; Moore, Paul H.; Mirkov, T. Erik; Albert, Henrik H.

    2009-01-01

    The Sugarcane yellow leaf virus (SCYLV) P0, a member of the highly heterologous proteins of poleroviruses, is a suppressor of posttranscriptional gene silencing (PTGS) and has additional activities not seen in other P0 proteins. The P0 protein in previously tested poleroviruses (Beet western yellows virus and Cucurbit aphid-borne yellows virus), suppresses local, but not systemic, PTGS induced by both sense GFP and inverted repeat GF using its F-box-like domain to mediate destabilization of the Argonaute1 protein. We now report that the SCYLV P0 protein not only suppressed local PTGS induced by sense GFP and inverted repeat GF in Nicotiana benthamiana, but also triggered a dosage dependent cell death phenotype in infiltrated leaves and suppressed systemic sense GFP-PTGS. Deletion of the first 15 N-terminal amino acid residues of SCYLV P0 abolished suppression of both local and systemic PTGS and the induction of cell death. In contrast, only systemic PTGS and cell death were lost when the 15 C-terminal amino acid residues were deleted. We conclude that the 15 C-terminal amino acid residue region of SCYLV P0 is necessary for suppressing systemic PTGS and inducing cell death, but is not required for suppression of local PTGS

  8. PTEN, a Tumor Suppressor Gene for Prostate Cancer

    National Research Council Canada - National Science Library

    Ittmann, Michael

    1999-01-01

    .... The PTEN gene is a tumor suppressor gene recently cloned from human chromosome 10q23.3 that encodes a lipid phosphatase which influences a variety of cellular processes that impact on the neoplastic phenotype...

  9. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  10. A mutation screening of oncogenes, tumor suppressor gene TP53 and nuclear encoded mitochondrial complex I genes in oncocytic thyroid tumors.

    Science.gov (United States)

    Evangelisti, Cecilia; de Biase, Dario; Kurelac, Ivana; Ceccarelli, Claudio; Prokisch, Holger; Meitinger, Thomas; Caria, Paola; Vanni, Roberta; Romeo, Giovanni; Tallini, Giovanni; Gasparre, Giuseppe; Bonora, Elena

    2015-03-21

    Thyroid neoplasias with oncocytic features represent a specific phenotype in non-medullary thyroid cancer, reflecting the unique biological phenomenon of mitochondrial hyperplasia in the cytoplasm. Oncocytic thyroid cells are characterized by a prominent eosinophilia (or oxyphilia) caused by mitochondrial abundance. Although disruptive mutations in the mitochondrial DNA (mtDNA) are the most significant hallmark of such tumors, oncocytomas may be envisioned as heterogeneous neoplasms, characterized by multiple nuclear and mitochondrial gene lesions. We investigated the nuclear mutational profile of oncocytic tumors to pinpoint the mutations that may trigger the early oncogenic hit. Total DNA was extracted from paraffin-embedded tissues from 45 biopsies of oncocytic tumors. High-resolution melting was used for mutation screening of mitochondrial complex I subunits genes. Specific nuclear rearrangements were investigated by RT-PCR (RET/PTC) or on isolated nuclei by interphase FISH (PAX8/PPARγ). Recurrent point mutations were analyzed by direct sequencing. In our oncocytic tumor samples, we identified rare TP53 mutations. The series of analyzed cases did not include poorly- or undifferentiated thyroid carcinomas, and none of the TP53 mutated cases had significant mitotic activity or high-grade features. Thus, the presence of disruptive TP53 mutations was completely unexpected. In addition, novel mutations in nuclear-encoded complex I genes were identified. These findings suggest that nuclear genetic lesions altering the bioenergetics competence of thyroid cells may give rise to an aberrant mitochondria-centered compensatory mechanism and ultimately to the oncocytic phenotype.

  11. The chromosome 3p21.3-encoded gene, LIMD1, is a critical tumor suppressor involved in human lung cancer development.

    Science.gov (United States)

    Sharp, Tyson V; Al-Attar, Ahmad; Foxler, Daniel E; Ding, Li; de A Vallim, Thomas Q; Zhang, Yining; Nijmeh, Hala S; Webb, Thomas M; Nicholson, Andrew G; Zhang, Qunyuan; Kraja, Aldi; Spendlove, Ian; Osborne, John; Mardis, Elaine; Longmore, Gregory D

    2008-12-16

    Loss of heterozygosity (LOH) and homozygous deletions at chromosome 3p21.3 are common in both small and nonsmall cell lung cancers, indicating the likely presence of tumor suppressor genes (TSGs). Although genetic and epigenetic changes within this region have been identified, the functional significance of these changes has not been explored. Concurrent protein expression and genetic analyses of human lung tumors coupled with functional studies have not been done. Here, we show that expression of the 3p21.3 gene, LIMD1, is frequently down-regulated in human lung tumors. Loss of LIMD1 expression occurs through a combination of gene deletion, LOH, and epigenetic silencing of transcription without evidence for coding region mutations. Experimentally, LIMD1 is a bona fide TSG. Limd1(-/-) mice are predisposed to chemical-induced lung adenocarcinoma and genetic inactivation of Limd1 in mice heterozygous for oncogenic K-Ras(G12D) markedly increased tumor initiation, promotion, and mortality. Thus, we conclude that LIMD1 is a validated chromosome 3p21.3 tumor-suppressor gene involved in human lung cancer development. LIMD1 is a LIM domain containing adapter protein that localizes to E-cadherin cell-cell adhesive junctions, yet also translocates to the nucleus where it has been shown to function as an RB corepressor. As such, LIMD1 has the potential to communicate cell extrinsic or environmental cues with nuclear responses.

  12. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... satellite DNA β which are predicted to function as silencing suppressors. In the present study suppressor function ... of plant viruses with circular single-stranded DNA genomes that are composed of one or two components of ..... 1 2 3 4 5 6 7 8 9 10 11 12 13 14 M. Figure 4. Southern blot analysis of DNA ...

  13. Suppressors of RNA silencing encoded by tomato leaf curl

    Indian Academy of Sciences (India)

    Whitefly-transmitted begomoviruses infecting tomato crop code for five different proteins, ORF AC4, ORF AC2 and ORF AV2 in DNA-A component, ORF BV1 in DNA-B ... In the present study suppressor function of ORF C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl ...

  14. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    In the present study suppressor function of ORF C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl Multan betasatellite CLCuMB–[IN:Sri:02] and Luffa leaf distortion betasatellite LuLDB-[IN:Lu:04] were examined. Agroinfiltration of GFP-silenced Nicotiana tabaccum cv.

  15. V2 from a curtovirus is a suppressor of post-transcriptional gene silencing.

    Science.gov (United States)

    Luna, Ana P; Rodríguez-Negrete, Edgar A; Morilla, Gabriel; Wang, Liping; Lozano-Durán, Rosa; Castillo, Araceli G; Bejarano, Eduardo R

    2017-10-01

    The suppression of gene silencing is a key mechanism for the success of viral infection in plants. DNA viruses from the Geminiviridae family encode several proteins that suppress transcriptional and post-transcriptional gene silencing (TGS/PTGS). In Begomovirus, the most abundant genus of this family, three out of six genome-encoded proteins, namely C2, C4 and V2, have been shown to suppress PTGS, with V2 being the strongest PTGS suppressor in transient assays. Beet curly top virus (BCTV), the model species for the Curtovirus genus, is able to infect the widest range of plants among geminiviruses. In this genus, only one protein, C2/L2, has been described as inhibiting PTGS. We show here that, despite the lack of sequence homology with its begomoviral counterpart, BCTV V2 acts as a potent PTGS suppressor, possibly by impairing the RDR6 (RNA-dependent RNA polymerase 6)/suppressor of gene silencing 3 (SGS3) pathway.

  16. Wilms' tumours: about tumour suppressor genes, an oncogene and a chameleon gene.

    Science.gov (United States)

    Huff, Vicki

    2011-02-01

    Genes identified as being mutated in Wilms' tumour include TP53, a classic tumour suppressor gene (TSG); CTNNB1 (encoding β-catenin), a classic oncogene; WTX, which accumulating data indicate is a TSG; and WT1, which is inactivated in some Wilms' tumours, similar to a TSG. However, WT1 does not always conform to the TSG label, and some data indicate that WT1 enhances cell survival and proliferation, like an oncogene. Is WT1 a chameleon, functioning as either a TSG or an oncogene, depending on cellular context? Are these labels even appropriate for describing and understanding the function of WT1?

  17. Intellectual disability, oncogenes and tumour suppressor genes: the ...

    Indian Academy of Sciences (India)

    disability, the presence of CNV including gene expressed in the brain or with specific brain function is a strong argument. In contrast, CNV affecting only genes involved in oncogen- esis are mostly ignored. However, links between some onco- genes or tumour suppressor genes and intellectual disability deserve attention.

  18. Characterization and subcellular localization of an RNA silencing suppressor encoded by Rice stripe tenuivirus

    International Nuclear Information System (INIS)

    Xiong Ruyi; Wu Jianxiang; Zhou Yijun; Zhou Xueping

    2009-01-01

    Rice stripe virus (RSV) is a single-stranded (ss) RNA virus belonging to the genus Tenuivirus. RSV is present in many East Asian countries and causes severe diseases in rice fields, especially in China. In this study, we analyzed six proteins encoded by the virus for their abilities to suppress RNA silencing in plant using a green fluorescent protein (GFP)-based transient expression assay. Our results indicate that NS3 encoded by RSV RNA3, but not other five RSV encoded proteins, can strongly suppress local GFP silencing in agroinfiltrated Nicotiana benthamiana leaves. NS3 can reverse the GFP silencing, it can also prevent long distance spread of silencing signals which have been reported to be necessary for inducing systemic silencing in host plants. The NS3 protein can significantly reduce the levels of small interfering RNAs (siRNAs) in silencing cells, and was found to bind 21-nucleotide ss-siRNA, siRNA duplex and long ssRNA but not long double-stranded (ds)-RNA. Both N and C terminal of the NS3 protein are critical for silencing suppression, and mutation of the putative nuclear localization signal decreases its local silencing suppression efficiency and blocks its systemic silencing suppression. The NS3-GFP fusion protein and NS3 were shown to accumulate predominantly in nuclei of onion, tobacco and rice cells through transient expression assay or immunocytochemistry and electron microscopy. In addition, transgenic rice and tobacco plants expressing the NS3 did not show any apparent alteration in plant growth and morphology, although NS3 was proven to be a pathogenicity determinant in the PVX heterogenous system. Taken together, our results demonstrate that RSV NS3 is a suppressor of RNA silencing in planta, possibly through sequestering siRNA molecules generated in cells that are undergoing gene silencing.

  19. High-density zero suppressor and encoder VME board using field programmable gate array

    International Nuclear Information System (INIS)

    Aloisio, A.; Cevenini, F.; Patricelli, S.; INFN, Napoli; Parascandolo, P.

    1994-01-01

    The authors describe a 96 bit zero-suppressor and encoder VME board designed for the RPC trigger system of the L3 Forward/Backward Muon detector at CERN. Running at 20 MHz clock frequency, the board processes the elementary 96 bit wide detector pattern in less than one microsecond, storing hit addresses in a FIFO array. Details of the board architecture--based on seven XILINX XC3020 LCAs--are presented and simulation and preliminary test results are briefly reported

  20. RET is a potential tumor suppressor gene in colorectal cancer

    Science.gov (United States)

    Luo, Yanxin; Tsuchiya, Karen D.; Park, Dong Il; Fausel, Rebecca; Kanngurn, Samornmas; Welcsh, Piri; Dzieciatkowski, Slavomir; Wang, Jianping; Grady, William M.

    2012-01-01

    Cancer arises as the consequence of mutations and epigenetic alterations that activate oncogenes and inactivate tumor suppressor genes. Through a genome-wide screen for methylated genes in colon neoplasms, we identified aberrantly methylated RET in colorectal cancer. RET, a transmembrane receptor tyrosine kinase and a receptor for the GDNF-family ligands, was one of the first oncogenes to be identified and has been shown to be an oncogene in thyroid cancer and pheochromocytoma. However, unexpectedly, we found RET is methylated in 27% of colon adenomas and in 63% of colorectal cancers, and now provide evidence that RET has tumor suppressor activity in colon cancer. The aberrant methylation of RET correlates with decreased RET expression, whereas the restoration of RET in colorectal cancer cell lines results in apoptosis. Furthermore, in support of a tumor suppressor function of RET, mutant RET has also been found in primary colorectal cancer. We now show that these mutations inactivate RET, which is consistent with RET being a tumor suppressor gene in the colon. These findings suggest that the aberrant methylation of RET and the mutational inactivation of RET promote colorectal cancer formation and that RET can serve as a tumor suppressor gene in the colon. Moreover, the increased frequency of methylated RET in colon cancers compared to adenomas suggests RET inactivation is involved in the progression of colon adenomas to cancer. PMID:22751117

  1. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  2. Tumour suppressor genes in sporadic epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Liu, Ying; Ganesan, Trivadi S

    2002-01-01

    Ovarian cancer is the most frequent cause of death from gynaecological malignancies in the western world, and sporadic epithelial ovarian cancer is its most predominant form. The aetiology of sporadic ovarian cancer remains unknown. Genetic studies have enabled a better understanding...... of the evolution of tumour progression. A major focus of research has been to identify tumour suppressor genes implicated in sporadic ovarian cancer over the past decade. Several tumour suppressor genes have been identified by strategies such as positional cloning and differential expression display. Further...... research is warranted to understand fully their contribution to the pathogenesis of sporadic ovarian cancer....

  3. Intellectual disability, oncogenes and tumour suppressor genes: the ...

    Indian Academy of Sciences (India)

    associated with Van-Hippel Lindau syndrome, an inherited neoplastic disorder with retinal and central nervous haeman- gioblastomas and high risk of renal cancers (Maher et al. Keywords. array-CGH; mental retardation; oncogenes; tumour suppressor genes; intellectual disability. Journal of Genetics, Vol. 91, No.

  4. Intellectual disability, oncogenes and tumour suppressor genes: the ...

    Indian Academy of Sciences (India)

    Keywords. array-CGH; mental retardation; oncogenes; tumour suppressor genes; intellectual disability. Author Affiliations. M. Bidart1 2 3 C. Coutton4 5 3. Plateforme Protéomique et Transcriptomique Clinique, Pole Recherche, CHU Grenoble, 38043 Grenoble, France; Equipe, Nanomédecine et Cerveau, Inserm U836, ...

  5. Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

    Science.gov (United States)

    Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

    2004-11-01

    Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

  6. Hypomethylation of tumor suppressor genes in odontogenic myxoma

    OpenAIRE

    Moreira,Paula Rocha; Cardoso,Fabiano Pereira; Brito,João Artur Ricieri; Batista,Aline Carvalho; Gomes,Carolina Cavaliéri; Gomez,Ricardo Santiago

    2011-01-01

    Odontogenic myxoma (OM) is an ectomesenchymal benign odontogenic tumor characterized by spindle or stellate-shaped cells embedded in an abundant myxoid or mucoid extracellular matrix. DNA methylation is characterized by the addition of methyl groups in cytosines within CpG islands in the promoter gene. DNA methylation can decrease the expression of tumor suppressor genes and contribute to the development of neoplastic lesions. The aim of study was to evaluate the methylation pattern of the tu...

  7. Molecular biology III - Oncogenes and tumor suppressor genes

    International Nuclear Information System (INIS)

    Giaccia, Amato J.

    1996-01-01

    Purpose: The purpose of this course is to introduce to radiation oncologists the basic concepts of tumorigenesis, building on the information that will be presented in the first and second part of this series of lectures. Objective: Our objective is to increase the current understanding of radiation oncologists with the process of tumorigenesis, especially focusing on genes that are altered in many tumor types that are potential candidates for novel molecular strategies. As strategies to treat cancer of cancer are becoming more sophisticated, it will be important for both the practitioner and academician to develop a basic understanding of the function of cancer 'genes'. This will be the third in a series of refresher courses that are meant to address recent advances in Cancer Biology in a way that both clinicians without previous knowledge of molecular biology or experienced researchers will find interesting. The lecture will begin with a basic overview of tumorigenesis; methods of detecting chromosome/DNA alterations, approaches used to isolate oncogenes and tumor suppressor genes, and their role in cell killing by apoptosis. Special attention will be given to oncogenes and tumor suppressor genes that are modulated by ionizing radiation and the tumor microenvironment. We will relate the biology of oncogenes and tumor suppressor genes to basic aspects of radiation biology that would be important in clinical practice. Finally, we will review recent studies on the prognostic significance of p53 mutations and apoptosis in tumor specimens. The main point of this lecture is to relate both researcher and clinician what are the therapeutic ramifications of oncogene and tumor suppressor gene mutations found in human neoptasia

  8. Tumor Suppressor Genes within Common Fragile Sites Are Active Players in the DNA Damage Response.

    Directory of Open Access Journals (Sweden)

    Idit Hazan

    2016-12-01

    Full Text Available The role of common fragile sites (CFSs in cancer remains controversial. Two main views dominate the discussion: one suggests that CFS loci are hotspots of genomic instability leading to inactivation of genes encoded within them, while the other view proposes that CFSs are functional units and that loss of the encoded genes confers selective pressure, leading to cancer development. The latter view is supported by emerging evidence showing that expression of a given CFS is associated with genome integrity and that inactivation of CFS-resident tumor suppressor genes leads to dysregulation of the DNA damage response (DDR and increased genomic instability. These two viewpoints of CFS function are not mutually exclusive but rather coexist; when breaks at CFSs are not repaired accurately, this can lead to deletions by which cells acquire growth advantage because of loss of tumor suppressor activities. Here, we review recent advances linking some CFS gene products with the DDR, genomic instability, and carcinogenesis and discuss how their inactivation might represent a selective advantage for cancer cells.

  9. The tumor suppressor Rb and its related Rbl2 genes are regulated by Utx histone demethylase

    Energy Technology Data Exchange (ETDEWEB)

    Terashima, Minoru; Ishimura, Akihiko; Yoshida, Masakazu [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan); Suzuki, Yutaka; Sugano, Sumio [Graduate School of Frontier Sciences, The University of Tokyo, Kashiwa 277-8561, Chiba (Japan); Suzuki, Takeshi, E-mail: suzuki-t@staff.kanazawa-u.ac.jp [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan)

    2010-08-20

    Research highlights: {yields} Utx increases expression of Rb and Rbl2 genes through its demethylase activity. {yields} Utx changes histone H3 methylation on the Rb and Rbl2 promoters. {yields} Utx induces decreased cell proliferation of mammalian primary cells. -- Abstract: Utx is a candidate tumor suppressor gene that encodes histone H3 lysine 27 (H3K27) demethylase. In this study, we found that ectopic expression of Utx enhanced the expression of retinoblastoma tumor suppressor gene Rb and its related gene Rbl2. This activation was dependent on the demethylase activity of Utx, and was suggested to contribute to the decreased cell proliferation induced by Utx. A chromatin immunoprecipitation assay showed that over-expressed Utx was associated with the promoter regions of Rb and Rbl2 resulting in the removal of repressive H3K27 tri-methylation and the increase in active H3K4 tri-methylation. Furthermore, siRNA-mediated knockdown of Utx revealed the recruitment of endogenous Utx protein on the promoters of Rb and Rbl2 genes. These results indicate that Rb and Rbl2 are downstream target genes of Utx and may play important roles in Utx-mediated cell growth control.

  10. Functional Analysis of Chromosome 18 in Pancreatic Cancer: Strong Evidence for New Tumour Suppressor Genes

    Directory of Open Access Journals (Sweden)

    Liviu P. Lefter

    2004-04-01

    Conclusion: These data represent strong functional evidence that chromosome 18q encodes strong tumour and metastasis suppressor activity that is able to switch human pancreatic cancer cells to a dormant phenotype.

  11. Molecular genetic analysis of tumor suppressor genes in ovarian cancer

    International Nuclear Information System (INIS)

    Lee, Je Ho; Park, Sang Yun

    1992-04-01

    To examine the loci of putative tumor suppressor genes in ovarian cancers, we performed the molecular genetic analysis with fresh human ovarian cancers and observed the following data. Frequent allelic losses were observed on chromosomes 4p(42%), 6p(50%), 7p(43%), 8q(31%), 12p(38%), 12q(33%), 16p(33%), 16q(37%), and 19p(34%) in addition to the previously reported 6q, 11p, and 17p in ovarian caroinomas. we have used an additional probe, TCP10 to narrow down the deleted region on chromosome 6q. TCP10 was reported to be mapped to 6q 25-27. Allelic loss was found to be 40% in epithelial ovarian caroinomas. This finding suggests that chromosome 6q 24-27 is one of putative region haboring the tumor suppressor gene of epithelial ovarian cancer (particularly serous type). To examine the association between FAL(Fractional Allelic Loss) and histopathological features, the FAL value on each phenotypically different tumor was calculated as the ratio of the number of allelic losses versus the number of cases informative in each chromosomal arm. The average FALs for each phenotypically different tumor were: serous cystoadenocarcinomas. FAL=0.31 : mucinous 0.12 : and clear cell carcinoma. FAL=0.20. (Author)

  12. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.

    2000-01-01

    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  13. Classical Oncogenes and Tumor Suppressor Genes: A Comparative Genomics Perspective

    Directory of Open Access Journals (Sweden)

    Oxana K. Pickeral

    2000-05-01

    Full Text Available We have curated a reference set of cancer-related genes and reanalyzed their sequences in the light of molecular information and resources that have become available since they were first cloned. Homology studies were carried out for human oncogenes and tumor suppressors, compared with the complete proteome of the nematode, Caenorhabditis elegans, and partial proteomes of mouse and rat and the fruit fly, Drosophila melanogaster. Our results demonstrate that simple, semi-automated bioinformatics approaches to identifying putative functionally equivalent gene products in different organisms may often be misleading. An electronic supplement to this article1 provides an integrated view of our comparative genomics analysis as well as mapping data, physical cDNA resources and links to published literature and reviews, thus creating a “window” into the genomes of humans and other organisms for cancer biology.

  14. Cellular senescence and tumor suppressor gene p16.

    Science.gov (United States)

    Rayess, Hani; Wang, Marilene B; Srivatsan, Eri S

    2012-04-15

    Cellular senescence is an irreversible arrest of cell growth. Biochemical and morphological changes occur during cellular senescence, including the formation of a unique cellular morphology such as flattened cytoplasm. Function of mitochondria, endoplasmic reticulum and lysosomes are affected resulting in the inhibition of lysosomal and proteosomal pathways. Cellular senescence can be triggered by a number of factors including, aging, DNA damage, oncogene activation and oxidative stress. While the molecular mechanism of senescence involves p16 and p53 tumor suppressor genes and telomere shortening, this review is focused on the mechanism of p16 control. The p16-mediated senescence acts through the retinoblastoma (Rb) pathway inhibiting the action of the cyclin dependant kinases leading to G1 cell cycle arrest. Rb is maintained in a hypophosphorylated state resulting in the inhibition of transcription factor E2F1. Regulation of p16 expression is complex and involves epigenetic control and multiple transcription factors. PRC1 (Pombe repressor complex (1) and PRC2 (Pombe repressor complex (2) proteins and histone deacetylases play an important role in the promoter hypermethylation for suppressing p16 expression. While transcription factors YY1 and Id1 suppress p16 expression, transcription factors CTCF, Sp1 and Ets family members activate p16 transcription. Senescence occurs with the inactivation of suppressor elements leading to the enhanced expression of p16. Copyright © 2011 UICC.

  15. Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

    1996-01-01

    Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

  16. Methylation of Tumor Suppressor Genes in Autoimmune Pancreatitis.

    Science.gov (United States)

    Kinugawa, Yasuhiro; Uehara, Takeshi; Sano, Kenji; Matsuda, Kazuyuki; Maruyama, Yasuhiro; Kobayashi, Yukihiro; Nakajima, Tomoyuki; Hamano, Hideaki; Kawa, Shigeyuki; Higuchi, Kayoko; Hosaka, Noriko; Shiozawa, Satoshi; Ishigame, Hiroki; Ota, Hiroyoshi

    Autoimmune pancreatitis (AIP) is a representative IgG4-related and inflammatory disease of unknown etiology. To clarify mechanisms of carcinogenesis resulting from AIP, we focused on methylation abnormalities and KRAS mutations in AIP. Six tumor suppressor genes (NPTX2, Cyclin D2, FOXE1, TFPI2, ppENK, and p16) that exhibited hypermethylation in pancreatic carcinoma were selected for quantitative SYBR green methylation-specific polymerase chain reaction in 10 AIP specimens, 10 pancreatic adenocarcinoma cases without history of AIP containing carcinoma areas (CAs) and noncarcinoma areas (NCAs), and 11 normal pancreas (NP) samples. KRAS mutation in codons 12, 13, and 61 were also investigated using direct sequencing. Hypermethylation events (≥10%) were identified in NPTX2, Cyclin D2, FOXE1, TFPI2, ppENK, and p16 in 1, 2, 2, 0, 2, and 0 CA cases, respectively, but not in these 6 candidate genes in AIP, NCA, and NP. However, the TFPI2 methylation ratio was significantly higher in AIP than NCA and NP. Direct sequencing results for KRAS showed no single-point mutations in AIP. These are the first studies characterizing methylation abnormalities in AIP. AIP's inflammatory condition may be related to carcinogenesis. Further study will elucidate methylation abnormalities associated with carcinogenesis in AIP.

  17. Epigenetic silencing of tumor suppressor genes: Paradigms, puzzles, and potential.

    Science.gov (United States)

    Kazanets, Anna; Shorstova, Tatiana; Hilmi, Khalid; Marques, Maud; Witcher, Michael

    2016-04-01

    Cancer constitutes a set of diseases with heterogeneous molecular pathologies. However, there are a number of universal aberrations common to all cancers, one of these being the epigenetic silencing of tumor suppressor genes (TSGs). The silencing of TSGs is thought to be an early, driving event in the oncogenic process. With this in consideration, great efforts have been made to develop small molecules aimed at the restoration of TSGs in order to limit tumor cell proliferation and survival. However, the molecular forces that drive the broad epigenetic reprogramming and transcriptional repression of these genes remain ill-defined. Undoubtedly, understanding the molecular underpinnings of transcriptionally silenced TSGs will aid us in our ability to reactivate these key anti-cancer targets. Here, we describe what we consider to be the five most logical molecular mechanisms that may account for this widely observed phenomenon: 1) ablation of transcription factor binding, 2) overexpression of DNA methyltransferases, 3) disruption of CTCF binding, 4) elevation of EZH2 activity, 5) aberrant expression of long non-coding RNAs. The strengths and weaknesses of each proposed mechanism is highlighted, followed by an overview of clinical efforts to target these processes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  19. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  20. Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

    International Nuclear Information System (INIS)

    Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

    2004-01-01

    Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

  1. The Function of PTEN Tumor Suppressor Gene in Prostate Cancer Development

    National Research Council Canada - National Science Library

    Wu, Hong

    2001-01-01

    .... The recently identified tumor suppressor gene PTEN is a promising candidate for being involved in prostate cancer since it is frequently deleted in prostate cancer, especially in advanced or metastatic forms...

  2. The Function of PTEN Tumor Suppressor Gene in Prostate Cancer Development

    National Research Council Canada - National Science Library

    Wu, Hong

    2002-01-01

    .... The recently identified tumor suppressor gene PTEN is a promising candidate for being involved in prostate cancer since it is frequently deleted in prostate cancer, especially in advanced or metastatic forms...

  3. Regulation of IAP (Inhibitor of Apoptosis) Gene Expression by the p53 Tumor Suppressor Protein

    National Research Council Canada - National Science Library

    Murphy, Maureen

    2003-01-01

    The goal of the work proposed in this application, which has just completed Year 1, was to analyze the ability of the p53 tumor suppressor protein to repress the anti-apoptotic genes survivin and cIAP-2...

  4. The potential for tumor suppressor gene therapy in head and neck cancer.

    Science.gov (United States)

    Birkeland, Andrew C; Ludwig, Megan L; Spector, Matthew E; Brenner, J Chad

    2016-01-01

    Head and neck squamous cell carcinoma remains a highly morbid and fatal disease. Importantly, genomic sequencing of head and neck cancers has identified frequent mutations in tumor suppressor genes. While targeted therapeutics increasingly are being investigated in head and neck cancer, the majority of these agents are against overactive/overexpressed oncogenes. Therapy to restore lost tumor suppressor gene function remains a key and under-addressed niche in trials for head and neck cancer. Recent advances in gene editing have captured the interest of both the scientific community and the public. As our technology for gene editing and gene expression modulation improves, addressing lost tumor suppressor gene function in head and neck cancers is becoming a reality. This review will summarize new techniques, challenges to implementation, future directions, and ethical ramifications of gene therapy in head and neck cancer.

  5. The oncogenic transcription factor ERG represses the transcription of the tumour suppressor gene PTEN in prostate cancer cells.

    Science.gov (United States)

    Adamo, Patricia; Porazinski, Sean; Rajatileka, Shavanthi; Jumbe, Samantha; Hagen, Rachel; Cheung, Man-Kim; Wilson, Ian; Ladomery, Michael R

    2017-11-01

    The oncogene ETS-related gene (ERG) encodes a transcription factor with roles in the regulation of haematopoiesis, angiogenesis, vasculogenesis, inflammation, migration and invasion. The ERG oncogene is activated in >50% of prostate cancer cases, generally through a gene fusion with the androgen-responsive promoter of transmembrane protease serine 2. Phosphatase and tensin homologue ( PTEN ) is an important tumour suppressor gene that is often inactivated in cancer. ERG overexpression combined with PTEN inactivation or loss is often associated with aggressive prostate cancer. The present study aimed to determine whether or not ERG regulates PTEN transcription directly. ERG was demonstrated to bind to the PTEN promoter and repress its transcription. ERG overexpression reduced endogenous PTEN expression, whereas ERG knockdown increased PTEN expression. The ability of ERG to repress PTEN may contribute to a more cancer-permissive environment.

  6. Alterations in tumour suppressor gene p53 in human gliomas from ...

    Indian Academy of Sciences (India)

    Unknown

    Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. In order ... from Indian patients, we checked 44 untreated primary gliomas for mutations in exons 5–9 of the p53 gene by. PCR-SSCP ... function of p53 is critical to the efficiency of many cancer treatment ...

  7. Alterations in tumour suppressor gene p53 in human gliomas from ...

    Indian Academy of Sciences (India)

    Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. In order to study the significance of the p53 gene in the genesis and development of human glioma from Indian patients, we checked 44 untreated primary gliomas for mutations in exons 5–9 of the p53 ...

  8. Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

    Science.gov (United States)

    Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

    2017-08-15

    Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

  9. Alterations in tumour suppressor gene p53 in human gliomas from ...

    Indian Academy of Sciences (India)

    Unknown

    [Phatak P, Selvi S K, Divya T, Hegde A S, Hegde S and Somasundaram K 2002 Alterations in tumour suppressor gene p53 in human gliomas from Indian patients; J. Biosci. 27 673–678]. 1. Introduction. Glioma, a neoplasm of neuroglial cells, is the most common type of brain tumour, constituting more than 50% of all.

  10. Analyses of tumor-suppressor genes in germline mouse models of cancer.

    Science.gov (United States)

    Wang, Jingqiang; Abate-Shen, Cory

    2014-08-01

    Tumor-suppressor genes are critical regulators of growth and functioning of cells, whose loss of function contributes to tumorigenesis. Accordingly, analyses of the consequences of their loss of function in genetically engineered mouse models have provided important insights into mechanisms of human cancer, as well as resources for preclinical analyses and biomarker discovery. Nowadays, most investigations of genetically engineered mouse models of tumor-suppressor function use conditional or inducible alleles, which enable analyses in specific cancer (tissue) types and overcome the consequences of embryonic lethality of germline loss of function of essential tumor-suppressor genes. However, historically, analyses of genetically engineered mouse models based on germline loss of function of tumor-suppressor genes were very important as these early studies established the principle that loss of function could be studied in mouse cancer models and also enabled analyses of these essential genes in an organismal context. Although the cancer phenotypes of these early germline models did not always recapitulate the expected phenotypes in human cancer, these models provided the essential foundation for the more sophisticated conditional and inducible models that are currently in use. Here, we describe these "first-generation" germline models of loss of function models, focusing on the important lessons learned from their analyses, which helped in the design and analyses of "next-generation" genetically engineered mouse models. © 2014 Cold Spring Harbor Laboratory Press.

  11. TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan

    2010-01-01

    Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC

  12. Modulation and Expression of Tumor Suppressor Genes by Environmental Agents

    National Research Council Canada - National Science Library

    Ostrander, Gary Kent

    1996-01-01

    ... in the retinoblastoma gene in retinoblastoma and hepatocarcinomas following induction with known environmental carcinogens. Studies to date suggest the retinoblastoma gene/protein may play a role in oncogenesis in the medaka.

  13. Regulation of the insulin-like developmental pathway of Caenorhabditis elegans by a homolog of the PTEN tumor suppressor gene.

    Science.gov (United States)

    Gil, E B; Malone Link, E; Liu, L X; Johnson, C D; Lees, J A

    1999-03-16

    The human PTEN tumor suppressor gene is mutated in a wide variety of sporadic tumors. To determine the function of PTEN in vivo we have studied a PTEN homolog in Caenorhabditis elegans. We have generated a strong loss-of-function allele of the PTEN homolog and shown that the deficient strain is unable to enter dauer diapause. An insulin-like phosphatidylinositol 3-OH kinase (PI3'K) signaling pathway regulates dauer-stage entry. Mutations in either the daf-2 insulin receptor-like (IRL) gene or the age-1 encoded PI3'K catalytic subunit homolog cause constitutive dauer formation and also affect the life span, brood size, and metabolism of nondauer animals. Strikingly, loss-of-function mutations in the age-1 PI3'K and daf-2 IRL genes are suppressed by loss-of-function mutations in the PTEN homolog. We establish that the PTEN homolog is encoded by daf-18, a previously uncloned gene that has been shown to interact genetically with the DAF-2 IRL AGE-1 PI3'K signaling pathway. This interaction provides clear genetic evidence that PTEN acts to antagonize PI3'K function in vivo. Given the conservation of the PI3'K signaling pathway between C. elegans and mammals, the analysis of daf-18 PTEN mutant nematodes should shed light on the role of human PTEN in the etiology of metabolic disease, aging, and cancer.

  14. Generation of two modified mouse alleles of the Hic1 tumor suppressor gene

    Czech Academy of Sciences Publication Activity Database

    Pospíchalová, Vendula; Turečková, Jolana; Fafílek, Bohumil; Vojtěchová, Martina; Krausová, Michaela; Lukáš, Jan; Šloncová, Eva; Takacova, S.; Divoký, V.; Leprince, D.; Plachý, Jiří; Kořínek, Vladimír

    2011-01-01

    Roč. 49, č. 3 (2011), s. 142-151 ISSN 1526-954X R&D Projects: GA ČR(CZ) GA204/07/1567; GA ČR(CZ) GD204/09/H058 Institutional research plan: CEZ:AV0Z50520514 Keywords : Hypermethylated In Cancer 1 * Hic1 tumor suppressor * gene targeting Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 2.527, year: 2011

  15. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  16. MIM, a Potential Metastasis Suppressor Gene in Bladder Cancer

    Directory of Open Access Journals (Sweden)

    Young-Goo Lee

    2002-01-01

    Full Text Available Using a modified version of the mRNA differential display technique, five human bladder cancer cell lines from low grade to metastatic were analyzed to identify differences in gene expression. A 316-bp cDNA (C11300 was isolated that was not expressed in the metastatic cell line TccSuP. Sequence analysis revealed that this gene was identical to KIAA 0429, has a 5.3-kb transcript that mapped to 8824.1. The protein is predicted to be 356 amino acids in size and has an actin-binding WH2 domain. Northern blot revealed expression in multiple normal tissues, but none in a metastatic breast cancer cell line (SKBR3 or in metastatic prostatic cancer cell lines (LNCaP, PC3. We have named this gene Missing in Metastasis (MIM and our data suggest that it may be involved in cytoskeletal organization.

  17. Mutational hotspots in the TP53 gene and, possibly, other tumor suppressors evolve by positive selection

    Directory of Open Access Journals (Sweden)

    Koonin Eugene V

    2006-01-01

    Full Text Available Abstract Background The mutation spectra of the TP53 gene and other tumor suppressors contain multiple hotspots, i.e., sites of non-random, frequent mutation in tumors and/or the germline. The origin of the hotspots remains unclear, the general view being that they represent highly mutable nucleotide contexts which likely reflect effects of different endogenous and exogenous factors shaping the mutation process in specific tissues. The origin of hotspots is of major importance because it has been suggested that mutable contexts could be used to infer mechanisms of mutagenesis contributing to tumorigenesis. Results Here we apply three independent tests, accounting for non-uniform base compositions in synonymous and non-synonymous sites, to test whether the hotspots emerge via selection or due to mutational bias. All three tests consistently indicate that the hotspots in the TP53 gene evolve, primarily, via positive selection. The results were robust to the elimination of the highly mutable CpG dinucleotides. By contrast, only one, the least conservative test reveals the signature of positive selection in BRCA1, BRCA2, and p16. Elucidation of the origin of the hotspots in these genes requires more data on somatic mutations in tumors. Conclusion The results of this analysis seem to indicate that positive selection for gain-of-function in tumor suppressor genes is an important aspect of tumorigenesis, blurring the distinction between tumor suppressors and oncogenes. Reviewers This article was reviewed by Sandor Pongor, Christopher Lee and Mikhail Blagosklonny.

  18. The Ras effector RASSF2 is a novel tumor-suppressor gene in human colorectal cancer.

    Science.gov (United States)

    Akino, Kimishige; Toyota, Minoru; Suzuki, Hiromu; Mita, Hiroaki; Sasaki, Yasushi; Ohe-Toyota, Mutsumi; Issa, Jean-Pierre J; Hinoda, Yuji; Imai, Kohzoh; Tokino, Takashi

    2005-07-01

    Activation of Ras signaling is a hallmark of colorectal cancer (CRC), but the roles of negative regulators of Ras are not fully understood. Our aim was to address that question by surveying genetic and epigenetic alterations of Ras-Ras effector genes in CRC cells. The expression and methylation status of 6 RASSF family genes were examined using RT-PCR and bisulfite PCR in CRC cell lines and in primary CRCs and colorectal adenomas. Colony formation assays and flow cytometry were used to assess the tumor suppressor activities of RASSF1 and RASSF2. Immunofluorescence microscopy was used to determine the effect of altered RASSF2 expression on cell morphology. Mutations of K- ras , BRAF, and p53 were identified using single-strand conformation analysis and direct sequencing. Aberrant methylation and histone deacetylation of RASSF2 was associated with the gene's silencing in CRC. The activities of RASSF2, which were distinct from those of RASSF1, included induction of morphologic changes and apoptosis; moreover, its ability to prevent cell transformation suggests that RASSF2 acts as a tumor suppressor in CRC. Primary CRCs that showed K- ras /BRAF mutations also frequently showed RASSF2 methylation, and inactivation of RASSF2 enhanced K- ras -induced oncogenic transformation. RASSF2 methylation was also frequently identified in colorectal adenomas. RASSF2 is a novel tumor suppressor gene that regulates Ras signaling and plays a pivotal role in the early stages of colorectal tumorigenesis.

  19. Hypermethylation Of The Tumor Suppressor RASSF1A Gene In ...

    African Journals Online (AJOL)

    Breast cancer is the leading cancer among females. There is a critical need for improved molecular biomarkers that are diagnostic, prognostic and also capable of predicting the progression of benign high-risk lesions to invasive carcinoma. RAS association domain family protein 1A (RASSF1A) gene, is a biologically ...

  20. Role of natural antisense transcripts pertaining to tumor suppressor genes in human carcinomas

    International Nuclear Information System (INIS)

    Pelicci, G.; Pierotti, M.

    2009-01-01

    Overlapping transcripts in opposite orientations can potentially form perfect sense-antisense duplex RNA. Recently, several studies have revealed the extent of natural antisense transcripts (NATs) and their role in important biological phenomena also in higher organisms. In order to test the hypothesis that the function of NATs in man might represent an essential element in the regulation of gene expression, especially at transcriptional level, in this study we planned to look for, systematically examine, and characterize NATs belonging in the human genome to the tumour suppressor class of genes, so to identify physiological (and potentially pathological) modulators in this gene class

  1. Molecular studies on the function of tumor suppressor gene in gastrointestinal cancer

    International Nuclear Information System (INIS)

    Kim, You Cheoul

    1993-01-01

    Cancer of stomach, colon and liver are a group of the most common cancer in Korea. However, results with current therapeutic modalities are still unsatisfactory. The intensive efforts have been made to understand basic pathogenesis and to find better therapeutic tools for the treatment of this miserable disease. We studies the alteration of tumor suppressor gene in various Gastrointestinal cancer in Korea. Results showed that genetic alteration of Rb gene was in 83% of colorectal cancer. Our results suggest that genetic alteration of Rb gene is crucially involved in the tumorigenesis of colorectum in Korea. (Author)

  2. Generation of two modified mouse alleles of the Hic1 tumor suppressor gene

    Czech Academy of Sciences Publication Activity Database

    Pospíchalová, Vendula; Turečková, Jolana; Fafílek, Bohumil; Vojtěchová, Martina; Krausová, Michaela; Lukáš, Jan; Šloncová, Eva; Takacova, S.; Divoký, V.; Leprince, D.; Plachý, Jiří; Kořínek, Vladimír

    2011-01-01

    Roč. 49, č. 3 (2011), s. 142-151 ISSN 1526-954X R&D Projects: GA ČR(CZ) GA204/07/1567; GA ČR(CZ) GD204/09/H058 Institutional research plan: CEZ:AV0Z50520514 Keywords : Hypermethylated In Cancer 1 * Hic1 tumor suppressor * gene targeting Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.527, year: 2011

  3. The p53 tumour suppressor gene and the tobacco industry: research, debate, and conflict of interest

    OpenAIRE

    Bitton, A; Neuman, M D; Barnoya, J; Glantz, Stanton A. Ph.D.

    2005-01-01

    Mutations in the p53 tumour suppressor gene lead to uncontrolled cell division and are found in over 50% of all human tumours, including 60% of lung cancers. Research published in 1996 by Denissenko and colleagues demonstrated patterned in-vitro mutagenic effects on p53 of benzo[a]pyrene, a carcinogen present in tobacco smoke. We investigated the tobacco industry's response to p53 research linking smoking to cancer. We searched online tobacco document archives, including the Legacy Tobacco Do...

  4. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy

    2017-06-01

    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  5. MMP-8, A Breast Cancer Bone Metastasis Suppressor Gene

    Science.gov (United States)

    2006-08-01

    and RD mutations were generated using the Chameleon double- stranded site-directed mutagenesis kit (Strata- gene). The fragments were released by...receptor TβR-I, the type II receptor TβR- II, the regulatory Smads (Smad2 and Smad3), and Smad4 (8). Most of these components have mutations in several...human cancers. But, mutations in TGF-β receptors or Smads are rare in breast cancer (9, 10). Moreover, for breast cancer cells, TGF-β1 is a crucial

  6. SERPINB5 and AKAP12 -- Expression and promoter methylation of metastasis suppressor genes in pancreatic ductal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Haier Joerg

    2010-10-01

    Full Text Available Abstract Background Early metastasis and infiltration are survival limiting characteristics of pancreatic ductal adenocarcinoma (PDAC. Thus, PDAC is likely to harbor alterations in metastasis suppressor genes that may provide novel diagnostic and therapeutic opportunities. This study investigates a panel of metastasis suppressor genes in correlation to PDAC phenotype and examines promoter methylation for regulatory influence on metastasis suppressor gene expression and for its potential as a diagnostic tool. Methods Metastatic and invasive potential of 16 PDAC cell lines were quantified in an orthotopic mouse model and mRNA expression of 11 metastasis suppressor genes determined by quantitative RT-PCR. Analysis for promoter methylation was performed using methylation specific PCR and bisulfite sequencing PCR. Protein expression was determined by Western blot. Results In general, higher metastasis suppressor gene mRNA expression was not consistent with less aggressive phenotypes of PDAC. Instead, mRNA overexpression of several metastasis suppressor genes was found in PDAC cell lines vs. normal pancreatic RNA. Of the investigated metastasis suppressor genes, only higher AKAP12 mRNA expression was correlated with decreased metastasis (P SERPINB5 mRNA expression was correlated with increased metastasis scores (P SERPINB5 methylation was associated with loss of mRNA and protein expression (P SERPINB5 methylation was also directly correlated to decreased metastasis scores (P Conclusions AKAP12 mRNA expression was correlated to attenuated invasive and metastatic potential and may be associated with less aggressive phenotypes of PDAC while no such evidence was obtained for the remaining metastasis suppressor genes. Increased SERPINB5 mRNA expression was correlated to increased metastasis and mRNA expression was regulated by methylation. Thus, SERPINB5 methylation was directly correlated to metastasis scores and may provide a diagnostic tool for PDAC.

  7. Unexpected functional similarities between gatekeeper tumour suppressor genes and proto-oncogenes revealed by systems biology.

    Science.gov (United States)

    Zhao, Yongzhong; Epstein, Richard J

    2011-05-01

    Familial tumor suppressor genes comprise two subgroups: caretaker genes (CTs) that repair DNA, and gatekeeper genes (GKs) that trigger cell death. Since GKs may also induce cell cycle delay and thus enhance cell survival by facilitating DNA repair, we hypothesized that the prosurvival phenotype of GKs could be selected during cancer progression, and we used a multivariable systems biology approach to test this. We performed multidimensional data analysis, non-negative matrix factorization and logistic regression to compare the features of GKs with those of their putative antagonists, the proto-oncogenes (POs), as well as with control groups of CTs and functionally unrelated congenital heart disease genes (HDs). GKs and POs closely resemble each other, but not CTs or HDs, in terms of gene structure (Pexpression level and breadth (Pimplied suggest a common functional attribute that is strongly negatively selected-that is, a shared phenotype that enhances cell survival. The counterintuitive finding of similar evolutionary pressures affecting GKs and POs raises an intriguing possibility: namely, that cancer microevolution is accelerated by an epistatic cascade in which upstream suppressor gene defects subvert the normal bifunctionality of wild-type GKs by constitutively shifting the phenotype away from apoptosis towards survival. If correct, this interpretation would explain the hitherto unexplained phenomenon of frequent wild-type GK (for example, p53) overexpression in tumors.

  8. Warburg tumours and the mechanisms of mitochondrial tumour suppressor genes. Barking up the right tree?

    Science.gov (United States)

    Bayley, Jean-Pierre; Devilee, Peter

    2010-06-01

    The past decade has seen a revival of interest in the metabolic adaptations of tumours, named for their original discoverer, Otto Warburg. Warburg reported a high rate of glycolysis in tumours, and a concurrent defect in mitochondrial respiration. The rediscovery of Warburg's hypothesis coincided with the discovery of mitochondrial tumours suppressor genes that may conform to Warburg's hypothesis. Succinate dehydrogenase and fumarate hydratase are mitochondrial proteins of the TCA cycle and the respiratory chain and when mutated lead to tumours of the nervous system known as paragangliomas and pheochromocytomas, and in the case of fumarate hydratase, cutaneous and uterine leiomyomas and renal cell cancer. Recently a novel mitochondrial protein, SDHAF2 (SDH5), was also shown to be a paraganglioma-related tumour suppressor gene. Another mitochondrial and TCA cycle-related protein, isocitrate dehydrogenase 2 is, together with IDH1, frequently mutated in the brain tumour glioblastoma. There are currently many competing hypotheses on the role of these genes in tumourigenesis, but frequent themes are the stabilization of hypoxia inducible factor 1 and upregulation of genes involved in angiogenesis, glucose transport and glycolysis. Other postulated mechanisms include the inhibition of developmental apoptosis, altered gene expression due to histone deregulation and the acquisition of novel catalytic properties. Here we discuss these diverse hypotheses and highlight very recent findings on the possible effects of IDH gene mutations.

