WorldWideScience

Sample records for suppressor gene encodes

  1. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

    2008-01-01

    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  2. Is the gene encoding Chibby implicated as a tumour suppressor in colorectal cancer ?

    International Nuclear Information System (INIS)

    Gad, Sophie; Teboul, David; Lièvre, Astrid; Goasguen, Nicolas; Berger, Anne; Beaune, Philippe; Laurent-Puig, Pierre

    2004-01-01

    A novel member of the Wnt signalling pathway, Chibby, was recently identified. This protein inhibits Wnt/β-catenin mediated transcriptional activation by competing with Lef-1 (the transcription factor and target of β-catenin) to bind to β-catenin. This suggests that Chibby could be a tumour suppressor protein. The C22orf2 gene coding Chibby is located on chromosome 22, a region recurrently lost in colorectal cancer. Activation of the Wnt pathway is a major feature of colorectal cancer and occurs through inactivation of APC or activation of β-catenin. All of this led us to analyse the possible implication of Chibby in colorectal carcinogenesis. First, 36 tumour and matched normal colonic mucosa DNA were genotyped with five microsatellite markers located on chromosome 22 to search for loss of heterozygosity. Then, mutation screening of the C22orf2 coding sequence and splice sites was performed in the 36 tumour DNA. Finally, expression of Chibby was analysed by quantitative RT-PCR on 10 patients, 4 with loss of heterozygosity (LOH) on chromosome 22. Loss of heterozygosity involving the C22orf2 region was detected in 11 out of 36 patients (30%). Sequencing analysis revealed a known variant, rs3747174, in exon 5: T321C leading to a silent amino acid polymorphism A107A. Allelic frequencies were 0.69 and 0.31 for T and C variants respectively. No other mutation was detected. Among the 10 patients studied, expression analysis revealed that Chibby is overexpressed in 2 tumours and underexpressed in 1. No correlations were found with 22q LOH status. As no somatic mutation was detected in C22orf2 in 36 colorectal tumour DNA, our results do not support the implication of Chibby as a tumour suppressor in colorectal carcinogenesis. This was supported by the absence of underexpression of Chibby among the tumour samples with 22q LOH. The implication of other Wnt pathway members remains to be identified to explain the part of colorectal tumours without mutation in APC and β-catenin

  3. A novel proapoptotic gene PANO encodes a post-translational modulator of the tumor suppressor p14ARF

    Energy Technology Data Exchange (ETDEWEB)

    Watari, Akihiro; Li, Yang; Higashiyama, Shinji; Yutsudo, Masuo, E-mail: yutsudo@biken.osaka-u.ac.jp

    2012-02-01

    The protein p14ARF is a known tumor suppressor protein controlling cell proliferation and survival, which mainly localizes in nucleoli. However, the regulatory mechanisms that govern its activity or expression remain unclear. Here, we report that a novel proapoptotic nucleolar protein, PANO, modulates the expression and activity of p14ARF in HeLa cells. Overexpression of PANO enhances the stability of p14ARF protein by protecting it from degradation, resulting in an increase in p14ARF expression levels. Overexpression of PANO also induces apoptosis under low serum conditions. This effect is dependent on the nucleolar localization of PANO and inhibited by knocking-down p14ARF. Alternatively, PANO siRNA treated cells exhibit a reduction in p14ARF protein levels. In addition, ectopic expression of PANO suppresses the tumorigenicity of HeLa cells in nude mice. These results indicate that PANO is a new apoptosis-inducing gene by modulating the tumor suppressor protein, p14ARF, and may itself be a new candidate tumor suppressor gene.

  4. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben

    2008-01-01

    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  5. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  6. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  7. Suppressors of RNA silencing encoded by tomato leaf curl

    Indian Academy of Sciences (India)

    Whitefly-transmitted begomoviruses infecting tomato crop code for five different proteins, ORF AC4, ORF AC2 and ORF AV2 in DNA-A component, ORF BV1 in DNA-B ... In the present study suppressor function of ORF C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl ...

  8. BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS

    Directory of Open Access Journals (Sweden)

    Omarov R.T.

    2012-08-01

    Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of

  9. RET is a potential tumor suppressor gene in colorectal cancer

    Science.gov (United States)

    Luo, Yanxin; Tsuchiya, Karen D.; Park, Dong Il; Fausel, Rebecca; Kanngurn, Samornmas; Welcsh, Piri; Dzieciatkowski, Slavomir; Wang, Jianping; Grady, William M.

    2012-01-01

    Cancer arises as the consequence of mutations and epigenetic alterations that activate oncogenes and inactivate tumor suppressor genes. Through a genome-wide screen for methylated genes in colon neoplasms, we identified aberrantly methylated RET in colorectal cancer. RET, a transmembrane receptor tyrosine kinase and a receptor for the GDNF-family ligands, was one of the first oncogenes to be identified and has been shown to be an oncogene in thyroid cancer and pheochromocytoma. However, unexpectedly, we found RET is methylated in 27% of colon adenomas and in 63% of colorectal cancers, and now provide evidence that RET has tumor suppressor activity in colon cancer. The aberrant methylation of RET correlates with decreased RET expression, whereas the restoration of RET in colorectal cancer cell lines results in apoptosis. Furthermore, in support of a tumor suppressor function of RET, mutant RET has also been found in primary colorectal cancer. We now show that these mutations inactivate RET, which is consistent with RET being a tumor suppressor gene in the colon. These findings suggest that the aberrant methylation of RET and the mutational inactivation of RET promote colorectal cancer formation and that RET can serve as a tumor suppressor gene in the colon. Moreover, the increased frequency of methylated RET in colon cancers compared to adenomas suggests RET inactivation is involved in the progression of colon adenomas to cancer. PMID:22751117

  10. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  11. Multi-gene epigenetic silencing of tumor suppressor genes in T-cell lymphoma cells; delayed expression of the p16 protein upon reversal of the silencing

    DEFF Research Database (Denmark)

    Nagasawa, T; Zhang, Q; Raghunath, P N

    2006-01-01

    To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...

  12. Molecular biology III - Oncogenes and tumor suppressor genes

    International Nuclear Information System (INIS)

    Giaccia, Amato J.

    1996-01-01

    Purpose: The purpose of this course is to introduce to radiation oncologists the basic concepts of tumorigenesis, building on the information that will be presented in the first and second part of this series of lectures. Objective: Our objective is to increase the current understanding of radiation oncologists with the process of tumorigenesis, especially focusing on genes that are altered in many tumor types that are potential candidates for novel molecular strategies. As strategies to treat cancer of cancer are becoming more sophisticated, it will be important for both the practitioner and academician to develop a basic understanding of the function of cancer 'genes'. This will be the third in a series of refresher courses that are meant to address recent advances in Cancer Biology in a way that both clinicians without previous knowledge of molecular biology or experienced researchers will find interesting. The lecture will begin with a basic overview of tumorigenesis; methods of detecting chromosome/DNA alterations, approaches used to isolate oncogenes and tumor suppressor genes, and their role in cell killing by apoptosis. Special attention will be given to oncogenes and tumor suppressor genes that are modulated by ionizing radiation and the tumor microenvironment. We will relate the biology of oncogenes and tumor suppressor genes to basic aspects of radiation biology that would be important in clinical practice. Finally, we will review recent studies on the prognostic significance of p53 mutations and apoptosis in tumor specimens. The main point of this lecture is to relate both researcher and clinician what are the therapeutic ramifications of oncogene and tumor suppressor gene mutations found in human neoptasia

  13. Tumor Suppressor Genes within Common Fragile Sites Are Active Players in the DNA Damage Response.

    Directory of Open Access Journals (Sweden)

    Idit Hazan

    2016-12-01

    Full Text Available The role of common fragile sites (CFSs in cancer remains controversial. Two main views dominate the discussion: one suggests that CFS loci are hotspots of genomic instability leading to inactivation of genes encoded within them, while the other view proposes that CFSs are functional units and that loss of the encoded genes confers selective pressure, leading to cancer development. The latter view is supported by emerging evidence showing that expression of a given CFS is associated with genome integrity and that inactivation of CFS-resident tumor suppressor genes leads to dysregulation of the DNA damage response (DDR and increased genomic instability. These two viewpoints of CFS function are not mutually exclusive but rather coexist; when breaks at CFSs are not repaired accurately, this can lead to deletions by which cells acquire growth advantage because of loss of tumor suppressor activities. Here, we review recent advances linking some CFS gene products with the DDR, genomic instability, and carcinogenesis and discuss how their inactivation might represent a selective advantage for cancer cells.

  14. The tumor suppressor Rb and its related Rbl2 genes are regulated by Utx histone demethylase

    Energy Technology Data Exchange (ETDEWEB)

    Terashima, Minoru; Ishimura, Akihiko; Yoshida, Masakazu [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan); Suzuki, Yutaka; Sugano, Sumio [Graduate School of Frontier Sciences, The University of Tokyo, Kashiwa 277-8561, Chiba (Japan); Suzuki, Takeshi, E-mail: suzuki-t@staff.kanazawa-u.ac.jp [Division of Functional Genomics, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192, Ishikawa (Japan)

    2010-08-20

    Research highlights: {yields} Utx increases expression of Rb and Rbl2 genes through its demethylase activity. {yields} Utx changes histone H3 methylation on the Rb and Rbl2 promoters. {yields} Utx induces decreased cell proliferation of mammalian primary cells. -- Abstract: Utx is a candidate tumor suppressor gene that encodes histone H3 lysine 27 (H3K27) demethylase. In this study, we found that ectopic expression of Utx enhanced the expression of retinoblastoma tumor suppressor gene Rb and its related gene Rbl2. This activation was dependent on the demethylase activity of Utx, and was suggested to contribute to the decreased cell proliferation induced by Utx. A chromatin immunoprecipitation assay showed that over-expressed Utx was associated with the promoter regions of Rb and Rbl2 resulting in the removal of repressive H3K27 tri-methylation and the increase in active H3K4 tri-methylation. Furthermore, siRNA-mediated knockdown of Utx revealed the recruitment of endogenous Utx protein on the promoters of Rb and Rbl2 genes. These results indicate that Rb and Rbl2 are downstream target genes of Utx and may play important roles in Utx-mediated cell growth control.

  15. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.

    2000-01-01

    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  16. Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

    1996-01-01

    Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

  17. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  18. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  19. Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

    International Nuclear Information System (INIS)

    Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

    2004-01-01

    Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

  20. The potential for tumor suppressor gene therapy in head and neck cancer.

    Science.gov (United States)

    Birkeland, Andrew C; Ludwig, Megan L; Spector, Matthew E; Brenner, J Chad

    2016-01-01

    Head and neck squamous cell carcinoma remains a highly morbid and fatal disease. Importantly, genomic sequencing of head and neck cancers has identified frequent mutations in tumor suppressor genes. While targeted therapeutics increasingly are being investigated in head and neck cancer, the majority of these agents are against overactive/overexpressed oncogenes. Therapy to restore lost tumor suppressor gene function remains a key and under-addressed niche in trials for head and neck cancer. Recent advances in gene editing have captured the interest of both the scientific community and the public. As our technology for gene editing and gene expression modulation improves, addressing lost tumor suppressor gene function in head and neck cancers is becoming a reality. This review will summarize new techniques, challenges to implementation, future directions, and ethical ramifications of gene therapy in head and neck cancer.

  1. A Restricted Spectrum of Mutations in the SMAD4 Tumor-Suppressor Gene Underlies Myhre Syndrome

    Science.gov (United States)

    Caputo, Viviana; Cianetti, Luciano; Niceta, Marcello; Carta, Claudio; Ciolfi, Andrea; Bocchinfuso, Gianfranco; Carrani, Eugenio; Dentici, Maria Lisa; Biamino, Elisa; Belligni, Elga; Garavelli, Livia; Boccone, Loredana; Melis, Daniela; Andria, Generoso; Gelb, Bruce D.; Stella, Lorenzo; Silengo, Margherita; Dallapiccola, Bruno; Tartaglia, Marco

    2012-01-01

    Myhre syndrome is a developmental disorder characterized by reduced growth, generalized muscular hypertrophy, facial dysmorphism, deafness, cognitive deficits, joint stiffness, and skeletal anomalies. Here, by performing exome sequencing of a single affected individual and coupling the results to a hypothesis-driven filtering strategy, we establish that heterozygous mutations in SMAD4, which encodes for a transducer mediating transforming growth factor β and bone morphogenetic protein signaling branches, underlie this rare Mendelian trait. Two recurrent de novo SMAD4 mutations were identified in eight unrelated subjects. Both mutations were missense changes altering Ile500 within the evolutionary conserved MAD homology 2 domain, a well known mutational hot spot in malignancies. Structural analyses suggest that the substituted residues are likely to perturb the binding properties of the mutant protein to signaling partners. Although SMAD4 has been established as a tumor suppressor gene somatically mutated in pancreatic, gastrointestinal, and skin cancers, and germline loss-of-function lesions and deletions of this gene have been documented to cause disorders that predispose individuals to gastrointestinal cancer and vascular dysplasias, the present report identifies a previously unrecognized class of mutations in the gene with profound impact on development and growth. PMID:22243968

  2. The tumor suppressor gene Trp53 protects the mouse lens against posterior subcapsular cataracts and the BMP receptor Acvr1 acts as a tumor suppressor in the lens

    Directory of Open Access Journals (Sweden)

    Luke A. Wiley

    2011-07-01

    We previously found that lenses lacking the Acvr1 gene, which encodes a bone morphogenetic protein (BMP receptor, had abnormal proliferation and cell death in epithelial and cortical fiber cells. We tested whether the tumor suppressor protein p53 (encoded by Trp53 affected this phenotype. Acvr1 conditional knockout (Acvr1CKO mouse fiber cells had increased numbers of nuclei that stained for p53 phosphorylated on serine 15, an indicator of p53 stabilization and activation. Deletion of Trp53 rescued the Acvr1CKO cell death phenotype in embryos and reduced Acvr1-dependent apoptosis in postnatal lenses. However, deletion of Trp53 alone increased the number of fiber cells that failed to withdraw from the cell cycle. Trp53CKO and Acvr1;Trp53DCKO (double conditional knockout, but not Acvr1CKO, lenses developed abnormal collections of cells at the posterior of the lens that resembled posterior subcapsular cataracts. Cells from human posterior subcapsular cataracts had morphological and molecular characteristics similar to the cells at the posterior of mouse lenses lacking Trp53. In Trp53CKO lenses, cells in the posterior plaques did not proliferate but, in Acvr1;Trp53DCKO lenses, many cells in the posterior plaques continued to proliferate, eventually forming vascularized tumor-like masses at the posterior of the lens. We conclude that p53 protects the lens against posterior subcapsular cataract formation by suppressing the proliferation of fiber cells and promoting the death of any fiber cells that enter the cell cycle. Acvr1 acts as a tumor suppressor in the lens. Enhancing p53 function in the lens could contribute to the prevention of steroid- and radiation-induced posterior subcapsular cataracts.

  3. Alterations in tumour suppressor gene p53 in human gliomas from ...

    Indian Academy of Sciences (India)

    Unknown

    Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.

  4. Analysis of a Novel 17q25 Cell Cycle Gene Homolog: Is it a Breast Tumor Suppressor Gene?

    National Research Council Canada - National Science Library

    Kalikin, Linda

    2000-01-01

    ... of these molecular reagents into successful tools for the medical management of breast cancer. We hypothesize that a 350 kb region on 17q25 detected by our allelic imbalance studies harbors a novel breast tumor suppressor gene...

  5. Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

    Science.gov (United States)

    Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

    2017-08-15

    Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

  6. Identification and Functional Analysis of Gene Regulatory Sequences Interacting with Colorectal Tumor Suppressors

    DEFF Research Database (Denmark)

    Dahlgaard, Katja; Troelsen, Jesper

    2018-01-01

    Several tumor suppressors possess gene regulatory activity. Here, we describe how promoter and promoter/enhancer reporter assays can be used to characterize a colorectal tumor suppressor proteins’ gene regulatory activity of possible target genes. In the first part, a bioinformatic approach...... of the quick and efficient In-Fusion cloning method, and how to carry out transient transfections of Caco-2 colon cancer cells with the produced luciferase reporter plasmids using polyethyleneimine (PEI). A plan describing how to set up and carry out the luciferase expression assay is presented. The luciferase...... to identify relevant gene regulatory regions of potential target genes is presented. In the second part, it is demonstrated how to prepare and carry out the functional assay. We explain how to clone the bioinformatically identified gene regulatory regions into luciferase reporter plasmids by the use...

  7. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    Science.gov (United States)

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  8. TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan

    2010-01-01

    Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC

  9. Modulation and Expression of Tumor Suppressor Genes by Environmental Agents

    National Research Council Canada - National Science Library

    Ostrander, Gary Kent

    1996-01-01

    ... in the retinoblastoma gene in retinoblastoma and hepatocarcinomas following induction with known environmental carcinogens. Studies to date suggest the retinoblastoma gene/protein may play a role in oncogenesis in the medaka.

  10. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  11. MIM, a Potential Metastasis Suppressor Gene in Bladder Cancer

    Directory of Open Access Journals (Sweden)

    Young-Goo Lee

    2002-01-01

    Full Text Available Using a modified version of the mRNA differential display technique, five human bladder cancer cell lines from low grade to metastatic were analyzed to identify differences in gene expression. A 316-bp cDNA (C11300 was isolated that was not expressed in the metastatic cell line TccSuP. Sequence analysis revealed that this gene was identical to KIAA 0429, has a 5.3-kb transcript that mapped to 8824.1. The protein is predicted to be 356 amino acids in size and has an actin-binding WH2 domain. Northern blot revealed expression in multiple normal tissues, but none in a metastatic breast cancer cell line (SKBR3 or in metastatic prostatic cancer cell lines (LNCaP, PC3. We have named this gene Missing in Metastasis (MIM and our data suggest that it may be involved in cytoskeletal organization.

  12. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  13. The Ras effector RASSF2 is a novel tumor-suppressor gene in human colorectal cancer.

    Science.gov (United States)

    Akino, Kimishige; Toyota, Minoru; Suzuki, Hiromu; Mita, Hiroaki; Sasaki, Yasushi; Ohe-Toyota, Mutsumi; Issa, Jean-Pierre J; Hinoda, Yuji; Imai, Kohzoh; Tokino, Takashi

    2005-07-01

    Activation of Ras signaling is a hallmark of colorectal cancer (CRC), but the roles of negative regulators of Ras are not fully understood. Our aim was to address that question by surveying genetic and epigenetic alterations of Ras-Ras effector genes in CRC cells. The expression and methylation status of 6 RASSF family genes were examined using RT-PCR and bisulfite PCR in CRC cell lines and in primary CRCs and colorectal adenomas. Colony formation assays and flow cytometry were used to assess the tumor suppressor activities of RASSF1 and RASSF2. Immunofluorescence microscopy was used to determine the effect of altered RASSF2 expression on cell morphology. Mutations of K- ras , BRAF, and p53 were identified using single-strand conformation analysis and direct sequencing. Aberrant methylation and histone deacetylation of RASSF2 was associated with the gene's silencing in CRC. The activities of RASSF2, which were distinct from those of RASSF1, included induction of morphologic changes and apoptosis; moreover, its ability to prevent cell transformation suggests that RASSF2 acts as a tumor suppressor in CRC. Primary CRCs that showed K- ras /BRAF mutations also frequently showed RASSF2 methylation, and inactivation of RASSF2 enhanced K- ras -induced oncogenic transformation. RASSF2 methylation was also frequently identified in colorectal adenomas. RASSF2 is a novel tumor suppressor gene that regulates Ras signaling and plays a pivotal role in the early stages of colorectal tumorigenesis.

  14. Role of natural antisense transcripts pertaining to tumor suppressor genes in human carcinomas

    International Nuclear Information System (INIS)

    Pelicci, G.; Pierotti, M.

    2009-01-01

    Overlapping transcripts in opposite orientations can potentially form perfect sense-antisense duplex RNA. Recently, several studies have revealed the extent of natural antisense transcripts (NATs) and their role in important biological phenomena also in higher organisms. In order to test the hypothesis that the function of NATs in man might represent an essential element in the regulation of gene expression, especially at transcriptional level, in this study we planned to look for, systematically examine, and characterize NATs belonging in the human genome to the tumour suppressor class of genes, so to identify physiological (and potentially pathological) modulators in this gene class

  15. Molecular studies on the function of tumor suppressor gene in gastrointestinal cancer

    International Nuclear Information System (INIS)

    Kim, You Cheoul

    1993-01-01

    Cancer of stomach, colon and liver are a group of the most common cancer in Korea. However, results with current therapeutic modalities are still unsatisfactory. The intensive efforts have been made to understand basic pathogenesis and to find better therapeutic tools for the treatment of this miserable disease. We studies the alteration of tumor suppressor gene in various Gastrointestinal cancer in Korea. Results showed that genetic alteration of Rb gene was in 83% of colorectal cancer. Our results suggest that genetic alteration of Rb gene is crucially involved in the tumorigenesis of colorectum in Korea. (Author)

  16. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy

    2017-06-01

    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  17. Generation of two modified mouse alleles of the Hic1 tumor suppressor gene

    Czech Academy of Sciences Publication Activity Database

    Pospíchalová, Vendula; Turečková, Jolana; Fafílek, Bohumil; Vojtěchová, Martina; Krausová, Michaela; Lukáš, Jan; Šloncová, Eva; Takacova, S.; Divoký, V.; Leprince, D.; Plachý, Jiří; Kořínek, Vladimír

    2011-01-01

    Roč. 49, č. 3 (2011), s. 142-151 ISSN 1526-954X R&D Projects: GA ČR(CZ) GA204/07/1567; GA ČR(CZ) GD204/09/H058 Institutional research plan: CEZ:AV0Z50520514 Keywords : Hypermethylated In Cancer 1 * Hic1 tumor suppressor * gene targeting Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.527, year: 2011

  18. A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

    Science.gov (United States)

    Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

    2010-01-01

    A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

  19. Unexpected functional similarities between gatekeeper tumour suppressor genes and proto-oncogenes revealed by systems biology.

    Science.gov (United States)

    Zhao, Yongzhong; Epstein, Richard J

    2011-05-01

    Familial tumor suppressor genes comprise two subgroups: caretaker genes (CTs) that repair DNA, and gatekeeper genes (GKs) that trigger cell death. Since GKs may also induce cell cycle delay and thus enhance cell survival by facilitating DNA repair, we hypothesized that the prosurvival phenotype of GKs could be selected during cancer progression, and we used a multivariable systems biology approach to test this. We performed multidimensional data analysis, non-negative matrix factorization and logistic regression to compare the features of GKs with those of their putative antagonists, the proto-oncogenes (POs), as well as with control groups of CTs and functionally unrelated congenital heart disease genes (HDs). GKs and POs closely resemble each other, but not CTs or HDs, in terms of gene structure (Pexpression level and breadth (Pimplied suggest a common functional attribute that is strongly negatively selected-that is, a shared phenotype that enhances cell survival. The counterintuitive finding of similar evolutionary pressures affecting GKs and POs raises an intriguing possibility: namely, that cancer microevolution is accelerated by an epistatic cascade in which upstream suppressor gene defects subvert the normal bifunctionality of wild-type GKs by constitutively shifting the phenotype away from apoptosis towards survival. If correct, this interpretation would explain the hitherto unexplained phenomenon of frequent wild-type GK (for example, p53) overexpression in tumors.

  20. SFRP Tumour Suppressor Genes Are Potential Plasma-Based Epigenetic Biomarkers for Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Yuen Yee Cheng

    2017-01-01

    Full Text Available Malignant pleural mesothelioma (MPM is associated with asbestos exposure. Asbestos can induce chronic inflammation which in turn can lead to silencing of tumour suppressor genes. Wnt signaling pathway can be affected by chronic inflammation and is aberrantly activated in many cancers including colon and MPM. SFRP genes are antagonists of Wnt pathway, and SFRPs are potential tumour suppressors in colon, gastric, breast, ovarian, and lung cancers and mesothelioma. This study investigated the expression and DNA methylation of SFRP genes in MPM cells lines with and without demethylation treatment. Sixty-six patient FFPE samples were analysed and have showed methylation of SFRP2 (56% and SFRP5 (70% in MPM. SFRP2 and SFRP5 tumour-suppressive activity in eleven MPM lines was confirmed, and long-term asbestos exposure led to reduced expression of the SFRP1 and SFRP2 genes in the mesothelium (MeT-5A via epigenetic alterations. Finally, DNA methylation of SFRPs is detectable in MPM patient plasma samples, with methylated SFRP2 and SFRP5 showing a tendency towards greater abundance in patients. These data suggested that SFRP genes have tumour-suppresive activity in MPM and that methylated DNA from SFRP gene promoters has the potential to serve as a biomarker for MPM patient plasma.

  1. Expression of the p16{sup INK4a} tumor suppressor gene in rodent lung tumors

    Energy Technology Data Exchange (ETDEWEB)

    Swafford, D.S.; Tesfaigzi, J.; Belinsky, S.A.

    1995-12-01

    Aberrations on the short arm of chromosome 9 are among the earliest genetic changes in human cancer. p16{sup INK4a} is a candidate tumor suppressor gene that lies within human 9p21, a chromosome region associated with frequent loss of heterozygosity in human lung tumors. The p16{sup INK4a} protein functions as an inhibitor of cyclin D{sub 1}-dependent kinases that phosphorylate the retinoblastoma (Rb) tumor suppressor gene product enabling cell-cycle progression. Thus, overexpression of cyclin D{sub 1}, mutation of cyclin-dependent kinase genes, or loss of p16{sup INK4a} function, can all result in functional inactivation of Rb. Inactivation of Rb by mutation or deletion can result in an increase in p16{sup INK4a} transcription, suggesting that an increased p16{sup INK4a} expression in a tumor cell signals dysfunction of the pathway. The p16{sup (INK4a)} gene, unlike some tumor suppressor genes, is rarely inactivated by mutation. Instead, the expression of this gene is suppressed in some human cancers by hypermethylation of the CpG island within the first exon or by homozygous deletion: 686. Chromosome losses have been observed at 9p21 syntenic loci in tumors of the mouse and rat, two species often used as animal models for pulmonary carcinogenesis. Expression of p16{sup INK4a} is lost in some mouse tumor cell lines, often due to homozygous deletion. These observations indicate that p16{sup INK4a} dysfunction may play a role in the development of neoplasia in rodents as well as humans. The purpose of the current investigation was to define the extent to which p16{sup INK4a} dysfunction contributes to the development of rodent lung tumors and to determine the mechanism of inactivation of the gene. There is no evidence to suggest a loss of function of the p16{sup INK4a} tumor suppressor gene in these primary murine lung tumors by mutation, deletion, or methylation.

  2. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  3. Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

    Science.gov (United States)

    Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

    2005-07-01

    To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

  4. Evolution of the HIV-1 nef gene in HLA-B*57 Positive Elite Suppressors

    Directory of Open Access Journals (Sweden)

    Siliciano Robert F

    2010-11-01

    Full Text Available Abstract Elite controllers or suppressors (ES are HIV-1 infected patients who maintain viral loads of gag and nef in HLA-B*57 positive ES. We previously showed evolution in the gag gene of ES which surprisingly was mostly due to synonymous mutations rather than non-synonymous mutation in targeted CTL epitopes. This finding could be the result of structural constraints on Gag, and we therefore examined the less conserved nef gene. We found slow evolution of nef in plasma virus in some ES. This evolution is mostly due to synonymous mutations and occurs at a rate similar to that seen in the gag gene in the same patients. The results provide further evidence of ongoing viral replication in ES and suggest that the nef and gag genes in these patients respond similarly to selective pressure from the host.

  5. Gene trapping identifies a putative tumor suppressor and a new inducer of cell migration

    International Nuclear Information System (INIS)

    Guardiola-Serrano, Francisca; Haendeler, Judith; Lukosz, Margarete; Sturm, Karsten; Melchner, Harald von; Altschmied, Joachim

    2008-01-01

    Tumor necrosis factor alpha (TNFα) is a pleiotropic cytokine involved in apoptotic cell death, cellular proliferation, differentiation, inflammation, and tumorigenesis. In tumors it is secreted by tumor associated macrophages and can have both pro- and anti-tumorigenic effects. To identify genes regulated by TNFα, we performed a gene trap screen in the mammary carcinoma cell line MCF-7 and recovered 64 unique, TNFα-induced gene trap integration sites. Among these were the genes coding for the zinc finger protein ZC3H10 and for the transcription factor grainyhead-like 3 (GRHL3). In line with the dual effects of TNFα on tumorigenesis, we found that ZC3H10 inhibits anchorage independent growth in soft agar suggesting a tumor suppressor function, whereas GRHL3 strongly stimulated the migration of endothelial cells which is consistent with an angiogenic, pro-tumorigenic function

  6. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  7. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  8. P18 tumor suppressor gene and progression of oligodendrogliomas to anaplasia.

    Science.gov (United States)

    He, J; Hoang-Xuan, K; Marie, Y; Leuraud, P; Mokhtari, K; Kujas, M; Delattre, J Y; Sanson, M

    2000-09-26

    P18INK4C is a good candidate to be the tumor suppressor gene involved in oligodendrogliomas on 1p32. Loss of heterozygosity on 1p, mutation(s), homozygous deletion(s), and expression of p18 in 30 oligodendroglial tumors were investigated. Loss of heterozygosity on 1p was found in 15 tumors. A p18 mutation was found at an recurrence of an anaplastic oligodendroglioma, but not in the primary, low-grade tumor. No homozygous deletions were found and p18 was expressed in all cases. These results show that p18 alteration is involved in tumor progression in a subset of oligodendrogliomas.

  9. Heterozygous Germline Mutations in the CBL Tumor-Suppressor Gene Cause a Noonan Syndrome-like Phenotype

    Science.gov (United States)

    Martinelli, Simone; De Luca, Alessandro; Stellacci, Emilia; Rossi, Cesare; Checquolo, Saula; Lepri, Francesca; Caputo, Viviana; Silvano, Marianna; Buscherini, Francesco; Consoli, Federica; Ferrara, Grazia; Digilio, Maria C.; Cavaliere, Maria L.; van Hagen, Johanna M.; Zampino, Giuseppe; van der Burgt, Ineke; Ferrero, Giovanni B.; Mazzanti, Laura; Screpanti, Isabella; Yntema, Helger G.; Nillesen, Willy M.; Savarirayan, Ravi; Zenker, Martin; Dallapiccola, Bruno; Gelb, Bruce D.; Tartaglia, Marco

    2010-01-01

    RAS signaling plays a key role in controlling appropriate cell responses to extracellular stimuli and participates in early and late developmental processes. Although enhanced flow through this pathway has been established as a major contributor to oncogenesis, recent discoveries have revealed that aberrant RAS activation causes a group of clinically related developmental disorders characterized by facial dysmorphism, a wide spectrum of cardiac disease, reduced growth, variable cognitive deficits, ectodermal and musculoskeletal anomalies, and increased risk for certain malignancies. Here, we report that heterozygous germline mutations in CBL, a tumor-suppressor gene that is mutated in myeloid malignancies and encodes a multivalent adaptor protein with E3 ubiquitin ligase activity, can underlie a phenotype with clinical features fitting or partially overlapping Noonan syndrome (NS), the most common condition of this disease family. Independent CBL mutations were identified in two sporadic cases and two families from among 365 unrelated subjects who had NS or suggestive features and were negative for mutations in previously identified disease genes. Phenotypic heterogeneity and variable expressivity were documented. Mutations were missense changes altering evolutionarily conserved residues located in the RING finger domain or the linker connecting this domain to the N-terminal tyrosine kinase binding domain, a known mutational hot spot in myeloid malignancies. Mutations were shown to affect CBL-mediated receptor ubiquitylation and dysregulate signal flow through RAS. These findings document that germline mutations in CBL alter development to cause a clinically variable condition that resembles NS and that possibly predisposes to malignancies. PMID:20619386

  10. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  11. Down-regulation of SFRP1 as a putative tumor suppressor gene can contribute to human hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Huang, Jian; Zhang, Yun-Li; Teng, Xiao-Mei; Lin, Yun; Zheng, Da-Li; Yang, Peng-Yuan; Han, Ze-Guang

    2007-01-01

    Hepatocellular carcinoma (HCC) is one of the most common cancers in the world. SFRP1 (the secreted frizzled-related protein 1), a putative tumor suppressor gene mapped onto chromosome 8p12-p11.1, the frequent loss of heterozygosity (LOH) region in human HCC, encodes a Wingless-type (Wnt) signaling antagonist and is frequently inactivated by promoter methylation in many human cancers. However, whether the down-regulation of SFRP1 can contribute to hepatocarcinogenesis still remains unclear. We investigated the expression of SFRP1 through real time RT-PCR and immunohistochemistry staining. The cell growth and colony formation were observed as the overexpression and knockdown of SFRP1. The DNA methylation status within SFRP1 promoter was analyzed through methylation-specific PCR or bisulphate-treated DNA sequencing assays. Loss of heterozygosity was here detected with microsatellite markers. SFRP1 was significantly down-regulated in 76.1% (35/46) HCC specimens at mRNA level and in 30% (30/100) HCCs indicated by immunohistochemistry staining, as compared to adjacent non-cancerous livers. The overexpression of SFRP1 can significantly inhibit the cell growth and colony formation of YY-8103, SMMC7721, and Hep3B cells. The RNA interference against the constitutional SFRP1 in the offspring SMMC7721 cells, which were stably transfected by ectopic SFRP1, can markedly promote cell growth of these cells. LOH of both microsatellite markers D8S532 and D8SAC016868 flanking the gene locus was found in 13% (6 of 46 HCCs) and 6.5% (3 of 46 HCCs) of the informative cases, respectively, where 5 of 8 HCC specimens with LOH showed the down-regulation of SFRP1. DNA hypermethylation within SFRP1 promoter was identified in two of three HCC specimens without SFRP1 expression. Moreover, the DNA methylation of SFRP1 promoter was significantly reduced, along with the re-expression of the gene, in those HCC cell lines, Bel7404, QGY7701, and MHCC-H, as treated by DAC. Our data suggested that the

  12. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  13. Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking

    NARCIS (Netherlands)

    Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.

    1993-01-01

    Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the

  14. Sleep quality and methylation status of selected tumor suppressor genes among nurses and midwives.

    Science.gov (United States)

    Bukowska-Damska, Agnieszka; Reszka, Edyta; Kaluzny, Pawel; Wieczorek, Edyta; Przybek, Monika; Zienolddiny, Shanbeh; Peplonska, Beata

    2018-01-01

    Chronic sleep restriction may affect metabolism, hormone secretion patterns and inflammatory responses. Limited reports suggest also epigenetic effects, such as changes in DNA methylation profiles. The study aims to assess the potential association between poor sleep quality or sleep duration and the levels of 5-methylcytosine in the promoter regions of selected tumor suppressor genes. A cross-sectional study was conducted on 710 nurses and midwives aged 40-60 years. Data from interviews regarding sleep habits and potential confounders were used. The methylation status of tumor suppressor genes was determined via qMSP reactions using DNA samples derived from leucocytes. No significant findings were observed in the total study population or in the two subgroups of women stratified by the current system of work. A borderline significance association was observed between a shorter duration of sleep and an increased methylation level in CDKN2A among day working nurses and midwives. Further studies are warranted to explore this under-investigated topic.

  15. Tumor suppressor genes are frequently methylated in lymph node metastases of breast cancers

    Directory of Open Access Journals (Sweden)

    Xu Jia

    2010-07-01

    Full Text Available Abstract Introduction Metastasis represents a major adverse step in the progression of breast carcinoma. Lymph node invasion is the most relevant prognostic factor; however little is known on the molecular events associated with lymph node metastasis process. This study is to investigate the status and role of methylation in lymph node metastatic tumors. Materials and methods Bisulfite pyrosequencing is used to screen 6 putative tumor suppressor genes (HIN-1, RASSF1A, RIL, CDH13, RARβ2 and E-cadherin in 38 pairs of primary breast tumors and lymph node metastases. Results We found that HIN-1, CDH13, RIL, RASSF1A and RARβ2 were frequently methylated both in primary and metastatic tissues (range: 55.3%~89.5%. E-cadherin was not frequently methylated in either setting (range: 18.4%~23.7%. The methylation status of HIN-1, CDH13, RIL, and RARβ2 in lymph nodes metastasis were correlated with that in primary tumors. The Pearson correlation values ranged from 0.624 to 0.472 (p values HIN-1 methylation and hormone status in metastatic lymph nodes. Hypermethylation of HIN-1 in metastasis lymph nodes was significantly associated with expression of ER (odds ratio, 1.070; P = 0.024 and with PR (odds ratio, 1.046; P = 0.026. Conclusions This study suggests that hypermethylation of tumor suppressor genes is extended from primary to metastatic tumors during tumor progression.

  16. Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

    Science.gov (United States)

    Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

    2012-01-01

    Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

  17. Generation and characterization of mice carrying a conditional allele of the Wwox tumor suppressor gene.

    Directory of Open Access Journals (Sweden)

    John H Ludes-Meyers

    2009-11-01

    Full Text Available WWOX, the gene that spans the second most common human chromosomal fragile site, FRA16D, is inactivated in multiple human cancers and behaves as a suppressor of tumor growth. Since we are interested in understanding WWOX function in both normal and cancer tissues we generated mice harboring a conditional Wwox allele by flanking Exon 1 of the Wwox gene with LoxP sites. Wwox knockout (KO mice were developed by breeding with transgenic mice carrying the Cre-recombinase gene under the control of the adenovirus EIIA promoter. We found that Wwox KO mice suffered from severe metabolic defect(s resulting in growth retardation and all mice died by 3 wk of age. All Wwox KO mice displayed significant hypocapnia suggesting a state of metabolic acidosis. This finding and the known high expression of Wwox in kidney tubules suggest a role for Wwox in acid/base balance. Importantly, Wwox KO mice displayed histopathological and hematological signs of impaired hematopoiesis, leukopenia, and splenic atrophy. Impaired hematopoiesis can also be a contributing factor to metabolic acidosis and death. Hypoglycemia and hypocalcemia was also observed affecting the KO mice. In addition, bone metabolic defects were evident in Wwox KO mice. Bones were smaller and thinner having reduced bone volume as a consequence of a defect in mineralization. No evidence of spontaneous neoplasia was observed in Wwox KO mice. We have generated a new mouse model to inactivate the Wwox tumor suppressor gene conditionally. This will greatly facilitate the functional analysis of Wwox in adult mice and will allow investigating neoplastic transformation in specific target tissues.

  18. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  19. Tumor-suppressor genes that escape from X-inactivation contribute to cancer sex bias.

    Science.gov (United States)

    Dunford, Andrew; Weinstock, David M; Savova, Virginia; Schumacher, Steven E; Cleary, John P; Yoda, Akinori; Sullivan, Timothy J; Hess, Julian M; Gimelbrant, Alexander A; Beroukhim, Rameen; Lawrence, Michael S; Getz, Gad; Lane, Andrew A

    2017-01-01

    There is a striking and unexplained male predominance across many cancer types. A subset of X-chromosome genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative 'escape from X-inactivation tumor-suppressor' (EXITS) genes, we examined somatic alterations from >4,100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) X-chromosome genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) harbored loss-of-function mutations more frequently in males (based on a false discovery rate < 0.1), in comparison to zero of 18,055 autosomal and PAR genes (Fisher's exact P < 0.0001). Male-biased mutations in genes that escape X-inactivation were observed in combined analysis across many cancers and in several individual tumor types, suggesting a generalized phenomenon. We conclude that biallelic expression of EXITS genes in females explains a portion of the reduced cancer incidence in females as compared to males across a variety of tumor types.

  20. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  1. The novel RASSF6 and RASSF10 candidate tumour suppressor genes are frequently epigenetically inactivated in childhood leukaemias

    Directory of Open Access Journals (Sweden)

    Maher Eamonn R

    2009-07-01

    Full Text Available Abstract Background The Ras-assocation family (RASSF of tumour suppressor genes (TSGs contains 10 members that encode proteins containing Ras-assocation (RA domains. Several members of the RASSF family are frequently epigenetically inactivated in cancer, however, their role in leukaemia has remained largely uninvestigated. Also, RASSF10 is a predicted gene yet to be experimentally verified. Here we cloned, characterised and demonstrated expression of RASSF10 in normal human bone marrow. We also determined the methylation status of CpG islands associated with RASSF1–10 in a series of childhood acute lymphocytic leukaemias (ALL and normal blood and bone marrow samples. Results COBRA and bisulphite sequencing revealed RASSF6 and RASSF10 were the only RASSF members with a high frequency of leukaemia-specific methylation. RASSF6 was methylated in 94% (48/51 B-ALL and 41% (12/29 T-ALL, whilst RASSF10 was methylated in 16% (8/51 B-ALL and 88% (23/26 T-ALL. RASSF6 and RASSF10 expression inversely correlated with methylation which was restored by treatment with 5-aza-2'deoxycytidine (5azaDC. Conclusion This study shows the hypermethylation profile of RASSF genes in leukaemias is distinct from that of solid tumours and represents the first report of inactivation of RASSF6 or RASSF10 in cancer. These data show epigenetic inactivation of the candidate TSGs RASSF6 and RASSF10 is an extremely frequent event in the pathogenesis of childhood leukaemia. This study also warrants further investigation of the newly identified RASSF member RASSF10 and its potential role in leukaemia.

  2. CFTR is a tumor suppressor gene in murine and human intestinal cancer

    NARCIS (Netherlands)

    Than, B. L. N.; Linnekamp, J. F.; Starr, T. K.; Largaespada, D. A.; Rod, A.; Zhang, Y.; Bruner, V.; Abrahante, J.; Schumann, A.; Luczak, T.; Niemczyk, A.; O'Sullivan, M. G.; Medema, J. P.; Fijneman, R. J. A.; Meijer, G. A.; van den Broek, E.; Hodges, C. A.; Scott, P. M.; Vermeulen, L.; Cormier, R. T.

    2016-01-01

    CFTR, the cystic fibrosis (CF) gene, encodes for the CFTR protein that plays an essential role in anion regulation and tissue homeostasis of various epithelia. In the gastrointestinal (GI) tract CFTR promotes chloride and bicarbonate secretion, playing an essential role in ion and acid-base

  3. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  4. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  5. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  6. ING Genes Work as Tumor Suppressor Genes in the Carcinogenesis of Head and Neck Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Xiaohan Li

    2011-01-01

    Full Text Available Head and neck squamous cell carcinoma (HNSCC is the sixth most common cancer in the world. The evolution and progression of HNSCC are considered to result from multiple stepwise alterations of cellular and molecular pathways in squamous epithelium. Recently, inhibitor of growth gene (ING family consisting of five genes, ING1 to ING5, was identified as a new tumor suppressor gene family that was implicated in the downregulation of cell cycle and chromatin remodeling. In contrast, it has been shown that ING1 and ING2 play an oncogenic role in some cancers, this situation being similar to TGF-β. In HNSCC, the ING family has been reported to be downregulated, and ING translocation from the nucleus to the cytoplasm may be a critical event for carcinogenesis. In this paper, we describe our recent results and briefly summarize current knowledge regarding the biologic functions of ING in HNSCC.

  7. Expression of the tumor suppressor genes NF2, 4.1B, and TSLC1 in canine meningiomas.

    Science.gov (United States)

    Dickinson, P J; Surace, E I; Cambell, M; Higgins, R J; Leutenegger, C M; Bollen, A W; LeCouteur, R A; Gutmann, D H

    2009-09-01

    Meningiomas are common primary brain tumors in dogs; however, little is known about the molecular genetic mechanisms involved in their tumorigenesis. Several tumor suppressor genes have been implicated in meningioma pathogenesis in humans, including the neurofibromatosis 2 (NF2), protein 4.1B (4.1 B), and tumor suppressor in lung cancer-1 (TSLC1) genes. We investigated the expression of these tumor suppressor genes in a series of spontaneous canine meningiomas using quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) (NF2; n = 25) and western blotting (NF2/merlin, 4.1B, TSLC1; n = 30). Decreased expression of 4.1B and TSLC1 expression on western blotting was seen in 6/30 (20%) and in 15/30 (50%) tumors, respectively, with 18/30 (60%) of meningiomas having decreased or absent expression of one or both proteins. NF2 gene expression assessed by western blotting and RT-PCR varied considerably between individual tumors. Complete loss of NF2 protein on western blotting was not seen, unlike 4.1B and TSLC1. Incidence of TSLC1 abnormalities was similar to that seen in human meningiomas, while perturbation of NF2 and 4.1B appeared to be less common than reported for human tumors. No association was observed between tumor grade, subtype, or location and tumor suppressor gene expression based on western blot or RT-PCR. These results suggest that loss of these tumor suppressor genes is a frequent occurrence in canine meningiomas and may be an early event in tumorigenesis in some cases. In addition, it is likely that other, as yet unidentified, genes play an important role in canine meningioma formation and growth.

  8. A phase I study of hydralazine to demethylate and reactivate the expression of tumor suppressor genes

    International Nuclear Information System (INIS)

    Zambrano, Pilar; Sandoval, Karina; Trejo-Becerril, Catalina; Chanona-Vilchis, Jose; Duenas-González, Alfonso; Segura-Pacheco, Blanca; Perez-Cardenas, Enrique; Cetina, Lucely; Revilla-Vazquez, Alma; Taja-Chayeb, Lucía; Chavez-Blanco, Alma; Angeles, Enrique; Cabrera, Gustavo

    2005-01-01

    The antihypertensive compound hydralazine is a known demethylating agent. This phase I study evaluated the tolerability and its effects upon DNA methylation and gene reactivation in patients with untreated cervical cancer. Hydralazine was administered to cohorts of 4 patients at the following dose levels: I) 50 mg/day, II) 75 mg/day, III) 100 mg/day and IV) 150 mg/day. Tumor biopsies and peripheral blood samples were taken the day before and after treatment. The genes APC, MGMT; ER, GSTP1, DAPK, RARβ, FHIT and p16 were evaluated pre and post-treatment for DNA promoter methylation and gene expression by MSP (Methylation-Specific PCR) and RT-PCR respectively in each of the tumor samples. Methylation of the imprinted H19 gene and the 'normally methylated' sequence clone 1.2 was also analyzed. Global DNA methylation was analyzed by capillary electrophoresis and cytosine extension assay. Toxicity was evaluated using the NCI Common Toxicity Criteria. Hydralazine was well tolerated. Toxicities were mild being the most common nausea, dizziness, fatigue, headache and palpitations. Overall, 70% of the pretreatment samples and all the patients had at least one methylated gene. Rates of demethylation at the different dose levels were as follows: 50 mg/day, 40%; 75 mg/day, 52%, 100 mg/day, 43%, and 150 mg/day, 32%. Gene expression analysis showed only 12 informative cases, of these 9 (75%) re-expressed the gene. There was neither change in the methylation status of H19 and clone 1.2 nor changes in global DNA methylation. Hydralazine at doses between 50 and 150 mg/day is well tolerated and effective to demethylate and reactivate the expression of tumor suppressor genes without affecting global DNA methylation

  9. Tumor Suppressor Gene-Based Nanotherapy: From Test Tube to the Clinic

    Directory of Open Access Journals (Sweden)

    Manish Shanker

    2011-01-01

    Full Text Available Cancer is a major health problem in the world. Advances made in cancer therapy have improved the survival of patients in certain types of cancer. However, the overall five-year survival has not significantly improved in the majority of cancer types. Major challenges encountered in having effective cancer therapy are development of drug resistance by the tumor cells, nonspecific cytotoxicity, and inability to affect metastatic tumors by the chemodrugs. Overcoming these challenges requires development and testing of novel therapies. One attractive cancer therapeutic approach is cancer gene therapy. Several laboratories including the authors' laboratory have been investigating nonviral formulations for delivering therapeutic genes as a mode for effective cancer therapy. In this paper the authors will summarize their experience in the development and testing of a cationic lipid-based nanocarrier formulation and the results from their preclinical studies leading to a Phase I clinical trial for nonsmall cell lung cancer. Their nanocarrier formulation containing therapeutic genes such as tumor suppressor genes when administered intravenously effectively controls metastatic tumor growth. Additional Phase I clinical trials based on the results of their nanocarrier formulation have been initiated or proposed for treatment of cancer of the breast, ovary, pancreas, and metastatic melanoma, and will be discussed.

  10. Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

    Science.gov (United States)

    Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

    2005-04-01

    The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

  11. Tumor suppressor gene-based nanotherapy: from test tube to the clinic.

    Science.gov (United States)

    Shanker, Manish; Jin, Jiankang; Branch, Cynthia D; Miyamoto, Shinya; Grimm, Elizabeth A; Roth, Jack A; Ramesh, Rajagopal

    2011-01-01

    Cancer is a major health problem in the world. Advances made in cancer therapy have improved the survival of patients in certain types of cancer. However, the overall five-year survival has not significantly improved in the majority of cancer types. Major challenges encountered in having effective cancer therapy are development of drug resistance by the tumor cells, nonspecific cytotoxicity, and inability to affect metastatic tumors by the chemodrugs. Overcoming these challenges requires development and testing of novel therapies. One attractive cancer therapeutic approach is cancer gene therapy. Several laboratories including the authors' laboratory have been investigating nonviral formulations for delivering therapeutic genes as a mode for effective cancer therapy. In this paper the authors will summarize their experience in the development and testing of a cationic lipid-based nanocarrier formulation and the results from their preclinical studies leading to a Phase I clinical trial for nonsmall cell lung cancer. Their nanocarrier formulation containing therapeutic genes such as tumor suppressor genes when administered intravenously effectively controls metastatic tumor growth. Additional Phase I clinical trials based on the results of their nanocarrier formulation have been initiated or proposed for treatment of cancer of the breast, ovary, pancreas, and metastatic melanoma, and will be discussed.

  12. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    Science.gov (United States)

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  13. Differential splicing of oncogenes and tumor suppressor genes in African and Caucasian American populations: contributing factor in prostate cancer disparities

    Science.gov (United States)

    2017-12-01

    populations: contributing factor in prostate cancer disparities? PRINCIPAL INVESTIGATOR: Norman H Lee, PhD CONTRACTING ORGANIZATION: George Washington...splicing of oncogenes and tumor suppressor genes in African and Caucasian American populations: contributing factor in prostate cancer disparities? 5b...American (AA) versus Caucasian American (CA) prostate cancer (PCa). We focused our efforts on two oncogenes, phosphatidylinositol-4,5-bisphosphate 3

  14. Mutation analysis of suppressor of cytokine signalling 3, a candidate gene in Type 1 diabetes and insulin sensitivity

    DEFF Research Database (Denmark)

    Gylvin, T; Nolsøe, R; Hansen, T

    2004-01-01

    Beta cell loss in Type 1 and Type 2 diabetes mellitus may result from apoptosis and necrosis induced by inflammatory mediators. The suppressor of cytokine signalling (SOCS)-3 is a natural inhibitor of cytokine signalling and also influences insulin signalling. SOCS3 could therefore be a candidate...... gene in the development of Type 1 and Type 2 diabetes mellitus....

  15. DLC1 tumor suppressor gene inhibits migration and invasion of multiple myeloma cells through RhoA GTPase pathway

    Czech Academy of Sciences Publication Activity Database

    Ullmannová-Benson, Veronika; Guan, M.; Zhou, X. G.; Tripathi, V.; Yang, V.; Zimonjic, D. B.; Popescu, C.

    2009-01-01

    Roč. 23, č. 2 (2009), s. 383-390 ISSN 0887-6924 Institutional research plan: CEZ:AV0Z50200510 Keywords : multiple myeloma * tumor suppressor gene * promoter methylation Subject RIV: EC - Immunology Impact factor: 8.296, year: 2009

  16. Key tumor suppressor genes inactivated by "greater promoter" methylation and somatic mutations in head and neck cancer

    NARCIS (Netherlands)

    Guerrero-Preston, Rafael; Michailidi, Christina; Marchionni, Luigi; Pickering, Curtis R.; Frederick, Mitchell J.; Myers, Jeffrey N.; Yegnasubramanian, Srinivasan; Hadar, Tal; Noordhuis, Maartje G.; Zizkova, Veronika; Fertig, Elana; Agrawal, Nishant; Westra, William; Koch, Wayne; Califano, Joseph; Velculescu, Victor E.; Sidransky, David

    Tumor suppressor genes (TSGs) are commonly inactivated by somatic mutation and/or promoter methylation; yet, recent high-throughput genomic studies have not identified key TSGs inactivated by both mechanisms. We pursued an integrated molecular analysis based on methylation binding domain sequencing

  17. Alternative polyadenylation of tumor suppressor genes in small intestinal neuroendocrine tumors.

    Science.gov (United States)

    Rehfeld, Anders; Plass, Mireya; Døssing, Kristina; Knigge, Ulrich; Kjær, Andreas; Krogh, Anders; Friis-Hansen, Lennart

    2014-01-01

    The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3' untranslated regions. Additionally, APA can also produce mRNAs containing different 3'-terminal coding regions. Therefore, APA alters both the repertoire and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3' truncation of mRNA coding regions or 3' untranslated regions. Among these, 11 genes had been previously associated with cancer, with 4 genes being known tumor suppressors: DCC, PDZD2, MAGI1, and DACT2. We validated the APA in three out of three cases with quantitative real-time-PCR. Our findings suggest that changes of APA pattern in these 16 genes could be involved in the tumorigenesis of SI-NETs. Furthermore, they also point to APA as a new target for both diagnostic and treatment of SI-NETs. The identified genes with APA specific to the SI-NETs could be further tested as diagnostic markers and drug targets for disease prevention and treatment.