  9. SFRP Tumour Suppressor Genes Are Potential Plasma-Based Epigenetic Biomarkers for Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Yuen Yee Cheng

    2017-01-01

    Full Text Available Malignant pleural mesothelioma (MPM is associated with asbestos exposure. Asbestos can induce chronic inflammation which in turn can lead to silencing of tumour suppressor genes. Wnt signaling pathway can be affected by chronic inflammation and is aberrantly activated in many cancers including colon and MPM. SFRP genes are antagonists of Wnt pathway, and SFRPs are potential tumour suppressors in colon, gastric, breast, ovarian, and lung cancers and mesothelioma. This study investigated the expression and DNA methylation of SFRP genes in MPM cells lines with and without demethylation treatment. Sixty-six patient FFPE samples were analysed and have showed methylation of SFRP2 (56% and SFRP5 (70% in MPM. SFRP2 and SFRP5 tumour-suppressive activity in eleven MPM lines was confirmed, and long-term asbestos exposure led to reduced expression of the SFRP1 and SFRP2 genes in the mesothelium (MeT-5A via epigenetic alterations. Finally, DNA methylation of SFRPs is detectable in MPM patient plasma samples, with methylated SFRP2 and SFRP5 showing a tendency towards greater abundance in patients. These data suggested that SFRP genes have tumour-suppresive activity in MPM and that methylated DNA from SFRP gene promoters has the potential to serve as a biomarker for MPM patient plasma.

  10. Expression of the p16{sup INK4a} tumor suppressor gene in rodent lung tumors

    Energy Technology Data Exchange (ETDEWEB)

    Swafford, D.S.; Tesfaigzi, J.; Belinsky, S.A.

    1995-12-01

    Aberrations on the short arm of chromosome 9 are among the earliest genetic changes in human cancer. p16{sup INK4a} is a candidate tumor suppressor gene that lies within human 9p21, a chromosome region associated with frequent loss of heterozygosity in human lung tumors. The p16{sup INK4a} protein functions as an inhibitor of cyclin D{sub 1}-dependent kinases that phosphorylate the retinoblastoma (Rb) tumor suppressor gene product enabling cell-cycle progression. Thus, overexpression of cyclin D{sub 1}, mutation of cyclin-dependent kinase genes, or loss of p16{sup INK4a} function, can all result in functional inactivation of Rb. Inactivation of Rb by mutation or deletion can result in an increase in p16{sup INK4a} transcription, suggesting that an increased p16{sup INK4a} expression in a tumor cell signals dysfunction of the pathway. The p16{sup (INK4a)} gene, unlike some tumor suppressor genes, is rarely inactivated by mutation. Instead, the expression of this gene is suppressed in some human cancers by hypermethylation of the CpG island within the first exon or by homozygous deletion: 686. Chromosome losses have been observed at 9p21 syntenic loci in tumors of the mouse and rat, two species often used as animal models for pulmonary carcinogenesis. Expression of p16{sup INK4a} is lost in some mouse tumor cell lines, often due to homozygous deletion. These observations indicate that p16{sup INK4a} dysfunction may play a role in the development of neoplasia in rodents as well as humans. The purpose of the current investigation was to define the extent to which p16{sup INK4a} dysfunction contributes to the development of rodent lung tumors and to determine the mechanism of inactivation of the gene. There is no evidence to suggest a loss of function of the p16{sup INK4a} tumor suppressor gene in these primary murine lung tumors by mutation, deletion, or methylation.

  11. Utility of P19 Gene-Silencing Suppressor for High Level Expression of Recombinant Human Therapeutic Proteins in Plant Cells

    Directory of Open Access Journals (Sweden)

    Maryam Zangi

    2016-07-01

    Full Text Available Background: The potential of plants, as a safe and eukaryotic system, is considered in the production of recombinant therapeutic human protein today; but the expression level of heterologous proteins is limited by the post-transcriptional gene silencing (PTGS response in this new technology. The use of viral suppressors of gene silencing can prevent PTGS and improve transient expression level of foreign proteins. In this study, we investigated the effect of p19 silencing suppressor on recombinant human nerve growth factor expression in Nicotiana benthamiana. Materials and Methods: The p19 coding region was inserted in the pCAMBIA using NcoI and BstEII recognition sites. Also, the cloned synthesized recombinant human NGF (rhNGF fragment was cloned directly into PVX vector by ClaI and SalI restriction enzymes. The co-agroinfiltration of rhNGF with p19 viral suppressor of gene silencing was evaluated by dot-blot and SDS-PAGE. The amount of expressed rhNGF protein was calculated by AlphaEaseFC software. Results: Co-agroinfiltration of hNGF with P19 suppressor showed about forty-fold increase (8% total soluble protein (TSP when compared to the absence of P19 suppressor (0.2%TSP. Conclusion: The results presented here confirmed that the use of P19 gene silencing suppressor derived from tomato bushy stunt virus (TBSV could efficiently increase the transient expression of recombinant proteins in Nicotiana benthamiana manifold.

  12. Remodeling epigenetic modifications at tumor suppressor gene promoters with bovine oocyte extract.

    Science.gov (United States)

    Wang, Zhenfei; Yue, Yongli; Han, Pengyong; Sa, Rula; Ren, Xiaolv; Wang, Jie; Bai, Haidong; Yu, Haiquan

    2013-09-01

    Epigenetic silencing of tumor suppressor genes by aberrant DNA methylation and histone modifications at their promoter regions plays an important role in the initiation and progression of cancer. The therapeutic effect of the widely used epigenetic drugs, including DNA methyltransferase inhibitors and histone deacetylase inhibitors, remains unsatisfactory. One important underlying factor in the ineffectiveness of these drugs is that their actions lack specificity. To investigate whether oocyte extract can be used for epigenetic re-programming of cancer cells, H460 human lung cancer cells were reversibly permeabilized and incubated with bovine oocyte extract. Bisulfite sequencing showed that bovine oocyte extract induced significant demethylation at hypermethylated promoter CpG islands of the tumor suppressor genes RUNX3 and CDH1; however, the DNA methylation levels of repetitive sequences were not affected. Chromatin immunoprecipitation showed that bovine oocyte extract significantly reduced transcriptionally repressive histone modifications and increased transcriptionally activating histone modifications at the promoter regions of RUNX3 and CDH1. Bovine oocyte extract reactivated the expression of RUNX3 and CDH1 at both the messenger RNA and the protein levels without up-regulating the transcription of pluripotency-associated genes. At the functional level, anchorage-independent proliferation, migration and invasion of H460 cells was strongly inhibited. These results demonstrate that bovine oocyte extract reactivates epigenetically silenced tumor suppressor genes by remodeling the epigenetic modifications at their promoter regions. Bovine oocyte extract may provide a useful tool for investigating epigenetic mechanisms in cancer and a valuable source for developing novel safe therapeutic approaches that target epigenetic alterations. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  13. Evolution of the HIV-1 nef gene in HLA-B*57 Positive Elite Suppressors

    Directory of Open Access Journals (Sweden)

    Siliciano Robert F

    2010-11-01

    Full Text Available Abstract Elite controllers or suppressors (ES are HIV-1 infected patients who maintain viral loads of gag and nef in HLA-B*57 positive ES. We previously showed evolution in the gag gene of ES which surprisingly was mostly due to synonymous mutations rather than non-synonymous mutation in targeted CTL epitopes. This finding could be the result of structural constraints on Gag, and we therefore examined the less conserved nef gene. We found slow evolution of nef in plasma virus in some ES. This evolution is mostly due to synonymous mutations and occurs at a rate similar to that seen in the gag gene in the same patients. The results provide further evidence of ongoing viral replication in ES and suggest that the nef and gag genes in these patients respond similarly to selective pressure from the host.

  14. Prediction of DNA methylation in the promoter of gene suppressor tumor.

    Science.gov (United States)

    Saif, Imane; Kasmi, Yassine; Allali, Karam; Ennaji, Moulay Mustapha

    2018-04-20

    The epigenetics methylation of cytosine is the most common epigenetic form in DNA sequences. It is highly concentrated in the promoter regions of the genes, leading to an inactivation of tumor suppressors regardless of their initial function. In this work, we aim to identify the highly methylated regions; the cytosine-phosphate-guanine (CpG) island located on the promoters and/or the first exon gene known for their key roles in the cell cycle, hence the need to study gene-gene interactions. The Frommer and hidden Markov model algorithms are used as computational methods to identify CpG islands with specificity and sensitivity up to 76% and 80%, respectively. The results obtained show, on the one hand, that the genes studied are suspected of developing hypermethylation in the promoter region of the gene involved in the case of a cancer. We then showed that the relative richness in CG results from a high level of methylation. On the other hand, we observe that the gene-gene interaction exhibits co-expression between the chosen genes. This let us to conclude that the hidden Markov model algorithm predicts more specific and valuable information about the hypermethylation in gene as a preventive and diagnostics tools for the personalized medicine; as that the tumor-suppresser-genes have relative co-expression and complementary relations which the hypermethylation affect in the samples studied in our work. Copyright © 2018. Published by Elsevier B.V.

  15. [Construction of Escherichia coli-Bifidobacterium longum shuttle vector and expression of tumor suppressor gene PTEN in B. longum].

    Science.gov (United States)

    Hou, Xin; Liu, Jun-E

    2006-06-01

    It was reported that Bifidobacterium longum accumulated specifically in hypoxic solid tumors, therefore could be used as a delivery system for cancer-specific gene therapy. Furthermore, construction of E.coli-B. longum shuttle vectors was proved by other research to be an efficient way for stable gene expression in B. longum. To obtain a shuttle vector and analyze the inhibition on mice solid tumors by genetically engineered B. longum, 48 primers with mutual overlaps were designed, assisted by software package Oligo 6.0. By PCR with the above primers, a linear plasmid was synthesized, which consists of pMB1 and HU gene promoter, both from B. longum. pMB-HU was constructed by cloning the synthesized linear plasmid into E.coli vector pMD 18-T, and was proved to be stably replicated in both E.coli DH5alpha and B. longum L17. By inserting PTEN cDNA into pMB-HU, expression vector pMB-HU-PTEN was obtained, in which PTEN gene was reported as a major tumor suppressor gene encoding a dual-specificity phosphatase. pMB-HU-PTEN was then transferred into B. longum L17 by electroporation. After transformation, an effective expression of PTEN in B. longum L17 was confirmed by Western blot, and significant inhibition on growth of mice solid tumors was also observed with the above genetically engineered B. longum. Those obtained results have laid foundation for tumor-targeting gene therapy with B. longum.

  16. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  17. Heterozygous mutations in the tumor suppressor gene PATCHED provoke basal cell carcinoma-like features in human organotypic skin cultures.

    Science.gov (United States)

    Brellier, F; Bergoglio, V; Valin, A; Barnay, S; Chevallier-Lagente, O; Vielh, P; Spatz, A; Gorry, P; Avril, M-F; Magnaldo, T

    2008-11-20

    Basal cell carcinoma of the skin is the most common type of cancer in humans. The majority of these tumors displays aberrant activation of the SONIC HEDGEHOG (SHH)/PATCHED pathway, triggered by mutations in the PATCHED tumor suppressor gene, which encodes a transmembrane receptor of SHH. In this study, we took advantage of the natural genotype (PATCHED(+/-)) of healthy keratinocytes expanded from patients with the nevoid basal cell carcinoma or Gorlin syndrome to mimic heterozygous somatic mutations thought to occur in the PATCHED gene early upon basal cell carcinoma development in the general population. PATCHED(+/-) epidermis developed on a dermal equivalent containing wild-type (WT) PATCHED(+/+) fibroblasts exhibited striking invasiveness and hyperproliferation, as well as marked differentiation impairment. Deciphering the phenotype of PATCHED(+/-) keratinocytes revealed slight increases of the transcriptional activators GLI1 and GLI2-the latter known to provoke basal cell carcinoma-like tumors when overexpressed in transgenic mice. PATCHED(+/-) keratinocytes also showed a substantial increase of the cell cycle regulator cyclin D1. These data show for the first time the physiological impact of constitutive heterozygous PATCHED mutations in primary human keratinocytes and strongly argue for a yet elusive mechanism of haploinsufficiency leading to cancer proneness.

  18. Heterozygous Germline Mutations in the CBL Tumor-Suppressor Gene Cause a Noonan Syndrome-like Phenotype

    Science.gov (United States)

    Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco

    2010-01-01

    RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386

  19. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  20. Isolation and characterization of the rat gene encoding glutamate dehydrogenase

    NARCIS (Netherlands)

    Das, A. T.; Arnberg, A. C.; Malingré, H.; Moerer, P.; Charles, R.; Moorman, A. F.; Lamers, W. H.

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  1. Tumor suppressor gene E-cadherin and its role in normal and malignant cells

    Directory of Open Access Journals (Sweden)

    Pećina-Šlaus Nives

    2003-10-01

    Full Text Available Abstract E-cadherin tumor suppressor genes are particularly active area of research in development and tumorigenesis. The calcium-dependent interactions among E-cadherin molecules are critical for the formation and maintenance of adherent junctions in areas of epithelial cell-cell contact. Loss of E-cadherin-mediated-adhesion characterises the transition from benign lesions to invasive, metastatic cancer. Nevertheless, there is evidence that E-cadherins may also play a role in the wnt signal transduction pathway, together with other key molecules involved in it, such as beta-catenins and adenomatous poliposis coli gene products. The structure and function of E-cadherin, gene and protein, in normal as well as in tumor cells are reviewed in this paper.

  2. Down-regulation of SFRP1 as a putative tumor suppressor gene can contribute to human hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Huang, Jian; Zhang, Yun-Li; Teng, Xiao-Mei; Lin, Yun; Zheng, Da-Li; Yang, Peng-Yuan; Han, Ze-Guang

    2007-01-01

    Hepatocellular carcinoma (HCC) is one of the most common cancers in the world. SFRP1 (the secreted frizzled-related protein 1), a putative tumor suppressor gene mapped onto chromosome 8p12-p11.1, the frequent loss of heterozygosity (LOH) region in human HCC, encodes a Wingless-type (Wnt) signaling antagonist and is frequently inactivated by promoter methylation in many human cancers. However, whether the down-regulation of SFRP1 can contribute to hepatocarcinogenesis still remains unclear. We investigated the expression of SFRP1 through real time RT-PCR and immunohistochemistry staining. The cell growth and colony formation were observed as the overexpression and knockdown of SFRP1. The DNA methylation status within SFRP1 promoter was analyzed through methylation-specific PCR or bisulphate-treated DNA sequencing assays. Loss of heterozygosity was here detected with microsatellite markers. SFRP1 was significantly down-regulated in 76.1% (35/46) HCC specimens at mRNA level and in 30% (30/100) HCCs indicated by immunohistochemistry staining, as compared to adjacent non-cancerous livers. The overexpression of SFRP1 can significantly inhibit the cell growth and colony formation of YY-8103, SMMC7721, and Hep3B cells. The RNA interference against the constitutional SFRP1 in the offspring SMMC7721 cells, which were stably transfected by ectopic SFRP1, can markedly promote cell growth of these cells. LOH of both microsatellite markers D8S532 and D8SAC016868 flanking the gene locus was found in 13% (6 of 46 HCCs) and 6.5% (3 of 46 HCCs) of the informative cases, respectively, where 5 of 8 HCC specimens with LOH showed the down-regulation of SFRP1. DNA hypermethylation within SFRP1 promoter was identified in two of three HCC specimens without SFRP1 expression. Moreover, the DNA methylation of SFRP1 promoter was significantly reduced, along with the re-expression of the gene, in those HCC cell lines, Bel7404, QGY7701, and MHCC-H, as treated by DAC. Our data suggested that the

  3. Molecular characterization of two suppressor of cytokine signaling 1 genes (SOCS1a and SOCS1b in chickens

    Directory of Open Access Journals (Sweden)

    Xue XU,Jiannan ZHANG,Juan LI,Yajun WANG

    2015-03-01

    Full Text Available Suppressor of cytokine signaling 1 (SOCS1 protein can inhibit the signal transduction triggered by some cytokines or hormones and thus are important in many physiological/pathological processes, including innate and adaptive immunity, inflammation, and development in mammals. However, there is sparse information about their structure, tissue expression, in birds, where their biological functions remain unknown. In this study, we cloned and characterized two SOCS1 genes (named cSOCS1a and cSOCS1b from chickens. SOCS1a is predicted to encode a 207-amino acid protein, which shares high amino acid sequence identity (64%–67% with human and mouse SOCS1. Besides SOCS1a, a novel SOCS1b gene was also identified in chickens and other non-mammalian vertebrates including Xenopus tropicalis. Chicken SOCS1b is predicted to encode a 212-amino acid protein, which shares only 30%–32% amino acid sequence identity with human SOCS1 and cSOCS1a. RT-PCR assay revealed that both cSOCS1a and cSOCS1b are widely expressed in all chicken tissues. Using a luciferase reporter assay system, we further demonstrated that transient expression of cSOCS1a and cSOCS1b can significantly inhibit chicken growth hormone (GH- or prolactin (PRL-induced luciferase activities of Hep G2 cells expressing cGH receptor (or cPRL receptor, indicating that SOCS1a and SOCS1b proteins can negatively regulate GH/PRL signaling. Taken together, these data suggest that both cSOCS1a and cSOCS1b may function as negative regulators of cytokine/hormone actions, such as modulation of GH/PRL actions in chickens.

  4. Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking

    NARCIS (Netherlands)

    Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.

    1993-01-01

    Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the

  5. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  6. Distinct and competitive regulatory patterns of tumor suppressor genes and oncogenes in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Min Zhao

    Full Text Available So far, investigators have found numerous tumor suppressor genes (TSGs and oncogenes (OCGs that control cell proliferation and apoptosis during cancer development. Furthermore, TSGs and OCGs may act as modulators of transcription factors (TFs to influence gene regulation. A comprehensive investigation of TSGs, OCGs, TFs, and their joint target genes at the network level may provide a deeper understanding of the post-translational modulation of TSGs and OCGs to TF gene regulation.In this study, we developed a novel computational framework for identifying target genes of TSGs and OCGs using TFs as bridges through the integration of protein-protein interactions and gene expression data. We applied this pipeline to ovarian cancer and constructed a three-layer regulatory network. In the network, the top layer was comprised of modulators (TSGs and OCGs, the middle layer included TFs, and the bottom layer contained target genes. Based on regulatory relationships in the network, we compiled TSG and OCG profiles and performed clustering analyses. Interestingly, we found TSGs and OCGs formed two distinct branches. The genes in the TSG branch were significantly enriched in DNA damage and repair, regulating macromolecule metabolism, cell cycle and apoptosis, while the genes in the OCG branch were significantly enriched in the ErbB signaling pathway. Remarkably, their specific targets showed a reversed functional enrichment in terms of apoptosis and the ErbB signaling pathway: the target genes regulated by OCGs only were enriched in anti-apoptosis and the target genes regulated by TSGs only were enriched in the ErbB signaling pathway.This study provides the first comprehensive investigation of the interplay of TSGs and OCGs in a regulatory network modulated by TFs. Our application in ovarian cancer revealed distinct regulatory patterns of TSGs and OCGs, suggesting a competitive regulatory mechanism acting upon apoptosis and the ErbB signaling pathway through

  7. Generation and characterization of mice carrying a conditional allele of the Wwox tumor suppressor gene.

    Directory of Open Access Journals (Sweden)

    John H Ludes-Meyers

    2009-11-01

    Full Text Available WWOX, the gene that spans the second most common human chromosomal fragile site, FRA16D, is inactivated in multiple human cancers and behaves as a suppressor of tumor growth. Since we are interested in understanding WWOX function in both normal and cancer tissues we generated mice harboring a conditional Wwox allele by flanking Exon 1 of the Wwox gene with LoxP sites. Wwox knockout (KO mice were developed by breeding with transgenic mice carrying the Cre-recombinase gene under the control of the adenovirus EIIA promoter. We found that Wwox KO mice suffered from severe metabolic defect(s resulting in growth retardation and all mice died by 3 wk of age. All Wwox KO mice displayed significant hypocapnia suggesting a state of metabolic acidosis. This finding and the known high expression of Wwox in kidney tubules suggest a role for Wwox in acid/base balance. Importantly, Wwox KO mice displayed histopathological and hematological signs of impaired hematopoiesis, leukopenia, and splenic atrophy. Impaired hematopoiesis can also be a contributing factor to metabolic acidosis and death. Hypoglycemia and hypocalcemia was also observed affecting the KO mice. In addition, bone metabolic defects were evident in Wwox KO mice. Bones were smaller and thinner having reduced bone volume as a consequence of a defect in mineralization. No evidence of spontaneous neoplasia was observed in Wwox KO mice. We have generated a new mouse model to inactivate the Wwox tumor suppressor gene conditionally. This will greatly facilitate the functional analysis of Wwox in adult mice and will allow investigating neoplastic transformation in specific target tissues.

  8. Tumor suppressor QM-like gene from disk abalone (Haliotis discus discus): molecular characterization and transcriptional analysis upon immune challenge.

    Science.gov (United States)

    Oh, Chulhong; De Zoysa, Mahanama; Nikapitiya, Chamilani; Whang, Ilson; Kim, Yu Cheol; Kang, Do-Hyung; Heo, Soo-jin; Choi, Young-Ung; Choi, Cheol Young; Lee, Jae-Seong; Lee, Jehee

    2010-09-01

    We describe molecular characterization and transcriptional analysis of the gene encoding tumor suppressor QM-like protein, AbQM, in the disk abalone Haliotis discus discus. The full-length cDNA (765-bp) of AbQM was found to consist of a 654-bp ORF coding for a 218 amino acid protein of a 25 kDa molecular mass with a 10.2 isoelectric point. Analysis of AbQM sequence revealed the presence of characteristic motifs, including the ribosomal protein L10 signature, SH3-binding motif and two antibiotic binding sites. Phylogenetic analysis confirmed that AbQM is closely related to other mollusk QM proteins, and altogether they form a mollusk QM protein sub-family which displays evolutionary conservation from yeast to human. Tissue-specific expression and transcriptional regulation of AbQM was analyzed by quantitative real-time PCR in response to bacterial (Vibrio alginolyticus and Vibrio parahemolyticus, Listeria monocytogenes) and viral (viral hemorrhagic septicemia virus, VHSV) challenge. AbQM transcripts were found to be expressed ubiquitously in all examined tissues in a constitutive manner, as similar expression levels were detected in hemocytes, mantle, digestive tract and muscle. Upon bacterial and VHSV challenge, AbQM showed significant up-regulation in gills, but not in hemocytes. Taken together, these findings suggest that AbQM in abalone-like mollusks can respond to and facilitate a defensive effect against pathogenic infection. Copyright 2010 Elsevier Ltd. All rights reserved.

  9. Functional interactions between the erupted/tsg101 growth suppressor gene and the DaPKC and rbf1 genes in Drosophila imaginal disc tumors.

    Directory of Open Access Journals (Sweden)

    M Melissa Gilbert

    Full Text Available BACKGROUND: The Drosophila gene erupted (ept encodes the fly homolog of human Tumor Susceptibility Gene-101 (TSG101, which functions as part of the conserved ESCRT-1 complex to facilitate the movement of cargoes through the endolysosomal pathway. Loss of ept or other genes that encode components of the endocytic machinery (e.g. synatxin7/avalanche, rab5, and vps25 produces disorganized overgrowth of imaginal disc tissue. Excess cell division is postulated to be a primary cause of these 'neoplastic' phenotypes, but the autonomous effect of these mutations on cell cycle control has not been examined. PRINCIPAL FINDINGS: Here we show that disc cells lacking ept function display an altered cell cycle profile indicative of deregulated progression through the G1-to-S phase transition and express reduced levels of the tumor suppressor ortholog and G1/S inhibitor Rbf1. Genetic reductions of the Drosophila aPKC kinase (DaPKC, which has been shown to promote tumor growth in other fly tumor models, prevent both the ept neoplastic phenotype and the reduction in Rbf1 levels that otherwise occurs in clones of ept mutant cells; this effect is coincident with changes in localization of Notch and Crumbs, two proteins whose sorting is altered in ept mutant cells. The effect on Rbf1 can also be blocked by removal of the gamma-secretase component presenilin, suggesting that cleavage of a gamma-secretase target influences Rbf1 levels in ept mutant cells. Expression of exogenous rbf1 completely ablates ept mutant eye tissues but only mildly affects the development of discs composed of cells with wild type ept. CONCLUSIONS: Together, these data show that loss of ept alters nuclear cell cycle control in developing imaginal discs and identify the DaPKC, presenilin, and rbf1 genes as modifiers of molecular and cellular phenotypes that result from loss of ept.

  10. Tumor-suppressor genes that escape from X-inactivation contribute to cancer sex bias.

    Science.gov (United States)

    Dunford, Andrew; Weinstock, David M; Savova, Virginia; Schumacher, Steven E; Cleary, John P; Yoda, Akinori; Sullivan, Timothy J; Hess, Julian M; Gimelbrant, Alexander A; Beroukhim, Rameen; Lawrence, Michael S; Getz, Gad; Lane, Andrew A

    2017-01-01

    There is a striking and unexplained male predominance across many cancer types. A subset of X-chromosome genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative 'escape from X-inactivation tumor-suppressor' (EXITS) genes, we examined somatic alterations from >4,100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) X-chromosome genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) harbored loss-of-function mutations more frequently in males (based on a false discovery rate < 0.1), in comparison to zero of 18,055 autosomal and PAR genes (Fisher's exact P < 0.0001). Male-biased mutations in genes that escape X-inactivation were observed in combined analysis across many cancers and in several individual tumor types, suggesting a generalized phenomenon. We conclude that biallelic expression of EXITS genes in females explains a portion of the reduced cancer incidence in females as compared to males across a variety of tumor types.

  11. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  12. The common mechanisms of transformation by the small DNA tumor viruses: The inactivation of tumor suppressor gene products: p53.

    Science.gov (United States)

    Levine, Arnold J

    2009-02-20

    The small DNA tumor viruses, Polyoma virus, Simian Vacuolating Virus 40, the Papilloma viruses and the human Adenoviruses, were first described during a period of intense virus discovery (1930-1960s) and shown to produce tumors in animals. In each of these cases the viral DNA was shown to persist (commonly integrated into a host chromosome) and only a selected portion of this DNA was expressed as m-RNA and proteins in these cancers. The viral encoded tumor antigens were identified and shown to be required to both establish the tumor and maintain the transformed cell phenotype. The functions of these viral tumor antigens were explored and shown to have common features and mechanisms even though they appear to have evolved from diverse genes. The SV40 large tumor antigen, the human Papilloma virus E7 protein and the Adenovirus E1A protein were shown to bind to and inactivate the functions of the Retinoblastoma proteins in transformed cells. This resulted in the activation of the E2F and DP transcription factors and the entry of cells into the S-phase of DNA synthesis which was required for viral DNA replication. These events triggered the activation of p53 which promotes apoptosis of these virus infected cells limiting virus replication and tumor formation. These viruses responded by evolving and producing the SV40 large tumor antigen, the human Papilloma virus E6 protein and the Adenovirus E1b-55Kd protein which binds to and inactivates the p53 functions in both the infected cells and transformed cells. Some of the human Papilloma viruses and one of the Polyoma viruses have been shown to cause selected cancers in humans. Both the p53 tumor suppressor gene, which was uncovered in the studies with these viruses, and the retinoblastoma protein, have been shown to play a central role in the origins of human cancers via both somatic and germ line mutations in those genes.

  13. The tumor suppressor gene hypermethylated in cancer 1 is transcriptionally regulated by E2F1

    DEFF Research Database (Denmark)

    Jenal, Mathias; Trinh, Emmanuelle; Britschgi, Christian

    2009-01-01

    The Hypermethylated in Cancer 1 (HIC1) gene encodes a zinc finger transcriptional repressor that cooperates with p53 to suppress cancer development. We and others recently showed that HIC1 is a transcriptional target of p53. To identify additional transcriptional regulators of HIC1, we screened...

  14. Gene cluster encoding cholate catabolism in Rhodococcus spp.

    Science.gov (United States)

    Mohn, William W; Wilbrink, Maarten H; Casabon, Israël; Stewart, Gordon R; Liu, Jie; van der Geize, Robert; Eltis, Lindsay D

    2012-12-01

    Bile acids are highly abundant steroids with important functions in vertebrate digestion. Their catabolism by bacteria is an important component of the carbon cycle, contributes to gut ecology, and has potential commercial applications. We found that Rhodococcus jostii RHA1 grows well on cholate, as well as on its conjugates, taurocholate and glycocholate. The transcriptome of RHA1 growing on cholate revealed 39 genes upregulated on cholate, occurring in a single gene cluster. Reverse transcriptase quantitative PCR confirmed that selected genes in the cluster were upregulated 10-fold on cholate versus on cholesterol. One of these genes, kshA3, encoding a putative 3-ketosteroid-9α-hydroxylase, was deleted and found essential for growth on cholate. Two coenzyme A (CoA) synthetases encoded in the cluster, CasG and CasI, were heterologously expressed. CasG was shown to transform cholate to cholyl-CoA, thus initiating side chain degradation. CasI was shown to form CoA derivatives of steroids with isopropanoyl side chains, likely occurring as degradation intermediates. Orthologous gene clusters were identified in all available Rhodococcus genomes, as well as that of Thermomonospora curvata. Moreover, Rhodococcus equi 103S, Rhodococcus ruber Chol-4 and Rhodococcus erythropolis SQ1 each grew on cholate. In contrast, several mycolic acid bacteria lacking the gene cluster were unable to grow on cholate. Our results demonstrate that the above-mentioned gene cluster encodes cholate catabolism and is distinct from a more widely occurring gene cluster encoding cholesterol catabolism.

  15. Characterization of the tumor suppressor gene WWOX in primary human oral squamous cell carcinomas

    Science.gov (United States)

    Pimenta, Flávio J.; Gomes, Dawidson A.; Perdigão, Paolla F.; Barbosa, Alvimar A.; Romano-Silva, Marco A.; Gomez, Marcus V.; Aldaz, C. Marcelo; De Marco, Luiz; Gomez, Ricardo S.

    2014-01-01

    Oral squamous cell carcinoma (OSCC) is the most common malignant neoplasm of the oral cavity, representing ~90% of all oral carcinomas and accounting for 3–5% of all malignancies. The WWOX gene (WW-domain containing oxidoreductase) is a candidate tumor suppressor gene located at 16q23.3–24.1, spanning the second most common fragile site, FRA16D. In this report, the role of the WWOX gene was investigated in 20 tumors and 10 normal oral mucosas, and we demonstrated an altered WWOX gene in 50% (10/20) of OSCCs. Using nested RT-PCR, mRNA transcription was altered in 35% of the tumors, with the complete absence of transcripts in 2 samples as well as absence of exons 6–8 (2 tumors), exon 7 (1 tumor), exon 7 and exon 6–8 (1 tumor) and partial loss of exons 8 and 9 (1 tumor). To determine if the aberrant transcripts were translated, Western blots were performed in all samples; however, only the normal protein was detected. By immunohistochemistry, a reduction in Wwox protein expression was observed, affecting 40% of the tumors when compared with normal mucosa. In addition, a novel somatic mutation (S329F) was found. The presence of alterations in mRNA transcription correlated with the reduced expression of Wwox protein in the tumors. These results show that the WWOX gene is frequently altered in OSCC and may contribute to the carcinogenesis processes in oral cancer. PMID:16152610

  16. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    2016-10-26

    Oct 26, 2016 ... The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the.

  17. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  18. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    Cloning, expression and characterisation of a novel gene encoding a chemosensory protein from Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) ... The BtabCSP amino acid residues deduced from the respective full-length cDNA shares four conserved cysteine motifs with known CSPs from other insects. Homology ...

  19. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  20. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum. XIUHONG YANG, CHAO SUN, YUANLEI HU and ZHONGPING LIN. *. College of Life Sciences, National Key Laboratory of Protein Engineering and Plant Genetic Engineering, Peking.

  1. ING Genes Work as Tumor Suppressor Genes in the Carcinogenesis of Head and Neck Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Xiaohan Li

    2011-01-01

    Full Text Available Head and neck squamous cell carcinoma (HNSCC is the sixth most common cancer in the world. The evolution and progression of HNSCC are considered to result from multiple stepwise alterations of cellular and molecular pathways in squamous epithelium. Recently, inhibitor of growth gene (ING family consisting of five genes, ING1 to ING5, was identified as a new tumor suppressor gene family that was implicated in the downregulation of cell cycle and chromatin remodeling. In contrast, it has been shown that ING1 and ING2 play an oncogenic role in some cancers, this situation being similar to TGF-β. In HNSCC, the ING family has been reported to be downregulated, and ING translocation from the nucleus to the cytoplasm may be a critical event for carcinogenesis. In this paper, we describe our recent results and briefly summarize current knowledge regarding the biologic functions of ING in HNSCC.

  2. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway

    Science.gov (United States)

    Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus

    2007-01-01

    Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

  3. Tumor suppressor gene-based nanotherapy: from test tube to the clinic.

    Science.gov (United States)

    Shanker, Manish; Jin, Jiankang; Branch, Cynthia D; Miyamoto, Shinya; Grimm, Elizabeth A; Roth, Jack A; Ramesh, Rajagopal

    2011-01-01

    Cancer is a major health problem in the world. Advances made in cancer therapy have improved the survival of patients in certain types of cancer. However, the overall five-year survival has not significantly improved in the majority of cancer types. Major challenges encountered in having effective cancer therapy are development of drug resistance by the tumor cells, nonspecific cytotoxicity, and inability to affect metastatic tumors by the chemodrugs. Overcoming these challenges requires development and testing of novel therapies. One attractive cancer therapeutic approach is cancer gene therapy. Several laboratories including the authors' laboratory have been investigating nonviral formulations for delivering therapeutic genes as a mode for effective cancer therapy. In this paper the authors will summarize their experience in the development and testing of a cationic lipid-based nanocarrier formulation and the results from their preclinical studies leading to a Phase I clinical trial for nonsmall cell lung cancer. Their nanocarrier formulation containing therapeutic genes such as tumor suppressor genes when administered intravenously effectively controls metastatic tumor growth. Additional Phase I clinical trials based on the results of their nanocarrier formulation have been initiated or proposed for treatment of cancer of the breast, ovary, pancreas, and metastatic melanoma, and will be discussed.

  4. Tumor Suppressor Gene-Based Nanotherapy: From Test Tube to the Clinic

    Directory of Open Access Journals (Sweden)

    Manish Shanker

    2011-01-01

    Full Text Available Cancer is a major health problem in the world. Advances made in cancer therapy have improved the survival of patients in certain types of cancer. However, the overall five-year survival has not significantly improved in the majority of cancer types. Major challenges encountered in having effective cancer therapy are development of drug resistance by the tumor cells, nonspecific cytotoxicity, and inability to affect metastatic tumors by the chemodrugs. Overcoming these challenges requires development and testing of novel therapies. One attractive cancer therapeutic approach is cancer gene therapy. Several laboratories including the authors' laboratory have been investigating nonviral formulations for delivering therapeutic genes as a mode for effective cancer therapy. In this paper the authors will summarize their experience in the development and testing of a cationic lipid-based nanocarrier formulation and the results from their preclinical studies leading to a Phase I clinical trial for nonsmall cell lung cancer. Their nanocarrier formulation containing therapeutic genes such as tumor suppressor genes when administered intravenously effectively controls metastatic tumor growth. Additional Phase I clinical trials based on the results of their nanocarrier formulation have been initiated or proposed for treatment of cancer of the breast, ovary, pancreas, and metastatic melanoma, and will be discussed.

  5. DLC1 tumor suppressor gene inhibits migration and invasion of multiple myeloma cells through RhoA GTPase pathway

    Czech Academy of Sciences Publication Activity Database

    Ullmannová-Benson, Veronika; Guan, M.; Zhou, X. G.; Tripathi, V.; Yang, V.; Zimonjic, D. B.; Popescu, C.

    2009-01-01

    Roč. 23, č. 2 (2009), s. 383-390 ISSN 0887-6924 Institutional research plan: CEZ:AV0Z50200510 Keywords : multiple myeloma * tumor suppressor gene * promoter methylation Subject RIV: EC - Immunology Impact factor: 8.296, year: 2009

  6. Mutation analysis of suppressor of cytokine signalling 3, a candidate gene in Type 1 diabetes and insulin sensitivity

    DEFF Research Database (Denmark)

    Gylvin, T; Nolsøe, R; Hansen, T

    2004-01-01

    Beta cell loss in Type 1 and Type 2 diabetes mellitus may result from apoptosis and necrosis induced by inflammatory mediators. The suppressor of cytokine signalling (SOCS)-3 is a natural inhibitor of cytokine signalling and also influences insulin signalling. SOCS3 could therefore be a candidate...... gene in the development of Type 1 and Type 2 diabetes mellitus....

  7. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    Science.gov (United States)

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  8. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    this antigen is a good candidate for development as a vaccine to prevent or control P. carinii infection. We have cloned and sequenced seven related but unique genes encoding the major surface glycoprotein of rat P. carinii. Partial amino acid sequencing confirmed the identity of these genes. Based on Southern...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  9. Identification and use of genes encoding amatoxin and phallotoxin

    Energy Technology Data Exchange (ETDEWEB)

    Hallen, Heather E.; Walton, Jonathan D.; Luo, Hong; Scott-Craig, John S.

    2016-12-13

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptide toxins and toxin production in mushrooms. In particular, the present invention relates to using genes and proteins from Amanita species encoding Amanita peptides, specifically relating to amatoxins and phallotoxins. In a preferred embodiment, the present invention also relates to methods for detecting Amanita peptide toxin genes for identifying Amanita peptide-producing mushrooms and for diagnosing suspected cases of mushroom poisoning. Further, the present inventions relate to providing kits for diagnosing and monitoring suspected cases of mushroom poisoning in patients.

  10. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  11. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  12. Self-association of the WT1 tumor suppressor gene product

    Energy Technology Data Exchange (ETDEWEB)

    Bruening, W.; Nakagama, H.: Bardessy, N. [McGill Univ., Montreal (Canada)] [and others

    1994-09-01

    Wilms` tumor (WT), an embryonal malignancy of the kidney, occurs most frequently in children under the age of 5 years, affecting {approximately}1 in 10,000 individuals. The WT1 tumor suppressor gene, residing at 11p13, is structurally altered in {approximately}10-15% of WT cases. Individuals with germline mutations within the WT1 gene suffer from predisposition to WT and developmental defects of the urogenital system. Patients with heterozygous deletions of the WT1 gene, or mutations predicted to cause inactivation of one WT1 allele, suffer relatively mild genital system defects (notably hypospadias and cryptorchidism in males) and a predisposition to WT. These results suggest that developing genital system development is sensitive to the absolute concentrations of the WT1 gene products. Patients with missense mutations within the WT1 gene, however, can suffer from a much more severe disorder known as Denys-Drash syndrome (DDS). This syndrome is characterized by intersex disorders, renal nephropathy, and a predisposition to WTs. The increased severity of the developmental defects associated with DDS, compared to those individuals with mild genital system anomalies and WTs, suggests that mutations defined in patients with DDS behave in a dominant-negative fashion. We have identified a novel WT1 mutation in a patient with DDS. This mutation, predicted to produce a truncated WT1 polypeptide encompassing exons 1, 2, and 3, defines a domain capable of behaving as an antimorph. We have also demonstrated that WT1 can self-associate in vivo using yeast two-hybrid systems. Deletion analysis have mapped the interacting domains to the amino terminus of the WT1 polypeptide, within exons 1 and 2. These results provide a molecular mechanism to explain how WT1 mutations can function in a dominant-negative fashion to eliminate wild-type WT1 activity, leading to DDS.

  13. Tumor suppressor gene P53 in fish species as a target for genotoxic effects monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Kusser, W.C.; Brand, D.; Glickman, B.W. [Univ. of Victoria, British Columbia (Canada); Cretney, W.

    1995-12-31

    Analysis of environmentally induced molecular changes in DNA from fish was initiated with a study of tumor suppressor gene p53. This gene was chosen because of the high number of documented mutations in p53 from humans and their relevance in tumorigenesis. Bottom-feeding flatfish (e.g. English sole, Pleuronectes vetulus) and members of the salmonid family (e.g. rainbow trout, Oncorhynchus mykiss and chinook salmon, O. tschaaytsha) were chosen, because they are widespread and of commercial and recreational importance. The studies include the use of histopathological, biochemical, and molecular genetic tools in aquatic systems. The authors are currently examining the deposition of DNA damage and mutation in the p53 gene in fish. Parallel histopathology of liver showed idiopathic liver lesions that were strongly dependent on location of capture (0.01 < p(X{sup 2} 0.05, 2 > 6.89) < 0.025) with a prevalence of 30% for fish collected from the vicinity of pulp mills. To assess DNA damage and mutation analysis, DNA was extracted from fish liver. Polymerase chain reaction (PCR) and DNA sequencing of the p53 gene was performed for rainbow trout, chinook and sockeye salmon, O. nerka. Southern blotting with a labeled p53 probe from rainbow trout was performed using genomic DNA from various teleost fish species. The presence of p53 could be shown in all fish species examined, including salmonids and sentinel species for environmental monitoring like English sole and white sucker (Catostomus commersom). To correlate histopathology with molecular analysis the authors initiated the determination of DNA damage, DNA adducts and mutations in the p53 gene (conserved exons 5 to 9).

  14. A study on tumor suppressor genes mutations associated with different pathological colorectal lesions

    International Nuclear Information System (INIS)

    Matar, S.N.A.

    2011-01-01

    Colorectal cancer (CRC) is the second leading cause of cancer-related death in the Western world. In Egypt; there is an increasing incidence of the disease, especially among patients ≤40 years age. While CRC have been reported in low incidence rate in developing countries, it is the third most common tumor in male and the fifth common tumor in females in Egypt. Early diagnosis and surgical interference guarantee long survival of most CRC patients. Early diagnosis is impeded by the disease onset at young age and imprecise symptoms at the initial stages of the disease. As in most solid tumors, the malignant transformation of colonic epithelial cells is to arise through a multistep process during which they acquire genetic changes involving the activation of proto-oncogenes and the loss of tumor suppressor genes. Recently, a candidate tumor suppressor gene, KLF6, which is mapped to chromosome 10p, was found to be frequently mutated in a number of cancers. There are some evidences suggesting that the disruption of the functional activity of KLF6 gene products may be one of the early events in tumor genesis of the colon. The main objective of the present study was to detect mutational changes of KLF6 tumor suppressor gene and to study the loss of heterozygosity (LOH) markers at chromosome 10p15 (KLF6 locus) in colorectal lesions and colorectal cancer in Egyptian patients. The patients included in this study were 83 presented with different indications for colonoscopic examination. Selecting patients with colorectal pre-cancerous lesions or colorectal cancer was done according to the results of tissue biopsy from lesion and adjacent normal. The patients were classified into three main groups; (G I) Cancerous group, (G II) polyps group including patients with adenomatous polyps (AP), familial adenomatous polyps (FAP) and hyperplastic polyps (HP) and (G III) Inflammatory Bowel Diseases (IBD) including patients with ulcerative colitis (UC) and Crohn's disease (CD

  15. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development...... of novel approaches to the control of this pathogen....

  16. gld-1, a tumor suppressor gene required for oocyte development in Caenorhabditis elegans

    Energy Technology Data Exchange (ETDEWEB)

    Francis, R.; Schedl, T. [Washington Univ. School of Medicine, St. Louis, MO (United States); Barton, M.K.; Kimble, J. [Univ. of Wisconsin, Madison, WI (United States)

    1995-02-01

    We have characterized 31 mutations in the gld-1 (defective in germline development) gene of Caenorhabditis elegans. In gld-1 (null) hermaphrodites, oogenesis is abolished and a germline tumor forms where oocyte development would normally occur. By contrast, gld-1 (null) males are unaffected. The hermaphrodite germline tumor appears to derive from germ cells that enter the meiotic pathway normally but then exit pachytene and return to the mitotic cycle. Certain gld-1 partial loss-of-function mutations also abolish oogenesis, but germ cells arrest in pachytene rather than returning to mitosis. Our results indicate that gld-1 is a tumor suppressor gene required for oocyte development. The tumorous phenotype suggests that gld-1(+) may function to negatively regulate proliferation during meiotic prophase and/or act to direct progression through meiotic prophase. We also show that gld-1(+) has an additional nonessential role in germline sex determination: promotion of hermaphrodite spermatogenesis. This function of gld-1 is inferred from a haplo-insufficient phenotype and from the properties of gain-of-function gld-1 mutations that cause alterations in the sexual identity of germ cells. 69 refs., 10 figs., 8 tabs.

  17. PU.1 is a major transcriptional activator of the tumour suppressor gene LIMD1.

    Science.gov (United States)

    Foxler, Daniel E; James, Victoria; Shelton, Samuel J; Vallim, Thomas Q de A; Shaw, Peter E; Sharp, Tyson V

    2011-04-06

    LIMD1 is a tumour suppressor gene (TSG) down regulated in ∼80% of lung cancers with loss also demonstrated in breast and head and neck squamous cell carcinomas. LIMD1 is also a candidate TSG in childhood acute lymphoblastic leukaemia. Mechanistically, LIMD1 interacts with pRB, repressing E2F-driven transcription as well as being a critical component of microRNA-mediated gene silencing. In this study we show a CpG island within the LIMD1 promoter contains a conserved binding motif for the transcription factor PU.1. Mutation of the PU.1 consensus reduced promoter driven transcription by 90%. ChIP and EMSA analysis demonstrated that PU.1 specifically binds to the LIMD1 promoter. siRNA depletion of PU.1 significantly reduced endogenous LIMD1 expression, demonstrating that PU.1 is a major transcriptional activator of LIMD1. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  18. The PTEN tumor suppressor gene and its role in lymphoma pathogenesis

    Science.gov (United States)

    Wang, Xiaoxiao; Huang, Huiqiang; Young, Ken H.

    2015-01-01

    The phosphatase and tensin homolog gene PTEN is one of the most frequently mutated tumor suppressor genes in human cancer. Loss of PTEN function occurs in a variety of human cancers via its mutation, deletion, transcriptional silencing, or protein instability. PTEN deficiency in cancer has been associated with advanced disease, chemotherapy resistance, and poor survival. Impaired PTEN function, which antagonizes phosphoinositide 3-kinase (PI3K) signaling, causes the accumulation of phosphatidylinositol (3,4,5)-triphosphate and thereby the suppression of downstream components of the PI3K pathway, including the protein kinase B and mammalian target of rapamycin kinases. In addition to having lipid phosphorylation activity, PTEN has critical roles in the regulation of genomic instability, DNA repair, stem cell self-renewal, cellular senescence, and cell migration. Although PTEN deficiency in solid tumors has been studied extensively, rare studies have investigated PTEN alteration in lymphoid malignancies. However, genomic or epigenomic aberrations of PTEN and dysregulated signaling are likely critical in lymphoma pathogenesis and progression. This review provides updated summary on the role of PTEN deficiency in human cancers, specifically in lymphoid malignancies; the molecular mechanisms of PTEN regulation; and the distinct functions of nuclear PTEN. Therapeutic strategies for rescuing PTEN deficiency in human cancers are proposed. PMID:26655726

  19. Fish Suppressors of Cytokine Signaling (SOCS): Gene Discovery, Modulation of Expression and Function

    Science.gov (United States)

    Wang, Tiehui; Gorgoglione, Bartolomeo; Maehr, Tanja; Holland, Jason W.; Vecino, Jose L. González; Wadsworth, Simon; Secombes, Christopher J.

    2011-01-01

    The intracellular suppressors of cytokine signaling (SOCS) family members, including CISH and SOCS1 to 7 in mammals, are important regulators of cytokine signaling pathways. So far, the orthologues of all the eight mammalian SOCS members have been identified in fish, with several of them having multiple copies. Whilst fish CISH, SOCS3, and SOCS5 paralogues are possibly the result of the fish-specific whole genome duplication event, gene duplication or lineage-specific genome duplication may also contribute to some paralogues, as with the three trout SOCS2s and three zebrafish SOCS5s. Fish SOCS genes are broadly expressed and also show species-specific expression patterns. They can be upregulated by cytokines, such as IFN-γ, TNF-α, IL-1β, IL-6, and IL-21, by immune stimulants such as LPS, poly I:C, and PMA, as well as by viral, bacterial, and parasitic infections in member- and species-dependent manners. Initial functional studies demonstrate conserved mechanisms of fish SOCS action via JAK/STAT pathways. PMID:22203897

  20. Cystatin D is a candidate tumor suppressor gene induced by vitamin D in human colon cancer cells.

    Science.gov (United States)

    Alvarez-Díaz, Silvia; Valle, Noelia; García, José Miguel; Peña, Cristina; Freije, José M P; Quesada, Víctor; Astudillo, Aurora; Bonilla, Félix; López-Otín, Carlos; Muñoz, Alberto

    2009-08-01

    The active vitamin D metabolite 1alpha,25-dihydroxyvitamin D3 [1alpha,25(OH)2D3] has wide but not fully understood antitumor activity. A previous transcriptomic analysis of 1alpha,25(OH)2D3 action on human colon cancer cells revealed cystatin D (CST5), which encodes an inhibitor of several cysteine proteases of the cathepsin family, as a candidate target gene. Here we report that 1alpha,25(OH)2D3 induced vitamin D receptor (VDR) binding to, and activation of, the CST5 promoter and increased CST5 RNA and protein levels in human colon cancer cells. In cells lacking endogenous cystatin D, ectopic cystatin D expression inhibited both proliferation in vitro and xenograft tumor growth in vivo. Furthermore, cystatin D inhibited migration and anchorage-independent growth, antagonized the Wnt/beta-catenin signaling pathway, and repressed c-MYC expression. Cystatin D repressed expression of the epithelial-mesenchymal transition inducers SNAI1, SNAI2, ZEB1, and ZEB2 and, conversely, induced E-cadherin and other adhesion proteins. CST5 knockdown using shRNA abrogated the antiproliferative effect of 1alpha,25(OH)2D3, attenuated E-cadherin expression, and increased c-MYC expression. In human colorectal tumors, expression of cystatin D correlated with expression of VDR and E-cadherin, and loss of cystatin D correlated with poor tumor differentiation. Based on these data, we propose that CST5 has tumor suppressor activity that may contribute to the antitumoral action of 1alpha,25(OH)2D3 in colon cancer.

  1. Analysis of loss of heterozygosity of the tumor suppressor genes p53 and BRCA1 in ovarial carcinomas

    OpenAIRE

    Luković Ljiljana; Popović Branka; Atanacković Jasmina; Novaković Ivana; Perović Milica; Petrović Bojana; Petković Spasoje

    2006-01-01

    Background/aim: Among the genes involved in ovarian carcinogenesis, there has been increased interest in tumor-suppressor genes p53 and BRCA1. Both of the genes make control of cell cycle, DNA repair and apoptosis. The p53 is a "genome guardian" inactivated in more than 50% of human cancers, while BRCA1 mutations are found mostly in breast and ovarian cancer. The aim of this investigation was to establish the frequency of loss of heterozygosity (LOH) in the regions of the genes p53 and BRCA1 ...

  2. Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis.

    Science.gov (United States)

    Lee, M M; Schiefelbein, J

    2001-05-01

    The duplication and divergence of developmental control genes is thought to have driven morphological diversification during the evolution of multicellular organisms. To examine the molecular basis of this process, we analyzed the functional relationship between two paralogous MYB transcription factor genes, WEREWOLF (WER) and GLABROUS1 (GL1), in Arabidopsis. The WER and GL1 genes specify distinct cell types and exhibit non-overlapping expression patterns during Arabidopsis development. Nevertheless, reciprocal complementation experiments with a series of gene fusions showed that WER and GL1 encode functionally equivalent proteins, and their unique roles in plant development are entirely due to differences in their cis-regulatory sequences. Similar experiments with a distantly related MYB gene (MYB2) showed that its product cannot functionally substitute for WER or GL1. Furthermore, an analysis of the WER and GL1 proteins shows that conserved sequences correspond to specific functional domains. These results provide new insights into the evolution of the MYB gene family in Arabidopsis, and, more generally, they demonstrate that novel developmental gene function may arise solely by the modification of cis-regulatory sequences.

  3. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  4. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  5. ERα Mediates Estrogen-Induced Expression of the Breast Cancer Metastasis Suppressor Gene BRMS1

    Directory of Open Access Journals (Sweden)

    Hongtao Ma

    2016-01-01

    Full Text Available Recently, estrogen has been reported as putatively inhibiting cancer cell invasion and motility. This information is in direct contrast to the paradigm of estrogen as a tumor promoter. However, data suggests that the effects of estrogen are modulated by the receptor isoform with which it interacts. In order to gain a clearer understanding of the role of estrogen in potentially suppressing breast cancer metastasis, we investigated the regulation of estrogen and its receptor on the downstream target gene, breast cancer metastasis suppressor 1 (BRMS1 in MCF-7, SKBR3, TTU-1 and MDA-MB-231 breast cancer cells. Our results showed that estrogen increased the transcription and expression of BRMS1 in the ERα positive breast cancer cell line, MCF-7. Additionally, the ERα specific agonist PPT also induced the transcription and expression of BRMS1. However, the two remaining estrogen receptor (ER subtype agonists had no effect on BRMS1 expression. In order to further examine the influence of ERα on BRMS1 expression, ERα expression was knocked down using siRNA (siERα. Western blot analysis showed that siERα reduced estrogen-induced and PPT-induced BRMS1 expression. In summary, this study demonstrates estrogen, via its α receptor, positively regulates the expression of BRMS1, providing new insight into a potential inhibitory effect of estrogen on metastasis suppression.

  6. Are there tumor suppressor genes on chromosome 4p in sporadic colorectal carcinoma?

    Science.gov (United States)

    Zheng, Hai-Tao; Jiang, Li-Xin; Lv, Zhong-Chuan; Li, Da-Peng; Zhou, Chong-Zhi; Gao, Jian-Jun; He, Lin; Peng, Zhi-Hai

    2008-01-07

    To study the candidate tumor suppressor genes (TSG) on chromosome 4p by detecting the high frequency of loss of heterozygosity (LOH) in sporadic colorectal carcinoma in Chinese patients. Seven fluorescent labeled polymorphic microsatellite markers were analyzed in 83 cases of colorectal carcinoma and matched normal tissue DNA by PCR. PCR products were electrophoresed on an ABI 377 DNA sequencer. Genescan 3.7 and Genotype 3.7 software were used for LOH scanning and analysis. The same procedure was performed by the other six microsatellite markers spanning D4S3013 locus to make further detailed deletion mapping. Comparison between LOH frequency and clinicopathological factors was performed by c2 test. Data were collected from all informative loci. The average LOH frequency on 4p was 24.25%, and 42.3% and 35.62% on D4S405 and D4S3013 locus, respectively. Adjacent markers of D4S3013 displayed a low LOH frequency (4p15.2) and D4S405 (4p14) locus are detected. Candidate TSG, which is involved in carcinogenesis and progression of sporadic colorectal carcinoma on chromosome 4p, may be located between D4S3017 and D4S2933 (about 1.7 cm).

  7. Inactivation of tumor suppressor genes and cancer therapy: An evolutionary game theory approach.

    Science.gov (United States)

    Khadem, Heydar; Kebriaei, Hamed; Veisi, Zahra

    2017-06-01

    Inactivation of alleles in tumor suppressor genes (TSG) is one of the important issues resulting in evolution of cancerous cells. In this paper, the evolution of healthy, one and two missed allele cells is modeled using the concept of evolutionary game theory and replicator dynamics. The proposed model also takes into account the interaction rates of the cells as designing parameters of the system. Different combinations of the equilibrium points of the parameterized nonlinear system is studied and categorized into some cases. In each case, the interaction rates' values are suggested in a way that the equilibrium points of the replicator dynamics are located on an appropriate region of the state space. Based on the suggested interaction rates, it is proved that the system doesn't have any undesirable interior equilibrium point as well. Therefore, the system will converge to the desirable region, where there is a scanty level of cancerous cells. In addition, the proposed conditions for interaction rates guarantee that, when a trajectory of the system reaches the boundaries, then it will stay there forever which is a desirable property since the equilibrium points have been already located on the boundaries, appropriately. The simulation results show the effectiveness of the suggestions in the elimination of the cancerous cells in different scenarios. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Tumor suppressors: enhancers or suppressors of regeneration?

    Science.gov (United States)

    Pomerantz, Jason H.; Blau, Helen M.

    2013-01-01

    Tumor suppressors are so named because cancers occur in their absence, but these genes also have important functions in development, metabolism and tissue homeostasis. Here, we discuss known and potential functions of tumor suppressor genes during tissue regeneration, focusing on the evolutionarily conserved tumor suppressors pRb1, p53, Pten and Hippo. We propose that their activity is essential for tissue regeneration. This is in contrast to suggestions that tumor suppression is a trade-off for regenerative capacity. We also hypothesize that certain aspects of tumor suppressor pathways inhibit regenerative processes in mammals, and that transient targeted modification of these pathways could be fruitfully exploited to enhance processes that are important to regenerative medicine. PMID:23715544

  9. HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

    Directory of Open Access Journals (Sweden)

    Lehto Kirsi

    2011-04-01

    Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

  10. 99: A Novel Myc-Interacting Protein with Features of a Breast Tumor Suppressor Gene Product

    National Research Council Canada - National Science Library

    Prendergast, George

    1997-01-01

    Bin1 is a novel tumor suppressor-like molecule we identified through its ability to interact with and inhibit the oncogenic activity of the Myc oncoprotein, which is widely deregulated in breast cancer...

  11. Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.

    Directory of Open Access Journals (Sweden)

    Stella Marie Reamon-Buettner

    Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.

  12. Organization of the gene encoding human lysosomal beta-galactosidase.

    Science.gov (United States)

    Morreau, H; Bonten, E; Zhou, X Y; D'Azzo, A

    1991-09-01

    Human beta-galactosidase precursor mRNA is alternatively spliced into an abundant 2.5-kb transcript and a minor 2.0-kb species. These templates direct the synthesis of the classic lysosomal beta-D-galactosidase enzyme and of a beta-galactosidase-related protein with no enzymatic activity. Mutations in the beta-galactosidase gene result in the lysosomal storage disorders GM1-gangliosidosis and Morquio B syndrome. To analyze the genetic lesions underlying these syndromes we have isolated the human beta-galactosidase gene and determined its organization. The gene spans greater than 62.5 kb and contains 16 exons. Promoter activity is located on a 236-bp Pst I fragment which works in a direction-independent manner. A second Pst I fragment of 851 bp located upstream from the first negatively regulates initiation of transcription. The promoter has characteristics of a housekeeping gene with GC-rich stretches and five potential SP1 transcription elements on two strands. We identified multiple cap sites of the mRNA, the major of which maps 53 bp upstream from the translation initiation codon. The portion of the human pre-mRNA undergoing alternative splicing is encoded by exons II-VII. Sequence analysis of equivalent mouse exons showed an identical genomic organization. However, translation of the corresponding differentially spliced murine transcript is interrupted in its reading frame. Thus, the mouse gene cannot encode a beta-galactosidase-related protein in a manner similar to the human counterpart. Differential expression of the murine beta-galactosidase transcript is observed in different mouse tissues.

  13. A targeted constitutive mutation in the APC tumor suppressor gene underlies mammary but not intestinal tumorigenesis.

    Directory of Open Access Journals (Sweden)

    Claudia Gaspar

    2009-07-01

    Full Text Available Germline mutations in the adenomatous polyposis coli (APC gene are responsible for familial adenomatous polyposis (FAP, an autosomal dominant hereditary predisposition to the development of multiple colorectal adenomas and of a broad spectrum of extra-intestinal tumors. Moreover, somatic APC mutations play a rate-limiting and initiating role in the majority of sporadic colorectal cancers. Notwithstanding its multifunctional nature, the main tumor suppressing activity of the APC gene resides in its ability to regulate Wnt/beta-catenin signaling. Notably, genotype-phenotype correlations have been established at the APC gene between the length and stability of the truncated proteins encoded by different mutant alleles, the corresponding levels of Wnt/beta-catenin signaling activity they encode for, and the incidence and distribution of intestinal and extra-intestinal tumors. Here, we report a novel mouse model, Apc1572T, obtained by targeting a truncated mutation at codon 1572 in the endogenous Apc gene. This hypomorphic mutant allele results in intermediate levels of Wnt/beta-catenin signaling activation when compared with other Apc mutations associated with multifocal intestinal tumors. Notwithstanding the constitutive nature of the mutation, Apc(+/1572T mice have no predisposition to intestinal cancer but develop multifocal mammary adenocarcinomas and subsequent pulmonary metastases in both genders. The histology of the Apc1572T primary mammary tumours is highly heterogeneous with luminal, myoepithelial, and squamous lineages and is reminiscent of metaplastic carcinoma of the breast in humans. The striking phenotype of Apc(+/1572T mice suggests that specific dosages of Wnt/beta-catenin signaling activity differentially affect tissue homeostasis and initiate tumorigenesis in an organ-specific fashion.

  14. Role of tumor suppressor genes in the cancer-associated reprogramming of human induced pluripotent stem cells.

    Science.gov (United States)

    Lin, Ying-Chu; Murayama, Yoshinobu; Hashimoto, Koichiro; Nakamura, Yukio; Lin, Chang-Shin; Yokoyama, Kazunari K; Saito, Shigeo

    2014-01-01

    Because of their pluripotent characteristics, human induced pluripotent stem cells (iPSCs) possess great potential for therapeutic application and for the study of degenerative disorders. These cells are generated from normal somatic cells, multipotent stem cells, or cancer cells. They express embryonic stem cell markers, such as OCT4, SOX2, NANOG, SSEA-3, SSEA-4, and REX1, and can differentiate into all adult tissue types, both in vitro and in vivo. However, some of the pluripotency-promoting factors have been implicated in tumorigenesis. Here, we describe the merits of tumor suppresser genes as reprogramming factors for the generation of iPSCs without tumorigenic activity. The initial step of reprogramming is induction of the exogenous pluripotent factors to generate the oxidative stress that leads to senescence by DNA damage and metabolic stresses, thus inducing the expression of tumor suppressor genes such as p21CIP1 and p16INK4a through the activation of p53 to be the pre-induced pluripotent stem cells (pre-iPSCs). The later stage includes overcoming the barrier of reprogramming-induced senescence or cell-cycle arrest by shutting off the function of these tumor suppressor genes, followed by the induction of endogenous stemness genes for the full commitment of iPSCs (full-iPSCs). Thus, the reactive oxygen species (ROS) produced by oxidative stress might be critical for the induction of endogenous reprogramming-factor genes via epigenetic changes or antioxidant reactions. We also discuss the critical role of tumor suppressor genes in the evaluation of the tumorigenicity of human cancer cell-derived pluripotent stem cells, and describe how to overcome their tumorigenic properties for application in stem cell therapy in the field of regenerative medicine.

  15. The Tumor Suppressor Gene, RASSF1A, Is Essential for Protection against Inflammation -Induced Injury

    Science.gov (United States)

    Fiteih, Yahya; Law, Jennifer; Volodko, Natalia; Mohamed, Anwar; El-Kadi, Ayman O. S.; Liu, Lei; Odenbach, Jeff; Thiesen, Aducio; Onyskiw, Christina; Ghazaleh, Haya Abu; Park, Jikyoung; Lee, Sean Bong; Yu, Victor C.; Fernandez-Patron, Carlos; Alexander, R. Todd; Wine, Eytan; Baksh, Shairaz

    2013-01-01

    Ras association domain family protein 1A (RASSF1A) is a tumor suppressor gene silenced in cancer. Here we report that RASSF1A is a novel regulator of intestinal inflammation as Rassf1a+/−, Rassf1a−/− and an intestinal epithelial cell specific knockout mouse (Rassf1a IEC-KO) rapidly became sick following dextran sulphate sodium (DSS) administration, a chemical inducer of colitis. Rassf1a knockout mice displayed clinical symptoms of inflammatory bowel disease including: increased intestinal permeability, enhanced cytokine/chemokine production, elevated nuclear factor of kappa light polypeptide gene enhancer in B-cells (NFκB) activity, elevated colonic cell death and epithelial cell injury. Furthermore, epithelial restitution/repair was inhibited in DSS-treated Rassf1a−/− mice with reduction of several makers of proliferation including Yes associated protein (YAP)-driven proliferation. Surprisingly, tyrosine phosphorylation of YAP was detected which coincided with increased nuclear p73 association, Bax-driven epithelial cell death and p53 accumulation resulting in enhanced apoptosis and poor survival of DSS-treated Rassf1a knockout mice. We can inhibit these events and promote the survival of DSS-treated Rassf1a knockout mice with intraperitoneal injection of the c-Abl and c-Abl related protein tyrosine kinase inhibitor, imatinib/gleevec. However, p53 accumulation was not inhibited by imatinib/gleevec in the Rassf1a−/− background which revealed the importance of p53-dependent cell death during intestinal inflammation. These observations suggest that tyrosine phosphorylation of YAP (to drive p73 association and up-regulation of pro-apoptotic genes such as Bax) and accumulation of p53 are consequences of inflammation-induced injury in DSS-treated Rassf1a−/− mice. Mechanistically, we can detect robust associations of RASSF1A with membrane proximal Toll-like receptor (TLR) components to suggest that RASSF1A may function to interfere and restrict TLR

  16. Lack of mutations in the TP53 tumor suppressor gene exons 5 to 8 in Fanconi's anemia.

    Science.gov (United States)

    Jonveaux, P; Le Coniat, M; Grausz, D; Berger, R

    1991-01-01

    The TP53 gene is considered to be a negative regulator of cell growth whose inactivation is an important step in the development or progression of malignancies. Recently, germ line TP53 mutations have been detected in a familial cancer syndrome, the dominantly inherited Li-Fraumeni syndrome. Using single strand conformation polymorphism analysis of PCR products, we looked for TP53 mutations in DNA of patients with Fanconi anemia, an autosomal recessive disease characterized by increased predisposition to neoplasia. We did not find any TP53 mutation in 13 patients, suggesting that this tumor suppressor gene is not directly involved in the cancer susceptibility observed in Fanconi's anemia.

  17. Regulation of the insulin-like developmental pathway of Caenorhabditis elegans by a homolog of the PTEN tumor suppressor gene

    OpenAIRE

    Gil, Elad B.; Malone Link, Elizabeth; Liu, Leo X.; Johnson, Carl D.; Lees, Jacqueline A.

    1999-01-01

    The human PTEN tumor suppressor gene is mutated in a wide variety of sporadic tumors. To determine the function of PTEN in vivo we have studied a PTEN homolog in Caenorhabditis elegans. We have generated a strong loss-of-function allele of the PTEN homolog and shown that the deficient strain is unable to enter dauer diapause. An insulin-like phosphatidylinositol 3-OH kinase (PI3′K) signaling pathway regulates dauer-stage entry. Mutations in either the daf-2 insulin receptor-like (IRL) gene or...

  18. Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia ...

    Indian Academy of Sciences (India)

    YINGJUN LI

    Identification of NBS-encodings and gene family classification of kiwi fruit. Kiwi fruit (A. chinensis) assembly and annotation ... There were three criteria to classify gene family. Both the coverage (aligned sequence/gene lengths) and iden- ... Number of identified NBS-encoding genes in kiwi fruit. Predicted protein domain.

  19. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  20. Molecular Analysis: Microsatellite Instability and Loss of Heterozygosity of Tumor Suppressor Gene in Hereditary Non-Polyposis Colorectal Cancer (HNPCC

    Directory of Open Access Journals (Sweden)

    Vesna Hadžiavdić

    2009-02-01

    Full Text Available HNPCC (Hereditary non-polyposis colorectal cancer development is caused by mutation of genes included in system of mismatch repair genes. The mutation exists at 60% of patients in hMSH2 gene, 30% in hMLH1 and 10% both in hPMS1and hPMS2 genes. RER+ exists in about 90% in hereditary non-polyposis colorectal cancer and about 15-28% in sporadic cancers.The purpose of the study was to determine highly sensitive microsatellite markers which can be fast and efficient way of microsatellite screening for detection of HNPCC patients. Moreover, we have analysed the loss of heterozygosity of tumour suppressor genes which could have the diagnostic value in detection of HPNCC patients.

  1. Genome-wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma.

    Science.gov (United States)

    Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J; Almutairi, Bader; Etchevers, Heather C; McConville, Carmel; Malik, Karim T A; Brown, Keith W

    2017-04-01

    Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome-wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome-wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down-regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest-expressing tumors had reduced relapse-free survival. Our functional studies showed that knock-down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc.

  2. Genome‐wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma

    Science.gov (United States)

    Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R.; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J.; Almutairi, Bader; Etchevers, Heather C.; McConville, Carmel; Malik, Karim T. A.

    2016-01-01

    Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome‐wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome‐wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down‐regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest‐expressing tumors had reduced relapse‐free survival. Our functional studies showed that knock‐down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. PMID:27862318

  3. Co-transcriptional folding is encoded within RNA genes

    Directory of Open Access Journals (Sweden)

    Miklós István

    2004-08-01

    Full Text Available Abstract Background Most of the existing RNA structure prediction programs fold a completely synthesized RNA molecule. However, within the cell, RNA molecules emerge sequentially during the directed process of transcription. Dedicated experiments with individual RNA molecules have shown that RNA folds while it is being transcribed and that its correct folding can also depend on the proper speed of transcription. Methods The main aim of this work is to study if and how co-transcriptional folding is encoded within the primary and secondary structure of RNA genes. In order to achieve this, we study the known primary and secondary structures of a comprehensive data set of 361 RNA genes as well as a set of 48 RNA sequences that are known to differ from the originally transcribed sequence units. We detect co-transcriptional folding by defining two measures of directedness which quantify the extend of asymmetry between alternative helices that lie 5' and those that lie 3' of the known helices with which they compete. Results We show with statistical significance that co-transcriptional folding strongly influences RNA sequences in two ways: (1 alternative helices that would compete with the formation of the functional structure during co-transcriptional folding are suppressed and (2 the formation of transient structures which may serve as guidelines for the co-transcriptional folding pathway is encouraged. Conclusions These findings have a number of implications for RNA secondary structure prediction methods and the detection of RNA genes.

  4. Hypermethylation of the tumor suppressor gene PRDM1/Blimp-1 supports a pathogenetic role in EBV-positive Burkitt lymphoma

    International Nuclear Information System (INIS)

    Zhang, T; Ma, J; Nie, K; Yan, J; Liu, Y; Bacchi, C E; Queiroga, E M; Gualco, G; Sample, J T; Orazi, A; Knowles, D M; Tam, W

    2014-01-01

    PRDM1/Blimp-1 is a tumor suppressor gene in the activated B-cell subtype of diffuse large B-cell lymphomas. Its inactivation contributes to pathogenesis in this setting by impairing terminal B-cell differentiation induced by constitutive nuclear factor-κB activation. The role of PRDM1 in Burkitt lymphoma (BL) lymphomagenesis is not known. Here we identified hypermethylation of the promoter region and exon 1 of PRDM1 in all six Epstein–Barr virus (EBV)-positive BL cell lines and 12 of 23 (52%) primary EBV-positive BL or BL-related cases examined, but in none of the EBV-negative BL cell lines or primary tumors that we assessed, implying a tumor suppressor role for PRDM1 specifically in EBV-associated BL. A direct induction of PRDM1 hypermethylation by EBV is unlikely, as PRDM1 hypermethylation was not observed in EBV-immortalized B lymphoblastoid cell lines. Treatment of EBV-positive BL cells with 5′ azacytidine resulted in PRDM1 induction associated with PRDM1 demethylation, consistent with transcriptional silencing of PRDM1 as a result of DNA methylation. Overexpression of PRDM1 in EBV-positive BL cell lines resulted in cell cycle arrest. Our results expand the spectrum of lymphoid malignancies in which PRDM1 may have a tumor suppressor role and identify an epigenetic event that likely contributes to the pathogenesis of BL

  5. Hypermethylation of the tumor suppressor gene PRDM1/Blimp-1 supports a pathogenetic role in EBV-positive Burkitt lymphoma.

    Science.gov (United States)

    Zhang, T; Ma, J; Nie, K; Yan, J; Liu, Y; Bacchi, C E; Queiroga, E M; Gualco, G; Sample, J T; Orazi, A; Knowles, D M; Tam, W

    2014-11-07

    PRDM1/Blimp-1 is a tumor suppressor gene in the activated B-cell subtype of diffuse large B-cell lymphomas. Its inactivation contributes to pathogenesis in this setting by impairing terminal B-cell differentiation induced by constitutive nuclear factor-κB activation. The role of PRDM1 in Burkitt lymphoma (BL) lymphomagenesis is not known. Here we identified hypermethylation of the promoter region and exon 1 of PRDM1 in all six Epstein-Barr virus (EBV)-positive BL cell lines and 12 of 23 (52%) primary EBV-positive BL or BL-related cases examined, but in none of the EBV-negative BL cell lines or primary tumors that we assessed, implying a tumor suppressor role for PRDM1 specifically in EBV-associated BL. A direct induction of PRDM1 hypermethylation by EBV is unlikely, as PRDM1 hypermethylation was not observed in EBV-immortalized B lymphoblastoid cell lines. Treatment of EBV-positive BL cells with 5' azacytidine resulted in PRDM1 induction associated with PRDM1 demethylation, consistent with transcriptional silencing of PRDM1 as a result of DNA methylation. Overexpression of PRDM1 in EBV-positive BL cell lines resulted in cell cycle arrest. Our results expand the spectrum of lymphoid malignancies in which PRDM1 may have a tumor suppressor role and identify an epigenetic event that likely contributes to the pathogenesis of BL.

  6. Clinical Utility of promoter methylation of the tumor suppressor genes DKK3, and RASSF1A in breast cancer patients

    Directory of Open Access Journals (Sweden)

    Marwa H. Saied

    2018-04-01

    Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1

  7. A novel protein encoded by the circular form of the SHPRH gene suppresses glioma tumorigenesis.

    Science.gov (United States)

    Zhang, Maolei; Huang, Nunu; Yang, Xuesong; Luo, Jingyan; Yan, Sheng; Xiao, Feizhe; Chen, Wenping; Gao, Xinya; Zhao, Kun; Zhou, Huangkai; Li, Ziqiang; Ming, Liu; Xie, Bo; Zhang, Nu

    2018-01-18

    Circular RNAs (circRNAs) are recognized as functional non-coding transcripts in eukaryotic cells. Recent evidence has indicated that even though circRNAs are generally expressed at low levels, they may be involved in many physiological or pathological processes, such as gene regulation, tissue development and carcinogenesis. Although the 'microRNA sponge' function is well characterized, most circRNAs do not contain perfect trapping sites for microRNAs, which suggests the possibility that circRNAs have functions that have not yet been defined. In this study, we show that a circRNA containing an open reading frame (ORF) driven by the internal ribosome entry site (IRES) can translate a functional protein. The circular form of the SNF2 histone linker PHD RING helicase (SHPRH) gene encodes a novel protein that we termed SHPRH-146aa. Circular SHPRH (circ-SHPRH) uses overlapping genetic codes to generate a 'UGA' stop codon, which results in the translation of the 17 kDa SHPRH-146aa. Both circ-SHPRH and SHPRH-146aa are abundantly expressed in normal human brains and are down-regulated in glioblastoma. The overexpression of SHPRH-146aa in U251 and U373 glioblastoma cells reduces their malignant behavior and tumorigenicity in vitro and in vivo. Mechanistically, SHPRH-146aa protects full-length SHPRH from degradation by the ubiquitin proteasome. Stabilized SHPRH sequentially ubiquitinates proliferating cell nuclear antigen (PCNA) as an E3 ligase, leading to inhibited cell proliferation and tumorigenicity. Our findings provide a novel perspective regarding circRNA function in physiological and pathological processes. Specifically, SHPRH-146aa generated from overlapping genetic codes of circ-SHPRH is a tumor suppressor in human glioblastoma.

  8. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    Science.gov (United States)

    Jarvis, Eric E.; Roessler, Paul G.

    1999-01-01

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  9. Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators

    Energy Technology Data Exchange (ETDEWEB)

    Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia [Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Katiyar, Santosh K., E-mail: skatiyar@uab.edu [Birmingham Veterans Affairs Medical Center, Birmingham, AL 35294 (United States); Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294 (United States); Comprehensive Cancer Center, University of Alabama at Birmingham, Birmingham, AL 35294 (United States)

    2012-08-15

    Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16{sup INK4a} and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin

  10. Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators

    International Nuclear Information System (INIS)

    Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.

    2012-01-01

    Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin

  11. Phytochemical Compositions of Immature Wheat Bran, and Its Antioxidant Capacity, Cell Growth Inhibition, and Apoptosis Induction through Tumor Suppressor Gene

    Directory of Open Access Journals (Sweden)

    Mi Jeong Kim

    2016-09-01

    Full Text Available The purpose of this study was to investigate the phytochemical compositions and antioxidant capacity, cell growth inhibition, and apoptosis induction in extracts of immature wheat bran. Immature wheat bran (IWB was obtained from immature wheat harvested 10 days earlier than mature wheat. The phytochemical compositions of bran extract samples were analyzed by ultra-high performance liquid chromatography. The total ferulic acid (3.09 mg/g and p-coumaric acid (75 µg/g in IWB were significantly higher than in mature wheat bran (MWB, ferulic acid: 1.79 mg/g; p-coumaric acid: 55 µg/g. The oxygen radical absorbance capacity (ORAC: 327 µM Trolox equivalents (TE/g and cellular antioxidant activity (CAA: 4.59 µM Quercetin equivalents (QE/g of the IWB were higher than those of the MWB (ORAC: 281 µM TE/g; CAA: 0.63 µM QE/g. When assessing cell proliferation, the IWB extracts resulted in the lowest EC50 values against HT-29 (18.9 mg/mL, Caco-2 (7.74 mg/mL, and HeLa cells (8.17 mg/mL among bran extract samples. Additionally, the IWB extracts increased the gene expression of p53 and PTEN (tumor suppressor genes in HT-29 cells, indicating inhibited cell growth and induced apoptosis through tumor suppressor genes.

  12. Evidence of molecular alterations in the tumour suppressor gene WWOX in benign and malignant bone related lesions of the jaws.

    Science.gov (United States)

    Diniz, Marina Gonçalves; Borges, Erica Rievrs; Pimenta, Flavio Juliano; De Mesquita Netto, Ana Carolina; De Marco, Luiz; Gomez, Ricardo Santiago; Gomes, Carolina Cavaliéri

    2011-02-01

    WWOX is a tumour suppressor gene altered in various human neoplasms. Deletion of WWOX is associated with bone metabolic defects and development of osteosarcoma in mice. We hypothesized that alterations of this gene are associated with the development of benign and malignant mesenchymal bone related lesions of the jaws. We investigated WWOX mRNA by nested reverse transcription-PCR and direct sequencing and quantitative real-time PCR in two osteosarcoma, two fibrosarcoma, eight ossifying fibroma and two fibrous dysplasia fresh samples. Malignancy was associated with a decreased WWOX mRNA expression. Aberrant transcription pattern was found in five samples; however, the relative quantification (RQ) of the WWOX mRNA in such lesions was not different from those carrying only the wild-type. We provide new evidence of WWOX alterations in osteosarcomas and demonstrate for the first time alterations of this gene in fibrosarcomas as well as in ossifying fibromas of the jaws.

  13. Human umbilical cord matrix mesenchymal stem cells suppress the growth of breast cancer by expression of tumor suppressor genes.

    Directory of Open Access Journals (Sweden)

    Naomi Ohta

    Full Text Available Human and rat umbilical cord matrix mesenchymal stem cells (UCMSC possess the ability to control the growth of breast carcinoma cells. Comparative analyses of two types of UCMSC suggest that rat UCMSC-dependent growth regulation is significantly stronger than that of human UCMSC. Their different tumoricidal abilities were clarified by analyzing gene expression profiles in the two types of UCMSC. Microarray analysis revealed differential gene expression between untreated naïve UCMSC and those co-cultured with species-matched breast carcinoma cells. The analyses screened 17 differentially expressed genes that are commonly detected in both human and rat UCMSC. The comparison between the two sets of gene expression profiles identified two tumor suppressor genes, adipose-differentiation related protein (ADRP and follistatin (FST, that were specifically up-regulated in rat UCMSC, but down-regulated in human UCMSC when they were co-cultured with the corresponding species' breast carcinoma cells. Over-expression of FST, but not ADRP, in human UCMSC enhanced their ability to suppress the growth of MDA-231 cells. The growth of MDA-231 cells was also significantly lower when they were cultured in medium conditioned with FST, but not ADRP over-expressing human UCMSC. In the breast carcinoma lung metastasis model generated with MDA-231 cells, systemic treatment with FST-over-expressing human UCMSC significantly attenuated the tumor burden. These results suggest that FST may play an important role in exhibiting stronger tumoricidal ability in rat UCMSC than human UCMSC and also implies that human UCMSC can be transformed into stronger tumoricidal cells by enhancing tumor suppressor gene expression.

  14. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...

  15. KLF10, transforming growth factor-β-inducible early gene 1, acts as a tumor suppressor

    International Nuclear Information System (INIS)

    Song, Ki-Duk; Kim, Duk-Jung; Lee, Jong Eun; Yun, Cheol-Heui; Lee, Woon Kyu

    2012-01-01

    Highlights: ► KLF10 −/− mice exhibited accelerated papilloma development after DMBA/TPA treatment. ► KLF10 −/− keratinocytes showed increased proliferation and apoptosis. ► KLF10 −/− MEFs yielded more colonies than wild-type one with H-Ras transfection. ► KLF10 dose-dependently activated p21 WAF1/CIP1 transcription. ► KLF10 is a tumor suppressor and that it targets p21 WAF1/CIP1 transcription. -- Abstract: Krüppel-like factor 10 (KLF10) has been suggested to be a putative tumor suppressor. In the present study, we generated KLF10 deficient mice to explore this hypothesis in vivo. KLF10 deficient mice exhibited increased predisposition to skin tumorigenesis and markedly accelerated papilloma development after DMBA/TPA treatment. On the other hand, KLF10 deficient keratinocytes showed increased proliferation and apoptosis. In colony formation assays after oncogenic H-Ras transfection, KLF10 deficient mouse embryonic fibroblasts (MEFs) yielded more colonies than wild-type MEFs. Furthermore, KLF10 dose-dependently activated p21 WAF1/CIP1 transcription, which was independent of p53 and Sp1 binding sites in p21 WAF1/CIP1 promoter. This study demonstrates that KLF10 is a tumor suppressor and that it targets p21 WAF1/CIP1 transcription.

  16. Retinoid-induced expression and activity of an immediate early tumor suppressor gene in vascular smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Streb

    2011-04-01

    Full Text Available Retinoids are used clinically to treat a number of hyper-proliferative disorders and have been shown in experimental animals to attenuate vascular occlusive diseases, presumably through nuclear receptors bound to retinoic acid response elements (RARE located in target genes. Here, we show that natural or synthetic retinoids rapidly induce mRNA and protein expression of a specific isoform of A-Kinase Anchoring Protein 12 (AKAP12β in cultured smooth muscle cells (SMC as well as the intact vessel wall. Expression kinetics and actinomycin D studies indicate Akap12β is a retinoid-induced, immediate-early gene. Akap12β promoter analyses reveal a conserved RARE mildly induced with atRA in a region that exhibits hyper-acetylation. Immunofluorescence microscopy and protein kinase A (PKA regulatory subunit overlay assays in SMC suggest a physical association between AKAP12β and PKA following retinoid treatment. Consistent with its designation as a tumor suppressor, inducible expression of AKAP12β attenuates SMC growth in vitro. Further, immunohistochemistry studies establish marked decreases in AKAP12 expression in experimentally-injured vessels of mice as well as atheromatous lesions in humans. Collectively, these results demonstrate a novel role for retinoids in the induction of an AKAP tumor suppressor that blocks vascular SMC growth thus providing new molecular insight into how retiniods may exert their anti-proliferative effects in the injured vessel wall.

  17. Cholesterol and phytosterols differentially regulate the expression of caveolin 1 and a downstream prostate cell growth-suppressor gene

    Science.gov (United States)

    Ifere, Godwin O.; Equan, Anita; Gordon, Kereen; Nagappan, Peri; Igietseme, Joseph U.; Ananaba, Godwin A.

    2010-01-01

    Background The purpose of our study was to show the distinction between the apoptotic and anti-proliferative signaling of phytosterols and cholesterol enrichment in prostate cancer cell lines, mediated by the differential transcription of caveolin-1, and N-myc downstream regulated gene1 (NDRG1), a pro-apoptotic androgen-regulated tumor suppressor. Methods PC-3 and DU145 cells were treated with sterols (cholesterol and phytosterols) for 72 h, followed by trypan blue dye exclusion measurement of necrosis and cell growth measured with a Coulter counter. Sterol induction of cell growth-suppressor gene expression was evaluated by mRNA transcription using RT-PCR, while cell cycle analysis was performed by FACS analysis. Altered expression of Ndrg1 protein was confirmed by Western blot analysis. Apoptosis was evaluated by real time RT-PCR amplification of P53, Bcl-2 gene and its related pro- and anti-apoptotic family members. Results Physiological doses (16 µM) of cholesterol and phytosterols were not cytotoxic in these cells. Cholesterol enrichment promoted cell growth (Pphytosterols significantly induced growth-suppression (Pphytosterols decreased mitotic subpopulations. We demonstrated for the first time that cholesterols concertedly attenuated the expression of caveolin-1(cav-1) and NDRG1 genes in both prostate cancer cell lines. Phytosterols had the opposite effect by inducing overexpression of cav-1, a known mediator of androgen-dependent signals that presumably control cell growth or apoptosis. Conclusions Cholesterol and phytosterol treatment differentially regulated the growth of prostate cancer cells and the expression of p53 and cav-1, a gene that regulates androgen-regulated signals. These sterols also differentially regulated cell cycle arrest, downstream pro-apoptotic androgen-regulated tumor-suppressor, NDRG1 suggesting that cav-1 may mediate pro-apoptotic NDRG1 signals. Elucidation of the mechanism for sterol modulation of growth and apoptosis signaling

  18. Analysis of losses of heterozygosity of the candidate tumour suppressor gene DMBT1 in melanoma resection specimens

    DEFF Research Database (Denmark)

    Deichmann, M; Mollenhauer, J; Helmke, B

    2002-01-01

    Deleted in malignant brain tumours 1 (DMBT1), a candidate tumour suppressor gene located on chromosome 10q25.3-q26.1, has recently been identified and found to be deleted in several different types of human tumours. In melanomas, the chromosomal region 10q22-qter is commonly affected by losses......, hence we screened primary melanoma samples for losses of heterozygosity (LOH), and acquired melanocytic naevi and melanomas for transcription of DMBT1 and protein expression. Of 38 informative melanomas, 1 nodular melanoma and 2 subcutaneous metastases showed LOH of both microsatellites flanking...... the gene, suggesting loss of 1 DMBT1 allele. Three further melanomas showed LOH at 1 informative locus but were heterozygous for the second marker. Applying reverse-transcription polymerase chain reaction (RT-PCR), DMBT1 transcription was not found in melanomas. However, DMBT1 transcription was also absent...

  19. Analysis of losses of heterozygosity of the candidate tumour suppressor gene DMBT1 in melanoma resection specimens

    DEFF Research Database (Denmark)

    Deichmann, M; Mollenhauer, J; Helmke, B

    2002-01-01

    , hence we screened primary melanoma samples for losses of heterozygosity (LOH), and acquired melanocytic naevi and melanomas for transcription of DMBT1 and protein expression. Of 38 informative melanomas, 1 nodular melanoma and 2 subcutaneous metastases showed LOH of both microsatellites flanking......Deleted in malignant brain tumours 1 (DMBT1), a candidate tumour suppressor gene located on chromosome 10q25.3-q26.1, has recently been identified and found to be deleted in several different types of human tumours. In melanomas, the chromosomal region 10q22-qter is commonly affected by losses...... the gene, suggesting loss of 1 DMBT1 allele. Three further melanomas showed LOH at 1 informative locus but were heterozygous for the second marker. Applying reverse-transcription polymerase chain reaction (RT-PCR), DMBT1 transcription was not found in melanomas. However, DMBT1 transcription was also absent...

  20. Towards the Identification of New Genes Involved in ABA-Dependent Abiotic Stresses Using Arabidopsis Suppressor Mutants of abh1 Hypersensitivity to ABA during Seed Germination

    Directory of Open Access Journals (Sweden)

    Iwona Szarejko

    2013-06-01

    Full Text Available Abscisic acid plays a pivotal role in the abiotic stress response in plants. Although great progress has been achieved explaining the complexity of the stress and ABA signaling cascade, there are still many questions to answer. Mutants are a valuable tool in the identification of new genes or new alleles of already known genes and in elucidating their role in signaling pathways. We applied a suppressor mutation approach in order to find new components of ABA and abiotic stress signaling in Arabidopsis. Using the abh1 (ABA hypersensitive 1 insertional mutant as a parental line for EMS mutagenesis, we selected several mutants with suppressed hypersensitivity to ABA during seed germination. Here, we present the response to ABA and a wide range of abiotic stresses during the seed germination and young seedling development of two suppressor mutants—soa2 (suppressor of abh1 hypersensitivity to ABA 2 and soa3 (suppressor of abh1 hypersensitivity to ABA 3. Generally, both mutants displayed a suppression of the hypersensitivity of abh1 to ABA, NaCl and mannitol during germination. Both mutants showed a higher level of tolerance than Columbia-0 (Col-0—the parental line of abh1 in high concentrations of glucose. Additionally, soa2 exhibited better root growth than Col-0 in the presence of high ABA concentrations. soa2 and soa3 were drought tolerant and both had about 50% fewer stomata per mm2 than the wild-type but the same number as their parental line—abh1. Taking into account that suppressor mutants had the same genetic background as their parental line—abh1, it was necessary to backcross abh1 with Landsberg erecta four times for the map-based cloning approach. Mapping populations, derived from the cross of abh1 in the Landsberg erecta background with each suppressor mutant, were created. Map based cloning in order to identify the suppressor genes is in progress.

  1. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  2. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  3. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  4. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  5. Multi-gene epigenetic silencing of tumor suppressor genes in T-cell lymphoma cells; delayed expression of the p16 protein upon reversal of the silencing

    DEFF Research Database (Denmark)

    Nagasawa, T; Zhang, Q; Raghunath, P N

    2006-01-01

    )-expressing T-cell lymphomas. p16 gene was epigenetically silenced in all but one of the 10 malignant T-cell lines examined, p15 gene silenced in roughly half of the lines, and p14 was the least frequently affected. Extensive methylation of the p16 promoter was seen in six out of 10 cutaneous T-cell lymphoma...... promoter demethylation and required up to 3 weeks to occur, seemingly reflecting late activation of the p16 gene. These findings indicate that epigenetic silencing affects in T-cell malignancies, often simultaneously, several tumor suppressor genes that impact on key cell functions. The observed...... differential silencing of p16 and p14, and to a lesser degree p15 gene, indicates that the silencing is governed by precise, promoter region-specific mechanisms. The study provides also further rationale for treatment of at least some types of T-cell lymphomas with DNA methyltransferase inhibitors to target...

  6. MicroRNA-375 Functions as a Tumor-Suppressor Gene in Gastric Cancer by Targeting Recepteur d’Origine Nantais

    Directory of Open Access Journals (Sweden)

    Sen Lian

    2016-09-01

    Full Text Available Emerging evidence supports a fundamental role for microRNAs (miRNA in regulating cancer metastasis. Recently, microRNA-375 (miR-375 was reported to be downregulated in many types of cancers, including gastric cancer. Increase in the expression of Recepteur d’Origine Nantais (RON, a receptor tyrosine kinase, has been reported in tumors. However, the function of miR-375 and RON expression in gastric cancer metastasis has not been sufficiently studied. In silico analysis identified miR-375 binding sites in the 3′-untranslated regions (3′-UTR of the RON-encoding gene. Expression of miR-375 resulted in reduced activity of a luciferase reporter containing the 3′-UTR fragments of RON-encoding mRNA, confirming that miR-375 directly targets the 3′-UTR of RON mRNA. Moreover, we found that overexpression of miR-375 inhibited mRNA and protein expression of RON, which was accompanied by the suppression of cell proliferation, migration, and invasion in gastric cancer AGS and MKN-28 cells. Ectopic miR-375 expression also induced G1 cell cycle arrest through a decrease in the expression of cyclin D1, cyclin D3, and in the phosphorylation of retinoblastoma (Rb. Knockdown of RON by RNAi, similar to miR-375 overexpression, suppressed tumorigenic properties and induced G1 arrest through a decrease in the expression of cyclin D1, cyclin D3, and in the phosphorylation of Rb. Thus, our study provides evidence that miR-375 acts as a suppressor of metastasis in gastric cancer by targeting RON, and might represent a new potential therapeutic target for gastric cancer.

  7. Transcriptomic and CRISPR/Cas9 technologies reveal FOXA2 as a tumor suppressor gene in pancreatic cancer.

    Science.gov (United States)

    Vorvis, Christina; Hatziapostolou, Maria; Mahurkar-Joshi, Swapna; Koutsioumpa, Marina; Williams, Jennifer; Donahue, Timothy R; Poultsides, George A; Eibl, Guido; Iliopoulos, Dimitrios

    2016-06-01

    Pancreatic ductal adenocarcinoma (PDAC) is an aggressive cancer with low survival rates and limited therapeutic options. Thus elucidation of signaling pathways involved in PDAC pathogenesis is essential for identifying novel potential therapeutic gene targets. Here, we used a systems approach to elucidate those pathways by integrating gene and microRNA profiling analyses together with CRISPR/Cas9 technology to identify novel transcription factors involved in PDAC pathogenesis. FOXA2 transcription factor was found to be significantly downregulated in PDAC relative to control pancreatic tissues. Functional experiments revealed that FOXA2 has a tumor suppressor function through inhibition of pancreatic cancer cell growth, migration, invasion, and colony formation. In situ hybridization analysis revealed miR-199a to be significantly upregulated in pancreatic cancer. Bioinformatics and luciferase analyses showed that miR-199a negatively but directly regulates FOXA2 expression through binding in its 3'-untranslated region (UTR). Evaluation of the functional importance of miR-199a on pancreatic cancer revealed that miR-199a acts as an inhibitor of FOXA2 expression, inducing an increase in pancreatic cancer cell proliferation, migration, and invasion. Additionally, gene ontology and network analyses in PANC-1 cells treated with a small interfering RNA (siRNA) against FOXA2 revealed an enrichment for cell invasion mechanisms through PLAUR and ERK activation. FOXA2 deletion (FOXA2Δ) by using two CRISPR/Cas9 vectors in PANC-1 cells induced tumor growth in vivo resulting in upregulation of PLAUR and ERK pathways in FOXA2Δ xenograft tumors. We have identified FOXA2 as a novel tumor suppressor in pancreatic cancer and it is regulated directly by miR-199a, thereby enhancing our understanding of how microRNAs interplay with the transcription factors to affect pancreatic oncogenesis. Copyright © 2016 the American Physiological Society.

  8. Helicobacter pylori infection is associated with decreased expression of SLC5A8, a cancer suppressor gene, in young children

    Directory of Open Access Journals (Sweden)

    Andrea Orellana Manzano

    2016-10-01

    Full Text Available Background: Helicobacter pylori infects half of the world's population and causes gastric cancer in a subset of infected adults. Previous blood microarray findings showed that apparently healthy children, persistently infected with H. pylori have differential gene expression compared to age-matched, non-infected children. SLC5A8, a cancer suppressor gene with decreased expression among infected children, was chosen for further study based on bioinformatics analysis. Methods: A pilot study was conducted using specific qRT-PCR amplification of SLC5A8 in blood samples from H. pylori infected and non-infected children, followed by a larger, blinded, case-control study. We then analyzed gastric tissue from H. pylori infected and non-infected children undergoing endoscopy for clinical purposes. Results: Demographics, clinical findings and family history were similar between groups. SLC5A8 expression was decreased in infected versus non-infected children in blood, 0.12 (IQR: 0 – 0.89 versus 1.86 (IQR: 0 – 8.94, P=0.002, and in gastric tissue, 0.08 (IQR: 0.04 – 0.15 versus 1.88 (IQR: 0.55 – 2.56; P=0.001. Children who were both stool positive and seropositive for H. pylori had the lowest SLC5A8 expression levels.Conclusions: H. pylori infection is associated with suppression of SCL5A8, a cancer suppressor gene, in both blood and tissue samples from young children.