  18. MUC1-C activates polycomb repressive complexes and downregulates tumor suppressor genes in human cancer cells.

    Science.gov (United States)

    Rajabi, Hasan; Hiraki, Masayuki; Kufe, Donald

    2018-04-01

    The PRC2 and PRC1 complexes are aberrantly expressed in human cancers and have been linked to decreases in patient survival. MUC1-C is an oncoprotein that is also overexpressed in diverse human cancers and is associated with a poor prognosis. Recent studies have supported a previously unreported function for MUC1-C in activating PRC2 and PRC1 in cancer cells. In the regulation of PRC2, MUC1-C (i) drives transcription of the EZH2 gene, (ii) binds directly to EZH2, and (iii) enhances occupancy of EZH2 on target gene promoters with an increase in H3K27 trimethylation. Regarding PRC1, which is recruited to PRC2 sites in the hierarchical model, MUC1-C induces BMI1 transcription, forms a complex with BMI1, and promotes H2A ubiquitylation. MUC1-C thereby contributes to the integration of PRC2 and PRC1-mediated repression of tumor suppressor genes, such as CDH1, CDKN2A, PTEN and BRCA1. Like PRC2 and PRC1, MUC1-C is associated with the epithelial-mesenchymal transition (EMT) program, cancer stem cell (CSC) state, and acquisition of anticancer drug resistance. In concert with these observations, targeting MUC1-C downregulates EZH2 and BMI1, inhibits EMT and the CSC state, and reverses drug resistance. These findings emphasize the significance of MUC1-C as a therapeutic target for inhibiting aberrant PRC function and reprogramming the epigenome in human cancers.

  19. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  20. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  1. RPS6KA2, a putative tumour suppressor gene at 6q27 in sporadic epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Bignone, P A; Lee, K Y; Liu, Y

    2007-01-01

    We had previously defined by allele loss studies a minimal region at 6q27 (between D6S264 and D6S297) to contain a putative tumour suppressor gene. The p90 ribosomal S6 kinase-3 gene (p90 Rsk-3, RPS6KA2) maps in this interval. It is a serine-threonine kinase that signals downstream of the mitogen...

  2. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  3. A study on tumor suppressor genes mutations associated with different pathological colorectal lesions

    International Nuclear Information System (INIS)

    Matar, S.N.A.

    2011-01-01

    Colorectal cancer (CRC) is the second leading cause of cancer-related death in the Western world. In Egypt; there is an increasing incidence of the disease, especially among patients ≤40 years age. While CRC have been reported in low incidence rate in developing countries, it is the third most common tumor in male and the fifth common tumor in females in Egypt. Early diagnosis and surgical interference guarantee long survival of most CRC patients. Early diagnosis is impeded by the disease onset at young age and imprecise symptoms at the initial stages of the disease. As in most solid tumors, the malignant transformation of colonic epithelial cells is to arise through a multistep process during which they acquire genetic changes involving the activation of proto-oncogenes and the loss of tumor suppressor genes. Recently, a candidate tumor suppressor gene, KLF6, which is mapped to chromosome 10p, was found to be frequently mutated in a number of cancers. There are some evidences suggesting that the disruption of the functional activity of KLF6 gene products may be one of the early events in tumor genesis of the colon. The main objective of the present study was to detect mutational changes of KLF6 tumor suppressor gene and to study the loss of heterozygosity (LOH) markers at chromosome 10p15 (KLF6 locus) in colorectal lesions and colorectal cancer in Egyptian patients. The patients included in this study were 83 presented with different indications for colonoscopic examination. Selecting patients with colorectal pre-cancerous lesions or colorectal cancer was done according to the results of tissue biopsy from lesion and adjacent normal. The patients were classified into three main groups; (G I) Cancerous group, (G II) polyps group including patients with adenomatous polyps (AP), familial adenomatous polyps (FAP) and hyperplastic polyps (HP) and (G III) Inflammatory Bowel Diseases (IBD) including patients with ulcerative colitis (UC) and Crohn's disease (CD

  4. Fish Suppressors of Cytokine Signaling (SOCS): Gene Discovery, Modulation of Expression and Function

    Science.gov (United States)

    Wang, Tiehui; Gorgoglione, Bartolomeo; Maehr, Tanja; Holland, Jason W.; Vecino, Jose L. González; Wadsworth, Simon; Secombes, Christopher J.

    2011-01-01

    The intracellular suppressors of cytokine signaling (SOCS) family members, including CISH and SOCS1 to 7 in mammals, are important regulators of cytokine signaling pathways. So far, the orthologues of all the eight mammalian SOCS members have been identified in fish, with several of them having multiple copies. Whilst fish CISH, SOCS3, and SOCS5 paralogues are possibly the result of the fish-specific whole genome duplication event, gene duplication or lineage-specific genome duplication may also contribute to some paralogues, as with the three trout SOCS2s and three zebrafish SOCS5s. Fish SOCS genes are broadly expressed and also show species-specific expression patterns. They can be upregulated by cytokines, such as IFN-γ, TNF-α, IL-1β, IL-6, and IL-21, by immune stimulants such as LPS, poly I:C, and PMA, as well as by viral, bacterial, and parasitic infections in member- and species-dependent manners. Initial functional studies demonstrate conserved mechanisms of fish SOCS action via JAK/STAT pathways. PMID:22203897

  5. Quantitative Methylation Profiles for Multiple Tumor Suppressor Gene Promoters in Salivary Gland Tumors

    Science.gov (United States)

    Durr, Megan L.; Mydlarz, Wojciech K.; Shao, Chunbo; Zahurak, Marianna L.; Chuang, Alice Y.; Hoque, Mohammad O.; Westra, William H.; Liegeois, Nanette J.; Califano, Joseph A.; Sidransky, David; Ha, Patrick K.

    2010-01-01

    Background Methylation profiling of tumor suppressor gene (TSGs) promoters is quickly becoming a powerful diagnostic tool for the early detection, prognosis, and even prediction of clinical response to treatment. Few studies address this in salivary gland tumors (SGTs); hence the promoter methylation profile of various TSGs was quantitatively assessed in primary SGT tissue to determine if tumor-specific alterations could be detected. Methodology DNA isolated from 78 tumor and 17 normal parotid gland specimens was assayed for promoter methylation status of 19 TSGs by fluorescence-based, quantitative methylation-specific PCR (qMSP). The data were utilized in a binary fashion as well as quantitatively (using a methylation quotient) allowing for better profiling and interpretation of results. Principal Findings The average number of methylation events across the studied genes was highest in salivary duct carcinoma (SDC), with a methylation value of 9.6, compared to the normal 4.5 (ptrend for increasing methylation in APC, Mint 1, PGP9.5, RAR-β, and Timp3. Conclusions/Significance Screening promoter methylation profiles in SGTs showed considerable heterogeneity. The methylation status of certain markers was surprisingly high in even normal salivary tissue, confirming the need for such controls. Several TSGs were found to be associated with malignant SGTs, especially SDC. Further study is needed to evaluate the potential use of these associations in the detection, prognosis, and therapeutic outcome of these rare tumors. PMID:20520817

  6. Genetic and biochemical evidence that haploinsufficiency of the Nf1 tumor suppressor gene modulates melanocyte and mast cell fates in vivo.

    Science.gov (United States)

    Ingram, D A; Yang, F C; Travers, J B; Wenning, M J; Hiatt, K; New, S; Hood, A; Shannon, K; Williams, D A; Clapp, D W

    2000-01-03

    Neurofibromatosis type 1 (NF1) is a common autosomal-dominant disorder characterized by cutaneous neurofibromas infiltrated with large numbers of mast cells, melanocyte hyperplasia, and a predisposition to develop malignant neoplasms. NF1 encodes a GTPase activating protein (GAP) for Ras. Consistent with Knudson's "two hit" model of tumor suppressor genes, leukemias and malignant solid tumors in NF1 patients frequently demonstrate somatic loss of the normal NF1 allele. However, the phenotypic and biochemical consequences of heterozygous inactivation of Nf1 are largely unknown. Recently neurofibromin, the protein encoded by NF1, was shown to negatively regulate Ras activity in Nf1-/- murine myeloid hematopoietic cells in vitro through the c-kit receptor tyrosine kinase (dominant white spotting, W). Since the W and Nf1 locus appear to function along a common developmental pathway, we generated mice with mutations at both loci to examine potential interactions in vivo. Here, we show that haploinsufficiency at Nf1 perturbs cell fates in mast cells in vivo, and partially rescues coat color and mast cell defects in W(41) mice. Haploinsufficiency at Nf1 also increased mast cell proliferation, survival, and colony formation in response to Steel factor, the ligand for c-kit. Furthermore, haploinsufficiency was associated with enhanced Ras-mitogen-activated protein kinase activity, a major downstream effector of Ras, via wild-type and mutant (W(41)) c-kit receptors. These observations identify a novel interaction between c-kit and neurofibromin in vivo, and offer experimental evidence that haploinsufficiency of Nf1 alters both cellular and biochemical phenotypes in two cell lineages that are affected in individuals with NF1. Collectively, these data support the emerging concept that heterozygous inactivation of tumor suppressor genes may have profound biological effects in multiple cell types.

  7. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  8. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  9. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  10. Epigenetic silencing of MAL, a putative tumor suppressor gene, can contribute to human epithelium cell carcinoma

    Directory of Open Access Journals (Sweden)

    Zhang Jun

    2010-11-01

    suppressor gene, can contribute to human epithelial cell carcinoma and may be served as a biomarker in HNSCC.

  11. Inactivation of tumor suppressor genes and cancer therapy: An evolutionary game theory approach.

    Science.gov (United States)

    Khadem, Heydar; Kebriaei, Hamed; Veisi, Zahra

    2017-06-01

    Inactivation of alleles in tumor suppressor genes (TSG) is one of the important issues resulting in evolution of cancerous cells. In this paper, the evolution of healthy, one and two missed allele cells is modeled using the concept of evolutionary game theory and replicator dynamics. The proposed model also takes into account the interaction rates of the cells as designing parameters of the system. Different combinations of the equilibrium points of the parameterized nonlinear system is studied and categorized into some cases. In each case, the interaction rates' values are suggested in a way that the equilibrium points of the replicator dynamics are located on an appropriate region of the state space. Based on the suggested interaction rates, it is proved that the system doesn't have any undesirable interior equilibrium point as well. Therefore, the system will converge to the desirable region, where there is a scanty level of cancerous cells. In addition, the proposed conditions for interaction rates guarantee that, when a trajectory of the system reaches the boundaries, then it will stay there forever which is a desirable property since the equilibrium points have been already located on the boundaries, appropriately. The simulation results show the effectiveness of the suggestions in the elimination of the cancerous cells in different scenarios. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Analysis of Suppressor of Cytokine Signaling 2 Gene (SOCS2 Polymorphism in Different Dog Breeds

    Directory of Open Access Journals (Sweden)

    Martina Miluchová

    2011-05-01

    Full Text Available SOCS2 is a negative regulator of growth hormone signaling. The deletion of SOCS2 in mice results in a 30-50% increase in post-natal growth. The aim of the paper was to identify of suppressor of cytokine signaling 2 gene (SOCS2 polymorphism in different dog breeds. The material involved 77 dogs from 14 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® (Molecular Research Center and linear polyacrylamide (LPA carrier and from blood by using NucleospinBlood (Macherey-Nagel and used in order to estimate SOCS2 genotypes by PCR-RFLP method. The PCR products were digested with TaqI restriction enzyme. The T allele was distributed among large dog breeds (Czech pointer, Golden retriever, Rottweiler with an allele frequency ranging from 0.2857 to 1.00. In the population of Czech pointer we detected all genotypes. There were detected homozygote genotype GG with frequency 0.5476, heterozygote genotype GT with frequency 0.3333 and homozygote genotype TT with frequency 0.1191. Results point out that frequency of G allele was high and was represented 0.7143. Frequency of T allele was 0.2857. In Rottweiler was detected homozygote genotype TT. Genotypes GG and GT has not been observed. In Golden retriever we detected only heterozygote genotype GT.

  13. Are there tumor suppressor genes on chromosome 4p in sporadic colorectal carcinoma?

    Science.gov (United States)

    Zheng, Hai-Tao; Jiang, Li-Xin; Lv, Zhong-Chuan; Li, Da-Peng; Zhou, Chong-Zhi; Gao, Jian-Jun; He, Lin; Peng, Zhi-Hai

    2008-01-07

    To study the candidate tumor suppressor genes (TSG) on chromosome 4p by detecting the high frequency of loss of heterozygosity (LOH) in sporadic colorectal carcinoma in Chinese patients. Seven fluorescent labeled polymorphic microsatellite markers were analyzed in 83 cases of colorectal carcinoma and matched normal tissue DNA by PCR. PCR products were electrophoresed on an ABI 377 DNA sequencer. Genescan 3.7 and Genotype 3.7 software were used for LOH scanning and analysis. The same procedure was performed by the other six microsatellite markers spanning D4S3013 locus to make further detailed deletion mapping. Comparison between LOH frequency and clinicopathological factors was performed by c2 test. Data were collected from all informative loci. The average LOH frequency on 4p was 24.25%, and 42.3% and 35.62% on D4S405 and D4S3013 locus, respectively. Adjacent markers of D4S3013 displayed a low LOH frequency (4p15.2) and D4S405 (4p14) locus are detected. Candidate TSG, which is involved in carcinogenesis and progression of sporadic colorectal carcinoma on chromosome 4p, may be located between D4S3017 and D4S2933 (about 1.7 cm).

  14. HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

    Directory of Open Access Journals (Sweden)

    Lehto Kirsi

    2011-04-01

    Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

  15. Presence of activating KRAS mutations correlates significantly with expression of tumour suppressor genes DCN and TPM1 in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Rems Miran

    2009-08-01

    Full Text Available Abstract Background Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC, it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. Methods We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. Results We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Conclusion Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin.

  16. Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.

    Directory of Open Access Journals (Sweden)

    Stella Marie Reamon-Buettner

    Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.

  17. Tumor suppressors: enhancers or suppressors of regeneration?

    Science.gov (United States)

    Pomerantz, Jason H.; Blau, Helen M.

    2013-01-01

    Tumor suppressors are so named because cancers occur in their absence, but these genes also have important functions in development, metabolism and tissue homeostasis. Here, we discuss known and potential functions of tumor suppressor genes during tissue regeneration, focusing on the evolutionarily conserved tumor suppressors pRb1, p53, Pten and Hippo. We propose that their activity is essential for tissue regeneration. This is in contrast to suggestions that tumor suppression is a trade-off for regenerative capacity. We also hypothesize that certain aspects of tumor suppressor pathways inhibit regenerative processes in mammals, and that transient targeted modification of these pathways could be fruitfully exploited to enhance processes that are important to regenerative medicine. PMID:23715544

  18. A targeted constitutive mutation in the APC tumor suppressor gene underlies mammary but not intestinal tumorigenesis.

    Directory of Open Access Journals (Sweden)

    Claudia Gaspar

    2009-07-01

    Full Text Available Germline mutations in the adenomatous polyposis coli (APC gene are responsible for familial adenomatous polyposis (FAP, an autosomal dominant hereditary predisposition to the development of multiple colorectal adenomas and of a broad spectrum of extra-intestinal tumors. Moreover, somatic APC mutations play a rate-limiting and initiating role in the majority of sporadic colorectal cancers. Notwithstanding its multifunctional nature, the main tumor suppressing activity of the APC gene resides in its ability to regulate Wnt/beta-catenin signaling. Notably, genotype-phenotype correlations have been established at the APC gene between the length and stability of the truncated proteins encoded by different mutant alleles, the corresponding levels of Wnt/beta-catenin signaling activity they encode for, and the incidence and distribution of intestinal and extra-intestinal tumors. Here, we report a novel mouse model, Apc1572T, obtained by targeting a truncated mutation at codon 1572 in the endogenous Apc gene. This hypomorphic mutant allele results in intermediate levels of Wnt/beta-catenin signaling activation when compared with other Apc mutations associated with multifocal intestinal tumors. Notwithstanding the constitutive nature of the mutation, Apc(+/1572T mice have no predisposition to intestinal cancer but develop multifocal mammary adenocarcinomas and subsequent pulmonary metastases in both genders. The histology of the Apc1572T primary mammary tumours is highly heterogeneous with luminal, myoepithelial, and squamous lineages and is reminiscent of metaplastic carcinoma of the breast in humans. The striking phenotype of Apc(+/1572T mice suggests that specific dosages of Wnt/beta-catenin signaling activity differentially affect tissue homeostasis and initiate tumorigenesis in an organ-specific fashion.

  19. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  20. The metastasis suppressor gene KISS-1 regulates osteosarcoma apoptosis and autophagy processes.

    Science.gov (United States)

    Yin, Yiran; Tang, Lian; Shi, Lei

    2017-03-01

    The expression of the metastasis suppressor gene KISS-1 in osteosarcoma cells during apoptosis and autophagy was evaluated. MG-63 osteosarcoma cells were transfected with either KISS-1 overexpression or KISS-1 knockdown expression vector in vitro, and compared with cell lines transfected with empty vector. After 12, 24, 48 and 72 h of cell culture, the cell proliferation was examined. The MTT method was used to detect apoptosis by flow cytometry, and the mRNA levels of apoptosis and autophagy markers caspase-3, Bcl-2, Bax, LC3 and Beclin1 were assessed by RT-PCR. Our results showed that cells in the control and low expression group kept proliferating during the cell culture period of 72 h, while the cells in the overexpression group progressively decreased in number. Also, the proliferation rate of the low expression group was significantly higher than that of the control group. The relative mRNA expression levels of caspase-3 and Bax mRNA in the control and low expression group showed no change (the expression was lowest in the low expression group). Moreover, the mRNA level of Bcl-2 increased in both cell groups. The mRNA expression levels of caspase-3 and Bax in the overexpression group were increased, and the level of Bcl-2 was reduced significantly. At the same time, the relative expression level of LC3 and Beclin1 mRNA in the control and low expression groups remained the same, and that of the overexpression group increased. The mRNA levels of LC3 and Beclin1 in the overexpression group were the highest, and that of the low expression group the lowest. The differences were statistically significant (Posteosarcoma in vitro, probably by accelerating the processes of apoptosis and autophagy in the cells.

  1. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  2. Molecular Analysis: Microsatellite Instability and Loss of Heterozygosity of Tumor Suppressor Gene in Hereditary Non-Polyposis Colorectal Cancer (HNPCC

    Directory of Open Access Journals (Sweden)

    Vesna Hadžiavdić

    2009-02-01

    Full Text Available HNPCC (Hereditary non-polyposis colorectal cancer development is caused by mutation of genes included in system of mismatch repair genes. The mutation exists at 60% of patients in hMSH2 gene, 30% in hMLH1 and 10% both in hPMS1and hPMS2 genes. RER+ exists in about 90% in hereditary non-polyposis colorectal cancer and about 15-28% in sporadic cancers.The purpose of the study was to determine highly sensitive microsatellite markers which can be fast and efficient way of microsatellite screening for detection of HNPCC patients. Moreover, we have analysed the loss of heterozygosity of tumour suppressor genes which could have the diagnostic value in detection of HPNCC patients.

  3. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    International Nuclear Information System (INIS)

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-01-01

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  4. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  5. Genome‐wide DNA methylation analysis identifies MEGF10 as a novel epigenetically repressed candidate tumor suppressor gene in neuroblastoma

    Science.gov (United States)

    Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R.; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J.; Almutairi, Bader; Etchevers, Heather C.; McConville, Carmel; Malik, Karim T. A.

    2016-01-01

    Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome‐wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome‐wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down‐regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest‐expressing tumors had reduced relapse‐free survival. Our functional studies showed that knock‐down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. PMID:27862318

  6. Geminivirus-encoded TrAP suppressor inhibits the histone methyltransferase SUVH4/KYP to counter host defense

    OpenAIRE

    Castillo-González, Claudia; Liu, Xiuying; Huang, Changjun; Zhao, Changjiang; Ma, Zeyang; Hu, Tao; Sun, Feng; Zhou, Yijun; Zhou, Xueping; Wang, Xiu-Jie; Zhang, Xiuren

    2015-01-01

    eLife digest Many viruses can infect plants and cause diseases that can reduce crop yields. The Geminiviruses are a family of plant viruses that are transmitted by insects and infect tomato, cabbage, and many other crop plants. These viruses hijack the plant cells that they infect and force the plant cells to make viral proteins using instructions provided by the genes in the virus' own DNA. To make proteins, DNA is first copied into molecules of messenger ribonucleic acid (or mRNA) in a proc...

  7. Alterations of tumor suppressor genes (Rb, p16, p27 and p53) and an increased FDG uptake in lung cancer

    International Nuclear Information System (INIS)

    Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo

    2003-01-01

    The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)

  8. Clinical Utility of promoter methylation of the tumor suppressor genes DKK3, and RASSF1A in breast cancer patients

    Directory of Open Access Journals (Sweden)

    Marwa H. Saied

    2018-04-01

    Full Text Available Background: DNA methylation is the commonest known epigenetic change that results in silencing of tumor suppressor genes. Promoter methylation of tumor suppressor genes has the potential for early detection of breast cancer. Aim: Aim is to examine the potential usefulness of blood based methylation specific polymerase chain reaction (MSP of methylated DKK3 and RASSF1A genes in early detection of breast cancer. Method: Methylation status of DKK3 and RASSF1 was investigated in forty breast cancer patients, twenty fibroadenoma patients and twenty healthy ladies as control group using MSP. Results: Methylation of DKK3 promoter was found in 22.5% of breast cancer patients, while DKK3 methylation was absent in both fibroadenoma patients and control group. Similarly, methylation of RASSF1 promoter was found in 17.5% of breast cancer patients and in none of fibroadenoma and control group. Conclusion: Promoter methylation of DKK3 and RASSF1 was found in breast cancer patients while absent in control group suggesting that tumorspecific methylation of the two genes (DKK3 and RASSF1A might be a valuable biomarker for the early detection of breast cancer. Keywords: DNA methylation, Breast cancer, DKK3, RASSF1

  9. Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators

    International Nuclear Information System (INIS)

    Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.

    2012-01-01

    Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin

  10. Phytochemical Compositions of Immature Wheat Bran, and Its Antioxidant Capacity, Cell Growth Inhibition, and Apoptosis Induction through Tumor Suppressor Gene

    Directory of Open Access Journals (Sweden)

    Mi Jeong Kim

    2016-09-01

    Full Text Available The purpose of this study was to investigate the phytochemical compositions and antioxidant capacity, cell growth inhibition, and apoptosis induction in extracts of immature wheat bran. Immature wheat bran (IWB was obtained from immature wheat harvested 10 days earlier than mature wheat. The phytochemical compositions of bran extract samples were analyzed by ultra-high performance liquid chromatography. The total ferulic acid (3.09 mg/g and p-coumaric acid (75 µg/g in IWB were significantly higher than in mature wheat bran (MWB, ferulic acid: 1.79 mg/g; p-coumaric acid: 55 µg/g. The oxygen radical absorbance capacity (ORAC: 327 µM Trolox equivalents (TE/g and cellular antioxidant activity (CAA: 4.59 µM Quercetin equivalents (QE/g of the IWB were higher than those of the MWB (ORAC: 281 µM TE/g; CAA: 0.63 µM QE/g. When assessing cell proliferation, the IWB extracts resulted in the lowest EC50 values against HT-29 (18.9 mg/mL, Caco-2 (7.74 mg/mL, and HeLa cells (8.17 mg/mL among bran extract samples. Additionally, the IWB extracts increased the gene expression of p53 and PTEN (tumor suppressor genes in HT-29 cells, indicating inhibited cell growth and induced apoptosis through tumor suppressor genes.

  11. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    Science.gov (United States)

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  12. KLF10, transforming growth factor-{beta}-inducible early gene 1, acts as a tumor suppressor

    Energy Technology Data Exchange (ETDEWEB)

    Song, Ki-Duk [Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921 (Korea, Republic of); Laboratory of Protein Engineering and Comparative Immunology, School of Agricultural Biotechnology, Seoul National University, Seoul 151-921 (Korea, Republic of); Kim, Duk-Jung [The Institute of Hankook Life Science, 7-9 Myungryun-dong, Jongno-gu, Seoul 110-521 (Korea, Republic of); Lee, Jong Eun [Department of Anatomy, College of Medicine, Yonsei University, Seoul 120-752 (Korea, Republic of); Yun, Cheol-Heui [Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921 (Korea, Republic of); Laboratory of Protein Engineering and Comparative Immunology, School of Agricultural Biotechnology, Seoul National University, Seoul 151-921 (Korea, Republic of); Lee, Woon Kyu, E-mail: wklee@inha.ac.kr [Laboratory of Developmental Genetics, School of Medicine, Inha University, Incheon 400-712 (Korea, Republic of); Brain Korea 21 Center for Advanced Medical Education, School of Medicine, Inha University, Incheon 400-712 (Korea, Republic of)

    2012-03-09

    Highlights: Black-Right-Pointing-Pointer KLF10{sup -/-} mice exhibited accelerated papilloma development after DMBA/TPA treatment. Black-Right-Pointing-Pointer KLF10{sup -/-} keratinocytes showed increased proliferation and apoptosis. Black-Right-Pointing-Pointer KLF10{sup -/-} MEFs yielded more colonies than wild-type one with H-Ras transfection. Black-Right-Pointing-Pointer KLF10 dose-dependently activated p21{sup WAF1/CIP1} transcription. Black-Right-Pointing-Pointer KLF10 is a tumor suppressor and that it targets p21{sup WAF1/CIP1} transcription. -- Abstract: Krueppel-like factor 10 (KLF10) has been suggested to be a putative tumor suppressor. In the present study, we generated KLF10 deficient mice to explore this hypothesis in vivo. KLF10 deficient mice exhibited increased predisposition to skin tumorigenesis and markedly accelerated papilloma development after DMBA/TPA treatment. On the other hand, KLF10 deficient keratinocytes showed increased proliferation and apoptosis. In colony formation assays after oncogenic H-Ras transfection, KLF10 deficient mouse embryonic fibroblasts (MEFs) yielded more colonies than wild-type MEFs. Furthermore, KLF10 dose-dependently activated p21{sup WAF1/CIP1} transcription, which was independent of p53 and Sp1 binding sites in p21{sup WAF1/CIP1} promoter. This study demonstrates that KLF10 is a tumor suppressor and that it targets p21{sup WAF1/CIP1} transcription.

  13. Retinoid-induced expression and activity of an immediate early tumor suppressor gene in vascular smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Streb

    2011-04-01

    Full Text Available Retinoids are used clinically to treat a number of hyper-proliferative disorders and have been shown in experimental animals to attenuate vascular occlusive diseases, presumably through nuclear receptors bound to retinoic acid response elements (RARE located in target genes. Here, we show that natural or synthetic retinoids rapidly induce mRNA and protein expression of a specific isoform of A-Kinase Anchoring Protein 12 (AKAP12β in cultured smooth muscle cells (SMC as well as the intact vessel wall. Expression kinetics and actinomycin D studies indicate Akap12β is a retinoid-induced, immediate-early gene. Akap12β promoter analyses reveal a conserved RARE mildly induced with atRA in a region that exhibits hyper-acetylation. Immunofluorescence microscopy and protein kinase A (PKA regulatory subunit overlay assays in SMC suggest a physical association between AKAP12β and PKA following retinoid treatment. Consistent with its designation as a tumor suppressor, inducible expression of AKAP12β attenuates SMC growth in vitro. Further, immunohistochemistry studies establish marked decreases in AKAP12 expression in experimentally-injured vessels of mice as well as atheromatous lesions in humans. Collectively, these results demonstrate a novel role for retinoids in the induction of an AKAP tumor suppressor that blocks vascular SMC growth thus providing new molecular insight into how retiniods may exert their anti-proliferative effects in the injured vessel wall.

  14. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  15. Cholesterol and phytosterols differentially regulate the expression of caveolin 1 and a downstream prostate cell growth-suppressor gene

    Science.gov (United States)

    Ifere, Godwin O.; Equan, Anita; Gordon, Kereen; Nagappan, Peri; Igietseme, Joseph U.; Ananaba, Godwin A.

    2010-01-01

    Background The purpose of our study was to show the distinction between the apoptotic and anti-proliferative signaling of phytosterols and cholesterol enrichment in prostate cancer cell lines, mediated by the differential transcription of caveolin-1, and N-myc downstream regulated gene1 (NDRG1), a pro-apoptotic androgen-regulated tumor suppressor. Methods PC-3 and DU145 cells were treated with sterols (cholesterol and phytosterols) for 72 h, followed by trypan blue dye exclusion measurement of necrosis and cell growth measured with a Coulter counter. Sterol induction of cell growth-suppressor gene expression was evaluated by mRNA transcription using RT-PCR, while cell cycle analysis was performed by FACS analysis. Altered expression of Ndrg1 protein was confirmed by Western blot analysis. Apoptosis was evaluated by real time RT-PCR amplification of P53, Bcl-2 gene and its related pro- and anti-apoptotic family members. Results Physiological doses (16 µM) of cholesterol and phytosterols were not cytotoxic in these cells. Cholesterol enrichment promoted cell growth (Pphytosterols significantly induced growth-suppression (Pphytosterols decreased mitotic subpopulations. We demonstrated for the first time that cholesterols concertedly attenuated the expression of caveolin-1(cav-1) and NDRG1 genes in both prostate cancer cell lines. Phytosterols had the opposite effect by inducing overexpression of cav-1, a known mediator of androgen-dependent signals that presumably control cell growth or apoptosis. Conclusions Cholesterol and phytosterol treatment differentially regulated the growth of prostate cancer cells and the expression of p53 and cav-1, a gene that regulates androgen-regulated signals. These sterols also differentially regulated cell cycle arrest, downstream pro-apoptotic androgen-regulated tumor-suppressor, NDRG1 suggesting that cav-1 may mediate pro-apoptotic NDRG1 signals. Elucidation of the mechanism for sterol modulation of growth and apoptosis signaling

  16. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  17. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  18. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  19. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  20. Towards the Identification of New Genes Involved in ABA-Dependent Abiotic Stresses Using Arabidopsis Suppressor Mutants of abh1 Hypersensitivity to ABA during Seed Germination

    Directory of Open Access Journals (Sweden)

    Iwona Szarejko

    2013-06-01

    Full Text Available Abscisic acid plays a pivotal role in the abiotic stress response in plants. Although great progress has been achieved explaining the complexity of the stress and ABA signaling cascade, there are still many questions to answer. Mutants are a valuable tool in the identification of new genes or new alleles of already known genes and in elucidating their role in signaling pathways. We applied a suppressor mutation approach in order to find new components of ABA and abiotic stress signaling in Arabidopsis. Using the abh1 (ABA hypersensitive 1 insertional mutant as a parental line for EMS mutagenesis, we selected several mutants with suppressed hypersensitivity to ABA during seed germination. Here, we present the response to ABA and a wide range of abiotic stresses during the seed germination and young seedling development of two suppressor mutants—soa2 (suppressor of abh1 hypersensitivity to ABA 2 and soa3 (suppressor of abh1 hypersensitivity to ABA 3. Generally, both mutants displayed a suppression of the hypersensitivity of abh1 to ABA, NaCl and mannitol during germination. Both mutants showed a higher level of tolerance than Columbia-0 (Col-0—the parental line of abh1 in high concentrations of glucose. Additionally, soa2 exhibited better root growth than Col-0 in the presence of high ABA concentrations. soa2 and soa3 were drought tolerant and both had about 50% fewer stomata per mm2 than the wild-type but the same number as their parental line—abh1. Taking into account that suppressor mutants had the same genetic background as their parental line—abh1, it was necessary to backcross abh1 with Landsberg erecta four times for the map-based cloning approach. Mapping populations, derived from the cross of abh1 in the Landsberg erecta background with each suppressor mutant, were created. Map based cloning in order to identify the suppressor genes is in progress.

  1. The Role of Tumor Metastases Suppressor Gene, Drg-1, in Breast Cancer

    Science.gov (United States)

    2008-03-01

    evidence to validate 14 our data of breast cancer. However, these prostate cells and reagents were existing materials in our lab or purchased by using...J. Lab . Clin. Med. 133, 265–273. Sloane, B.F., Honn, K.V., 1984. Cysteine proteinases and metastasis. Cancer Metastasis Rev. 3, 249–263. Sridhar, S.C... Beest , P. Moerer, K. van der Horn, R. Goldschmeding, T. Logtenberg and H. Clevers: Synergy between tumor suppressor APC and the beta- catenin-Tcf4

  2. Repression of Akt3 gene transcription by the tumor suppressor RIZ1

    OpenAIRE

    Liu, Qingnan; Qu, Xiaotian; Xie, Xiaolei; He, Pei; Huang, Shi

    2018-01-01

    RIZ1 has been studied as a tumor suppressor and may play a role in metabolic diseases related to the Western style diet, such as cancer and obesity. The Akt pathway is known to play a role in both cancer and obesity, and a link between Akt and RIZ1 has also been found. To better understand the role of RIZ1 in obesity and cancer, we investigated how RIZ1 regulates the expression of Akt3. We found that overexpression of RIZ1 in HEK293 cells reduced the expression of Akt3 protein. Luciferase rep...

  3. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

    2016-11-15

    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  4. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  5. The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

    2010-07-01

    WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

  6. The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

    2010-01-01

    WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

  7. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  8. The transformation suppressor gene Reck is required for postaxial patterning in mouse forelimbs

    Directory of Open Access Journals (Sweden)

    Mako Yamamoto

    2012-03-01

    The membrane-anchored metalloproteinase-regulator RECK has been characterized as a tumor suppressor. Here we report that mice with reduced Reck-expression show limb abnormalities including right-dominant, forelimb-specific defects in postaxial skeletal elements. The forelimb buds of low-Reck mutants have an altered dorsal ectoderm with reduced Wnt7a and Igf2 expression, and hypotrophy in two signaling centers (i.e., ZPA and AER that are essential for limb outgrowth and patterning. Reck is abundantly expressed in the anterior mesenchyme in normal limb buds; mesenchyme-specific Reck inactivation recapitulates the low-Reck phenotype; and some teratogens downregulate Reck in mesenchymal cells. Our findings illustrate a role for Reck in the mesenchymal-epithelial interactions essential for mammalian development.

  9. Genomic Analyses Reveal Global Functional Alterations That Promote Tumor Growth and Novel Tumor Suppressor Genes in Natural Killer-Cell Malignancies

    DEFF Research Database (Denmark)

    Kucuk, Can; Iqbal, Javeed; J. deLeeuw, Ronald

    in cell proliferation, growth and energy metabolic processes important for the neoplastic cells. In deleted regions, genes showing decreased expression included transcription factors or repressors (e.g. SP4, PRDM1, NCOR1 and ZNF10), tumor suppressors or negative regulators of the cell cycle (e.g. CDKN2C...

  10. Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L)

    Science.gov (United States)

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango (Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5′ UTR and a 189 bp long 3′ UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems’ leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue –specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis. In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango. PMID:27965680

  11. Molecular Cloning, Characterization, and Expression of MiSOC1: A Homolog of the Flowering Gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from Mango (Mangifera indica L).

    Science.gov (United States)

    Wei, Junya; Liu, Debing; Liu, Guoyin; Tang, Jie; Chen, Yeyuan

    2016-01-01

    MADS-box transcription factor plays a crucial role in plant development, especially controlling the formation and development of floral organs. Mango ( Mangifera indica L) is an economically important fruit crop, but its molecular control of flowering is largely unknown. To better understand the molecular basis of flowering regulation in mango, we isolated and characterized the MiSOC1, a putative mango orthologs for the Arabidopsis SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1/AGAMOUS-LIKE 20 (SOC1/AGL20) with homology-based cloning and RACE. The full-length cDNA (GenBank accession No.: KP404094) is 945 bp in length including a 74 bp long 5' UTR and a 189 bp long 3' UTR and the open reading frame was 733 bps, encoding 223 amino acids with molecular weight 25.6 kD. Both sequence alignment and phylogenetic analysis all indicated that deduced protein contained a conservative MADS-box and semi-conservative K domain and belonged to the SOC1/TM3 subfamily of the MADS-box family. Quantitative real-time PCR was performed to investigate the expression profiles of MiSOC1 gene in different tissues/organs including root, stem, leaves, flower bud, and flower. The result indicated MiSOC1 was widely expressed at different levels in both vegetative and reproductive tissues/organs with the highest expression level in the stems' leaves and inflorescences, low expression in roots and flowers. The expression of MiSOC1 in different flower developmental stages was different while same tissue -specific pattern among different varieties. In addition, MiSOC1 gene expression was affect by ethephon while high concentration ethephon inhibit the expression of MiSOC1. Overexpression of MiSOC1 resulted in early flowering in Arabidopsis . In conclusion, these results suggest that MiSOC1 may act as induce flower function in mango.

  12. The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

    Directory of Open Access Journals (Sweden)

    Ruilin Wang

    Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

  13. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  14. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  15. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  16. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  17. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  18. No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-09-01

    Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.

  19. NF2 tumor suppressor gene: a comprehensive and efficient detection of somatic mutations by denaturing HPLC and microarray-CGH.

    Science.gov (United States)

    Szijan, Irene; Rochefort, Daniel; Bruder, Carl; Surace, Ezequiel; Machiavelli, Gloria; Dalamon, Viviana; Cotignola, Javier; Ferreiro, Veronica; Campero, Alvaro; Basso, Armando; Dumanski, Jan P; Rouleau, Guy A

    2003-01-01

    The NF2 tumor suppressor gene, located in chromosome 22q12, is involved in the development of multiple tumors of the nervous system, either associated with neurofibromatosis 2 or sporadic ones, mainly schwannomas and meningiomas. In order to evaluate the role of the NF2 gene in sporadic central nervous system (CNS) tumors, we analyzed NF2 mutations in 26 specimens: 14 meningiomas, 4 schwannomas, 4 metastases, and 4 other histopathological types of neoplasms. Denaturing high performance liquid chromatography (denaturing HPLC) and comparative genomic hybridization on a DNA microarray (microarray- CGH) were used as scanning methods for small mutations and gross rearrangements respectively. Small mutations were identified in six out of seventeen meningiomas and schwannomas, one mutation was novel. Large deletions were detected in six meningiomas. All mutations were predicted to result in truncated protein or in the absence of a large protein domain. No NF2 mutations were found in other histopathological types of CNS tumors. These results provide additional evidence that mutations in the NF2 gene play an important role in the development of sporadic meningiomas and schwannomas. Denaturing HPLC analysis of small mutations and microarray-CGH of large deletions are complementary, fast, and efficient methods for the detection of mutations in tumor tissues.

  20. Polymorphisms rs12998 and rs5780218 in KiSS1 Suppressor Metastasis Gene in Mexican Patients with Breast Cancer

    Directory of Open Access Journals (Sweden)

    Edhit Guadalupe Cruz Quevedo

    2015-01-01

    Full Text Available Aims. KiSS1 is a metastasis suppressor gene associated with inhibition of cellular chemotaxis and invasion attenuating the metastasis in melanoma and breast cancer cell lines. Along the KiSS-1 gene at least 294 SNPs have been described; however the association of these polymorphisms as genetic markers for metastasis in breast cancer studies has not been investigated. Here we describe two simple PCR-RFLPs protocols to identify the rs5780218 (9DelT and the rs12998 (E20K KiSS1 polymorphisms and the allelic, genotypic, and haplotypic frequencies in Mexican general population (GP and patients with benign breast disease (BBD or breast cancer (BC. Results. The rs5780218 polymorphism was individually associated with breast cancer (P=0.0332 and the rs12998 polymorphism shows statistically significant differences when GP versus case (BC and BBD groups were compared (P<0.0001. The H1 Haplotype (G/- occurred more frequently in BC group (0.4256 whereas H2 haplotype (G/T was the most prevalent in BBD group (0.4674. Conclusions. Our data indicated that the rs5780218 polymorphism individually confers susceptibility for development of breast cancer in Mexican population and a possible role as a genetic marker in breast cancer metastasis for H1 haplotype (Wt/variant in KiSS1 gene must be analyzed in other populations.

  1. A Tumor Suppressor Gene Product, Platelet-Derived Growth Factor Receptor-Like Protein Controls Chondrocyte Proliferation and Differentiation.

    Science.gov (United States)

    Kawata, Kazumi; Kubota, Satoshi; Eguchi, Takanori; Aoyama, Eriko; Moritani, Norifumi H; Oka, Morihiko; Kawaki, Harumi; Takigawa, Masaharu

    2017-11-01

    The platelet-derived growth factor receptor-like (PDGFRL) gene is regarded as a tumor suppressor gene. However, nothing is known about the molecular function of PDGFRL. In this study, we initially clarified its function in chondrocytes. Among all cell lines examined, the PDGFRL mRNA level was the highest in chondrocytic HCS-2/8 cells. Interestingly, the proliferation of chondrocytic HCS-2/8 cells was promoted by PDGFRL overexpression, whereas that of the breast cancer-derived MDA-MB-231 cells was inhibited. Of note, in PDGFRL-overexpressing HCS-2/8 cells, the expression of chondrocyte differentiation marker genes, SOX9, ACAN, COL2A1, COL10A1, and ALP, was decreased. Moreover, we confirmed the expression of PDGFRL mRNA in normal cartilage tissue and chondrocytes. Eventually, the expression of PDGFRL mRNA in condrocytes except in the case of hypertrophic chondrocytes was demonstrated in vivo and in vitro. These findings suggest that PDGFRL plays the different roles, depending upon cell types. Particularly, in chondrocytes, PDGFRL may play a new and important role which is distinct from the function previously reported. J. Cell. Biochem. 118: 4033-4044, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  2. Evolution and origin of merlin, the product of the Neurofibromatosis type 2 (NF2 tumor-suppressor gene

    Directory of Open Access Journals (Sweden)

    Omelyanchuk Leonid V

    2005-12-01

    Full Text Available Abstract Background Merlin, the product of the Neurofibromatosis type 2 (NF2 tumor suppressor gene, belongs to the ezrin-radixin-moesin (ERM subgroup of the protein 4.1 superfamily, which links cell surface glycoproteins to the actin cytoskeleton. While merlin's functional activity has been examined in mammalian and Drosophila models, little is understood about its evolution, diversity, and overall distribution among different taxa. Results By combining bioinformatic and phylogenetic approaches, we demonstrate that merlin homologs are present across a wide range of metazoan lineages. While the phylogenetic tree shows a monophyletic origin of the ERM family, the origin of the merlin proteins is robustly separated from that of the ERM proteins. The derivation of merlin is thought to be in early metazoa. We have also observed the expansion of the ERM-like proteins within the vertebrate clade, which occurred after its separation from Urochordata (Ciona intestinalis. Amino acid sequence alignment reveals the absence of an actin-binding site in the C-terminal region of all merlin proteins from various species but the presence of a conserved internal binding site in the N-terminal domain of the merlin and ERM proteins. In addition, a more conserved pattern of amino acid residues is found in the region containing the so-called "Blue Box," although some amino acid substitutions in this region exist in the merlin sequences of worms, fish, and Ciona. Examination of sequence variability at functionally significant sites, including the serine-518 residue, the phosphorylation of which modulates merlin's intra-molecular association and function as a tumor suppressor, identifies several potentially important sites that are conserved among all merlin proteins but divergent in the ERM proteins. Secondary structure prediction reveals the presence of a conserved α-helical domain in the central to C-terminal region of the merlin proteins of various species. The

  3. Positive selection of deleterious alleles through interaction with a sex-ratio suppressor gene in African Buffalo: a plausible new mechanism for a high frequency anomaly.

    Directory of Open Access Journals (Sweden)

    Pim van Hooft

    Full Text Available Although generally rare, deleterious alleles can become common through genetic drift, hitchhiking or reductions in selective constraints. Here we present a possible new mechanism that explains the attainment of high frequencies of deleterious alleles in the African buffalo (Syncerus caffer population of Kruger National Park, through positive selection of these alleles that is ultimately driven by a sex-ratio suppressor. We have previously shown that one in four Kruger buffalo has a Y-chromosome profile that, despite being associated with low body condition, appears to impart a relative reproductive advantage, and which is stably maintained through a sex-ratio suppressor. Apparently, this sex-ratio suppressor prevents fertility reduction that generally accompanies sex-ratio distortion. We hypothesize that this body-condition-associated reproductive advantage increases the fitness of alleles that negatively affect male body condition, causing genome-wide positive selection of these alleles. To investigate this we genotyped 459 buffalo using 17 autosomal microsatellites. By correlating heterozygosity with body condition (heterozygosity-fitness correlations, we found that most microsatellites were associated with one of two gene types: one with elevated frequencies of deleterious alleles that have a negative effect on body condition, irrespective of sex; the other with elevated frequencies of sexually antagonistic alleles that are negative for male body condition but positive for female body condition. Positive selection and a direct association with a Y-chromosomal sex-ratio suppressor are indicated, respectively, by allele clines and by relatively high numbers of homozygous deleterious alleles among sex-ratio suppressor carriers. This study, which employs novel statistical techniques to analyse heterozygosity-fitness correlations, is the first to demonstrate the abundance of sexually-antagonistic genes in a natural mammal population. It also has

  4. Inactivation of the Tumor Suppressor Genes Causing the Hereditary Syndromes Predisposing to Head and Neck Cancer via Promoter Hypermethylation in Sporadic Head and Neck Cancers

    OpenAIRE

    Smith, Ian M.; Mithani, Suhail K.; Mydlarz, Wojciech K.; Chang, Steven S.; Califano, Joseph A.

    2010-01-01

    Fanconi anemia (FA) and dyskeratosis congenita (DC) are rare inherited syndromes that cause head and neck squamous cell cancer (HNSCC). Prior studies of inherited forms of cancer have been extremely important in elucidating tumor suppressor genes inactivated in sporadic tumors. Here, we studied whether sporadic tumors have epigenetic silencing of the genes causing the inherited forms of HNSCC. Using bisulfite sequencing, we investigated the incidence of promoter hypermethylation of the 17 Fan...

  5. Identification of genes highly downregulated in pancreatic cancer through a meta-analysis of microarray datasets: implications for discovery of novel tumor-suppressor genes and therapeutic targets.

    Science.gov (United States)

    Goonesekere, Nalin C W; Andersen, Wyatt; Smith, Alex; Wang, Xiaosheng

    2018-02-01

    The lack of specific symptoms at early tumor stages, together with a high biological aggressiveness of the tumor contribute to the high mortality rate for pancreatic cancer (PC), which has a 5-year survival rate of about 7%. Recent failures of targeted therapies inhibiting kinase activity in clinical trials have highlighted the need for new approaches towards combating this deadly disease. In this study, we have identified genes that are significantly downregulated in PC, through a meta-analysis of large number of microarray datasets. We have used qRT-PCR to confirm the downregulation of selected genes in a panel of PC cell lines. This study has yielded several novel candidate tumor-suppressor genes (TSGs) including GNMT, CEL, PLA2G1B and SERPINI2. We highlight the role of GNMT, a methyl transferase associated with the methylation potential of the cell, and CEL, a lipase, as potential therapeutic targets. We have uncovered genetic links to risk factors associated with PC such as smoking and obesity. Genes important for patient survival and prognosis are also discussed, and we confirm the dysregulation of metabolic pathways previously observed in PC. While many of the genes downregulated in our dataset are associated with protein products normally produced by the pancreas for excretion, we have uncovered some genes whose downregulation appear to play a more causal role in PC. These genes will assist in providing a better understanding of the disease etiology of PC, and in the search for new therapeutic targets and biomarkers.

  6. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  7. The essential Escherichia coli msgB gene, a multicopy suppressor of a temperature-sensitive allele of the heat shock gene grpE, is identical to dapE.

    Science.gov (United States)

    Wu, B; Georgopoulos, C; Ang, D

    1992-08-01

    The grpE gene product is one of three Escherichia coli heat shock proteins (DnaK, DnaJ, and GrpE) that are essential for both bacteriophage lambda DNA replication and bacterial growth at all temperatures. In an effort to determine the role of GrpE and to identify other factors that it may interact with, we isolated multicopy suppressors of the grpE280 point mutation, as judged by their ability to reverse the temperature-sensitive phenotype of grpE280. Here we report the characterization of one of them, designated msgB. The msgB gene maps at approximately 53 min on the E. coli chromosome. The minimal gene possesses an open reading frame that encodes a protein with a predicted size of 41,269 M(r). This open reading frame was confirmed the correct one by direct amino-terminal sequence analysis of the overproduced msgB gene product. Genetic experiments demonstrated that msgB is essential for E. coli growth in the temperature range of 22 to 37 degrees C. Through a sequence homology search, MsgB was shown to be identical to N-succinyl-L-diaminopimelic acid desuccinylase (the dapE gene product), which participates in the diaminopimelic acid-lysine pathway involved in cell wall biosynthesis. Consistent with this finding, the msgB null allele mutant is viable only when the growth medium is supplemented with diaminopimelic acid. These results suggest that GrpE may have a previously unsuspected function(s) in cell wall biosynthesis in E. coli.

  8. The Quest for the 1p36 Tumor Suppressor

    Science.gov (United States)

    Bagchi, Anindya; Mills, Alea A.

    2010-01-01

    Genomic analyses of late-stage human cancers have uncovered deletions encompassing 1p36, thereby providing an extensive body of literature supporting the idea that a potent tumor suppressor resides in this interval. Although a number of genes have been proposed as 1p36 candidate tumor suppressors, convincing evidence that their encoded products protect from cancer has been scanty. A recent functional study identified CHD5 as a novel tumor suppressor mapping to 1p36. Here we discuss evidence supporting CHD5’s tumor suppressive role. Together, these findings suggest that strategies designed to enhance CHD5 activity could provide novel approaches for treating a broad range of human malignancies. PMID:18413720

  9. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  10. Effects of emodin on the demethylation of tumor-suppressor genes in pancreatic cancer PANC-1 cells.

    Science.gov (United States)

    Zhang, Hao; Chen, Liang; Bu, He-Qi; Yu, Qing-Jiang; Jiang, Dan-Dan; Pan, Feng-Ping; Wang, Yu; Liu, Dian-Lei; Lin, Sheng-Zhang

    2015-06-01

    Emodin, a natural anthraquinone derivative isolated from Rheum palmatum, has been reported to inhibit the growth of pancreatic cancer cells through different modes of action; yet, the detailed mechanism remains unclear. In the present study, we hypothesized that emodin exerts its antitumor effect by participating in the regulation of the DNA methylation level. Our research showed that emodin inhibited the growth of pancreatic cancer PANC-1 cells in a dose- and time-dependent manner. Dot-blot results showed that 40 µM emodin significantly inhibited genomic 5 mC expression in the PANC-1 cells, and mRNA-Seq showed that different concentrations of emodin could alter the gene expression profile in the PANC-1 cells. BSP confirmed that the methylation levels of P16, RASSF1A and ppENK were decreased, while concomitantly the unmethylated status was increased. RT-PCR and western blotting results confirmed that the low expression or absence of expression of mRNA and protein in the PANC-1 cells was re-expressed following treatment with emodin. In conclusion, our study for the first time suggests that emodin inhibits pancreatic cancer cell growth, which may be related to the demethylation of tumor-suppressor genes. The related mechanism may be through the inhibition of methyltransferase expression.

  11. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Ricardo Harakava

    2005-01-01

    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  12. Loss of Mitochondrial Tumor Suppressor Genes Expression Is Associated with Unfavorable Clinical Outcome in Head and Neck Squamous Cell Carcinoma: Data from Retrospective Study.

    Directory of Open Access Journals (Sweden)

    Ishrat Mahjabeen

    Full Text Available Mitochondrial genes play important roles in cellular energy metabolism, free radical generation, and apoptosis. Dysregulation of these genes have long been suspected to contribute to the generation of reactive oxygen species (ROS, increased proliferation and progression of cancer. A family of orthologues of yeast silent information regulator 3 (SIRT3, 4 (SIRT4 and mitochondrial tumor suppressor 1 (MTUS1 are important mitochondrial tumor suppressor genes which play an important role in the progression of multiple cancers. However, their role in the development of oxidative stress, enhanced proliferation and progression of head and neck squamous cell carcinoma (HNSCC has not yet been studied. In this study we aimed to test the association between reduced mitochondrial tumor suppressor genes' activities and enhancement in tissue oxidative stress and cell proliferation in HNSCC cases. The expression of mitochondrial tumor suppressor genes (SIRT3, SIRT4 and MTUS1, mitochondrial DNA repair gene (OGG1-2a and a proliferation marker (Ki-67 was studied in a study cohort of 120 HNSCC patients and controls with reverse transcriptase polymerase chain reaction (RT-PCR and real-time PCR (qPCR in order to determine the potential prognostic significance of these genes. A statistically significant downregulation of SIRT3 (p<0.001, SIRT4 (p<0.0001, MTUS1 (p<0.002 and OGG1 (p<0.0001 was observed in HNSCC compared to control samples. Ki-67 was also overexpressed (p<0.0001 in HNSCC versus control samples. Additionally, to explore gene-gene relationship, we observed a positive spearmen correlation between SIRT3 versus SIRT4 (r = 0.523***, p<0.0001, SIRT3 versus MTUS1 (r = 0.273***, p<0.001, SIRT3 versus OGG1-2a (r = 0.213*, p<0.03, SIRT4 versus OGG1 (r = 0.338***, p<0.0001 and MTUS1 versus OGG1-2a (r = 0.215*, p<0.03 in HNSCC cases. A negative spearman correlation was observed between OGG1 versus Ki-67 (r = -0.224**, p<0.01 and OGG1-2a versus Ki-67 (r = -0.224**, p<0

  13. Tumor suppressor genes that escape from X-inactivation contribute to cancer sex bias

    OpenAIRE

    Dunford, Andrew; Weinstock, David M.; Savova, Virginia; Schumacher, Steven E.; Cleary, John P.; Yoda, Akinori; Sullivan, Timothy J.; Hess, Julian M.; Gimelbrant, Alexander A.; Beroukhim, Rameen; Lawrence, Michael S.; Getz, Gad; Lane, Andrew A.