  9. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  10. The transformation suppressor gene Reck is required for postaxial patterning in mouse forelimbs

    Directory of Open Access Journals (Sweden)

    Mako Yamamoto

    2012-03-01

    The membrane-anchored metalloproteinase-regulator RECK has been characterized as a tumor suppressor. Here we report that mice with reduced Reck-expression show limb abnormalities including right-dominant, forelimb-specific defects in postaxial skeletal elements. The forelimb buds of low-Reck mutants have an altered dorsal ectoderm with reduced Wnt7a and Igf2 expression, and hypotrophy in two signaling centers (i.e., ZPA and AER that are essential for limb outgrowth and patterning. Reck is abundantly expressed in the anterior mesenchyme in normal limb buds; mesenchyme-specific Reck inactivation recapitulates the low-Reck phenotype; and some teratogens downregulate Reck in mesenchymal cells. Our findings illustrate a role for Reck in the mesenchymal-epithelial interactions essential for mammalian development.

  11. Re-expression of methylation-induced tumor suppressor gene silencing is associated with the state of histone modification in gastric cancer cell lines

    OpenAIRE

    Meng, Chun-Feng; Zhu, Xin-Jiang; Peng, Guo; Dai, Dong-Qiu

    2007-01-01

    AIM: To identify the relationship between DNA hyper-methylation and histone modification at a hyperme-thylated, silenced tumor suppressor gene promoter in human gastric cancer cell lines and to elucidate whether alteration of DNA methylation could affect histone modification.

  12. Molecular Cloning, Characterization, and Expression ofMiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indicaL).

    Science.gov (United States)

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango ( Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5' UTR and a 189 bp long 3' UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems' leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue -specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis . In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango.

  13. Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L)

    Science.gov (United States)

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango (Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5′ UTR and a 189 bp long 3′ UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems’ leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue –specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis. In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango. PMID:27965680

  14. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  15. Alternative exon usage creates novel transcript variants of tumor suppressor SHREW-1 gene with differential tissue expression profile

    Directory of Open Access Journals (Sweden)

    Petra A. B. Klemmt

    2016-11-01

    Full Text Available Shrew-1, also called AJAP1, is a transmembrane protein associated with E-cadherin-mediated adherence junctions and a putative tumor suppressor. Apart from its interaction with β-catenin and involvement in E-cadherin internalization, little structure or function information exists. Here we explored shrew-1 expression during postnatal differentiation of mammary gland as a model system. Immunohistological analyses with antibodies against either the extracellular or the cytoplasmic domains of shrew-1 consistently revealed the expression of full-length shrew-1 in myoepithelial cells, but only part of it in luminal cells. While shrew-1 localization remained unaltered in myoepithelial cells, nuclear localization occurred in luminal cells during lactation. Based on these observations, we identified two unknown shrew-1 transcript variants encoding N-terminally truncated proteins. The smallest shrew-1 protein lacks the extracellular domain and is most likely the only variant present in luminal cells. RNA analyses of human tissues confirmed that the novel transcript variants of shrew-1 exist in vivo and exhibit a differential tissue expression profile. We conclude that our findings are essential for the understanding and interpretation of future functional and interactome analyses of shrew-1 variants.

  16. No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-09-01

    Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.

  17. Nuclear pore component Nup98 is a potential tumor suppressor and regulates posttranscriptional expression of select p53 target genes.

    Science.gov (United States)

    Singer, Stephan; Zhao, Ruiying; Barsotti, Anthony M; Ouwehand, Anette; Fazollahi, Mina; Coutavas, Elias; Breuhahn, Kai; Neumann, Olaf; Longerich, Thomas; Pusterla, Tobias; Powers, Maureen A; Giles, Keith M; Leedman, Peter J; Hess, Jochen; Grunwald, David; Bussemaker, Harmen J; Singer, Robert H; Schirmacher, Peter; Prives, Carol

    2012-12-14

    The p53 tumor suppressor utilizes multiple mechanisms to selectively regulate its myriad target genes, which in turn mediate diverse cellular processes. Here, using conventional and single-molecule mRNA analyses, we demonstrate that the nucleoporin Nup98 is required for full expression of p21, a key effector of the p53 pathway, but not several other p53 target genes. Nup98 regulates p21 mRNA levels by a posttranscriptional mechanism in which a complex containing Nup98 and the p21 mRNA 3'UTR protects p21 mRNA from degradation by the exosome. An in silico approach revealed another p53 target (14-3-3σ) to be similarly regulated by Nup98. The expression of Nup98 is reduced in murine and human hepatocellular carcinomas (HCCs) and correlates with p21 expression in HCC patients. Our study elucidates a previously unrecognized function of wild-type Nup98 in regulating select p53 target genes that is distinct from the well-characterized oncogenic properties of Nup98 fusion proteins. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Polymorphisms rs12998 and rs5780218 in KiSS1 Suppressor Metastasis Gene in Mexican Patients with Breast Cancer

    Directory of Open Access Journals (Sweden)

    Edhit Guadalupe Cruz Quevedo

    2015-01-01

    Full Text Available Aims. KiSS1 is a metastasis suppressor gene associated with inhibition of cellular chemotaxis and invasion attenuating the metastasis in melanoma and breast cancer cell lines. Along the KiSS-1 gene at least 294 SNPs have been described; however the association of these polymorphisms as genetic markers for metastasis in breast cancer studies has not been investigated. Here we describe two simple PCR-RFLPs protocols to identify the rs5780218 (9DelT and the rs12998 (E20K KiSS1 polymorphisms and the allelic, genotypic, and haplotypic frequencies in Mexican general population (GP and patients with benign breast disease (BBD or breast cancer (BC. Results. The rs5780218 polymorphism was individually associated with breast cancer (P=0.0332 and the rs12998 polymorphism shows statistically significant differences when GP versus case (BC and BBD groups were compared (P<0.0001. The H1 Haplotype (G/- occurred more frequently in BC group (0.4256 whereas H2 haplotype (G/T was the most prevalent in BBD group (0.4674. Conclusions. Our data indicated that the rs5780218 polymorphism individually confers susceptibility for development of breast cancer in Mexican population and a possible role as a genetic marker in breast cancer metastasis for H1 haplotype (Wt/variant in KiSS1 gene must be analyzed in other populations.

  19. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...

  20. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  1. Evolution and origin of merlin, the product of the Neurofibromatosis type 2 (NF2 tumor-suppressor gene

    Directory of Open Access Journals (Sweden)

    Omelyanchuk Leonid V

    2005-12-01

    Full Text Available Abstract Background Merlin, the product of the Neurofibromatosis type 2 (NF2 tumor suppressor gene, belongs to the ezrin-radixin-moesin (ERM subgroup of the protein 4.1 superfamily, which links cell surface glycoproteins to the actin cytoskeleton. While merlin's functional activity has been examined in mammalian and Drosophila models, little is understood about its evolution, diversity, and overall distribution among different taxa. Results By combining bioinformatic and phylogenetic approaches, we demonstrate that merlin homologs are present across a wide range of metazoan lineages. While the phylogenetic tree shows a monophyletic origin of the ERM family, the origin of the merlin proteins is robustly separated from that of the ERM proteins. The derivation of merlin is thought to be in early metazoa. We have also observed the expansion of the ERM-like proteins within the vertebrate clade, which occurred after its separation from Urochordata (Ciona intestinalis. Amino acid sequence alignment reveals the absence of an actin-binding site in the C-terminal region of all merlin proteins from various species but the presence of a conserved internal binding site in the N-terminal domain of the merlin and ERM proteins. In addition, a more conserved pattern of amino acid residues is found in the region containing the so-called "Blue Box," although some amino acid substitutions in this region exist in the merlin sequences of worms, fish, and Ciona. Examination of sequence variability at functionally significant sites, including the serine-518 residue, the phosphorylation of which modulates merlin's intra-molecular association and function as a tumor suppressor, identifies several potentially important sites that are conserved among all merlin proteins but divergent in the ERM proteins. Secondary structure prediction reveals the presence of a conserved α-helical domain in the central to C-terminal region of the merlin proteins of various species. The

  2. Positive selection of deleterious alleles through interaction with a sex-ratio suppressor gene in African Buffalo: a plausible new mechanism for a high frequency anomaly.

    Science.gov (United States)

    van Hooft, Pim; Greyling, Ben J; Getz, Wayne M; van Helden, Paul D; Zwaan, Bas J; Bastos, Armanda D S

    2014-01-01

    Although generally rare, deleterious alleles can become common through genetic drift, hitchhiking or reductions in selective constraints. Here we present a possible new mechanism that explains the attainment of high frequencies of deleterious alleles in the African buffalo (Syncerus caffer) population of Kruger National Park, through positive selection of these alleles that is ultimately driven by a sex-ratio suppressor. We have previously shown that one in four Kruger buffalo has a Y-chromosome profile that, despite being associated with low body condition, appears to impart a relative reproductive advantage, and which is stably maintained through a sex-ratio suppressor. Apparently, this sex-ratio suppressor prevents fertility reduction that generally accompanies sex-ratio distortion. We hypothesize that this body-condition-associated reproductive advantage increases the fitness of alleles that negatively affect male body condition, causing genome-wide positive selection of these alleles. To investigate this we genotyped 459 buffalo using 17 autosomal microsatellites. By correlating heterozygosity with body condition (heterozygosity-fitness correlations), we found that most microsatellites were associated with one of two gene types: one with elevated frequencies of deleterious alleles that have a negative effect on body condition, irrespective of sex; the other with elevated frequencies of sexually antagonistic alleles that are negative for male body condition but positive for female body condition. Positive selection and a direct association with a Y-chromosomal sex-ratio suppressor are indicated, respectively, by allele clines and by relatively high numbers of homozygous deleterious alleles among sex-ratio suppressor carriers. This study, which employs novel statistical techniques to analyse heterozygosity-fitness correlations, is the first to demonstrate the abundance of sexually-antagonistic genes in a natural mammal population. It also has important

  3. Positive selection of deleterious alleles through interaction with a sex-ratio suppressor gene in African Buffalo: a plausible new mechanism for a high frequency anomaly.

    Directory of Open Access Journals (Sweden)

    Pim van Hooft

    Full Text Available Although generally rare, deleterious alleles can become common through genetic drift, hitchhiking or reductions in selective constraints. Here we present a possible new mechanism that explains the attainment of high frequencies of deleterious alleles in the African buffalo (Syncerus caffer population of Kruger National Park, through positive selection of these alleles that is ultimately driven by a sex-ratio suppressor. We have previously shown that one in four Kruger buffalo has a Y-chromosome profile that, despite being associated with low body condition, appears to impart a relative reproductive advantage, and which is stably maintained through a sex-ratio suppressor. Apparently, this sex-ratio suppressor prevents fertility reduction that generally accompanies sex-ratio distortion. We hypothesize that this body-condition-associated reproductive advantage increases the fitness of alleles that negatively affect male body condition, causing genome-wide positive selection of these alleles. To investigate this we genotyped 459 buffalo using 17 autosomal microsatellites. By correlating heterozygosity with body condition (heterozygosity-fitness correlations, we found that most microsatellites were associated with one of two gene types: one with elevated frequencies of deleterious alleles that have a negative effect on body condition, irrespective of sex; the other with elevated frequencies of sexually antagonistic alleles that are negative for male body condition but positive for female body condition. Positive selection and a direct association with a Y-chromosomal sex-ratio suppressor are indicated, respectively, by allele clines and by relatively high numbers of homozygous deleterious alleles among sex-ratio suppressor carriers. This study, which employs novel statistical techniques to analyse heterozygosity-fitness correlations, is the first to demonstrate the abundance of sexually-antagonistic genes in a natural mammal population. It also has

  4. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  5. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... synthase (crtB), phytoene desaturase (crtL) and lycopene cyclase. (crtY). It also retains a chloramphenicol resistance gene. Cells of E. coli containing this plasmid produce and accumulate β-carotene, resulting in yellow colonies. The plasmid, pTrc-ATIPI, retains an ampicillin resistance gene and an IPI gene ...

  6. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Peanut Ubiquitin gene (Luo et al. 2005) was used as the internal control. Expression data of the target gene was normalized with internal control using the 2. –ΔΔCT method (Livak and Schmittgen 2001). Lysophosphatidyl acyltransferase gene from Arachis hypogaea. 1031. J. Biosci. 37(6), December 2012 ...

  7. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  8. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

    Science.gov (United States)

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

    2013-02-01

    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (pgoat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  9. In silicio search for genes encoding peroxisomal proteins in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kal, A J; Hettema, E H; van den Berg, M; Koerkamp, M G; van Ijlst, L; Distel, B; Tabak, H F

    2000-01-01

    The biogenesis of peroxisomes involves the synthesis of new proteins that after, completion of translation, are targeted to the organelle by virtue of peroxisomal targeting signals (PTS). Two types of PTSs have been well characterized for import of matrix proteins (PTS1 and PTS2). Induction of the genes encoding these matrix proteins takes place in oleate-containing medium and is mediated via an oleate response element (ORE) present in the region preceding these genes. The authors have searched the yeast genome for OREs preceding open reading frames (ORFs), and for ORFs that contain either a PTS1 or PTS2. Of the ORFs containing an ORE, as well as either a PTS1 or a PTS2, many were known to encode bona fide peroxisomal matrix proteins. In addition, candidate genes were identified as encoding putative new peroxisomal proteins. For one case, subcellular location studies validated the in silicio prediction. This gene encodes a new peroxisomal thioesterase.

  10. Effect of salt stress on genes encoding translation-associated proteins in Arabidopsis thaliana.

    Science.gov (United States)

    Omidbakhshfard, Mohammad Amin; Omranian, Nooshin; Ahmadi, Farajollah Shahriari; Nikoloski, Zoran; Mueller-Roeber, Bernd

    2012-09-01

    Salinity negatively affects plant growth and disturbs chloroplast integrity. Here, we aimed at identifying salt-responsive translation-related genes in Arabidopsis thaliana with an emphasis on those encoding plastid-located proteins. We used quantitative real-time PCR to test the expression of 170 genes after short-term salt stress (up to 24 h) and identified several genes affected by the stress including: PRPL11, encoding plastid ribosomal protein L11, ATAB2, encoding a chloroplast-located RNA-binding protein presumably functioning as an activator of translation, and PDF1B, encoding a peptide deformylase involved in N-formyl group removal from nascent proteins synthesized in chloroplasts. These genes were previously shown to have important functions in chloroplast biology and may therefore represent new targets for biotechnological optimization of salinity tolerance.

  11. Identification of genes highly downregulated in pancreatic cancer through a meta-analysis of microarray datasets: implications for discovery of novel tumor-suppressor genes and therapeutic targets.

    Science.gov (United States)

    Goonesekere, Nalin C W; Andersen, Wyatt; Smith, Alex; Wang, Xiaosheng

    2018-02-01

    The lack of specific symptoms at early tumor stages, together with a high biological aggressiveness of the tumor contribute to the high mortality rate for pancreatic cancer (PC), which has a 5-year survival rate of about 7%. Recent failures of targeted therapies inhibiting kinase activity in clinical trials have highlighted the need for new approaches towards combating this deadly disease. In this study, we have identified genes that are significantly downregulated in PC, through a meta-analysis of large number of microarray datasets. We have used qRT-PCR to confirm the downregulation of selected genes in a panel of PC cell lines. This study has yielded several novel candidate tumor-suppressor genes (TSGs) including GNMT, CEL, PLA2G1B and SERPINI2. We highlight the role of GNMT, a methyl transferase associated with the methylation potential of the cell, and CEL, a lipase, as potential therapeutic targets. We have uncovered genetic links to risk factors associated with PC such as smoking and obesity. Genes important for patient survival and prognosis are also discussed, and we confirm the dysregulation of metabolic pathways previously observed in PC. While many of the genes downregulated in our dataset are associated with protein products normally produced by the pancreas for excretion, we have uncovered some genes whose downregulation appear to play a more causal role in PC. These genes will assist in providing a better understanding of the disease etiology of PC, and in the search for new therapeutic targets and biomarkers.

  12. The essential Escherichia coli msgB gene, a multicopy suppressor of a temperature-sensitive allele of the heat shock gene grpE, is identical to dapE.

    Science.gov (United States)

    Wu, B; Georgopoulos, C; Ang, D

    1992-08-01

    The grpE gene product is one of three Escherichia coli heat shock proteins (DnaK, DnaJ, and GrpE) that are essential for both bacteriophage lambda DNA replication and bacterial growth at all temperatures. In an effort to determine the role of GrpE and to identify other factors that it may interact with, we isolated multicopy suppressors of the grpE280 point mutation, as judged by their ability to reverse the temperature-sensitive phenotype of grpE280. Here we report the characterization of one of them, designated msgB. The msgB gene maps at approximately 53 min on the E. coli chromosome. The minimal gene possesses an open reading frame that encodes a protein with a predicted size of 41,269 M(r). This open reading frame was confirmed the correct one by direct amino-terminal sequence analysis of the overproduced msgB gene product. Genetic experiments demonstrated that msgB is essential for E. coli growth in the temperature range of 22 to 37 degrees C. Through a sequence homology search, MsgB was shown to be identical to N-succinyl-L-diaminopimelic acid desuccinylase (the dapE gene product), which participates in the diaminopimelic acid-lysine pathway involved in cell wall biosynthesis. Consistent with this finding, the msgB null allele mutant is viable only when the growth medium is supplemented with diaminopimelic acid. These results suggest that GrpE may have a previously unsuspected function(s) in cell wall biosynthesis in E. coli.

  13. Hypoxia Inducible Factor-independent functions for the von Hippel-Lindau tumor suppressor gene

    NARCIS (Netherlands)

    Lolkema, Martijn Paul Jung Kyu

    2006-01-01

    Inactivating mutations of the von Hippel-Lindau gene (VHL) on chromosome 3p have been associated with the autosomal dominant VHL disease, characterized by extensively vascularized tumors and cysts in different organs, as well as the majority of conventional kidney cancers. The VHL gene product

  14. Distinct Patterns of Gene Gain and Loss: Diverse Evolutionary Modes of NBS-Encoding Genes in Three Solanaceae Crop Species.

    Science.gov (United States)

    Qian, Lan-Hua; Zhou, Guang-Can; Sun, Xiao-Qin; Lei, Zhao; Zhang, Yan-Mei; Xue, Jia-Yu; Hang, Yue-Yu

    2017-05-05

    Plant resistance conferred by nucleotide binding site (NBS)-encoding resistance genes plays a key role in the defense against various pathogens throughout the entire plant life cycle. However, comparative analyses for the systematic evaluation and determination of the evolutionary modes of NBS-encoding genes among Solanaceae species are rare. In this study, 447, 255, and 306 NBS-encoding genes were identified from the genomes of potato, tomato, and pepper, respectively. These genes usually clustered as tandem arrays on chromosomes; few existed as singletons. Phylogenetic analysis indicated that three subclasses [TNLs (TIR-NBS-LRR), CNLs (CC-NBS-LRR), and RNLs (RPW8-NBS-LRR)] each formed a monophyletic clade and were distinguished by unique exon/intron structures and amino acid motif sequences. By comparing phylogenetic and systematic relationships, we inferred that the NBS-encoding genes in the present genomes of potato, tomato, and pepper were derived from 150 CNL, 22 TNL, and 4 RNL ancestral genes, and underwent independent gene loss and duplication events after speciation. The NBS-encoding genes therefore exhibit diverse and dynamic evolutionary patterns in the three Solanaceae species, giving rise to the discrepant gene numbers observed today. Potato shows a "consistent expansion" pattern, tomato exhibits a pattern of "first expansion and then contraction," and pepper presents a "shrinking" pattern. The earlier expansion of CNLs in the common ancestor led to the dominance of this subclass in gene numbers. However, RNLs remained at low copy numbers due to their specific functions. Along the evolutionary process of NBS-encoding genes in Solanaceae, species-specific tandem duplications contributed the most to gene expansions. Copyright © 2017 Qian et al.

  15. Identification of toxin genes encoding Cyt proteins from standard ...

    African Journals Online (AJOL)

    Polymerase chain reaction-restriction fragment length polymorphism methods for identification of cyt subclasses from Bacillus thuringiensis were established. Eight of 68 standard and ten of 107 Argentine B. thuringiensis strains harbor at least one cyt gene. The combination of cyt1Aa/cyt2Ba genes was identified in four ...

  16. Ontogeny of clock and KiSS-1 metastasis-suppressor (Kiss1) gene expression in the prepubertal mouse hypothalamus.

    Science.gov (United States)

    Yap, Cassandra C; Mark, Peter J; Waddell, Brendan J; Smith, Jeremy T

    2017-09-01

    Kisspeptin is crucial for the generation of the circadian-gated preovulatory gonadotrophin-releasing hormone (GnRH)-LH surge in female rodents, with expression in the anteroventral periventricular nucleus (AVPV) peaking in the late afternoon of pro-oestrus. Given kisspeptin expression is established before puberty, the aim of the present study was to investigate kisspeptin and clock gene rhythms during the neonatal period. Anterior and posterior hypothalami were collected from C57BL/6J mice on Postnatal Days (P) 5, 15 and 25, at six time points across 24h, for analysis of gene expression by reverse transcription-quantitative polymerase chain reaction. Expression of aryl hydrocarbon receptor nuclear translocator-like gene (Bmal1) and nuclear receptor subfamily 1, group D, member 2 (Rev-erbα) in the anterior hypothalamus (containing the suprachiasmatic nucleus) was not rhythmic at P5 or P15, but Bmal1 expression exhibited rhythmicity in P25 females, whereas Rev-erbα expression was rhythmic in P25 males. KiSS-1 metastasis-suppressor (Kiss1) expression did not exhibit time-of-day variation in the anterior (containing the AVPV) or posterior (containing the arcuate nucleus) hypothalami in female and male mice at P5, P15 or P25. The data indicate that the kisspeptin circadian peak in expression observed in the AVPV of pro-oestrous females does not manifest at P5, P15 or P25, likely due to inadequate oestrogenic stimuli, as well as incomplete development of clock gene rhythmicity before puberty.

  17. Tumor suppressor genes that escape from X-inactivation contribute to cancer sex bias

    OpenAIRE

    Dunford, Andrew; Weinstock, David M.; Savova, Virginia; Schumacher, Steven E.; Cleary, John P.; Yoda, Akinori; Sullivan, Timothy J.; Hess, Julian M.; Gimelbrant, Alexander A.; Beroukhim, Rameen; Lawrence, Michael S.; Getz, Gad; Lane, Andrew A.

    2016-01-01

    There is a striking and unexplained male predominance across many cancer types. A subset of X chromosome (chrX) genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative “Escape from X-Inactivation Tumor Suppressor” (EXITS) genes, we compared somatic alterations from >4100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) chrX genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) ...

  18. Analysis of loss of heterozygosity of the tumor suppressor genes p53 and BRCA1 in ovarial carcinomas

    Directory of Open Access Journals (Sweden)

    Luković Ljiljana

    2006-01-01

    Full Text Available Background/aim: Among the genes involved in ovarian carcinogenesis, there has been increased interest in tumor-suppressor genes p53 and BRCA1. Both of the genes make control of cell cycle, DNA repair and apoptosis. The p53 is a "genome guardian" inactivated in more than 50% of human cancers, while BRCA1 mutations are found mostly in breast and ovarian cancer. The aim of this investigation was to establish the frequency of loss of heterozygosity (LOH in the regions of the genes p53 and BRCA1 in ovarian carcinomas, and to analyze the association of LOH with the disease stage and prognosis. Methods. We analyzed 20 patients with a confirmed diagnosis of epithelilal ovarian carcinoma. DNA for molecular-genetic analysis was extracted from the tumor tissue and blood as normal tissue of each person. Microsatellite markers of the regions of genes p53 and BRCA1 were amplified by PCR method. The determination of allelic status of microsatellites and detection of LOH was performed after PAA gel electroforesis. Results. Both of the analyzed microsatellite markers were informative in 13/20 (65% cases. In the region of gene p53, LOH was established in 4/13 (30.7% tumors. One of them had histological gradus G1, one had gradus G2, and two of them had gradus G3, while all were with the International Federation of Gynecology and Obstetrics (FIGO IIIc stage. In the region of gene BRCA1, LOH was detected in 5/13 (38.5% tumors. Four of them had histological gradus G2, and one had gradus G3, while by the (FIGO classification one was with stage Ib, one was with stage IIIb, while the three were with stage IIIc. LOH in both of the analyzed regions was detected in one tumor (7.7%, with histological gradus G3 and the FIGO IIIc stage. Conclusion. The frequency of LOH in epthelial ovarian carcinomas was 30.7% and 38.5% for p53 and BRCA1 gene regions, respectively. Most of tumors with LOH had histological gradus G2 or G3, and the clinical FIGO stage IIIc, suggesting the

  19. [Analysis of loss of heterozygosity of the tumor suppressor genes p53 and BRCA1 in ovarial carcinomas].

    Science.gov (United States)

    Petrović, Bojana; Perović, Milica; Novaković, Ivana; Atanacković, Jasmina; Popović, Branka; Luković, Ljiljana; Petković, Spasoje

    2006-09-01

    Among the genes involved in ovarian carcinogenesis, there has been increased interest in tumor-suppressor genes p53 and BRCA1. Both of the genes make control of cell cycle, DNA repair and apoptosis. The p53 is a "genome guardian" inactivated in more than 50% of human cancers, while BRCA1 mutations are found mostly in breast and ovarian cancer. The aim of this investigation was to establish the frequency of loss of heterozygosity (LOH) in the regions of the genes p53 and BRCA1 in ovarian carcinomas, and to analyze the association of LOH with the disease stage and prognosis. We analyzed 20 patients with a confirmed diagnosis of epithelilal ovarian carcinoma. DNA for molecular-genetic analysis was extracted from the tumor tissue and blood as normal tissue of each person. Microsatellite markers of the regions of genes p53 and BRCA1 were amplified by PCR method. The determination of allelic status of microsatellites and detection of LOH was performed after PAA gel electroforesis. Both of the analyzed microsatellite markers were informative in 13/20 (65%) cases. In the region of gene p53, LOH was established in 4/13 (30.7%) tumors. One of them had histological gradus G1, one had gradus G2, and two of them had gradus G3, while all were with the International Federation of Gynecology and Obstetrics (FIGO) IIIc stage. In the region of gene BRCA1, LOH was detected in 5/13 (38.5%) tumors. Four of them had histological gradus G2, and one had gradus G3, while by the (FIGO) classification one was with stage Ib, one was with stage IIIb, while the three were with stage IlIc. LOH in both of the analyzed regions was detected in one tumor (7.70), with histological gradus G3 and the FIGO IIIc stage. The frequency of LOH in epthelial ovarian carcinomas was 30.7% and 38.5% for p53 and BRCA1 gene regions, respectively. Most of tumors with LOH had histological gradus G2 or G3, and the clinical FIGO stage IIIc, suggesting the association of this occurrence with a later phase of the disease.

  20. Occurrence of enterotoxin-encoding genes in Staphylococcus aureus causing mastitis in lactating goats

    Directory of Open Access Journals (Sweden)

    Daneelly H. Ferreira

    2014-07-01

    Full Text Available Staphylococcal enterotoxins are the leading cause of human food poisoning worldwide. Staphylococcus spp. are the main mastitis-causing agents in goats and frequently found in high counts in goat milk. This study aimed to investigate the occurrence of enterotoxin-encoding genes in Staphylococcus aureus associated with mastitis in lactating goats in Paraiba State, Brazil. Milk samples (n=2024 were collected from 393 farms. Staphylococcus aureus was isolated in 55 milk samples. Classical (sea, seb, sec, sed, see and novel (seg, seh, sei enterotoxin-encoding genes were investigated by means of polymerase chain reaction (PCR. From thirty-six tested isolates, enterotoxin-encoding genes were detected in 7 (19.5% S. aureus. The gene encoding enterotoxin C (seC was identified in six isolates, while seiwas observed in only one isolate. The genes sea, seb, sed, see, seg and seh were not observed amongst the S. aureus investigated in this study. In summary, S. aureus causing mastitis in goats can harbor enterotoxin-encoding genes and seC was the most frequent gene observed amongst the investigated isolates. This finding is important for surveillance purposes, since enterotoxin C should be investigated in human staphylococcal food poisoning outbreaks caused by consumption of goat milk and dairy products.

  1. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    Science.gov (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  2. Asthma and genes encoding components of the vitamin D pathway

    Directory of Open Access Journals (Sweden)

    Raby Benjamin A

    2009-10-01

    Full Text Available Abstract Background Genetic variants at the vitamin D receptor (VDR locus are associated with asthma and atopy. We hypothesized that polymorphisms in other genes of the vitamin D pathway are associated with asthma or atopy. Methods Eleven candidate genes were chosen for this study, five of which code for proteins in the vitamin D metabolism pathway (CYP27A1, CYP27B1, CYP2R1, CYP24A1, GC and six that are known to be transcriptionally regulated by vitamin D (IL10, IL1RL1, CD28, CD86, IL8, SKIIP. For each gene, we selected a maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. A total of 87 SNPs were genotyped in a French-Canadian family sample ascertained through asthmatic probands (388 nuclear families, 1064 individuals and evaluated using the Family Based Association Test (FBAT program. We then sought to replicate the positive findings in four independent samples: two from Western Canada, one from Australia and one from the USA (CAMP. Results A number of SNPs in the IL10, CYP24A1, CYP2R1, IL1RL1 and CD86 genes were modestly associated with asthma and atopy (p IL10 and VDR genes as well as in the IL10 and IL1RL1 genes were associated with asthma (p IL10 and CYP24A1 genes were again modestly associated with asthma and atopy (p IL10 and VDR was replicated in CAMP, but not in the other populations. Conclusion A number of genes involved in the vitamin D pathway demonstrate modest levels of association with asthma and atopy. Multilocus models testing genes in the same pathway are potentially more effective to evaluate the risk of asthma, but the effects are not uniform across populations.

  3. Protocadherin-10 acts as a tumor suppressor gene, and is frequently downregulated by promoter methylation in pancreatic cancer cells.

    Science.gov (United States)

    Qiu, Chan; Bu, Xiaona; Jiang, Zheng

    2016-07-01

    Protocadherin-10 (PCDH10), a member of non-clustered protocadherin family which plays important roles in calcium-dependent cell-cell signal transduction and adhesion. PCDH10 functions as a tumor suppressor gene and its expression is downregulated by promoter methylation in many malignances. In the present study, we explored PCDH10 expression and promoter methylation status, and its biological effects in pancreatic cancer cells, and furthermore, we explored the mechanism of PCDH10 preliminary in pancreatic cancer cells. the mRNA level of PCDH10 was detected by semi-quantitative reverse transcription PCR and promoter methylation status examined by methylation-specific PCR in the pancreatic cancer cells (Capan-1, Panc-1, AsPC-1 and BxPC-3) as well as the human normal pancreatic ductal epithelial cells HPDE6-C7 which was used as a control. The human pancreatic cells were transfected with plasmid pcDNA3.1-PCDH10 or pcDNA3.1 by lipofectamine 2000. The biological function of PCDH10 in pancreatic cancer cells was determined by CCK-8 assay, colony formation assay, flow cytometry, Transwell invasion assay and wound-healing assay. The levels of apoptosis related proteins were examined by western blotting. PCDH10 expression was obviously downregulated in the pancreatic cancer cells (Capan-1, Panc-1, BxPC-3) compared to the normal pancreatic ductal epithelial cells. PCDH10 promoter methylation was observed in the two pancreatic cancer cells Capan-1 and BxPC-3,and the expression of PCDH10 could be restored after treating with 5-aza-2'-deoxycytidine and trichostatin A in the two cell types. Overexpression of PCDH10 can inhibit the proliferation, migration, invasion ability of pancreatic cancer cells and induce apoptosis. Ectopic expression of PCDH10 could increase the levels of PARP, caspase-3, caspase-9 and decrease the level of bcl-2, AKT and p-AKT. PCDH10 acts as a tumor suppressor gene, and is frequently down-regulated by promoter methylation in pancreatic cancer cells. PCDH

  4. Molecular evolution of genes encoding ribonucleases in ruminant species.

    Science.gov (United States)

    Confalone, E; Beintema, J J; Sasso, M P; Carsana, A; Palmieri, M; Vento, M T; Furia, A

    1995-12-01

    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that demonstrate the existence of the orthologues of the bovine pancreatic, seminal, and cerebral ribonucleases coding sequences in the genomes of giraffe and sheep. The "seminal" sequence is a pseudogene in both species. We also report an analysis of the transcriptional expression of ribonuclease genes in sheep tissues. The data presented support a model for positive selection acting on the molecular evolution of ruminant ribonuclease genes.

  5. Tumor suppressor genes that escape from X-inactivation contribute to cancer sex bias

    Science.gov (United States)

    Dunford, Andrew; Weinstock, David M.; Savova, Virginia; Schumacher, Steven E.; Cleary, John P.; Yoda, Akinori; Sullivan, Timothy J.; Hess, Julian M.; Gimelbrant, Alexander A.; Beroukhim, Rameen; Lawrence, Michael S.; Getz, Gad; Lane, Andrew A.

    2016-01-01

    There is a striking and unexplained male predominance across many cancer types. A subset of X chromosome (chrX) genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative “Escape from X-Inactivation Tumor Suppressor” (EXITS) genes, we compared somatic alterations from >4100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) chrX genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) more frequently harbored loss-of-function mutations in males (based on false discovery rate <0.1), compared to zero of 18,055 autosomal and PAR genes (P<0.0001). Male-biased mutations in genes that escape X-inactivation were observed in combined analysis across many cancers and in several individual tumor types, suggesting a generalized phenomenon. We conclude that biallelic expression of EXITS genes in females explains a portion of the reduced cancer incidence compared to males across a variety of tumor types. PMID:27869828

  6. Characterization of a gene encoding cellulase from uncultured soil bacteria.

    Science.gov (United States)

    Kim, Soo-Jin; Lee, Chang-Muk; Han, Bo-Ram; Kim, Min-Young; Yeo, Yun-Soo; Yoon, Sang-Hong; Koo, Bon-Sung; Jun, Hong-Ki

    2008-05-01

    To detect cellulases encoded by uncultured microorganisms, we constructed metagenomic libraries from Korean soil DNAs. Screenings of the libraries revealed a clone pCM2 that uses carboxymethyl cellulose (CMC) as a sole carbon source. Further analysis of the insert showed two consecutive ORFs (celM2 and xynM2) encoding proteins of 226 and 662 amino acids, respectively. A multiple sequence analysis with the deduced amino acid sequences of celM2 showed 36% sequence identity with cellulase from the Synechococcus sp., while xynM2 had 59% identity to endo-1,4-beta-xylanase A from Cellulomonas pachnodae. The highest enzymatic CMC hydrolysis was observable at pH 4.0 and 45 degrees C with recombinant CelM2 protein. Although the enzyme CelM2 additionally hydrolyzed avicel and xylan, no substrate hydrolysis was observed on oligosaccharides such as cellobiose, pNP-beta-cellobioside, pNP-beta-glucoside, and pNP-beta-xyloside. These results showed that CelM2 is a novel endo-type cellulase.

  7. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    families. The recombinant BtabCSP was successfully expressed in Escherichia coli cells. This is the first report on the existence of chemosensory protein-coding gene in whiteflies. It will help us to elucidate the molecular.

  8. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    Unknown

    digested with SmaI and SspI and self-ligated to generate. pSAC86 which eliminated the SacI site present in the. Multiple Cloning Site (MCS). Plasmid pBH86 contains a modified version of the erg-3 gene in which the intronic. HindIII site was destroyed (Prakash et al 1999). pMOD86 contains the erg-3 gene of Neurospora in ...

  9. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    Energy Technology Data Exchange (ETDEWEB)

    Parke, D.; Ornston, L.N.

    1993-03-01

    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.

  10. Hypermethylation of the 16q23.1 Tumor Suppressor Gene ADAMTS18 in Clear Cell Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Ben Xu

    2015-01-01

    Full Text Available To identify tumor suppressor genes (TSGs silenced by hypermethylation and discover new epigenetic biomarkers for early cancer detection. ADAMTS18, located at 16q23.1, has been reported to be a critical TSG in multiple primary tumors; however, this has not yet been verified in clear cell renal cell carcinoma (ccRCC. We explored epigenetic alterations in this gene in ccRCC and analyzed possible clinicopathological associations. We examined ADAMTS18 gene expression and methylation by semi-quantitative reverse transcription PCR (RT-PCR and methylation-specific polymerase chain reaction (MSP in 5 ccRCC-derived cell lines before and after treatment with 5-aza-2'-deoxycytidine (5-AzaC. MSP was further performed for 101 ccRCC primary tumors and 20 adjacent normal tissues. Some cell lines and specimens were examined by subsequent bisulfite genomic sequencing (BGS and real-time PCR. Further, we analyzed the relationship between the ADAMTS18 gene methylation and clinicopathological features, including short-term disease-free survival (DFS, in patients with ccRCC. ADAMTS18 down-regulation and hypermethylation were detected in the ccRCC-derived cell lines using RT-PCR and MSP. Treatment with 5-AzaC reversed the hypermethylation of the ADAMTS18 gene and restored its expression. Hypermethylation was further detected in 44 of 101 (43.6% primary tumors and 3 of 20 (15.0% adjacent normal tissues. However, a significant difference between both groups was observed (p = 0.02. BGS analysis and real-time PCR were subsequently performed to confirm the results of RT-PCR and MSP. Furthermore, the methylation status of ADAMTS18 was not significantly associated with gender, age, location, tumor diameter, pathological stage, nuclear grade or short-term DFS in patients with ccRCC (p > 0.05. The ADAMTS18 gene is often down-regulated by hypermethylation in ccRCC-derived cell lines and primary tumors, indicating its critical role as a TSG in ccRCC. We conclude that ADAMTS18

  11. Aberrations of the p53 tumor suppressor gene in human epithelial ovarian carcinoma.

    Science.gov (United States)

    Kim, J W; Cho, Y H; Kwon, D J; Kim, T E; Park, T C; Lee, J M; Namkoong, S E

    1995-05-01

    Aberrations of the p53 gene in 26 surgical specimens of human epithelial ovarian carcinomas were examined by single-strand conformation polymorphism (SSCP) analysis of polymerase chain reaction (PCR) products. Seven (27%) of the tumors demonstrated a SSCP band shift in exons 4 to 9 of the gene, including 5 in the region encompassing exons 5 and 6, 1 in exon 7, and 1 in the region encompassing exons 8 and 9. Mutations were clustered in exon 5 in highly conserved regions of the p53 gene. All of the abnormal DNA fragments have been further characterized by direct DNA sequencing. These include five missense mutations (five transitions), a one-base-pair deletion introducing, by frameshift, a stop codon further downstream, and a two-base-pair insertion introducing a stop codon downstream by frameshift. Most mutations were base substitutions, and were clustered in exon 5 (71%), especially codons 175 and 179. The aberrations of the p53 gene were only found in tumors of FIGO stages III and IV. Histologic grading was also reviewed with respect to p53 aberrations. The aberrations were absent in well-differentiated carcinomas. The more undifferentiated the primary tumor, the more frequent p53 mutation (P p53 gene were common in epithelial ovarian cancers and p53 aberration may occur late during ovarian cancer evolution.

  12. PI3K/Akt/mTOR signaling & its regulator tumour suppressor genes PTEN & LKB1 in human uterine leiomyomas.

    Science.gov (United States)

    Makker, Annu; Goel, Madhu Mati; Mahdi, Abbas Ali; Bhatia, Vikram; Das, Vinita; Agarwal, Anjoo; Pandey, Amita

    2016-05-01

    Despite their high occurrence and associated significant level of morbidity manifesting as spectrum of clinical symptoms, the pathogenesis of uterine leiomyomas (ULs) remains unclear. We investigated expression profile of tumour suppressor genes PTEN (phosphatase and tensin homolog deleted on chromosome ten) and LKB1 (liver kinase B1), and key signaling components of P13K (phosphatidylinositol 3-kinase)/Akt (protein kinase B)/mTOR (mammalian target of rapamycin) pathway in leiomyomas and adjacent normal myometrium in women of reproductive age, to explore the possibility of targeting this pathway for future therapeutic implications. Real time PCR (qPCR) was used to quantify relative gene expression levels of PTEN, Akt1, Akt2, mTOR, LKB1 and VEGFA (vascular endothelial growth factor A) in leiomyoma as compared to adjacent normal myometrium. Immunohistochemistry was subsequently performed to analyze expression of PTEN, phospho-Akt, phospho-mTOR, phospho-S6, LKB1 and VEGFA in leiomyoma and adjacent normal myometrium. Significant upregulation of PTEN (2.52 fold; P=0.03) and LKB1 (3.93 fold; P0.01), and downregulation of VEGFA (2.95 fold; P=0.01) genes were observed in leiomyoma as compared to normal myometrium. Transcript levels of Akt1, Akt2 and mTOR did not vary significantly between leiomyoma and myometrium. An increased immunoexpression of PTEN (P=0.015) and LKB1 (PPTEN and LKB1 in concert with negative or low levels of activated Akt, mTOR and S6 indicates that PI3K/Akt/mTOR pathway may not play a significant role in pathogenesis of leiomyoma.

  13. ISOLATION AND CHARACTERIZATION OF THE RAT GENE ENCODING GLUTAMATE-DEHYDROGENASE

    NARCIS (Netherlands)

    DAS, AT; ARNBERG, AC; MALINGRE, H; MOERER, P; CHARLES, R; MOORMAN, AFM; LAMERS, WH

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  14. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  15. Isolation and characterization of the rat glutamine synthetase-encoding gene

    NARCIS (Netherlands)

    van de Zande, L.; Labruyère, W. T.; Arnberg, A. C.; Wilson, R. H.; van den Bogaert, A. J.; Das, A. T.; van Oorschot, D. A.; Frijters, C.; Charles, R.; Moorman, A. F.

    1990-01-01

    From a rat genomic library in phage lambda Charon4A, a complete glutamine synthetase-encoding gene was isolated. The gene is 9.5-10 kb long, consists of seven exons, and codes for two mRNA species of 1375 nucleotides (nt) and 2787 nt, respectively. For both mRNAs, full-length cDNAs containing a

  16. Molecular cloning, phylogenetic analysis, and expression patterns of LATERAL SUPPRESSOR-LIKE and REGULATOR OF AXILLARY MERISTEM FORMATION-LIKE genes in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Fambrini, Marco; Salvini, Mariangela; Pugliesi, Claudio

    2017-03-01

    The wild sunflower (Helianthus annuus) plants develop a highly branched form with numerous small flowering heads. The origin of a no branched sunflower, producing a single large head, has been a key event in the domestication process of this species. The interaction between hormonal factors and several genes organizes the initiation and outgrowth of axillary meristems (AMs). From sunflower, we have isolated two genes putatively involved in this process, LATERAL SUPPRESSOR (LS)-LIKE (Ha-LSL) and REGULATOR OF AXILLARY MERISTEM FORMATION (ROX)-LIKE (Ha-ROXL), encoding for a GRAS and a bHLH transcription factor (TF), respectively. Typical amino acid residues and phylogenetic analyses suggest that Ha-LSL and Ha-ROXL are the orthologs of the branching regulator LS and ROX/LAX1, involved in the growth habit of both dicot and monocot species. qRT-PCR analyses revealed a high accumulation of Ha-LSL transcripts in roots, vegetative shoots, and inflorescence shoots. By contrast, in internodal stems and young leaves, a lower amount of Ha-LSL transcripts was observed. A comparison of transcription patterns between Ha-LSL and Ha-ROXL revealed some analogies but also remarkable differences; in fact, the gene Ha-ROXL displayed a low expression level in all organs analyzed. In situ hybridization (ISH) analysis showed that Ha-ROXL transcription was strongly restricted to a small domain within the boundary zone separating the shoot apical meristem (SAM) and the leaf primordia and in restricted regions of the inflorescence meristem, beforehand the separation of floral bracts from disc flower primordia. These results suggested that Ha-ROXL may be involved to establish a cell niche for the initiation of AMs as well as flower primordia. The accumulation of Ha-LSL transcripts was not restricted to the boundary zones in vegetative and inflorescence shoots, but the mRNA activity was expanded in other cellular domains of primary shoot apical meristem as well as AMs. In addition, Ha

  17. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...... analysis established the subunit Mr as 43,500. Primer extension analysis indicated the presence of an adequate Pribnow box and suggested that the transcript contained a 110-base leader sequence. Strains harboring the gsk gene on multicopy plasmids overexpressed both guanosine and inosine kinase activities...

  18. Transcriptional regulation of teleost aicda genes. Pt 1 suppressors of promiscuous promoters

    Science.gov (United States)

    In order to better understand antibody affinity maturation in fishes we sought to identify gene regulatory elements that could drive expression of activated B-cell specific fluorescent reporter transgenes in zebrafish. Specifically the promoter and several non-coding regions of the channel catfish (...

  19. Identification of Prostate Cancer Metastasis-Suppressor Genes Using Genomic shRNA Libraries

    National Research Council Canada - National Science Library

    Gelman, Irwin H

    2008-01-01

    .... However, little is known regarding the genetics that control disease recurrence. Our proposed research was to screen for metastasis- inducing genes in LNCaP and LAPC-4 CaP cells using libraries expressing RNAi covering the entire human genome...

  20. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... is provided by a competitively coamplified DNA standard constructed by point mutation PCR. A single base difference was introduced to achieve a suitable migration difference in TGGE between the original target DNA and the modified standard without altering the PCR amplification efficiency. This competitive...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  1. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  2. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  3. miR-203 Acts as a Tumor Suppressor Gene in Osteosarcoma by Regulating RAB22A.

    Directory of Open Access Journals (Sweden)

    Dawei Yang

    Full Text Available microRNAs (miRNAs, small noncoding RNAs of 19-25 nt, play an important roles in the pathological processes of tumorigenesis. The object of this study was to study the expression and function of miR-203 and to found its target gene in osteosarcoma. In our study, we found the expression level of miR-203 was significantly downregulated in osteosarcoma cell lines and tissues. In addition, overexpression of miR-203 inhibited the osteosarcoma cell proliferation and migration and inhibited Mesenchymal-to-Epithelial reversion Transition (MErT. Moreover, we identified RAB22A as a direct target of miR-203 and RAB22A overexpression blocks the roles of miR-203 in osteosarcoma cell. Furthermore, we demonstrated that RAB22A expression was upregulated in human osteosarcoma cell lines and tissues. Take together, our results demonstrated that miR-203 act as a tumor suppressor miRNA through regulating RAB22A expression and suggested its involvement in osteosarcoma progression and carcinogenesis.

  4. The induction of a tumor suppressor gene (p53) expression by low-dose radiation and its biological meaning

    International Nuclear Information System (INIS)

    Ohnishi, Takeo

    1997-01-01

    I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)

  5. Molecular evolution of genes encoding ribonucleases in ruminant species

    NARCIS (Netherlands)

    Confalone, E; Beintema, JJ; Sasso, MP; Carsana, A; Palmieri, M; Vento, MT; Furia, A

    1995-01-01

    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that

  6. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous impact on crop productivity. To survive under unfavourable conditions, plants have developed a variety of sophisticated strategies (Bray 1997; Thomashow. 1999). One of the fundamental properties of adaptive mechanisms is that a gene must be ...

  7. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  8. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    Jane

    2011-04-06

    Apr 6, 2011 ... This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from. Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for.

  9. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  10. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    detoxification enzymes (glutathione S-transferase, soluble epoxide hydrolase, catalase and superoxide dismutase). The second group contains protein factors involved in the regulation of signal transduction and gene expression, which probably function in stress responses such as protein kinases, transcription factors and ...

  11. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    Escherichia coli was isolated and identified by standard cultural and biochemical methods. Pathogenicity of environmental and human isolates was determined by amplification of genes associated with virulence of E. coli, using specific primers. Of a total of 228 water and river sediment samples screened, E. coli was ...

  12. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  13. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  14. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  15. Alternative polyadenylation of tumor suppressor genes in small intestinal neuroendocrine tumors

    DEFF Research Database (Denmark)

    Rehfeld, Anders Aagaard; Plass, Mireya; Døssing, Kristina

    2014-01-01

    The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site...... and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3' untranslated regions. Additionally, APA can also produce mRNAs containing different 3'-terminal coding regions. Therefore, APA alters both the repertoire...... and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3' truncation of mRNA coding regions...

  16. Prediction of functionally significant single nucleotide polymorphisms in PTEN tumor suppressor gene: An in silico approach.

    Science.gov (United States)

    Khan, Imran; Ansari, Irfan A; Singh, Pratichi; Dass J, Febin Prabhu

    2017-09-01

    The phosphatase and tensin homolog (PTEN) gene plays a crucial role in signal transduction by negatively regulating the PI3K signaling pathway. It is the most frequent mutated gene in many human-related cancers. Considering its critical role, a functional analysis of missense mutations of PTEN gene was undertaken in this study. Thirty five nonsynonymous single nucleotide polymorphisms (nsSNPs) within the coding region of the PTEN gene were selected for our in silico investigation, and five nsSNPs (G129E, C124R, D252G, H61D, and R130G) were found to be deleterious based on combinatorial predictions of different computational tools. Moreover, molecular dynamics (MD) simulation was performed to investigate the conformational variation between native and all the five mutant PTEN proteins having predicted deleterious nsSNPs. The results of MD simulation of all mutant models illustrated variation in structural attributes such as root-mean-square deviation, root-mean-square fluctuation, radius of gyration, and total energy; which depicts the structural stability of PTEN protein. Furthermore, mutant PTEN protein structures also showed a significant variation in the solvent accessible surface area and hydrogen bond frequencies from the native PTEN structure. In conclusion, results of this study have established the deleterious effect of the all the five predicted nsSNPs on the PTEN protein structure. Thus, results of the current study can pave a new platform to sort out nsSNPs that can be undertaken for the confirmation of their phenotype and their correlation with diseased status in case of control studies. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  17. The Role of Tumor Metastases Suppressor Gene, Drg-1, in Breast Cancer

    National Research Council Canada - National Science Library

    Watabe, Kounosuke

    2008-01-01

    .... This inhibition leads to down-regulation of the ATF3 gene and thus suppressing metastases. We also found that a combination of NDRGI, PTEN and ATF3 is a good prognostic marker for breast cancer patients. These results suggest that the Wnt and ATF3 pathways are a potential therapeutic target for patients with metastatic disease. We will focus our next year's effort on further clarification of the NDRG1 pathway.

  18. NKL homeobox gene MSX1 acts like a tumor suppressor in NK-cell leukemia.

    Science.gov (United States)

    Nagel, Stefan; Pommerenke, Claudia; Meyer, Corinna; Kaufmann, Maren; MacLeod, Roderick A F; Drexler, Hans G

    2017-09-15

    NKL homeobox gene MSX1 is physiologically expressed in lymphoid progenitors and subsequently downregulated in developing T- and B-cells. In contrast, elevated expression levels of MSX1 persist in mature natural killer (NK)-cells, indicating a functional role in this compartment. While T-cell acute lymphoblastic leukemia (T-ALL) subsets exhibit aberrant overexpression of MSX1, we show here that in malignant NK-cells the level of MSX1 transcripts is aberrantly downregulated. Chromosomal deletions at 4p16 hosting the MSX1 locus have been described in NK-cell leukemia patients. However, NK-cell lines analyzed here showed normal MSX1 gene configurations, indicating that this aberration might be uncommon. To identify alternative MSX1 regulatory mechanisms we compared expression profiling data of primary normal NK-cells and malignant NK-cell lines. This procedure revealed several deregulated genes including overexpressed IRF4, MIR155HG and MIR17HG and downregulated AUTS2, EP300, GATA3 and HHEX. As shown recently, chromatin-modulator AUTS2 is overexpressed in T-ALL subsets where it mediates aberrant transcriptional activation of MSX1. Here, our data demonstrate that in malignant NK-cell lines AUTS2 performed MSX1 activation as well, but in accordance with downregulated MSX1 transcription therein we detected reduced AUTS2 expression, a small genomic deletion at 7q11 removing exons 3 and 4, and truncating mutations in exon 1. Moreover, genomic profiling and chromosomal analyses of NK-cell lines demonstrated amplification of IRF4 at 6p25 and deletion of PRDM1 at 6q21, highlighting their potential oncogenic impact. Functional analyses performed via knockdown or forced expression of these genes revealed regulatory network disturbances effecting downregulation of MSX1 which may underlie malignant development in NK-cells.

  19. Relationship of ultrasonic shear wave velocity with oncogene and tumor suppressor gene expression in primary liver cancer lesions as well as angiogenesis factor contents

    Directory of Open Access Journals (Sweden)

    Xing Yin1

    2017-06-01

    Full Text Available Objective: To discuss the relationship of ultrasonic shear wave velocity (SWV with oncogene and tumor suppressor gene expression in primary liver cancer lesions as well as angiogenesis factor contents. Methods: 100 patients with primary liver cancer who underwent surgical treatment in our hospital between March 2014 and September 2016 were collected as observation group, and 50 healthy subjects who received physical examination in our hospital during the same period were collected as normal control group. The ultrasonic SWV levels of two groups of subjects were measured before the operation, and the observation groups were further divided into high SWV group and low SWV group, 50 cases in each group. Intraoperative tumor tissue samples were kept and fluorescence quantitative PCR was used to determine the mRNA expression of oncogenes and tumor suppressor genes. Enzymelinked immunosorbent assay was used to determine serum contents of angiogenesis factors in observation group before operation. Results: Hepatic ultrasonic SWV level in observation group was significantly higher than that in normal control group; proto-oncogene CK, Ki67, Gly-3, Survivin and Pokemon mRNA expression in tumor tissue of high SWV group were higher than those of low SWV group while tumor suppressor genes Tg737, p16, p27, PTEN and runx3 mRNA expression were lower than those of low SWV group; serum angiogenesis factors VEGF, MMP-9 and IGF-1R contents were higher than those in low SWV group. Conclusion: The hepatic ultrasonic SWV level increases in patients with primary liver cancer, and the SWV level is directly correlated with oncogene and tumor suppressor gene expression as well as angiogenesis factor contents.

  20. The first gene in the Escherichia coli secA operon, gene X, encodes a nonessential secretory protein.

    OpenAIRE

    Rajapandi, T; Dolan, K M; Oliver, D B

    1991-01-01

    TnphoA insertions in the first gene of the Escherichia coli secA operon, gene X, were isolated and analyzed. Studies of the Gene X-PhoA fusion proteins showed that gene X encodes a secretory protein, since the fusion proteins possessed normal alkaline phosphatase activity and a substantial portion of this activity was found in the periplasm. In addition, the Gene X-PhoA fusion proteins were initially synthesized with a cleavable signal peptide. A gene X::TnphoA insertion was used to construct...

  1. Thrombospondin-4 is a putative tumour-suppressor gene in colorectal cancer that exhibits age-related methylation

    International Nuclear Information System (INIS)

    Greco, Sonia A; Leggett, Barbara A; Whitehall, Vicki LJ; Chia, June; Inglis, Kelly J; Cozzi, Sarah-Jane; Ramsnes, Ingunn; Buttenshaw, Ronald L; Spring, Kevin J; Boyle, Glen M; Worthley, Daniel L

    2010-01-01

    colon. THBS4 shows increased methylation in colorectal cancer, but this is not strongly associated with altered gene expression, either because methylation has not always reached a critical level or because other factors influence THBS4 expression. THBS4 may act as a tumour suppressor gene, demonstrated by its suppression of tumour colony formation in vitro. THBS4 methylation is detectable in normal colonic mucosa and its level may be a biomarker for the occurrence of adenomas and carcinoma

  2. Inactivation of the FLCN tumor suppressor gene induces TFE3 transcriptional activity by increasing its nuclear localization.

    Directory of Open Access Journals (Sweden)

    Seung-Beom Hong

    2010-12-01

    Full Text Available Germline mutations in a tumor suppressor gene FLCN lead to development of fibrofolliculomas, lung cysts and renal cell carcinoma (RCC in Birt-Hogg-Dubé syndrome. TFE3 is a member of the MiTF/TFE transcription factor family and Xp11.2 translocations found in sporadic RCC involving TFE3 result in gene fusions and overexpression of chimeric fusion proteins that retain the C-terminal DNA binding domain of TFE3. We found that GPNMB expression, which is regulated by MiTF, was greatly elevated in renal cancer cells harboring either TFE3 translocations or FLCN inactivation. Since TFE3 is implicated in RCC, we hypothesized that elevated GPNMB expression was due to increased TFE3 activity resulting from the inactivation of FLCN.TFE3 knockdown reduced GPNMB expression in renal cancer cells harboring either TFE3 translocations or FLCN inactivation. Moreover, FLCN knockdown induced GPNMB expression in FLCN-restored renal cancer cells. Conversely, wildtype FLCN suppressed GPNMB expression in FLCN-null cells. FLCN inactivation was correlated with increased TFE3 transcriptional activity accompanied by its nuclear localization as revealed by elevated GPNMB mRNA and protein expression, and predominantly nuclear immunostaining of TFE3 in renal cancer cells, mouse embryo fibroblast cells, mouse kidneys and mouse and human renal tumors. Nuclear localization of TFE3 was associated with TFE3 post-translational modifications including decreased phosphorylation.Increased TFE3 activity is a downstream event induced by FLCN inactivation and is likely to be important for renal tumor development. This study provides an important novel mechanism for induction of TFE3 activity in addition to TFE3 overexpression resulting from Xp11.2 translocations, suggesting that TFE3 may be more broadly involved in tumorigenesis.

  3. Analysis of the Mitogen-activated protein kinase kinase 4 (MAP2K4) tumor suppressor gene in ovarian cancer

    International Nuclear Information System (INIS)

    Davis, Sally J; Choong, David YH; Ramakrishna, Manasa; Ryland, Georgina L; Campbell, Ian G; Gorringe, Kylie L

    2011-01-01

    MAP2K4 is a putative tumor and metastasis suppressor gene frequently found to be deleted in various cancer types. We aimed to conduct a comprehensive analysis of this gene to assess its involvement in ovarian cancer. We screened for mutations in MAP2K4 using High Resolution Melt analysis of 149 primary ovarian tumors and methylation at the promoter using Methylation-Specific Single-Stranded Conformation Polymorphism analysis of 39 tumors. We also considered the clinical impact of changes in MAP2K4 using publicly available expression and copy number array data. Finally, we used siRNA to measure the effect of reducing MAP2K4 expression in cell lines. In addition to 4 previously detected homozygous deletions, we identified a homozygous 16 bp truncating deletion and a heterozygous 4 bp deletion, each in one ovarian tumor. No promoter methylation was detected. The frequency of MAP2K4 homozygous inactivation was 5.6% overall, and 9.8% in high-grade serous cases. Hemizygous deletion of MAP2K4 was observed in 38% of samples. There were significant correlations of copy number and expression in three microarray data sets. There was a significant correlation between MAP2K4 expression and overall survival in one expression array data set, but this was not confirmed in an independent set. Treatment of JAM and HOSE6.3 cell lines with MAP2K4 siRNA showed some reduction in proliferation. MAP2K4 is targeted by genetic inactivation in ovarian cancer and restricted to high grade serous and endometrioid carcinomas in our cohort

  4. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  5. Differential expression of the klf6 tumor suppressor gene upon cell damaging treatments in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Gehrau, Ricardo C.; D' Astolfo, Diego S.; Andreoli, Veronica [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Bocco, Jose L., E-mail: jbocco@fcq.unc.edu.ar [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Koritschoner, Nicolas P. [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina)

    2011-02-10

    The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC{sub 50}). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p < 0.0001) in KLF6 mRNA levels were observed depending on the cellular p53 status upon cell damage. KLF6 expression was significantly increased in 63% of p53-deficient cells (122/195). Conversely, KLF6 mRNA level decreased nearly 4 fold in more than 70% of p53+/+ cells. In addition, klf6 gene promoter activity was down-regulated by DNA damaging agents in cells expressing the functional p53 protein whereas it was moderately increased in the absence of functional p53. Consistent results were obtained for the endogenous KLF6 protein level. Results indicate that human klf6 gene expression is responsive to external cell damage mediated by IC{sub 50} concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable

  6. Differential expression of the klf6 tumor suppressor gene upon cell damaging treatments in cancer cells

    International Nuclear Information System (INIS)

    Gehrau, Ricardo C.; D'Astolfo, Diego S.; Andreoli, Veronica; Bocco, Jose L.; Koritschoner, Nicolas P.

    2011-01-01

    The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC 50 ). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p 50 concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable marker for the efficiency of cell death upon cancer treatment.

  7. Genetic interactions between the Drosophila tumor suppressor gene ept and the stat92E transcription factor.

    Directory of Open Access Journals (Sweden)

    M Melissa Gilbert

    2009-09-01

    Full Text Available Tumor Susceptibility Gene-101 (TSG101 promotes the endocytic degradation of transmembrane proteins and is implicated as a mutational target in cancer, yet the effect of TSG101 loss on cell proliferation in vertebrates is uncertain. By contrast, Drosophila epithelial tissues lacking the TSG101 ortholog erupted (ept develop as enlarged undifferentiated tumors, indicating that the gene can have anti-growth properties in a simple metazoan. A full understanding of pathways deregulated by loss of Drosophila ept will aid in understanding potential links between mammalian TSG101 and growth control.We have taken a genetic approach to the identification of pathways required for excess growth of Drosophila eye-antennal imaginal discs lacking ept. We find that this phenotype is very sensitive to the genetic dose of stat92E, the transcriptional effector of the Jak-Stat signaling pathway, and that this pathway undergoes strong activation in ept mutant cells. Genetic evidence indicates that stat92E contributes to cell cycle deregulation and excess cell size phenotypes that are observed among ept mutant cells. In addition, autonomous Stat92E hyper-activation is associated with altered tissue architecture in ept tumors and an effect on expression of the apical polarity determinant crumbs.These findings identify ept as a cell-autonomous inhibitor of the Jak-Stat pathway and suggest that excess Jak-Stat signaling makes a significant contribution to proliferative and tissue architectural phenotypes that occur in ept mutant tissues.

  8. ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paolo Kunderfranco

    2010-05-01

    Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

  9. Relevance of miR-21 in regulation of tumor suppressor gene PTEN in human cervical cancer cells

    International Nuclear Information System (INIS)

    Peralta-Zaragoza, Oscar; Deas, Jessica; Meneses-Acosta, Angélica; De la O-Gómez, Faustino; Fernández-Tilapa, Gloria; Gómez-Cerón, Claudia; Benítez-Boijseauneau, Odelia; Burguete-García, Ana; Torres-Poveda, Kirvis; Bermúdez-Morales, Victor Hugo; Madrid-Marina, Vicente; Rodríguez-Dorantes, Mauricio; Hidalgo-Miranda, Alfredo; Pérez-Plasencia, Carlos

    2016-01-01

    Expression of the microRNA miR-21 has been found to be altered in almost all types of cancers and it has been classified as an oncogenic microRNA or oncomir. Due to the critical functions of its target proteins in various signaling pathways, miR-21 is an attractive target for genetic and pharmacological modulation in various cancers. Cervical cancer is the second most common cause of death from cancer in women worldwide and persistent HPV infection is the main etiologic agent. This malignancy merits special attention for the development of new treatment strategies. In the present study we analyze the role of miR-21 in cervical cancer cells. To identify the downstream cellular target genes of upstream miR-21, we silenced endogenous miR-21 expression in a cervical intraepithelial neoplasia-derived cell lines using siRNAs. The effect of miR-21 on gene expression was assessed in cervical cancer cells transfected with the siRNA expression plasmid pSIMIR21. We identified the tumor suppressor gene PTEN as a target of miR-21 and determined the mechanism of its regulation throughout reporter construct plasmids. Using this model, we analyzed the expression of miR-21 and PTEN as well as functional effects such as autophagy and apoptosis induction. In SiHa cells, there was an inverse correlation between miR-21 expression and PTEN mRNA level as well as PTEN protein expression in cervical cancer cells. Transfection with the pSIMIR21 plasmid increased luciferase reporter activity in construct plasmids containing the PTEN-3′-UTR microRNA response elements MRE21-1 and MRE21-2. The role of miR-21 in cell proliferation was also analyzed in SiHa and HeLa cells transfected with the pSIMIR21 plasmid, and tumor cells exhibited markedly reduced cell proliferation along with autophagy and apoptosis induction. We conclude that miR-21 post-transcriptionally down-regulates the expression of PTEN to promote cell proliferation and cervical cancer cell survival. Therefore, it may be a

  10. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    Science.gov (United States)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-06-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  11. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  12. Transient receptor potential (TRP gene superfamily encoding cation channels

    Directory of Open Access Journals (Sweden)

    Pan Zan

    2011-01-01

    Full Text Available Abstract Transient receptor potential (TRP non-selective cation channels constitute a superfamily, which contains 28 different genes. In mammals, this superfamily is divided into six subfamilies based on differences in amino acid sequence homology between the different gene products. Proteins within a subfamily aggregate to form heteromeric or homomeric tetrameric configurations. These different groupings have very variable permeability ratios for calcium versus sodium ions. TRP expression is widely distributed in neuronal tissues, as well as a host of other tissues, including epithelial and endothelial cells. They are activated by environmental stresses that include tissue injury, changes in temperature, pH and osmolarity, as well as volatile chemicals, cytokines and plant compounds. Their activation induces, via intracellular calcium signalling, a host of responses, including stimulation of cell proliferation, migration, regulatory volume behaviour and the release of a host of cytokines. Their activation is greatly potentiated by phospholipase C (PLC activation mediated by coupled GTP-binding proteins and tyrosine receptors. In addition to their importance in maintaining tissue homeostasis, some of these responses may involve various underlying diseases. Given the wealth of literature describing the multiple roles of TRP in physiology in a very wide range of different mammalian tissues, this review limits itself to the literature describing the multiple roles of TRP channels in different ocular tissues. Accordingly, their importance to the corneal, trabecular meshwork, lens, ciliary muscle, retinal, microglial and retinal pigment epithelial physiology and pathology is reviewed.

  13. Discovery of Metastatic Breast Cancer Suppressor Genes Using Functional Genome Analysis

    Science.gov (United States)

    2012-07-01

    al., 2008; Cheung,H.W., et al., 2011; Barbie ,D.A., et al., 2009]. To identify genes whose essentiality could be associated specifically with...Reference Barbie ,D.A., Tamayo,P., Boehm,J.S., Kim,S.Y., Moody,S.E., Dunn,I.F., Schinzel,A.C., Sandy,P., Meylan,E., Scholl,C., Frohling,S., Chan,E.M... Barbie ,D.A., Awad,T., Zhou,X., Nguyen,T., Piqani,B., Li,C., Golub,T.R., Meyerson,M., Hacohen,N., Hahn,W.C., Lander,E.S., Sabatini,D.M., and Root

  14. The effect of age at exposure on the inactivating mechanisms and relative contributions of key tumor suppressor genes in radiation-induced mouse T-cell lymphomas

    International Nuclear Information System (INIS)

    Sunaoshi, Masaaki; Amasaki, Yoshiko; Hirano-Sakairi, Shinobu; Blyth, Benjamin J.; Morioka, Takamitsu; Kaminishi, Mutsumi; Shang, Yi; Nishimura, Mayumi; Shimada, Yoshiya; Tachibana, Akira

    2015-01-01

    Highlights: • T-cell lymphoma incidence, latency and weight did not change with age at exposure. • Lymphomas had frequent loss of heterozygosity on chromosomes 4, 11 and 19. • These lesions targeted the Cdkn2a, Ikaros and Pten tumor suppressor genes. • Age at exposure may influence which tumor suppressor genes are lost in each tumor. • The mechanisms of tumor suppressor gene loss were different at each locus. - Abstract: Children are considered more sensitive to radiation-induced cancer than adults, yet any differences in genomic alterations associated with age-at-exposure and their underlying mechanisms remain unclear. We assessed genome-wide DNA copy number and mutation of key tumor suppressor genes in T-cell lymphomas arising after weekly irradiation of female B6C3F1 mice with 1.2 Gy X-rays for 4 consecutive weeks starting during infancy (1 week old), adolescence (4 weeks old) or as young adults (8 weeks old). Although T-cell lymphoma incidence was similar, loss of heterozygosity at Cdkn2a on chromosome 4 and at Ikaros on chromosome 11 was more frequent in the two older groups, while loss at the Pten locus on chromosome 19 was more frequent in the infant-irradiated group. Cdkn2a and Ikaros mutation/loss was a common feature of the young adult-irradiation group, with Ikaros frequently (50%) incurring multiple independent hits (including deletions and mutations) or suffering a single hit predicted to result in a dominant negative protein (such as those lacking exon 4, an isoform we have designated Ik12, which lacks two DNA binding zinc-finger domains). Conversely, Pten mutations were more frequent after early irradiation (60%) than after young adult-irradiation (30%). Homozygous Pten mutations occurred without DNA copy number change after irradiation starting in infancy, suggesting duplication of the mutated allele by chromosome mis-segregation or mitotic recombination. Our findings demonstrate that while deletions on chromosomes 4 and 11 affecting Cdkn2

  15. The effect of age at exposure on the inactivating mechanisms and relative contributions of key tumor suppressor genes in radiation-induced mouse T-cell lymphomas

    Energy Technology Data Exchange (ETDEWEB)

    Sunaoshi, Masaaki [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Department of Biological Sciences, College of Science, Ibaraki University, Bunkyo 2-1-1, Mito, Ibaraki 310-8512 (Japan); Amasaki, Yoshiko; Hirano-Sakairi, Shinobu; Blyth, Benjamin J. [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Morioka, Takamitsu [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Radiation Effect Accumulation and Prevention Project, Fukushima Project Headquarters, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kaminishi, Mutsumi [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Shang, Yi [Radiation Effect Accumulation and Prevention Project, Fukushima Project Headquarters, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Nishimura, Mayumi; Shimada, Yoshiya [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Radiation Effect Accumulation and Prevention Project, Fukushima Project Headquarters, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Tachibana, Akira [Department of Biological Sciences, College of Science, Ibaraki University, Bunkyo 2-1-1, Mito, Ibaraki 310-8512 (Japan); and others

    2015-09-15

    Highlights: • T-cell lymphoma incidence, latency and weight did not change with age at exposure. • Lymphomas had frequent loss of heterozygosity on chromosomes 4, 11 and 19. • These lesions targeted the Cdkn2a, Ikaros and Pten tumor suppressor genes. • Age at exposure may influence which tumor suppressor genes are lost in each tumor. • The mechanisms of tumor suppressor gene loss were different at each locus. - Abstract: Children are considered more sensitive to radiation-induced cancer than adults, yet any differences in genomic alterations associated with age-at-exposure and their underlying mechanisms remain unclear. We assessed genome-wide DNA copy number and mutation of key tumor suppressor genes in T-cell lymphomas arising after weekly irradiation of female B6C3F1 mice with 1.2 Gy X-rays for 4 consecutive weeks starting during infancy (1 week old), adolescence (4 weeks old) or as young adults (8 weeks old). Although T-cell lymphoma incidence was similar, loss of heterozygosity at Cdkn2a on chromosome 4 and at Ikaros on chromosome 11 was more frequent in the two older groups, while loss at the Pten locus on chromosome 19 was more frequent in the infant-irradiated group. Cdkn2a and Ikaros mutation/loss was a common feature of the young adult-irradiation group, with Ikaros frequently (50%) incurring multiple independent hits (including deletions and mutations) or suffering a single hit predicted to result in a dominant negative protein (such as those lacking exon 4, an isoform we have designated Ik12, which lacks two DNA binding zinc-finger domains). Conversely, Pten mutations were more frequent after early irradiation (60%) than after young adult-irradiation (30%). Homozygous Pten mutations occurred without DNA copy number change after irradiation starting in infancy, suggesting duplication of the mutated allele by chromosome mis-segregation or mitotic recombination. Our findings demonstrate that while deletions on chromosomes 4 and 11 affecting Cdkn2

  16. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  17. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    International Nuclear Information System (INIS)

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

    1994-01-01

    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

  18. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  19. PREVALENCE OF TOXIN ENCODING GENES IN ESCHERICHIACOLI ISOLATES FROM URINARY TRACT INFECTIONS INSLOVENIA

    Directory of Open Access Journals (Sweden)

    Marjanca Starčič-Erjavec

    2008-06-01

    Full Text Available Methods 110 uropathogenic Escherichia coli strains (UPEC obtained from the Institute of Microbiology and Immunology of the Medical Faculty in Ljubljana were screened by PCR withprimers specific for the following toxin encoding genes: hlyA (haemolysin, cnf1 (cytotoxicnecrotising factor 1, usp (uropathogenic specific protein USP and ibeA (invasin. Dotblot hybridisation experiments were performed to validate the PCR assays.Results In 44% of the strains usp gene sequences were detected. The prevalence of hlyA and cnf1was 25% and 23%, respectively. Only 9% of the strains harbored ibeA. The majority of thetested toxin encoding genes was found in strains belonging to the B2 phylogenetic group.Conclusions The toxin encoding genes hlyA, cnf1 and usp were strongly co-associated. Further, we founda statistically significant co-association of ibeA and usp. The prevalence of the testedtoxin encoding genes in E. coli strains from urinary tract infections isolated in Slovenia iscomparable to those from studies in other geographic regions.

  20. Identification of a conserved cluster of skin-specific genes encoding secreted proteins.

    Science.gov (United States)

    Moffatt, Pierre; Salois, Patrick; St-Amant, Natalie; Gaumond, Marie-Hélène; Lanctôt, Christian

    2004-06-09

    Terminal differentiation of keratinocytes results in the formation of a cornified layer composed of cross-linked intracellular and extracellular material. Using a signal trap expression screening strategy, we have identified four cDNAs encoding secreted proteins potentially involved in this process. One of the cDNAs is identical to the short isoform of suprabasin, a recently described epidermis-specific protein, which is shown here to contain a functional secretory signal. The second cDNA, sk89, encodes a protein of 493 amino acids, rich in glycine and serine residues. The third cDNA encodes a C-terminal fragment of SK89 (amino acids 410-493). It comprises exons 13 to 18 of the sk89 locus but transcription starts at an isoform-specific exon encoding a distinct secretory signal. The fourth cDNA encodes keratinocyte differentiation-associated protein (KDAP), a precursor protein of 102 amino acids. Subcellular localization by immunofluorescence and detection of the tagged proteins by Western blotting confirmed that the four proteins are secreted. Northern analysis and in situ hybridization revealed that expression of the corresponding genes was restricted to the suprabasal keratinocytes of the epidermis. These genes encoding epidermis-specific secreted products are found in a conserved cluster on human chromosome 19q13.12 and on mouse chromosome 7A3.

  1. Targeting activating mutations of EZH2 leads to potent cell growth inhibition in human melanoma by derepression of tumor suppressor genes

    OpenAIRE

    Tiffen, Jessamy C.; Gunatilake, Dilini; Gallagher, Stuart J.; Gowrishankar, Kavitha; Heinemann, Anja; Cullinane, Carleen; Dutton-Regester, Ken; Pupo, Gulietta M.; Strbenac, Dario; Yang, Jean Y.; Madore, Jason; Mann, Graham J.; Hayward, Nicholas K.; McArthur, Grant A.; Filipp, Fabian V.

    2015-01-01

    The epigenetic modifier EZH2 is part of the polycomb repressive complex that suppresses gene expression via histone methylation. Activating mutations in EZH2 are found in a subset of melanoma that contributes to disease progression by inactivating tumor suppressor genes. In this study we have targeted EZH2 with a specific inhibitor (GSK126) or depleted EZH2 protein by stable shRNA knockdown. We show that inhibition of EZH2 has potent effects on the growth of both wild-type and EZH2 mutant hum...

  2. LEA (Late Embryogenesis Abundant proteins and their encoding genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Hincha Dirk K

    2008-03-01

    Full Text Available Abstract Background LEA (late embryogenesis abundant proteins have first been described about 25 years ago as accumulating late in plant seed development. They were later found in vegetative plant tissues following environmental stress and also in desiccation tolerant bacteria and invertebrates. Although they are widely assumed to play crucial roles in cellular dehydration tolerance, their physiological and biochemical functions are largely unknown. Results We present a genome-wide analysis of LEA proteins and their encoding genes in Arabidopsis thaliana. We identified 51 LEA protein encoding genes in the Arabidopsis genome that could be classified into nine distinct groups. Expression studies were performed on all genes at different developmental stages, in different plant organs and under different stress and hormone treatments using quantitative RT-PCR. We found evidence of expression for all 51 genes. There was only little overlap between genes expressed in vegetative tissues and in seeds and expression levels were generally higher in seeds. Most genes encoding LEA proteins had abscisic acid response (ABRE and/or low temperature response (LTRE elements in their promoters and many genes containing the respective promoter elements were induced by abscisic acid, cold or drought. We also found that 33% of all Arabidopsis LEA protein encoding genes are arranged in tandem repeats and that 43% are part of homeologous pairs. The majority of LEA proteins were predicted to be highly hydrophilic and natively unstructured, but some were predicted to be folded. Conclusion The analyses indicate a wide range of sequence diversity, intracellular localizations, and expression patterns. The high fraction of retained duplicate genes and the inferred functional diversification indicate that they confer an evolutionary advantage for an organism under varying stressful environmental conditions. This comprehensive analysis will be an important starting point for

  3. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  4. A Gene Selection Method for Microarray Data Based on Binary PSO Encoding Gene-to-Class Sensitivity Information.

    Science.gov (United States)

    Han, Fei; Yang, Chun; Wu, Ya-Qi; Zhu, Jian-Sheng; Ling, Qing-Hua; Song, Yu-Qing; Huang, De-Shuang

    2017-01-01

    Traditional gene selection methods for microarray data mainly considered the features' relevance by evaluating their utility for achieving accurate predication or exploiting data variance and distribution, and the selected genes were usually poorly explicable. To improve the interpretability of the selected genes as well as prediction accuracy, an improved gene selection method based on binary particle swarm optimization (BPSO) and prior information is proposed in this paper. In the proposed method, BPSO encoding gene-to-class sensitivity (GCS) information is used to perform gene selection. The gene-to-class sensitivity information, extracted from the samples by extreme learning machine (ELM), is encoded into the selection process in four aspects: initializing particles, updating the particles, modifying maximum velocity, and adopting mutation operation adaptively. Constrained by the gene-to-class sensitivity information, the new method can select functional gene subsets which are significantly sensitive to the samples' classes. With the few discriminative genes selected by the proposed method, ELM, K-nearest neighbor and support vector machine classifiers achieve much high prediction accuracy on five public microarray data, which in turn verifies the efficiency and effectiveness of the proposed gene selection method.

  5. DNA methylation status of nuclear-encoded mitochondrial genes underlies the tissue-dependent mitochondrial functions

    Directory of Open Access Journals (Sweden)

    Takasugi Masaki

    2010-08-01

    Full Text Available Abstract Background Mitochondria are semi-autonomous, semi-self-replicating organelles harboring their own DNA (mitochondrial DNA, mtDNA, and their dysregulation is involved in the development of various diseases. While mtDNA does not generally undergo epigenetic modifications, almost all mitochondrial proteins are encoded by nuclear DNA. However, the epigenetic regulation of nuclear-encoded mitochondrial genes (nuclear mt genes has not been comprehensively analyzed. Results We analyzed the DNA methylation status of 899 nuclear mt genes in the liver, brain, and heart tissues of mouse, and identified 636 nuclear mt genes carrying tissue-dependent and differentially methylated regions (T-DMRs. These nuclar mt genes are involved in various mitochondrial functions and they also include genes related to human diseases. T-DMRs regulate the expression of nuclear mt genes. Nuclear mt genes with tissue-specific hypomethylated T-DMRs were characterized by enrichment of the target genes of specific transcription factors such as FOXA2 in the liver, and CEBPA and STAT1 in the brain. Conclusions A substantial proportion of nuclear mt genes contained T-DMRs, and the DNA methylation status of numerous T-DMRs should underlie tissue-dependent mitochondrial functions.

  6. The gene encoding topoisomerase I from the human malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Tosh, K; Kilbey, B

    1995-09-22

    Part of the topoisomerase I (TopoI)-encoding gene from Plasmodium falciparum (Pf) was isolated by PCR from cDNA using oligodeoxyribonucleotides modelled on the highly conserved regions of sequence from other species. The entire TopoI gene was obtained by screening a Pf K1 HindIII-EcoRI genomic library in lambda NM1149 with a random-labeled heterologous probe from the Saccharomyces cerevisiae TopoI gene. DNA sequence analysis revealed an open reading frame of 2520 nt encoding a deduced protein of 839 amino acids (aa) with no detectable introns. The Pf TopoI aa sequence has about 40% identity with most eukaryotic TopoI homologues. The gene is located as a single copy on chromosome 5 and Northern analysis identified a transcript of 3.8 kb.

  7. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki

    2003-06-01

    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  8. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    Science.gov (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn AL; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-01-01

    Background Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing

  9. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    Directory of Open Access Journals (Sweden)

    St Clair Dina A

    2007-10-01

    Full Text Available Abstract Background Nucleotide binding site-leucine rich repeat (NBS-LRR-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST representation, massively parallel signature sequencing (MPSS, microarray analysis, rapid amplification of cDNA ends (RACE PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH, a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for

  10. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis.

    Science.gov (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn A L; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-10-23

    Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. We analyzed the expression patterns of approximately 170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing was

  11. Ty3 GAG3 and POL3 genes encode the components of intracellular particles.

    OpenAIRE

    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B

    1992-01-01

    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposo...

  12. New Integron-Associated Gene Cassette Encoding a 3-N-Aminoglycoside Acetyltransferase

    OpenAIRE

    Levings, Renee S.; Partridge, Sally R.; Lightfoot, Diane; Hall, Ruth M.; Djordjevic, Steven P.

    2005-01-01

    A fifth gene cassette containing an aacC gene, aacCA5, was found in an aacCA5-aadA7 cassette array in a class 1 integron isolated from a multiply drug resistant Salmonella enterica serovar Kentucky strain. The AacC-A5 or AAC(3)-Ie acetyltransferase encoded by aacCA5 is related to other AAC(3)-I enzymes and confers resistance to gentamicin.

  13. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    OpenAIRE

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.

  14. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  15. Pentocin KCA1: a novel circular bacteriocin gene encoded in the ...

    African Journals Online (AJOL)

    We isolated and carried out comprehensive genome sequence analysis of the first Lactobacillus pentosus KCA1 of human origin encoding genes for the biosynthesis of antimicrobial bacteriocin peptide. Due to the growing number of antimicrobial resistance, the need for developing alternatives to traditional antibiotics is ...

  16. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available for the efficient hydrolytic kinetic resolution of epoxides, which serve as high-value intermediates in the fine chemicals and pharmaceutical industries. Degenerate primers, based on data from available EH-encoding gene sequences, in conjunction with inverse PCR...

  17. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.

    Directory of Open Access Journals (Sweden)

    Francisco Muñoz-Martínez

    Full Text Available Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF. CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was

  18. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.

    Science.gov (United States)

    Muñoz-Martínez, Francisco; García-Fontana, Cristina; Rico-Jiménez, Miriam; Alfonso, Carlos; Krell, Tino

    2012-01-01

    Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF). CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR) domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was found to be

  19. BAGE: a new gene encoding an antigen recognized on human melanomas by cytolytic T lymphocytes.

    Science.gov (United States)

    Boël, P; Wildmann, C; Sensi, M L; Brasseur, R; Renauld, J C; Coulie, P; Boon, T; van der Bruggen, P

    1995-02-01

    Several tumor antigens are recognized by autologous cytolytic T lymphocytes (CTL) on human melanoma MZ2-MEL. Some of them are encoded by genes MAGE-1 and MAGE-3, which are not expressed in normal tissues except in testis. Here, we report the identification of a new gene that codes for another of these antigens. This gene, named BAGE, codes for a putative protein of 43 aa and seems to belong to a family of several genes. The antigen recognized by the autologous CTL consists of BAGE-encoded peptide AARAVFLAL bound to an HLA-Cw 1601 molecule. Gene BAGE is expressed in 22% of melanomas, 30% of infiltrating bladder carcinomas, 10% of mammary carcinomas, 8% of head and neck squamous cell carcinomas, and 6% of non-small cell lung carcinomas. Like the MAGE genes, it is silent in normal tissues with the exception of testis. Because of its tumor-specific expression, the BAGE-encoded antigen may prove useful for cancer immunotherapy.

  20. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  1. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  2. Sulforaphane Alone and in Combination with Clofarabine Epigenetically Regulates the Expression of DNA Methylation-Silenced Tumour Suppressor Genes in Human Breast Cancer Cells.

    Science.gov (United States)

    Lubecka-Pietruszewska, Katarzyna; Kaufman-Szymczyk, Agnieszka; Stefanska, Barbara; Cebula-Obrzut, Barbara; Smolewski, Piotr; Fabianowska-Majewska, Krystyna

    2015-01-01

    Sporadic breast cancer is frequently associated with aberrant DNA methylation patterns that are reversible and responsive to environmental factors, including diet. In the present study, we investigated the effects of sulforaphane (SFN), a phytochemical from cruciferous vegetables, on the methylation and expression of PTEN and RARbeta2 tumour suppressor genes as well as on the expression of regulators of DNA methylation reaction, DNMT1 , p53 , and p21 , in MCF-7 and MDA-MB-231 human breast cancer cells with different invasive potential. We also evaluate the role of SFN epigenetic effects in support of therapy with clofarabine (ClF) that was recently shown to modulate the epigenome as well. Promoter methylation and gene expression were estimated using methylation-sensitive restriction analysis and real-time PCR, respectively. In both MCF-7 and MDA-MB-231 cells, SFN at IC 50 (22 and 46 μ M , respectively) and a physiologically relevant 10 μ M concentration lead to hypomethylation of PTEN and RARbeta2 promoters with concomitant gene upregulation. The combination of SFN and ClF enhances these effects, resulting in an increase in cell growth arrest and apoptosis at a non-invasive breast cancer stage. Our findings provide evidence that SFN activates DNA methylation-silenced tumour suppressor genes in breast cancer cells and may contribute to SFN-mediated support of therapy with an anti-cancer drug, ClF, increasing its applications in solid tumours.

  3. The tumor suppressors p33ING1 and p33ING2 interact with alien in vivo and enhance alien-mediated gene silencing.

    Science.gov (United States)

    Fegers, Inga; Kob, Robert; Eckey, Maren; Schmidt, Oliver; Goeman, Frauke; Papaioannou, Maria; Escher, Niko; von Eggeling, Ferdinand; Melle, Christian; Baniahmad, Aria

    2007-11-01

    The tumor suppressor p33ING1 is involved in DNA repair and cell cycle regulation. Furthermore, p33ING1 is a transcriptional silencer that recognizes the histone mark for trimethylated lysine 4 at histone H3. Interestingly, expression of p33ING1 and p33ING2 is able to induce premature senescence in primary human fibroblasts. The corepressor Alien is involved in gene silencing mediated by selected members of nuclear hormone receptors. In addition, Alien acts as a corepressor for E2F1, a member of the E2F cell cycle regulatory family. Furthermore, recent findings suggest that Alien is complexed with transcription factors participating in DNA repair and chromatin. Here, using a proteomic approach by surface-enhanced laser desorption ionization and mass spectrometry (SELDI-MS) combined with immunological techniques, we show that Alien interacts in vivo with the tumor suppressor p33ING1 as well as with the related tumor suppressor candidate p33ING2. The interaction of Alien with p33ING1 and p33ING2 was confirmed in vitro with GST-pull-down, suggesting a direct binding of Alien to these factors. The binding domain was mapped to a central region of Alien. Functionally, the expression of p33ING1 or p33ING2 enhances the Alien-mediated silencing, suggesting that the interaction plays a role in transcriptional regulation. Thus, the findings suggest that the identified interaction between Alien and the tumor suppressors p33ING1 and p33ING2 reveals a novel cellular protein network.

  4. Allelic loss of the short arm of chromosome 4 in neuroblastoma suggests a novel tumour suppressor gene locus

    NARCIS (Netherlands)

    Caron, H.; van Sluis, P.; Buschman, R.; Pereira do Tanque, R.; Maes, P.; Beks, L.; de Kraker, J.; Voûte, P. A.; Vergnaud, G.; Westerveld, A.; Slater, R.; Versteeg, R.

    1996-01-01

    Neuroblastoma is a childhood neural crest tumour, genetically characterized by frequent deletions of the short arm of chromosome 1 and amplification of N-myc. Here we report the first evidence for a neuroblastoma tumour suppressor locus on 4pter. Cytogenetically we demonstrated rearrangements of 4p

  5. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  6. Cloning of Lab Gene Encoding Bacteriocin From Pediococcus acidilactici Fil Into Escherichia coli DH5a

    OpenAIRE

    Margono, Sebastian; Wijaya, Agus; Rahayu, Endang S.

    2017-01-01

    Pediococcus acidilactici F11 is able to inhibit the growth of related species of enterobacteriaceae by secreting bacteriocin. Effort to increase bacteriocin production by transforming lab gene encoding bacteriocin from P. acidilactici Fl 1 into E. colt DH5a was carried out. Plasmid pPAF11 (encoding bacteriocin from P. acidilactici F11) and p13C19 as vector which were double-digested with Madill and BamHI, ligated, and transformed into E. colt DH5a. White colonies, as indicator of transformant...

  7. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    Directory of Open Access Journals (Sweden)

    A.V. Karlyshev

    2014-01-01

    Full Text Available According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection.

  8. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  9. Differential roles of two SARP-encoding regulatory genes during tylosin biosynthesis.

    Science.gov (United States)

    Bate, Neil; Stratigopoulos, George; Cundliffe, Eric

    2002-01-01

    The tylosin biosynthetic gene cluster of Streptomyces fradiae is remarkable in harbouring at least five regulatory genes, two of which (tylS and tylT) encode proteins of the Streptomyces antibiotic regulatory protein (SARP) family. The aim of the present work was to assess the respective contributions of TylS and TylT to tylosin production. A combination of targeted gene disruption, fermentation studies and gene expression analysis via reverse transcriptase-polymerase chain reaction (RT-PCR) suggests that tylS is essential for tylosin production and controls the expression of tylR (previously shown to be a global activator of the biosynthetic pathway) plus at least one other gene involved in polyketide metabolism or regulation thereof. This is the first demonstration of a SARP acting to control another regulatory gene during antibiotic biosynthesis. In contrast, tylT is not essential for tylosin production.

  10. [Silencing of tumor metastasis suppressor gene 1 promotes invasion of prostate cancer cell in vitro and its molecular mechanisms].

    Science.gov (United States)

    Xu, Xiao-yan; You, Jiang-feng; Pei, Fei; Zhang, Bo

    2011-12-18

    , indicating that LASS2 is a novel tumor metastasis suppressor gene.

  11. Moringa oleifera Gold Nanoparticles Modulate Oncogenes, Tumor Suppressor Genes, and Caspase-9 Splice Variants in A549 Cells.

    Science.gov (United States)

    Tiloke, Charlette; Phulukdaree, Alisa; Anand, Krishnan; Gengan, Robert M; Chuturgoon, Anil A

    2016-10-01

    Gold nanoparticles (AuNP's) facilitate cancer cell recognition and can be manufactured by green synthesis using nutrient rich medicinal plants such as Moringa oleifera (MO). Targeting dysregulated oncogenes and tumor suppressor genes is crucial for cancer therapeutics. We investigated the antiproliferative effects of AuNP synthesized from MO aqueous leaf extracts (MLAuNP ) in A549 lung and SNO oesophageal cancer cells. A one-pot green synthesis technique was used to synthesise MLAuNP . A549, SNO cancer cells and normal peripheral blood mononuclear cells (PBMCs) were exposed to MLAuNP and CAuNP to evaluate cytotoxicity (MTT assay); apoptosis was measured by phosphatidylserine (PS) externalization, mitochondrial depolarization (ΔΨm) (flow cytometry), caspase-3/7, -9 activity, and ATP levels (luminometry). The mRNA expression of c-myc, p53, Skp2, Fbw7α, and caspase-9 splice variants was determined using qPCR, while relative protein expression of c-myc, p53, SRp30a, Bax, Bcl-2, Smac/DIABLO, Hsp70, and PARP-1 were determined by Western blotting. MLAuNP and CAuNP were not cytotoxic to PBMCs, whilst its pro-apoptotic properties were confirmed in A549 and SNO cells. MLAuNP significantly increased caspase activity in SNO cells while MLAuNP significantly increased PS externalization, ΔΨm, caspase-9, caspase-3/7 activities, and decreased ATP levels in A549 cells. Also, p53 mRNA and protein levels, SRp30a (P = 0.428), Bax, Smac/DIABLO and PARP-1 24 kDa fragment levels were significantly increased. Conversely, MLAuNP significantly decreased Bcl-2, Hsp70, Skp2, Fbw7α, c-myc mRNA, and protein levels and activated alternate splicing with caspase-9a splice variant being significantly increased. MLAuNP possesses antiproliferative properties and induced apoptosis in A549 cells by activating alternate splicing of caspase-9. J. Cell. Biochem. 117: 2302-2314, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...

  13. Indications for a tumor suppressor gene at 22q11 involved in the pathogenesis of ependymal tumors and distinct from hSNF5/INI1.

    Science.gov (United States)

    Kraus, J A; de Millas, W; Sörensen, N; Herbold, C; Schichor, C; Tonn, J C; Wiestler, O D; von Deimling, A; Pietsch, T

    2001-07-01

    Ependymomas account for approximately 9% of all neuroepithelial tumors and represent the most frequent neuroepithelial tumors of the spinal cord. In adults, allelic loss of chromosome arm 22q occurs in up to 60% of the cases studied. Some of these tumors show an altered neurofibromatosis type 2 (NF2) gene; in others, NF2 appears to be unaffected, indicating the involvement of another tumor suppressor gene. Recently, the tumor suppressor gene hSNF5/INI1, located on 22q11.23, has been shown to contribute to the pathogenesis of renal and extrarenal rhabdoid tumors. In addition, this gene may be responsible for a new hereditary syndrome predisposing to a variety of tumors designated "rhabdoid predisposition syndrome." In the present study, we analyzed a series of 53 ependymal tumors of 48 patients [4 myxopapillary ependymomas (WHO grade I), 3 subependymomas (WHO grade I), 18 ependymomas (WHO grade II), 21 anaplastic ependymomas (WHO grade III) and 2 ependymoblastomas (WHO grade IV)] for mutations and homozygous deletions in the coding region of the hSNF5/INI1 gene and for allelic loss of its flanking chromosomal regions in 39 ependymal tumors of 35 patients. Allelic loss was detected in 11 of 35 informative primary ependymal tumors (31%) with a common region of overlap covered by the markers D22S257 and D22S310 on 22q11 including the marker D22S301. However, a detailed molecular analysis of 53 ependymal tumors for mutations and homozygous deletion of the hSNF5/INI1 gene revealed no alterations. We conclude that the hSNF5/INI1 gene is not involved in the pathogenesis of human ependymal tumors with allelic loss on chromosome arm 22q and an intact NF2 locus. In addition, our study localizes a putative ependymoma tumor suppressor gene(s) to a domain of chromosome arm 22q flanked by the microsatellite markers D22S257 and D22S310.