    2016-01-01

    There is a striking and unexplained male predominance across many cancer types. A subset of X chromosome (chrX) genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative “Escape from X-Inactivation Tumor Suppressor” (EXITS) genes, we compared somatic alterations from >4100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) chrX genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) ...

  14. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  15. Tumor suppressor genes that escape from X-inactivation contribute to cancer sex bias

    Science.gov (United States)

    Dunford, Andrew; Weinstock, David M.; Savova, Virginia; Schumacher, Steven E.; Cleary, John P.; Yoda, Akinori; Sullivan, Timothy J.; Hess, Julian M.; Gimelbrant, Alexander A.; Beroukhim, Rameen; Lawrence, Michael S.; Getz, Gad; Lane, Andrew A.

    2016-01-01

    There is a striking and unexplained male predominance across many cancer types. A subset of X chromosome (chrX) genes can escape X-inactivation, which would protect females from complete functional loss by a single mutation. To identify putative “Escape from X-Inactivation Tumor Suppressor” (EXITS) genes, we compared somatic alterations from >4100 cancers across 21 tumor types for sex bias. Six of 783 non-pseudoautosomal region (PAR) chrX genes (ATRX, CNKSR2, DDX3X, KDM5C, KDM6A, and MAGEC3) more frequently harbored loss-of-function mutations in males (based on false discovery rate <0.1), compared to zero of 18,055 autosomal and PAR genes (P<0.0001). Male-biased mutations in genes that escape X-inactivation were observed in combined analysis across many cancers and in several individual tumor types, suggesting a generalized phenomenon. We conclude that biallelic expression of EXITS genes in females explains a portion of the reduced cancer incidence compared to males across a variety of tumor types. PMID:27869828

  16. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

  17. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  18. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  19. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  20. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  1. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  2. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  3. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  4. Molecular cloning, phylogenetic analysis, and expression patterns of LATERAL SUPPRESSOR-LIKE and REGULATOR OF AXILLARY MERISTEM FORMATION-LIKE genes in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Fambrini, Marco; Salvini, Mariangela; Pugliesi, Claudio

    2017-03-01

    The wild sunflower (Helianthus annuus) plants develop a highly branched form with numerous small flowering heads. The origin of a no branched sunflower, producing a single large head, has been a key event in the domestication process of this species. The interaction between hormonal factors and several genes organizes the initiation and outgrowth of axillary meristems (AMs). From sunflower, we have isolated two genes putatively involved in this process, LATERAL SUPPRESSOR (LS)-LIKE (Ha-LSL) and REGULATOR OF AXILLARY MERISTEM FORMATION (ROX)-LIKE (Ha-ROXL), encoding for a GRAS and a bHLH transcription factor (TF), respectively. Typical amino acid residues and phylogenetic analyses suggest that Ha-LSL and Ha-ROXL are the orthologs of the branching regulator LS and ROX/LAX1, involved in the growth habit of both dicot and monocot species. qRT-PCR analyses revealed a high accumulation of Ha-LSL transcripts in roots, vegetative shoots, and inflorescence shoots. By contrast, in internodal stems and young leaves, a lower amount of Ha-LSL transcripts was observed. A comparison of transcription patterns between Ha-LSL and Ha-ROXL revealed some analogies but also remarkable differences; in fact, the gene Ha-ROXL displayed a low expression level in all organs analyzed. In situ hybridization (ISH) analysis showed that Ha-ROXL transcription was strongly restricted to a small domain within the boundary zone separating the shoot apical meristem (SAM) and the leaf primordia and in restricted regions of the inflorescence meristem, beforehand the separation of floral bracts from disc flower primordia. These results suggested that Ha-ROXL may be involved to establish a cell niche for the initiation of AMs as well as flower primordia. The accumulation of Ha-LSL transcripts was not restricted to the boundary zones in vegetative and inflorescence shoots, but the mRNA activity was expanded in other cellular domains of primary shoot apical meristem as well as AMs. In addition, Ha

  5. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  6. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  7. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  8. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.

  9. The Neurofibromatosis 2 Tumor Suppressor Gene Product, Merlin, Regulates Human Meningioma Cell Growth by Signaling through YAP

    Directory of Open Access Journals (Sweden)

    Katherine Striedinger

    2008-11-01

    Full Text Available Neurofibromatosis type 2 (NF2 is an autosomal dominant disorder characterized by the occurrence of schwannomas and meningiomas. Several studies have examined the ability of the NF2 gene product, merlin, to function as a tumor suppressor in diverse cell types; however, little is known about merlin growth regulation in meningiomas. In Drosophila, merlin controls cell proliferation and apoptosis by signaling through the Hippo pathway to inhibit the function of the transcriptional coactivator Yorkie. The Hippo pathway is conserved in mammals. On the basis of these observations, we developed human meningioma cell lines matched for merlin expression to evaluate merlin growth regulation and investigate the relationship between NF2 status and Yes-associated protein (YAP, the mammalian homolog of Yorkie. NF2 loss in meningioma cells was associated with loss of contact-dependent growth inhibition, enhanced anchorage-independent growth and increased cell proliferation due to increased S-phase entry. In addition, merlin loss in both meningioma cell lines and primary tumors resulted in increased YAP expression and nuclear localization. Finally, siRNA-mediated reduction of YAP in NF2-deficient meningioma cells rescued the effects of merlin loss on cell proliferation and S-phase entry. Collectively, these results represent the first demonstration that merlin regulates cell growth in human cancer cells by suppressing YAP.

  10. The induction of a tumor suppressor gene (p53) expression by low-dose radiation and its biological meaning

    International Nuclear Information System (INIS)

    Ohnishi, Takeo

    1997-01-01

    I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)

  11. Expression level of novel tumor suppressor gene FATS is associated with the outcome of node positive breast cancer

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jun; GU Lin; ZHAO Lu-jun; ZHANG Xi-feng; QIU Li; LI Zheng

    2011-01-01

    Background Recently, we reported the identification of a previously uncharacterized and evolutionarily conserved gene, fragile-site associated tumor suppressor (FATS), at a frequently deleted region in irradiation (IR)-induced tumors.However, the role of FATS in breast cancer development and its clinical significance has not been defined. The aim of this study was to determine the role of FA7S in breast cancer development and to evaluate its clinical significance in breast cancer.Methods The expression level of FATS mRNA was determined in 106 breast carcinomas and 23 paired normal breast tissues using quantitative real time reverse transcription-polymerase chain reaction (RT-PCR). The relationship between FATS expression and clinicopathological parameters were also analyzed.Results The mRNA level of FATS was down-regulated in breast cancer compared with paired normal tissues. Low expression of FATS was correlated with high nuclear grade. There was a tendency to a favorable outcome for patients with high expression of FATS (P=0.346). However, low expression of FATS was associated with poor outcome of breast cancer patients with node positive (P=0.011). Furthermore, the mRNA level of FATS showed an independent value in predicting the outcome of breast cancer patients with positive lymph nodes.Conclusion FATS is involved in the carcinogenesis and development of breast cancer and could be a potential biomarker and prognostic factor for breast cancer therapy.

  12. Alternative polyadenylation of tumor suppressor genes in small intestinal neuroendocrine tumors

    DEFF Research Database (Denmark)

    Rehfeld, Anders Aagaard; Plass, Mireya; Døssing, Kristina

    2014-01-01

    The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site...... and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3' untranslated regions. Additionally, APA can also produce mRNAs containing different 3'-terminal coding regions. Therefore, APA alters both the repertoire...... and the expression level of proteins. Here, we used high-throughput sequencing data to map polyA sites and characterize polyadenylation genome-wide in three SI-NETs and a reference sample. In the tumors, 16 genes showed significant changes of APA pattern, which lead to either the 3' truncation of mRNA coding regions...

  13. NKL homeobox gene MSX1 acts like a tumor suppressor in NK-cell leukemia.

    Science.gov (United States)

    Nagel, Stefan; Pommerenke, Claudia; Meyer, Corinna; Kaufmann, Maren; MacLeod, Roderick A F; Drexler, Hans G

    2017-09-15

    NKL homeobox gene MSX1 is physiologically expressed in lymphoid progenitors and subsequently downregulated in developing T- and B-cells. In contrast, elevated expression levels of MSX1 persist in mature natural killer (NK)-cells, indicating a functional role in this compartment. While T-cell acute lymphoblastic leukemia (T-ALL) subsets exhibit aberrant overexpression of MSX1, we show here that in malignant NK-cells the level of MSX1 transcripts is aberrantly downregulated. Chromosomal deletions at 4p16 hosting the MSX1 locus have been described in NK-cell leukemia patients. However, NK-cell lines analyzed here showed normal MSX1 gene configurations, indicating that this aberration might be uncommon. To identify alternative MSX1 regulatory mechanisms we compared expression profiling data of primary normal NK-cells and malignant NK-cell lines. This procedure revealed several deregulated genes including overexpressed IRF4, MIR155HG and MIR17HG and downregulated AUTS2, EP300, GATA3 and HHEX. As shown recently, chromatin-modulator AUTS2 is overexpressed in T-ALL subsets where it mediates aberrant transcriptional activation of MSX1. Here, our data demonstrate that in malignant NK-cell lines AUTS2 performed MSX1 activation as well, but in accordance with downregulated MSX1 transcription therein we detected reduced AUTS2 expression, a small genomic deletion at 7q11 removing exons 3 and 4, and truncating mutations in exon 1. Moreover, genomic profiling and chromosomal analyses of NK-cell lines demonstrated amplification of IRF4 at 6p25 and deletion of PRDM1 at 6q21, highlighting their potential oncogenic impact. Functional analyses performed via knockdown or forced expression of these genes revealed regulatory network disturbances effecting downregulation of MSX1 which may underlie malignant development in NK-cells.

  14. Relationship of ultrasonic shear wave velocity with oncogene and tumor suppressor gene expression in primary liver cancer lesions as well as angiogenesis factor contents

    Directory of Open Access Journals (Sweden)

    Xing Yin1

    2017-06-01

    Full Text Available Objective: To discuss the relationship of ultrasonic shear wave velocity (SWV with oncogene and tumor suppressor gene expression in primary liver cancer lesions as well as angiogenesis factor contents. Methods: 100 patients with primary liver cancer who underwent surgical treatment in our hospital between March 2014 and September 2016 were collected as observation group, and 50 healthy subjects who received physical examination in our hospital during the same period were collected as normal control group. The ultrasonic SWV levels of two groups of subjects were measured before the operation, and the observation groups were further divided into high SWV group and low SWV group, 50 cases in each group. Intraoperative tumor tissue samples were kept and fluorescence quantitative PCR was used to determine the mRNA expression of oncogenes and tumor suppressor genes. Enzymelinked immunosorbent assay was used to determine serum contents of angiogenesis factors in observation group before operation. Results: Hepatic ultrasonic SWV level in observation group was significantly higher than that in normal control group; proto-oncogene CK, Ki67, Gly-3, Survivin and Pokemon mRNA expression in tumor tissue of high SWV group were higher than those of low SWV group while tumor suppressor genes Tg737, p16, p27, PTEN and runx3 mRNA expression were lower than those of low SWV group; serum angiogenesis factors VEGF, MMP-9 and IGF-1R contents were higher than those in low SWV group. Conclusion: The hepatic ultrasonic SWV level increases in patients with primary liver cancer, and the SWV level is directly correlated with oncogene and tumor suppressor gene expression as well as angiogenesis factor contents.

  15. Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

    Science.gov (United States)

    van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

    2005-06-10

    To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

  16. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  17. Thrombospondin-4 is a putative tumour-suppressor gene in colorectal cancer that exhibits age-related methylation

    International Nuclear Information System (INIS)

    Greco, Sonia A; Leggett, Barbara A; Whitehall, Vicki LJ; Chia, June; Inglis, Kelly J; Cozzi, Sarah-Jane; Ramsnes, Ingunn; Buttenshaw, Ronald L; Spring, Kevin J; Boyle, Glen M; Worthley, Daniel L

    2010-01-01

    colon. THBS4 shows increased methylation in colorectal cancer, but this is not strongly associated with altered gene expression, either because methylation has not always reached a critical level or because other factors influence THBS4 expression. THBS4 may act as a tumour suppressor gene, demonstrated by its suppression of tumour colony formation in vitro. THBS4 methylation is detectable in normal colonic mucosa and its level may be a biomarker for the occurrence of adenomas and carcinoma

  18. Thrombospondin-4 is a putative tumour-suppressor gene in colorectal cancer that exhibits age-related methylation

    Directory of Open Access Journals (Sweden)

    Greco Sonia A

    2010-09-01

    negatively with the occurrence of adenomas elsewhere in the colon. Conclusions THBS4 shows increased methylation in colorectal cancer, but this is not strongly associated with altered gene expression, either because methylation has not always reached a critical level or because other factors influence THBS4 expression. THBS4 may act as a tumour suppressor gene, demonstrated by its suppression of tumour colony formation in vitro. THBS4 methylation is detectable in normal colonic mucosa and its level may be a biomarker for the occurrence of adenomas and carcinoma.

  19. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  20. Analysis of the Mitogen-activated protein kinase kinase 4 (MAP2K4) tumor suppressor gene in ovarian cancer

    International Nuclear Information System (INIS)

    Davis, Sally J; Choong, David YH; Ramakrishna, Manasa; Ryland, Georgina L; Campbell, Ian G; Gorringe, Kylie L

    2011-01-01

    MAP2K4 is a putative tumor and metastasis suppressor gene frequently found to be deleted in various cancer types. We aimed to conduct a comprehensive analysis of this gene to assess its involvement in ovarian cancer. We screened for mutations in MAP2K4 using High Resolution Melt analysis of 149 primary ovarian tumors and methylation at the promoter using Methylation-Specific Single-Stranded Conformation Polymorphism analysis of 39 tumors. We also considered the clinical impact of changes in MAP2K4 using publicly available expression and copy number array data. Finally, we used siRNA to measure the effect of reducing MAP2K4 expression in cell lines. In addition to 4 previously detected homozygous deletions, we identified a homozygous 16 bp truncating deletion and a heterozygous 4 bp deletion, each in one ovarian tumor. No promoter methylation was detected. The frequency of MAP2K4 homozygous inactivation was 5.6% overall, and 9.8% in high-grade serous cases. Hemizygous deletion of MAP2K4 was observed in 38% of samples. There were significant correlations of copy number and expression in three microarray data sets. There was a significant correlation between MAP2K4 expression and overall survival in one expression array data set, but this was not confirmed in an independent set. Treatment of JAM and HOSE6.3 cell lines with MAP2K4 siRNA showed some reduction in proliferation. MAP2K4 is targeted by genetic inactivation in ovarian cancer and restricted to high grade serous and endometrioid carcinomas in our cohort

  1. Differential expression of the klf6 tumor suppressor gene upon cell damaging treatments in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Gehrau, Ricardo C.; D' Astolfo, Diego S.; Andreoli, Veronica [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Bocco, Jose L., E-mail: jbocco@fcq.unc.edu.ar [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina); Koritschoner, Nicolas P. [Centro de Investigaciones en Bioquimica Clinica e Inmunologia (CIBICI-CONICET), Departamento de Bioquimica Clinica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Haya de la Torre y Medina Allende, Ciudad Universitaria, 5000 Cordoba (Argentina)

    2011-02-10

    The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC{sub 50}). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p < 0.0001) in KLF6 mRNA levels were observed depending on the cellular p53 status upon cell damage. KLF6 expression was significantly increased in 63% of p53-deficient cells (122/195). Conversely, KLF6 mRNA level decreased nearly 4 fold in more than 70% of p53+/+ cells. In addition, klf6 gene promoter activity was down-regulated by DNA damaging agents in cells expressing the functional p53 protein whereas it was moderately increased in the absence of functional p53. Consistent results were obtained for the endogenous KLF6 protein level. Results indicate that human klf6 gene expression is responsive to external cell damage mediated by IC{sub 50} concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable

  2. Alternative Polyadenylation of Tumor Suppressor Genes in Small Intestinal Neuroendocrine Tumors

    OpenAIRE

    Rehfeld, Anders; Plass, Mireya; Døssing, Kristina; Knigge, Ulrich; Kjær, Andreas; Krogh, Anders; Friis-Hansen, Lennart

    2014-01-01

    The tumorigenesis of small intestinal neuroendocrine tumors (SI-NETs) is poorly understood. Recent studies have associated alternative polyadenylation (APA) with proliferation, cell transformation, and cancer. Polyadenylation is the process in which the pre-messenger RNA is cleaved at a polyA site and a polyA tail is added. Genes with two or more polyA sites can undergo APA. This produces two or more distinct mRNA isoforms with different 3′ untranslated regions. Additionally, APA can also pro...

  3. SUMOylation of the ING1b tumor suppressor regulates gene transcription

    DEFF Research Database (Denmark)

    Satpathy, Shankha; Guérillon, Claire; Kim, Tae-Sun

    2014-01-01

    members of histone deacetylase complexes, whereas ING3-5 are stoichiometric components of different histone acetyltransferase complexes. The INGs target these complexes to histone marks, thus acting as epigenetic regulators. ING proteins affect angiogenesis, apoptosis, DNA repair, metastasis......1b E195A), we further demonstrate that ING1b SUMOylation regulates the binding of ING1b to the ISG15 and DGCR8 promoters, consequently regulating ISG15 and DGCR8 transcription. These results suggest a role for ING1b SUMOylation in the regulation of gene transcription....

  4. Smoking, genes encoding dopamine pathway and risk for Parkinson's disease.

    Science.gov (United States)

    Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu

    2010-09-20

    Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  5. Differential expression of the klf6 tumor suppressor gene upon cell damaging treatments in cancer cells

    International Nuclear Information System (INIS)

    Gehrau, Ricardo C.; D'Astolfo, Diego S.; Andreoli, Veronica; Bocco, Jose L.; Koritschoner, Nicolas P.

    2011-01-01

    The mammalian Krueppel-like factor 6 (KLF6) is involved in critical roles such as growth-related signal transduction, cell proliferation and differentiation, development, apoptosis and angiogenesis. Also, KLF6 appears to be an emerging key factor during cancer development and progression. Its expression is thoroughly regulated by several cell-damaging stimuli. DNA damaging agents at lethal concentrations induce a p53-independent down-regulation of the klf6 gene. To investigate the impact of external stimuli on human klf6 gene expression, its mRNA level was analyzed using a cancer cell line profiling array system, consisting in an assortment of immobilized cDNAs from multiple cell lines treated with several cell-damaging agents at growth inhibitory concentrations (IC 50 ). Cell-damaging agents affected the klf6 expression in 62% of the cDNA samples, though the expression pattern was not dependent on the cell origin type. Interestingly, significant differences (p 50 concentrations of physical and chemical stimuli in a p53-dependent manner. Most of these agents are frequently used in cancer therapy. Induction of klf6 expression in the absence of functional p53 directly correlates with cell death triggered by these compounds, whereas it is down-regulated in p53+/+ cells. Hence, klf6 expression level could represent a valuable marker for the efficiency of cell death upon cancer treatment.

  6. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  7. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  8. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  9. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  10. ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paolo Kunderfranco

    2010-05-01

    Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

  11. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  12. Mutations in TP53 tumor suppressor gene in wood dust-related sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Bornholdt, Jette; Heikkilä, Pirjo

    2010-01-01

    The causal role of work-related exposure to wood dust in the development of sinonasal cancer has long been established by numerous epidemiologic studies. To study molecular changes in these tumors, we analyzed TP53 gene mutations in 358 sinonasal cancer cases with or without occupational exposure...... affected the ORs only slightly. Smoking did not influence the occurrence of TP53 mutation; however, it was associated with multiple mutations (p = 0.03). As far as we are aware, this is the first study to demonstrate a high prevalence of TP53 mutation-positive cases in a large collection of sinonasal...... cancers with data on occupational exposure. Our results indicate that mutational mechanisms, in particular TP53 mutations, are associated with work-related exposure to wood dust in sinonasal cancer....

  13. Apoptosis in neural crest cells by functional loss of APC tumor suppressor gene

    Science.gov (United States)

    Hasegawa, Sumitaka; Sato, Tomoyuki; Akazawa, Hiroshi; Okada, Hitoshi; Maeno, Akiteru; Ito, Masaki; Sugitani, Yoshinobu; Shibata, Hiroyuki; Miyazaki, Jun-ichi; Katsuki, Motoya; Yamauchi, Yasutaka; Yamamura, Ken-ichi; Katamine, Shigeru; Noda, Tetsuo

    2002-01-01

    Apc is a gene associated with familial adenomatous polyposis coli (FAP) and its inactivation is a critical step in colorectal tumor formation. The protein product, adenomatous polyposis coli (APC), acts to down-regulate intracellular levels of β-catenin, a key signal transducer in the Wnt signaling. Conditional targeting of Apc in the neural crest of mice caused massive apoptosis of cephalic and cardiac neural crest cells at about 11.5 days post coitum, resulting in craniofacial and cardiac anomalies at birth. Notably, the apoptotic cells localized in the regions where β-catenin had accumulated. In contrast to its role in colorectal epithelial cells, inactivation of APC leads to dysregulation of β-catenin/Wnt signaling with resultant apoptosis in certain tissues including neural crest cells. PMID:11756652

  14. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  15. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  16. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    International Nuclear Information System (INIS)

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

    1994-01-01

    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

  17. The effect of age at exposure on the inactivating mechanisms and relative contributions of key tumor suppressor genes in radiation-induced mouse T-cell lymphomas

    Energy Technology Data Exchange (ETDEWEB)

    Sunaoshi, Masaaki [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Department of Biological Sciences, College of Science, Ibaraki University, Bunkyo 2-1-1, Mito, Ibaraki 310-8512 (Japan); Amasaki, Yoshiko; Hirano-Sakairi, Shinobu; Blyth, Benjamin J. [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Morioka, Takamitsu [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Radiation Effect Accumulation and Prevention Project, Fukushima Project Headquarters, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kaminishi, Mutsumi [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Shang, Yi [Radiation Effect Accumulation and Prevention Project, Fukushima Project Headquarters, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Nishimura, Mayumi; Shimada, Yoshiya [Radiobiology for Children' s Health Program, Research Center for Radiation Protection, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Radiation Effect Accumulation and Prevention Project, Fukushima Project Headquarters, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Tachibana, Akira [Department of Biological Sciences, College of Science, Ibaraki University, Bunkyo 2-1-1, Mito, Ibaraki 310-8512 (Japan); and others

    2015-09-15

    Highlights: • T-cell lymphoma incidence, latency and weight did not change with age at exposure. • Lymphomas had frequent loss of heterozygosity on chromosomes 4, 11 and 19. • These lesions targeted the Cdkn2a, Ikaros and Pten tumor suppressor genes. • Age at exposure may influence which tumor suppressor genes are lost in each tumor. • The mechanisms of tumor suppressor gene loss were different at each locus. - Abstract: Children are considered more sensitive to radiation-induced cancer than adults, yet any differences in genomic alterations associated with age-at-exposure and their underlying mechanisms remain unclear. We assessed genome-wide DNA copy number and mutation of key tumor suppressor genes in T-cell lymphomas arising after weekly irradiation of female B6C3F1 mice with 1.2 Gy X-rays for 4 consecutive weeks starting during infancy (1 week old), adolescence (4 weeks old) or as young adults (8 weeks old). Although T-cell lymphoma incidence was similar, loss of heterozygosity at Cdkn2a on chromosome 4 and at Ikaros on chromosome 11 was more frequent in the two older groups, while loss at the Pten locus on chromosome 19 was more frequent in the infant-irradiated group. Cdkn2a and Ikaros mutation/loss was a common feature of the young adult-irradiation group, with Ikaros frequently (50%) incurring multiple independent hits (including deletions and mutations) or suffering a single hit predicted to result in a dominant negative protein (such as those lacking exon 4, an isoform we have designated Ik12, which lacks two DNA binding zinc-finger domains). Conversely, Pten mutations were more frequent after early irradiation (60%) than after young adult-irradiation (30%). Homozygous Pten mutations occurred without DNA copy number change after irradiation starting in infancy, suggesting duplication of the mutated allele by chromosome mis-segregation or mitotic recombination. Our findings demonstrate that while deletions on chromosomes 4 and 11 affecting Cdkn2

  18. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  19. The SUD1 gene encodes a putative E3 ubiquitin ligase and is a positive regulator of 3-hydroxy-3-methylglutaryl coenzyme a reductase activity in Arabidopsis.

    Science.gov (United States)

    Doblas, Verónica G; Amorim-Silva, Vítor; Posé, David; Rosado, Abel; Esteban, Alicia; Arró, Montserrat; Azevedo, Herlander; Bombarely, Aureliano; Borsani, Omar; Valpuesta, Victoriano; Ferrer, Albert; Tavares, Rui M; Botella, Miguel A

    2013-02-01

    The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. In contrast with our extensive knowledge of the regulation of HMGR in yeast and animals, little is known about this process in plants. To identify regulatory components of the MVA pathway in plants, we performed a genetic screen for second-site suppressor mutations of the Arabidopsis thaliana highly drought-sensitive drought hypersensitive2 (dry2) mutant that shows decreased squalene epoxidase activity. We show that mutations in SUPPRESSOR OF DRY2 DEFECTS1 (SUD1) gene recover most developmental defects in dry2 through changes in HMGR activity. SUD1 encodes a putative E3 ubiquitin ligase that shows sequence and structural similarity to yeast Degradation of α factor (Doα10) and human TEB4, components of the endoplasmic reticulum-associated degradation C (ERAD-C) pathway. While in yeast and animals, the alternative ERAD-L/ERAD-M pathway regulates HMGR activity by controlling protein stability, SUD1 regulates HMGR activity without apparent changes in protein content. These results highlight similarities, as well as important mechanistic differences, among the components involved in HMGR regulation in plants, yeast, and animals.