  14. A genomic analysis of disease-resistance genes encoding nucleotide binding sites in Sorghum bicolor

    Directory of Open Access Journals (Sweden)

    Xiao Cheng

    2010-01-01

    Full Text Available A large set of candidate nucleotide-binding site (NBS-encoding genes related to disease resistance was identified in the sorghum (Sorghum bicolor genome. These resistance (R genes were characterized based on their structural diversity, physical chromosomal location and phylogenetic relationships. Based on their N-terminal motifs and leucine-rich repeats (LRR, 50 non-regular NBS genes and 224 regular NBS genes were identified in 274 candidate NBS genes. The regular NBS genes were classified into ten types: CNL, CN, CNLX, CNX, CNXL, CXN, NX, N, NL and NLX. The vast majority (97% of NBS genes occurred in gene clusters, indicating extensive gene duplication in the evolution of S. bicolor NBS genes. Analysis of the S. bicolor NBS phylogenetic tree revealed two major clades. Most NBS genes were located at the distal tip of the long arms of the ten sorghum chromosomes, a pattern significantly different from rice and Arabidopsis, the NBS genes of which have a random chromosomal distribution.

  15. Genetic and Epigenetic Tumor Suppressor Gene Silencing are Distinct Molecular Phenotypes Driven by Growth Promoting Mutations in Non small Cell Lung Cancer

    International Nuclear Information System (INIS)

    Marsit, C. J.; Kelsey, K. T.; Houseman, E. A.; Kelsey, K. T.; Houseman, E. A.; Nelson, H. H.

    2008-01-01

    Both genetic and epigenetic alterations characterize human non small cell lung cancer (NSCLC), but the biological processes that create or select these alterations remain incompletely investigated. Our hypothesis posits that a roughly reciprocal relationship between the propensity for promoter hyper methylation and a propensity for genetic deletion leads to distinct molecular phenotypes of lung cancer. To test this hypothesis, we examined promoter hyper methylation of 17 tumor suppressor genes, as a marker of epigenetic alteration propensity, and deletion events at the 3p21 region, as a marker of genetic alteration. To model the complex biology between these somatic alterations, we utilized an item response theory model. We demonstrated that tumors exhibiting LOH at greater than 30% of informative alleles in the 3p21 region have a significantly reduced propensity for hyper methylation. At the same time, tumors with activating KRAS mutations showed a significantly increased propensity for hyper methylation of the loci examined, a result similar to what has been observed in colon cancer. These data suggest that NSCLCs have distinct epigenetic or genetic alteration phenotypes acting upon tumor suppressor genes and that mutation of oncogenic growth promoting genes, such as KRAS, is associated with the epigenetic phenotype.

  16. Metagenomic Analysis of Apple Orchard Soil Reveals Antibiotic Resistance Genes Encoding Predicted Bifunctional Proteins▿

    Science.gov (United States)

    Donato, Justin J.; Moe, Luke A.; Converse, Brandon J.; Smart, Keith D.; Berklein, Flora C.; McManus, Patricia S.; Handelsman, Jo

    2010-01-01

    To gain insight into the diversity and origins of antibiotic resistance genes, we identified resistance genes in the soil in an apple orchard using functional metagenomics, which involves inserting large fragments of foreign DNA into Escherichia coli and assaying the resulting clones for expressed functions. Among 13 antibiotic-resistant clones, we found two genes that encode bifunctional proteins. One predicted bifunctional protein confers resistance to ceftazidime and contains a natural fusion between a predicted transcriptional regulator and a β-lactamase. Sequence analysis of the entire metagenomic clone encoding the predicted bifunctional β-lactamase revealed a gene potentially involved in chloramphenicol resistance as well as a predicted transposase. A second clone that encodes a predicted bifunctional protein confers resistance to kanamycin and contains an aminoglycoside acetyltransferase domain fused to a second acetyltransferase domain that, based on nucleotide sequence, was predicted not to be involved in antibiotic resistance. This is the first report of a transcriptional regulator fused to a β-lactamase and of an aminoglycoside acetyltransferase fused to an acetyltransferase not involved in antibiotic resistance. PMID:20453147

  17. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  18. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci.

    Science.gov (United States)

    Perumal, N; Murugesan, S; Krishnan, P

    2016-01-01

    The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs) and staphylococcal cassette chromosome mec (SCCmec) elements among clinical isolates of methicillin-resistant staphylococci (MRS). Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6')-Ie-aph (2''), aph (3')-IIIa and ant (4')-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6')-Ie-aph (2'') (55.4%) followed by aph (3')-IIIa (32.3%) and ant (4')-Ia gene (9%). SCCmec type I (34%) was predominant in this study. In conclusion, the aac (6')-Ie-aph (2'') was the most common AME gene and SCCmec type I was most predominant among the MRS isolates.

  19. The insect metalloproteinase inhibitor gene of the lepidopteran Galleria mellonella encodes two distinct inhibitors.

    Science.gov (United States)

    Wedde, Marianne; Weise, Christoph; Nuck, Rolf; Altincicek, Boran; Vilcinskas, Andreas

    2007-01-01

    The insect metalloproteinase inhibitor (IMPI) from the greater wax moth, Galleria mellonella, represents the first and to date only specific inhibitor of microbial metalloproteinases reported from animals. Here, we report on the characterization including carbohydrate analysis of two recombinant constructs encoded by impi cDNA either upstream or downstream of the furin cleavage site identified. rIMPI-1, corresponding to native IMPI purified from hemolymph, is encoded by the N-terminal part of the impi sequence, whereas rIMPI-2 is encoded by its C-terminal part. rIMPI-1 is glycosylated at N48 with GlcNAc2Man3, showing fucosylation to different extents. Similarly, rIMPI-2 is glycosylated at N149 with GlcNAc2Man3, but is fully fucosylated. rIMPI-1 represents a promising template for the design of second-generation antibiotics owing to its specific activity against thermolysin-like metalloproteinases produced by human pathogenic bacteria such as Vibrio vulnificus. In contrast, rIMPI-2 does not inhibit bacterial metalloproteinases, but is moderately active against recombinant human matrix metalloproteinases (MMPs). Both microbial metalloproteinases and MMPs induce expression of the impi gene when injected into G. mellonella larvae. These findings provide evidence that the impi gene encodes two distinct inhibitors, one inhibiting microbial metalloproteinases and contributing to innate immunity, the other putatively mediating regulation of endogenous MMPs during metamorphosis.

  20. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  1. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter

    2004-01-01

    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  2. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  3. Sca1, a previously undescribed paralog from autotransporter protein-encoding genes in Rickettsia species

    Directory of Open Access Journals (Sweden)

    Raoult Didier

    2006-02-01

    Full Text Available Abstract Background Among the 17 genes encoding autotransporter proteins of the "surface cell antigen" (sca family in the currently sequenced Rickettsia genomes, ompA, sca5 (ompB and sca4 (gene D, have been extensively used for identification and phylogenetic purposes for Rickettsia species. However, none of these genes is present in all 20 currently validated Rickettsia species. Of the remaining 14 sca genes, sca1 is the only gene to be present in all nine sequenced Rickettsia genomes. To estimate whether the sca1 gene is present in all Rickettsia species and its usefulness as an identification and phylogenetic tool, we searched for sca1genes in the four published Rickettsia genomes and amplified and sequenced this gene in the remaining 16 validated Rickettsia species. Results Sca1 is the only one of the 17 rickettsial sca genes present in all 20 Rickettsia species. R. prowazekii and R. canadensis exhibit a split sca1 gene whereas the remaining species have a complete gene. Within the sca1 gene, we identified a 488-bp variable sequence fragment that can be amplified using a pair of conserved primers. Sequences of this fragment are specific for each Rickettsia species. The phylogenetic organization of Rickettsia species inferred from the comparison of sca1 sequences strengthens the classification based on the housekeeping gene gltA and is similar to those obtained from the analyses of ompA, sca5 and sca4, thus suggesting similar evolutionary constraints. We also observed that Sca1 protein sequences have evolved under a dual selection pressure: with the exception of typhus group rickettsiae, the amino-terminal part of the protein that encompasses the predicted passenger domain, has evolved under positive selection in rickettsiae. This suggests that the Sca1 protein interacts with the host. In contrast, the C-terminal portion containing the autotransporter domain has evolved under purifying selection. In addition, sca1 is transcribed in R. conorii

  4. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    Science.gov (United States)

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.   PMID:14742219

  5. Sequencing the Gene Encoding Manganese-Dependent Superoxide Dismutase for Rapid Species Identification of Enterococci

    OpenAIRE

    Poyart, Claire; Quesnes, Gilles; Trieu-Cuot, Patrick

    2000-01-01

    Simple PCR and sequencing assays that utilize a single pair of degenerate primers were used to characterize a 438-bp-long DNA fragment internal (sodAint) to the sodA gene encoding the manganese-dependent superoxide dismutase in 19 enterococcal type strains (Enterococcus avium, Enterococcus casseliflavus, Enterococcus cecorum, Enterococcus columbae, Enterococcus dispar, Enterococcus durans, Enterococcus faecalis, Enterococcus faecium, Enterococcus flavescens, Enterococcus gallinarum, Enterococ...

  6. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  7. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant.

    Science.gov (United States)

    da Silva, Sabina Dos Santos Paulino; Cidral, Thiago André; Soares, Maria José dos Santos; de Melo, Maria Celeste Nunes

    2015-11-01

    Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

  8. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  9. Mutations in the gene encoding epsilon-sarcoglycan cause myoclonus-dystonia syndrome.

    Science.gov (United States)

    Zimprich, A; Grabowski, M; Asmus, F; Naumann, M; Berg, D; Bertram, M; Scheidtmann, K; Kern, P; Winkelmann, J; Müller-Myhsok, B; Riedel, L; Bauer, M; Müller, T; Castro, M; Meitinger, T; Strom, T M; Gasser, T

    2001-09-01

    The dystonias are a common clinically and genetically heterogeneous group of movement disorders. More than ten loci for inherited forms of dystonia have been mapped, but only three mutated genes have been identified so far. These are DYT1, encoding torsin A and mutant in the early-onset generalized form, GCH1 (formerly known as DYT5), encoding GTP-cyclohydrolase I and mutant in dominant dopa-responsive dystonia, and TH, encoding tyrosine hydroxylase and mutant in the recessive form of the disease. Myoclonus-dystonia syndrome (MDS; DYT11) is an autosomal dominant disorder characterized by bilateral, alcohol-sensitive myoclonic jerks involving mainly the arms and axial muscles. Dystonia, usually torticollis and/or writer's cramp, occurs in most but not all affected patients and may occasionally be the only symptom of the disease. In addition, patients often show prominent psychiatric abnormalities, including panic attacks and obsessive-compulsive behavior. In most MDS families, the disease is linked to a locus on chromosome 7q21 (refs. 11-13). Using a positional cloning approach, we have identified five different heterozygous loss-of-function mutations in the gene for epsilon-sarcoglycan (SGCE), which we mapped to a refined critical region of about 3.2 Mb. SGCE is expressed in all brain regions examined. Pedigree analysis shows a marked difference in penetrance depending on the parental origin of the disease allele. This is indicative of a maternal imprinting mechanism, which has been demonstrated in the mouse epsilon-sarcoglycan gene.

  10. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  11. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli.

    OpenAIRE

    Okada, K; Minehira, M; Zhu, X; Suzuki, K; Nakagawa, T; Matsuda, H; Kawamukai, M

    1997-01-01

    The Escherichia coli ispB gene encoding octaprenyl diphosphate synthase is responsible for the synthesis of the side chain of isoprenoid quinones. We tried to construct an E. coli ispB-disrupted mutant but could not isolate the chromosomal ispB disrupted mutant unless the ispB gene or its homolog was supplied on a plasmid. The chromosomal ispB disruptants that harbored plasmids carrying the ispB homologs from Haemophilus influenzae and Synechocystis sp. strain PCC6803 produced mainly ubiquino...

  12. PRS1 is a key member of the gene family encoding phosphoribosylpyrophosphate synthetase in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Carter, Andrew T.; Beiche, Flora; Hove-Jensen, Bjarne

    1997-01-01

    In Saccharomyces cerevisiae the metabolite phosphoribosyl-pyrophosphate (PRPP) is required for purine, pyrimidine, tryptophan and histidine biosynthesis. Enzymes that can synthesize PRPP can be encoded by at least four genes. We have studied 5-phospho-ribosyl-1(α)-pyrophosphate synthetases (PRS......) genetically and biochemically. Each of the four genes, all of which are transcribed, has been disrupted in haploid yeast strains of each mating type and although all disruptants are able to grow on complete medium, differences in growth rate and enzyme activity suggest that disruption of PRS1 or PRS3 has...

  13. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  14. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  15. Selection and characterization of forest soil metagenome genes encoding lipolytic enzymes.

    Science.gov (United States)

    Hong, Kyung Sik; Lim, He Kyoung; Chung, Eu Jin; Park, Eun Jin; Lee, Myung Hwan; Kim, Jin-Cheol; Choi, Gyung Ja; Cho, Kwang Yun; Lee, Seon-Woo

    2007-10-01

    A metagenome is a unique resource to search for novel microbial enzymes from the unculturable microorganisms in soil. A forest soil metagenomic library using a fosmid and soil microbial DNA from Gwangneung forest, Korea, was constructed in Escherichia coli and screened to select lipolytic genes. A total of seven unique lipolytic clones were selected by screening of the 31,000-member forest soil metagenome library based on tributyrin hydrolysis. The ORFs for lipolytic activity were subcloned in a high copy number plasmid by screening the secondary shortgun libraries from the seven clones. Since the lipolytic enzymes were well secreted in E. coli into the culture broth, the lipolytic activity of the subclones was confirmed by the hydrolysis of p-nitrophenyl butyrate using culture broth. Deduced amino acid sequence analysis of the identified ORFs for lipolytic activity revealed that 4 genes encode hormone-sensitive lipase (HSL) in lipase family IV. Phylogenetic analysis indicated that 4 proteins were clustered with HSL in the database and other metagenomic HSLs. The other 2 genes and 1 gene encode non-heme peroxidase-like enzymes of lipase family V and a GDSL family esterase/lipase in family II, respectively. The gene for the GDSL enzyme is the first description of the enzyme from metagenomic screening.

  16. Production of cyanophycin in Rhizopus oryzae through the expression of a cyanophycin synthetase encoding gene.

    Science.gov (United States)

    Meussen, Bas J; Weusthuis, Ruud A; Sanders, Johan P M; Graaff, Leo H de

    2012-02-01

    Cyanophycin or cyanophycin granule peptide is a protein that results from non-ribosomal protein synthesis in microorganisms such as cyanobacteria. The amino acids in cyanophycin can be used as a feedstock in the production of a wide range of chemicals such as acrylonitrile, polyacrylic acid, 1,4-butanediamine, and urea. In this study, an auxotrophic mutant (Rhizopus oryzae M16) of the filamentous fungus R. oryzae 99-880 was selected to express cyanophycin synthetase encoding genes. These genes originated from Synechocystis sp. strain PCC6803, Anabaena sp. strain PCC7120, and a codon optimized version of latter gene. The genes were under control of the pyruvate decarboxylase promoter and terminator elements of R. oryzae. Transformants were generated by the biolistic transformation method. In only two transformants both expressing the cyanophycin synthetase encoding gene from Synechocystis sp. strain PCC6803 was a specific enzyme activity detected of 1.5 mU/mg protein. In one of these transformants was both water-soluble and insoluble cyanophycin detected. The water-soluble fraction formed the major fraction and accounted for 0.5% of the dry weight. The water-insoluble CGP was produced in trace amounts. The amino acid composition of the water-soluble form was determined and constitutes of equimolar amounts of arginine and aspartic acid.

  17. Primary microcephaly gene MCPH1 shows signatures of tumor suppressors and is regulated by miR-27a in oral squamous cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Thejaswini Venkatesh

    Full Text Available Mutations in the MCPH1 (microcephalin 1 gene, located at chromosome 8p23.1, result in two autosomal recessive disorders: primary microcephaly and premature chromosome condensation syndrome. MCPH1 has also been shown to be downregulated in breast, prostate and ovarian cancers, and mutated in 1/10 breast and 5/41 endometrial tumors, suggesting that it could also function as a tumor suppressor (TS gene. To test the possibility of MCPH1 as a TS gene, we first performed LOH study in a panel of 81 matched normal oral tissues and oral squamous cell carcinoma (OSCC samples, and observed that 14/71 (19.72% informative samples showed LOH, a hallmark of TS genes. Three protein truncating mutations were identified in 1/15 OSCC samples and 2/5 cancer cell lines. MCPH1 was downregulated at both the transcript and protein levels in 21/41 (51.22% and 19/25 (76% OSCC samples respectively. A low level of MCPH1 promoter methylation was also observed in 4/40 (10% tumor samples. We further observed that overexpression of MCPH1 decreased cellular proliferation, anchorage-independent growth in soft agar, cell invasion and tumor size in nude mice, indicating its tumor suppressive function. Using bioinformatic approaches and luciferase assay, we showed that the 3'-UTR of MCPH1 harbors two non-overlapping functional seed regions for miR-27a which negatively regulated its level. The expression level of miR-27a negatively correlated with the MCPH1 protein level in OSCC. Our study indicates for the first time that, in addition to its role in brain development, MCPH1 also functions as a tumor suppressor gene and is regulated by miR-27a.

  18. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...... and to the Saccharomyces cerevisiae STE6 gene product, which mediates export of a-factor mating pheromone. We show that STE6 can also mediate secretion of M-factor in S. pombe....

  19. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis

    Directory of Open Access Journals (Sweden)

    González Mauricio

    2009-09-01

    Full Text Available Abstract Background Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Results Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Conclusion Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we

  20. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis.

    Science.gov (United States)

    Zúñiga, Alejandro; Hödar, Christian; Hanna, Patricia; Ibáñez, Freddy; Moreno, Pablo; Pulgar, Rodrigo; Pastenes, Luis; González, Mauricio; Cambiazo, Verónica

    2009-09-22

    Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we recovered a substantial number of unknown genes encoding

  1. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  2. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  3. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  4. A highly conserved NB-LRR encoding gene cluster effective against Setosphaeria turcica in sorghum

    Directory of Open Access Journals (Sweden)

    Martin Tom

    2011-11-01

    Full Text Available Abstract Background The fungal pathogen Setosphaeria turcica causes turcicum or northern leaf blight disease on maize, sorghum and related grasses. A prevalent foliar disease found worldwide where the two host crops, maize and sorghum are grown. The aim of the present study was to find genes controlling the host defense response to this devastating plant pathogen. A cDNA-AFLP approach was taken to identify candidate sequences, which functions were further validated via virus induced gene silencing (VIGS, and real-time PCR analysis. Phylogenetic analysis was performed to address evolutionary events. Results cDNA-AFLP analysis was run on susceptible and resistant sorghum and maize genotypes to identify resistance-related sequences. One CC-NB-LRR encoding gene GRMZM2G005347 was found among the up-regulated maize transcripts after fungal challenge. The new plant resistance gene was designated as St referring to S. turcica. Genome sequence comparison revealed that the CC-NB-LRR encoding St genes are located on chromosome 2 in maize, and on chromosome 5 in sorghum. The six St sorghum genes reside in three pairs in one locus. When the sorghum St genes were silenced via VIGS, the resistance was clearly compromised, an observation that was supported by real-time PCR. Database searches and phylogenetic analysis suggest that the St genes have a common ancestor present before the grass subfamily split 50-70 million years ago. Today, 6 genes are present in sorghum, 9 in rice and foxtail millet, respectively, 3 in maize and 4 in Brachypodium distachyon. The St gene homologs have all highly conserved sequences, and commonly reside as gene pairs in the grass genomes. Conclusions Resistance genes to S. turcica, with a CC-NB-LRR protein domain architecture, have been found in maize and sorghum. VIGS analysis revealed their importance in the surveillance to S. turcica in sorghum. The St genes are highly conserved in sorghum, rice, foxtail millet, maize and

  5. Re-expression of methylation-induced tumor suppressor gene silencing is associated with the state of histone modification in gastric cancer cell lines.

    Science.gov (United States)

    Meng, Chun-Feng; Zhu, Xin-Jiang; Peng, Guo; Dai, Dong-Qiu

    2007-12-14

    To identify the relationship between DNA hyper-methylation and histone modification at a hyperme-thylated, silenced tumor suppressor gene promoter in human gastric cancer cell lines and to elucidate whether alteration of DNA methylation could affect histone modification. We used chromatin immunoprecipitation (ChIP) assay to assess the status of histone acetylation and methylation in promoter regions of the p16 and mutL homolog 1 (MLH1) genes in 2 gastric cancer cell lines, SGC-7901 and MGC-803. We used methylation-specific PCR (MSP) to evaluate the effect of 5-Aza-2'-deoxycytidine (5-Aza-dC), trichostatin A (TSA) or their combination treatment on DNA methylation status. We used RT-PCR to determine whether alterations of histone modification status after 5-Aza-dC and TSA treatment are reflected in gene expression. For the p16 and MLH1 genes in two cell lines, silenced loci associated with DNA hypermethylation were characterized by histone H3-K9 hypoacetylation and hypermethylation and histone H3-K4 hypomethylation. Treatment with TSA resulted in moderately increased histone H3-K9 acetylation at the silenced loci with no effect on histone H3-K9 methylation and minimal effects on gene expression. In contrast, treatment with 5-Aza-dC rapidly reduced histone H3-K9 methylation at the silenced loci and resulted in reactivation of the two genes. Combined treatment with 5-Aza-dC and TSA was synergistic in reactivating gene expression at the loci showing DNA hypermethylation. Similarly, histone H3-K4 methylation was not affected after TSA treatment, and increased moderately at the silenced loci after 5-Aza-dC treatment. Hypermethylation of DNA in promoter CpG islands is related to transcriptional silencing of tumor suppressor genes. Histone H3-K9 methylation in different regions of the promoters studied correlates with DNA methylation status of each gene in gastric cancer cells. However, histone H3-K9 acetylation and H3-K4 methylation inversely correlate with DNA methylation

  6. Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris.

    Science.gov (United States)

    Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro

    2015-08-01

    Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  7. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  8. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    Directory of Open Access Journals (Sweden)

    Dhia Bouktila

    2014-09-01

    Full Text Available Proteins containing nucleotide binding sites (NBS encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution.

  9. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  10. A corm-specific gene encodes tarin, a major globulin of taro (Colocasia esculenta L. Schott).

    Science.gov (United States)

    Bezerra, I C; Castro, L A; Neshich, G; de Almeida, E R; de Sá, M F; Mello, L V; Monte-Neshich, D C

    1995-04-01

    A gene encoding a globulin from a major taro (Colocasia esculenta L. Schott) corm protein family, tarin (G1, ca. 28 kDa) was isolated from a lambda Charon 35 library, using a cDNA derived from a highly abundant corm-specific mRNA, as probe. The gene, named tar1, and the corresponding cDNA were characterized and compared. No introns were found. The major transcription start site was determined by primer extension analysis. The gene has an open reading frame (ORF) of 765 bp, and the deduced amino acid sequence indicated a precursor polypeptide of 255 residues that is post-translationally processed into two subunits of about 12.5 kDa each. The deduced protein is 45% homologous to curculin, a sweet-tasting protein found in the fruit pulp of Curculigo latifolia and 40% homologous to a mannose-binding lectin from Galanthus nivalis. Significant similarity was also found at the nucleic acid sequence level with genes encoding lectins from plant species of the Amaryllidaceae and Lilliaceae families.

  11. [Cloning and structure of gene encoded alpha-latrocrustoxin from the Black widow spider venom].

    Science.gov (United States)

    Danilevich, V N; Luk'ianov, S A; Grishin, E V

    1999-07-01

    The primary structure of the crusta gene encoding alpha-latrocrustoxin (alpha-LCT), a high molecular mass neurotoxin specific to crustaceans, was determined in the black widow spider Latrodectus mactans tredicimguttatus genome. The total length of the sequenced DNA was 4693 bp. The structural part of the black widow spider chromosome gene encoding alpha-LCT does not contain introns. The sequenced DNA contains a single extended open reading frame (4185 bp) and encodes a protein precursor of alpha-LCT, comprising 1395 aa. We assume the Met residue at position -10 relative to the N-terminal residue of Glu1 of the mature toxin to be the first one in the protein precursor. The calculated molecular mass of the precursor (156147 Da) exceeds that of the mature toxin by approximately 30 kDa. These data are in agreement with the notion that over the course of maturation the protein precursor undergoes double processing--cleavage of a decapeptide from the N-terminal part and of a approximately 200-aa fragment from the C-terminal part. alpha-LCT displayed a number of imperfect ankyrin-like repeats and areas of structural homology with earlier studied latrotoxins; the highest homology degree (62%) was revealed with alpha-latroinsectotoxin (alpha-LIT).

  12. The immune gene repertoire encoded in the purple sea urchin genome.

    Science.gov (United States)

    Hibino, Taku; Loza-Coll, Mariano; Messier, Cynthia; Majeske, Audrey J; Cohen, Avis H; Terwilliger, David P; Buckley, Katherine M; Brockton, Virginia; Nair, Sham V; Berney, Kevin; Fugmann, Sebastian D; Anderson, Michele K; Pancer, Zeev; Cameron, R Andrew; Smith, L Courtney; Rast, Jonathan P

    2006-12-01

    Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the vertebrate adaptive immune system. Here we present an initial survey of the purple sea urchin genome for genes associated with immunity. An elaborate repertoire of potential immune receptors, regulators and effectors is present, including unprecedented expansions of innate pathogen recognition genes. These include a diverse array of 222 Toll-like receptor (TLR) genes and a coordinate expansion of directly associated signaling adaptors. Notably, a subset of sea urchin TLR genes encodes receptors with structural characteristics previously identified only in protostomes. A similarly expanded set of 203 NOD/NALP-like cytoplasmic recognition proteins is present. These genes have previously been identified only in vertebrates where they are represented in much lower numbers. Genes that mediate the alternative and lectin complement pathways are described, while gene homologues of the terminal pathway are not present. We have also identified several homologues of genes that function in jawed vertebrate adaptive immunity. The most striking of these is a gene cluster with similarity to the jawed vertebrate Recombination Activating Genes 1 and 2 (RAG1/2). Sea urchins are long-lived, complex organisms and these findings reveal an innate immune system of unprecedented complexity. Whether the presumably intense selective processes that molded these gene families also gave rise to novel immune mechanisms akin to adaptive systems remains to be seen. The genome sequence provides immediate opportunities to apply the advantages of the sea urchin model toward problems in developmental and evolutionary immunobiology.

  13. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  14. Phylogenetic and evolutionary analysis of NBS-encoding genes in Rosaceae fruit crops.

    Science.gov (United States)

    Xu, Qiang; Wen, Xiaopeng; Deng, Xiuxin

    2007-07-01

    Phylogenetic relationships of the nucleotide binding site (NBS)-encoding resistance gene homologues (RGHs) among 12 species in five genera of Rosaceae fruit crops were evaluated. A total of 228 Rosaceous RGHs were deeply separated into two distinct clades, designated as TIR (sequences within this clade containing a Toll Interleukin-1 Receptor domain) and NonTIR (sequences lacking a TIR domain). Most Rosaceous RGH genes were phylogenetically distinct from Arabidopsis, Rice or Pine genes, except for a few Rosaceous members which grouped closely with Arabidopsis genes. Within Rosaceae, sequences from multiple species were often phylogenetically clustered together, forming heterogenous groups, however, apple- and chestnut rose-specific groups really exist. Gene duplication followed by sequence divergence were proposed as the mode for the evolution of a large number of distantly or closely related RGH genes in Rosaceae, and this mode may play a role in the generation of new resistance specificity. Positively selected sites within NBS-coding region were detected and thus nucleotide variation within NBS domain may function in determining disease resistance specificity. This study also discusses the synteny of a genomic region that encompass powdery mildew resistance locus among Malus, Prunus and Rosa, which may have potential use for fruit tree disease breeding and important gene cloning.

  15. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  16. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  17. Isolation and sequence analysis of the gene encoding triose phosphate isomerase from Zygosaccharomyces bailii.

    Science.gov (United States)

    Merico, A; Rodrigues, F; Côrte-Real, M; Porro, D; Ranzi, B M; Compagno, C

    2001-06-30

    The ZbTPI1 gene encoding triose phosphate isomerase (TIM) was cloned from a Zygosaccharomyces bailii genomic library by complementation of the Saccharomyces cerevisiae tpi1 mutant strain. The nucleotide sequence of a 1.5 kb fragment showed an open reading frame (ORF) of 746 bp, encoding a protein of 248 amino acid residues. The deduced amino acid sequence shares a high degree of homology with TIMs from other yeast species, including some highly conserved regions. The analysis of the promoter sequence of the ZbTPI1 revealed the presence of putative motifs known to have regulatory functions in S. cerevisiae. The GenBank Accession No. of ZbTPI1 is AF325852. Copyright 2001 John Wiley & Sons, Ltd.

  18. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes.

    NARCIS (Netherlands)

    Jensen, A.; Magistrado, P.; Sharp, S.; Joergensen, L.; Lavstsen, T.; Chiucchiuini, A.; Salanti, A.; Vestergaard, L.S.; Lusingu, J.P.; Hermsen, R.; Sauerwein, R.W.; Christensen, J.; Nielsen, M.A.; Hviid, L.; Sutherland, C.J.; Staalsoe, T.; Theander, T.G.

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in

  19. Identification and characterization of the Vibrio anguillarum prtV gene encoding a new metalloprotease

    Science.gov (United States)

    Mo, Zhaolan; Guo, Dongsheng; Mao, Yunxiang; Ye, Xuhong; Zou, Yuxia; Xiao, Peng; Hao, Bin

    2010-01-01

    We cloned and sequenced a prtV-like gene from Vibrio anguillarum M3 strain. This prtV gene encodes a putative protein of 918 amino acids, and is highly homologous to the V. cholerae prtV gene. We found that a prtV insertion mutant strain displayed lower gelatinase activity on gelatin agar, lower protease activity against azocasein, and lower activity for four glycosidases. This prtV mutant strain also had increased activity for two esterases in its extracellular products, as analyzed by the API ZYM system. In addition, the prtV mutant strain exhibited decreased growth in turbot intestinal mucus and reduced hemolytic activity on turbot erythrocytes. Infection experiments showed that the LD50 of the prtV mutant strain increased by at least 1 log compared to the wild-type in turbot fish. We propose that prtV plays an important role in the pathogenesis of V. anguillarum.

  20. Genetic variability in the sable (Martes zibellina L.) with respect to genes encoding blood proteins

    Energy Technology Data Exchange (ETDEWEB)

    Kashtanov, S.N. [Vavilov Institute of General Genetics, Moscow (Russian Federation); Kazakova, T.I. [Afanas`ev Scientific Research Institute for Breeding of Fur-Bearing Animals, Moscow (Russian Federation)

    1995-02-01

    Electrophoresis of blood proteins was used to determine, for the first time, the level of genetic variability of certain loci in the sable (Martes zibellina L., Mustelidae). Variation of 23 blood proteins encoded by 25 genes was analyzed. Polymorphism was revealed in six genes. The level of heterozygosity was estimated at 0.069; the proportion of polymorphic loci was 24%. Data on the history of the sable population maintained at the farm, on geographical distribution of natural sable populations, and on the number of animals selected for reproduction in captivity is presented. The great number of animals studies and the extensive range of natural sable populations, on the basis of which the population maintained in captivity was obtained, suggest that the results of this work can be used for estimating the variability of the gene pool of sable as a species. 9 refs., 2 figs., 1 tab.

  1. Sodium butyrate induces cell death by autophagy and reactivates a tumor suppressor gene DIRAS1 in renal cell carcinoma cell line UOK146.

    Science.gov (United States)

    Verma, Shiv Prakash; Agarwal, Ayushi; Das, Parimal

    2018-04-01

    Sodium butyrate (SB), a histone deacetylase inhibitor, is emerging as a potent anti-cancer drug for different types of cancers. In the present study, anti-cancer activity of SB in Xp11.2 (TFE3) translocated renal cell carcinoma cell line UOK146 was studied. Anti-proliferative effect of SB in renal cell carcinoma (RCC) cell line UOK146 was evaluated by MTT assay and morphological characteristics were observed by phase contrast microscopy which displayed the cell death after SB treatment. SB induces DNA fragmentation and change in nuclear morphology observed by increased sub-G1 region cell population and nuclear blebbings. Cell cycle arrest at G2/M phase was found after SB treatment. UOK146 cell line shows autophagy mode of cell death as displayed by acridine orange staining and flow cytometry analysis. LC3-II, a protein marker of autophagy, was also found to be upregulated after SB treatment. A tumor suppressor gene DIRAS1 was upregulated after SB treatment, displaying its anti-cancer potential at molecular level. These findings suggest that SB could serve as a novel regulator of tumor suppressors and lead to the discovery of novel therapeutics with better and enhanced anti-cancer activity.

  2. The expression of a tumor suppressor gene JDP2 and its prognostic value in hepatocellular carcinoma patients.

    Science.gov (United States)

    Chen, Yao-Li; Chan, Shih-Hsuan; Lin, Ping-Yi; Chu, Pei-Yi

    2017-05-01

    The c-Jun dimerization protein 2 (JDP2) belongs to the activator protein-1 (AP-1) family and functions as a repressor of the AP-1 complex by dimerizing with other c-Jun proteins. Thus, JDP2 plays an important role in the repression of AP-1-driven biological processes, such as differentiation and proliferation. Recent studies have suggested that JDP2 may function as a tumor suppressor through its suppressive action against the AP-1 complex, which is known to drive oncogenic signals in several human malignancies. In this study, we used immunohistochemistry to examine the JDP2 expression in 211 cases of hepatocellular carcinoma (HCC) and analyzed the potential link of JDP2 expression to the clinicopathological features of HCC patients. Clinical parameter analysis showed that high expression of JDP2 was significantly correlated with smaller tumor size (P=.002) and early stage HCC (P=.039). Moreover, Kaplan-Meier survival analysis showed that high expression of JDP2 was significantly associated with better survival in HCC patients (P=.006). Taken together, our results showed that JDP2 may serve as a tumor suppressor in HCC and could therefore serve as a good prognostic marker for patients with HCC. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    NARCIS (Netherlands)

    Dijkman, Ronald; Jebbink, Maarten F.; Wilbrink, Berry; Pyrc, Krzysztof; Zaaijer, Hans L.; Minor, Philip D.; Franklin, Sally; Berkhout, Ben; Thiel, Volker; van der Hoek, Lia

    2006-01-01

    BACKGROUND: The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV) 229E. The prototype virus has a

  4. A gene encoding phosphatidylethanolamine N-methyltransferase from Acetobacter aceti and some properties of its disruptant.

    Science.gov (United States)

    Hanada, T; Kashima, Y; Kosugi, A; Koizumi, Y; Yanagida, F; Udaka, S

    2001-12-01

    Phosphatidylcholine (PC) is a major component of membranes not only in eukaryotes, but also in several bacteria, including Acetobacter. To identify the PC biosynthetic pathway and its role in Acetobacter sp., we have studied Acetobacter aceti IFO3283, which is characterized by high ethanol oxidizing ability and high resistance to acetic acid. The pmt gene of A. aceti, encoding phosphatidylethanolamine N-methyltransferase (Pmt), which catalyzes methylation of phosphatidylethanolamine (PE) to PC, has been cloned and sequenced. One recombinant plasmid that complemented the PC biosynthesis was isolated from a gene library of the genomic DNA of A. aceti. The pmt gene encodes a polypeptide with molecular mass of either 25125, 26216, or 29052 for an about 27-kDa protein. The sequence of this gene showed significant similarity (44.3% identity in the similar sequence region) with the Rhodobacter sphaeroides pmtA gene which is involved in PE N-methylation. When the pmt gene was expressed in E. coli, which lacks PC, the Pmt activity and PC formation were clearly demonstrated. A. aceti strain harboring an interrupted pmt allele, pmt::Km, was constructed. The pmt disruption was confirmed by loss of Pmt and PC, and by Southern blot analyses. The null pmt mutant contained no PC, but tenfold more PE and twofold more phosphatidylglycerol (PG). The pmt disruptant did not show any dramatic effects on growth in basal medium supplemented with ethanol, but the disruption caused slow growth in basal medium supplemented with acetate. These results suggest that the lack of PC in the A. aceti membrane may be compensated by the increases of PE and PG by an unknown mechanism, and PC in A. aceti membrane is related to its acetic acid tolerance.

  5. Cis and trans interactions between genes encoding PAF1 complex and ESCRT machinery components in yeast.

    Science.gov (United States)

    Rodrigues, Joana; Lydall, David

    2018-03-22

    Saccharomyces cerevisiae is a commonly used model organism for understanding eukaryotic gene function. However, the close proximity between yeast genes can complicate the interpretation of yeast genetic data, particularly high-throughput data. In this study, we examined the interplay between genes encoding components of the PAF1 complex and VPS36, the gene located next to CDC73 on chromosome XII. The PAF1 complex (Cdc73, Paf1, Ctr9, Leo1, and Rtf1, in yeast) affects RNA levels by affecting transcription, histone modifications, and post-transcriptional RNA processing. The human PAF1 complex is linked to cancer, and in yeast, it has been reported to play a role in telomere biology. Vps36, part of the ESCRT-II complex, is involved in sorting proteins for vacuolar/lysosomal degradation. We document a complex set of genetic interactions, which include an adjacent gene effect between CDC73 and VPS36 and synthetic sickness between vps36Δ and cdc73Δ, paf1Δ, or ctr9Δ. Importantly, paf1Δ and ctr9Δ are synthetically lethal with deletions of other components of the ESCRT-II (SNF8 and VPS25), ESCRT-I (STP22), or ESCRT-III (SNF7) complexes. We found that RNA levels of VPS36, but not other ESCRT components, are positively regulated by all components of the PAF1 complex. Finally, we show that deletion of ESCRT components decreases the telomere length in the S288C yeast genetic background, but not in the W303 background. Together, our results outline complex interactions, in cis and in trans, between genes encoding PAF1 and ESCRT-II complex components that affect telomere function and cell viability in yeast.

  6. Lysine demethylase KDM2A inhibits TET2 to promote DNA methylation and silencing of tumor suppressor genes in breast cancer.

    Science.gov (United States)

    Chen, J-Y; Luo, C-W; Lai, Y-S; Wu, C-C; Hung, W-C

    2017-08-07

    The coupling between DNA methylation and histone modification contributes to aberrant expression of oncogenes or tumor suppressor genes that leads to tumor development. Our previous study demonstrated that lysine demethylase 2A (KDM2A) functions as an oncogene in breast cancer by promoting cancer stemness and angiogenesis via activation of the Notch signaling. Here, we demonstrate that knockdown of KDM2A significantly increases the 5'-hydroxymethylcytosine (5'-hmc) level in genomic DNA and expression of tet-eleven translocation 2 (TET2) in various breast cancer cell lines. Conversely, ectopic expression of KDM2A inhibits TET2 expression in KDM2A-depleted cells suggesting TET2 is a transcriptional repression target of KDM2A. Our results show that KDM2A interacts with RelA to co-occupy at the TET2 gene promoter to repress transcription and depletion of RelA or KDM2A restores TET2 expression. Upregulation of TET2 in the KDM2A-depleted cells induces the re-activation of two TET downstream tumor suppressor genes, epithelial cell adhesion molecule (EpCAM) and E-cadherin, and inhibits migration and invasion. On the contrary, knockdown of TET2 in these cells decreases EpCAM and E-cadherin and increases cell invasiveness. More importantly, TET2 expression is negatively associated KDM2A in triple-negative breast tumor tissues, and its expression predicts a better survival. Taken together, we demonstrate for the first time that TET2 is a direct repression target of KDM2A and reveal a novel mechanism by which KDM2A promotes DNA methylation and breast cancer progression via the inhibition of a DNA demethylase.

  7. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  8. High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

    Directory of Open Access Journals (Sweden)

    Bianco Linda

    2009-11-01

    Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

  9. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA.

    Science.gov (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B

    2003-11-01

    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  10. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  11. The Lethal Toxin from Australian Funnel-Web Spiders Is Encoded by an Intronless Gene

    Science.gov (United States)

    Pineda, Sandy Steffany; Wilson, David; Mattick, John S.; King, Glenn F.

    2012-01-01

    Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome. PMID:22928020

  12. Cloning and characterization of a gene encoding trehalose phosphorylase (TP) from Pleurotus sajor-caju.

    Science.gov (United States)

    Han, Sang-Eun; Kwon, Hawk-Bin; Lee, Seung-Bum; Yi, Bu-Young; Murayama, Ikuo; Kitamoto, Yutaka; Byun, Myung-Ok

    2003-08-01

    Complementary DNA for a gene encoding trehalose phosphorylase (TP) that reversibly catalyzes trehalose synthesis and degradation from alpha-glucose-1-phosphate (alpha-Glc-1-P) and glucose was cloned from Pleurotus sajor-caju. The cDNA of P. sajor-caju TP (designated PsTP, GenBank Accession No. AF149777) encodes a polypeptide of 751 amino acids with a deduced molecular mass of 83.7 kDa. The PsTP gene is expressed in mycelia, pilei, and stipes of fruiting bodies. Trehalose phosphorylase PsTP was purified from PsTP-transformed Escherichia coli. The enzyme catalyzes both the phosphorolysis of trehalose to produce alpha-Glc-1-P and glucose, and the synthesis of trehalose. The apparent K(m) values for trehalose and Pi in phosphorolytic reaction at pH 7.0 were 74.8 and 5.4 mM, respectively. The PsTP gene complemented Saccharomyces cerevisiae Deltatps1, Deltatps2 double-mutant cells, allowing their growth on glucose medium. Furthermore, yeast transformed with PsTP produced 2-2.5-fold more trehalose than non-transformants or cells transformed with empty vector only.

  13. The lethal toxin from Australian funnel-web spiders is encoded by an intronless gene.

    Directory of Open Access Journals (Sweden)

    Sandy Steffany Pineda

    Full Text Available Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome.

  14. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae.

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro

    2016-03-04

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Directory of Open Access Journals (Sweden)

    Silke Roedder

    2017-11-01

    Full Text Available Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (<21 years and adult (>21 years renal allograft recipients at the point of AR (n = 61 and absence of rejection (n = 94 for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection. Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression.

  16. The Neurospora crassa colonial temperature-sensitive 3 (cot-3) gene encodes protein elongation factor 2.

    Science.gov (United States)

    Propheta, O; Vierula, J; Toporowski, P; Gorovits, R; Yarden, O

    2001-02-01

    At elevated temperatures, the Neurospora crassa mutant colonial, temperature-sensitive 3 (cot-3) forms compact, highly branched colonies. Growth of the cot-3 strain under these conditions also results in the loss of the lower molecular weight (LMW) isoform of the Ser/Thr protein kinase encoded by the unlinked cot-1 gene, whose function is also involved in hyphal elongation. The unique cot-3 gene has been cloned by complementation and shown to encode translation elongation factor 2 (EF-2). As expected for a gene with a general role in protein synthesis, cot-3 mRNA is abundantly expressed throughout all asexual phases of the N. crassa life cycle. The molecular basis of the cot-3 mutation was determined to be an ATT to AAT transversion, which causes an Ile to Asn substitution at residue 278. Treatment with fusidic acid (a specific inhibitor of EF-2) inhibits hyphal elongation and induces hyperbranching in a manner which mimics the cot-3 phenotype, and also leads to a decrease in the abundance of the LMW isoform of COT1. This supports our conclusion that the mutation in cot-3 which results in abnormal hyphal elongation/branching impairs EF-2 function and confirms that the abundance of a LMW isoform of COT1 kinase is dependent on the function of this general translation factor.

  17. The CREB Coactivator CRTC2 Is a Lymphoma Tumor Suppressor that Preserves Genome Integrity through Transcription of DNA Mismatch Repair Genes.

    Science.gov (United States)

    Fang, Minggang; Pak, Magnolia L; Chamberlain, Lynn; Xing, Wei; Yu, Hongbo; Green, Michael R

    2015-06-09

    The CREB-regulated transcription coactivator CRTC2 stimulates CREB target gene expression and has a well-established role in modulating glucose and lipid metabolism. Here, we find, unexpectedly, that loss of CRTC2, as well as CREB1 and its coactivator CREB-binding protein (CBP), results in a deficiency in DNA mismatch repair (MMR) and a resultant increased mutation frequency. We show that CRTC2, CREB1, and CBP are transcriptional activators of well-established MMR genes, including EXO1, MSH6, PMS1, and POLD2. Mining of expression profiling databases and analysis of patient samples reveal that CRTC2 and its target MMR genes are downregulated in specific T cell lymphoma subtypes, which are microsatellite unstable. The levels of acetylated histone H3 on the CRTC2 promoter are significantly reduced in lymphoma in comparison to normal tissue, explaining the decreased CRTC2 expression. Our results establish a role for CRTC2 as a lymphoma tumor suppressor gene that preserves genome integrity by stimulating transcription of MMR genes. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Physical mapping of chromosome 17p13.3 in the region of a putative tumor suppressor gene important in medulloblastoma

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, J.D.; Daneshvar, L.; Willert, J.R. [Univ. of California, San Franciso, CA (United States)] [and others

    1994-09-01

    Deletion mapping of a medulloblastoma tumor panel revealed loss of distal chromosome 17p13.3 sequences in tumors from 14 of 32 patients (44%). Of the 14 tumors showing loss of heterozygosity by restriction fragment length polymorphism analysis, 14 of 14 (100%) displayed loss of the telomeric marker p144-D6 (D17S34), while a probe for the ABR gene on 17p13.3 was lost in 7 of 8 (88%) informative cases. Using pulsed-field gel electrophoresis, we localized the polymorphic marker (VNTR-A) of the ABR gene locus to within 220 kb of the p144-D6 locus. A cosmid contig constructed in this region was used to demonstrate by fluorescence in situ hybridization that the ABR gene is oriented transcriptionally 5{prime} to 3{prime} toward the telomere. This report provides new physical mapping data for the ABR gene, which has not been previously shown to be deleted in medulloblastoma. These results provide further evidence for the existence of a second tumor suppressor gene distinct from p53 on distal chromosome 17p. 12 refs., 3 figs.

  19. Tumoral tissue specific promoter hypermethylation of distinct tumor suppressor genes in a case with non--small cell lung carcinoma: A case report

    Directory of Open Access Journals (Sweden)

    Arslan Sulhattin

    2008-01-01

    Full Text Available Objective: Non-small cell lung carcinoma is an aggressive phenomenon and the epigenetical alterations of some tumor supressor genes have been reported for the different tumor types. Case Presentation: It is presented a case report concerning a 43 years old male with NSCLC on the lower segment of the right lung. The patient underwent a diag-nostic excisional thin-needle biopsy and after the histological confirmation. We examined the promoter methylation status of some distinct tumor supressor genes in tumoral and blood tissues of the case after sodium bisulfite conversion and DNA amplification with methylation specific multiplex PCR technique. Both tissues were also searched for G to A transitions in codons 12 and 13 of the K-ras proto-oncogene. Results: Tumor specimen showed fully methyl pattern profiles for the SFRP2, p16, DAPK1 and partially hyper-methylated profile for the p53 and MGMT genes in this case with non-small lung carci-noma. Blood speicemen showed normal hypomethylated profiles for all studied TS genes. The K-ras proto-oncogene was in normal structure both in blood and tumoral spiecemens that examined. Conclusion: Results indicate that genes exhibit tumor suppressor activi-ties in blood, but exhibit epigenetic inactivation in carcinoma cell. These findings strongly support the hypothesis that epigenetic mechanisms may play an important role in the non-small cell lung carcinogenesis in human.

  20. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods.

    Science.gov (United States)

    Jung, Yangjin; Matthews, Karl R

    2016-12-01

    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. The ROOT HAIRLESS 1 gene encodes a nuclear protein required for root hair initiation in Arabidopsis.