  20. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  1. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  2. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  3. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  4. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  5. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  6. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  7. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  8. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  9. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  10. Complementation of non-tumorigenicity of HPV18-positive cervical carcinoma cells involves differential mRNA expression of cellular genes including potential tumor suppressor genes on chromosome 11q13.

    Science.gov (United States)

    Kehrmann, Angela; Truong, Ha; Repenning, Antje; Boger, Regina; Klein-Hitpass, Ludger; Pascheberg, Ulrich; Beckmann, Alf; Opalka, Bertram; Kleine-Lowinski, Kerstin

    2013-01-01

    The fusion between human tumorigenic cells and normal human diploid fibroblasts results in non-tumorigenic hybrid cells, suggesting a dominant role for tumor suppressor genes in the generated hybrid cells. After long-term cultivation in vitro, tumorigenic segregants may arise. The loss of tumor suppressor genes on chromosome 11q13 has been postulated to be involved in the induction of the tumorigenic phenotype of human papillomavirus (HPV)18-positive cervical carcinoma cells and their derived tumorigenic hybrid cells after subcutaneous injection in immunocompromised mice. The aim of this study was the identification of novel cellular genes that may contribute to the suppression of the tumorigenic phenotype of non-tumorigenic hybrid cells in vivo. We used cDNA microarray technology to identify differentially expressed cellular genes in tumorigenic HPV18-positive hybrid and parental HeLa cells compared to non-tumorigenic HPV18-positive hybrid cells. We detected several as yet unknown cellular genes that play a role in cell differentiation, cell cycle progression, cell-cell communication, metastasis formation, angiogenesis, antigen presentation, and immune response. Apart from the known differentially expressed genes on 11q13 (e.g., phosphofurin acidic cluster sorting protein 1 (PACS1) and FOS ligand 1 (FOSL1 or Fra-1)), we detected novel differentially expressed cellular genes located within the tumor suppressor gene region (e.g., EGF-containing fibulin-like extracellular matrix protein 2 (EFEMP2) and leucine rich repeat containing 32 (LRRC32) (also known as glycoprotein-A repetitions predominant (GARP)) that may have potential tumor suppressor functions in this model system of non-tumorigenic and tumorigenic HeLa x fibroblast hybrid cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  12. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  13. Genome-wide analysis of histone H3 acetylation patterns in AML identifies PRDX2 as an epigenetically silenced tumor suppressor gene

    DEFF Research Database (Denmark)

    Agrawal-Singh, Shuchi; Isken, Fabienne; Agelopoulos, Konstantin

    2012-01-01

    to have lower H3Ac levels in AML compared with progenitor cells, which suggested that a large number of genes are epigenetically silenced in AML. Intriguingly, we identified peroxiredoxin 2 (PRDX2) as a novel potential tumor suppressor gene in AML. H3Ac was decreased at the PRDX2 gene promoter in AML......With the use of ChIP on microarray assays in primary leukemia samples, we report that acute myeloid leukemia (AML) blasts exhibit significant alterations in histone H3 acetylation (H3Ac) levels at > 1000 genomic loci compared with CD34+ progenitor cells. Importantly, core promoter regions tended......, which correlated with low mRNA and protein expression. We also observed DNA hypermethylation at the PRDX2 promoter in AML. Low protein expression of the antioxidant PRDX2 gene was clinically associated with poor prognosis in patients with AML. Functionally, PRDX2 acted as inhibitor of myeloid cell...

  14. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  15. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  16. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  17. The tumor suppressors p33ING1 and p33ING2 interact with alien in vivo and enhance alien-mediated gene silencing.

    Science.gov (United States)

    Fegers, Inga; Kob, Robert; Eckey, Maren; Schmidt, Oliver; Goeman, Frauke; Papaioannou, Maria; Escher, Niko; von Eggeling, Ferdinand; Melle, Christian; Baniahmad, Aria

    2007-11-01

    The tumor suppressor p33ING1 is involved in DNA repair and cell cycle regulation. Furthermore, p33ING1 is a transcriptional silencer that recognizes the histone mark for trimethylated lysine 4 at histone H3. Interestingly, expression of p33ING1 and p33ING2 is able to induce premature senescence in primary human fibroblasts. The corepressor Alien is involved in gene silencing mediated by selected members of nuclear hormone receptors. In addition, Alien acts as a corepressor for E2F1, a member of the E2F cell cycle regulatory family. Furthermore, recent findings suggest that Alien is complexed with transcription factors participating in DNA repair and chromatin. Here, using a proteomic approach by surface-enhanced laser desorption ionization and mass spectrometry (SELDI-MS) combined with immunological techniques, we show that Alien interacts in vivo with the tumor suppressor p33ING1 as well as with the related tumor suppressor candidate p33ING2. The interaction of Alien with p33ING1 and p33ING2 was confirmed in vitro with GST-pull-down, suggesting a direct binding of Alien to these factors. The binding domain was mapped to a central region of Alien. Functionally, the expression of p33ING1 or p33ING2 enhances the Alien-mediated silencing, suggesting that the interaction plays a role in transcriptional regulation. Thus, the findings suggest that the identified interaction between Alien and the tumor suppressors p33ING1 and p33ING2 reveals a novel cellular protein network.

  18. Allelic loss of the short arm of chromosome 4 in neuroblastoma suggests a novel tumour suppressor gene locus

    NARCIS (Netherlands)

    Caron, H.; van Sluis, P.; Buschman, R.; Pereira do Tanque, R.; Maes, P.; Beks, L.; de Kraker, J.; Voûte, P. A.; Vergnaud, G.; Westerveld, A.; Slater, R.; Versteeg, R.

    1996-01-01

    Neuroblastoma is a childhood neural crest tumour, genetically characterized by frequent deletions of the short arm of chromosome 1 and amplification of N-myc. Here we report the first evidence for a neuroblastoma tumour suppressor locus on 4pter. Cytogenetically we demonstrated rearrangements of 4p

  19. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  20. CDKN1C/p57kip2 is a candidate tumor suppressor gene in human breast cancer

    International Nuclear Information System (INIS)

    Larson, Pamela S; Schlechter, Benjamin L; King, Chia-Lin; Yang, Qiong; Glass, Chelsea N; Mack, Charline; Pistey, Robert; Morenas, Antonio de las; Rosenberg, Carol L

    2008-01-01

    CDKN1C (also known as p57 KIP2 ) is a cyclin-dependent kinase inhibitor previously implicated in several types of human cancer. Its family members (CDKN1A/p21 CIP1 and B/p27 KIP1 ) have been implicated in breast cancer, but information about CDKN1C's role is limited. We hypothesized that decreased CDKN1C may be involved in human breast carcinogenesis in vivo. We determined rates of allele imbalance or loss of heterozygosity (AI/LOH) in CDKN1C, using an intronic polymorphism, and in the surrounding 11p15.5 region in 82 breast cancers. We examined the CDKN1C mRNA level in 10 cancers using quantitative real-time PCR (qPCR), and the CDKN1C protein level in 20 cancers using immunohistochemistry (IHC). All samples were obtained using laser microdissection. Data were analyzed using standard statistical tests. AI/LOH at 11p15.5 occurred in 28/73 (38%) informative cancers, but CDKN1C itself underwent AI/LOH in only 3/16 (19%) cancers (p = ns). In contrast, CDKN1C mRNA levels were reduced in 9/10 (90%) cancers (p < 0.0001), ranging from 2–60% of paired normal epithelium. Similarly, CDKN1C protein staining was seen in 19/20 (95%) cases' normal epithelium but in only 7/14 (50%) cases' CIS (p < 0.004) and 5/18 (28%) cases' IC (p < 0.00003). The reduction appears primarily due to loss of CDKN1C expression from myoepithelial layer cells, which stained intensely in 17/20 (85%) normal lobules, but in 0/14 (0%) CIS (p < 0.00001). In contrast, luminal cells displayed less intense, focal staining fairly consistently across histologies. Decreased CDKN1C was not clearly associated with tumor grade, histology, ER, PR or HER2 status. CDKN1C is expressed in normal epithelium of most breast cancer cases, mainly in the myothepithelial layer. This expression decreases, at both the mRNA and protein level, in the large majority of breast cancers, and does not appear to be mediated by AI/LOH at the gene. Thus, CDKN1C may be a breast cancer tumor suppressor

  1. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  2. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  3. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  4. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  5. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  6. Genetic and Epigenetic Tumor Suppressor Gene Silencing are Distinct Molecular Phenotypes Driven by Growth Promoting Mutations in Non small Cell Lung Cancer

    International Nuclear Information System (INIS)

    Marsit, C. J.; Kelsey, K. T.; Houseman, E. A.; Kelsey, K. T.; Houseman, E. A.; Nelson, H. H.

    2008-01-01

    Both genetic and epigenetic alterations characterize human non small cell lung cancer (NSCLC), but the biological processes that create or select these alterations remain incompletely investigated. Our hypothesis posits that a roughly reciprocal relationship between the propensity for promoter hyper methylation and a propensity for genetic deletion leads to distinct molecular phenotypes of lung cancer. To test this hypothesis, we examined promoter hyper methylation of 17 tumor suppressor genes, as a marker of epigenetic alteration propensity, and deletion events at the 3p21 region, as a marker of genetic alteration. To model the complex biology between these somatic alterations, we utilized an item response theory model. We demonstrated that tumors exhibiting LOH at greater than 30% of informative alleles in the 3p21 region have a significantly reduced propensity for hyper methylation. At the same time, tumors with activating KRAS mutations showed a significantly increased propensity for hyper methylation of the loci examined, a result similar to what has been observed in colon cancer. These data suggest that NSCLCs have distinct epigenetic or genetic alteration phenotypes acting upon tumor suppressor genes and that mutation of oncogenic growth promoting genes, such as KRAS, is associated with the epigenetic phenotype.

  7. Genetic and Epigenetic Tumor Suppressor Gene Silencing Are Distinct Molecular Phenotypes Driven by Growth Promoting Mutations in Nonsmall Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Carmen J. Marsit

    2008-01-01

    Full Text Available Both genetic and epigenetic alterations characterize human nonsmall cell lung cancer (NSCLC, but the biological processes that create or select these alterations remain incompletely investigated. Our hypothesis posits that a roughly reciprocal relationship between the propensity for promoter hypermethylation and a propensity for genetic deletion leads to distinct molecular phenotypes of lung cancer. To test this hypothesis, we examined promoter hypermethylation of 17 tumor suppressor genes, as a marker of epigenetic alteration propensity, and deletion events at the 3p21 region, as a marker of genetic alteration. To model the complex biology between these somatic alterations, we utilized an item response theory model. We demonstrated that tumors exhibiting LOH at greater than 30% of informative alleles in the 3p21 region have a significantly reduced propensity for hypermethylation. At the same time, tumors with activating KRAS mutations showed a significantly increased propensity for hypermethylation of the loci examined, a result similar to what has been observed in colon cancer. These data suggest that NSCLCs have distinct epigenetic or genetic alteration phenotypes acting upon tumor suppressor genes and that mutation of oncogenic growth promoting genes, such as KRAS, is associated with the epigenetic phenotype.

  8. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  9. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  10. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Science.gov (United States)

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  11. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  12. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  13. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  14. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  15. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  16. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  17. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  18. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  19. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  20. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  1. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  2. Primary microcephaly gene MCPH1 shows signatures of tumor suppressors and is regulated by miR-27a in oral squamous cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Thejaswini Venkatesh

    Full Text Available Mutations in the MCPH1 (microcephalin 1 gene, located at chromosome 8p23.1, result in two autosomal recessive disorders: primary microcephaly and premature chromosome condensation syndrome. MCPH1 has also been shown to be downregulated in breast, prostate and ovarian cancers, and mutated in 1/10 breast and 5/41 endometrial tumors, suggesting that it could also function as a tumor suppressor (TS gene. To test the possibility of MCPH1 as a TS gene, we first performed LOH study in a panel of 81 matched normal oral tissues and oral squamous cell carcinoma (OSCC samples, and observed that 14/71 (19.72% informative samples showed LOH, a hallmark of TS genes. Three protein truncating mutations were identified in 1/15 OSCC samples and 2/5 cancer cell lines. MCPH1 was downregulated at both the transcript and protein levels in 21/41 (51.22% and 19/25 (76% OSCC samples respectively. A low level of MCPH1 promoter methylation was also observed in 4/40 (10% tumor samples. We further observed that overexpression of MCPH1 decreased cellular proliferation, anchorage-independent growth in soft agar, cell invasion and tumor size in nude mice, indicating its tumor suppressive function. Using bioinformatic approaches and luciferase assay, we showed that the 3'-UTR of MCPH1 harbors two non-overlapping functional seed regions for miR-27a which negatively regulated its level. The expression level of miR-27a negatively correlated with the MCPH1 protein level in OSCC. Our study indicates for the first time that, in addition to its role in brain development, MCPH1 also functions as a tumor suppressor gene and is regulated by miR-27a.

  3. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  4. Divergent mechanisms underlie Smad4-mediated positive regulation of the three genes encoding the basement membrane component laminin-332 (laminin-5)

    International Nuclear Information System (INIS)

    Zboralski, Dirk; Böckmann, Miriam; Zapatka, Marc; Hoppe, Sabine; Schöneck, Anna; Hahn, Stephan A; Schmiegel, Wolff; Schwarte-Waldhoff, Irmgard

    2008-01-01

    Functional inactivation of the tumor suppressor Smad4 in colorectal and pancreatic carcinogenesis occurs coincident with the transition to invasive growth. Breaking the basement membrane (BM) barrier, a prerequisite for invasive growth, can be due to tumor induced proteolytic tissue remodeling or to reduced synthesis of BM molecules by incipient tumor cells. Laminin-332 (laminin-5), a heterotrimeric BM component composed of α3-, β3- and γ2-chains, has recently been identified as a target structure of Smad4 and represents the first example for expression control of an essential BM component by a tumor and invasion suppressor. Biochemically Smad4 is a transmitter of signals of the TGFβ superfamily of cytokines. We have reported previously, that Smad4 functions as a positive transcriptional regulator of constitutive and of TGFβ-induced transcription of all three genes encoding Laminin-332, LAMA3, LAMB3 and LAMC2. Promoter-reporter constructs harboring 4 kb upstream regions, each of the three genes encoding Laminin-322 as well as deletion and mutations constructs were established. Promoter activities and TGFβ induction were assayed through transient transfections in Smad4-negative human cancer cells and their stable Smad4-positive derivatives. Functionally relevant binding sites were subsequently confirmed through chromatin immunoprecipitation. Herein, we report that Smad4 mediates transcriptional regulation through three different mechanisms, namely through Smad4 binding to a functional SBE site exclusively in the LAMA3 promoter, Smad4 binding to AP1 (and Sp1) sites presumably via interaction with AP1 family components and lastly a Smad4 impact on transcription of AP1 factors. Whereas Smad4 is essential for positive regulation of all three genes, the molecular mechanisms are significantly divergent between the LAMA3 promoter as compared to the LAMB3 and LAMC2 promoters. We hypothesize that this divergence in modular regulation of the three promoters may lay the

  5. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  6. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  7. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  8. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  9. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  10. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  11. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  12. Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

    Science.gov (United States)

    Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

    1995-02-15

    The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

  13. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  15. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  16. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  17. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  18. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  19. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  20. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  1. Adenovirus small E1A employs the lysine acetylases p300/CBP and tumor suppressor Rb to repress select host genes and promote productive virus infection.

    Science.gov (United States)

    Ferrari, Roberto; Gou, Dawei; Jawdekar, Gauri; Johnson, Sarah A; Nava, Miguel; Su, Trent; Yousef, Ahmed F; Zemke, Nathan R; Pellegrini, Matteo; Kurdistani, Siavash K; Berk, Arnold J

    2014-11-12

    Oncogenic transformation by adenovirus small e1a depends on simultaneous interactions with the host lysine acetylases p300/CBP and the tumor suppressor RB. How these interactions influence cellular gene expression remains unclear. We find that e1a displaces RBs from E2F transcription factors and promotes p300 acetylation of RB1 K873/K874 to lock it into a repressing conformation that interacts with repressive chromatin-modifying enzymes. These repressing p300-e1a-RB1 complexes specifically interact with host genes that have unusually high p300 association within the gene body. The TGF-β, TNF-, and interleukin-signaling pathway components are enriched among such p300-targeted genes. The p300-e1a-RB1 complex condenses chromatin in a manner dependent on HDAC activity, p300 lysine acetylase activity, the p300 bromodomain, and RB K873/K874 and e1a K239 acetylation to repress host genes that would otherwise inhibit productive virus infection. Thus, adenovirus employs e1a to repress host genes that interfere with viral replication. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  3. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  4. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  5. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  6. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  7. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  8. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  9. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  10. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  11. High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

    Directory of Open Access Journals (Sweden)

    Bianco Linda

    2009-11-01

    Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

  12. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  13. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  14. Physical mapping of chromosome 17p13.3 in the region of a putative tumor suppressor gene important in medulloblastoma

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, J.D.; Daneshvar, L.; Willert, J.R. [Univ. of California, San Franciso, CA (United States)] [and others

    1994-09-01

    Deletion mapping of a medulloblastoma tumor panel revealed loss of distal chromosome 17p13.3 sequences in tumors from 14 of 32 patients (44%). Of the 14 tumors showing loss of heterozygosity by restriction fragment length polymorphism analysis, 14 of 14 (100%) displayed loss of the telomeric marker p144-D6 (D17S34), while a probe for the ABR gene on 17p13.3 was lost in 7 of 8 (88%) informative cases. Using pulsed-field gel electrophoresis, we localized the polymorphic marker (VNTR-A) of the ABR gene locus to within 220 kb of the p144-D6 locus. A cosmid contig constructed in this region was used to demonstrate by fluorescence in situ hybridization that the ABR gene is oriented transcriptionally 5{prime} to 3{prime} toward the telomere. This report provides new physical mapping data for the ABR gene, which has not been previously shown to be deleted in medulloblastoma. These results provide further evidence for the existence of a second tumor suppressor gene distinct from p53 on distal chromosome 17p. 12 refs., 3 figs.

  15. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  16. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  17. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  18. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  19. Putative tumour-suppressor gene DAB2 is frequently down regulated by promoter hypermethylation in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Tong, Joanna H; Lo, Kwok W; To, Ka F; Ng, David C; Chau, Shuk L; So, Ken K; Leung, Patrick P; Lee, Tin L; Lung, Raymond W; Chan, Michael W; Chan, Anthony W

    2010-01-01

    Human Disabled-2 (DAB2), is a multi-function signalling molecule that it is frequently down-regulated in human cancers. We aimed to investigate the possible tumour suppressor effect of DAB2 in nasopharyngeal carcinoma (NPC). We studied the expression of DAB2 in NPC cell lines, xenografts and primary tumour samples. The status of promoter methylation was assessed by methylation specific PCR and bisulfite sequencing. The functional role of DAB2 in NPC was investigated by re-introducing DAB2 expression into NPC cell line C666-1. Decrease or absent of DAB2 transcript was observed in NPC cell lines and xenografts. Loss of DAB2 protein expression was seen in 72% (33/46) of primary NPC as demonstrated by immunohistochemistry. Aberrant DAB2 promoter methylation was detected in 65.2% (30/46) of primary NPC samples by methylation specific PCR. Treatment of the DAB2 negative NPC cell line C666-1 with 5-aza-2'-deoxycytidine resulted in restoration of DAB2 expression in a dose-dependent manner. Overexpression of DAB2 in NPC cell line C666-1 resulted in reduced growth rate and 35% reduction in anchorage-dependent colony formation, and inhibition of serum-induced c-Fos expression compared to vector-transfected controls. Over expression of DAB2 resulted in alterations of multiple pathways as demonstrated by expression profiling and functional network analysis, which confirmed the role of DAB2 as an adaptor molecule involved in multiple receptor-mediated signalling pathways. We report the frequent down regulation of DAB2 in NPC and the promoter hypermethylation contributes to the loss of expression of DAB2. This is the first study demonstrating frequent DAB2 promoter hypermethylation in human cancer. Our functional studies support the putative tumour suppressor effect of DAB2 in NPC cells

  20. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

    Science.gov (United States)

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

    2013-09-01

    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  1. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  2. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  3. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  4. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  5. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  6. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  7. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  8. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  9. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Science.gov (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  11. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  12. Simultaneous down-regulation of tumor suppressor genes RBSP3/CTDSPL, NPRL2/G21 and RASSF1A in primary non-small cell lung cancer

    International Nuclear Information System (INIS)

    Senchenko, Vera N; Zabarovsky, Eugene R; Anedchenko, Ekaterina A; Kondratieva, Tatiana T; Krasnov, George S; Dmitriev, Alexei A; Zabarovska, Veronika I; Pavlova, Tatiana V; Kashuba, Vladimir I; Lerman, Michael I

    2010-01-01

    The short arm of human chromosome 3 is involved in the development of many cancers including lung cancer. Three bona fide lung cancer tumor suppressor genes namely RBSP3 (AP20 region),NPRL2 and RASSF1A (LUCA region) were identified in the 3p21.3 region. We have shown previously that homozygous deletions in AP20 and LUCA sub-regions often occurred in the same tumor (P < 10 -6 ). We estimated the quantity of RBSP3, NPRL2, RASSF1A, GAPDH, RPN1 mRNA and RBSP3 DNA copy number in 59 primary non-small cell lung cancers, including 41 squamous cell and 18 adenocarcinomas by real-time reverse transcription-polymerase chain reaction based on TaqMan technology and relative quantification. We evaluated the relationship between mRNA level and clinicopathologic characteristics in non-small cell lung cancer. A significant expression decrease (≥2) was found for all three genes early in tumor development: in 85% of cases for RBSP3; 73% for NPRL2 and 67% for RASSF1A (P < 0.001), more strongly pronounced in squamous cell than in adenocarcinomas. Strong suppression of both, NPRL2 and RBSP3 was seen in 100% of cases already at Stage I of squamous cell carcinomas. Deregulation of RASSF1A correlated with tumor progression of squamous cell (P = 0.196) and adenocarcinomas (P < 0.05). Most likely, genetic and epigenetic mechanisms might be responsible for transcriptional inactivation of RBSP3 in non-small cell lung cancers as promoter methylation of RBSP3 according to NotI microarrays data was detected in 80% of squamous cell and in 38% of adenocarcinomas. With NotI microarrays we tested how often LUCA (NPRL2, RASSF1A) and AP20 (RBSP3) regions were deleted or methylated in the same tumor sample and found that this occured in 39% of all studied samples (P < 0.05). Our data support the hypothesis that these TSG are involved in tumorigenesis of NSCLC. Both genetic and epigenetic mechanisms contribute to down-regulation of these three genes representing two tumor suppressor clusters in 3p21

  13. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  14. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  15. The essential Escherichia coli msgB gene, a multicopy suppressor of a temperature-sensitive allele of the heat shock gene grpE, is identical to dapE.

    OpenAIRE

    Wu, B; Georgopoulos, C; Ang, D

    1992-01-01

    The grpE gene product is one of three Escherichia coli heat shock proteins (DnaK, DnaJ, and GrpE) that are essential for both bacteriophage lambda DNA replication and bacterial growth at all temperatures. In an effort to determine the role of GrpE and to identify other factors that it may interact with, we isolated multicopy suppressors of the grpE280 point mutation, as judged by their ability to reverse the temperature-sensitive phenotype of grpE280. Here we report the characterization of on...

  16. Transient Co-Expression of Post-Transcriptional Gene Silencing Suppressors for Increased in Planta Expression of a Recombinant Anthrax Receptor Fusion Protein

    Directory of Open Access Journals (Sweden)

    Kittipong Rattanaporn

    2011-08-01

    Full Text Available Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin, CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA domain of human capillary morphogenesis 2 (CMG2, an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG. We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS: p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI, with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

  17. Transient co-expression of post-transcriptional gene silencing suppressors for increased in planta expression of a recombinant anthrax receptor fusion protein.

    Science.gov (United States)

    Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M; McDonald, Karen A

    2011-01-01

    Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

  18. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  19. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  20. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  1. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  2. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  3. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  4. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  5. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  6. PURA, the gene encoding Pur-alpha, member of an ancient nucleic acid-binding protein family with mammalian neurological functions.

    Science.gov (United States)

    Daniel, Dianne C; Johnson, Edward M

    2018-02-15

    The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding

  7. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  8. Tsw gene-based resistance is triggered by a functional RNA silencing suppressor protein of the Tomato spotted wilt virus

    NARCIS (Netherlands)

    Ronde, de D.; Butterbach, P.B.E.; Lohuis, H.; Hedil, M.; Lent, van J.W.M.; Kormelink, R.J.M.

    2013-01-01

    As a result of contradictory reports, the avirulence (Avr) determinant that triggers Tsw gene-based resistance in Capsicum annuum against the Tomato spotted wilt virus (TSWV) is still unresolved. Here, the N and NSs genes of resistance-inducing (RI) and resistance-breaking (RB) isolates were cloned

  9. Caffeine mediates sustained inactivation of breast cancer-associated myofibroblasts via up-regulation of tumor suppressor genes.

    Directory of Open Access Journals (Sweden)

    Mysoon M Al-Ansari

    Full Text Available BACKGROUND: Active cancer-associated fibroblasts (CAFs or myofibroblasts play important roles not only in the development and progression of breast carcinomas, but also in their prognosis and treatment. Therefore, targeting these cells through suppressing their supportive procarcinogenic paracrine effects is mandatory for improving the current therapies that are mainly targeting tumor cells. To this end, we investigated the effect of the natural and pharmacologically safe molecule, caffeine, on CAF cells and their various procarcinogenic effects. METHODOLOGY/PRINCIPAL FINDINGS: We have shown here that caffeine up-regulates the tumor suppressor proteins p16, p21, p53 and Cav-1, and reduces the expression/secretion of various cytokines (IL-6, TGF-β, SDF-1 and MMP-2, and down-regulates α-SMA. Furthermore, caffeine suppressed the migratory/invasiveness abilities of CAF cells through PTEN-dependent Akt/Erk1/2 inactivation. Moreover, caffeine reduced the paracrine pro-invasion/-migration effects of CAF cells on breast cancer cells. These results indicate that caffeine can inactivate breast stromal myofibroblasts. This has been confirmed by showing that caffeine also suppresses the paracrine pro-angiogenic effect of CAF cells through down-regulating HIF-1αand its downstream effector VEGF-A. Interestingly, these effects were sustained in absence of caffeine. CONCLUSION/SIGNIFICANCE: The present findings provide a proof of principle that breast cancer myofibroblasts can be inactivated, and thereby caffeine may provide a safe and effective prevention against breast tumor growth/recurrence through inhibition of the procarcinogenic effects of active stromal fibroblasts.