    Science.gov (United States)

    Schneider, K; Mathur, J; Boudonck, K; Wells, B; Dolan, L; Roberts, K

    1998-07-01

    The epidermis of Arabidopsis wild-type primary roots, in which some cells grow hairs and others remain hairless in a position-dependent manner, has become an established model system to study cell differentiation. Here we present a molecular analysis of the RHL1 (ROOT HAIRLESS 1) gene that, if mutated, prevents the formation of hairs on primary roots and causes a seedling lethal phenotype. We have cloned the RHL1 gene by use of a T-DNA-tagged mutant and found that it encodes a protein that appears to be plant specific. The predicted RHL1 gene product is a small hydrophilic protein (38.9 kD) containing putative nuclear localization signals and shows no significant homology to any known amino acid sequence. We demonstrate that a 78-amino-acid sequence at its amino terminus is capable of directing an RHL1-GFP fusion protein to the nucleus. The RHL1 transcript is present throughout the wild-type plant and in suspension culture cells, but in very low amounts, suggesting a regulatory function for the RHL1 protein. Structural evidence suggests a role for the RHL1 gene product in the nucleolus. We have examined the genetic relationship between RHL1 and GL2, an inhibitor of root hair initiation in non-hair cells. Our molecular and genetic data with double mutants, together with the expression analysis of a GL2 promoter-GUS reporter gene construct, indicate that the RHL1 gene acts independently of GL2.

  2. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  3. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  4. Phytochrome-regulated expression of the genes encoding the small GTP-binding proteins in peas.

    OpenAIRE

    Yoshida, K; Nagano, Y; Murai, N; Sasaki, Y

    1993-01-01

    We examined the effect of light on the mRNA levels of 11 genes (pra1-pra9A, pra9B, and pra9C) encoding the small GTP-binding proteins that belong to the ras superfamily in Pisum sativum. When the dark-grown seedlings were exposed to continuous white light for 24 hr, the levels of several pra mRNAs in the pea buds decreased: pra2 and pra3 mRNAs decreased markedly; pra4, pra6, and pra9A mRNAs decreased slightly; the other 6 pra mRNAs did not decrease. We studied the kinetics of mRNA accumulatio...

  5. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  6. Loss of function of the tuberous sclerosis 2 tumor suppressor gene results in embryonic lethality characterized by disrupted neuroepithelial growth and development

    Science.gov (United States)

    Rennebeck, Gabriela; Kleymenova, Elena V.; Anderson, Rebecca; Yeung, Raymond S.; Artzt, Karen; Walker, Cheryl L.

    1998-01-01

    Germline defects in the tuberous sclerosis 2 (TSC2) tumor suppressor gene predispose humans and rats to benign and malignant lesions in a variety of tissues. The brain is among the most profoundly affected organs in tuberous sclerosis (TSC) patients and is the site of development of the cortical tubers for which the hereditary syndrome is named. A spontaneous germline inactivation of the Tsc2 locus has been described in an animal model, the Eker rat. We report that the homozygous state of this mutation (Tsc2Ek/Ek) was lethal in mid-gestation (the equivalent of mouse E9.5–E13.5), when Tsc2 mRNA was highly expressed in embryonic neuroepithelium. During this period homozygous mutant Eker embryos lacking functional Tsc2 gene product, tuberin, displayed dysraphia and papillary overgrowth of the neuroepithelium, indicating that loss of tuberin disrupted the normal development of this tissue. Interestingly, there was significant intraspecies variability in the penetrance of cranial abnormalities in mutant embryos: the Long–Evans strain Tsc2Ek/Ek embryos displayed these defects whereas the Fisher 344 homozygous mutant embryos had normal-appearing neuroepithelium. Taken together, our data indicate that the Tsc2 gene participates in normal brain development and suggest the inactivation of this gene may have similar functional consequences in both mature and embryonic brain. PMID:9861021

  7. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  8. Molecular cloning and characterization of a glutathione S-transferase encoding gene from Opisthorchis viverrini.

    Science.gov (United States)

    Eursitthichai, Veerachai; Viyanant, Vithoon; Vichasri-Grams, Suksiri; Sobhon, Prasert; Tesana, Smarn; Upatham, Suchart Edward; Hofmann, Annemarie; Korge, Günter; Grams, Rudi

    2004-12-01

    An adult stage Opisthorchis viverrini cDNA library was constructed and screened for abundant transcripts. One of the isolated cDNAs was found by sequence comparison to encode a glutathione S-transferase (GST) and was further analyzed for RNA expression, encoded protein function, tissue distribution and cross-reactivity of the encoded protein with other trematode protein counterparts. The cDNA has a size of 893 bp and encodes a GST of 213 amino acids length (OV28GST). The most closely-related GST of OV28GST among those published for trematodes is a 28 kDa GST of Clonorchis sinensis as shown by multiple sequence alignment and phylogenetic analysis. Northern analysis of total RNA with a gene-specific probe revealed a 900 nucleotide OV28GST transcriptional product in the adult parasite. Through RNA in situ hybridization OV28GST RNA was detected in the parenchymal cells of adult parasites. This result was confirmed by immunolocalization of OV28GST with an antiserum generated in a mouse against bacterially-produced recombinant OV28GST. Both, purified recombinant and purified native OV28GST were resolved as 28 kDa proteins by SDS-PAGE. Using the anti-recOV28GST antiserum, no or only weak cross-reactivity was observed in an immunoblot of crude worm extracts against the GSTs of Schistosoma mansoni, S. japonicum, S. mekongi, Eurytrema spp. and Fasciola gigantica. The enzyme activity of the purified recombinant OV28GST was verified by a standard 1-chloro-2, 4-dinitrobenzene (CDNB) based activity assay. The present results of our molecular analysis of OV28GST should be helpful in the ongoing development of diagnostic applications for opisthorchiasis viverrini.

  9. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata

    Science.gov (United States)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin

    2011-03-01

    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  10. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  11. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  12. Multidrug resistance in fungi: regulation of transporter-encoding gene expression.

    Science.gov (United States)

    Paul, Sanjoy; Moye-Rowley, W Scott

    2014-01-01

    A critical risk to the continued success of antifungal chemotherapy is the acquisition of resistance; a risk exacerbated by the few classes of effective antifungal drugs. Predictably, as the use of these drugs increases in the clinic, more resistant organisms can be isolated from patients. A particularly problematic form of drug resistance that routinely emerges in the major fungal pathogens is known as multidrug resistance. Multidrug resistance refers to the simultaneous acquisition of tolerance to a range of drugs via a limited or even single genetic change. This review will focus on recent progress in understanding pathways of multidrug resistance in fungi including those of most medical relevance. Analyses of multidrug resistance in Saccharomyces cerevisiae have provided the most detailed outline of multidrug resistance in a eukaryotic microorganism. Multidrug resistant isolates of S. cerevisiae typically result from changes in the activity of a pair of related transcription factors that in turn elicit overproduction of several target genes. Chief among these is the ATP-binding cassette (ABC)-encoding gene PDR5. Interestingly, in the medically important Candida species, very similar pathways are involved in acquisition of multidrug resistance. In both C. albicans and C. glabrata, changes in the activity of transcriptional activator proteins elicits overproduction of a protein closely related to S. cerevisiae Pdr5 called Cdr1. The major filamentous fungal pathogen, Aspergillus fumigatus, was previously thought to acquire resistance to azole compounds (the principal antifungal drug class) via alterations in the azole drug target-encoding gene cyp51A. More recent data indicate that pathways in addition to changes in the cyp51A gene are important determinants in A. fumigatus azole resistance. We will discuss findings that suggest azole resistance in A. fumigatus and Candida species may share more mechanistic similarities than previously thought.

  13. Cell type-specific transcriptional regulation of the gene encoding importin-α1

    International Nuclear Information System (INIS)

    Kamikawa, Yasunao; Yasuhara, Noriko; Yoneda, Yoshihiro

    2011-01-01

    Importin-α1 belongs to a receptor family that recognizes classical nuclear localization signals. Encoded by Kpna2, this receptor subtype is highly expressed in mouse embryonic stem (ES) cells. In this study, we identified a critical promoter region in Kpna2 and showed that the expression of this gene is differentially regulated in ES cells and NIH3T3 cells. Conserved CCAAT boxes are required for Kpna2 promoter activity in both ES and NIH3T3 cells. Interestingly, deletion of the region from nucleotide position - 251 to - 179 bp resulted in a drastic reduction in Kpna2 transcriptional activity only in ES cells. This region contains Krueppel-like factor (Klf) binding sequences and is responsible for transactivation of the gene by Klf2 and Klf4. Accordingly, endogenous Kpna2 mRNA levels decreased in response to depletion of Klf2 and Klf4 in ES cells. Our results suggest that Klf2 and Klf4 function redundantly to drive high level of Kpna2 expression in ES cells. -- Research Highlights: → We showed the cell type-specific transcriptional regulation of Kpna2 encoding importin-al. → NF-Y binds the CCAAT boxes to activate Kpna2 transcription in NIH3T3 cells. → Klf2 and Klf4 redundantly activate the expression of Kpna2 in ES cells.

  14. Cloning, sequencing and expression of the gene encoding the extracellular metalloprotease of Aeromonas caviae.

    Science.gov (United States)

    Kawakami, K; Toma, C; Honma, Y

    2000-01-01

    A gene (apk) encoding the extracellular protease of Aeromonas caviae Ae6 has been cloned and sequenced. For cloning the gene, the DNA genomic library was screened using skim milk LB agar. One clone harboring plasmid pKK3 was selected for sequencing. Nucleotide sequencing of the 3.5 kb region of pKK3 revealed a single open reading frame (ORF) of 1,785 bp encoding 595 amino acids. The deduced polypeptide contained a putative 16-amino acid signal peptide followed by a large propeptide. The N-terminal amino acid sequence of purified recombinant protein (APK) was consistent with the DNA sequence. This result suggested a mature protein of 412 amino acids with a molecular mass of 44 kDa. However, the molecular mass of purified recombinant APK revealed 34 kDa by SDS-PAGE, suggesting that further processing at the C-terminal region took place. The 2 motifs of zinc binding sites deduced are highly conserved in the APK as well as in other zinc metalloproteases including Vibrio proteolyticus neutral protease, Emp V from Vibrio vulnificus, HA/P from Vibrio cholerae, and Pseudomonas aeruginosa elastase. Proteolytic activity was inhibited by EDTA, Zincov, 1,10-phenanthroline and tetraethylenepentamine while unaffected by the other inhibitors tested. The protease showed maximum activity at pH 7.0 and was inactivated by heating at 80 C for 15 min. These results together suggest that APK belongs to the thermolysin family of metalloendopeptidases.

  15. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  16. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    Science.gov (United States)

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  17. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Science.gov (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  18. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  19. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  20. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  1. Adenovirus carrying gene encoding Haliotis discus discus sialic acid binding lectin induces cancer cell apoptosis.

    Science.gov (United States)

    Yang, Xinyan; Wu, Liqin; Duan, Xuemei; Cui, Lianzhen; Luo, Jingjing; Li, Gongchu

    2014-06-30

    Lectins exist widely in marine bioresources such as bacteria, algae, invertebrate animals and fishes. Some purified marine lectins have been found to elicit cytotoxicity to cancer cells. However, there are few reports describing the cytotoxic effect of marine lectins on cancer cells through virus-mediated gene delivery. We show here that a replication-deficient adenovirus-carrying gene encoding Haliotis discus discus sialic acid binding lectin (Ad.FLAG-HddSBL) suppressed cancer cell proliferation by inducing apoptosis, as compared to the control virus Ad.FLAG. A down-regulated level of anti-apoptosis factor Bcl-2 was suggested to be responsible for the apoptosis induced by Ad.FLAG-HddSBL infection. Further subcellular localization studies revealed that HddSBL distributed in cell membrane, ER, and the nucleus, but not in mitochondria and Golgi apparatus. In contrast, a previously reported mannose-binding lectin Pinellia pedatisecta agglutinin entered the nucleus as well, but did not distribute in inner membrane systems, suggesting differed intracellular sialylation and mannosylation, which may provide different targets for lectin binding. Further cancer-specific controlling of HddSBL expression and animal studies may help to provide insights into a novel way of anti-cancer marine lectin gene therapy. Lectins may provide a reservoir of anti-cancer genes.

  2. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  3. The Bradyrhizobium japonicum frcB Gene Encodes a Diheme Ferric Reductase ▿†

    Science.gov (United States)

    Small, Sandra K.; O'Brian, Mark R.

    2011-01-01

    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria. PMID:21705608

  4. The Bradyrhizobium japonicum frcB gene encodes a diheme ferric reductase.

    Science.gov (United States)

    Small, Sandra K; O'Brian, Mark R

    2011-08-01

    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria.

  5. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2015-04-01

    Full Text Available The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produce a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous genes. We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters.

  6. Hypoxia-inducible genes encoding small EF-hand proteins in rice and tomato.

    Science.gov (United States)

    Otsuka, Chie; Minami, Ikuko; Oda, Kenji

    2010-01-01

    Rice has evolved metabolic and morphological adaptations to low-oxygen stress to grow in submerged paddy fields. To characterize the molecular components that mediate the response to hypoxia in rice, we identified low-oxygen stress early response genes by microarray analysis. Among the highly responsive genes, five genes, OsHREF1 to OsHREF5, shared strong homology. They encoded small proteins harboring two EF-hands, typical Ca(2+)-binding motifs. Homologous genes were found in many land plants, including SlHREF in tomato, which is also strongly induced by hypoxia. SlHREF induction was detected in both roots and shoots of tomato plants under hypoxia. With the exception of OsHREF5, OsHREF expression was unaffected by drought, salinity, cold, or osmotic stress. Fluorescent signals of green fluorescent protein-fused OsHREFs were detected in the cytosol and nucleus. Ruthenium red, an inhibitor of intracellular Ca(2+) release, repressed induction of OsHREF1-4 under hypoxia. The HREFs may be related to the Ca(2+) response to hypoxia.

  7. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  8. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans

    Science.gov (United States)

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress. PMID:15115284

  9. Mitochondrial Genes of Dinoflagellates Are Transcribed by a Nuclear-Encoded Single-Subunit RNA Polymerase.

    Directory of Open Access Journals (Sweden)

    Chang Ying Teng

    Full Text Available Dinoflagellates are a large group of algae that contribute significantly to marine productivity and are essential photosynthetic symbionts of corals. Although these algae have fully-functioning mitochondria and chloroplasts, both their organelle genomes have been highly reduced and the genes fragmented and rearranged, with many aberrant transcripts. However, nothing is known about their RNA polymerases. We cloned and sequenced the gene for the nuclear-encoded mitochondrial polymerase (RpoTm of the dinoflagellate Heterocapsa triquetra and showed that the protein presequence targeted a GFP construct into yeast mitochondria. The gene belongs to a small gene family, which includes a variety of 3'-truncated copies that may have originated by retroposition. The catalytic C-terminal domain of the protein shares nine conserved sequence blocks with other single-subunit polymerases and is predicted to have the same fold as the human enzyme. However, the N-terminal (promoter binding/transcription initiation domain is not well-conserved. In conjunction with the degenerate nature of the mitochondrial genome, this suggests a requirement for novel accessory factors to ensure the accurate production of functional mRNAs.

  10. Polymorphisms in genes encoding the serotonin and dopamine pathways in two sisters with metachromatic leukodystrophy.

    Science.gov (United States)

    Kumperscak, H G; Dolzan, V; Videtic, A; Plesnicar, B K

    2008-01-01

    Metachromatic leukodystrophy (MLD) is a metabolic disease that has recently been investigated as a model for the study of psychosis. We report on two sisters with adult-type MLD who developed psychiatric symptomatology, but differed in their expression of psychotic and depressive symptoms. Association studies have indicated that polymorphisms in genes encoding the serotonin and dopamine transporters and receptors are related to the symptomatology of schizophrenia and/or depression; hence both sisters were genotyped for some of these candidate genes. The sisters shared dopamine receptor D(2) (DRD(2)) c.1047GG (p.311Ser/Ser) and c.-141Cins/ins polymorphisms, which are significantly associated with schizophrenia, but differed in the serotonin transporter gene-linked polymorphic region and serotonin receptor 1A (5-HT(1A)) c.-1019C to G polymorphisms, which may have increased the elder sister's susceptibility to depressive symptoms. Much bigger samples would be needed to gain enough statistical power to develop any hypotheses. This is the first report on genotyping MLD patients for candidate genes for psychiatric disorders, although MLD has been proposed as a model for schizophrenia.

  11. EXPRESSION OF B-XYLOSIDASE ENCODING GENE IN PHIS/ BACILLUS MEGATERIUM MS SYSTEM

    Directory of Open Access Journals (Sweden)

    sri sumarsih

    2011-01-01

    Full Text Available b-Xylosidase encoding gene from G. thermoleovorans IT-08 had been expressed in the pHIS1525/ B. megaterium MS941 system. The b-xylosidase gene (xyl was inserted into plasmid pHIS1525 and propagated in E. coli DH10b. The recombinant plasmid was transformed into B. megaterium MS941 by protoplast transformation. Transformants were selected by growing the recombinant cells on solid LB medium containing tetracycline (10 µg/ ml. The expression of the b-xylosidase gene was assayed by overlaid the recombinant B. megaterium MS941 cell with agar medium containing 0.2% ethylumbelliferyl-b-D-xyloside (MUX. This research showed that the b-xylosidase gene was succesfully sub-cloned in pHIS1525 system and expressed by the recombinant B. megaterium MS941. Theaddition of 0.5% xylose into the culture medium could increase the activity of recombinantactivity of recombinant of recombinantb-xylosidase by 2.74 fold. The recombinant B. megaterium MS941 secreted 75.56% of the expressed b-xylosidase into culture medium. The crude extract b-xylosidase showed the optimum activity at 50° C and pH 6. The recombinant b-xylosidase was purified from culture supernatant by affinity chromatographic method using agarose containing Ni-NTA (Nickel-Nitrilotriacetic acid. The pure b-xylosidase showed a specific activity of 10.06 Unit/mg protein and relative molecular weight ± 58 kDa.

  12. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall

    2011-06-01

    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  13. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  14. Enhanced expression in tobacco of the gene encoding green fluorescent protein by modification of its codon usage

    NARCIS (Netherlands)

    Rouwendal, G.J.A.; Mendes, O.; Wolbert, E.J.H.; Boer, de A.D.

    1997-01-01

    The gene encoding green fluorescent protein (GFP) from Aequorea victoria was resynthesized to adapt its codon usage for expression in plants by increasing the frequency of codons with a C or a G in the third position from 32 to 60%. The strategy for constructing the synthetic gfp gene was based on

  15. Prevalence of genes encoding for members of the staphylococcal leukotoxin family among clinical isolates of Staphylococcus aureus

    NARCIS (Netherlands)

    von Eiff, Christof; Friedrich, Alexander W.; Peters, Georg; Becker, Karsten

    Well-characterized Staphylococcus aureus nasal and blood isolates (N = 429) were tested by polymerase chain reaction for the prevalence of genes that encode leukocidal toxins. The leukotoxin genes lukE+lukD were found at high prevalence, significantly more so in blood (82%) than in nasal isolates

  16. Cloning and Characterization of a Gene (mspA) Encoding the Major Sheath Protein of Treponema maltophilum ATCC 51939T

    Science.gov (United States)

    Heuner, Klaus; Choi, Bong-Kyu; Schade, Rüdiger; Moter, Annette; Otto, Albrecht; Göbel, Ulf B.

    1999-01-01

    The major sheath protein-encoding gene (mspA) of the oral spirochete Treponema maltophilum ATCC 51939T was cloned by screening a genomic library with an anti-outer membrane fraction antibody. The mspA gene encodes a precursor protein of 575 amino acids with a predicted molecular mass of 62.3 kDa, including a signal peptide of 19 amino acids. The native MspA formed a heat-modifiable, detergent- and trypsin-stable complex which is associated with the outer membrane. Hybridization with an mspA-specific probe showed no cross-reactivity with the msp gene from Treponema denticola. PMID:9922270

  17. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.

    Science.gov (United States)

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H

    2016-01-01

    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. The essential Escherichia coli msgB gene, a multicopy suppressor of a temperature-sensitive allele of the heat shock gene grpE, is identical to dapE.

    OpenAIRE

    Wu, B; Georgopoulos, C; Ang, D

    1992-01-01

    The grpE gene product is one of three Escherichia coli heat shock proteins (DnaK, DnaJ, and GrpE) that are essential for both bacteriophage lambda DNA replication and bacterial growth at all temperatures. In an effort to determine the role of GrpE and to identify other factors that it may interact with, we isolated multicopy suppressors of the grpE280 point mutation, as judged by their ability to reverse the temperature-sensitive phenotype of grpE280. Here we report the characterization of on...

  19. SLI1 (YGR212W) is a major gene conferring resistance to the sphingolipid biosynthesis inhibitor ISP-1, and encodes an ISP-1 N-acetyltransferase in yeast.

    Science.gov (United States)

    Momoi, Michiko; Tanoue, Daisuke; Sun, Yidi; Takematsu, Hiromu; Suzuki, Yusuke; Suzuki, Minoru; Suzuki, Akemi; Fujita, Tetsuro; Kozutsumi, Yasunori

    2004-07-01

    ISP-1 (myriocin) is a potent inhibitor of serine palmitoyltransferase, the primary enzyme of sphingolipid biosynthesis, and is a useful tool for studying the biological functions of sphingolipids in both mammals and yeast (Saccharomyces cerevisiae). In a previous study, we cloned yeast multicopy suppressor genes for ISP-1, and one of these, YPK1/SLI2, was shown to encode a serine/threonine kinase which is a yeast homologue of mammalian SGK1 (serum/glucocorticoid-regulated kinase 1). In the present study, another gene, termed SLI1 (YGR212W; GenBank accession number CAA97239.1), was characterized. Sli1p has weak similarity to Atf1p and Atf2p, which are alcohol acetyltransferases. Although a sli1-null strain grew normally, the IC50 of ISP-1 for the growth of this strain was markedly decreased compared with that for the parental strain, indicating that Sli1p is a major contributor to ISP-1 resistance in yeast. On a sli1-null background, the increase in resistance to ISP-1 induced by YPK1 gene transfection was almost abolished. These data indicate that Sli1p co-operates with Ypk1p in mediating resistance to ISP-1 in yeast. Sli1p was found to convert ISP-1 into N-acetyl-ISP-1 in vitro. Furthermore, N-acetyl-ISP-1 did not share the ability of ISP-1 to inhibit the growth of yeast cells, and the serine palmitoyltransferase inhibitory activity of N-acetyl-ISP-1 was much lower than that of ISP-1. These data suggest that Sli1p inactivates ISP-1 due to its N-acetyltransferase activity towards ISP-1.

  20. MTHFR variants reduce the risk of G:C->A:T transition mutations within the p53 tumor suppressor gene in colon tumors.

    Science.gov (United States)

    Ulrich, C M; Curtin, K; Samowitz, W; Bigler, J; Potter, J D; Caan, B; Slattery, M L

    2005-10-01

    5,10-Methylene-tetrahydrofolate reductase (MTHFR) is a key enzyme in folate-mediated 1-carbon metabolism. Reduced MTHFR activity has been associated with genomic DNA hypomethylation. Methylated cytosines at CpG sites are easily mutated and have been implicated in G:C-->A:T transitions in the p53 tumor suppressor gene. We investigated 2 polymorphisms in the MTHFR gene (C677T and A1298C) and their associations with colon tumor characteristics, including acquired mutations in Ki-ras and p53 genes and microsatellite instability (MSI). The study population comprised 1248 colon cancer cases and 1972 controls, who participated in a population-based case-control study and had been analyzed previously for MSI, acquired mutations in Ki-ras, p53, and germline MTHFR polymorphisms. Multivariable-adjusted odds ratios are presented. Overall, MTHFR genotypes were not associated with MSI status or the presence of any p53 or Ki-ras mutation. Individuals with homozygous variant MTHFR genotypes had a significantly reduced risk of G:C-->A:T transition mutations within the p53 gene, yet, as hypothesized, only at CpG-associated sites [677TT vs. 677CC (referent group) OR = 0.4 (95% CI: 0.1-0.8) for CpG-associated sites; OR = 1.5 (0.7-3.6) for non-CpG associated sites]. Genotypes conferring reduced MTHFR activity were associated with a decreased risk of acquired G:C-->A:T mutations within the p53 gene occurring at CpG sites. Consistent with evidence on the phenotypic effect of the MTHFR C677T variant, we hypothesize that this relation may be explained by modestly reduced genomic DNA methylation, resulting in a lower probability of spontaneous deamination of methylated cytosine to thymidine. These results suggest a novel mechanism by which MTHFR polymorphisms can affect the risk of colon cancer.

  1. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  2. Demonstration of expression of a neuropeptide-encoding gene in crustacean hemocytes.

    Science.gov (United States)

    Wu, Su-Hua; Chen, Yan-Jhou; Huang, Shao-Yen; Tsai, Wei-Shiun; Wu, Hsin-Ju; Hsu, Tsan-Ting; Lee, Chi-Ying

    2012-04-01

    Crustacean hyperglycemic hormone (CHH) was originally identified in a neuroendocrine system-the X-organ/sinus gland complex. In this study, a cDNA (Prc-CHH) encoding CHH precursor was cloned from the hemocyte of the crayfish Procambarus clarkii. Analysis of tissues by a CHH-specific enzyme-linked immunosorbent assay (ELISA) confirmed the presence of CHH in hemocytes, the levels of which were much lower than those in the sinus gland, but 2 to 10 times higher than those in the thoracic and cerebral ganglia. Total hemocytes were separated by density gradient centrifugation into layers of hyaline cell (HC), semi-granular cell (SGC), and granular cell (GC). Analysis of extracts of each layer using ELISA revealed that CHH is present in GCs (202.8±86.7 fmol/mg protein) and SGCs (497.8±49.4 fmol/mg protein), but not in HCs. Finally, CHH stimulated the membrane-bound guanylyl cyclase (GC) activity of hemocytes in a dose-dependent manner. These data for the first time confirm that a crustacean neuropeptide-encoding gene is expressed in cells essential for immunity and its expression in hemocytes is cell type-specific. Effect of CHH on the membrane-bound GC activity of hemocyte suggests that hemocyte is a target site of CHH. Possible functions of the hemocyte-derived CHH are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Lateral gene transfer of streptococcal ICE element RD2 (region of difference 2 encoding secreted proteins

    Directory of Open Access Journals (Sweden)

    Mereghetti Laurent

    2011-04-01

    Full Text Available Abstract Background The genome of serotype M28 group A Streptococcus (GAS strain MGAS6180 contains a novel genetic element named Region of Difference 2 (RD2 that encodes seven putative secreted extracellular proteins. RD2 is present in all serotype M28 strains and strains of several other GAS serotypes associated with female urogenital infections. We show here that the GAS RD2 element is present in strain MGAS6180 both as an integrative chromosomal form and a circular extrachromosomal element. RD2-like regions were identified in publicly available genome sequences of strains representing three of the five major group B streptococcal serotypes causing human disease. Ten RD2-encoded proteins have significant similarity to proteins involved in conjugative transfer of Streptococcus thermophilus integrative chromosomal elements (ICEs. Results We transferred RD2 from GAS strain MGAS6180 (serotype M28 to serotype M1 and M4 GAS strains by filter mating. The copy number of the RD2 element was rapidly and significantly increased following treatment of strain MGAS6180 with mitomycin C, a DNA damaging agent. Using a PCR-based method, we also identified RD2-like regions in multiple group C and G strains of Streptococcus dysgalactiae subsp.equisimilis cultured from invasive human infections. Conclusions Taken together, the data indicate that the RD2 element has disseminated by lateral gene transfer to genetically diverse strains of human-pathogenic streptococci.

  4. The zebrafish moonshine gene encodes transcriptional intermediary factor 1gamma, an essential regulator of hematopoiesis.

    Directory of Open Access Journals (Sweden)

    David G Ransom

    2004-08-01

    Full Text Available Hematopoiesis is precisely orchestrated by lineage-specific DNA-binding proteins that regulate transcription in concert with coactivators and corepressors. Mutations in the zebrafish moonshine (mon gene specifically disrupt both embryonic and adult hematopoiesis, resulting in severe red blood cell aplasia. We report that mon encodes the zebrafish ortholog of mammalian transcriptional intermediary factor 1gamma (TIF1gamma (or TRIM33, a member of the TIF1 family of coactivators and corepressors. During development, hematopoietic progenitor cells in mon mutants fail to express normal levels of hematopoietic transcription factors, including gata1, and undergo apoptosis. Three different mon mutant alleles each encode premature stop codons, and enforced expression of wild-type tif1gamma mRNA rescues embryonic hematopoiesis in homozygous mon mutants. Surprisingly, a high level of zygotic tif1gamma mRNA expression delineates ventral mesoderm during hematopoietic stem cell and progenitor formation prior to gata1 expression. Transplantation studies reveal that tif1gamma functions in a cell-autonomous manner during the differentiation of erythroid precursors. Studies in murine erythroid cell lines demonstrate that Tif1gamma protein is localized within novel nuclear foci, and expression decreases during erythroid cell maturation. Our results establish a major role for this transcriptional intermediary factor in the differentiation of hematopoietic cells in vertebrates.

  5. Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2.

    Directory of Open Access Journals (Sweden)

    Catherine Dodé

    2006-10-01

    Full Text Available Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2 and one of its ligands, prokineticin-2 (PROK2, respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome.

  6. Growth Characteristics of Methanomassiliicoccus luminyensis and Expression of Methyltransferase Encoding Genes

    Directory of Open Access Journals (Sweden)

    Lena Kröninger

    2017-01-01

    Full Text Available DNA sequence analysis of the human gut revealed the presence a seventh order of methanogens referred to as Methanomassiliicoccales. Methanomassiliicoccus luminyensis is the only member of this order that grows in pure culture. Here, we show that the organism has a doubling time of 1.8 d with methanol + H2 and a growth yield of 2.4 g dry weight/mol CH4. M. luminyensis also uses methylamines + H2 (monomethylamine, dimethylamine, and trimethylamine with doubling times of 2.1–2.3 d. Similar cell yields were obtained with equimolar concentrations of methanol and methylamines with respect to their methyl group contents. The transcript levels of genes encoding proteins involved in substrate utilization indicated increased amounts of mRNA from the mtaBC2 gene cluster in methanol-grown cells. When methylamines were used as substrates, mRNA of the mtb/mtt operon and of the mtmBC1 cluster were found in high abundance. The transcript level of mtaC2 was almost identical in methanol- and methylamine-grown cells, indicating that genes for methanol utilization were constitutively expressed in high amounts. The same observation was made with resting cells where methanol always yielded the highest CH4 production rate independently from the growth substrate. Hence, M. luminyensis is adapted to habitats that provide methanol + H2 as substrates.

  7. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  8. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  9. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster.

    Science.gov (United States)

    Gilbert, Lawrence I

    2004-02-27

    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  10. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  11. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Science.gov (United States)

    Mousa, Walaa K.; Raizada, Manish N.

    2015-01-01

    The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produces a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins, and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous coding sequences (CDS). We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters. PMID:25914708

  12. A Mutation in the Tubulin-Encoding Gene Causes Complex Cortical Malformations and Unilateral Hypohidrosis

    Directory of Open Access Journals (Sweden)

    Shinobu Fukumura MD

    2016-08-01

    Full Text Available Recent studies have emphasized the association between tubulin gene mutations and developmental abnormalities of the cortex. In this study, the authors identified a mutation in the tubulin-encoding class III β-tubulin ( TUBB3 gene in a 4-year-old boy presenting with brain abnormalities and unilateral hypohidrosis. The patient showed a left internal strabismus, moderate developmental delay, and congenital hypohidrosis of the right side of the body. Magnetic resonance imaging disclosed gyral disorganization mainly in the left perisylvian region, dysmorphic and hypertrophic basal ganglia with fusion between the putamen and caudate nucleus without affecting the anterior limb of the internal capsule, and moderate hypoplasia of the right brain stem and cerebellum. Diffusion tensor imaging studies revealed disorganization of the pyramidal fibers. The amplitude of the sympathetic skin response was low in the right arm, which led to a diagnosis of focal autonomic neuropathy. Sequencing the TUBB3 gene revealed a de novo missense mutation, c.862G>A (p.E288K.

  13. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Science.gov (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  14. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  15. Kruppel-like factor 6 (KLF6) is a tumor-suppressor gene frequently inactivated in colorectal cancer.

    Science.gov (United States)

    Reeves, Helen L; Narla, Goutham; Ogunbiyi, Olagunju; Haq, Asif I; Katz, Amanda; Benzeno, Sharon; Hod, Eldad; Harpaz, Noam; Goldberg, Shlomit; Tal-Kremer, Sigal; Eng, Francis J; Arthur, Michael J P; Martignetti, John A; Friedman, Scott L

    2004-04-01

    Kruppel-like factor 6 (KLF6) is a ubiquitous zinc finger tumor suppressor that is often mutated in prostate cancer. Our aims were to establish the frequency of KLF6 inactivation in sporadic and inflammatory bowel disease (IBD)-associated colorectal cancers (CRC); to correlate these abnormalities with mutation and/or loss of TP53, APC, and K-RAS; and to characterize the behavior of mutant KLF6 in colon-derived cell lines. We analyzed DNA isolated from 50 microdissected CRC cases, including 35 sporadic and 15 IBD-associated tumors. Microsatellite analysis and direct sequencing were used to establish the incidence of microsatellite instability, KLF6 and TP53 allelic imbalance, and KLF6, K-RAS, TP53, and APC mutation. Loss of growth suppressive function of the CRC-derived KLF6 mutants was characterized by in vitro thymidine incorporation assays and Western blotting. KLF6 was inactivated by loss and/or mutation in most sporadic and IBD-related CRCs. The KLF6 locus was deleted in at least 55% of tumors, and mutations were identified in 44%. Rates of KLF6 loss and mutation were similar to those of TP53 and K-RAS in the same samples. KLF6 mutations were present in tumors with either microsatellite or chromosomal instability and were more common, particularly in the IBD-related cancers, in the presence of wild-type APC. Unlike wild-type KLF6, cancer-derived KLF6 mutants neither suppressed growth nor induced p21 following transfection into cultured cells. Deregulation of KLF6 by a combination of allelic imbalance and mutation may play a role in the development of CRC.

  16. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    -of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited......The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  17. A flax-retting endopolygalacturonase-encoding gene from Rhizopus oryzae.

    Science.gov (United States)

    Xiao, Zhizhuang; Wang, Shaozhao; Bergeron, Hélène; Zhang, Jianchun; Lau, Peter C K

    2008-11-01

    A polygalacturonase from the filamentous fungus Rhizopus oryzae strain sb (NRRL 29086), previously shown to be effective in the retting of flax fibers, was shown by the analysis of its reaction products on polygalacturonic acid to be an endo-type. By zymogram analysis, the enzyme in the crude culture filtrate appeared as two active species of 37 and 40 kD. The endopolygalacturonase-encoding gene was cloned in Escherichia coli and its translated 383-amino acid sequence found to be identical to that of a presumed exopolygalacturonase found in R. oryzae strain YM9901 and 96% identical to a hypothetical protein (RO3G_04731.1) in the sequenced genome of R. oryzae strain 99-880. Phylogenetic analysis revealed the presence of an unique cluster of Rhizopus polygalacturonase sequences that are separate from other fungal polygalacturonases. Conservation of 12 cysteines appears to be a special feature of this family of Rhizopus polygalacturonase sequences.

  18. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters.

    Science.gov (United States)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven; Jørgensen, Morten Egevang; Olsen, Carl Erik; Andersen, Jonathan Sonne; Seynnaeve, David; Verhoye, Thalia; Fulawka, Rudy; Denolf, Peter; Halkier, Barbara Ann

    2017-04-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica.

  19. A Clostridioides difficile bacteriophage genome encodes functional binary toxin-associated genes.

    Science.gov (United States)

    Riedel, Thomas; Wittmann, Johannes; Bunk, Boyke; Schober, Isabel; Spröer, Cathrin; Gronow, Sabine; Overmann, Jörg

    2017-05-20

    Pathogenic clostridia typically produce toxins as virulence factors which cause severe diseases in both humans and animals. Whereas many clostridia like e.g., Clostridium perfringens, Clostridium botulinum or Clostridium tetani were shown to contain toxin-encoding plasmids, only toxin genes located on the chromosome were detected in Clostridioides difficile so far. In this study, we determined, annotated, and analyzed the complete genome of the bacteriophage phiSemix9P1 using single-molecule real-time sequencing technology (SMRT). To our knowledge, this represents the first C. difficile-associated bacteriophage genome that carries a complete functional binary toxin locus in its genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  1. Tsw gene-based resistance is triggered by a functional RNA silencing suppressor protein of the Tomato spotted wilt virus

    NARCIS (Netherlands)

    Ronde, de D.; Butterbach, P.B.E.; Lohuis, H.; Hedil, M.; Lent, van J.W.M.; Kormelink, R.J.M.

    2013-01-01

    As a result of contradictory reports, the avirulence (Avr) determinant that triggers Tsw gene-based resistance in Capsicum annuum against the Tomato spotted wilt virus (TSWV) is still unresolved. Here, the N and NSs genes of resistance-inducing (RI) and resistance-breaking (RB) isolates were cloned

  2. Ty3 GAG3 and POL3 genes encode the components of intracellular particles.

    Science.gov (United States)

    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B

    1992-03-01

    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposon. Characterization of extracts from cells in which Ty3 expression was induced showed the presence of Ty3 nucleoprotein complexes, or viruslike particles, that migrated on linear sucrose gradients with a size of 156S. These particles are composed of Ty3 RNA, full-length, linear DNA, and proteins. In this study, antibodies raised against peptides predicted from the Ty3 sequence were used to identify Ty3-encoded proteins. These include the capsid (26 kDa), nucleocapsid (9 kDa), and reverse transcriptase (55 kDa) proteins. Ty3 integrase proteins of 61 and 58 kDa were identified previously (L. J. Hansen and S. B. Sandmeyer, J. Virol. 64:2599-2607, 1990). Reverse transcriptase activity associated with the particles was measured by using exogenous and endogenous primer-templates. Immunofluorescence studies of cells overexpressing Ty3 revealed cytoplasmic clusters of immunoreactive proteins. Transmission electron microscopy showed that Ty3 viruslike particles are about 50 nm in diameter. Thus, despite the unusual position specificity of Ty3 upstream of tRNA-coding regions, aspects of the Ty3 life cycle are fundamentally similar to those of retroviruses.

  3. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  4. Gene-based neonatal immune priming potentiates a mucosal adenoviral vaccine encoding mycobacterial Ag85B.

    Science.gov (United States)

    Dai, Guixiang; Rady, Hamada F; Huang, Weitao; Shellito, Judd E; Mason, Carol; Ramsay, Alistair J

    2016-12-07

    Tuberculosis remains a major public health hazard worldwide, with neonates and young infants potentially more susceptible to infection than adults. BCG, the only vaccine currently available, provides some protection against tuberculous meningitis in children but variable efficacy in adults, and is not safe to use in immune compromised individuals. A safe and effective vaccine that could be given early in life, and that could also potentiate subsequent booster immunization, would represent a significant advance. To test this proposition, we have generated gene-based vaccine vectors expressing Ag85B from Mycobacterium tuberculosis (Mtb) and designed experiments to test their immunogenicity and protective efficacy particularly when given in heterologous prime-boost combination, with the initial DNA vaccine component given soon after birth. Intradermal delivery of DNA vaccines elicited Th1-based immune responses against Ag85B in neonatal mice but did not protect them from subsequent aerosol challenge with virulent Mtb H37Rv. Recombinant adenovirus vectors encoding Ag85B, given via the intranasal route at six weeks of age, generated moderate immune responses and were poorly protective. However, neonatal DNA priming following by mucosal boosting with recombinant adenovirus generated strong immune responses, as evidenced by strong Ag85B-specific CD4+ and CD8+ T cell responses, both in the lung-associated lymph nodes and the spleen, by the quality of these responding cells (assessed by their capacity to secrete multiple antimicrobial factors), and by improved protection, as indicated by reduced bacterial burden in the lungs following pulmonary TB challenge. These results suggest that neonatal immunization with gene-based vaccines may create a favorable immunological environment that potentiates the pulmonary mucosal boosting effects of a subsequent heterologous vector vaccine encoding the same antigen. Our data indicate that immunization early in life with mycobacterial

  5. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    RUBÉN POLANCO

    2006-01-01

    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  6. The role of UV induced lesions in skin carcinogenesis: an overview of oncogene and tumor suppressor gene modifications in xeroderma pigmentosum skin tumors.

    Science.gov (United States)

    Daya-Grosjean, Leela; Sarasin, Alain

    2005-04-01

    Xeroderma pigmentosum (XP), a rare hereditary syndrome, is characterized by a hypersensitivity to solar irradiation due to a defect in nucleotide excision repair resulting in a predisposition to squamous and basal cell carcinomas as well as malignant melanomas appearing at a very early age. The mutator phenotype of XP cells is evident by the higher levels of UV specific modifications found in key regulatory genes in XP skin tumors compared to those in the same tumor types from the normal population. Thus, XP provides a unique model for the study of unrepaired DNA lesions, mutations and skin carcinogenesis. The high level of ras oncogene activation, Ink4a-Arf and p53 tumor suppressor gene modifications as well as alterations of the different partners of the mitogenic sonic hedgehog signaling pathway (patched, smoothened and sonic hedgehog), characterized in XP skin tumors have clearly demonstrated the major role of the UV component of sunlight in the development of skin tumors. The majority of the mutations are C to T or tandem CC to TT UV signature transitions, occurring at bipyrimidine sequences, the specific targets of UV induced lesions. These characteristics are also found in the same genes modified in sporadic skin cancers but with lower frequencies confirming the validity of studying the XP model. The knowledge gained by studying XP tumors has given us a greater perception of the contribution of genetic predisposition to cancer as well as the consequences of the many alterations which modulate the activities of different genes affecting crucial pathways vital for maintaining cell homeostasis.

  7. p16 Tumor Suppressor Gene Methylation in Diffuse Large B Cell Lymphoma: A Study of 88 Cases at Two Hospitals in the East Coast of Malaysia

    Science.gov (United States)

    Mohd Ridah, Lailatul Jalilah; A Talib, Norlelawati; Muhammad, Naznin; Hussain, Faezahtul Arbaeyah; Zainuddin, Norafiza

    2017-10-26

    Introduction: p16 gene plays an important role in the normal cell cycle regulation. Methylation of p16 has been reported to be one of the epigenetic events contributing to the pathogenesis of diffuse large B-cell lymphoma (DLBCL) which occurring at varying frequency. DLBCL is an aggressive and high-grade malignancy which accounts for approximately 30% of all non-Hodgkin lymphoma cases. However, little is known regarding the epigenetic alterations of p16 gene in DLBCL cases in Malaysia. Therefore, the objective of this study was to examine the status of p16 methylation in DLBCL. Methods: A total of 88 formalin-fixed paraffin-embedded DLBCL tissues retrieved from two hospitals located in the east coast of Malaysia, namely Hospital Tengku Ampuan Afzan (HTAA) Pahang and Hospital Universiti Sains Malaysia (HUSM) Kelantan, were chosen for this study. DNA specimens were isolated and subsequently subjected to bisulfite treatment prior to methylation specific-PCR. Two pairs of primers were used to amplify methylated and unmethylated regions of p16 gene. The PCR products were then separated using agarose gel electrophoresis and visualised under UV illumination. SPSS version 12.0 was utilised to perform all statistical analysis. Result: p16 methylation was detected in 65 of 88 (74%) samples. There was a significant association between p16 methylation status and patients aged >50 years old (p=0.04). Conclusion: Our study demonstrated that methylation of p16 tumor suppressor gene in our DLBCL cases is common and significantly increased among patients aged 50 years and above. Aging is known to be an important risk factor in the development of cancers and we speculate that this might be due to the increased transformation of malignant cells in aging cell population. However, this has yet to be confirmed with further research and correlate the findings with clinicopathological parameters. Creative Commons Attribution License

  8. The role of UV induced lesions in skin carcinogenesis: an overview of oncogene and tumor suppressor gene modifications in xeroderma pigmentosum skin tumors

    International Nuclear Information System (INIS)

    Daya-Grosjean, Leela; Sarasin, Alain

    2005-01-01

    Xeroderma pigmentosum (XP), a rare hereditary syndrome, is characterized by a hypersensitivity to solar irradiation due to a defect in nucleotide excision repair resulting in a predisposition to squamous and basal cell carcinomas as well as malignant melanomas appearing at a very early age. The mutator phenotype of XP cells is evident by the higher levels of UV specific modifications found in key regulatory genes in XP skin tumors compared to those in the same tumor types from the normal population. Thus, XP provides a unique model for the study of unrepaired DNA lesions, mutations and skin carcinogenesis. The high level of ras oncogene activation, Ink4a-Arf and p53 tumor suppressor gene modifications as well as alterations of the different partners of the mitogenic sonic hedgehog signaling pathway (patched, smoothened and sonic hedgehog), characterized in XP skin tumors have clearly demonstrated the major role of the UV component of sunlight in the development of skin tumors. The majority of the mutations are C to T or tandem CC to TT UV signature transitions, occurring at bipyrimidine sequences, the specific targets of UV induced lesions. These characteristics are also found in the same genes modified in sporadic skin cancers but with lower frequencies confirming the validity of studying the XP model. The knowledge gained by studying XP tumors has given us a greater perception of the contribution of genetic predisposition to cancer as well as the consequences of the many alterations which modulate the activities of different genes affecting crucial pathways vital for maintaining cell homeostasis

  9. The role of UV induced lesions in skin carcinogenesis: an overview of oncogene and tumor suppressor gene modifications in xeroderma pigmentosum skin tumors

    Energy Technology Data Exchange (ETDEWEB)

    Daya-Grosjean, Leela [Laboratory of Genetic Instability and Cancer, UPR2169 CNRS, IFR 54, Institut Gustave Roussy, 39, rue Camille Desmoulins, 94805 Villejuif Cedex (France)]. E-mail: daya@igr.fr; Sarasin, Alain [Laboratory of Genetic Instability and Cancer, UPR2169 CNRS, IFR 54, Institut Gustave Roussy, 39, rue Camille Desmoulins, 94805 Villejuif Cedex (France)

    2005-04-01

    Xeroderma pigmentosum (XP), a rare hereditary syndrome, is characterized by a hypersensitivity to solar irradiation due to a defect in nucleotide excision repair resulting in a predisposition to squamous and basal cell carcinomas as well as malignant melanomas appearing at a very early age. The mutator phenotype of XP cells is evident by the higher levels of UV specific modifications found in key regulatory genes in XP skin tumors compared to those in the same tumor types from the normal population. Thus, XP provides a unique model for the study of unrepaired DNA lesions, mutations and skin carcinogenesis. The high level of ras oncogene activation, Ink4a-Arf and p53 tumor suppressor gene modifications as well as alterations of the different partners of the mitogenic sonic hedgehog signaling pathway (patched, smoothened and sonic hedgehog), characterized in XP skin tumors have clearly demonstrated the major role of the UV component of sunlight in the development of skin tumors. The majority of the mutations are C to T or tandem CC to TT UV signature transitions, occurring at bipyrimidine sequences, the specific targets of UV induced lesions. These characteristics are also found in the same genes modified in sporadic skin cancers but with lower frequencies confirming the validity of studying the XP model. The knowledge gained by studying XP tumors has given us a greater perception of the contribution of genetic predisposition to cancer as well as the consequences of the many alterations which modulate the activities of different genes affecting crucial pathways vital for maintaining cell homeostasis.

  10. [Cloning of y3 gene encoding a tobacco mosaic virus inhibitor from Coprinus comatus and transformation to Nicotiana tabacum].

    Science.gov (United States)

    Wang, Xueren; He, Tao; Zhang, Gaina; Hao, Jianguo; Jia, Jingfen

    2010-02-01

    The protein Y3 was a TMV inhibitor which was encoded by y3 gene. The aim of this work was to clone the full length of y3 gene from Coprinus comatus and to reveal its inhibitory function to TMV in in vivo conditions. We amplified the unknown 5'- terminal cDNA sequence of y3 gene with 5'- Full RACE Core Set (TaKaRa), obtained the full length of this gene by RT-PCR, constructed the expression plasmid pCAMBIA1301-y3 via inserting gene y3 sequence, CaMV 35 S promoter, and NOS terminator at MCS and transformed it into Nicotiana tabacum via agrobacterium-mediation. The full length of y3 gene was 534 bps including one ORF encoding 130 amino acid residues (GenBank Accession No. GQ859168; EMBL FN546262). The cDNA sequence and its deduced amino acid sequence showed high similarity (94%) to the published fragment of y3 gene sequence. Northern blot analysis proved the transcription of y3 gene in transgenic tobacco plants. The transgenic plants inoculated with TMV expressed the inhibitory activity to TMV. We cloned the full length of y3 gene and obtained transgenic tobacco plants. The expression of y3 gene in transgenic plants improved the inhibitory activity to TMV. The cloning and expression analysis of y3 gene might provide background information for future studying of y3 gene.