  10. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  11. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  12. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  13. NF-{kappa}B p50 promotes tumor cell invasion through negative regulation of invasion suppressor gene CRMP-1 in human lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Ming, Gao [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); National Center of Excellence for Clinical Trial and Research, National Taiwan University, Hospital, Taipei, Taiwan (China); Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Yeh, P Y [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Department of Oncology, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei 10016, Taiwan (China); Lu, Y -S [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); National Center of Excellence for Clinical Trial and Research, National Taiwan University, Hospital, Taipei, Taiwan (China); Department of Oncology, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei 10016, Taiwan, ROC (China); Chang, W C [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Kuo, M -L [Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Cheng, A -L [Cancer Research Center, College of Medicine, National Taiwan University, Taipei, Taiwan (China); National Center of Excellence for Clinical Trial and Research, National Taiwan University, Hospital, Taipei, Taiwan (China); Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Department of Oncology, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei 10016, Taiwan (China); Department of Internal Medicine, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei 10016, Taiwan (China)], E-mail: alcheng@ntu.edu.tw

    2008-11-14

    Lung adenocarcinoma Cl1-5 cells were selected from parental Cl1-0 cells based on their high metastatic potential. In a previous study, CRMP-1, an invasion suppressor gene, was shown to be suppressed in Cl1-5 cells. However, the regulation of CRMP-1 expression has not been explored. In this study, we showed nuclear factor-{kappa}B controls CRMP-1 expression. The electromobility shift assay showed that while Cl1-0 cells exhibited low NF-{kappa}B activity in response to TNF-{alpha}, an abundance of basal and TNF-{alpha}-induced NF-{kappa}B-DNA complex was detected in Cl1-5 cells. Supershift-coupled EMSA and Western blotting of nuclear proteins, however, revealed p50 protein, but not classic p65/p50 heterodimer in the complex. ChIP and EMSA demonstrated that p50 binds to a {kappa}B site residing between -1753 and -1743 of the CRMP-1 promoter region. Transfection of antisense p50 gene into Cl1-5 cells increased the CRMP-1 protein level and decreased the invasive activity of Cl1-5 cells.

  14. Up-regulation of tumor suppressor genes by exogenous dhC16-Cer contributes to its anti-cancer activity in primary effusion lymphoma.

    Science.gov (United States)

    Cao, Yueyu; Qiao, Jing; Lin, Zhen; Zabaleta, Jovanny; Dai, Lu; Qin, Zhiqiang

    2017-02-28

    Primary effusion lymphoma (PEL) is a rare and highly aggressive B-cell malignancy with Kaposi's sarcoma-associated herpesvirus (KSHV) infection, while lack of effective therapies. Our recent data indicated that targeting the sphingolipid metabolism by either sphingosine kinase inhibitor or exogenous ceramide species induces PEL cell apoptosis and suppresses tumor progression in vivo. However, the underlying mechanisms for these exogenous ceramides "killing" PEL cells remain largely unknown. Based on the microarray analysis, we found that exogenous dhC16-Cer treatment affected the expression of many cellular genes with important functions within PEL cells such as regulation of cell cycle, cell survival/proliferation, and apoptosis/anti-apoptosis. Interestingly, we found that a subset of tumor suppressor genes (TSGs) was up-regulated from dhC16-Cer treated PEL cells. One of these elevated TSGs, Thrombospondin-1 (THBS1) was required for dhC16-Cer induced PEL cell cycle arrest. Moreover, dhC16-Cer up-regulation of THBS1 was through the suppression of multiple KSHV microRNAs expression. Our data demonstrate that exogenous ceramides display anti-cancer activities for PEL through regulation of both host and oncogenic virus factors.

  15. The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

    Science.gov (United States)

    Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

    2011-10-01

    The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

  16. NF-κB p50 promotes tumor cell invasion through negative regulation of invasion suppressor gene CRMP-1 in human lung adenocarcinoma cells

    International Nuclear Information System (INIS)

    Gao Ming; Yeh, P.Y.; Lu, Y.-S.; Chang, W.C.; Kuo, M.-L.; Cheng, A.-L.

    2008-01-01

    Lung adenocarcinoma Cl1-5 cells were selected from parental Cl1-0 cells based on their high metastatic potential. In a previous study, CRMP-1, an invasion suppressor gene, was shown to be suppressed in Cl1-5 cells. However, the regulation of CRMP-1 expression has not been explored. In this study, we showed nuclear factor-κB controls CRMP-1 expression. The electromobility shift assay showed that while Cl1-0 cells exhibited low NF-κB activity in response to TNF-α, an abundance of basal and TNF-α-induced NF-κB-DNA complex was detected in Cl1-5 cells. Supershift-coupled EMSA and Western blotting of nuclear proteins, however, revealed p50 protein, but not classic p65/p50 heterodimer in the complex. ChIP and EMSA demonstrated that p50 binds to a κB site residing between -1753 and -1743 of the CRMP-1 promoter region. Transfection of antisense p50 gene into Cl1-5 cells increased the CRMP-1 protein level and decreased the invasive activity of Cl1-5 cells

  17. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. The role of UV induced lesions in skin carcinogenesis: an overview of oncogene and tumor suppressor gene modifications in xeroderma pigmentosum skin tumors

    International Nuclear Information System (INIS)

    Daya-Grosjean, Leela; Sarasin, Alain

    2005-01-01

    Xeroderma pigmentosum (XP), a rare hereditary syndrome, is characterized by a hypersensitivity to solar irradiation due to a defect in nucleotide excision repair resulting in a predisposition to squamous and basal cell carcinomas as well as malignant melanomas appearing at a very early age. The mutator phenotype of XP cells is evident by the higher levels of UV specific modifications found in key regulatory genes in XP skin tumors compared to those in the same tumor types from the normal population. Thus, XP provides a unique model for the study of unrepaired DNA lesions, mutations and skin carcinogenesis. The high level of ras oncogene activation, Ink4a-Arf and p53 tumor suppressor gene modifications as well as alterations of the different partners of the mitogenic sonic hedgehog signaling pathway (patched, smoothened and sonic hedgehog), characterized in XP skin tumors have clearly demonstrated the major role of the UV component of sunlight in the development of skin tumors. The majority of the mutations are C to T or tandem CC to TT UV signature transitions, occurring at bipyrimidine sequences, the specific targets of UV induced lesions. These characteristics are also found in the same genes modified in sporadic skin cancers but with lower frequencies confirming the validity of studying the XP model. The knowledge gained by studying XP tumors has given us a greater perception of the contribution of genetic predisposition to cancer as well as the consequences of the many alterations which modulate the activities of different genes affecting crucial pathways vital for maintaining cell homeostasis

  19. The role of UV induced lesions in skin carcinogenesis: an overview of oncogene and tumor suppressor gene modifications in xeroderma pigmentosum skin tumors

    Energy Technology Data Exchange (ETDEWEB)

    Daya-Grosjean, Leela [Laboratory of Genetic Instability and Cancer, UPR2169 CNRS, IFR 54, Institut Gustave Roussy, 39, rue Camille Desmoulins, 94805 Villejuif Cedex (France)]. E-mail: daya@igr.fr; Sarasin, Alain [Laboratory of Genetic Instability and Cancer, UPR2169 CNRS, IFR 54, Institut Gustave Roussy, 39, rue Camille Desmoulins, 94805 Villejuif Cedex (France)

    2005-04-01

    Xeroderma pigmentosum (XP), a rare hereditary syndrome, is characterized by a hypersensitivity to solar irradiation due to a defect in nucleotide excision repair resulting in a predisposition to squamous and basal cell carcinomas as well as malignant melanomas appearing at a very early age. The mutator phenotype of XP cells is evident by the higher levels of UV specific modifications found in key regulatory genes in XP skin tumors compared to those in the same tumor types from the normal population. Thus, XP provides a unique model for the study of unrepaired DNA lesions, mutations and skin carcinogenesis. The high level of ras oncogene activation, Ink4a-Arf and p53 tumor suppressor gene modifications as well as alterations of the different partners of the mitogenic sonic hedgehog signaling pathway (patched, smoothened and sonic hedgehog), characterized in XP skin tumors have clearly demonstrated the major role of the UV component of sunlight in the development of skin tumors. The majority of the mutations are C to T or tandem CC to TT UV signature transitions, occurring at bipyrimidine sequences, the specific targets of UV induced lesions. These characteristics are also found in the same genes modified in sporadic skin cancers but with lower frequencies confirming the validity of studying the XP model. The knowledge gained by studying XP tumors has given us a greater perception of the contribution of genetic predisposition to cancer as well as the consequences of the many alterations which modulate the activities of different genes affecting crucial pathways vital for maintaining cell homeostasis.

  20. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  1. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  2. The von Hippel-Lindau tumor suppressor gene inhibits hepatocyte growth factor/scatter factor-induced invasion and branching morphogenesis in renal carcinoma cells.

    Science.gov (United States)

    Koochekpour, S; Jeffers, M; Wang, P H; Gong, C; Taylor, G A; Roessler, L M; Stearman, R; Vasselli, J R; Stetler-Stevenson, W G; Kaelin, W G; Linehan, W M; Klausner, R D; Gnarra, J R; Vande Woude, G F

    1999-09-01

    Loss of function in the von Hippel-Lindau (VHL) tumor suppressor gene occurs in familial and most sporadic renal cell carcinomas (RCCs). VHL has been linked to the regulation of cell cycle cessation (G(0)) and to control of expression of various mRNAs such as for vascular endothelial growth factor. RCC cells express the Met receptor tyrosine kinase, and Met mediates invasion and branching morphogenesis in many cell types in response to hepatocyte growth factor/scatter factor (HGF/SF). We examined the HGF/SF responsiveness of RCC cells containing endogenous mutated (mut) forms of the VHL protein (VHL-negative RCC) with that of isogenic cells expressing exogenous wild-type (wt) VHL (VHL-positive RCC). We found that VHL-negative 786-0 and UOK-101 RCC cells were highly invasive through growth factor-reduced (GFR) Matrigel-coated filters and exhibited an extensive branching morphogenesis phenotype in response to HGF/SF in the three-dimensional (3D) GFR Matrigel cultures. In contrast, the phenotypes of A498 VHL-negative RCC cells were weaker, and isogenic RCC cells ectopically expressing wt VHL did not respond at all. We found that all VHL-negative RCC cells expressed reduced levels of tissue inhibitor of metalloproteinase 2 (TIMP-2) relative to the wt VHL-positive cells, implicating VHL in the regulation of this molecule. However, consistent with the more invasive phenotype of the 786-0 and UOK-101 VHL-negative RCC cells, the levels of TIMP-1 and TIMP-2 were reduced and levels of the matrix metalloproteinases 2 and 9 were elevated compared to the noninvasive VHL-positive RCC cells. Moreover, recombinant TIMPs completely blocked HGF/SF-mediated branching morphogenesis, while neutralizing antibodies to the TIMPs stimulated HGF/SF-mediated invasion in vitro. Thus, the loss of the VHL tumor suppressor gene is central to changes that control tissue invasiveness, and a more invasive phenotype requires additional genetic changes seen in some but not all RCC lines. These

  3. Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

    Directory of Open Access Journals (Sweden)

    Hashishe Mervat M

    2010-06-01

    Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations

  4. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  5. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  6. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  7. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  8. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  9. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  10. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  11. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  12. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    International Nuclear Information System (INIS)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-01-01

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  13. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  14. Meta-analysis of promoter methylation in eight tumor-suppressor genes and its association with the risk of thyroid cancer.

    Directory of Open Access Journals (Sweden)

    Fatemeh Khatami

    Full Text Available Promoter methylation in a number of tumor-suppressor genes (TSGs can play crucial roles in the development of thyroid carcinogenesis. The focus of the current meta-analysis was to determine the impact of promoter methylation of eight selected candidate TSGs on thyroid cancer and to identify the most important molecules in this carcinogenesis pathway. A comprehensive search was performed using Pub Med, Scopus, and ISI Web of Knowledge databases, and eligible studies were included. The methodological quality of the included studies was evaluated according to the Newcastle Ottawa scale table and pooled odds ratios (ORs; 95% confidence intervals (CIs were used to estimate the strength of the associations with Stata 12.0 software. Egger's and Begg's tests were applied to detect publication bias, in addition to the "Metatrim" method. A total of 55 articles were selected, and 135 genes with altered promoter methylation were found. Finally, we included eight TSGs that were found in more than four studies (RASSF1, TSHR, PTEN, SLC5A, DAPK, P16, RARβ2, and CDH1. The order of the pooled ORs for these eight TSGs from more to less significant was CDH1 (OR = 6.73, SLC5 (OR = 6.15, RASSF1 (OR = 4.16, PTEN (OR = 3.61, DAPK (OR = 3.51, P16 (OR = 3.31, TSHR (OR = 2.93, and RARβ2 (OR = 1.50. Analyses of publication bias and sensitivity confirmed that there was very little bias. Thus, our findings showed that CDH1 and SCL5A8 genes were associated with the risk of thyroid tumor genesis.

  15. Influence of tumour suppressor gene (TP53, BRCA1 and BRCA2) polymorphisms on polycystic ovary syndrome in South Indian women.

    Science.gov (United States)

    Siddamalla, Swapna; Reddy, Tumu Venkat; Govatati, Suresh; Guruvaiah, Praveen; Deenadayal, Mamata; Shivaji, Sisinthy; Bhanoori, Manjula

    2018-05-24

    Polycystic Ovary Syndrome (PCOS) is a heterogeneous multifactorial endocrine metabolic disorder. In addition to hyperandrogenism, acne, hirsutism, obesity, oligoanovulation and infertility, insulin resistance is also a common feature in women of PCOS. Tumor suppressor genes (TSGs) perform essential function in the maintenance of genomic stability and regulatory pathways influencing the activity of several replication and transcription factors. The main aim of this study was to investigate the association of Single Nucleotide Polymorphisms of TP53, BRCA1and BRCA2 genes with the susceptibility to PCOS in South Indian women. Present study investigated association between TP53 gene (rs1042522 G/C), BRCA1 (rs71361504 -/GTT, rs3092986 T/C) and BRCA2 (rs206118 A/G) and, SNPs and PCOS risk. Genotyping of TSGs was carried out on DNA from PCOS patients (n = 110) and controls (n = 130) of South Indian origin by polymerase chain reaction (PCR) and confirmed by sequencing analysis. The genotype frequency and allele distributions of cases and controls were analyzed using Fisher's exact test. Haplotype frequencies for multiple loci and the standardized disequilibrium coefficient (D') for pair wise linkage disequilibrium (LD) were assessed by Haploview Software. Significant increase in frequencies ofTP53 (rs1042522 G/C), BRCA1 (rs71361504 -/GTT, rs3092986 T/C) genotypes and alleles in patients compared to controls. In addition, the frequency of the C/T (P = 0.002) and A/C (P = 0.012) haplotype was also significantly elevated in patients. But BRCA2 (rs206118 A/G) did not show significant association with PCOS. The TP53 and BRCA1 may constitute an inheritable risk factor for PCOS in South Indian women. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Physical mapping of a commonly deleted region, the site of a candidate tumor suppressor gene, at 12q22 in human male germ cell tumors

    Energy Technology Data Exchange (ETDEWEB)

    Murty, V.V.V.S.; Bosl, G.J.; Chaganti, R.S.K. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [and others

    1996-08-01

    A candidate tumor suppressor gene (TSG) site at 12q22 characterized by a high frequency of loss of heterozygosity (LOH) and a homozygous deletion has previously (LOH) and a homozygous deletion has previously been reported in human male germ cell tumors (GCTs). In a detailed deletion mapping analysis of 67 normal-tumor DNAs utilizing 20 polymorphic markers mapped to 12q22-q24, we identified the limits of the minimal region of deletion at 12q22 between D12S377 (priximal) and D12S296 (distal). We have constructed a YAC contig map of a 3-cM region of this band between the proximal marker D12S101 and the distal marker D12S346, which contained the minimal region of deletion in GCTs. The map is composed of 53 overlapping YACs and 3 cosmids onto which 25 polymorphic and nonpolymorphic sequence-tagged sites (STSs) were placed in a unique order. The size of the minimal region of deletion was approximately 2 Mb from overlapping, nonchimeric YACs that spanned the region. We also developed a radiation hybrid (RH) map of the region between D12S101 and D12S346 containing 17 loci. The consensus order developed by RH mapping is in good agreement with the YAC STS-content map order. The RH map estimated the distance between D12S101 and D12S346 to be 246 cR{sub 8000} and the minimal region of deletion to be 141 cR{sub 8000}. In addition, four genes that were previously mapped to 12q22 have been excluded as candidate genes. The leads gained from the deletion mapping and physical maps should expedite the isolation and characterization of the TSG at 12q22. 35 refs., 4 figs., 2 tabs.

  17. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  18. DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

    Directory of Open Access Journals (Sweden)

    Hong Wei Yang

    2001-01-01

    Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

  19. Sulforaphane Reverses the Expression of Various Tumor Suppressor Genes by Targeting DNMT3B and HDAC1 in Human Cervical Cancer Cells

    Directory of Open Access Journals (Sweden)

    Munawwar Ali Khan

    2015-01-01

    Full Text Available Sulforaphane (SFN may hinder carcinogenesis by altering epigenetic events in the cells; however, its molecular mechanisms are unclear. The present study investigates the role of SFN in modifying epigenetic events in human cervical cancer cells, HeLa. HeLa cells were treated with SFN (2.5 µM for a period of 0, 24, 48, and 72 hours for all experiments. After treatment, expressions of DNMT3B, HDAC1, RARβ, CDH1, DAPK1, and GSTP1 were studied using RT-PCR while promoter DNA methylation of tumor suppressor genes (TSGs was studied using MS-PCR. Inhibition assays of DNA methyl transferases (DNMTs and histone deacetylases (HDACs were performed at varying time points. Molecular modeling and docking studies were performed to explore the possible interaction of SFN with HDAC1 and DNMT3B. Time-dependent exposure to SFN decreases the expression of DNMT3B and HDAC1 and significantly reduces the enzymatic activity of DNMTs and HDACs. Molecular modeling data suggests that SFN may interact directly with DNMT3B and HDAC1 which may explain the inhibitory action of SFN. Interestingly, time-dependent reactivation of the studied TSGs via reversal of methylation in SFN treated cells correlates well with its impact on the epigenetic alterations accumulated during cancer development. Thus, SFN may have significant implications for epigenetic based therapy.

  20. Loss of heterozygosity of CDKN2A (p16INK4a) and RB1 tumor suppressor genes in testicular germ cell tumors

    International Nuclear Information System (INIS)

    Vladusic, Tomislav; Hrascan, Reno; Pecina-Slaus, Nives; Vrhovac, Ivana; Gamulin, Marija; Franekic, Jasna; Kruslin, Bozo

    2010-01-01

    Testicular germ cell tumors (TGCTs) are the most frequent malignances in young adult men. The two main histological forms, seminomas and nonseminomas, differ biologically and clinically. pRB protein and its immediate upstream regulator p16INK4a are involved in the RB pathway which is deregulated in most TGCTs. The objective of this study was to evaluate the occurrence of loss of heterozygosity (LOH) of the CDKN2A (p16INK4a) and RB1 tumor suppressor genes in TGCTs. Forty TGCTs (18 seminomas and 22 nonseminomas) were analyzed by polymerase chain reaction using the restriction fragment length polymorphism or the nucleotide repeat polymorphism method. LOH of the CDKN2A was found in two (6%) out of 34 (85%) informative cases of our total TGCT sample. The observed changes were assigned to two (11%) nonseminomas out of 18 (82%) informative samples. Furthermore, LOH of the RB1 was detected in two (6%) out of 34 (85%) informative cases of our total TGCT sample. Once again, the observed changes were assigned to two (10.5%) nonseminomas out of 19 (86%) informative samples. Both LOHs of the CDKN2A were found in nonseminomas with a yolk sac tumor component, and both LOHs of the RB1 were found in nonseminomas with an embryonal carcinoma component. The higher incidence of observed LOH in nonseminomas may provide a clue to their invasive behavior

  1. Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage

    Directory of Open Access Journals (Sweden)

    María José Benítez-Galeano

    2015-07-01

    Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.

  2. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  3. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  4. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  5. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  6. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  7. Suppressor of Overexpression of CO 1 Negatively Regulates Dark-Induced Leaf Degreening and Senescence by Directly Repressing Pheophytinase and Other Senescence-Associated Genes in Arabidopsis.

    Science.gov (United States)

    Chen, Junyi; Zhu, Xiaoyu; Ren, Jun; Qiu, Kai; Li, Zhongpeng; Xie, Zuokun; Gao, Jiong; Zhou, Xin; Kuai, Benke

    2017-03-01

    Although the biochemical pathway of chlorophyll (Chl) degradation has been largely elucidated, how Chl is rapidly yet coordinately degraded during leaf senescence remains elusive. Pheophytinase (PPH) is the enzyme for catalyzing the removal of the phytol group from pheophytin a , and PPH expression is significantly induced during leaf senescence. To elucidate the transcriptional regulation of PPH , we used a yeast ( Saccharomyces cerevisiae ) one-hybrid system to screen for its trans-regulators. SUPPRESSOR OF OVEREXPRESSION OF CO 1 (SOC1), a key flowering pathway integrator, was initially identified as one of the putative trans-regulators of PPH After dark treatment, leaves of an SOC1 knockdown mutant ( soc1-6 ) showed an accelerated yellowing phenotype, whereas those of SOC1 -overexpressing lines exhibited a partial stay-green phenotype. SOC1 and PPH expression showed a negative correlation during leaf senescence. Substantially, SOC1 protein could bind specifically to the CArG box of the PPH promoter in vitro and in vivo, and overexpression of SOC1 significantly inhibited the transcriptional activity of the PPH promoter in Arabidopsis ( Arabidopsis thaliana ) protoplasts. Importantly, soc1-6 pph-1 (a PPH knockout mutant) double mutant displayed a stay-green phenotype similar to that of pph-1 during dark treatment. These results demonstrated that SOC1 inhibits Chl degradation via negatively regulating PPH expression. In addition, measurement of the Chl content and the maximum photochemical efficiency of photosystem II of soc1-6 and SOC1-OE leaves after dark treatment suggested that SOC1 also negatively regulates the general senescence process. Seven SENESCENCE-ASSOCIATED GENES ( SAGs ) were thereafter identified as its potential target genes, and NONYELLOWING1 and SAG113 were experimentally confirmed. Together, we reveal that SOC1 represses dark-induced leaf Chl degradation and senescence in general in Arabidopsis. © 2017 American Society of Plant Biologists. All

  8. Frequent loss of heterozygosity and altered expression of the candidate tumor suppressor gene 'FAT' in human astrocytic tumors

    International Nuclear Information System (INIS)

    Chosdol, Kunzang; Misra, Anjan; Puri, Sachin; Srivastava, Tapasya; Chattopadhyay, Parthaprasad; Sarkar, Chitra; Mahapatra, Ashok K; Sinha, Subrata

    2009-01-01

    We had earlier used the comparison of RAPD (Random Amplification of Polymorphic DNA) DNA fingerprinting profiles of tumor and corresponding normal DNA to identify genetic alterations in primary human glial tumors. This has the advantage that DNA fingerprinting identifies the genetic alterations in a manner not biased for locus. In this study we used RAPD-PCR to identify novel genomic alterations in the astrocytic tumors of WHO grade II (Low Grade Diffuse Astrocytoma) and WHO Grade IV (Glioblastoma Multiforme). Loss of heterozygosity (LOH) of the altered region was studied by microsatellite and Single Nucleotide Polymorphism (SNP) markers. Expression study of the gene identified at the altered locus was done by semi-quantitative reverse-transcriptase-PCR (RT-PCR). Bands consistently altered in the RAPD profile of tumor DNA in a significant proportion of tumors were identified. One such 500 bp band, that was absent in the RAPD profile of 33% (4/12) of the grade II astrocytic tumors, was selected for further study. Its sequence corresponded with a region of FAT, a putative tumor suppressor gene initially identified in Drosophila. Fifty percent of a set of 40 tumors, both grade II and IV, were shown to have Loss of Heterozygosity (LOH) at this locus by microsatellite (intragenic) and by SNP markers. Semi-quantitative RT-PCR showed low FAT mRNA levels in a major subset of tumors. These results point to a role of the FAT in astrocytic tumorigenesis and demonstrate the use of RAPD analysis in identifying specific alterations in astrocytic tumors

  9. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  10. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  11. Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

    Science.gov (United States)

    Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

    2013-08-30

    Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Amtyr1: characterization of a gene from honeybee (Apis mellifera) brain encoding a functional tyramine receptor.

    Science.gov (United States)

    Blenau, W; Balfanz, S; Baumann, A

    2000-03-01

    Biogenic amine receptors are involved in the regulation and modulation of various physiological and behavioral processes in both vertebrates and invertebrates. We have cloned a member of this gene family from the CNS of the honeybee, Apis mellifera. The deduced amino acid sequence is homologous to tyramine receptors cloned from Locusta migratoria and Drosophila melanogaster as well as to an octopamine receptor cloned from Heliothis virescens. Functional properties of the honeybee receptor were studied in stably transfected human embryonic kidney 293 cells. Tyramine reduced forskolin-induced cyclic AMP production in a dose-dependent manner with an EC50 of approximately 130 nM. A similar effect of tyramine was observed in membrane homogenates of honeybee brains. Octopamine also reduced cyclic AMP production in the transfected cell line but was both less potent (EC50 of approximately 3 microM) and less efficacious than tyramine. Receptor-encoding mRNA has a wide-spread distribution in the brain and subesophageal ganglion of the honeybee, suggesting that this tyramine receptor is involved in sensory signal processing as well as in higher-order brain functions.

  13. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  14. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  15. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  16. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  17. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  18. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  19. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  20. Proto-oncogene FBI-1 (Pokemon/ZBTB7A) Represses Transcription of the Tumor Suppressor Rb Gene via Binding Competition with Sp1 and Recruitment of Co-repressors*S⃞

    Science.gov (United States)

    Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook

    2008-01-01

    FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp –308 to –188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp –65 to –56) and GC-box 2 (bp –18 to –9), the latter of which is also bound by FBI-1. We found that FRE3 (bp –244 to –236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742

  1. Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.

    Directory of Open Access Journals (Sweden)

    Eunseong Kim

    Full Text Available Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV and bracovirus (BV. In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF. The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13 homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14 of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF.

  2. Genetic modelling of PIM proteins in cancer: proviral tagging, cooperation with oncogenes, tumor suppressor genes and carcinogens.

    Directory of Open Access Journals (Sweden)

    Enara eAguirre

    2014-05-01

    Full Text Available The PIM proteins, which were initially discovered as proviral insertion sites in Moloney murine leukemia virus infection, are a family of highly homologous serine/threonine kinases that have been reported to be overexpressed in hematological malignancies and solid tumors. The PIM proteins have also been associated with metastasis and overall treatment responses and implicated in the regulation of apoptosis, metabolism, the cell cycle, and homing and migration, which makes these proteins interesting targets for anticancer drug discovery. The use of retroviral insertional mutagenesis and refined approaches such as complementation tagging has allowed the identification of myc, pim and a third group of genes (including bmi1 and gfi1 as complementing genes in lymphomagenesis. Moreover, mouse modeling of human cancer has provided an understanding of the molecular pathways that are involved in tumor initiation and progression at the physiological level. In particular, genetically modified mice have allowed researchers to further elucidate the role of each of the Pim isoforms in various tumor types. PIM kinases have been identified as weak oncogenes because experimental overexpression in lymphoid tissue, prostate and liver induces tumors at a relatively low incidence and with a long latency. However, very strong synergistic tumorigenicity between Pim1/2 and c-Myc and other oncogenes has been observed in lymphoid tissues. Mouse models have also been used to study whether the inhibition of specific PIM isoforms is required to prevent carcinogen-induced sarcomas, indicating that the absence of Pim2 and Pim3 greatly reduces sarcoma growth and bone invasion; the extent of this effect is similar to that observed in the absence of all 3 isoforms. This review will summarize some of the animal models that have been used to understand the isoform-specific contribution of PIM kinases to tumorigenesis.

  3. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  4. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  5. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  6. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  7. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  8. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  9. The tumor suppressor homolog in fission yeast, myh1+, displays a strong interaction with the checkpoint gene rad1+

    International Nuclear Information System (INIS)

    Jansson, Kristina; Warringer, Jonas; Farewell, Anne; Park, Han-Oh; Hoe, Kwang-Lae; Kim, Dong-Uk; Hayles, Jacqueline; Sunnerhagen, Per

    2008-01-01

    The DNA glycosylase MutY is strongly conserved in evolution, and homologs are found in most eukaryotes and prokaryotes examined. This protein is implicated in repair of oxidative DNA damage, in particular adenine mispaired opposite 7,8-dihydro-8-oxoguanine. Previous investigations in Escherichia coli, fission yeast, and mammalian cells show an association of mutations in MutY homologs with a mutator phenotype and carcinogenesis. Eukaryotic MutY homologs physically associate with several proteins with a role in replication, DNA repair, and checkpoint signaling, specifically the trimeric 9-1-1 complex. In a genetic investigation of the fission yeast MutY homolog, myh1 + , we show that the myh1 mutation confers a moderately increased UV sensitivity alone and in combination with mutations in several DNA repair genes. The myh1 rad1, and to a lesser degree myh1 rad9, double mutants display a synthetic interaction resulting in enhanced sensitivity to DNA damaging agents and hydroxyurea. UV irradiation of myh1 rad1 double mutants results in severe chromosome segregation defects and visible DNA fragmentation, and a failure to activate the checkpoint. Additionally, myh1 rad1 double mutants exhibit morphological defects in the absence of DNA damaging agents. We also found a moderate suppression of the slow growth and UV sensitivity of rhp51 mutants by the myh1 mutation. Our results implicate fission yeast Myh1 in repair of a wider range of DNA damage than previously thought, and functionally link it to the checkpoint pathway

  10. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  11. Promoter hypermethylation contributes to frequent inactivation of a putative conditional tumor suppressor gene connective tissue growth factor in ovarian cancer.

    Science.gov (United States)

    Kikuchi, Ryoko; Tsuda, Hitoshi; Kanai, Yae; Kasamatsu, Takahiro; Sengoku, Kazuo; Hirohashi, Setsuo; Inazawa, Johji; Imoto, Issei

    2007-08-01

    Connective tissue growth factor (CTGF) is a secreted protein belonging to the CCN family, members of which are implicated in various biological processes. We identified a homozygous loss of CTGF (6q23.2) in the course of screening a panel of ovarian cancer cell lines for genomic copy number aberrations using in-house array-based comparative genomic hybridization. CTGF mRNA expression was observed in normal ovarian tissue and immortalized ovarian epithelial cells but was reduced in many ovarian cancer cell lines without its homozygous deletion (12 of 23 lines) and restored after treatment with 5-aza 2'-deoxycytidine. The methylation status around the CTGF CpG island correlated inversely with the expression, and a putative target region for methylation showed promoter activity. CTGF methylation was frequently observed in primary ovarian cancer tissues (39 of 66, 59%) and inversely correlated with CTGF mRNA expression. In an immunohistochemical analysis of primary ovarian cancers, CTGF protein expression was frequently reduced (84 of 103 cases, 82%). Ovarian cancer tended to lack CTGF expression more frequently in the earlier stages (stages I and II) than the advanced stages (stages III and IV). CTGF protein was also differentially expressed among histologic subtypes. Exogenous restoration of CTGF expression or treatment with recombinant CTGF inhibited the growth of ovarian cancer cells lacking its expression, whereas knockdown of endogenous CTGF accelerated growth of ovarian cancer cells with expression of this gene. These results suggest that epigenetic silencing by hypermethylation of the CTGF promoter leads to a loss of CTGF function, which may be a factor in the carcinogenesis of ovarian cancer in a stage-dependent and/or histologic subtype-dependent manner.

  12. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  13. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.

    Science.gov (United States)

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G

    1995-05-19

    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  14. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  15. Ring structure amino acids affect the suppressor activity of melon aphid-borne yellows virus P0 protein.

    Science.gov (United States)

    Han, Yan-Hong; Xiang, Hai-Ying; Wang, Qian; Li, Yuan-Yuan; Wu, Wen-Qi; Han, Cheng-Gui; Li, Da-Wei; Yu, Jia-Lin

    2010-10-10

    Melon aphid-borne yellows virus (MABYV) is a newly identified polerovirus occurring in China. Here, we demonstrate that the MABYV encoded P0 (P0(MA)) protein is a strong suppressor of post-transcriptional gene silencing (PTGS) with activity comparable to tobacco etch virus (TEV) HC-Pro. In addition we have shown that the LP F-box motif present at the N-terminus of P0(MA) is required for suppressor activity. Detailed mutational analyses on P0(MA) revealed that changing the conserved Trp 212 with non-ring structured amino acids altered silencing suppressor functions. Ala substitutions at positions 12 and 211 for Phe had no effect on P0 suppression-activity, whereas Arg and Glu substitutions had greatly decreased suppressor activity. Furthermore, substitutions targeting Phe at position 30 also resulted in reduced P0 suppression-activity. Altogether, these results suggest that ring structured Trp/Phe residues in P0 have important roles in suppressor activity. Copyright © 2010 Elsevier Inc. All rights reserved.

  16. Radiation of different human melanoma cell lines increased expression of RHOB. Level of this tumor suppressor gene in different cell lines

    International Nuclear Information System (INIS)

    Notcovich, C.; Molinari, B.; Duran, H.; Delgado González, D.; Sánchez Crespo, R.

    2013-01-01

    Previous results of our group show that a correlation exists between intrinsic radiosensitivity of human melanoma cells and cell death by apoptosis. RhoB is a small GTPase that regulates cytoskeletal organization. Besides, is related to the process of apoptosis in cells exposed to DNA damage as radiation. Also, RhoB levels decrease in a wide variety of tumors with the tumor stage, being considered a tumor suppressor gene due to its antiproliferative and proapoptotic effect. The aim of this study was to analyze the expression of RhoB in different human melanoma cell lines in relation to melanocytes, and evaluate the effect of gamma radiation on the expression of RhoB. We used the A375, SB2 and Meljcell lines, and the derived from melanocytes Pig1. It was found for all three tumor lines RhoB expression levels significantly lower than those of Pig1 (p <0.05), as assessed by semiquantitative RT-PCR . When tumor cells were irradiated to a dose of 2Gyinduction was observed at 3 hours RhoB irradiation. RhoB expression increased in all lines relative to non-irradiated control, showing a greater induction ( p< 0.05) for the more radiosensitive line SB2, consistent with apoptosis in response to radiation. The results allow for the first time in melanoma demonstrate that RhoB, as well as in other tumor types, has a lower expression in tumor cells than their normal counterparts. Moreover, induction in the expression of RhoB in irradiated cells may be associated with the process of radiation-induced apoptosis. The modulation of RhoB could be a new tool to sensitize radioresistant melanoma. (author)

  17. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  18. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  19. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  20. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  1. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  2. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  3. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  4. Metformin inhibits epithelial–mesenchymal transition in prostate cancer cells: Involvement of the tumor suppressor miR30a and its target gene SOX4

    International Nuclear Information System (INIS)

    Zhang, Jing; Shen, Chengwu; Wang, Lin; Ma, Quanping; Xia, Pingtian; Qi, Mei; Yang, Muyi; Han, Bo

    2014-01-01

    Highlights: • Metformin inhibits TGF-β-induced EMT in prostate cancer (PCa) cells. • Metformin upregulates tumor suppressor miR30a and downregulates SOX4 in PCa cells. • SOX4 is a target gene of miR30a. - Abstract: Tumor metastasis is the leading cause of mortality and morbidity of prostate cancer (PCa) patients. Epithelial–mesenchymal transition (EMT) plays a critical role in cancer progression and metastasis. Recent evidence suggested that diabetic patients treated with metformin have lower PCa risk and better prognosis. This study was aimed to investigate the effects of metformin on EMT in PCa cells and the possible microRNA (miRNA)-based mechanisms. MiRNAs have been shown to regulate various processes of cancer metastasis. We herein showed that metformin significantly inhibits proliferation of Vcap and PC-3 cells, induces G0/G1 cell cycle arrest and inhibits invasiveness and motility capacity of Vcap cells. Metformin could inhibit TGF-β-induced EMT in Vcap cells, as manifested by inhibition of the increase of N-cadherin (p = 0.013), Vimentin (p = 0.002) and the decrease of E-cadherin (p = 0.0023) and β-catenin (p = 0.034) at mRNA and protein levels. Notably, we demonstrated significant upregulation of miR30a levels by metformin (P < 0.05) and further experiments indicated that miR30a significantly inhibits proliferation and EMT process of Vcap cells. Interestingly, we identified that SOX4, a previously reported oncogenic transcriptional factor and modulator of EMT, is a direct target gene of miR30a. Finally, we screened the expression of miR30a and SOX4 in 84 PCa cases with radical prostatectomy. Of note, SOX4 overexpression is significantly associated with decreased levels of miR30a in PCa cases. In all, our study suggested that inhibition of EMT by metformin in PCa cells may involve upregulation of miR30a and downregulation of SOX4

  5. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  6. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  7. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  8. PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

    International Nuclear Information System (INIS)

    Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang

    2006-01-01

    HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties

  9. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  10. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  11. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  12. The tumor suppressor gene TRC8/RNF139 is disrupted by a constitutional balanced translocation t(8;22(q24.13;q11.21 in a young girl with dysgerminoma

    Directory of Open Access Journals (Sweden)

    Fiorio Patrizia

    2009-07-01

    Full Text Available Abstract Background RNF139/TRC8 is a potential tumor suppressor gene with similarity to PTCH, a tumor suppressor implicated in basal cell carcinomas and glioblastomas. TRC8 has the potential to act in a novel regulatory relationship linking the cholesterol/lipid biosynthetic pathway with cellular growth control and has been identified in families with hereditary renal (RCC and thyroid cancers. Haploinsufficiency of TRC8 may facilitate development of clear cell-RCC in association with VHL mutations, and may increase risk for other tumor types. We report a paternally inherited balanced translocation t(8;22 in a proposita with dysgerminoma. Methods The translocation was characterized by FISH and the breakpoints cloned, sequenced, and compared. DNA isolated from normal and tumor cells was checked for abnormalities by array-CGH. Expression of genes TRC8 and TSN was tested both on dysgerminoma and in the proposita and her father. Results The breakpoints of the translocation are located within the LCR-B low copy repeat on chromosome 22q11.21, containing the palindromic AT-rich repeat (PATRR involved in recurrent and non-recurrent translocations, and in an AT-rich sequence inside intron 1 of the TRC8 tumor-suppressor gene at 8q24.13. TRC8 was strongly underexpressed in the dysgerminoma. Translin is underexpressed in the dysgerminoma compared to normal ovary. TRC8 is a target of Translin (TSN, a posttranscriptional regulator of genes transcribed by the transcription factor CREM-tau in postmeiotic male germ cells. Conclusion A role for TRC8 in dysgerminoma may relate to its interaction with Translin. We propose a model in which one copy of TRC8 is disrupted by a palindrome-mediated translocation followed by complete loss of expression through suppression, possibly mediated by miRNA.

  13. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  14. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  15. Off and back-on again: a tumor suppressor's tale.

    Science.gov (United States)

    Acosta, Jonuelle; Wang, Walter; Feldser, David M

    2018-06-01

    Tumor suppressor genes play critical roles orchestrating anti-cancer programs that are both context dependent and mechanistically diverse. Beyond canonical tumor suppressive programs that control cell division, cell death, and genome stability, unexpected tumor suppressor gene activities that regulate metabolism, immune surveillance, the epigenetic landscape, and others have recently emerged. This diversity underscores the important roles these genes play in maintaining cellular homeostasis to suppress cancer initiation and progression, but also highlights a tremendous challenge in discerning precise context-specific programs of tumor suppression controlled by a given tumor suppressor. Fortunately, the rapid sophistication of genetically engineered mouse models of cancer has begun to shed light on these context-dependent tumor suppressor activities. By using techniques that not only toggle "off" tumor suppressor genes in nascent tumors, but also facilitate the timely restoration of gene function "back-on again" in disease specific contexts, precise mechanisms of tumor suppression can be revealed in an unbiased manner. This review discusses the development and implementation of genetic systems designed to toggle tumor suppressor genes off and back-on again and their potential to uncover the tumor suppressor's tale.

  16. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  17. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  18. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  19. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  20. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  1. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  2. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  3. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  4. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  5. Abnormalities in structure and expression of the retinoblastoma gene in small cell lung cancer cell lines and xenografts in nude mice

    DEFF Research Database (Denmark)

    Rygaard, K; Sorenson, G D; Pettengill, O S

    1990-01-01

    The putative retinoblastoma gene (Rb) is a tumor suppressor gene which is believed to cause retinoblastomas when both alleles are inactivated, leading to lack of the encoded Mr 110,000-116,000 phosphoprotein. Inactivation of the Rb gene has also been found in several other tumor types, including...

  6. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  7. P53 and Rb tumor suppressor gene alterations in gastric cancer Alterações dos genes supressores tumorais p53 e Rb no câncer gástrico

    Directory of Open Access Journals (Sweden)

    Rejane Mattar

    2004-01-01

    Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea

  8. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  9. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  10. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  11. Gene Discovery in Prostate Cancer: Functional Identification and Isolation of PAC-1, a Novel Tumor Suppressor Gene Within Chromosome 10p

    Science.gov (United States)

    1999-09-01

    I.. Zbar. B.. androle for the VHL gene in the development of hyperplasia in a number Lerman. I. I. Identification of the son Hippel-Lindau disease...of heterozy- gosity of chromosome 3p markers in small-cell lung cancer. Nature (Lond.). 329: eleguns produced hyperplasia in all tissues (26...central fibrovascular core lined by cuboidal tumor cells. Tumor weights were determined (Fig. 2d). At the end of 47 days after cells were

  12. A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

    NARCIS (Netherlands)

    Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.

    2000-01-01

    Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

  13. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  14. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

    Science.gov (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

    1993-09-15

    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  15. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

    Science.gov (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

    2014-12-13

    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  16. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  17. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  18. Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

    Science.gov (United States)

    Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

    2017-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  19. Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

    Science.gov (United States)

    Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

    2010-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  20. Identification of Two Suppressors of CSG2 Calcium Sensitivity, SCS7 and SUR2, as Genes Encoding Hydroxylases of the Sphingolipid Biosynthetic Pathway of Saccharomyces cerevisiae

    National Research Council Canada - National Science Library

    Haak, Dale A

    1997-01-01

    .... The biochemical significance of much of this structural variability is not well understood. The sphingolipids of the yeast Saccharomyces cerevisiae undergo the a-hydroxylation of the very long chain fatty acid (VLCFA...

  1. Cell size checkpoint control by the retinoblastoma tumor suppressor pathway.

    Science.gov (United States)

    Fang, Su-Chiung; de los Reyes, Chris; Umen, James G

    2006-10-13

    Size control is essential for all proliferating cells, and is thought to be regulated by checkpoints that couple cell size to cell cycle progression. The aberrant cell-size phenotypes caused by mutations in the retinoblastoma (RB) tumor suppressor pathway are consistent with a role in size checkpoint control, but indirect effects on size caused by altered cell cycle kinetics are difficult to rule out. The multiple fission cell cycle of the unicellular alga Chlamydomonas reinhardtii uncouples growth from division, allowing direct assessment of the relationship between size phenotypes and checkpoint function. Mutations in the C. reinhardtii RB homolog encoded by MAT3 cause supernumerous cell divisions and small cells, suggesting a role for MAT3 in size control. We identified suppressors of an mat3 null allele that had recessive mutations in DP1 or dominant mutations in E2F1, loci encoding homologs of a heterodimeric transcription factor that is targeted by RB-related proteins. Significantly, we determined that the dp1 and e2f1 phenotypes were caused by defects in size checkpoint control and were not due to a lengthened cell cycle. Despite their cell division defects, mat3, dp1, and e2f1 mutants showed almost no changes in periodic transcription of genes induced during S phase and mitosis, many of which are conserved targets of the RB pathway. Conversely, we found that regulation of cell size was unaffected when S phase and mitotic transcription were inhibited. Our data provide direct evidence that the RB pathway mediates cell size checkpoint control and suggest that such control is not directly coupled to the magnitude of periodic cell cycle transcription.

  2. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi

    2013-12-01

    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  3. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  4. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  5. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  6. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  7. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  8. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  9. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  11. Extravirgin olive oil up-regulates CB₁ tumor suppressor gene in human colon cancer cells and in rat colon via epigenetic mechanisms.

    Science.gov (United States)

    Di Francesco, Andrea; Falconi, Anastasia; Di Germanio, Clara; Micioni Di Bonaventura, Maria Vittoria; Costa, Antonio; Caramuta, Stefano; Del Carlo, Michele; Compagnone, Dario; Dainese, Enrico; Cifani, Carlo; Maccarrone, Mauro; D'Addario, Claudio

    2015-03-01

    Extravirgin olive oil (EVOO) represents the typical lipid source of the Mediterranean diet, an eating habit pattern that has been associated with a significant reduction of cancer risk. Diet is the more studied environmental factor in epigenetics, and many evidences suggest dysregulation of epigenetic pathways in cancer. The aim of our study was to investigate the effects of EVOO and its phenolic compounds on endocannabinoid system (ECS) gene expression via epigenetic regulation in both human colon cancer cells (Caco-2) and rats exposed to short- and long-term dietary EVOO. We observed a selective and transient up-regulation of CNR1 gene - encoding for type 1 cannabinoid receptor (CB₁) - that was evoked by exposure of Caco-2 cells to EVOO (100 ppm), its phenolic extracts (OPE, 50 μM) or authentic hydroxytyrosol (HT, 50 μM) for 24 h. None of the other major elements of the ECS (i.e., CB₂; GPR55 and TRPV1 receptors; and NAPE-PLD, DAGL, FAAH and MAGL enzymes) was affected at any time point. The stimulatory effect of OPE and HT on CB₁ expression was inversely correlated to DNA methylation at CNR1 promoter and was associated with reduced proliferation of Caco-2 cells. Interestingly, CNR1 gene was less expressed in Caco-2 cells when compared to normal colon mucosa cells, and again this effect was associated with higher level of DNA methylation at CNR1. Moreover, in agreement with the in vitro studies, we also observed a remarkable (~4-fold) and selective increase in CB₁ expression in the colon of rats receiving dietary EVOO supplementation for 10 days. Consistently, CpG methylation of rat Cnr1 promoter, miR23a and miR-301a, previously shown to be involved in the pathogenesis of colorectal cancer and predicted to target CB₁ mRNA, was reduced after EVOO administration down to ~50% of controls. Taken together, our findings demonstrating CB₁ gene expression modulation by EVOO or its phenolic compounds via epigenetic mechanism, both in vitro and in vivo, may

  12. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  13. Expression of genes encoding F-1-ATPase results in uncoupling of glycolysis from biomass production in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.

    2002-01-01

    of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...

  14. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    ). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  15. Restoration of tumor suppressor gene function by gene replacement or small molecule strategies for the treatment of small cell lung cancer

    DEFF Research Database (Denmark)

    Zandi, Roza

    2011-01-01

    markedly. PRIMA-1 Met also induced significant tumor growth delay in human SCLC mouse models without any signs of toxicity. These results suggest that PRIMA-1 Met can reactivate mutant p53 in SCLC cells, leading to the induction of apoptosis and tumor growth delay. To study the growth inhibitory effect......-mediated gene transfer in SCLC cells expressing various levels of endogenous FHIT protein. FHIT overexpression led to growth inhibition in all of the SCLC cell lines studied; although more effectively in cell lines with high levels of endogenous FHIT protein and transduction efficiency. FHIT-induced inhibition...... as potential therapeutic strategies for SCLC. However, as mutant p53 proteins tend to accumulate in SCLC cells, reintroduction of wild-type p53 may not be effective due to dominant-negative effects of the mutant protein. Therefore, a more effective approach would be to reactivate the endogenous mutant p53...

  16. A Drosophila gene encoding a protein resembling the human β-amyloid protein precursor

    International Nuclear Information System (INIS)

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K.

    1989-01-01

    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human β-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human β-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development

  17. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  18. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Science.gov (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  19. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil.

    Science.gov (United States)

    Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso

    2017-12-18

    Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

  20. Comparative structural and functional analysis of genes encoding pectin methylesterases in Phytophthora spp.

    Science.gov (United States)

    Mingora, Christina; Ewer, Jason; Ospina-Giraldo, Manuel

    2014-03-15

    We have scanned the Phytophthora infestans, P. ramorum, and P. sojae genomes for the presence of putative pectin methylesterase genes and conducted a sequence analysis of all gene models found. We also searched for potential regulatory motifs in the promoter region of the proposed P. infestans models, and investigated the gene expression levels throughout the course of P. infestans infection on potato plants, using in planta and detached leaf assays. We found that genes located on contiguous chromosomal regions contain similar motifs in the promoter region, indicating the possibility of a shared regulatory mechanism. Results of our investigations also suggest that, during the pathogenicity process, the expression levels of some of the analyzed genes vary considerably when compared to basal expression observed in in vitro cultures of non-sporulating mycelium. These results were observed both in planta and in detached leaf assays. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  2. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

    Science.gov (United States)

    Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

    2005-06-01

    Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

  3. Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus.

    Science.gov (United States)

    Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A

    1996-07-15

    The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

  4. Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

    Science.gov (United States)

    Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

    1999-04-16

    A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

  5. A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

    Science.gov (United States)

    Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

    1996-01-01

    we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

  6. Thermal response of rat fibroblasts stably transfected with the human 70-kDa heat shock protein-encoding gene

    International Nuclear Information System (INIS)

    Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.

    1991-01-01

    The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress

  7. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  8. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.

    2003-12-01

    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  9. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  10. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  11. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    Science.gov (United States)

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

  12. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  13. A highly divergent gene cluster in honey bees encodes a novel silk family

    OpenAIRE

    Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.

    2006-01-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-r...

  14. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  15. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  16. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway.

    Science.gov (United States)

    Bassler, B L; Wright, M; Silverman, M R

    1994-07-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

  17. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  18. Expression of the rgMT gene, encoding for a rice metallothionein ...

    Indian Academy of Sciences (India)

    the rice rgMT gene in transgenic yeast and Arabidopsis is implicated in improving their tolerance for .... possible by the use of a microscope with UV optics that ... Abiotic stress factors that induced the expression of the ..... Arabidopsis mutant.

  19. Cloning and expression of gene encoding P23 protein from Cryptosporidium parvum

    Directory of Open Access Journals (Sweden)

    Dinh Thi Bich Lan

    2014-12-01

    Full Text Available We cloned the cp23 gene coding P23 (glycoprotein from Cryptosporidium parvum isolated from Thua Thien Hue province, Vietnam. The coding region of cp23 gene from C. parvum is 99% similar with cp23 gene deposited in NCBI (accession number: U34390. SDS-PAGE and Western blot analysis showed that the cp23 gene in E. coli BL21 StarTM (DE3 produced polypeptides with molecular weights of approximately 37, 40 and 49 kDa. These molecules may be non-glycosylated or glycosylated P23 fusion polypeptides. Recombinant P23 protein purified by GST (glutathione S-transferase affinity chromatography can be used as an antigen for C. parvum antibody production as well as to develop diagnostic kit for C. parvum.

  20. Molecular cloning and expression of gene encoding aromatic amino acid decarboxylase in 'Vidal blanc' grape berries.

    Science.gov (United States)

    Pan, Qiu-Hong; Chen, Fang; Zhu, Bao-Qing; Ma, Li-Yan; Li, Li; Li, Jing-Ming

    2012-04-01

    The pleasantly fruity and floral 2-phenylethanol are a dominant aroma compound in post-ripening 'Vidal blanc' grapes. However, to date little has been reported about its synthetic pathway in grapevine. In the present study, a full-length cDNA of VvAADC (encoding aromatic amino acid decarboxylase) was firstly cloned from the berries of 'Vidal blanc', an interspecific hybrid variety of Vitis vinifera × Vitis riparia. This sequence encodes a complete open reading frame of 482 amino acids with a calculated molecular mass of 54 kDa and isoelectric point value (pI) of 5.73. The amino acid sequence deduced shared about 79% identity with that of aromatic L: -amino acid decarboxylases (AADCs) from tomato. Real-time PCR analysis indicated that VvAADC transcript abundance presented a small peak at 110 days after full bloom and then a continuous increase at the berry post-ripening stage, which was consistent with the accumulation of 2-phenylethanol, but did not correspond to the trends of two potential intermediates, phenethylamine and 2-phenylacetaldehyde. Furthermore, phenylalanine still exhibited a continuous increase even in post-ripening period. It is thus suggested that 2-phenylethanol biosynthetic pathway mediated by AADC exists in grape berries, but it has possibly little contribution to a considerable accumulation of 2-phenylethanol in post-ripening 'Vidal blanc' grapes.

  1. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  2. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

    Science.gov (United States)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi

    2013-03-01

    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  3. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  4. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  5. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis.

    Science.gov (United States)

    Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael

    2009-08-01

    Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

  6. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  7. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  8. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

    Science.gov (United States)

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  9. Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans

    Directory of Open Access Journals (Sweden)

    Chen Xu

    2016-09-01

    Full Text Available The 2-C-methyl-d-erythritol 4-phosphate (MEP pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans. Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these