  11. [Identification of the gene encoding transglutaminase zymogen from Streptomyces hygroscopicus and its expression in Escherichia coli].

    Science.gov (United States)

    Ren, Zengliang; Zhang, Dongxu; Yu, Meiying; Zhao, Qingxin; Du, Guocheng; Chen, Jian; Wu, Jing

    2008-04-01

    We identified a microbial transglutaminase (MTGase) gene from Streptomyces hygroscopicus; cloned and expressed it in Escherichia coli. We also analyzed the active sites sequence of S. hygroscopicus MTGase through homologous sequence comparison. Wild-type microbial transglutaminase zymogen (pro-MTGase) was purified from liquid culture of S. hygroscopicus (CCTCC M203062). N-terminal amino acid sequence of this pro-MTGase was determined. According to the N-terminal sequence and the corresponding nucleotide sequence of MTGase from other three Streptomyces species, PCR primers of S. hygroscopicus pro-MTGase were designed and the completed gene of pro-MTGase was amplified and sequenced. The gene was sub-cloned into pET-20b(+) vector downstream pelB signal peptide to construct the expression vector pET/pro-MTG. The nucleotide sequence showed 92% homologue with that of S. platensis and S. caniferus. Rosetta (DE3) pLysS carrying the expression vector was induced with IPTG at 24 and expressed pro-MTGase as extracellular soluble protein. SDS-PAGE showed the expressed recombinant pro-MTGase was about 44 kDa, similar to the wild-type pro-MTGase purified from S. hgroscopicus. Recombinant pro-MTGase was activated with trypsin and the enzyme activity reached to 0.24U/mL. This is the first report of the gene encoding microbial pro-transglutaminase from S. hygroscopicus, and also this is the first report of expression extracellular soluble pro-MTGase in E. coli in our country.

  12. The von Hippel-Lindau tumor suppressor gene inhibits hepatocyte growth factor/scatter factor-induced invasion and branching morphogenesis in renal carcinoma cells.

    Science.gov (United States)

    Koochekpour, S; Jeffers, M; Wang, P H; Gong, C; Taylor, G A; Roessler, L M; Stearman, R; Vasselli, J R; Stetler-Stevenson, W G; Kaelin, W G; Linehan, W M; Klausner, R D; Gnarra, J R; Vande Woude, G F

    1999-09-01

    Loss of function in the von Hippel-Lindau (VHL) tumor suppressor gene occurs in familial and most sporadic renal cell carcinomas (RCCs). VHL has been linked to the regulation of cell cycle cessation (G(0)) and to control of expression of various mRNAs such as for vascular endothelial growth factor. RCC cells express the Met receptor tyrosine kinase, and Met mediates invasion and branching morphogenesis in many cell types in response to hepatocyte growth factor/scatter factor (HGF/SF). We examined the HGF/SF responsiveness of RCC cells containing endogenous mutated (mut) forms of the VHL protein (VHL-negative RCC) with that of isogenic cells expressing exogenous wild-type (wt) VHL (VHL-positive RCC). We found that VHL-negative 786-0 and UOK-101 RCC cells were highly invasive through growth factor-reduced (GFR) Matrigel-coated filters and exhibited an extensive branching morphogenesis phenotype in response to HGF/SF in the three-dimensional (3D) GFR Matrigel cultures. In contrast, the phenotypes of A498 VHL-negative RCC cells were weaker, and isogenic RCC cells ectopically expressing wt VHL did not respond at all. We found that all VHL-negative RCC cells expressed reduced levels of tissue inhibitor of metalloproteinase 2 (TIMP-2) relative to the wt VHL-positive cells, implicating VHL in the regulation of this molecule. However, consistent with the more invasive phenotype of the 786-0 and UOK-101 VHL-negative RCC cells, the levels of TIMP-1 and TIMP-2 were reduced and levels of the matrix metalloproteinases 2 and 9 were elevated compared to the noninvasive VHL-positive RCC cells. Moreover, recombinant TIMPs completely blocked HGF/SF-mediated branching morphogenesis, while neutralizing antibodies to the TIMPs stimulated HGF/SF-mediated invasion in vitro. Thus, the loss of the VHL tumor suppressor gene is central to changes that control tissue invasiveness, and a more invasive phenotype requires additional genetic changes seen in some but not all RCC lines. These

  13. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ...

  14. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  15. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  16. Cloning of the mouse cDNA encoding DNA topoisomerase I and chromosomal location of the gene.

    Science.gov (United States)

    Koiwai, O; Yasui, Y; Sakai, Y; Watanabe, T; Ishii, K; Yanagihara, S; Andoh, T

    1993-03-30

    The mouse cDNA encoding DNA topoisomerase I (TopoI) was cloned and the nucleotide sequence of 3512 bp was determined. The cDNA clone contained an open reading frame encoding a protein of 767 amino acids (aa), which is 2 aa longer than its human counterpart. Overall aa sequence homology between the mouse and human, and between the mouse and yeast (Saccharomyces cerevisiae) sequences was 96% and 42%, respectively. The mouse TopI gene was mapped at position 54.5 on chromosome 2 from linkage analyses of a three-point cross test with Geg, Ada, and a as marker genes.

  17. The Drosophila homologue of vertebrate myogenic-determination genes encodes a transiently expressed nuclear protein marking primary myogenic cells.

    OpenAIRE

    Paterson, B M; Walldorf, U; Eldridge, J; Dübendorfer, A; Frasch, M; Gehring, W J

    1991-01-01

    We have isolated a cDNA clone, called Dmyd for Drosophila myogenic-determination gene, that encodes a protein with structural and functional characteristics similar to the members of the vertebrate MyoD family. Dmyd clone encodes a polypeptide of 332 amino acids with 82% identity to MyoD in the 41 amino acids of the putative helix-loop-helix region and 100% identity in the 13 amino acids of the basic domain proposed to contain the essential recognition code for muscle-specific gene activation...

  18. Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

    Directory of Open Access Journals (Sweden)

    Hashishe Mervat M

    2010-06-01

    Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations

  19. Human AZU-1 gene, variants thereof and expressed gene products

    Science.gov (United States)

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  20. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication.

    Science.gov (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J

    2000-01-15

    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  1. Novel Genes Encoding Hexadecanoic Acid Δ6-Desaturase Activity in a Rhodococcus sp.

    Science.gov (United States)

    Araki, Hiroyuki; Hagihara, Hiroshi; Takigawa, Hirofumi; Tsujino, Yukiharu; Ozaki, Katsuya

    2016-11-01

    cis-6-Hexadecenoic acid, a major component of human sebaceous lipids, is involved in the defense mechanism against Staphylococcus aureus infection in healthy skin and closely related to atopic dermatitis. Previously, Koike et al. (Biosci Biotechnol Biochem 64:1064-1066, 2000) reported that a mutant strain of Rhodococcus sp. produced cis-6-hexadecenoate derivatives from palmitate alkyl esters. From the mutant Rhodococcus strain, we identified and sequenced two open reading frames present in an amplified 5.7-kb region; these open reading frames encoded tandemly repeated Δ6-desaturase-like genes, Rdes1 and Rdes2. A phylogenetic tree indicated that Rdes1 and Rdes2 were different from previously known Δ6-desaturase genes, and that they formed a new cluster. Rdes1 and Rdes2 were each introduced into vectors and then expressed separately in Escherichia coli, and the fatty acid composition of the transformed cells was analyzed by gas chromatography and mass spectrometry. The amount of cis-6-hexadecenoic acid was significantly higher in Rdes1- or Rdes2-transformed E. coli cells (twofold and threefold, respectively) than in vector-only control cells. These results showed that cis-6-hexadecenoic acid was produced in E. coli cells by the rhodococcal Δ6-desaturase-like proteins.

  2. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  3. Little things make big things happen: A summary of micropeptide encoding genes

    Directory of Open Access Journals (Sweden)

    Jeroen Crappé

    2014-06-01

    Full Text Available Classical bioactive peptides are cleaved from larger precursor proteins and are targeted toward the secretory pathway by means of an N-terminal signaling sequence. In contrast, micropeptides encoded from small open reading frames, lack such signaling sequence and are immediately released in the cytoplasm after translation. Over the past few years many such non-canonical genes (including open reading frames, ORFs smaller than 100 AAs have been discovered and functionally characterized in different eukaryotic organisms. Furthermore, in silico approaches enabled the prediction of the existence of many more putatively coding small ORFs in the genomes of Sacharomyces cerevisiae, Arabidopsis thaliana, Drosophila melanogaster and Mus musculus. However, questions remain as to what the functional role of this new class of eukaryotic genes might be, and how widespread they are. In the future, approaches integrating in silico, conservation-based prediction and a combination of genomic, proteomic and functional validation methods will prove to be indispensable to answer these open questions.

  4. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  5. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  6. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  7. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  8. Physical mapping of a commonly deleted region, the site of a candidate tumor suppressor gene, at 12q22 in human male germ cell tumors

    Energy Technology Data Exchange (ETDEWEB)

    Murty, V.V.V.S.; Bosl, G.J.; Chaganti, R.S.K. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [and others

    1996-08-01

    A candidate tumor suppressor gene (TSG) site at 12q22 characterized by a high frequency of loss of heterozygosity (LOH) and a homozygous deletion has previously (LOH) and a homozygous deletion has previously been reported in human male germ cell tumors (GCTs). In a detailed deletion mapping analysis of 67 normal-tumor DNAs utilizing 20 polymorphic markers mapped to 12q22-q24, we identified the limits of the minimal region of deletion at 12q22 between D12S377 (priximal) and D12S296 (distal). We have constructed a YAC contig map of a 3-cM region of this band between the proximal marker D12S101 and the distal marker D12S346, which contained the minimal region of deletion in GCTs. The map is composed of 53 overlapping YACs and 3 cosmids onto which 25 polymorphic and nonpolymorphic sequence-tagged sites (STSs) were placed in a unique order. The size of the minimal region of deletion was approximately 2 Mb from overlapping, nonchimeric YACs that spanned the region. We also developed a radiation hybrid (RH) map of the region between D12S101 and D12S346 containing 17 loci. The consensus order developed by RH mapping is in good agreement with the YAC STS-content map order. The RH map estimated the distance between D12S101 and D12S346 to be 246 cR{sub 8000} and the minimal region of deletion to be 141 cR{sub 8000}. In addition, four genes that were previously mapped to 12q22 have been excluded as candidate genes. The leads gained from the deletion mapping and physical maps should expedite the isolation and characterization of the TSG at 12q22. 35 refs., 4 figs., 2 tabs.

  9. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  10. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  11. Sulforaphane Reverses the Expression of Various Tumor Suppressor Genes by Targeting DNMT3B and HDAC1 in Human Cervical Cancer Cells

    Directory of Open Access Journals (Sweden)

    Munawwar Ali Khan

    2015-01-01

    Full Text Available Sulforaphane (SFN may hinder carcinogenesis by altering epigenetic events in the cells; however, its molecular mechanisms are unclear. The present study investigates the role of SFN in modifying epigenetic events in human cervical cancer cells, HeLa. HeLa cells were treated with SFN (2.5 µM for a period of 0, 24, 48, and 72 hours for all experiments. After treatment, expressions of DNMT3B, HDAC1, RARβ, CDH1, DAPK1, and GSTP1 were studied using RT-PCR while promoter DNA methylation of tumor suppressor genes (TSGs was studied using MS-PCR. Inhibition assays of DNA methyl transferases (DNMTs and histone deacetylases (HDACs were performed at varying time points. Molecular modeling and docking studies were performed to explore the possible interaction of SFN with HDAC1 and DNMT3B. Time-dependent exposure to SFN decreases the expression of DNMT3B and HDAC1 and significantly reduces the enzymatic activity of DNMTs and HDACs. Molecular modeling data suggests that SFN may interact directly with DNMT3B and HDAC1 which may explain the inhibitory action of SFN. Interestingly, time-dependent reactivation of the studied TSGs via reversal of methylation in SFN treated cells correlates well with its impact on the epigenetic alterations accumulated during cancer development. Thus, SFN may have significant implications for epigenetic based therapy.

  12. Immunohistochemical observations on tumor suppressor gene p53 status in mouse fibrosarcoma following in-vivo photodynamic therapy: the role of xanthine oxidase activity

    Science.gov (United States)

    Ziolkowski, Piotr P.; Symonowicz, Krzysztof; Milnerowicz, Artur; Osiecka, Beata J.

    1997-12-01

    Tumor suppressor gene p53 expression in a mouse fibrosarcoma following in-vivo photodynamic therapy has been studied using the immunohistochemical method. Photodynamic treatment involved injections of the well known sensitizer -- hematoporphyrin derivative at the doses 1.25 and 2.5 mg/kg of body weight and irradiations at the doses 25 and 50 J/sq cm. Glass slide preparations from PDT-treated tumors were obtained at different time points (15, 60 minutes, 2 and 24 hours) after therapy, subsequently stained for wild type/mutant p53, and assessed for positive reaction. High PDT doses (HpD -- 2.5 mg/kg; light dose -- 50 J/sq cm) correlated with decreased expression of p53 in tumor cells. The other part of the study was directed to measure the xanthine oxidase (XO) activity in the tumor cells. PDT included injections of HpD and light exposure at the same doses as for p53 study. We observed a complete inhibition of the enzyme activity. The slight increase in XO activity was found following treatment with either light or HpD alone.

  13. Diversity of β-lactamase-encoding genes among Gram-negative isolates from water samples in Northern Portugal

    OpenAIRE

    Manageiro, Vera; Ferreira, Eugénia; Figueira, Vânia; Manaia, Célia M.; Caniça, Manuela

    2012-01-01

    Water has been recognized as a reservoir for antibiotic resistance genes (ARG), where the presence of mobile genetic elements, including plasmids, favors their dissemination. It is noteworthy that non- pathogenic environmental organisms, where plasmids encoding multiple ARG are prevalent, can provide resistance to most classes of antimicrobials including :-lactams, aminoglycosides, chloramphenicol, trimethoprim, streptomycin, fosfomycin, q...

  14. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

    Science.gov (United States)

    Tomas Johansson; Per Olof Nyman; Daniel Cullen

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  15. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  16. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    Science.gov (United States)

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  17. Annotation and analysis of malic enzyme genes encoding for multiple isoforms in the fungus Mucor circinelloides CBS 277.49.

    Science.gov (United States)

    Vongsangnak, Wanwipa; Zhang, Yingtong; Chen, Wei; Ratledge, Colin; Song, Yuanda

    2012-05-01

    Based on the newly-released genomic data of Mucor circinelloides CBS 277.49, we have annotated five genes encoding for malic enzyme: all code for proteins that contain conserved domains/motifs for malic acid binding, NAD(+) binding and NAD(P)(+) binding. Phylogenetic analysis for malic enzyme genes showed that genes ID 78524 and 11639 share ~80% amino acid identity and are grouped in cluster 1; genes ID 182779, 186772 and 116127 share ~66% amino acid identity are grouped in cluster 2. Genes ID 78524, 11639 and 166127 produce proteins that are localized in the mitochondrion, while the products from genes 182779 and 186772 are localized in the cytosol. Based on the comparative analysis published previously by Song et al. (Microbiology 147:1507-1515, 2001), we propose that malic enzyme genes ID 78524, 166127, 182779, 186772, 11639, respectively, represent protein isoforms I, II, III/IV, V, and VI.

  18. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  19. Suppressor of Overexpression of CO 1 Negatively Regulates Dark-Induced Leaf Degreening and Senescence by Directly Repressing Pheophytinase and Other Senescence-Associated Genes in Arabidopsis.

    Science.gov (United States)

    Chen, Junyi; Zhu, Xiaoyu; Ren, Jun; Qiu, Kai; Li, Zhongpeng; Xie, Zuokun; Gao, Jiong; Zhou, Xin; Kuai, Benke

    2017-03-01

    Although the biochemical pathway of chlorophyll (Chl) degradation has been largely elucidated, how Chl is rapidly yet coordinately degraded during leaf senescence remains elusive. Pheophytinase (PPH) is the enzyme for catalyzing the removal of the phytol group from pheophytin a , and PPH expression is significantly induced during leaf senescence. To elucidate the transcriptional regulation of PPH , we used a yeast ( Saccharomyces cerevisiae ) one-hybrid system to screen for its trans-regulators. SUPPRESSOR OF OVEREXPRESSION OF CO 1 (SOC1), a key flowering pathway integrator, was initially identified as one of the putative trans-regulators of PPH After dark treatment, leaves of an SOC1 knockdown mutant ( soc1-6 ) showed an accelerated yellowing phenotype, whereas those of SOC1 -overexpressing lines exhibited a partial stay-green phenotype. SOC1 and PPH expression showed a negative correlation during leaf senescence. Substantially, SOC1 protein could bind specifically to the CArG box of the PPH promoter in vitro and in vivo, and overexpression of SOC1 significantly inhibited the transcriptional activity of the PPH promoter in Arabidopsis ( Arabidopsis thaliana ) protoplasts. Importantly, soc1-6 pph-1 (a PPH knockout mutant) double mutant displayed a stay-green phenotype similar to that of pph-1 during dark treatment. These results demonstrated that SOC1 inhibits Chl degradation via negatively regulating PPH expression. In addition, measurement of the Chl content and the maximum photochemical efficiency of photosystem II of soc1-6 and SOC1-OE leaves after dark treatment suggested that SOC1 also negatively regulates the general senescence process. Seven SENESCENCE-ASSOCIATED GENES ( SAGs ) were thereafter identified as its potential target genes, and NONYELLOWING1 and SAG113 were experimentally confirmed. Together, we reveal that SOC1 represses dark-induced leaf Chl degradation and senescence in general in Arabidopsis. © 2017 American Society of Plant Biologists. All

  20. Folliculin, the product of the Birt-Hogg-Dube tumor suppressor gene, interacts with the adherens junction protein p0071 to regulate cell-cell adhesion.

    Directory of Open Access Journals (Sweden)

    Doug A Medvetz

    Full Text Available Birt-Hogg-Dube (BHD is a tumor suppressor gene syndrome associated with fibrofolliculomas, cystic lung disease, and chromophobe renal cell carcinoma. In seeking to elucidate the pathogenesis of BHD, we discovered a physical interaction between folliculin (FLCN, the protein product of the BHD gene, and p0071, an armadillo repeat containing protein that localizes to the cytoplasm and to adherens junctions. Adherens junctions are one of the three cell-cell junctions that are essential to the establishment and maintenance of the cellular architecture of all epithelial tissues. Surprisingly, we found that downregulation of FLCN leads to increased cell-cell adhesion in functional cell-based assays and disruption of cell polarity in a three-dimensional lumen-forming assay, both of which are phenocopied by downregulation of p0071. These data indicate that the FLCN-p0071 protein complex is a negative regulator of cell-cell adhesion. We also found that FLCN positively regulates RhoA activity and Rho-associated kinase activity, consistent with the only known function of p0071. Finally, to examine the role of Flcn loss on cell-cell adhesion in vivo, we utilized keratin-14 cre-recombinase (K14-cre to inactivate Flcn in the mouse epidermis. The K14-Cre-Bhd(flox/flox mice have striking delays in eyelid opening, wavy fur, hair loss, and epidermal hyperplasia with increased levels of mammalian target of rapamycin complex 1 (mTORC1 activity. These data support a model in which dysregulation of the FLCN-p0071 interaction leads to alterations in cell adhesion, cell polarity, and RhoA signaling, with broad implications for the role of cell-cell adhesion molecules in the pathogenesis of human disease, including emphysema and renal cell carcinoma.

  1. Frequent loss of heterozygosity and altered expression of the candidate tumor suppressor gene 'FAT' in human astrocytic tumors

    International Nuclear Information System (INIS)

    Chosdol, Kunzang; Misra, Anjan; Puri, Sachin; Srivastava, Tapasya; Chattopadhyay, Parthaprasad; Sarkar, Chitra; Mahapatra, Ashok K; Sinha, Subrata

    2009-01-01

    We had earlier used the comparison of RAPD (Random Amplification of Polymorphic DNA) DNA fingerprinting profiles of tumor and corresponding normal DNA to identify genetic alterations in primary human glial tumors. This has the advantage that DNA fingerprinting identifies the genetic alterations in a manner not biased for locus. In this study we used RAPD-PCR to identify novel genomic alterations in the astrocytic tumors of WHO grade II (Low Grade Diffuse Astrocytoma) and WHO Grade IV (Glioblastoma Multiforme). Loss of heterozygosity (LOH) of the altered region was studied by microsatellite and Single Nucleotide Polymorphism (SNP) markers. Expression study of the gene identified at the altered locus was done by semi-quantitative reverse-transcriptase-PCR (RT-PCR). Bands consistently altered in the RAPD profile of tumor DNA in a significant proportion of tumors were identified. One such 500 bp band, that was absent in the RAPD profile of 33% (4/12) of the grade II astrocytic tumors, was selected for further study. Its sequence corresponded with a region of FAT, a putative tumor suppressor gene initially identified in Drosophila. Fifty percent of a set of 40 tumors, both grade II and IV, were shown to have Loss of Heterozygosity (LOH) at this locus by microsatellite (intragenic) and by SNP markers. Semi-quantitative RT-PCR showed low FAT mRNA levels in a major subset of tumors. These results point to a role of the FAT in astrocytic tumorigenesis and demonstrate the use of RAPD analysis in identifying specific alterations in astrocytic tumors

  2. The life-extending gene Indy encodes an exchanger for Krebs-cycle intermediates.

    Science.gov (United States)

    Knauf, Felix; Mohebbi, Nilufar; Teichert, Carsten; Herold, Diana; Rogina, Blanka; Helfand, Stephen; Gollasch, Maik; Luft, Friedrich C; Aronson, Peter S

    2006-07-01

    A longevity gene called Indy (for 'I'm not dead yet'), with similarity to mammalian genes encoding sodium-dicarboxylate cotransporters, was identified in Drosophila melanogaster. Functional studies in Xenopus oocytes showed that INDY mediates the flux of dicarboxylates and citrate across the plasma membrane, but the specific transport mechanism mediated by INDY was not identified. To test whether INDY functions as an anion exchanger, we examined whether substrate efflux is stimulated by transportable substrates added to the external medium. Efflux of [14C]citrate from INDY-expressing oocytes was greatly accelerated by the addition of succinate to the external medium, indicating citrate-succinate exchange. The succinate-stimulated [14C]citrate efflux was sensitive to inhibition by DIDS (4,4'-di-isothiocyano-2,2'-disulphonic stilbene), as demonstrated previously for INDY-mediated succinate uptake. INDY-mediated efflux of [14C]citrate was also stimulated by external citrate and oxaloacetate, indicating citrate-citrate and citrate-oxaloacetate exchange. Similarly, efflux of [14C]succinate from INDY-expressing oocytes was stimulated by external citrate, alpha-oxoglutarate and fumarate, indicating succinate-citrate, succinate-alpha-oxoglutarate and succinate-fumarate exchange respectively. Conversely, when INDY-expressing Xenopus oocytes were loaded with succinate and citrate, [14C]succinate uptake was markedly stimulated, confirming succinate-succinate and succinate-citrate exchange. Exchange of internal anion for external citrate was markedly pH(o)-dependent, consistent with the concept that citrate is co-transported with a proton. Anion exchange was sodium-independent. We conclude that INDY functions as an exchanger of dicarboxylate and tricarboxylate Krebs-cycle intermediates. The effect of decreasing INDY activity, as in the long-lived Indy mutants, may be to alter energy metabolism in a manner that favours lifespan extension.

  3. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium.

    Science.gov (United States)

    Todd, Sarah J; Moir, Arthur J G; Johnson, Matt J; Moir, Anne

    2003-06-01

    The exosporium is the outermost layer of spores of Bacillus cereus and its close relatives Bacillus anthracis and Bacillus thuringiensis. For these pathogens, it represents the surface layer that makes initial contact with the host. To date, only the BclA glycoprotein has been described as a component of the exosporium; this paper defines 10 more tightly associated proteins from the exosporium of B. cereus ATCC 10876, identified by N-terminal sequencing of proteins from purified, washed exosporium. Likely coding sequences were identified from the incomplete genome sequence of B. anthracis or B. cereus ATCC 14579, and the precise corresponding sequence from B. cereus ATCC 10876 was defined by PCR and sequencing. Eight genes encode likely structural components (exsB, exsC, exsD, exsE, exsF, exsG, exsJ, and cotE). Several proteins of the exosporium are related to morphogenetic and outer spore coat proteins of B. subtilis, but most do not have homologues in B. subtilis. ExsE is processed from a larger precursor, and the CotE homologue appears to have been C-terminally truncated. ExsJ contains a domain of GXX collagen-like repeats, like the BclA exosporium protein of B. anthracis. Although most of the exosporium genes are scattered on the genome, bclA and exsF are clustered in a region flanking the rhamnose biosynthesis operon; rhamnose is part of the sugar moiety of spore glycoproteins. Two enzymes, alanine racemase and nucleoside hydrolase, are tightly adsorbed to the exosporium layer; they could metabolize small molecule germinants and may reduce the sensitivity of spores to these, limiting premature germination.

  4. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  5. Gene encoding erythrocyte binding ligand linked to blood stage multiplication rate phenotype in Plasmodium yoelii yoelii.

    Science.gov (United States)

    Pattaradilokrat, Sittiporn; Culleton, Richard L; Cheesman, Sandra J; Carter, Richard

    2009-04-28

    Variation in the multiplication rate of blood stage malaria parasites is often positively correlated with the severity of the disease they cause. The rodent malaria parasite Plasmodium yoelii yoelii has strains with marked differences in multiplication rate and pathogenicity in the blood. We have used genetic analysis by linkage group selection (LGS) to identify genes that determine differences in multiplication rate. Genetic crosses were generated between genetically unrelated, fast- (17XYM) and slowly multiplying (33XC) clones of P. y. yoelii. The uncloned progenies of these crosses were placed under multiplication rate selection in blood infections in mice. The selected progenies were screened for reduction in intensity of quantitative genetic markers of the slowly multiplying parent. A small number of strongly selected markers formed a linkage group on P. y. yoelii chromosome 13. Of these, that most strongly selected marked the gene encoding the P. yoelii erythrocyte binding ligand (pyebl), which has been independently identified by Otsuki and colleagues [Otsuki H, et al. (2009) Proc Natl Acad Sci USA 106:10.1073/pnas.0811313106] as a major determinant of virulence in these parasites. In an analysis of a previous genetic cross in P. y. yoelii, pyebl alleles of fast- and slowly multiplying parents segregated with the fast and slow multiplication rate phenotype in the cloned recombinant progeny, implying the involvement of the pyebl locus in determining the multiplication rate. Our genome-wide LGS analysis also indicated effects of at least 1 other locus on multiplication rate, as did the findings of Otsuki and colleagues on virulence in P. y. yoelii.

  6. RPS6KA2, a putative tumour suppressor gene at 6q27 in sporadic epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Bignone, P A; Lee, K Y; Liu, Y

    2007-01-01

    -activated protein kinase pathway. It is expressed in normal ovarian epithelium, whereas reduced or absent in tumours or cell lines. We show that RPS6KA2 is monoallelically expressed in the ovary suggesting that loss of a single expressed allele is sufficient to cause complete loss of expression in cancer cells....... Further, we have identified two new isoforms of RPS6KA2 with an alternative start codon. Homozygous deletions were identified within the RPS6KA2 gene in two cell lines. Re-expression of RPS6KA2 in ovarian cancer cell lines suppressed colony formation. In UCI101 cells, the expression of RPS6KA2 reduced...

  7. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  8. A novel GDNF-inducible gene, BMZF3, encodes a transcriptional repressor associated with KAP-1

    International Nuclear Information System (INIS)

    Suzuki, Chikage; Murakumo, Yoshiki; Kawase, Yukari; Sato, Tomoko; Morinaga, Takatoshi; Fukuda, Naoyuki; Enomoto, Atsushi; Ichihara, Masatoshi; Takahashi, Masahide

    2008-01-01

    The Krueppel-associated box (KRAB)-containing zinc finger proteins (ZFPs) comprise the largest family of zinc finger transcription factors that function as transcriptional repressors. In the study of glial cell line-derived neurotrophic factor (GDNF)-RET signaling, we have identified bone marrow zinc finger 3 (BMZF3), encoding a KRAB-ZFP, as a GDNF-inducible gene by differential display analysis. The expression of BMZF3 transcripts in the human neuroblastoma cell line TGW increased 1 h after GDNF stimulation, as determined by Northern blotting and quantitative reverse-transcriptase polymerase chain reaction. The BMZF3 possesses transcriptional repressor activity in the KRAB domain. BMZF3 interacts with a co-repressor protein, KRAB-associated protein 1 (KAP-1), through the KRAB domain and siRNA-mediated knockdown of KAP-1 abolished the transcriptional repressor activity of BMZF3, indicating that KAP-1 is necessary for BMZF3 function. Furthermore, siRNA-mediated silencing of BMZF3 inhibited cell proliferation. These findings suggest that BMZF3 is a transcriptional repressor induced by GDNF that plays a role in cell proliferation

  9. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Wang, Christian W.; Mkumbaye, Sixbert I.

    2016-01-01

    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding hum...... the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction....... endothelial protein C receptor (EPCR) through the CIDRα1 domain of certain PfEMP1 were recently associated with severe malaria in children. However, it has remained unclear to which extend the EPCR-binding CIDRα1 domains epitomize PfEMP1 expressed in severe malaria. Here, we characterized the near full......-length transcripts dominating the var transcriptome in children with severe malaria and found that the only common feature of the encoded PfEMP1 was CIDRα1 domains. Such genes were highly and dominantly expressed in both children with severe malarial anaemia and cerebral malaria. These observations support...

  10. Molecular cloning and characterization of two genes encoding dihydroflavonol-4-reductase from Populus trichocarpa.

    Directory of Open Access Journals (Sweden)

    Yan Huang

    Full Text Available Dihydroflavonol 4-reductase (DFR, EC 1.1.1.219 is a rate-limited enzyme in the biosynthesis of anthocyanins and condensed tannins (proanthocyanidins that catalyzes the reduction of dihydroflavonols to leucoanthocyanins. In this study, two full-length transcripts encoding for PtrDFR1 and PtrDFR2 were isolated from Populus trichocarpa. Sequence alignment of the two PtrDFRs with other known DFRs reveals the homology of these genes. The expression profile of PtrDFRs was investigated in various tissues of P. trichocarpa. To determine their functions, two PtrDFRs were overexpressed in tobacco (Nicotiana tabacum via Agrobacterium-mediated transformation. The associated color change in the flowers was observed in all 35S:PtrDFR1 lines, but not in 35S:PtrDFR2 lines. Compared to the wild-type control, a significantly higher accumulation of anthocyanins was detected in transgenic plants harboring the PtrDFR1. Furthermore, overexpressing PtrDFR1 in Chinese white poplar (P. tomentosa Carr. resulted in a higher accumulation of both anthocyanins and condensed tannins, whereas constitutively expressing PtrDFR2 only improved condensed tannin accumulation, indicating the potential regulation of condensed tannins by PtrDFR2 in the biosynthetic pathway in poplars.

  11. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  12. Effects of light fluence and wavelength on expression of the gene encoding cucumber hydroxypyruvate reductase.

    Science.gov (United States)

    Bertoni, G P; Becker, W M

    1993-01-01

    We have investigated the regulation of cucumber (Cucumis sativus) hydroxypyruvate reductase mRNA abundance in response to white-, red-, and far-red-light treatments. Following irradiation of dark-adapted cucumber seedlings with 15 min to 4 h of either white or red light and return to darkness, the mRNA level for the gene encoding hydroxypyruvate reductase (Hpr) in cotyledons peaks in the darkness 16 to 20 h later. The response of the Hpr mRNA level to total fluence of white light depends more directly on irradiation time than on fluence rate. In addition to this time-dependent component, a phytochrome-dependent component is involved in Hpr regulation in dark-adapted green cotyledons as shown by red-light induction and partial far-red-light reversibility. Parallel measurements of mRNA levels for the ribulose bisphosphate carboxylase/oxygenase small subunit and for the chlorophyll a/b-binding protein show that Hpr is the most responsive to short (about 60 min) white- and red-light treatments and that each mRNA has a characteristic pattern of accumulation in dark-adapted cotyledons in response to light. PMID:8022942

  13. [Cloning and analysis of three genes encoding type II CHH family neuropeptides from Fennropenaeus chinensis].

    Science.gov (United States)

    Wang, Zai-Zhao; Xiang, Jian-Hai

    2003-10-01

    On the basis of sequence similarity, the crustean hyperglycemic hormone (CHH) family peptides have been classified into two types of hormones: type I and type II. Molt-inhibiting hormone (MIH) is a neuropeptide member of type II CHH family. Molting in shrimp is controlled by MIH and ecdysone. By inhibiting the synthesis of ecdysone in the Y-organ, MIH indirectly suppresses the molting activity of shrimp. In this study, we reported the cloning and characterization of 3 gene fragments encoding type II CHH family neuropeptides of the shrimp Fennropenaeus chinensis. According to the complementary DNA sequence of the mult-inhibiting hormone of Fennropenaeus chinensis, 3 primers were designed and synthesized. MP1 and MP2 are sense primers, and MP3 is anti-sense primer. Polymerase chain reaction was performed using genomic DNA of Fennropenaeus chinensis as template. Three PCR products were obtained using primers MP1 and MP3. Their sizes are about 600 bp, 850 bp, 1050 bp, respectively. A 580 bp PCR product was obtained using primers MP2 and MP3. All the 4 PCR products were cloned into pMD18-T vector. The recombinant clones were sequenced using ABI 310 Genetic Analyzer. After sequencing, all the DNA sequences were searched in the GenBank by Blast program to find similar gene sequences. The searching results revealed 3 DNA fragment sequences were of high similarity with CHH family neuropeptide genes from various crustean species. The 3 DNA fragments were named as NP1, NP2, and NP3. Their sizes were 540 bp, 601 bp, and 826 bp, respectively. Using the mRNA sequences with the most similarity to the 3 sequence fragments as reference, the gene structure of the 3 DNA fragment sequences was analyzed. The exons of 3 sequence fragments were aligned with their similar sequences by Clustal W program. Both NP1 and NP2 consisted of 1 intron and 2 exons. NP3 consisted of 2 introns and 3 exons. Sequence analysis suggested that these 3 products belonged to sequence fragments of neuropeptide

  14. Proto-oncogene FBI-1 (Pokemon/ZBTB7A) Represses Transcription of the Tumor Suppressor Rb Gene via Binding Competition with Sp1 and Recruitment of Co-repressors*S⃞

    Science.gov (United States)

    Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

    2008-01-01

    FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp –308 to –188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp –65 to –56) and GC-box 2 (bp –18 to –9), the latter of which is also bound by FBI-1. We found that FRE3 (bp –244 to –236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742

  15. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  16. The yeast ISN1 (YOR155c gene encodes a new type of IMP-specific 5'-nucleotidase

    Directory of Open Access Journals (Sweden)

    Schmitter Jean-Marie

    2003-05-01

    Full Text Available Abstract Background The purine salvage enzyme inosine 5'-monophosphate (IMP-specific 5'-nucleotidase catalyzes degradation of IMP to inosine. Although this enzymatic activity has been purified and characterized in Saccharomyces cerevisiae, the gene encoding IMP 5'-nucleotidase had not been identified. Results Mass spectrometry analysis of several peptides of this enzyme purified from yeast allowed identification of the corresponding gene as YOR155c, an open reading frame of unknown function, renamed ISN1. The deduced Isn1p sequence was clearly not homologous to 5'-nucleotidases from other species. However, significant similarities to Isn1p were found in proteins of unknown function from Neurospora crassa, Plasmodium falciparum and several yeast species. Knock-out of ISN1 resulted in the total loss of IMP-specific 5'-nucleotidase activity, thus confirming that the ISN1 gene indeed encodes the enzymatic activity purified from yeast. In vivo studies revealed that, when IMP is overproduced through constitutive activation of the IMP de novo synthesis pathway, ISN1 is required for excretion of inosine and hypoxanthine in the medium. Conclusion We have identified a new yeast gene, ISN1 (YOR155c, as encoding IMP-specific 5'-nucleotidase activity. The ISN1 gene defines a new type of 5'-nucleotidase which was demonstrated to be functional in vivo.

  17. Genetic modelling of PIM proteins in cancer: proviral tagging, cooperation with oncogenes, tumor suppressor genes and carcinogens.

    Directory of Open Access Journals (Sweden)

    Enara eAguirre

    2014-05-01

    Full Text Available The PIM proteins, which were initially discovered as proviral insertion sites in Moloney murine leukemia virus infection, are a family of highly homologous serine/threonine kinases that have been reported to be overexpressed in hematological malignancies and solid tumors. The PIM proteins have also been associated with metastasis and overall treatment responses and implicated in the regulation of apoptosis, metabolism, the cell cycle, and homing and migration, which makes these proteins interesting targets for anticancer drug discovery. The use of retroviral insertional mutagenesis and refined approaches such as complementation tagging has allowed the identification of myc, pim and a third group of genes (including bmi1 and gfi1 as complementing genes in lymphomagenesis. Moreover, mouse modeling of human cancer has provided an understanding of the molecular pathways that are involved in tumor initiation and progression at the physiological level. In particular, genetically modified mice have allowed researchers to further elucidate the role of each of the Pim isoforms in various tumor types. PIM kinases have been identified as weak oncogenes because experimental overexpression in lymphoid tissue, prostate and liver induces tumors at a relatively low incidence and with a long latency. However, very strong synergistic tumorigenicity between Pim1/2 and c-Myc and other oncogenes has been observed in lymphoid tissues. Mouse models have also been used to study whether the inhibition of specific PIM isoforms is required to prevent carcinogen-induced sarcomas, indicating that the absence of Pim2 and Pim3 greatly reduces sarcoma growth and bone invasion; the extent of this effect is similar to that observed in the absence of all 3 isoforms. This review will summarize some of the animal models that have been used to understand the isoform-specific contribution of PIM kinases to tumorigenesis.

  18. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: jsligh@azcc.arizona.edu [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  19. Expression of the nucleus-encoded chloroplast division genes and proteins regulated by the algal cell cycle.

    Science.gov (United States)

    Miyagishima, Shin-Ya; Suzuki, Kenji; Okazaki, Kumiko; Kabeya, Yukihiro

    2012-10-01

    Chloroplasts have evolved from a cyanobacterial endosymbiont and their continuity has been maintained by chloroplast division, which is performed by the constriction of a ring-like division complex at the division site. It is believed that the synchronization of the endosymbiotic and host cell division events was a critical step in establishing a permanent endosymbiotic relationship, such as is commonly seen in existing algae. In the majority of algal species, chloroplasts divide once per specific period of the host cell division cycle. In order to understand both the regulation of the timing of chloroplast division in algal cells and how the system evolved, we examined the expression of chloroplast division genes and proteins in the cell cycle of algae containing chloroplasts of cyanobacterial primary endosymbiotic origin (glaucophyte, red, green, and streptophyte algae). The results show that the nucleus-encoded chloroplast division genes and proteins of both cyanobacterial and eukaryotic host origin are expressed specifically during the S phase, except for FtsZ in one graucophyte alga. In this glaucophyte alga, FtsZ is persistently expressed throughout the cell cycle, whereas the expression of the nucleus-encoded MinD and MinE as well as FtsZ ring formation are regulated by the phases of the cell cycle. In contrast to the nucleus-encoded division genes, it has been shown that the expression of chloroplast-encoded division genes is not regulated by the host cell cycle. The endosymbiotic gene transfer of minE and minD from the chloroplast to the nuclear genome occurred independently on multiple occasions in distinct lineages, whereas the expression of nucleus-encoded MIND and MINE is regulated by the cell cycle in all lineages examined in this study. These results suggest that the timing of chloroplast division in algal cell cycle is restricted by the cell cycle-regulated expression of some but not all of the chloroplast division genes. In addition, it is

  20. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  1. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  2. Developmentally regulated expression of a human ''finger'' - containing gene encoded by the 5' half of the ret transforming gene

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, M.; Inaguma, Y.; Hiai, H.; Hirose, F.

    1988-04-01

    The authors isolated and sequenced a cDNA clone of the human gene encoded by the 5' half of the ret transforming gene. The nucleotide sequence indicates that it encodes a protein with ''finger'' structures which represent putative metal- and nucleic acid-binding domains. Transcriptions of this gene was detected at high levels in a variety of human and rodent tumor cell lines, mouse testis, and embryos. In addition, a unique transcript was observed in testis RNA. When the expression of the unique transcript was examined at different stages of spermatogenesis, a striking increase in mRNA levels accompanied progression from meiotic prophase pachytene spermatocytes to postmeiotic round spermatids. This finger-containing gene may thus function in male germ cell development.

  3. Radiation of different human melanoma cell lines increased expression of RHOB. Level of this tumor suppressor gene in different cell lines

    International Nuclear Information System (INIS)

    Notcovich, C.; Molinari, B.; Duran, H.; Delgado González, D.; Sánchez Crespo, R.

    2013-01-01

    Previous results of our group show that a correlation exists between intrinsic radiosensitivity of human melanoma cells and cell death by apoptosis. RhoB is a small GTPase that regulates cytoskeletal organization. Besides, is related to the process of apoptosis in cells exposed to DNA damage as radiation. Also, RhoB levels decrease in a wide variety of tumors with the tumor stage, being considered a tumor suppressor gene due to its antiproliferative and proapoptotic effect. The aim of this study was to analyze the expression of RhoB in different human melanoma cell lines in relation to melanocytes, and evaluate the effect of gamma radiation on the expression of RhoB. We used the A375, SB2 and Meljcell lines, and the derived from melanocytes Pig1. It was found for all three tumor lines RhoB expression levels significantly lower than those of Pig1 (p <0.05), as assessed by semiquantitative RT-PCR . When tumor cells were irradiated to a dose of 2Gyinduction was observed at 3 hours RhoB irradiation. RhoB expression increased in all lines relative to non-irradiated control, showing a greater induction ( p< 0.05) for the more radiosensitive line SB2, consistent with apoptosis in response to radiation. The results allow for the first time in melanoma demonstrate that RhoB, as well as in other tumor types, has a lower expression in tumor cells than their normal counterparts. Moreover, induction in the expression of RhoB in irradiated cells may be associated with the process of radiation-induced apoptosis. The modulation of RhoB could be a new tool to sensitize radioresistant melanoma. (author)

  4. A fine balance: epigenetic control of cellular quiescence by the tumor suppressor PRDM2/RIZ at a bivalent domain in the cyclin a gene.

    Science.gov (United States)

    Cheedipudi, Sirisha; Puri, Deepika; Saleh, Amena; Gala, Hardik P; Rumman, Mohammed; Pillai, Malini S; Sreenivas, Prethish; Arora, Reety; Sellathurai, Jeeva; Schrøder, Henrik Daa; Mishra, Rakesh K; Dhawan, Jyotsna

    2015-07-27

    Adult stem cell quiescence is critical to ensure regeneration while minimizing tumorigenesis. Epigenetic regulation contributes to cell cycle control and differentiation, but few regulators of the chromatin state in quiescent cells are known. Here we report that the tumor suppressor PRDM2/RIZ, an H3K9 methyltransferase, is enriched in quiescent muscle stem cells in vivo and controls reversible quiescence in cultured myoblasts. We find that PRDM2 associates with >4400 promoters in G0 myoblasts, 55% of which are also marked with H3K9me2 and enriched for myogenic, cell cycle and developmental regulators. Knockdown of PRDM2 alters histone methylation at key promoters such as Myogenin and CyclinA2 (CCNA2), and subverts the quiescence program via global de-repression of myogenesis, and hyper-repression of the cell cycle. Further, PRDM2 acts upstream of the repressive PRC2 complex in G0. We identify a novel G0-specific bivalent chromatin domain in the CCNA2 locus. PRDM2 protein interacts with the PRC2 protein EZH2 and regulates its association with the bivalent domain in the CCNA2 gene. Our results suggest that induction of PRDM2 in G0 ensures that two antagonistic programs-myogenesis and the cell cycle-while stalled, are poised for reactivation. Together, these results indicate that epigenetic regulation by PRDM2 preserves key functions of the quiescent state, with implications for stem cell self-renewal. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Molecular and Biochemical Characterization of Two Xylanase-Encoding Genes from Cellulomonas pachnodae

    Science.gov (United States)

    Cazemier, Anne E.; Verdoes, Jan C.; van Ooyen, Albert J. J.; Op den Camp, Huub J. M.

    1999-01-01

    Two xylanase-encoding genes, named xyn11A and xyn10B, were isolated from a genomic library of Cellulomonas pachnodae by expression in Escherichia coli. The deduced polypeptide, Xyn11A, consists of 335 amino acids with a calculated molecular mass of 34,383 Da. Different domains could be identified in the Xyn11A protein on the basis of homology searches. Xyn11A contains a catalytic domain belonging to family 11 glycosyl hydrolases and a C-terminal xylan binding domain, which are separated from the catalytic domain by a typical linker sequence. Binding studies with native Xyn11A and a truncated derivative of Xyn11A, lacking the putative binding domain, confirmed the function of the two domains. The second xylanase, designated Xyn10B, consists of 1,183 amino acids with a calculated molecular mass of 124,136 Da. Xyn10B also appears to be a modular protein, but typical linker sequences that separate the different domains were not identified. It comprises a N-terminal signal peptide followed by a stretch of amino acids that shows homology to thermostabilizing domains. Downstream of the latter domain, a catalytic domain specific for family 10 glycosyl hydrolases was identified. A truncated derivative of Xyn10B bound tightly to Avicel, which was in accordance with the identified cellulose binding domain at the C terminus of Xyn10B on the basis of homology. C. pachnodae, a (hemi)cellulolytic bacterium that was isolated from the hindgut of herbivorous Pachnoda marginata larvae, secretes at least two xylanases in the culture fluid. Although both Xyn11A and Xyn10B had the highest homology to xylanases from Cellulomonas fimi, distinct differences in the molecular organizations of the xylanases from the two Cellulomonas species were identified. PMID:10473422

  6. Transcriptional regulation of the Rhodococcus rhodochrous J1 nitA gene encoding a nitrilase.

    Science.gov (United States)

    Komeda, H; Hori, Y; Kobayashi, M; Shimizu, S

    1996-01-01

    The 1.4-kb downstream region from a nitrilase gene (nitA) of an actinomycete Rhodococcus rhodochrous J1, which is industrially in use, was found to be required for the isovaleronitrile-dependent induction of nitrilase synthesis in experiments using a Rhodococcus-Escherichia coli shuttle vector pK4 in a Rhodococcus strain. Sequence analysis of the 1.4-kb region revealed the existence of an open reading frame (nitR) of 957 bp, which would encode a protein with a molecular mass of 35,100. Deletion of the central and 3'-terminal portion of nitR resulted in the complete loss of nitrilase activity, demonstrating that nitR codes for a transcriptional positive regulator in nitA expression. The deduced amino acid sequence of nitR showed similarity to a positive regulator family including XylS from Pseudomonas putida and AraC from E. coli. By Northern blot analysis, the 1.4-kb transcripts for nitA were detected in R. rhodochrous J1 cells cultured in the presence of isovaleronitrile, but not those cultured in the absence of isovaleronitrile. The transcriptional start site for nitA was mapped to a C residue located 26 bp upstream of its translational start site. Deletion analysis to define the nitA promoter region suggested the possible participation of an inverted repeat sequence, centered on base pair -52, in induction of nitA transcription. Images Fig. 2 Fig. 5 Fig. 6 PMID:8855219

  7. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissu