
Sample records for superpave binder specifications

  1. Implementation of the SuperPave IDT Analysis Procedure

    DEFF Research Database (Denmark)

    Du, Guangli

    framework, which is used to characterize the fracture resistance of mixtures based on the SuperPave indirect tensile test (IDT). An open source Matlab-based software for analyzing resilient modulus, Poisson’s ratio, creep parameters and fracture resistance parameters has been developed. The software...

  2. The Effect of High RAP and High Asphalt Binder Content on the Dynamic Modulus and Fatigue Resistance of Asphalt Concrete


    Tomlinson, Christopher


    This thesis investigates the effects of using various percentages of RAP and asphalt binder contents on the dynamic modulus and fatigue resistance of asphalt concrete. Two RAP percentages (20% and 40%) and three binder percentages (plant-mixed, plant-mixed + 0.5%, and plant-mixed + 1.0%) were evaluated. A Superpave gyratory compactor and an asphalt vibratory compactor were used to prepare dynamic modulus samples and fatigue beam samples at 7% air voids. Three replicate samples for each percen...

  3. Effects of Sasobit® content on the rheological characteristics of unaged and aged asphalt binders at high and intermediate temperatures

    Directory of Open Access Journals (Sweden)

    Ali Jamshidi


    Full Text Available This paper describes the rheological properties of PG64, PG70, and PG76 asphalt binders blended with different Sasobit® contents. The rheological properties of the Sasobit®-modified binders were characterized after being subjected to different aging conditions using the dynamic shear rheometer (DSR and rotational viscometer (RV according to SuperpaveTM test protocols. The results indicated that the characterization of aging in terms of the Aging Index (AI depends on the rheological property of the asphalt binder selected for use in evaluating aging, the amount of Sasobit®, the binder type, and the temperature range. Linear relationships between failure temperatures of unaged and short-term-aged asphalt were observed for three binder types. Design charts were developed to select the appropriate Sasobit® content as a function of temperature, taking into consideration the stiffening effects of Sasobit®, using the SuperpaveTM fatigue factor and asphalt mix construction temperatures.

  4. Utilisation of antibody microarrays for the selection of specific and informative antibodies from recombinant library binders of unknown quality

    DEFF Research Database (Denmark)

    Kibat, Janek; Schirrmann, Thomas; Knape, Matthias J


    Many diagnostic and therapeutic concepts require antibodies of high specificity. Recombinant binder libraries and related selection approaches allow the efficient isolation of antibodies against almost every target of interest. Nevertheless, it cannot be guaranteed that selected antibodies perform...... reducing the effort of antibody characterisation by concentrating on relevant molecules. In a pilot scheme, a library of 456 single-chain variable fragment (scFv) binders to 134 antigens was used. They were arranged in a microarray format and incubated with the protein content of clinical tissue samples...

  5. Estudo de misturas asfálticas com ligante modificado pelo polímero EVA para pavimentos urbanos de Manaus - AM Study of asphalt mixtures containing a binder modified with EVA polymer for use in urban pavements in Manaus

    Directory of Open Access Journals (Sweden)

    Daniela M. G. D'Antona


    Full Text Available A presente pesquisa buscou soluções com materiais alternativos visando à construção de pavimentos urbanos para Manaus (AM com maior vida útil e condizente com as suas condições de serviço, em particular, o seu desempenho mecânico frente às temperaturas regionais. Estudou-se o ligante regional, CAP 50/70, misturado com 4% do polímero EVA, e como partícipe em compósitos asfálticos. A incorporação do mencionado polímero teve como objetivo melhorar suas propriedades reológicas e, por conseguinte, o comportamento mecânico desse compósito - concreto asfáltico, empregado como revestimento nas vias urbanas da Capital do Estado do Amazonas. Os ligantes (virgem e modificado foram caracterizados conforme a especificação da ANP e a metodologia Superpave. As misturas asfálticas foram avaliadas pelo ensaio de fluência por compressão axial, com carregamento dinâmico à temperatura de 40 ºC. O material asfáltico modificado com EVA (AMP EVA demonstrou melhores propriedades reológicas ou equivalentes ao asfalto convencional (REMAN, ao longo de todos os ensaios de caracterização. As misturas alternativas compostas com o CAP modificado (SEVA obtiveram desempenho mecânico superior ao de misturas com cimento asfáltico habitualmente comercializado na região (SMAN.In this research we investigated alternative materials to build urban pavements in Manaus, seeking for pavements with longer lifetime for usage and suitable mechanical properties to withstand the local temperatures. The asphaltic mixtures contained a regional binder, namely CAP 50/70, mixed with 4% of EVA polymer. The incorporation of the latter polymer was aimed at improving the rheological properties of asphaltic concrete used in roads in the Amazonas' capital. The asphalt binders (original and modified were characterized in accordance with the ANP (National Petroleum Agency specification and the Superpave methodology. The asphalt mixtures had their mechanical properties


    Directory of Open Access Journals (Sweden)

    Carlos Rodolfo Marín Uribe


    products is the Superpave system (Superior Performance Asphalt Pavements. In 1996, Colombia changed the specifications for road constructions and introduced requirements on the control of construction processes but without modifying the appreciable way of designing hot mixtures. This article shows the results of a research that aimed at studying one of the many aspects that inspect the performance of asphalt mixtures; this aspect is the mixture design because it is considered to be the stage where one can completely analyze the constitutive materials and the mixtures themselves in order to predict, with a higher rate of certainty, their performance in a construction work under determined conditions of traffic, climate and structural support. Then the article compares de dynamics modulus obtained from sample of asphalt mixtures through two different methodologies: Marshall and Superpave. The first one is traditional in Colombia while the second has not been a successful new alternative in our country yet.

  7. Detection of seasonal H3N2 influenza A virus by type-specific TaqMan minor groove binder probe assay (United States)

    Wang, Ruixue; Schwartzman, Louis M.; Memoli, Matthew J.; Taubenberger, Jeffery K.


    Despite the emergence of the pandemic H1N1 influenza A virus in 2009, seasonal H3N2 viruses continue to co-circulate in the population, and may even predominate in the coming influenza season. We describe a specific minor groove binder Taqman assay for H3N2 viruses with a detection limit of 16.5 standard DNA copies. PMID:21429691

  8. Rheological evaluation of polymer-modified asphalt binders

    Directory of Open Access Journals (Sweden)

    Mônica Romero Santos Fernandes


    Full Text Available Currently, the most used polymer for asphalt binder modification is the thermoplastic elastomer styrene butadiene styrene (SBS and aromatic oil is commonly added to the mixtures to improve their compatibly. This paper proposes the use of oil shale from sedimentary rock as a compatibilizer agent for polymer-modified asphalt binder (PMB. PMBs were produced by mixing a bitumen with a linear SBS copolymer (3.5% (w.w-1 using two oil shale contents (2 and 4% and petroleum aromatic oil to evaluate comparatively the effect of the compatibilizer agent on the SBS PMB properties. The rheological characteristics of the SBS PMBs were analyzed in a dynamic shear rheometer (DSR and the morphology accessed by fluorescence optical microscopy. The viscoelastic behavior of the samples corroborated the results for the classical properties and varied according to the sample morphology and composition. The results indicate that the aromatic and shale oils have similar effects on the microstructure, storage stability and viscoelastic behavior of the PMBs. Thus, shale oil could be successfully used as a compatibilizer agent without loss of properties or could even replace the aromatic oil. Following the Superpave methodology it was observed that the linear- and radial-SBS PMBs and linear-SBS PMB with 2% of shale oil can be used up to 70 °C, and the linear-SBS PMBs with 4% of shale oil or 2% of aromatic oil can be used only up to 64 °C.

  9. Metal-phosphate binders (United States)

    Howe, Beth Ann [Lewistown, IL; Chaps-Cabrera, Jesus Guadalupe [Coahuila, MX


    A metal-phosphate binder is provided. The binder may include an aqueous phosphoric acid solution, a metal-cation donor including a metal other than aluminum, an aluminum-cation donor, and a non-carbohydrate electron donor.

  10. Anionic surface binders

    Directory of Open Access Journals (Sweden)

    Aljaž-Rožič Mateja


    Full Text Available The MELAMIN Chemical Factory in Kočevje manufactures synthetic resins and binders for the paper industry. Binders based on AKD (alkyl ketene dimer are produced which are used for binding paper and cardboard in the range of neutral and partially basic pH. Cationic and, lately, anionic binders are mostly used for the bulk binding of paper and board. The possibility of using AKD binders on paper or board surfaces is presented. In this case partially cationic AKD binders may be applied. When optical whiteners are used, the application of AKD binders is recommended. In the case of paper it is possible to substitute acrylate binders by AKD binders. The best results are obtained when the paper is first partly treated in bulk and subsequently surface treated.

  11. Increase in composite binder activity (United States)

    Fediuk, R.; Smoliakov, A.; Stoyushko, N.


    The binder of portland cement (51-59 wt.%), fly ash of thermal power stations (3644 wt.%), limestone crushing waste (4-9 wt.%) and dry hyper plasticizer (0.2 wt.%) has been created. It can be used in the building materials industry for production of high-strength concrete. The composite binder is obtained by co-milling of the components in vario-planetary mill to a specific surface area of 550-600 m2/kg. The technical result is the possibility of obtaining a composite binder with significant replacement of cement with industrial waste, cost-effective and superior to portland cement for construction and technical properties, increased activity. This allows producing concrete for walling with a compressive strength of 100 MPa, while using more than 50% of industrial waste.


    Directory of Open Access Journals (Sweden)

    Carlos Rodolfo Marín Uribe


    Full Text Available El programa SHRP (Strategic Higway Research Program a través del nuevo método de diseño de mezclas asfálticas en caliente 'Superpave', ha impulsado el desarrollo de investigaciones con el fin de obtener mezclas asfálticas más durables, resistentes y en general, que muestren un comportamiento superior como su nombre lo indica. Entonces, es importante conocer los estados de esfuerzos y deformaciones que se producen al modelar una estructura de pavimento con capas de rodadura, compuestas con mezclas asfálticas diseñadas por métodos distintos (Marshall y Superpave y, por supuesto, con una caracterización dinámica diferente (leyes de fatiga, módulos dinámicos y respuesta al ahuellamiento. Esta modelación permite tener una idea general de la capacidad estructural para soportar el tránsito durante su vida útil representada en el valor de N (Número de ejes equivalentes de carga y quizá obtener algunos indicios de posibles ahorros en costos de conservación de los pavimentos, razones fundamentales para apoyar e incentivar la implementación del método Superpave como nuevo diseño de las mezclas asfálticas en caliente.The SHRP (Strategic Highway Research Program through the new design method of hot asphalt mixtures 'Superpave' has promoted the development of researches in order to get more durable and resistant asphalt mixtures that show a superior performance. Then, it is important to know the effort and deformation condition that are produced when modeling a pavement structure with asphalt layers made up of asphalt mixtures designed with different methods (Marshall and Superpave and therefore, with a different dynamic characterization (fatigue laws, dynamic modules, and deterioration answers. This modeling allows us to have a general idea of the structural capacity to endure traffic throughout its life cycle represented by N value (Number of equivalent loads axis and perhaps to obtain some hints of possible savings in pavement

  13. Optimization of Binder Jetting Using Taguchi Method (United States)

    Shrestha, Sanjay; Manogharan, Guha


    Among several additive manufacturing (AM) methods, binder-jetting has undergone a recent advancement in its ability to process metal powders through selective deposition of binders on a powder bed followed by curing, sintering, and infiltration. This study analyzes the impact of various process parameters in binder jetting on mechanical properties of sintered AM metal parts. The Taguchi optimization method has been employed to determine the optimum AM parameters to improve transverse rupture strength (TRS), specifically: binder saturation, layer thickness, roll speed, and feed-to-powder ratio. The effects of the selected process parameters on the TRS performance of sintered SS 316L samples are studied with the American Society of Testing Materials (ASTM) standard test method. It was found that binder saturation and feed-to-powder ratio were the most critical parameters, which reflects the strong influence of binder powder interaction and density of powder bed on resulting mechanical properties. This article serves as an aid in understanding the optimum process parameters for binder jetting of SS 316L.

  14. Optimization of Binder Jetting Using Taguchi Method (United States)

    Shrestha, Sanjay; Manogharan, Guha


    Among several additive manufacturing (AM) methods, binder-jetting has undergone a recent advancement in its ability to process metal powders through selective deposition of binders on a powder bed followed by curing, sintering, and infiltration. This study analyzes the impact of various process parameters in binder jetting on mechanical properties of sintered AM metal parts. The Taguchi optimization method has been employed to determine the optimum AM parameters to improve transverse rupture strength (TRS), specifically: binder saturation, layer thickness, roll speed, and feed-to-powder ratio. The effects of the selected process parameters on the TRS performance of sintered SS 316L samples are studied with the American Society of Testing Materials (ASTM) standard test method. It was found that binder saturation and feed-to-powder ratio were the most critical parameters, which reflects the strong influence of binder powder interaction and density of powder bed on resulting mechanical properties. This article serves as an aid in understanding the optimum process parameters for binder jetting of SS 316L.

  15. HMX/TATB/binder development

    Energy Technology Data Exchange (ETDEWEB)

    Stallings, T.L.; Osborn, A.G.; Schaffer, C.L.; Crutchmer, J.A.


    The processing and sensitivity characteristics of three HMX/TATB/Binder formulations were investigated. Viton A, Kraton G 1650, and Estane 5702-F1 binders were studied. The thermal stabilities of these compositions are near those of HMX/binder formulations, whereas impact, skid and friction sensitivity levels are less than HMX compositions, but greater than those of TATB/binder systems.

  16. Evaluating the Superpave Option in Unified Facilities Guide Specification 32-12-15.13, Hot Mix Asphalt Airfield Paving (United States)


    than with the manual Marshall compaction. Four of the six SGC specimens were tested in the APA . The test temperature was set to 64°C, the high PG...Approved for public release; distribution is unlimited. The U.S. Army Engineer Research and Development Center (ERDC) solves the nation’s...resources, and environmental sciences for the Army, the Department of Defense, civilian agencies, and our nation’s public good. Find out more at

  17. Binder content influences on chloride ingress in concrete

    Energy Technology Data Exchange (ETDEWEB)

    Dhir, R.K.; Jones, M.R.; McCarthy, M.J. [Univ. of Dundee (United Kingdom)


    The reported study looked at the effect of reducing free water contents, and thereby binder contents, and thereby binder contents, on the ingress of chloride in concrete. Concretes with equal water/binder ratio (and design strength), but with water contents reduced by up to 30 liters/m{sup 3}, were tested for chloride diffusion (D) and penetration. The quality of the microstructure was inferred from initial surface absorption tests (ISAT). The results show no practical difference in chloride durability between the corresponding concretes, and that reducing the binder content, (providing that the water/binder ratio is maintained) is not likely to be detrimental. However, the results reported underline the importance of binder type, in this case PFA. Implications of the results are discussed and, in light of the findings, whether specifications which demand minimum cement contents are justified.

  18. Breakpoint or Binder

    NARCIS (Netherlands)

    dr. Gürkan Çelik


    Civil society as a social sphere is constantly subjected to change. Using the Dutch context, this article addresses the question whether religiously inspired engagement is a binder or a breakpoint in modern societies. The author examines how religiously inspired people in the Netherlands involve the

  19. Effects of binders on the performance of electric double-layer capacitors of carbon nanotube electrodes

    Institute of Scientific and Technical Information of China (English)

    LI Chensha; WANG Dazhi; ZHANG Baoyou; WANG Xiaofeng; CAO Maosheng; LIANG Ji


    Polarizable electrodes of electric double layer capacitor (EDLCs) were made from carhon nanotubes. Effects of different binders, which are phenolic resin (PF) and polytetrafluoroethylene (PTFE), on the properties of polarizable electrodes are studied. Results indicate that the microstructure, pore size distribution and specific capacitance of the electrodes with PTFE binder are superior to those electrodes with PF binder after carbonization. The suitable binder (PTFE) for carbon nanotubes electrodes is proposed.

  20. Phosphate binders in chronic kidney disease: a systematic review of recent data. (United States)

    Floege, Jürgen


    Hyperphosphatemia is common in chronic kidney disease (CKD) and is treated by dietary measures, dialysis techniques and/or phosphate binders. For the present review PubMed was searched for new publications on phosphate binders appearing between January 2010 and October 2015. This review summarizes the latest information on non-pharmacological measures and their problems in lowering phosphate in CKD patients, effects of phosphate binders on morbidity and mortality, adherence to phosphate binder therapy as well as new information on specific aspects of the various phosphate binders on the market: calcium acetate, calcium carbonate, magnesium-containing phosphate binders, polymeric phosphate binders (sevelamer, bixalomer, colestilan), lanthanum carbonate, ferric citrate, sucroferric oxyhydroxide, aluminum-containing phosphate binders, and new compounds in development. The review also briefly covers the emerging field of drugs targeting intestinal phosphate transporters.

  1. Assessment of low temperature cracking in asphalt pavement mixes and rheological performance of asphalt binders (United States)

    Sowah-Kuma, David

    Government spends a lot of money on the reconstruction and rehabilitation of road pavements in any given year due to various distresses and eventual failure. Low temperature (thermal) cracking, one of the main types of pavement distress, contributes partly to this economic loss, and comes about as a result of accumulated tensile strains exceeding the threshold tensile strain capacity of the pavement. This pavement distress leads to a drastic reduction of the pavement's service life and performance. In this study, the severity of low temperature (thermal) cracking on road pavements selected across the Province of Ontario and its predicted time to failure was assessed using the AASTHO Mechanistic-Empirical Pavement Design Guide (MEPDG) and AASHTOWARE(TM) software, with inputs such as creep compliance and tensile strength from laboratory test. Highway 400, K1, K2, Y1, Sasobit, Rediset LQ, and Rediset WMX were predicted to have a pavement in-service life above 15 years. Additionally, the rheological performance of the recovered asphalt binders was assessed using Superpave(TM) tests such as the dynamic shear rheometer (DSR) and bending beam rheometer (BBR). Further tests using modified standard protocols such as the extended bending beam rheometer (eBBR) (LS-308) test method and double-edge notched tension (DENT) test (LS-299) were employed to evaluate the failure properties associated with in service performance. The various rheological tests showed K1 to be the least susceptible to low temperature cracking compared to the remaining samples whiles Highway 24 will be highly susceptible to low temperature cracking. X-ray fluorescence (XRF) analysis was performed on the recovered asphalt binders to determine the presence of metals such as zinc (Zn) and molybdenum (Mo) believed to originate from waste engine oil, which is often added to asphalt binders. Finally, the severity of oxidative aging (hardening) of the recovered asphalt binders was also evaluated using the

  2. Hygroscopicity -resistant mechanism of an α -starch based composite binder for dry sand molds and cores

    Directory of Open Access Journals (Sweden)

    Xia ZHOU


    Full Text Available Hygroscopicity-resistance of an α-starch based composite binder for dry sand molds (cores has been studied experimentally and theoretically. Focus is placed on the relationship between the hardening structure and humidity-resistance of the composite binder. The results show that the α-starch composite binder has good humidity-resistance due to its special complex structure. SEM observations illustrate that the composite binder consists of reticular matrix and a ball- or lump-shaped reinforcement phase, and the specific property of the binding membrane with heterogeneous structure is affected by humidity to a small extent. Based on the analyses on the interplays of different ingredients in the binder at hardening, the structure model and hygroscopicity-resistant mechanisms of the hardening composite binder were further proposed. Moreover, the reasons for good humidity-resistance of the composite binder bonded sand are well explained by the humidity-resistant mechanisms.

  3. Composite binders for concrete with reduced permeability (United States)

    Fediuk, R.; Yushin, A.


    Composite binder consisting of cement (55%), acid fly ash (40%) and limestone (5%) has been designed. It is obtained by co-milling to a specific surface of 550 kg/m2, it has an activity of 77.3 MPa and can produce a more dense cement stone structure. Integrated study revealed that the concrete on the composite binder basis provides an effective diffusion coefficient D. So we can conclude that the concrete layer protects buildings from toxic effects of expanded polystyrene. Low water absorption of the material (2.5% by weight) is due to the structure of its cement stone pore space. Besides lime powder prevents the penetration of moisture, reduces water saturation of the coverage that has a positive effect on useful life period. It also explains rather low water vapor permeability of the material - 0.021 mg/(m- hour-Pa).

  4. Viscoelastic models for explosive binder materials

    Energy Technology Data Exchange (ETDEWEB)

    Bardenhagen, S.G.; Harstad, E.N.; Maudlin, P.J.; Gray, G.T. [Los Alamos National Lab., NM (United States); Foster, J.C. Jr. [Wright Lab., Eglin AFB, FL (United States)


    An improved model of the mechanical properties of the explosive contained in conventional munitions is needed to accurately simulate performance and accident scenarios in weapons storage facilities. A specific class of explosives can he idealized as a mixture of two components: energetic crystals randomly suspended in a polymeric matrix (binder). Strength characteristics of each component material are important in the macroscopic behavior of the composite (explosive). Of interest here is the determination of an appropriate constitutive law for a polyurethane binder material. This paper is a continuation of previous work in modeling polyurethane at moderately high strain rates and for large deformations. Simulation of a large deformation (strains in excess of 100%) Taylor Anvil experiment revealed numerical difficulties which have been addressed. Additional experimental data have been obtained including improved resolution Taylor Anvil data, and stress relaxation data at various strain rates. A thorough evaluation of the candidate viscoelastic constitutive model is made and possible improvements discussed.

  5. Interaction nonlinearity in asphalt binders (United States)

    Motamed, Arash; Bhasin, Amit; Liechti, Kenneth M.


    Asphalt mixtures are complex composites that comprise aggregate, asphalt binder, and air. Several research studies have shown that the mechanical behavior of the asphalt mixture is strongly influenced by the matrix, i.e. the asphalt binder. Characterization and a thorough understanding of the binder behavior is the first and crucial step towards developing an accurate constitutive model for the composite. Accurate constitutive models for the constituent materials are critical to ensure accurate performance predictions at a material and structural level using micromechanics. This paper presents the findings from a systematic investigation into the nature of the linear and nonlinear response of asphalt binders subjected to different types of loading using the Dynamic Shear Rheometer (DSR). Laboratory test data show that a compressive normal force is generated in an axially constrained specimen subjected to torsional shear. This paper investigates the source of this normal force and demonstrates that the asphalt binder can dilate when subjected to shear loads. This paper also presents the findings from a study conducted to investigate the source of the nonlinearity in the asphalt binder. Test results demonstrate that the application of cyclic shear loads results in the development of a normal force and a concomitant reduction in the dynamic shear modulus. This form of nonlinear response is referred to as an "interaction nonlinearity". A combination of experimental and analytical tools is used to demonstrate and verify the presence of this interaction nonlinearity in asphalt binders. The findings from this study highlight the importance of modeling the mechanical behavior of asphalt binders based on the overall stress state of the material.

  6. Establishment of a minor groove binder-probe based quantitative real time PCR to detect Borrelia burgdorferi sensu lato and differentiation of Borrelia spielmanii by ospA-specific conventional PCR

    Directory of Open Access Journals (Sweden)

    Strube Christina


    Full Text Available Abstract Background Borrelia burgdorferi sensu lato (sl, the causative agent of Lyme borreliosis, is transmitted by ticks of the genus Ixodes as vector. For identification of Borrelia infections in ticks a TaqMan™ minor groove binder (MGB probe-based quantitative real time PCR (qPCR was established targeting the 5S-23S intergenic spacer. Extension to a duplex qPCR included an Ixodes spp. positive control to verify successful DNA isolation. Besides qPCR, an ospA-specific conventional PCR for species-specific identification of B. spielmanii was established. Afterwards 1000 I. ricinus flagged in the city of Hanover, Germany, were investigated for B. burgdorferi sl infections followed by species identification. Furthermore, I. hexagonus ticks were investigated to proof applicability of the PCRs. Results Quantitative real time PCR (qPCR identifying B. burgdorferi sl in ticks was able to detect 1-10 copies per reaction. B. spielmanii ospA-specific conventional PCR was also highly specific and showed no cross reactions with the other tested Borrelia species. From 1000 hanoveranian ticks 24.3% were positive compared to only 7.4% positives by dark-field microscopy. Related to tick stage 1.7% larvae, 18.1% nymphs, and 34.6% adults were positive. The most frequent species was B. garinii, followed by B. afzelii, B. spielmanii, B. valaisiana and B. burgdorferi sensu stricto (ss. 70.6% of I. ricinus were mono-infected, whereas 28.0% and 1.4% were infected with two and three Borrelia species, respectively. From 232 I. hexagonus collected from hedgehogs in different sites of Germany, qPCR detected 5.7% to be infected with B. burgdorferi sl, which were identified as B. afzelii, B. garinii and B. spielmanii. Conclusions The evaluated qPCR to detect B. burgdorferi sl in Ixodes spp. is highly specific and sensitive. As a duplex qPCR including detection of Ixodes spp. DNA it is the first DNA based technique incorporating a control for successful DNA isolation from

  7. Electrochemical components employing polysiloxane-derived binders (United States)

    Delnick, Frank M.


    A processed polysiloxane resin binder for use in electrochemical components and the method for fabricating components with the binder. The binder comprises processed polysiloxane resin that is partially oxidized and retains some of its methyl groups following partial oxidation. The binder is suitable for use in electrodes of various types, separators in electrochemical devices, primary lithium batteries, electrolytic capacitors, electrochemical capacitors, fuel cells and sensors.

  8. Heat-resistant inorganic binders.

    Directory of Open Access Journals (Sweden)

    KUDRYAVTSEV Pavel Gennadievich,


    Full Text Available The authors consider some aspects of production of inorganic heat-resistant composite materials in which new classes of inorganic binders - the basic salts of various metals – are applied. The possibility to use hydroxochlorides and hydroxonitrates of aluminum, zirconium, chromium and a number of other metals as the binder has been shown. The main products of the thermal decomposition of all types of binders discussed in this paper are nano-dispersed highly refractory oxides. Increased pressure in the manufacture of these materials shifts the position of the minimum of the dependence «production strength – production temperature» in the direction of low temperatures. This effect is caused by decreased film thickness of the binder located between filler particles and hence by increased rate of transfer of the matter to the interface and by facilitated sintering process. Materials based on the systems containing chromium and some other elements in transitional oxidation states are colour. For this reason, they have the worst thermal conductivity under the same heat resistance compared to colorless materials.

  9. The Influence of Wall Binders

    DEFF Research Database (Denmark)

    Rose, Jørgen


    This report is an analysis of the thermal bridge effects that occur in wall binders in masonry buildings. The effects are analyzed using a numerical calculation programme.The results are compared to the values given in the danish standard, DS418....

  10. DNA complexes: Durable binders (United States)

    Urbach, Adam R.


    A tetra-intercalator compound that threads through a DNA double-helix to form a remarkably stable complex exhibits an unusual combination of sequence specificity and rapid association yet slow dissociation.

  11. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study. (United States)

    Kittler, L; Baguley, B C; Löber, G; Waring, M J


    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  12. In silico design of smart binders to anthrax PA (United States)

    Sellers, Michael; Hurley, Margaret M.


    The development of smart peptide binders requires an understanding of the fundamental mechanisms of recognition which has remained an elusive grail of the research community for decades. Recent advances in automated discovery and synthetic library science provide a wealth of information to probe fundamental details of binding and facilitate the development of improved models for a priori prediction of affinity and specificity. Here we present the modeling portion of an iterative experimental/computational study to produce high affinity peptide binders to the Protective Antigen (PA) of Bacillus anthracis. The result is a general usage, HPC-oriented, python-based toolkit based upon powerful third-party freeware, which is designed to provide a better understanding of peptide-protein interactions and ultimately predict and measure new smart peptide binder candidates. We present an improved simulation protocol with flexible peptide docking to the Anthrax Protective Antigen, reported within the context of experimental data presented in a companion work.

  13. Permeability analysis for thermal binder removal from green ceramic bodies (United States)

    Yun, Jeong Woo


    The permeability of unlaminated and laminated green tapes was determined as a function of binder content for binder removed by air oxidation. The tapes are comprised of barium titanate as the dielectric, and polyvinyl butyral and dioctyl phthalate as the main compoents of the binder mixture. The flow in porous media through the tapes was analyzed in terms of models for describing Knudsen, slip, and Poiseuille flow mechanisms. The characteristic pore size was determined to be 0.5-2 mum and thus Poiseuille flow was the dominant transport mechanism contributing to the flux. The permeability was then determined from Darcy's law for flow in porous media. The permeability was also determined from micro-structural attributes in terms of the specific surface, the pore fraction, and terms to account for tortuosity and constrictions. The permeability and adhesion strength of laminated green ceramic tapes were determined as a function of lamination conditions of time, temperature, and pressure.

  14. Observation of asphalt binder microstructure with ESEM. (United States)

    Mikhailenko, P; Kadhim, H; Baaj, H; Tighe, S


    The observation of asphalt binder with the environmental scanning electron microscope (ESEM) has shown the potential to observe asphalt binder microstructure and its evolution with binder aging. A procedure for the induction and identification of the microstructure in asphalt binder was established in this study and included sample preparation and observation parameters. A suitable heat-sampling asphalt binder sample preparation method was determined for the test and several stainless steel and Teflon sample moulds developed, finding that stainless steel was the preferable material. The magnification and ESEM settings conducive to observing the 3D microstructure were determined through a number of observations to be 1000×, although other magnifications could be considered. Both straight run binder (PG 58-28) and an air blown oxidised binder were analysed; their structures being compared for their relative size, abundance and other characteristics, showing a clear evolution in the fibril microstructure. The microstructure took longer to appear for the oxidised binder. It was confirmed that the fibril microstructure corresponded to actual characteristics in the asphalt binder. Additionally, a 'bee' micelle structure was found as a transitional structure in ESEM observation. The test methods in this study will be used for more comprehensive analysis of asphalt binder microstructure. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

  15. Twin screw wet granulation: Binder delivery. (United States)

    Saleh, Mohammed F; Dhenge, Ranjit M; Cartwright, James J; Hounslow, Michael J; Salman, Agba D


    The effects of three ways of binder delivery into the twin screw granulator (TSG) on the residence time, torque, properties of granules (size, shape, strength) and binder distribution were studied. The binder distribution was visualised through the transparent barrel using high speed imaging as well as quantified using offline technique. Furthermore, the effect of binder delivery and the change of screw configuration (conveying elements only and conveying elements with kneading elements) on the surface velocity of granules across the screw channel were investigated using particle image velocimetry (PIV). The binder was delivered in three ways; all solid binder incorporated with powder mixture, 50% of solid binder mixed with powder mixture and 50% mixed with water, all the solid binder dissolved in water. Incorporation of all solid binder with powder mixture resulted in the relatively longer residence time and higher torque, narrower granule size distribution, more spherical granules, weaker big-sized granules, stronger small-sized granules and better binder distribution compared to that in other two ways. The surface velocity of granules showed variation from one screw to another as a result of uneven liquid distribution as well as shown a reduction while introducing the kneading elements into the screw configuration.

  16. Enhanced electrochemical properties of LiFePO4 (LFP) cathode using the carboxymethyl cellulose lithium (CMC-Li) as novel binder in lithium-ion battery. (United States)

    Qiu, Lei; Shao, Ziqiang; Wang, Daxiong; Wang, Wenjun; Wang, Feijun; Wang, Jianquan


    Novel water-based binder CMC-Li is synthesized using cotton as raw material. The mechanism of the CMC-Li as a binder is reported. Electrochemical properties of batteries cathodes based on commercially available lithium iron phosphate (LiFePO4, LFP) and CMC-Li as a water-soluble binder are investigated. CMC-Li is a novel lithium-ion binder. Compare with conventional poly(vinylidene fluoride) (PVDF) binder, and the battery with CMC-Li as the binder retained 97.8% of initial reversible capacity after 200 cycles at 176 mAh g(-1), which is beyond the theoretical specific capacity of LFP. Constant current charge-discharge test results demonstrate that the LFP electrode using CMC-Li as the binder has the highest rate capability, follow closely by that using PVDF binder. The batteries have good electrochemical property, outstanding pollution-free and excellent stability.

  17. Rheological characteristics of synthetic road binders

    Energy Technology Data Exchange (ETDEWEB)

    Gordon D. Airey; Musarrat H. Mohammed; Caroline Fichter [University of Nottingham, Nottingham (United Kingdom)


    This paper deals with the synthesis of polymer binders from monomers that could in future be derived from renewable resources. These binders consist of polyethyl acrylate (PEA) of different molecular weight, polymethyl acrylate (PMA) and polybutyl acrylate (PBA), which were synthesised from ethyl acrylate, methyl acrylate and butyl acrylate, respectively, by atom transfer radical polymerization (ATRP). The fundamental rheological properties of these binders were determined by means of a dynamic shear rheometer (DSR) using a combination of temperature and frequency sweeps. The results indicate that PEA has rheological properties similar to that of 100/150 penetration grade bitumen, PMA similar rheological properties to that of 10/20 penetration grade bitumen, while PBA, due to its highly viscous nature and low complex modulus, cannot be used on its own as an asphalt binder. The synthetic binders were also combined with conventional penetration grade bitumen to produce a range of bitumen-synthetic polymer binder blends. These blends were batched by mass in the ratio of 1:1 or 3:1 and subjected to the same DSR rheological testing as the synthetic binders. The blends consisting of a softer bitumen (70/100 pen or 100/150 pen) with a hard synthetic binder (PMA) tended to be more compatible and therefore stable and produced rheological properties that combined the properties of the two components. The synthetic binders and particularly the extended bitumen samples (blends) produced rheological properties that showed similar characteristics to elastomeric SBS PMBs. 30 refs., 12 figs., 2 tabs.

  18. Water-resistant gypsum binder

    Directory of Open Access Journals (Sweden)

    Panchenko Alexander I.


    Full Text Available The authors developed a multi-component gypsum binder (MGB with an improved (by 1.8 to 2.2 times water resistance value in comparison with the initial gypsum and a softening factor value within the range of 0.85 to 0.91 through the introduction of a complex additive containing carbide mud and bio-silica. The use of a complex additive provides for the formation of a denser structure due to the formation of low-base calcium hydrated silicates at early stages of the hardening process under wet or dry air conditions. The developed binding agent has a lower (by 2.5 to 3 times open porosity, a greater compressive strength (by 1.4 to 1.6 times for a dry state and by 2.6 times in a water-saturated state and does not require any special curing conditions in contrast to the other multi-component gypsum binders. The authors show the influence of mud-and-silica additive on the properties of hardened MGB and suggest a method of computation of the optimum MGB composition for given components.

  19. The effect of crumb rubber particle size to the optimum binder content for open graded friction course. (United States)

    Ibrahim, Mohd Rasdan; Katman, Herda Yati; Karim, Mohamed Rehan; Koting, Suhana; Mashaan, Nuha S


    The main objective of this paper is to investigate the relations of rubber size, rubber content, and binder content in determination of optimum binder content for open graded friction course (OGFC). Mix gradation type B as specified in Specification for Porous Asphalt produced by the Road Engineering Association of Malaysia (REAM) was used in this study. Marshall specimens were prepared with four different sizes of rubber, namely, 20 mesh size [0.841 mm], 40 mesh [0.42 mm], 80 mesh [0.177 mm], and 100 mesh [0.149 mm] with different concentrations of rubberised bitumen (4%, 8%, and 12%) and different percentages of binder content (4%-7%). The appropriate optimum binder content is then selected according to the results of the air voids, binder draindown, and abrasion loss test. Test results found that crumb rubber particle size can affect the optimum binder content for OGFC.

  20. On the microstructure of bituminous binders

    NARCIS (Netherlands)

    Fischer, H.R.; Dillingh, E.C.; Hermse, C.G.M.


    The objective of this work is to study the common features and the evolution of microstructures of bituminous binders regardless of their grade (PEN 10/20 to 160/220) and source/origin using the atomic force microscope operated in phase contrast mode. All bituminous binders show the same microstruct

  1. Rheological characteristics of aged asphalt binder

    Institute of Scientific and Technical Information of China (English)

    刘聪慧; 吴少鹏; 刘全涛; 朱国军


    Different aging levels(RTFOT,PAV-10h,PAV-20h and PAV-30 h) of asphalt binders with various mass ratios of mineral powder to asphalt(0,0.4,0.8,1.2,1.6,2.0) were used to investigate the rheological properties of aged asphalt binders with respect to their short and long terms aging characteristics.Viscosity test,dynamic shear test and creep test were conducted.The test results indicate that the viscosity of aged asphalt binder increases sharply with the extension of aging period.Complex shear modulus of aged asphalt increases,which indicates that the stiffness of asphalt binders can increase.The phase angle for aged asphalt binders reduces,which indicates that the elastic portion for viscoelastic property of asphalt binders increases.|G*|·sin δ increases after aging procedure which means that the fatigue resistance becomes poor.The creep test results show that creep strain curves varies remarkably for virgin and aged asphalt binders.The total strain during loading period and the permanent strain decreases significantly for aged asphalt binders,which implies that the elastic portion increases and the viscous portion decreases.

  2. Compressive strength and rheology of environmentally-friendly binders

    Directory of Open Access Journals (Sweden)

    Juan Manuel Lizarazo Marriaga


    Full Text Available Ordinary Portland cement production accounts for 9% of worldwide greenhouse gas emissions. This paper summarises the results of research aimed at developing environmentally-friendly binders which can be used as an alternative in civil construction, aimed at generating alternatives and sustainable materials. Mixes of the combination of granulated ground blast furnace slag, basic oxygen slag, cement kiln dust and plasterboard gypsum were used for optimising the binders, according to their compressive strength, to obtain 5 concrete mixtures made partially or completely with industrial waste. The results showed that the compressive strength of mixtures of Portland cement and industrial waste were suitable for different civil construction applications and, although mixtures formed entirely from industrial waste had a significant decrease in their compressive strength, the results sho- wed great potential for specific industrial applications. In addition to compressive strength, the rheological properties of these mixtures were determined for defining flow and workability characteristics.

  3. Process Development of Porcelain Ceramic Material with Binder Jetting Process for Dental Applications (United States)

    Miyanaji, Hadi; Zhang, Shanshan; Lassell, Austin; Zandinejad, Amirali; Yang, Li


    Custom ceramic structures possess significant potentials in many applications such as dentistry and aerospace where extreme environments are present. Specifically, highly customized geometries with adequate performance are needed for various dental prostheses applications. This paper demonstrates the development of process and post-process parameters for a dental porcelain ceramic material using binder jetting additive manufacturing (AM). Various process parameters such as binder amount, drying power level, drying time and powder spread speed were studied experimentally for their effect on geometrical and mechanical characteristics of green parts. In addition, the effects of sintering and printing parameters on the qualities of the densified ceramic structures were also investigated experimentally. The results provide insights into the process-property relationships for the binder jetting AM process, and some of the challenges of the process that need to be further characterized for the successful adoption of the binder jetting technology in high quality ceramic fabrications are discussed.

  4. Essential work of fracture approach to fatigue grading of asphalt binders (United States)

    Andriescu, Adrian

    The main objective of this thesis was to apply failure mechanics principles to the characterization of fatigue cracking of asphalt pavements and to identify the correlations between the pavement performance and the composition of binders. The essential work of fracture (EWF) method developed herein is an energy-based testing approach used for the fracture characterization of ductile materials. Developed for both binders and asphalt mixtures, the method provides fundamental parameters, such as specific essential work of fracture and critical tip opening displacement, as potential candidates for a better fatigue specification. It was shown that binders from different sources and with the same performance grade can have very different levels of fatigue susceptibility depending on their manufacturing method and hence failure properties. Also, the currently used binder loss modulus as developed by the Strategic Highway Research Program does not correlate with the newly proposed fracture mechanics based parameters. An extensive theological and ductile failure investigation on a large interval of testing conditions was performed for a group of binders that are used in the recently built test sections of Highway 655 in northern Ontario. It was found that the shift factors used in the construction of the master curves of the ductile fracture parameters differ from the shift factors of the rheological master curves. The difference was attributed to the response of the internal structure of the binder at the high strain levels that precede the failure phenomenon.

  5. Advancing the Use of Secondary Inputs in Geopolymer Binders for Sustainable Cementitious Composites: A Review

    Directory of Open Access Journals (Sweden)

    Esther Obonyo


    Full Text Available Because of concerns over the construction industry‘s heavy use of cement and the general dissatisfaction with the performance of building envelopes with respect to durability, there is a growing demand for a novel class of ―green‖ binders. Geopolymer binders have re-emerged as binders that can be used as a replacement for Portland cement given their numerous advantages over the latter including lower carbon dioxide emissions, greater chemical and thermal resistance, combined with enhanced mechanical properties at both normal and extreme exposure conditions. The paper focuses on the use of geopolymer binders in building applications. It discusses the various options for starting materials and describes key engineering properties associated with geopolymer compositions that are ideal for structural applications. Specific properties, such as compressive strength, density, pore size distribution, cumulative water absorption, and acid resistance, are comparable to the specifications for structures incorporating conventional binders. This paper presents geopolymer binders, with their three dimensional microstructure, as material for structural elements that can be used to advance the realization of sustainable building systems.

  6. Analysis of the binder yield energy test as an indicator of fatigue behaviour of asphalt mixes (United States)

    O’Connell, Johan; Mturi, Georges A. J.; Komba, Julius; Du Plessis, Louw


    Empirical binder testing has increasingly failed to predict pavement performance in South Africa, with fatigue cracking being one of the major forms of premature pavement distress. In response, it has become a national aspiration to incorporate a performance related fatigue test into the binder specifications for South Africa. The Binder Yield Energy Test (BYET) was the first in a series of tests analysed for its potential to predict the fatigue performance of the binder. The test is performed with the dynamic shear rheometer, giving two key parameters, namely, yield energy and shear strain at maximum shear stress (γτmax). The objective of the investigation was to perform a rudimentary evaluation of the BYET; followed by a more in-depth investigation should the initial BYET results prove promising. The paper discusses the results generated from the BYET under eight different conditions, using six different binders. The results are then correlated with four point bending beam fatigue test results obtained from asphalt mix samples that were manufactured from the same binders. Final results indicate that the BYET is not ideal as an indicator of fatigue performance.

  7. Small things make a big difference: binder effects on the performance of Li and Na batteries. (United States)

    Chou, Shu-Lei; Pan, Yuede; Wang, Jia-Zhao; Liu, Hua-Kun; Dou, Shi-Xue


    Li and Na batteries are very important as energy storage devices for electric vehicles and smart grids. It is well known that, when an electrode is analysed in detail, each of the components (the active material, the conductive carbon, the current collector and the binder) makes a portion of contribution to the battery performance in terms of specific capacity, rate capability, cycle life, etc. However, there has not yet been a review on the binder, though there are already many review papers on the active materials. Binders make up only a small part of the electrode composition, but in some cases, they play an important role in affecting the cycling stability and rate capability for Li-ion and Na-ion batteries. Poly(vinylidene difluoride) (PVDF) has been the mainstream binder, but there have been discoveries that aqueous binders can sometimes make a battery perform better, not to mention they are cheaper, greener, and easier to use for electrode fabrication. In this review, we focus on several kinds of promising electrode materials, to show how their battery performance can be affected significantly by binder materials: anode materials such as Si, Sn and transitional metal oxides; cathode materials such as LiFePO4, LiNi1/3Co1/3Mn1/3O2, LiCoO2 and sulphur.

  8. Tapioca binder for porous zinc anodes electrode in zinc–air batteries

    Directory of Open Access Journals (Sweden)

    Mohamad Najmi Masri


    Full Text Available Tapioca was used as a binder for porous Zn anodes in an electrochemical zinc-air (Zn-air battery system. The tapioca binder concentrations varied to find the optimum composition. The effect of the discharge rate at 100 mA on the constant current, current–potential and current density–power density of the Zn-air battery was measured and analyzed. At concentrations of 60–80 mg cm−3, the tapioca binder exhibited the optimum discharge capability, with a specific capacity of approximately 500 mA h g−1 and a power density of 17 mW cm−2. A morphological analysis proved that at this concentration, the binder is able to provide excellent binding between the Zn powders. Moreover, the structure of Zn as the active material was not affected by the addition of tapioca as the binder, as shown by the X-ray diffraction analysis. Furthermore, the conversion of Zn into ZnO represents the full utilization of the active material, which is a good indication that tapioca can be used as the binder.

  9. Biodegradable materials as foundry moulding sands binders

    Directory of Open Access Journals (Sweden)

    K. Major - Gabryś


    Full Text Available The aim of this article is to show the possibility of using biodegradable materials as part of the composition of foundry moulding and core sand binders. Research shows that moulding sands with biodegradable materials selected as binders are not only less toxic but are also better suited to mechanical reclamation than moulding sands with phenol-furfuryl resin. The use of biodegradable materials as additives to typical synthetic resins can result in their decreased toxicity and improved ability to reclamation as well as in accelerated biodegradation of binding material leftovers of mechanical reclamation.

  10. Studies on the Renewability of Polymeric Binders for Foundry

    Directory of Open Access Journals (Sweden)

    B. Grabowska


    Full Text Available In this paper the results of studies of polymeric binders on the example of the new BioCo2 binder, including the problem of itsrenewability, are presented. The results of structural studies (FT-IR for the BioCo2 binder before and after crosslinking, and bendingstrength tests Rg u fresh and renewed cured molding sands with BioCo2 binder are discussed. The cross-linking binder and curring ofmoulding sand was carried out by physical agents (microwave radiation, temperature. On the basis of obtained results was shown that it is possible to restore the initial properties of the adhesive of BioCo2 binder. The initial properties of moulding sand can be achieved, after the cross-linking binders and after curing in the moulding sands with bioCo2 binder , by supplementing the moulding sand composition by the appropriate amount of water.


    Institute of Scientific and Technical Information of China (English)

    YunLiang; KefuChen


    Binder migration during coating process and themechanism of binder migration were studied in thispaper. After the latex was tagged by osmium, thedegree of binder migration was measured byenergy-dispersive X-ray spectrometer. For the wetsample just after coating application, the realinformation of binder distribution was kept byquenching the sample in liquid nitrogen followed byfreeze-drying. The results showed: under thecondition of this research, binder migration occurredboth in the process of coating application and drying.But the amount of binder migration occurred duringcoating application was much little than that occurredduring drying. The mechanism of binder migrationduring the process of coating application was studiedby force analyses. And one viewpoint was proposedthat was binder migration was caused by Magnusforce and Saffman force.


    Institute of Scientific and Technical Information of China (English)

    Yun Liang; Kefu Chen


    Binder migration during coating process and the mechanism of binder migration were studied in this paper. After the latex was tagged by osmium, the degree of binder migration was measured by energy-dispersive X-ray spectrometer. For the wet sample just after coating application, the real information of binder distribution was kept by quenching the sample in liquid nitrogen followed by freeze-drying. The results showed: under the condition of this research, binder migration occurred both in the process of coating application and drying.But the amount of binder migration occurred during coating application was much little than that occurred during drying. The mechanism of binder migration during the process of coating application was studied by force analyses. And one viewpoint was proposed that was binder migration was caused by Magnus force and Saffman force.

  13. Modification Bituminous Binders Petroleum Resin (Based on C9 Fraction

    Directory of Open Access Journals (Sweden)

    Elena A. Chigorina


    Full Text Available The goal of the present study is to measure the basic parameters of a bituminous binder obtained by modification of the BND 60/90 binder with petroleum resin, for both dynamic and static modification modes.


    Directory of Open Access Journals (Sweden)

    Hardiman Hardiman


    Full Text Available Binder drainage occurs with mixes of small aggregate surface area particularly porous asphalt. The binder drainage test, developed by the Transport Research Laboratory, UK, is commonly used to set an upper limit on the acceptable binder content for a porous mix. This paper presents the results of a laboratory investigation to determine the effects of different binder types on the binder drainage characteristics of porous mix made of various maximum aggregate sizes 20, 14 and 10 mm. Two types of binder were used, conventional 60/70 pen bitumen, and styrene butadiene styrene (SBS modified bitumen. The amount of binder lost through drainage after three hours at the maximum mixing temperature were measured in duplicate for mixes of different maximum sizes and binder contents. The maximum mixing temperature adopted depends on the types of binder used. The retained binder is plotted against the initial mixed binder content, together with the line of equality where the retained binder equals the mixed binder content. The results indicate the significant contribution of using SBS modified bitumen to increase the target bitumen binder content. Their significance is discussed in terms of target binder content, the critical binder content, the maximum mixed binder content and the maximum retained binder content values obtained from the binder drainage test. It was concluded that increasing maximum aggregate sizes decrease the maximum retained binder content, critical binder content, target binder content, maximum mixed binder content, and mixed content for both binders, but however for all mixtures, SBS is the highest.

  15. The effect of sodium hydroxide treatment on biomass binder preparation

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, X.; Xu, D.; Xu, Z.; Chen, Q. [China University of Mining and Technology, Beijing (China). Beijing Campus


    The possibility of rice straw which has been treated with sodium hydroxide for use as coal briquette binder was studied. The main factor which influenced the binder preparation was the concentration of sodium hydroxide. It was found that the binding ability of the solid component was higher than the liquid part. The prepared rice straw binder was mixed with inorganic material, bentonite, or high molecular synthetic organic materials to manufacture a compound coal briquette binder. This compound binder is waterproofing and can further enhance the strength of the briquette. 5 refs., 5 figs., 2 tabs.

  16. Phenomena during thermal removal of binders (United States)

    Hrdina, Kenneth Edward

    The research presented herein has focused on debinding of an ethylene copolymer from a SiC based molded ceramic green body. Examination of the binder burnout process was carried out by breaking down the process into two distinct regions: those events which occur before any weight loss begins, and those events occurring during binder removal. Below the temperature of observed binder loss (175sp°C), both reversible and irreversible displacement was observed to occur. The displacement was accounted for by relaxation of molding stresses, thermal expansion of the system, and melting of the semicrystalline copolymer occurring during heating. Upon further heating the binder undergoes a two stage thermal degradation process. In the first stage, acetic acid is the only degradation product formed, as determined by GC/MS analysis. In this stage, component shrinkage persisted and it was found that one unit volume of shrinkage corresponded with one unit volume of binder removed, indicating that no porosity developed. The escaping acetic acid effluents must diffuse through liquid polymer filled porous regions to escape. The gas pressure of the acetic acid species produced in the first stage of the thermal degradation may exceed the ambient pressure promoting bubble formation. Controlling the heating rate of the specimen maintains the gas pressure below the bubbling threshold and minimizes the degradation time. Experiments have determined the kinetics of the reaction in the presence of the high surface area (10-15msp2/g) ceramic powder and then verified that acetic acid was diffusing through the polymer phase to the specimen surface where evaporation is taking place. The sorption method measured the diffusivity and activity of acetic acid within the filled ceramic system within a TGA. These data were incorporated into a Fickian type model which included the rate of generation of the diffusing species. The modeling process involved prediction of the bloating temperature as a

  17. Curing Reaction Model of Epoxy Asphalt Binder

    Institute of Scientific and Technical Information of China (English)

    QIAN Zhendong; CHEN Leilei; WANG Yaqi; SHEN Jialin


    In order to understand the strength developing law of the epoxy asphalt mixture,a curing reaction model of the epoxy asphalt binder was proposed based upon the thermokinetic analysis.Given some assumptions,the model was developed by applying the Kissinger law as well as Arrhenius equation,and the differential scanning calorimetry was performed for estimating the model parameters.To monitor the strength development of the epoxy asphalt mixture,a strength test program was employed and then results were compared to those produced from the proposed model.The comparative evaluation shows that a good consistency exists between the outputs from test program and the proposed model,indicating that the proposed model can be used effectively for simulating the curing reaction process for the epoxy asphalt binder and predicting the strength development for the epoxy asphalt mixture.

  18. Zirconium phosphate binder for periclase refractories

    Energy Technology Data Exchange (ETDEWEB)

    Volceanov, E. [ICEM S.A., Bucharest (Romania). Metallurgical Research Inst.; Georgescu, M.; Volceanov, A. [Universitatea Politehnica, Bucharest (Romania). Faculty of Industrial Chemistry; Mihalache, F. [REAL S.A., Ploiesti (Romania)


    Present paper brings information concerning the physical-mechanical properties of some high thermal resistant composites with phosphate bonding obtained from periclase clinker as solid component and various zirconium phosphates solutions as liquid component: ZI, ZII and ZIII. All these solutions were prepared from hydrous zirconia and orthophosphoric acid. The batches corresponding to a weight ratio solid / liquid = 3 / 1, have shown a good hardening behavior at normal temperature, especially for the ZII binder. Such compositions exhibit a very good thermal-mechanical behavior in the temperature range 1400 C - 1750 C. X-ray diffraction and electronomicroscopy (TEM) analysis provided information concerning the evolution of phase composition and microstructure during heating of the thermal resistant specimens chemically bound with a zirconium phosphate binder. (orig.)

  19. Valorization of phosphogypsum as hydraulic binder. (United States)

    Kuryatnyk, T; Angulski da Luz, C; Ambroise, J; Pera, J


    Phosphogypsum (calcium sulfate) is a naturally occurring part of the process of creating phosphoric acid (H(3)PO(4)), an essential component of many modern fertilizers. For every tonne of phosphoric acid made, from the reaction of phosphate rock with acid, commonly sulfuric acid, about 3t of phosphogypsum are created. There are three options for managing phosphogypsum: (i) disposal or dumping, (ii) stacking, (iii) use-in, for example, agriculture, construction, or landfill. This paper presents the valorization of two Tunisian phosphogypsums (referred as G and S) in calcium sulfoaluminate cement in the following proportions: 70% phosphogypsum-30% calcium sulfoaluminate clinker. The use of sample G leads to the production of a hydraulic binder which means that it is not destroyed when immersed in water. The binder including sample S performs very well when cured in air but is not resistant in water. Formation of massive ettringite in a rigid body leads to cracking and strength loss.

  20. Modular mobility investigation of polymer binder bitumen (United States)

    Ayupov, D.; Makarov, D.; Murafa, A.; Khozin, V.; Khakimullin, Y.; Sundukov, V.; Khakimov, A.; Gizatullin, B.


    This paper is aimed to obtain polymer binder bitumen for the road applications with improved properties. Objectives included studying the degradation of crumb rubber during devulcanization in melted petroleum bitumen for its modification and resulted structural properties of bitumen. Using equilibrium swelling technique reduced density of the polymer chains was observed and analysis of sol-gel fractions showed a significant decrease in gel fraction. Under selected method of devulcanization 64% of the backbone rubber remained. With The H1 NMR relaxation method the reduction of bitumen molecular mobility was observed due to thickening of its light fractions. The effectiveness of devulcanization was optimized using a new agent in a powder form and vacuum application. The developed binder has an improved spectrum of physical and technical properties such as softening point temperature, hardness, elasticity, frost resistance, low temperature characteristics.

  1. High Performance Binder for EMCDB Propellants

    Directory of Open Access Journals (Sweden)

    V. K. Bhat


    Full Text Available A novel block polymer has been synthesised from caprolactone using hydroxy terminated polybutadiene as ring opening initiator. Usefulness of this polymer as propellant binder has been studied by generating data on physico-chemical properties of the polymer. The polymer exhibited high miscibility with nitrate ester and high solid loading capability. Preliminary data generated on typical propellant formulation indicated higher performance as compared to composite propellant.

  2. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Directory of Open Access Journals (Sweden)

    Josephine Morton

    Full Text Available The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni. Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  3. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species. (United States)

    Morton, Josephine; Karoonuthaisiri, Nitsara; Charlermroj, Ratthaphol; Stewart, Linda D; Elliott, Christopher T; Grant, Irene R


    The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni). Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  4. On the measurement of surface tension in binders used for moulding sands

    Directory of Open Access Journals (Sweden)

    B. Hutera


    Full Text Available The surface tension of foundry binders is a very important parameter affecting the properties of a sand-binder system. Combined with other parameters, its value determines an outcome of the process of moulding sand preparation and the mechanical properties of the ready moulding composition. The problem of how to measure the surface tension of binders used in preparation of moulding sands is discussed only occasionally. Indirectly, the surface tension is characterised by the value of a contact angle, but it never means that these two parameters can be considered identical. Numerous methods are available and used at present to measure the surface tension, among others, the capillary rise method, the spinning drop method, the sessile drop method, the pendant drop method, the method of pulled out ring (or plate, or frame. There is also a rich variety of devices offered with different measuring methods. The devices are modern and represent a high level of the technical skill and art. Unfortunately, also their price is high. It is, however, possible to obtain the reliable results of the surface tension measurement using relatively simple methods, viz. the stalagmometric method and the capillary rise method. What is necessary are proper conditions of the measurement, directly related with the specific properties of binders. The present paper gives examples of the results obtained during measurement of the surface tension of some selected binders. Attention was drawn to the methods of taking measurements, and the obtained results were discussed and analysed. The possibilities of detemining the surface tension of the examined binders from the results of the contact angle measurements using the “sessile drop” and “pendant drop” methods were outlined.

  5. Application of Microwaves for Binder Content Assessment in Moulding Sands

    Directory of Open Access Journals (Sweden)

    Nowak D.


    Full Text Available The paper presents results of preliminary examinations on possibility of determining binder content in traditional moulding sands with the microwave method. The presented measurements were carried-out using a special stand, the so-called slot line. Binder content in the sandmix was determined by measurements of absorption damping Ad and insertion losses IL of electromagnetic wave. One of main advantages of the suggested new method of binder content measurement is short measuring time.

  6. The Effect of Crumb Rubber Particle Size to the Optimum Binder Content for Open Graded Friction Course

    Directory of Open Access Journals (Sweden)

    Mohd Rasdan Ibrahim


    Full Text Available The main objective of this paper is to investigate the relations of rubber size, rubber content, and binder content in determination of optimum binder content for open graded friction course (OGFC. Mix gradation type B as specified in Specification for Porous Asphalt produced by the Road Engineering Association of Malaysia (REAM was used in this study. Marshall specimens were prepared with four different sizes of rubber, namely, 20 mesh size [0.841 mm], 40 mesh [0.42 mm], 80 mesh [0.177 mm], and 100 mesh [0.149 mm] with different concentrations of rubberised bitumen (4%, 8%, and 12% and different percentages of binder content (4%–7%. The appropriate optimum binder content is then selected according to the results of the air voids, binder draindown, and abrasion loss test. Test results found that crumb rubber particle size can affect the optimum binder content for OGFC.

  7. Utilization of Cellulose from Luffa cylindrica Fiber as Binder in Acetaminophen Tablets

    Directory of Open Access Journals (Sweden)

    John Carlo O. Macuja


    Full Text Available Cellulose is an important pharmaceutical excipient. This study aimed to produce cellulose from the fiber of Luffa cylindrica as an effective binder in the formulation of acetaminophen tablets. This study was divided into three phases, namely, (I preparation of cellulose from Luffa cylindrica, (II determination of the powder properties of the LC-cellulose, and (III production and evaluation of acetaminophen of the tablets produced using LC-cellulose as binder. The percentage yield of LC-cellulose was 61%. The values of the powder properties of LC-cellulose produced show fair and passable flow properties and are within the specifications of a powdered pharmaceutical excipient. The mean tablet hardness and disintegration time of the LC-cellulose tablets have a significant difference in the mean tablet hardness and disintegration time of the tablets without binder; thus the cellulose produced improved the suitability of acetaminophen in the dry compression process. However, the tablet properties of the tablets produced using LC-cellulose as binder do not conform to the specifications of the US pharmacopeia; thus the study of additional methods and excipients is recommended.

  8. Thermal debinding dynamics of novel binder system

    Institute of Scientific and Technical Information of China (English)

    周继承; 黄伯云; 张传福; 刘业翔


    The thermal debinding dynamics of newly developed binders for cemented carbides extrusion molding was studied. It is shown that the thermal debinding processes can be divided into two stages: low temperature region, in which the low molecular mass components (LMMCs) are removed; and high temperature region, in which the polymer components are removed. The rate of thermal debinding is controlled by diffusion mechanism. The thermal debinding activation energies were solved out by differential method and integral method. The results show that the addition of other components acted as a catalyzer can effectively decrease the activation energy of thermal debinding processes.

  9. Sustainable binders for concrete: A structured approach from waste screening to binder composition development

    NARCIS (Netherlands)

    Vinai, R.; Panagiotopoulou, C.; Soutsos, M.; Taxiarchou, M.; Zervaki, M.; Valcke, S.L.A.; Ligero, V.C.; Couto, S.; Gupta, A.; Pipilikaki, P.; Alvarez, I.L.; Coelho, D.; Branquinho, J.


    Worldwide, the building sector requires the production of 4 billion tonnes of cement annually, consuming more than 40% of global energy. Alkali activated “cementless” binders have recently emerged as a novel eco-friendly construction material with a promising potential to replace ordinary Portland c

  10. Fracture properties of concrete specimens made from alkali activated binders (United States)

    Šimonová, Hana; Kucharczyková, Barbara; Topolář, Libor; Bílek, Vlastimil, Jr.; Keršner, Zbyněk


    The aim of this paper is to quantify crack initiation and other fracture properties – effective fracture toughness and specific fracture energy – of two types of concrete with an alkali activated binder. The beam specimens with a stress concentrator were tested in a three-point bending test after 28, 90, and 365 days of maturing. Records of fracture tests in the form of load versus deflection (P–d) diagrams were evaluated using effective crack model and work-of-fracture method and load versus mouth crack opening displacement (P–CMOD) diagrams were evaluated using the Double-K fracture model. The initiation of cracks during the fracture tests for all ages was also monitored by the acoustic emission method. The higher value of monitored mechanical fracture parameters of concrete with alkali activated blast furnace slag were achieved with substitution blast furnace slag by low calcium fly ash in comparison with substitution by cement kiln dust.

  11. Evolution of geopolymer binders: a review (United States)

    Nuruddin, M. F.; Malkawi, A. B.; Fauzi, A.; Mohammed, B. S.; Almattarneh, H. M.


    This study aimed to present the current state of research about the terminology, chemical reactions, mechanisms, and microstructure modelling of geopolymer binders. Modelling the structure of the geopolymerization products is essential for controlling the product properties. The currently available models have shown some limitations in determining the rate of geopolymerization and setting time of the gel. There is a need for deeper knowledge regarding the physicochemical analysis of geopolymer binders. Most of the available models have used pure material like metakaolin; however, the less pure materials are expected to have different mechanisms. The FTIR and MAS-NMR analysis are considered as effective tools in providing information on the molecular deviations during geopolymerization. However, XRD analysis is not effective because most of the changes take place in amorphous phases. Also, the role of the iron oxides and some of the other impurities still not clear where none of the previous method of investigation can be used to detect the molecular changes of the iron compounds. This issue is very relevant hence the iron oxides are existed in substantial amounts in most of the waste materials that are suitable to be used as geopolymer source materials.

  12. High-performance binders with reduced autogenous shrinkage on the basis of fine cement

    Energy Technology Data Exchange (ETDEWEB)

    Martschuk, V. [Inst. of the Cement Industry, Dusseldorf (Germany)


    A study on the hydration of portland cement was presented. The paper presented special features of the chemical shrinkage of cement paste at high and low water-cement ratios. It also described the effect of silica fume on the deformation behaviour of cement paste, as well as on the behaviour of hardened binder paste at water-binder ratios of 0.40 and 0.25. High performance concrete has a high density and a tendency to chemically shrink because of its low water-cement ratio. The study showed that the autogenous shrinkage increases if silica fume is added. Theoretical calculations were performed and showed that the typical addition of silica fume results in an increase in total porosity, and therefore, to the deterioration of the packing density of the binder mixture. The specific surface area of the dry powder is also increased. It was concluded that replacing cement by optimized fine cements improves the theoretical packing density in binders. The hardened cement paste studies showed that this makes a cement that is denser with less tendency to shrink. 7 refs., 3 tabs., 8 figs.

  13. Identification of proteinaceous binders used in artworks by MALDI-TOF mass spectrometry. (United States)

    Kuckova, Stepanka; Hynek, Radovan; Kodicek, Milan


    Proper identification of proteinaceous binders in artworks is essential for specification of the painting technique and thus also for selection of the restoration method; moreover, it might be helpful for the authentication of the artwork. This paper is concerned with the optimisation of analysis of the proteinaceous binders contained in the colour layers of artworks. Within this study, we worked out a method for the preparation and analysis of solid samples from artworks using tryptic cleavage and subsequent analysis of the acquired peptide mixture by matrix-assisted laser desorption/ionisation time of flight mass spectrometry. To make this approach rational and efficient, we created a database of commonly used binders (egg yolk, egg white, casein, milk, curd, whey, gelatine, and various types of animal glues); certain peaks in the mass spectra of these binders, formed by rich protein mixtures, were matched to amino acid sequences of the individual proteins that were found in the Internet database ExPASy; their cleavage was simulated by the program Mass-2.0-alpha4. The method developed was tested on model samples of ground layers prepared by an independent laboratory and then successfully applied to a real sample originating from a painting by Edvard Munch.

  14. Polyamidoamine dendrimer-based binders for high-loading lithium–sulfur battery cathodes

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharya, Priyanka; Nandasiri, Manjula I.; Lv, Dongping; Schwarz, Ashleigh M.; Darsell, Jens T.; Henderson, Wesley A.; Tomalia, Donald A.; Liu, Jun; Zhang, Ji-Guang; Xiao, Jie


    Lithium-sulfur (Li-S) batteries are regarded as one of the most promising candidates for next generation energy storage systems because of their ultra high theoretical specific energy. To realize the practical application of Li-S batteries, however, a high S active material loading is essential (>70 wt% in the carbon-sulfur (C-S) composite cathode and >2 mg cm-2 in the electrode). A critical challenge to achieving this high capacity in practical electrodes is the dissolution of the longer lithium polysulfide reaction intermediates in the electrolyte (resulting in loss of active material from the cathode and contamination of the anode due to the polysulfide shuttle mechanism). The binder material used for the cathode is therefore crucial as this is a key determinant of the bonding interactions between the active material (S) and electronic conducting support (C), as well as the maintenance of intimate contact between the electrode materials and current collector. The battery performance can thus be directly correlated with the choice of binder, but this has received only minimal attention in the relevant Li-S battery published literature. Here, we investigated the application of polyamidoamine (PAMAM) dendrimers as functional binders in Li-S batteries—a class of materials which has been unexplored for electrode design. By using dendrimers, it is demonstrated that high S loadings (>4 mg cm-2) can be easily achieved using "standard" (not specifically tailored) materials and simple processing methods. An exceptional electrochemical cycling performance was obtained (as compared to cathodes with conventional linear polymeric binders such as carboxymethyl cellulose (CMC) and styrene-butadiene rubber (SBR)) with >100 cycles and 85-98% capacity retention, thus demonstrating the significant utility of this new binder architecture which exhibits critical physicochemical properties and flexible nanoscale design parameters (CNDP's).

  15. Mortar and concrete based on calcium sulphate binders

    NARCIS (Netherlands)

    Bakker, J.J.F.; Brouwers, H.J.H.


    In this study both hemi-hydrate and anhydrite are tested as calcium sulphate binders for structural mortar and concrete. The advantage of using calcium sulphates instead of cement as a binder is the fact that the production of calcium sulphate is more environmental friendly than that of cement. For

  16. 46 CFR 308.544 - Facultative binder, Form MA-315. (United States)


    ... 46 Shipping 8 2010-10-01 2010-10-01 false Facultative binder, Form MA-315. 308.544 Section 308.544 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION EMERGENCY OPERATIONS WAR RISK INSURANCE War Risk Cargo Insurance Iii-Facultative War Risk Cargo Insurance § 308.544 Facultative binder, Form...

  17. An Open Challenge Problem Repository for Systems Supporting Binders

    Directory of Open Access Journals (Sweden)

    Amy Felty


    Full Text Available A variety of logical frameworks support the use of higher-order abstract syntax in representing formal systems; however, each system has its own set of benchmarks. Even worse, general proof assistants that provide special libraries for dealing with binders offer a very limited evaluation of such libraries, and the examples given often do not exercise and stress-test key aspects that arise in the presence of binders. In this paper we design an open repository ORBI (Open challenge problem Repository for systems supporting reasoning with BInders. We believe the field of reasoning about languages with binders has matured, and a common set of benchmarks provides an important basis for evaluation and qualitative comparison of different systems and libraries that support binders, and it will help to advance the field.

  18. Viscoelastic Behaviour of Solid Propellants based on Various Polymeric Binders

    Directory of Open Access Journals (Sweden)

    N. Prabhakaran


    Full Text Available The dynamic mechanical properties of different binders and corresponding propellants are studied in terms of storage modulus and loss tangent. The binders investigated are HTPB, CTPB, PBAN, HEF-20 and ISRO polyol. The viscoelastic behaviour is investigated using Rheovibron viscoelastometer at 35 Hz covering a wide temperature range (-100 degree centigrade to 100 degree centigrade. The properties of the binder and corresponding propellant are compared in terms of parameters, tan delta/sub max/, T/sub g/ and the trend of their master relaxation modulus curves. It is found that polybutadiene binders exhibit lowest T/sub g/ (around -60 degree centigrade and ISRO polyol the highest (near -20 degree centigrade. The propellants have higher moduli than the binders at any temperature. The master relaxation modulus curve is influenced by the type of propellant.

  19. Environmentally Friendly Geopolymeric Binders Made with Perlite (United States)

    Erdogan, S. T.


    Production of Portland cement (PC), the ubiquitous binding material for construction works, is responsible for 5-10 % of all anthropogenic CO2 emissions. Nearly half of these emissions arise from the decomposition of calcareous raw materials, and the other half from kiln fuel combustion and cement clinker grinding operations. As such, PC production contributes significantly to global warming and climate change. Lately, there have been efforts to develop alternative binders with lower associated green house gas emissions. An important class of such binders is geopolymers, formed by activating natural or waste materials with suitable alkaline or acidic solutions. These binders have very low CO2 emissions from grinding of the starting material, and some from the production of the activating chemical. The total CO2 emission from carefully formulated mixtures can be as low as 1/5th - 1/10th of those of Portland cement concrete mixtures with comparable properties. While use of industrial wastes is environmentally preferable, the variability of their chemical compositions over time makes their use difficult. Use of natural materials depletes resources but can have more consistent properties and can be more easily accepted. Perlite is a volcanic aluminosilicate glass abundant in Turkey, China, Japan, the US and several EU countries. It has been used in its expanded form, for horticulture, for insulation, and for producing lightweight concrete. Turkish perlites contain more than 70 % SiO2, and have a SiO2/Al2O3 ratio of ~5.5. This study shows that ground perlite can be mixed with alkaline activators like sodium hydroxide or sodium silicate to yield mortars with strengths comparable to those of portland cement mortars. Strength gain is slower than with PC mixtures at room temperature but adequate ultimate strength can be achieved with curing at slightly elevated temperatures in 24 h or less. Since perlite is natural, perlite geopolymers can have environmental, energetic, and

  20. Development of a green binder system for paper products. (United States)

    Flory, Ashley R; Vicuna Requesens, Deborah; Devaiah, Shivakumar P; Teoh, Keat Thomas; Mansfield, Shawn D; Hood, Elizabeth E


    It is important for industries to find green chemistries for manufacturing their products that have utility, are cost-effective and that protect the environment. The paper industry is no exception. Renewable resources derived from plant components could be an excellent substitute for the chemicals that are currently used as paper binders. Air laid pressed paper products that are typically used in wet wipes must be bound together so they can resist mechanical tearing during storage and use. The binders must be strong but cost-effective. Although chemical binders are approved by the Environmental Protection Agency, the public is demanding products with lower carbon footprints and that are derived from renewable sources. In this project, carbohydrates, proteins and phenolic compounds were applied to air laid, pressed paper products in order to identify potential renewable green binders that are as strong as the current commercial binders, while being organic and renewable. Each potential green binder was applied to several filter paper strips and tested for strength in the direction perpendicular to the cellulose fibril orientation. Out of the twenty binders surveyed, soy protein, gelatin, zein protein, pectin and Salix lignin provided comparable strength results to a currently employed chemical binder. These organic and renewable binders can be purchased in large quantities at low cost, require minimal reaction time and do not form viscous solutions that would clog sprayers, characteristics that make them attractive to the non-woven paper industry. As with any new process, a large-scale trial must be conducted along with an economic analysis of the procedure. However, because multiple examples of "green" binders were found that showed strong cross-linking activity, a candidate for commercial application will likely be found.

  1. Development of a green binder system for paper products (United States)


    Background It is important for industries to find green chemistries for manufacturing their products that have utility, are cost-effective and that protect the environment. The paper industry is no exception. Renewable resources derived from plant components could be an excellent substitute for the chemicals that are currently used as paper binders. Air laid pressed paper products that are typically used in wet wipes must be bound together so they can resist mechanical tearing during storage and use. The binders must be strong but cost-effective. Although chemical binders are approved by the Environmental Protection Agency, the public is demanding products with lower carbon footprints and that are derived from renewable sources. Results In this project, carbohydrates, proteins and phenolic compounds were applied to air laid, pressed paper products in order to identify potential renewable green binders that are as strong as the current commercial binders, while being organic and renewable. Each potential green binder was applied to several filter paper strips and tested for strength in the direction perpendicular to the cellulose fibril orientation. Out of the twenty binders surveyed, soy protein, gelatin, zein protein, pectin and Salix lignin provided comparable strength results to a currently employed chemical binder. Conclusions These organic and renewable binders can be purchased in large quantities at low cost, require minimal reaction time and do not form viscous solutions that would clog sprayers, characteristics that make them attractive to the non-woven paper industry. As with any new process, a large-scale trial must be conducted along with an economic analysis of the procedure. However, because multiple examples of “green” binders were found that showed strong cross-linking activity, a candidate for commercial application will likely be found. PMID:23531016

  2. Dilatometric examination of moulds with plaster binder

    Directory of Open Access Journals (Sweden)

    M. Nadolski


    Full Text Available Investigations concerning thermal expansion of moulding materials with plaster binder have been performed for two mixture compositionsof Authors’ own design, as well as for the material used in jewellery industry under the Prima-Cast trade name, and for ThermoMold 1200moulding material. The results of dilatometric examinations of these materials, carried out within the temperature range from about 20°Cto 650°C by means of the DA-3 automatic dilatometer, have been compared. An analysis of this comparison has revealed that it is thematrix composition which is decisive for the magnitude of dimensional changes of moulds, and that applying components which do notexhibit polymorphic transformations reduces dimensional changes of a mould during its thermal treatment.

  3. Guar gum: Structural and electrochemical characterization of natural polymer based binder for silicon-carbon composite rechargeable Li-ion battery anodes (United States)

    Kuruba, Ramalinga; Datta, Moni Kanchan; Damodaran, Krishnan; Jampani, Prashanth H.; Gattu, Bharat; Patel, Prasad P.; Shanthi, Pavithra M.; Damle, Sameer; Kumta, Prashant N.


    Long term cyclability of a composite Li-ion anode electrode comprised of 82 wt.% Si/C lithium ion active material along with 8 wt.% polymeric binder and 10 wt.% Super P conductive carbon black has been studied utilizing polymeric binders exhibiting different elastic/tensile moduli and tensile yield strengths. Accordingly, electrochemically active Si/C composite synthesized by high energy mechanical milling (HEMM), exhibiting reversible specific capacities of ∼780 mAh/g and ∼600 mAh/g at charge/discharge rates of ∼50 mA/g and ∼200 mA/g, respectively were selected as the Li-ion active anode. Polyvinylidene fluoride (PVDF) and purified guar gum (PGG) with reported elastic moduli ∼1000 MPa and ∼3200 MPa, respectively were selected as the binders. Results show that the composite electrode (Si/C + binder + conducting carbon) comprising the higher elastic modulus binder (PGG) exhibits better long term cyclability contrasted with PVDF. 1H-NMR analysis of the polymer before and after cycling shows structural degradation/deformation of the low elastic modulus PVDF, whereas the high elastic modulus PGG binder shows no permanent structural deformation or damage. The results presented herein thus suggest that PGG based polymers exhibiting high elastic modulus are a promising class of binders with the desired mechanical integrity needed for enduring the colossal volume expansion stresses of Si/C based composite anodes.

  4. Cobalt Oxide Porous Nanofibers Directly Grown on Conductive Substrate as a Binder/Additive-Free Lithium-Ion Battery Anode with High Capacity. (United States)

    Liu, Hao; Zheng, Zheng; Chen, Bochao; Liao, Libing; Wang, Xina


    In order to reduce the amount of inactive materials, such as binders and carbon additives in battery electrode, porous cobalt monoxide nanofibers were directly grown on conductive substrate as a binder/additive-free lithium-ion battery anode. This electrode exhibited very high specific discharging/charging capacities at various rates and good cycling stability. It was promising as high capacity anode materials for lithium-ion battery.

  5. Burning Characteristics of Ammonium-Nitrate-Based Composite Propellants with a Hydroxyl-Terminated Polybutadiene/Polytetrahydrofuran Blend Binder

    Directory of Open Access Journals (Sweden)

    Makoto Kohga


    Full Text Available Ammonium-nitrate-(AN- based composite propellants prepared with a hydroxyl-terminated polybutadiene (HTPB/polytetrahydrofuran (PTHF blend binder have unique thermal decomposition characteristics. In this study, the burning characteristics of AN/HTPB/PTHF propellants are investigated. The specific impulse and adiabatic flame temperature of an AN-based propellant theoretically increases with an increase in the proportion of PTHF in the HTPB/PTHF blend. With an AN/HTPB propellant, a solid residue is left on the burning surface of the propellant, and the shape of this residue is similar to that of the propellant. On the other hand, an AN/HTPB/PTHF propellant does not leave a solid residue. The burning rates of the AN/HTPB/PTHF propellant are not markedly different from those of the AN/HTPB propellant because some of the liquefied HTPB/PTHF binder cover the burning surface and impede decomposition and combustion. The burning rates of an AN/HTPB/PTHF propellant with a burning catalyst are higher than those of an AN/HTPB propellant supplemented with a catalyst. The beneficial effect of the blend binder on the burning characteristics is clarified upon the addition of a catalyst. The catalyst suppresses the negative influence of the liquefied binder that covers the burning surface. Thus, HTPB/PTHF blend binders are useful in improving the performance of AN-based propellants.

  6. Carbon nanotube reinforced metal binder for diamond cutting tools

    DEFF Research Database (Denmark)

    Sidorenko, Daria; Mishnaevsky, Leon; Levashov, Evgeny


    of grain size of the structural constituents of the binder, what in turn leads to the improved simultaneously hardness, Young modulus, plastic extension, bending strength and performances of the metallic binders. Comparing service properties of diamond end-cutting drill bits with and without MWCNT one......The potential of carbon nanotube reinforcement of metallic binders for the improvement of quality and efficiency of diamond cutting wheels is studied. The effect of multi-walled carbon nanotube (MWCNT) reinforcement on the mechanical properties i.e. hardness, Young modulus, strength and deformation...

  7. Cationic fluorinated polymer binders for microbial fuel cell cathodes

    KAUST Repository

    Chen, Guang


    Fluorinated quaternary ammonium-containing polymers were used as catalyst binders in microbial fuel cell (MFC) cathodes. The performance of the cathodes was examined and compared to NAFION ® and other sulfonated aromatic cathode catalyst binders using linear sweep voltammetry (LSV), impedance spectroscopy, and performance tests in single chamber air-cathode MFCs. The cathodes with quaternary ammonium functionalized fluorinated poly(arylene ether) (Q-FPAE) binders showed similar current density and charge transfer resistance (R ct) to cathodes with NAFION ® binders. Cathodes containing either of these fluorinated binders exhibited better electrochemical responses than cathodes with sulfonated or quaternary ammonium-functionalized RADEL ® poly(sulfone) (S-Radel or Q-Radel) binders. After 19 cycles (19 d), the power densities of all the MFCs declined compared to the initial cycles due to biofouling at the cathode. MFC cathodes with fluorinated polymer binders (1445 mW m -2, Q-FPAE-1.4-H; 1397 mW m -2, Q-FPAE-1.4-Cl; 1277 mW m -2, NAFION ®; and 1256 mW m -2, Q-FPAE-1.0-Cl) had better performance than those with non-fluorinated polymer binders (880 mW m -2, S-Radel; 670 mW m -2, Q-Radel). There was a 15% increase in the power density using the Q-FPAE binder with a 40% higher ion exchange capacity (Q-FPAE-1.4-H compared to Q-FPAE-1.0-Cl) after 19 cycles of operation, but there was no effect on the power production due to counter ions in the binder (Cl -vs. HCO 3 -). The highest-performance cathodes (NAFION ® and Q-FPAE binders) had the lowest charge transfer resistances (R ct) in fresh and in fouled cathodes despite the presence of thick biofilms on the surface of the electrodes. These results show that fluorinated binders may decrease the penetration of the biofilm and associated biopolymers into the cathode structure, which helps to combat MFC performance loss over time. © 2012 The Royal Society of Chemistry.

  8. Strength properties of moulding sands with chosen biopolymer binders

    Directory of Open Access Journals (Sweden)

    St.M. Dobosz


    Full Text Available The article presents the results of primary researches of the IV generation moulding sands, in which as the binders are used differentbiodegradable materials. The bending and the tensile strength of the moulding sands with polylactide, poly(lactic-co-glycolic acid,polycaprolactone, polyhydroxybutyrate and cellulose acetate as binders were measured. The researches show that the best strengthproperties have the moulding sands with polylactide as binder. It was proved that the tested moulding sands’ strength properties are goodenough for foundry practice.

  9. Effects of binder addition on the mechanical properties of bulk Y-Ba-Cu-O superconductors (United States)

    Seki, H.; Wongsatanawarid, A.; Kobayashi, S.; Ikeda, Y.; Murakami, M.


    We studied the effects of binder addition on the mechanical properties of bulk Y-Ba-Cu-O superconductors. We prepared YBa2Cu3Oy, Y2BaCuO5 powders and polyvinyl alcohol mixed with water as a binder. These raw materials were mixed, and the binder-added powders were pressed into pellets. The hardness of the green compacts with binder is higher than that without the binder. However, the hardness of green compacts with 8% binder is the same as that with 4% binder. The maximum compression strength of the precursor with binder is higher than that without binder. Equally, the maximum strength of the green compacts with 8% binder is higher than that with 4% binder. The differential thermal analysis measurements showed that the exothermic reaction due to the decomposition of the organic binder started at 550 °C and gradually proceeded with further heating. After de-binder treatment, BaCO3 powders were produced on the green compacts. The green compacts were subjected to melt-processing. We also measured trapped magnetic fields of binder-added bulk Y-Ba-Cu-O superconductors with a Hall probe scanning device. Trapped magnetic field of the bulk added with 4% is higher than that of the binder-free bulk. Hence, Y-Ba-Cu-O bulk with suitable amount of binder shows good influence for mechanical strength and trapped magnetic field.

  10. Haemodynamic and respiratory effects of an abdominal compression binder

    DEFF Research Database (Denmark)

    Toft, M.H.; Bulow, J.; Simonsen, L.


    In order to elucidate the circulatory and respiratory effects of a newly developed abdominal compression binder 25 healthy, normal weight subjects were studied. In supine position the central haemodynamics were measured and estimated with a Finapress device. Lower extremity venous haemodynamics...... with or without the abdominal compression binder. The results show that the compression binder significantly increases the venous volume in the lower extremities as showed by a reduction in the venous capacitance in the lower extremities and a reduction in the stroke volume and cardiac output, while it does...... not influence the pulmonary volumes. It is concluded that the applied abdominal binder significantly affects peripheral and central haemodynamics. It should therefore be used with caution when in the supine position for longer periods, as the pooling of blood it induces in the lower extremities may have...

  11. New BioCo binders containing biopolymers for foundry industry

    Directory of Open Access Journals (Sweden)

    B. Grabowska


    Full Text Available Possibilities of cross-linking of new polymer binders from the BioCo group, their hardening in moulding sands at the application of cross-linking agents both physical and chemical are presented. Their thermal stability was determined. It was proved, that moulding sands bound by the BioCo binders are characterised by the compression strength (Ruc of an order of 2 MPa, and the bending strength (Rug of 1 MPa, after 1 hour of a sample curing. The worked out BioCo binders are biodegradable and renewable in the part which was not completely burned. The investigated moulding sands with the BioCo binders are easily knocked out and have a good susceptibility for mechanical reclamation processes.

  12. Development of bio-sourced binder to metal injection moulding (United States)

    Royer, Alexandre; Barrière, Thierry; Gelin, Jean-Claude


    In the MIM process the binder play the most important role. It provides fluidity of the feedstock mixture for injection molding and adhesion of the powder to keep the molded shape. The binder must provide strength and cohesion for the molded part, must be easy to be removed from the molded part, and must be the recyclable, environmentally friendly and economical ones. The goal of this study is to develop a binder environmentally friendly. For this, a study of formulation based on polyethylene glycol, because of is water debinding properties, was made. Polylactic acid and Polyhydroxyalkanoates were investigated as bio sourced polymers. The chemical, miscibility and rheological behavior of the binder formulation were investigated.

  13. Role of binder in the synthesis of titania membrane

    Indian Academy of Sciences (India)

    K S Seshadri; M Selvaraj; R Kesava Moorthy; K Varatharajan; M P Srinivasan; K B Lal


    The synthesis of titania membrane through sol–gel route involves hydrolysis of alkoxide, peptization of hydrous oxide of titanium to obtain a sol, adjustment of the sol viscosity by including a binder and filtration of the viscous sol through a microporous support, gelation and sintering to desired temperature. The binder plays an important role in that it not only helps in adjustment of sol viscosity but also helps in binding the sol particle with porous support. Here a comparative study on the role of different binders, viz. polyvinyl alcohol, polyethyleneimine, polyacrylamide, effect of their viscosity and surface tension effect on the morphology of the titania membrane is presented. The results show that among the three binders studied polyvinyl alcohol gave rise to membranes of desired characteristics when the sol viscosity was 0.08 pa.s.


    Directory of Open Access Journals (Sweden)

    I. E. Illarionov


    Full Text Available Some features of the use of mixtures of metal phosphate binder and management principles of their properties for production of castings of ferrous and non-ferrous metals and alloys were shown.

  15. Impact of Binder Composition on Inkjet Printing Paper

    Directory of Open Access Journals (Sweden)

    Yan Zhang


    Full Text Available This article is focused on the impact of different binder mixtures on the performances of paper surface and printability. The coating properties were studied with the chosen silica pigment, and the binder consisted of vinyl acetate copolymer and polyvinyl alcohol with different ratios, followed by the measurement of smoothness, whiteness, and surface strength. The inkjet image quality was assessed using water-based inks. The print density, dot gain, and line quality were analyzed. The results showed that the surface performance and printability were affected by the composition of the binder. With the decrease of vinyl acetate copolymer and the increase of polyvinyl alcohol, the surface smoothness and strength decreased, and the penetration and diffusion of the ink changed as well. When the binder mixture was used with proper ratio, a larger solid density, smaller dot gain, and higher definition can be achieved, which were better than using either one of them alone.

  16. Using the organic-mineral binder for molybdenum concentrate granulation in metallurgy

    Directory of Open Access Journals (Sweden)

    Farhod Yusupov


    Full Text Available When we use the traditional composition of the batch mixture in the production of cinder, the proportion of Mo in the granules is reduced to 4% (Table 1. In addition, it is known that the presence of kaolin in cinder makes difficult sublimating rhenium oxide and impairs its commodity indices such as the fullness of ammonia leaching, Au and Ag extraction from a cake. To improve these technical and economic indicators was an idea to replace, completely or partially, kaolin with organic binder to be burned at a sintering of Mo-concentrate and causing no dilution of the product. The purpose of our study is to develop such a binder for JSC "Almalyk GMK" with the specific requirements. It should not contain any "technological poisons" (such as phosphates adversely affecting the redistribution of cinder: leaching, sorption of Mo (VI ions, hydrogen reduction to metal, sintering rods.

  17. Evaluation of Trapa bispinosa Roxb. starch as pharmaceutical binder in solid dosage form

    Institute of Scientific and Technical Information of China (English)

    Akhilesh V Singh; Anudwipa Singh; Lila K Nath; Nihar R Pani


    Objective: To evaluate binding efficiency of Trapa bispinosa Roxb. starch (TBS) in diclofenac sodium tablets. Methods: Diclofenac sodium tablets were prepared using wet granulation method. The starch paste in different concentrations (5%-15% w/w) was evaluated for optimized binder concentration. Preformulation study of the drug with TBS and different excipients were also analyzed using fourier transform infrared spectroscopy (FTIR) and isothermal stress testing (IST). Results: Preformulation study of the drug, water chestnut starch and different excipients showed no interaction or, drug degradation in FTIR and IST, respectively. The tablets were evaluated for hardness, friability, drug content, disintegration and dissolution studies, and all the parameters were found within the official specifications. Conclusions: The results reveal that this starch has potential to be used as binder at industrial scale in pharmaceutical solid dosage form development.

  18. Synthesis and methane storage of binder-free porous graphene monoliths

    Institute of Scientific and Technical Information of China (English)

    Guoqing Ning; Hao Wang; Xiaoxin Zhang; Chenggen Xu; Guangjin Chen; Jinsen Gao


    Nanomesh graphene (NMG) obtained by template chemical vapor deposition was used to synthesize the binder-free graphene monoliths by simple tablet pressing.The stacking manner of the NMG sheets was crucial to the cohesion interaction between the graphene sheets,only the NMG materials with a loosely stacking manner could be pressed into binder-free monoliths.At the tableting pressure of 2-8 MPa,both the bulk densities and the specific surface areas of the monoliths keep nearly constant as the tableting pressure increases,indicating that the NMG monoliths have obvious elasticity and a porous structure due to the large corrugations and the mesh structures of the graphene sheets.As a result,an extraordinary methane storage capacity of 236 (v/v) at 9MPa was obtained in the graphene monolith prepared by tableting at 4 MPa.

  19. Development of composite solid propellent using dicyclopentadien binder (United States)

    Bluestone, Stephen Ray

    Through the history of composite solid propellant binders new chemicals are introduced as binders to improve upon the previous generation. Sometimes this is done to improve upon the flaws or shortcomings of a previous binder. Other time it is to meet a new set of requirements desired by industry. Dicyclopentadiene (DCPD) is a hydrocarbon monomer being considered for its potential as a new binder in the composite propellant industry. The binder of a composite solid propellant is arguably the most important feature of the propellant. It is the binder that provides the majority of the structural characteristics of the propellant while also contributing itself as fuel to the combustion process. A binder in composite propellants must also be able to accept the introduction of a large quantity of solid filler; oxidizer, fuel, and other energetic and non-energetic particles. Many of the composite propellants used in industry today have over 80% of their weight composed of non-binder solid or liquid fillers. These requirements must be met by the binder in some form or fashion to produce a propellant able to compete with binders currently in use. When DCPD is polymerized it produces an extremely tough plastic with excellent tensile and impact strength. Experimentation has found that DCPD is able to support a large quantity of solid materials, over 80% weight of the mixture, while still retaining a great portion of its original strength. When compared to another similarly loaded binder currently used in industry, Hydroxyl-Terminated Polybutadiene (HTPB), it was found that DCPD composite propellant had nearly 1.5 times the stress capacity while still exhibiting over 75% of the strain capacity of HTPB based composite propellant. In addition it was also shown that DCPD composite propellant allows for tailoring of its mechanical properties with the addition of plasticizers. The DCPD based composite propellant also exhibits a burning rate nearly twice that HTPB. These factors

  20. Influence of binder solvent on carbon-layer structure in electrical-double-layer capacitors

    Indian Academy of Sciences (India)

    A Banerjee; P Suresh Kumar; A K Shukla


    Porous activated-carbons with a large surface-area have been the most common materials for electrical-double-layer capacitors (EDLCs). These carbons having a wide pore distribution ranges from micropores to macropores in conjunction with a random pore connection that facilitates the high specific-capacitance values. Pore distribution plays a central role in controlling the capacitance value of EDLCs, since electrolyte distribution inside the active material mainly depends on the pore distribution. This has a direct influence on the distribution of resistance and capacitance values within the electrode. As a result, preparation of electrodes remains a vital issue in realising high-performance EDLCs. Generally, carbon materials along with some binders are dispersed into a solvent and coated onto the current collectors. This study examines the role of binder solvents used for the carbon-ink preparation on the microstructure of the electrodes and the consequent performance of the EDLCs. It is observed that the physical properties of the binder solvent namely its dielectric constant, viscosity and boiling point have important role in determining the pore-size distribution as well as the microstructure of electrodes which influence their specific capacitance values.

  1. Basal Gnathostomes Provide Unique Insights into the Evolution of Vitamin B12 Binders (United States)

    Lopes-Marques, Mónica; Ruivo, Raquel; Delgado, Inês; Wilson, Jonathan M.; Aluru, Neelakanteswar; Castro, L. Filipe C.


    The uptake and transport of vitamin B12 (cobalamin; Cbl) in mammals involves a refined system with three evolutionarily related transporters: transcobalamin 1 (Tcn1), transcobalamin 2 (Tcn2), and the gastric intrinsic factor (Gif). Teleosts have a single documented binder with intermediate features to the human counterparts. Consequently, it has been proposed that the expansion of Cbl binders occurred after the separation of Actinopterygians. Here, we demonstrate that the diversification of this gene family took place earlier in gnathostome ancestry. Our data indicates the presence of single copy orthologs of the Sarcopterygii/Tetrapoda duplicates Tcn1 and Gif, and Tcn2, in Chondrichthyes. In addition, a highly divergent Cbl binder was found in the Elasmobranchii. We unveil a complex scenario forged by genome, tandem duplications and lineage-specific gene loss. Our findings suggest that from an ancestral transporter, exhibiting large spectrum and high affinity binding, highly specific Cbl transporters emerged through gene duplication and mutations at the binding pocket. PMID:25552533

  2. Rheological Evaluation of Polymer Modiifed Asphalt Binders

    Institute of Scientific and Technical Information of China (English)

    WANG Lan; CHANG Chunqing


    The microstructure and dynamic rheological characteristics of asphalt containing different polymer modifiers (crumb rubber, styrene-butadiene-styrene and crumb rubber mix with styrene-butadiene-styrene) at mid and high service temperature levels were investigated by using scanning electron microscopy(SEM), dynamic shear rheometer(DSR) and repeat creep test. The main objective of the investigation was to rank the modifiers based on their effect on performance characteristics of asphalt under service conditions. To evaluate the effect of different modiifers on the viscoelastic response of asphalt, the temperature and frequency dependences of the dynamic viscoelastic properties were compared. The mid-temperature fatigue resistance and high-temperature rutting resistance of three polymer modiifed asphalts were evaluated to predict their ifeld performance in roads. Based on the current results, an improved rutting factor was proposed to determine the rutting resistance of asphalt pavements. In addition, the viscous stiffness (Gv), deifned as the reciprocal of viscous compliance, was used to evaluate the high-temperature deformation resistance of asphalt mixtures. The experimental results indicate that the asphalt containing crumb rubber only shows superior performance at mid and high service temperatures in all three modiifed asphalt binders due to the action of the crumb rubber.

  3. Realizing of Optimization of Binder Backfill Material Under Certain Strength with Fuzzy Sets

    Institute of Scientific and Technical Information of China (English)

    崔明义; 胡华


    The main factors deciding the compressive strength of binder backfill body are tailing density and binder dosage in binder backfill materials. Based on the antecedent of certain pulp density, the method of increasing the tailing density and reducing the binder dosage, or the manner of cutting down the tailing density and gaining the binder dosage are taken to guarantee the strength of backfill body. The problem that should be solved is how to determine the tailing density and the binder dosage rationally. This paper tries to realize the correct selection of the tailing density and the binder dosage in computer with the method of fuzzy mathematics.

  4. Novel Binders and Methods for Agglomeration of Ore

    Energy Technology Data Exchange (ETDEWEB)

    S. K. Kawatra; T. C. Eisele; K. A. Lewandowski; J. A. Gurtler


    Many metal extraction operations, such as leaching of copper, leaching of precious metals, and reduction of metal oxides to metal in high-temperature furnaces, require agglomeration of ore to ensure that reactive liquids or gases are evenly distributed throughout the ore being processed. Agglomeration of ore into coarse, porous masses achieves this even distribution of fluids by preventing fine particles from migrating and clogging the spaces and channels between the larger ore particles. Binders are critically necessary to produce agglomerates that will not break down during processing. However, for many important metal extraction processes there are no binders known that will work satisfactorily. Primary examples of this are copper heap leaching, where there are no binders that will work in the acidic environment encountered in this process, and advanced ironmaking processes, where binders must function satisfactorily over an extraordinarily large range of temperatures (from room temperature up to over 1200 C). As a result, operators of many facilities see a large loss of process efficiency due to their inability to take advantage of agglomeration. The large quantities of ore that must be handled in metal extraction processes also means that the binder must be inexpensive and useful at low dosages to be economical. The acid-resistant binders and agglomeration procedures developed in this project will also be adapted for use in improving the energy efficiency and performance of a broad range of mineral agglomeration applications, particularly heap leaching and advanced primary ironmaking. This project has identified several acid-resistant binders and agglomeration procedures that can be used for improving the energy efficiency of heap leaching, by preventing the ''ponding'' and ''channeling'' effects that currently cause reduced recovery and extended leaching cycle times. Methods have also been developed for iron ore

  5. Neutral hydrophilic cathode catalyst binders for microbial fuel cells

    KAUST Repository

    Saito, Tomonori


    Improving oxygen reduction in microbial fuel cell (MFC) cathodes requires a better understanding of the effects of the catalyst binder chemistry and properties on performance. A series of polystyrene-b-poly(ethylene oxide) (PS-b-PEO) polymers with systematically varying hydrophilicity were designed to determine the effect of the hydrophilic character of the binder on cathode performance. Increasing the hydrophilicity of the PS-b-PEO binders enhanced the electrochemical response of the cathode and MFC power density by ∼15%, compared to the hydrophobic PS-OH binder. Increased cathode performance was likely a result of greater water uptake by the hydrophilic binder, which would increase the accessible surface area for oxygen reduction. Based on these results and due to the high cost of PS-b-PEO, the performance of an inexpensive hydrophilic neutral polymer, poly(bisphenol A-co-epichlorohydrin) (BAEH), was examined in MFCs and compared to a hydrophilic sulfonated binder (Nafion). MFCs with BAEH-based cathodes with two different Pt loadings initially (after 2 cycles) had lower MFC performance (1360 and 630 mW m-2 for 0.5 and 0.05 mg Pt cm-2) than Nafion cathodes (1980 and 1080 mW m -2 for 0.5 and 0.05 mg Pt cm-2). However, after long-term operation (22 cycles, 40 days), power production of each cell was similar (∼1200 and 700-800 mW m-2 for 0.5 and 0.05 mg Pt cm-2) likely due to cathode biofouling that could not be completely reversed through physical cleaning. While binder chemistry could improve initial electrochemical cathode performance, binder materials had less impact on overall long-term MFC performance. This observation suggests that long-term operation of MFCs will require better methods to avoid cathode biofouling. © 2011 The Royal Society of Chemistry.

  6. Novel Binders and Methods for Agglomeration of Ore

    Energy Technology Data Exchange (ETDEWEB)

    S. K. Kawatra; T. C. Eisele; K. A. Lewandowski; J. A. Gurtler


    Many metal extraction operations, such as leaching of copper, leaching of precious metals, and reduction of metal oxides to metal in high-temperature furnaces, require agglomeration of ore to ensure that reactive liquids or gases are evenly distributed throughout the ore being processed. Agglomeration of ore into coarse, porous masses achieves this even distribution of fluids by preventing fine particles from migrating and clogging the spaces and channels between the larger ore particles. Binders are critically necessary to produce agglomerates that will not break down during processing. However, for many important metal extraction processes there are no binders known that will work satisfactorily. Primary examples of this are copper heap leaching, where there are no binders that will work in the acidic environment encountered in this process, and advanced ironmaking processes, where binders must function satisfactorily over an extraordinarily large range of temperatures (from room temperature up to over 1200 C). As a result, operators of many facilities see a large loss of process efficiency due to their inability to take advantage of agglomeration. The large quantities of ore that must be handled in metal extraction processes also means that the binder must be inexpensive and useful at low dosages to be economical. The acid-resistant binders and agglomeration procedures developed in this project will also be adapted for use in improving the energy efficiency and performance of a broad range of mineral agglomeration applications, particularly heap leaching and advanced primary ironmaking. This project has identified several acid-resistant binders and agglomeration procedures that can be used for improving the energy efficiency of heap leaching, by preventing the ''ponding'' and ''channeling'' effects that currently cause reduced recovery and extended leaching cycle times. Methods have also been developed for iron ore


    Directory of Open Access Journals (Sweden)

    Ms. Natalia V. Zakharova


    Full Text Available The possibility of using foamed polystyrene waste as the binder in manufacturing core sand mixtures. The article provides experimental data obtained by studying the core sand mixtures properties depending on the methods of addition, foamed polystyrene solution amount, its viscosity and the method of drying. The author investigates the ways of using foamed polystyrene as the binder and as the polymeric additive.

  8. Aqueous Tape Casting Process with Styrene-acrylic Latex Binder

    Institute of Scientific and Technical Information of China (English)

    CUI Xue-min; OUYANG Shi-xi; HUANG Yong; YU Zhi-yong; ZHAO Shi-ke; WANG Chang-an


    A commercial styrene-acrylic latex binder has been investigated as a good binder for aqueous Al2O3 suspensions tape-casting process. This paper focuses on the forming film mechanism of latex binder, the rheological behaviors of the suspensions, physical properties of green tapes and drying process of aqueous slurries with latex binder system. The drying process of the alumina suspensions is shown to follow a two-stage mechanism (the first stage: evaporation controlled process; and the second stage: diffusion controlled process). During the drying stage of the suspensions, the compressive force presses the latex particles and makes them be distorted, which results in cross-linking structure in contacted latex particles of the solidified tapes.A smooth-surface and high-strength green tape was fabricated by aqueous tape casting with latex binder system. The results from the SEM images of the crossing section microstructure of green tapes show that the latex is a very suitable binder for aqueous tape casting.

  9. A novel screening system for claudin binder using baculoviral display.

    Directory of Open Access Journals (Sweden)

    Hideki Kakutani

    Full Text Available Recent progress in cell biology has provided new insight into the claudin (CL family of integral membrane proteins, which contains more than 20 members, as a target for pharmaceutical therapy. Few ligands for CL have been identified because it is difficult to prepare CL in an intact form. In the present study, we developed a method to screen for CL binders by using the budded baculovirus (BV display system. CL4-displaying BV interacted with a CL4 binder, the C-terminal fragment of Clostridium perfringens enterotoxin (C-CPE, but it did not interact with C-CPE that was mutated in its CL4-binding region. C-CPE did not interact with BV and CL1-displaying BV. We used CL4-displaying BV to select CL4-binding phage in a mixture of a scFv-phage and C-CPE-phage. The percentage of C-CPE-phage in the phage mixture increased from 16.7% before selection to 92% after selection, indicating that CL-displaying BV may be useful for the selection of CL binders. We prepared a C-CPE phage library by mutating the functional amino acids. We screened the library for CL4 binders by affinity to CL4-displaying BV, and we found that the novel CL4 binders modulated the tight-junction barrier. These findings indicate that the CL-displaying BV system may be a promising method to produce a novel CL binder and modulator.

  10. A Granule Model for Evaluating Adhesion of Pharmaceutical Binders

    Directory of Open Access Journals (Sweden)

    Hossein Orafai


    Full Text Available Granule capability is defined in terms of the strength of individual granule and friability of granulation batch to withstand breaking, abrasion and compactibility. Binder(s are added to perform the above properties .The common methods to asses their capability are to test crushing strength of the granules directly and to make statistical analysis and /or testing the friability of bulk granulation. In this work four substrate models including polymethylmetacrylate beads(PMMA,glass powder, acetaminophen, and para-aminobebzoic acid were chosen. The binder models were corn starch, gelatin, methylcellulose (MC and hydroxypropylmethylcellulose (HPMC. After massing the substrates with the binder solutions, discs were produced by the mean of the mold technique. The discs were dried and conditioned and then tested for tensile strength while the failed areas were scanned by SEM. Various granulations were made and the results of friability and crush strength were compared with the discs strength .The bond areas in the SEM showed the trend with the binder concentration .A comparison of the standard deviation shows that discs have much lower level of the strength than granules. The resulting discs showed a higher performance which is related to the stems for the discs shape .In conclusion, this method is a simple and is applicable to differentiate efficacy of binder under studies.


    Energy Technology Data Exchange (ETDEWEB)

    Bailey, Alta C [ORNL; Elliott, Amy M [ORNL; Basti, Mufeed M [ORNL


    Binder jetting works by selectively depositing a binder with an inkjet print head into layers of powdered material. Compared with other metal Additive Manufacturing (AM) processes, binder jetting has significant potential for near-term adoption in manufacturing environments due to its reliability and throughput. The Achilles heel of binder jetting, however, is the inability to produce fully dense, single-alloy materials. The lack of density in printed binder jet parts is strictly dictated by the packing factor of the powder feedstock. Adding nanoparticles during printing will not only increase the part s packing factor but may also serve as a sintering aid. This study focuses on the effect of both the binder and nanoparticles on the final part density. As an unintended consequence of high nanoparticle loading, printed parts underwent a significant increase in porosity during the curing process. This unintended consequence is the apparent result of the nanoparticles blocking the exit of the solvent vapor during the curing step. Additionally, nanoparticle use for densification is validated with SEM imagery.


    Energy Technology Data Exchange (ETDEWEB)

    S.K. Kawatra; T.C. Eisele; J.A. Gurtler; C.A. Hardison; K. Lewandowski


    Many metal extraction operations, such as leaching of copper, leaching of precious metals, and reduction of metal oxides to metal in high-temperature furnaces, require agglomeration of ore to ensure that reactive liquids or gases are evenly distributed throughout the ore being processed. Agglomeration of ore into coarse, porous masses achieves this even distribution of fluids by preventing fine particles from migrating and clogging the spaces and channels between the larger ore particles. Binders are critically necessary to produce agglomerates that will not break down during processing. However, for many important metal extraction processes there are no binders known that will work satisfactorily. Primary examples of this are copper heap leaching, where there are no binders that will work in the acidic environment encountered in this process, and advanced ironmaking processes, where binders must function satisfactorily over an extraordinarily large range of temperatures (from room temperature up to over 1200 C). As a result, operators of many facilities see a large loss of process efficiency due to their inability to take advantage of agglomeration. The large quantities of ore that must be handled in metal extraction processes also means that the binder must be inexpensive and useful at low dosages to be economical. The acid-resistant binders and agglomeration procedures developed in this project will also be adapted for use in improving the energy efficiency and performance of a broad range of mineral agglomeration applications, particularly heap leaching and advanced primary ironmaking.

  13. Binder/HMX interaction in PBX9501 at Elevated Temperatures

    Energy Technology Data Exchange (ETDEWEB)

    K., S C; M., T C


    Plastic bonded explosives (PBX) generally consist of 85 - 95 % by weight energetic material, such as HMX, and 5 - 15 % polymeric binder. Understanding of the structure and morphology at elevated temperatures and pressures is important for predicting of PBX behavior in accident scenarios. The crystallographic behavior of pure HMX has been measured as functions of temperature and grain size. The investigation is extended to the high temperature behavior of PBX 9501 (95% HMX, 2.5 % Estane, 2.5 % BDNPA/F). The results show that the HMX {beta}-phase to {delta}-phase transition in PBX 9501 is similar to that in neat HMX. However, in the presence of the PBX 9501 binder, {delta}-phase HMX readily converts back to {beta}-phase during cooling. Using the same temperature profile, the conversion rate decreases for each subsequent heating and cooling cycle. As observed in earlier experiments, no reverse conversion is observed without the polymer binder. It is proposed that the reversion of {delta}-phase to {beta}-phase is due to changes in the surface molecular potential caused by the influence of the polymer binder on the surface molecules of the {delta}-phase. Upon thermal cycling, the polymer binder segregates from the HMX particles and thus reduces the influence of the binder on the surface molecules. This segregation increases the resistance for the {delta}-phase to {beta}-phase transition, as demonstrated in an aged PBX 9501 material for which the reversion is not observed.

  14. Evaluation of wettability of binders used in moulding sands

    Directory of Open Access Journals (Sweden)

    Hutera B.


    Full Text Available Binders used in moulding sand have the differential properties. One of the main parameters influencing on moulding sand properties is wettability of the sand grain by binding material. In the article some problems concerned with wettability evaluation have been presented and the importance of this parameter for quantity description of process occurring in system: binder- sand grain has been mentioned. The procedure of wetting angle measurement and operation of prototype apparatus for wettability investigation of different binders used in moulding sand have been described, as well as the results of wetting angle measurement for different binders at different conditions. The addition of little amount of proper diluent to binder results in the state of equilibrium reached almost immediately. Such addition can also reduce the value of equilibrium contact angle. The uniform distribution of binder on the surface of the sand grains and reducing of the required mixing time can be obtained. It has also a positive effect on the moulding sand strength.

  15. Development of an innovative bio-binder using Asphalt-rubber technology



    This research work evaluates several parameters that can affect Asphalt Rubber (AR) binder performance and applies the AR technology to the development of an innovative renewable bio-binder that can fully and cost-effectively replace asphaltic bitumen derived from petroleum in flexible pavement construction. The “Binder Accelerated Separator” method was used to divide the constituents of the Asphalt Rubber and bio-binder (residual binder and swelled rubber). The physical and chemi...

  16. Effect of Binder on the Structure and Properties of Silicon Powder-supported TiO2 Photocatalysis Material

    Institute of Scientific and Technical Information of China (English)

    WU Ren-Ping; GUO Jin-Yu; Chen Zhu-Ling; YU Yan


    Recoverable TiO2 photocatalysis material supported by silicon powder was pre- pared with sol-gel method, afterwards the silica gol and sodium silicate were used as molding binder respectively to investigate their effects (including binder type and binder addition quantity) on the crystal structure and catalysis properties of photocatalyst. In this work, the catalysis activity was defined as the degradation rate of methyl orange solution upon ultraviolet lamp irradiation, and the specific areas were determined with nitrogen desorption method. TiO2 crystal form was measured with X-ray powder diffraction and their micro-morphology was observed with SEM. Experimental results indicate that these two binders do not affect the crystal form transformation of TiO2, but silica gol can increase the specific surface area of TiO2 photocatalyst obviously and the addition of sodium silicate can decrease it. In all, silica gol is a better candidate than sodium silicate for higher catalysis property. In conclusion, 6% silica gol is the optimal addition concentration. Under this condition, the ratio of anatase to rutile TiO2 is 64:36, the specific area is 29.67 m2/g, and as expected, the degradation rate of methyl orange could be as high as 90% after irradiation for 5 days.

  17. Polyvinylpyrrolidone/polyvinyl butyral composite as a stable binder for castable supercapacitor electrodes in aqueous electrolytes (United States)

    Aslan, M.; Weingarth, D.; Herbeck-Engel, P.; Grobelsek, I.; Presser, V.


    Mixtures of polyvinylpyrrolidone/polyvinyl butyral (PVP/PVB) are attractive binders for the preparation of carbon electrodes for aqueous electrolyte supercapacitors. The use of PVP/PVB offers several key advantages: They are soluble in ethanol and can be used to spray coat or drain cast activated carbon (AC) electrodes directly on a current collector. Infrared spectroscopy and contact angle measurements show that the PVP-to-PVB ratio determines the degree of binder hydrophilicity. Within our study, the most favorable performance was obtained for AC electrodes with a composition of AC + 1.5 mass% PVP + 6.0 mass% PVB; such electrodes were mechanically stabile and water resistant with a PVP release of less than 5% of total PVP while PVB itself is water insoluble. Compared to when using PVDF, the specific surface area (SSA) of the assembled electrodes was 10% higher, indicating a reduced pore blocking tendency. A good electrochemical performance was observed in different aqueous electrolytes for composite electrodes with the optimized binder composition: 160 F g-1 at 1 A g-1 for 1 M H2SO4 and 6 M KOH and 120 F g-1 for 1 M NaCl. The capacitance was slightly reduced by 2.5% after cycling to 1.2 V with 1.28 A g-1 in 1 M NaCl for 10,000 times.

  18. The addition effects of macro and nano clay on the performance of asphalt binder

    Directory of Open Access Journals (Sweden)

    M. El-Shafie


    Full Text Available The study was carried out to explore the addition effect of macro and organically modified nanoclay on the physical and mechanical properties of asphalt binders. Both macroclay and modified nanoclay were blended in an asphalt binder in various percentages (starting from 2% to 8%. The blended asphalt binders were characterized using kinematic viscosity (, softening point (°C, and penetration and compared with anunmodified binder. The tensile strength of the asphalt binders was also tested as a function of clay types and content%. The results of the study indicated an increase in softening point; kinematics viscosity and decrease in binder penetration. The tensile strength of modified clay binders was enhanced at all percentages by a comparison with both macroclay and unmodified binders. The best improvements in the modified binders were obtained with 6% nanoclay.

  19. Interfacial reaction in squeeze cast SiCw/AZ91 composites with different binders

    Institute of Scientific and Technical Information of China (English)


    The whisker/matrix interfaces in squeeze cast SiCw/AZ91 composites with different binders (silica binder, acid aluminum phosphate binder and without binder), were studied by transmission electron microscopy (TEM) and high resolution electron microscopy (HREM). The SiCw/AZ91 interface is very clean in the composites with no binders. For the composites with acid aluminum phosphate binders or silica binders, there exists fine discrete interfacial reaction products MgO at the interface, and a definite orientation relationship between MgO and SiCw. The interfacial reaction products MgO is unevenly distributed at different parts of the composite ingot with silica binder, and mainly distributed to the interface at the side part of the composite cylinder. While in the SiCw/AZ91 composite with acid aluminum phosphate binder, MgO particles are distributed evenly at the interface in almost all the parts of the composite ingot.

  20. Performance analysis of flexible DSSC with binder addition (United States)

    Muliani, Lia; Hidayat, Jojo; Anggraini, Putri Nur


    Flexible DSSC is one of modification of DSSC based on its substrate. Operating at low temperature, flexible DSSC requires a binder to improve particles interconnection. This research was done to compare the morphology and performance of flexible DSSC that was produced with binder-added and binder-free. TiO2 powder, butanol, and HCl were mixed for preparation of TiO2 paste. Small amount of titanium isopropoxide as binder was added into the mixture. TiO2 paste was deposited on ITO-PET plastic substrate with area of 1x1 cm2 by doctor blade method. Furthermore, SEM, XRD, and BET characterization were done to analyze morphology and surface area of the TiO2 photoelectrode microstructures. Dyed TiO2 photoelectrode and platinum counter electrode were assembled and injected by electrolyte. In the last process, flexible DSSCs were illuminated by sun simulator to do J-V measurement. As a result, flexible DSSC containing binder showed higher performance with photoconversion efficiency of 0.31%.

  1. Performance analysis of flexible DSSC with binder addition

    Energy Technology Data Exchange (ETDEWEB)

    Muliani, Lia; Hidayat, Jojo; Anggraini, Putri Nur, E-mail: [Research Center for Electronics and Telecommunications Indonesian Institute of Sciences (PPET-LIPI) Kampus LIPI, Jl. Sangkuriang, Bandung 40135 (Indonesia)


    Flexible DSSC is one of modification of DSSC based on its substrate. Operating at low temperature, flexible DSSC requires a binder to improve particles interconnection. This research was done to compare the morphology and performance of flexible DSSC that was produced with binder-added and binder-free. TiO{sub 2} powder, butanol, and HCl were mixed for preparation of TiO{sub 2} paste. Small amount of titanium isopropoxide as binder was added into the mixture. TiO{sub 2} paste was deposited on ITO-PET plastic substrate with area of 1x1 cm{sup 2} by doctor blade method. Furthermore, SEM, XRD, and BET characterization were done to analyze morphology and surface area of the TiO{sub 2} photoelectrode microstructures. Dyed TiO{sub 2} photoelectrode and platinum counter electrode were assembled and injected by electrolyte. In the last process, flexible DSSCs were illuminated by sun simulator to do J-V measurement. As a result, flexible DSSC containing binder showed higher performance with photoconversion efficiency of 0.31%.

  2. Nanocrystalline WC with non-toxic Fe-Mn binder

    Energy Technology Data Exchange (ETDEWEB)

    Siemiaszko, Dariusz [Military University of Technology, Department of Advanced Technology and Chemistry, ul. Gen. S. Kaliskiego 2, 00-908 Warsaw (Poland); Rosinski, Marcin; Michalski, Andrzej [Warsaw University of Technology, Department of Materials Science and Engineering, Woloska 141, 02-507 Warsaw (Poland)


    Cemented carbides, based on the tungsten carbide (WC), are very popular and useful in an industry. The most important metal us as a binder in this kind of materials is cobalt. It has many advantages as a binder: very good wettability, favourable solubility with WC and thermal conductivity similar to WC. However, cost of cobalt is very high because of its low natural resources. Cobalt is not also neutral for health. It is known as an allergen and same research shown that it could cause a cancer. This paper presents results of sintering the tungsten carbides with Fe-Mn alloys as the binders. (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  3. Modified polysaccharides as alternative binders for foundry industry

    Directory of Open Access Journals (Sweden)

    K. Kaczmarska


    Full Text Available Polysaccharides constitute a wide group of important polymers with many commercial applications, for example food packaging, fibres, coatings, adhesives etc. This review is devoted to the presentation of polysaccharide application in foundry industry. In this paper the selected properties of foundry moulding sand and core sand containing modified polysaccharides as binders are presented according to foreign literature data. Also, author’s own research about effect of using moulding sand binder consisting of modified polysaccharide (modified starch or its composition with non-toxic synthetic polymers are discussed. Based on technologies taken under consideration in this paper, it could be concluded that polysaccharides are suitable as an alternative for use as binder in foundry moulding applications.

  4. Effect of crumb rubber on asphaltic binder chemistry and rheology

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Cicero de S.; Tome, Luisa G.A.; Sant' ana, Hosiberto B.; Soares, Jorge B.; Soares, Sandra A. [University Federal of Ceara, Fortaleza, CE (Brazil)


    The use of the crumb rubber (CR) from scraps tires to modify asphalt binders (AB) at high temperature can improve significantly the performance grade, but the storage stability can be influenced after the mix of AB and CR or polymer. The major concern of asphalt binder with polymer and CR blends is their lack of stability during prolonged storage at high temperatures. The tendency to phase separation under quiescent conditions appears as an important limitation for the practical use of these blends. After the RTFOT and PAV process, the binder conventional and modified was analyzed in a Fourier Transform Infrared spectrometer (FTIR) for chemical characterization. After aging in RTFOT, the AB presented a larger degradation compared to the CR of RABC and RABC commercial. So, the crumb rubber contributed to the binder stability, acting as an antioxidant in the aging process. The dynamic mechanical properties of CR modify asphalts binder before and after graft has been characterized by use of dynamic shear rheometer (DSR) or advances rheology expanded system (ARES) of Rheometric Scientific. The difference in the viscoelastic parameters between the top and the bottom sections of the tube was measured. It has been found that the added content of CR has great effect on the rheological properties of the AB and its high temperature performance. It also has been confirmed that the RABC sample showed larger storage stability compared to the sample RABC commercial observed with viscoelastic parameters. As a consequence, the use CR and aromatic oil can be considered a suitable alternative for modification of binder in pavement. (author)

  5. Influence of conductive additive on temperature susceptibility of asphalt binders

    Institute of Scientific and Technical Information of China (English)

    吴少鹏; 李波; 陈筝; 黄旭


    The effects of graphite on temperature susceptibility of asphalt binders were investigated by penetration test,Ring & Ball softening point test and viscosity test.And penetration index(IP),viscosity-temperature susceptibility(SVT),and penetration-viscosity numbers(NPV) were introduced to evaluate the effects.The results show that the penetration,softening point and viscosity of asphalt binder increase with the increase of content of graphite.This means that the addition of graphite makes asphalts stiffer.The results from IP,NPV and SVT show that temperature susceptibility is reduced by the addition of graphite.

  6. Electronically conductive polymer binder for lithium-ion battery electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Gao; Xun, Shidi; Battaglia, Vincent S.; Zheng, Honghe


    A family of carboxylic acid group containing fluorene/fluorenon copolymers is disclosed as binders of silicon particles in the fabrication of negative electrodes for use with lithium ion batteries. These binders enable the use of silicon as an electrode material as they significantly improve the cycle-ability of silicon by preventing electrode degradation over time. In particular, these polymers, which become conductive on first charge, bind to the silicon particles of the electrode, are flexible so as to better accommodate the expansion and contraction of the electrode during charge/discharge, and being conductive promote the flow battery current.

  7. Influencing of foundry bentonite mixtures by binder activation

    Directory of Open Access Journals (Sweden)

    J. Beňo


    Full Text Available Although new moulding processes for manufacture of high quality castings have been developed and introduced into foundry practice in recent years, the green-sand moulding in bentonite mixture still remains the most widely used technology. Higher utility properties of bentonite binders are achieved through their activation. This contribution is aimed at finding a suitable activating agent. A number of sodium salts and MgO based agents has been chosen. In the framework of the experiment the swelling volume of chosen agents was tested and technological parameters of a bentonite mixture with a binder activated with the studied agents were determined.

  8. Novel, inorganic composites using porous, alkali-activated, aluminosilicate binders (United States)

    Musil, Sean

    Geopolymers are an inorganic polymeric material composed of alumina, silica, and alkali metal oxides. Geopolymers are chemical and fire resistant, can be used as refractory adhesives, and are processed at or near ambient temperature. These properties make geopolymer an attractive choice as a matrix material for elevated temperature composites. This body of research investigated numerous different reinforcement possibilities and variants of geopolymer matrix material and characterized their mechanical performance in tension, flexure and flexural creep. Reinforcements can then be chosen based on the resulting properties to tailor the geopolymer matrix composites to a specific application condition. Geopolymer matrix composites combine the ease of processing of polymer matrix composites with the high temperature capability of ceramic matrix composites. This study incorporated particulate, unidirectional fiber and woven fiber reinforcements. Sodium, potassium, and cesium based geopolymer matrices were evaluated with cesium based geopolymer showing great promise as a high temperature matrix material. It showed the best strength retention at elevated temperature, as well as a very low coefficient of thermal expansion when crystallized into pollucite. These qualities made cesium geopolymer the best choice for creep resistant applications. Cesium geopolymer binders were combined with unidirectional continuous polycrystalline mullite fibers (Nextel(TM) 720) and single crystal mullite fibers, then the matrix was crystallized to form cubic pollucite. Single crystal mullite fibers were obtained by the internal crystallization method and show excellent creep resistance up to 1400°C. High temperature flexural strength and flexural creep resistance of pollucite and polycrystalline/single-crystal fibers was evaluated at 1000-1400°C.

  9. Effect of DNA groove binder distamycin A upon chromatin structure.

    Directory of Open Access Journals (Sweden)

    Parijat Majumder

    Full Text Available BACKGROUND: Distamycin A is a prototype minor groove binder, which binds to B-form DNA, preferentially at A/T rich sites. Extensive work in the past few decades has characterized the binding at the level of double stranded DNA. However, effect of the same on physiological DNA, i.e. DNA complexed in chromatin, has not been well studied. Here we elucidate from a structural perspective, the interaction of distamycin with soluble chromatin, isolated from Sprague-Dawley rat. METHODOLOGY/PRINCIPAL FINDINGS: Chromatin is a hierarchical assemblage of DNA and protein. Therefore, in order to characterize the interaction of the same with distamycin, we have classified the system into various levels, according to the requirements of the method adopted, and the information to be obtained. Isothermal titration calorimetry has been employed to characterize the binding at the levels of chromatin, chromatosome and chromosomal DNA. Thermodynamic parameters obtained thereof, identify enthalpy as the driving force for the association, with comparable binding affinity and free energy for chromatin and chromosomal DNA. Reaction enthalpies at different temperatures were utilized to evaluate the change in specific heat capacity (ΔCp, which, in turn, indicated a possible binding associated structural change. Ligand induced structural alterations have been monitored by two complementary methods--dynamic light scattering, and transmission electron microscopy. They indicate compaction of chromatin. Using transmission electron microscopy, we have visualized the effect of distamycin upon chromatin architecture at di- and trinucleosome levels. Our results elucidate the simultaneous involvement of linker bending and internucleosomal angle contraction in compaction process induced by distamycin. CONCLUSIONS/SIGNIFICANCE: We summarize here, for the first time, the thermodynamic parameters for the interaction of distamycin with soluble chromatin, and elucidate its effect on

  10. Conductive Polymeric Binder for Lithium-Ion Battery Anode (United States)

    Gao, Tianxiang

    Tin (Sn) has a high-specific capacity (993 mAhg-1) as an anode material for Li-ion batteries. To overcome the poor cycling performance issue caused by its large volume expansion and pulverization during the charging and discharging process, many researchers put efforts into it. Most of the strategies are through nanostructured material design and introducing conductive polymer binders that serve as matrix of the active material in anode. This thesis aims for developing a novel method for preparing the anode to improve the capacity retention rate. This would require the anode to have high electrical conductivity, high ionic conductivity, and good mechanical properties, especially elasticity. Here the incorporation of a conducting polymer and a conductive hydrogel in Sn-based anodes using a one-step electrochemical deposition via a 3-electrode cell method is reported: the Sn particles and conductive component can be electrochemically synthesized and simultaneously deposited into a hybrid thin film onto the working electrode directly forming the anode. A well-defined three dimensional network structure consisting of Sn nanoparticles coated by conducting polymers is achieved. Such a conductive polymer-hydrogel network has multiple advantageous features: meshporous polymeric structure can offer the pathway for lithium ion transfer between the anode and electrolyte; the continuous electrically conductive polypyrrole network, with the electrostatic interaction with elastic, porous hydrogel, poly (2-acrylamido-2-methyl-1-propanesulfonic acid-co-acrylonitrile) (PAMPS) as both the crosslinker and doping anion for polypyrrole (PPy) can decrease the volume expansion by creating porous scaffold and softening the system itself. Furthermore, by increasing the amount of PAMPS and creating an interval can improve the cycling performance, resulting in improved capacity retention about 80% after 20 cycles, compared with only 54% of that of the control sample without PAMPS. The cycle

  11. Effects of Fiber Finish on the Performance of Asphalt Binders and Mastics

    Directory of Open Access Journals (Sweden)

    Bradley J. Putman


    Full Text Available The objective of this study was to determine the effects of finishes applied to polyester fibers on the properties of asphalt binders and mastics. Asphalt binders were mixed with finishes that were extracted from the fibers, and mastics were also made with binder and fibers (with and without finish to isolate the effects of the finish. The results indicated that crude source plays a significant role in how the fiber finish affects the binders and mastics. Additionally different finishes had different effects on binder properties. The major finding of this study is that different polyester fibers, even from the same manufacturer, may not necessarily perform the same in an asphalt mixture. It is important to use fibers that are compatible with the particular asphalt binder that is being used because of the significance of the binder source on the interaction between the finish and the binder.

  12. Comparison of efficacy of the phosphate binders nicotinic acid and sevelamer hydrochloride in hemodialysis patients

    National Research Council Canada - National Science Library

    Ahmadi, Farrokhlagha; Shamekhi, Fatemeh; Lessan-Pezeshki, Mahbob; Khatami, Mohammad Reza


    ...), and must be controlled with the use of phosphate binders. Studies comparing the effects of sevelamer and nicotinic acid, both similar non-calcium and non-aluminum phosphate binders, are not available...

  13. Oil-acrylic hybrid latexes as binders for waterborne coatings

    NARCIS (Netherlands)

    Hamersveld, van E.M.S.; Es, van J.; German, A.L.; Cuperus, F.P.; Weissenborn, P.; Hellgren, A.C.


    The combination of the characteristics of oil, or alkyd, emulsions and acrylic latexes in a waterborne binder has been the object of various studies in the past. Strategies for combining the positive properties of alkyds, e.g. autoxidative curing, gloss and penetration in wood, with the fast drying

  14. Haemodynamic and respiratory effects of an abdominal compression binder

    DEFF Research Database (Denmark)

    Toft, Mette Helene; Bülow, Jens; Simonsen, Lene


    In order to elucidate the circulatory and respiratory effects of a newly developed abdominal compression binder 25 healthy, normal weight subjects were studied. In supine position the central haemodynamics were measured and estimated with a Finapress device. Lower extremity venous haemodynamics w...

  15. 46 CFR 308.103 - Insured amounts under interim binder. (United States)


    ... INSURANCE War Risk Hull and Disbursements Insurance § 308.103 Insured amounts under interim binder. (a... chapter. (b) Insurance risks. Insurance risks covered by the terms of the standard form of war risk hull... insurance additional to the war risk hull insurance provided under this subpart, and payment of claim......

  16. Evaluation of Reclamability of Molding Sands with New Inorganic Binders

    Directory of Open Access Journals (Sweden)

    I. Izdebska-Szanda


    Full Text Available One of the purposes of the application of chemically modified inorganic binders is to improve knocking out properties and the related reclamability with previously used in foundry inorganic binder (water glass, which allowing the use of ecological binders for casting non- ferrous metals. Good knocking out properties of the sands is directly related to the waste sands reclamability, which is a necessary condition of effective waste management. Reclamation of moulding and core sands is a fundamental and effective way to manage waste on site at the foundry, in accordance with the Environmental Guidelines. Therefore, studies of reclamation of waste moulding and core sands with new types of inorganic binders (developed within the framework of the project were carried out. These studies allowed to determine the degree of recovery of useful, material, what the reclaimed sand is, and the degree of its use in the production process. The article presents these results of investigation. They are a part of broader research programme executed under the project POIG.01.01.02-00- 015/09 "Advanced materials and technologies".

  17. Multimodality and Immigrant Children (Response to Marni Binder) (United States)

    Campano, Gerald; Low, David


    This response to Marni Binder reflects upon two examples of (im)migrant children's artwork and challenges the dominant notion that (im)migration experiences--and their subsequent portrayals--can be fit into neat slots. The authors position multimodal composing opportunities as affording children a vital instrument for deploying their full semiotic…

  18. 40 CFR 427.30 - Applicability; description of the asbestos paper (starch binder) subcategory. (United States)


    ... asbestos paper (starch binder) subcategory. 427.30 Section 427.30 Protection of Environment ENVIRONMENTAL... Asbestos Paper (Starch Binder) Subcategory § 427.30 Applicability; description of the asbestos paper (starch binder) subcategory. The provisions of this subpart are applicable to discharges resulting...


    Directory of Open Access Journals (Sweden)

    Kimberly Farrand


    Serum P can be difficult to control following initiation of HD. Patients with elevated serum P were younger, and most had higher P binder use than the reference group. Overall, binder use was lower than in other studies of HD patients. Dietary education and higher doses of the most effective P binders may be needed to improve P management.

  20. Novel Binders and Methods for Agglomeration of Ore

    Energy Technology Data Exchange (ETDEWEB)

    S. K. Kawatra; T. C. Eisele; K. A. Lewandowski; J. A. Gurtler


    Heap leaching is one of the methods being used to recover metal from low grade ore deposits. The main problem faced during heap leaching is the migration of fine grained particles through the heap, forming impermeable beds which result in poor solution flow. The poor solution flow leads to less contact between the leach solution and the ore, resulting in low recovery rates. Agglomeration of ore into coarse, porous masses prevents fine particles from migrating and clogging the spaces and channels between the larger ore particles. Currently, there is one facility in the United States which uses agglomeration. This operation agglomerates their ore using leach solution (raffinate), but is still experiencing undesirable metal recovery from the heaps due to agglomerate breakdown. The use of a binder, in addition to the leach solution, during agglomeration would help to produce stronger agglomerates that did not break down during processing. However, there are no known binders that will work satisfactorily in the acidic environment of a heap, at a reasonable cost. As a result, operators of many facilities see a large loss of process efficiency due to their inability to take advantage of agglomeration. Increasing copper recovery in heap leaching by the use of binders and agglomeration would result in a significant decrease in the amount of energy consumed. Assuming that 70% of all the leaching heaps would convert to using agglomeration technology, as much as 1.64*10{sup 12} BTU per year would be able to be saved if a 25% increase in copper recovery was experienced, which is equivalent to saving approximately 18% of the energy currently being used in leaching heaps. For every week a leach cycle was decreased, a savings of as much as 1.23*10{sup 11} BTU per week would result. This project has identified several acid-resistant binders and agglomeration procedures. These binders and experimental procedures will be able to be used for use in improving the energy efficiency of

  1. Investigation of the ageing effects on phenol-urea-formaldehyde binder and alkanol amine-acid anhydride binder coated mineral fibres

    DEFF Research Database (Denmark)

    Zafar, Ashar; Schjødt-Thomsen, Jan; Sodhi, R.;


    Phenol-Urea-Formaldehyde (PUF) binder coated mineral fibres' mechanical properties have been observed to degrade during ageing at elevated temperatures and humidity, while alkanol amine-acid anhydride binder based mineral fibres exhibited better ageing properties for same duration of ageing. X......-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) were employed to identify the chemical changes occurring in the PUF binder coated mineral fibres and alkanol amine-acid anhydride binder coated mineral fibres during that ageing. The samples were aged in a climate...... of amide, methylene ether and methylene linkages between urea groups present in the PUF binder. In the case of the alkanol amine-acid anhydride binder coated mineral fibres, both XPS and ToF-SIMS techniques consistently showed that the surface chemical composition of the organic components of the alkanol...

  2. Investigation of the ageing effects on phenol-urea-formaldehyde binder and alkanol amine-acid anhydride binder coated mineral fibres

    DEFF Research Database (Denmark)

    Zafar, Ashar; Schjødt-Thomsen, Jan; Sodhi, R.


    . Principal Component Analysis (PCA) was applied on the positive and negative ToF-SIMS spectra of the PUF binder coated mineral fibres, showing a decrease in the concentration of the nitrogen containing peaks during ageing. This decrease was attributed to the depolymerisation of the binder due to hydrolysis......Phenol-Urea-Formaldehyde (PUF) binder coated mineral fibres' mechanical properties have been observed to degrade during ageing at elevated temperatures and humidity, while alkanol amine-acid anhydride binder based mineral fibres exhibited better ageing properties for same duration of ageing. X......-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) were employed to identify the chemical changes occurring in the PUF binder coated mineral fibres and alkanol amine-acid anhydride binder coated mineral fibres during that ageing. The samples were aged in a climate...


    Directory of Open Access Journals (Sweden)

    Osman Sivrikaya


    Full Text Available This study was started to find alternative binders to bentonite and to recover the low preheated and fired pellet mechanical strengths of organic binders-bonded pellets. Bentonite is considered as a chemical impurity for pellet chemistry due to acid constituents (SiO2 and Al2O3. Especially addition of silica-alumina bearing binders is detrimental for iron ore concentrate with high acidic content. Organic binders are the most studied binders since they are free in silica. Although they yield pellets with good wet strength; they have found limited application in industry since they fail to give sufficient physical and mechanical strength to preheated and fired pellets. It is investigated that how insufficient preheated and fired pellet strengths can be improved when organic binders are used as binder. The addition of a slag bonding/strength increasing constituent (free in acidic contents into pellet feed to provide pellet strength with the use of organic binders was proposed. Addition of boron compounds such as colemanite, tincal, borax pentahydrate, boric acid together with organic binders such as CMC, starch, dextrin and some organic based binders, into magnetite and hematite pellet mixture was tested. After determining the addition of boron compounds is beneficial to recover the low pellet physical and mechanical qualities in the first part of this study, in this second part, metallurgical and chemical properties (reducibility - swelling index – microstructure – mineralogy - chemical content of pellets produced with combined binders (an organic binder plus a boron compound were presented. The metallurgical and chemical tests results showed that good quality product pellets can be produced with combined binders when compared with the bentonite-bonded pellets. Hence, the suggested combined binders can be used as binder in place of bentonite in iron ore pelletizing without compromising the pellet chemistry.

  4. Effects of Fibre Additive on the High Temperature Property of Asphalt Binder

    Institute of Scientific and Technical Information of China (English)


    Polyester fibre and floc xylogen fibre were used to prepare fibre-asphalt binder.An SHRP's dynamic shear rheometer (DSR) was employed to investigate the rheology charac teristics of fibre-asphalt binder, andthe flow resistance of binder was revealed by combining the rutting parameter, G * / sinδ.The results indicate that both kinds of fibres remarkably improved the high temperature pe~orrnance of asphalt binder.At the same time, the reinforcement mechanism of the fibres in the asphalt binder was also analyzed.

  5. Alkali-activated binders/geopolymer and an application to environmental engineering

    Directory of Open Access Journals (Sweden)

    Nida Chaimoon


    Full Text Available For environmental reason, new binders that can be used as Portland cement replacement materials are being needed. Recently, alkali-activated binders (AAB and geopolymer have found increasing interest. As several research reports have showed that the two new binders are likely to have high potential to be developed and become an alternative to OPC. However, confusion in the classification of both binders is still there. This paper reviews knowledge about AAB and geopolymer including historical background, reaction mechanisms and reaction products. The similarities and differences of both binders are discussed. The application to environmental engineering on hazardous waste management using stabilization/solidification is also described.

  6. Effect of modified humic acid binder on pelletisation of specularite concentrates

    Institute of Scientific and Technical Information of China (English)

    周友连; 张元波; 刘兵兵; 李光辉; 姜涛


    A modified humic acid (MHA) binder was tested as a substitute for bentonite to prepare qualified specularite pellets. The results show that there is stronger chemisorption between organic functional groups in MHA binder molecular and specularite particles, improving the green pellet strength. MHA binder has obvious effect on the strength and microstructure of preheated pellets due to the thermal decomposition of organic matters in MHA binder. Appropriately increasing preheating temperature or time can eliminate the adverse impact of organic matters on the preheated pellet strength. Compared with the bentonite pellets, the roasted pellets with MHA binder have a more compact microstructure, and the recrystallization of the Fe2O3 crystal grains is better. Consequently, under optimal conditions, 0.75%(mass fraction) MHA binder pellets have equal or better pellet strengths and contain 1.06%more total iron than 2%bentonite pellets. The testing results indicate that MHA binder is a promising and effective alternative to bentonite for the specularite pellets.

  7. Investigation of Ageing Effects on Organic Binders used for Mineral Wool Products

    DEFF Research Database (Denmark)

    Zafar, Ashar

    for the same duration of ageing. The main purpose of the present work is to examine the chemical changes occurring in the phenol-urea-formaldehyde binder based mineral fibres due to ageing, which cause deterioration of the mechanical properties of mineral wool products. This has been done using surface...... properties is the PUF binder, therefore further research work was performed to the pure PUF binder coatings to directly observe the ageing effects on the surface chemistry of the binder. High mass resolution ToFSIMS spectra of the pure PUF binder coatings confirmed that the depolymerisation of the cured......Phenol-Urea-Formaldehyde (PUF) binder based mineral wool products’ mechanical properties have been observed to degrade during ageing at elevated temperatures and humidity, while mineral wool products based on a newly developed alkanol amine-acid anhydride binder exhibited better ageing properties...

  8. A binder phase of TiO based cermets

    Institute of Scientific and Technical Information of China (English)

    LI Qing-kui; GUAN Shao-kang; ZHONH Hui; LI Jiang; ZHONG Hai-yun


    A binder phase of TiO based cermets, a kind of imitated gold materials, was developed by adding active element Si to Fe-Cr alloy, and the related mechanisms were studied. The wettability, matching in thermodynamics and interfacial strength were investigated by the high temperature sessile drop method and element area scanning. The linear expansion coefficients of the materials were measured using TAH100 thermal analyzer. The results show that the wettability of Fe-Cr alloy on TiO are small, with a wetting angle about 90°. After adding some Si in Fe-Cr alloy, its wetting angle can be decreased to about 25°, the interfacial reactions can be prevented effectively and high interface binding can be formed. Fe-25%Cr-1.5%Si matches the thermal expansion coefficient of TiO, so it is a kind of relatively perfect binder for TiO based cermets imitated gold.

  9. Preparation of Flame Retardant Modified with Titanate for Asphalt Binder

    Directory of Open Access Journals (Sweden)

    Bo Li


    Full Text Available Improving the compatibility between flame retardant and asphalt is a difficult task due to the complex nature of the materials. This study explores a low dosage compound flame retardant and seeks to improve the compatibility between flame retardants and asphalt. An orthogonal experiment was designed taking magnesium hydroxide, ammonium polyphosphate, and melamine as factors. The oil absorption and activation index were tested to determine the effect of titanate on the flame retardant additive. The pavement performance test was conducted to evaluate the effect of the flame retardant additive. Oxygen index test was conducted to confirm the effect of flame retardant on flame ability of asphalt binder. The results of this study showed that the new composite flame retardant is more effective in improving the compatibility between flame retardant and asphalt and reducing the limiting oxygen index of asphalt binder tested in this study.

  10. Studies on organic binders with high infrared transparency*

    Institute of Scientific and Technical Information of China (English)

    Fu Cheng-Wu; Zhou Hao-Shen; Chen Ming-Qing


    This paper reports that two kinds of polymers with high infrared transparency and good mechanical and physical properties have been prepared. An internal standard method is used to evaluate the infrared transparency of the binders.The physical and mechanical properties of the binders are measured according to corresponding standards. The results show the absorbance of polymer A in 8-14 μm range is 26% that of the ethylene-vinyl acetate copolymer (EVA), and polymer B is 9% that of the EVA correspondingly. The film of polymer A shows good flexibility of above 1 mm, a hardness of grade 1, and adhesion of grade 2. The film of polymer B shows good flexibility of above 1 mm, a hardness of grade 1, and adhesion of grade 1.

  11. Characterization of low-purity clays for geopolymer binder formulation (United States)

    Mostafa, Nasser Y.; Mohsen, Q.; El-maghraby, A.


    The production of geopolymer binders from low-purity clays was investigated. Three low-purity clays were calcined at 750°C for 4 h. The calcined clays were chemically activated by the alkaline solutions of NaOH and Na2SiO3. The compressive strength was measured as a function of curing time at room temperature and 85°C. The results were compared with those of a pure kaolin sample. An amorphous aluminosilicate polymer was formed in all binders at both processing temperatures. The results show that, the mechanical properties depend on the type and amount of active aluminum silicates in the starting clay material, the impurities, and the processing temperature.

  12. Characterization of low-purity clays for geopolymer binder formulation

    Institute of Scientific and Technical Information of China (English)

    Nasser Y.Mostafa; Q.Mohsen; A.El-maghraby


    The production of geopolymer binders from low-purity clays was investigated. Three low-purity clays were calcined at 750°C for 4 h. The calcined clays were chemically activated by the alkaline solutions of NaOH and Na2SiO3. The compressive strength was measured as a function of curing time at room temperature and 85°C. The results were compared with those of a pure kaolin sample. An amorphous aluminosilicate polymer was formed in all binders at both processing temperatures. The results show that, the mechanical properties depend on the type and amount of active aluminum silicates in the starting clay material, the impurities, and the processing temperature.

  13. Electronically conductive polymer binder for lithium-ion battery electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Gao; Battaglia, Vincent S.; Park, Sang -Jae


    A family of carboxylic acid groups containing fluorene/fluorenon copolymers is disclosed as binders of silicon particles in the fabrication of negative electrodes for use with lithium ion batteries. Triethyleneoxide side chains provide improved adhesion to materials such as, graphite, silicon, silicon alloy, tin, tin alloy. These binders enable the use of silicon as an electrode material as they significantly improve the cycle-ability of silicon by preventing electrode degradation over time. In particular, these polymers, which become conductive on first charge, bind to the silicon particles of the electrode, are flexible so as to better accommodate the expansion and contraction of the electrode during charge/discharge, and being conductive promote the flow battery current.

  14. Electronically conductive polymer binder for lithium-ion battery electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Gao; Xun, Shidi; Battaglia, Vincent S.; Zheng, Honghe; Wu, Mingyan


    A family of carboxylic acid groups containing fluorene/fluorenon copolymers is disclosed as binders of silicon particles in the fabrication of negative electrodes for use with lithium ion batteries. Triethyleneoxide side chains provide improved adhesion to materials such as, graphite, silicon, silicon alloy, tin, tin alloy. These binders enable the use of silicon as an electrode material as they significantly improve the cycle-ability of silicon by preventing electrode degradation over time. In particular, these polymers, which become conductive on first charge, bind to the silicon particles of the electrode, are flexible so as to better accommodate the expansion and contraction of the electrode during charge/discharge, and being conductive promote the flow battery current.

  15. Effectiveness and cost-efficiency of phosphate binders in hemodialysis

    Directory of Open Access Journals (Sweden)

    Zsifkovits, Johannes


    Full Text Available Health political background: In 2006, the prevalence of chronic renal insufficiency in Germany was 91,718, of which 66,508 patients were on dialysis. The tendency is clearly growing. Scientific background: Chronic renal insufficiency results in a disturbance of the mineral balance. It leads to hyperphosphataemia, which is the strongest independent risk factor for mortality in renal patients. Usually, a reduction in the phosphate intake through nutrition and the amount of phosphate filtered out during dialysis are not sufficient to reduce the serum phosphate values to the recommended value. Therefore, phosphate binders are used to bind ingested phosphate in the digestive tract in order to lower the phosphate concentration in the serum. Four different groups of phosphate binders are available: calcium- and aluminium salts are the traditional therapies. Sevelamer and Lanthanum are recent developments on the market. In varying doses, all phosphate binders are able to effectively lower phosphate concentrations. However, drug therapies have achieved recommended phosphate levels in only 50 percent of patients during the last years. Research questions: How effective and efficient are the different phosphate binders in chronic renal insufficient patients? Methods: The systematic literature search yielded 1,251 abstracts. Following a two-part selection process with predefined criteria 18 publications were included in the assessment. Results: All studies evaluated conclude that serum phosphate, serum calcium and intact parathyroid hormone can be controlled effectively with all phosphate binders. Only the number of episodes of hypercalcaemia is higher when using calcium-containing phosphatebinders compared to Sevelamer and Lanthanum. Regarding the mortality rate, the cardiovascular artery calcification and bone metabolism no definite conclusions can be drawn. In any case, the amount of calcification at study start seems to be crucial for the further

  16. Electronically conductive polymer binder for lithium-ion battery electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Gao; Xun, Shidi; Battaglia, Vincent S.; Zheng, Honghe; Wu, Mingyan


    A family of carboxylic acid groups containing fluorene/fluorenon copolymers is disclosed as binders of silicon particles in the fabrication of negative electrodes for use with lithium ion batteries. Triethyleneoxide side chains provide improved adhesion to materials such as, graphite, silicon, silicon alloy, tin, tin alloy. These binders enable the use of silicon as an electrode material as they significantly improve the cycle-ability of silicon by preventing electrode degradation over time. In particular, these polymers, which become conductive on first charge, bind to the silicon particles of the electrode, are flexible so as to better accommodate the expansion and contraction of the electrode during charge/discharge, and being conductive promote the flow battery current.

  17. Optimization of propellant binders - part I: statistical methodology

    Energy Technology Data Exchange (ETDEWEB)

    Niehaus, Michael; Greeb, Olaf [Fraunhofer Institut fuer Chemische Technologie, D-76327 Pfinztal (Germany)


    The development of new propellant binder systems requires the thermodynamic calculation of physico-chemical data as well as the adaption of the mechanical properties in order to achieve a reliable innerballistic profile of the resulting propellant. However, in most cases the mechanical data may not be easily predicted due to the complex interactions between the components of the binder like the resin, the curing agent or possibly plasticizers and curing catalysts. Therefore, this study focusses on the capability of the multivariate analysis on the prediction of the E-modulus of a system comprising nitrocellulose as well as GAP, Desmodur N100 and an energetic plasticiser. Using this method, an equation has been derived which, within the regression intervall, may be used for the prediction of the E-modulus as a function of the components mentioned above. (Abstract Copyright [2004], Wiley Periodicals, Inc.)

  18. Mechanical Activation of Construction Binder Materials by Various Mills (United States)

    Fediuk, R. S.


    The paper deals with the mechanical grinding down to the nano powder of construction materials. During mechanical activation a composite binder active molecules cement minerals occur in the destruction of the molecular defects in the areas of packaging and breaking metastable phase decompensation intermolecular forces. The process is accompanied by a change in the kinetics of hardening of portland cement. Mechanical processes during grinding mineral materials cause, along with the increase in their surface energy, increase the Gibbs energy of powders and, respectively, their chemical activity, which also contributes to the high adhesion strength when contacting them with binders. Thus, the set of measures for mechanical activation makes better use of the weight of components filled with cement systems and adjust their properties. At relatively low cost is possible to provide a spectacular and, importantly, easily repeatable results in a production environment.

  19. Toward practical application of functional conductive polymer binder for a high-energy lithium-ion battery design. (United States)

    Zhao, Hui; Wang, Zhihui; Lu, Peng; Jiang, Meng; Shi, Feifei; Song, Xiangyun; Zheng, Ziyan; Zhou, Xin; Fu, Yanbao; Abdelbast, Guerfi; Xiao, Xingcheng; Liu, Zhi; Battaglia, Vincent S; Zaghib, Karim; Liu, Gao


    Silicon alloys have the highest specific capacity when used as anode material for lithium-ion batteries; however, the drastic volume change inherent in their use causes formidable challenges toward achieving stable cycling performance. Large quantities of binders and conductive additives are typically necessary to maintain good cell performance. In this report, only 2% (by weight) functional conductive polymer binder without any conductive additives was successfully used with a micron-size silicon monoxide (SiO) anode material, demonstrating stable and high gravimetric capacity (>1000 mAh/g) for ∼500 cycles and more than 90% capacity retention. Prelithiation of this anode using stabilized lithium metal powder (SLMP) improves the first cycle Coulombic efficiency of a SiO/NMC full cell from ∼48% to ∼90%. The combination enables good capacity retention of more than 80% after 100 cycles at C/3 in a lithium-ion full cell.

  20. Conductive Polymer Binder-Enabled SiO-SnxCoyCz Anode for High-Energy Lithium-Ion Batteries. (United States)

    Zhao, Hui; Fu, Yanbao; Ling, Min; Jia, Zhe; Song, Xiangyun; Chen, Zonghai; Lu, Jun; Amine, Khalil; Liu, Gao


    A SiOSnCoC composite anode is assembled using a conductive polymer binder for the application in next-generation high energy density lithium-ion batteries. A specific capacity of 700 mAh/g is achieved at a 1C (900 mA/g) rate. A high active material loading anode with an areal capacity of 3.5 mAh/cm(2) is demonstrated by mixing SiOSnCoC with graphite. To compensate for the lithium loss in the first cycle, stabilized lithium metal powder (SLMP) is used for prelithiation; when paired with a commercial cathode, a stable full cell cycling performance with a 86% first cycle efficiency is realized. By achieving these important metrics toward a practical application, this conductive polymer binder/SiOSnCoC anode system presents great promise to enable the next generation of high-energy lithium-ion batteries.

  1. Effect of base bitumen composition on asphalt rubber binder properties


    Partl, M.N.; Ould-Henia, M.; Dumont, A.-G.


    The asphalt rubber blend properties are strongly related to its base components properties. The base bitumen composition is considered as a key factor influencing the final rheological properties of asphalt rubber binder. This paper describes results from a laboratory investigation of the interaction between crumb rubber and different composition bitumen according to the wet process. The bitumen composition is determined according to the SARA decomposition approac...

  2. Layered manganese oxides-decorated and nickel foam-supported carbon nanotubes as advanced binder-free supercapacitor electrodes

    KAUST Repository

    Huang, Ming


    Three-dimensional carbon nanotubes@MnO2 core-shell nanostructures grown on Ni foam for binder-free capacitor electrodes have been fabricated by a floating catalyst chemical vapor deposition process and a facile hydrothermal approach. Ultrathin layered MnO2 nanosheets are uniformly coated on the surface of the carbon nanotubes (CNTs), directly grown on Ni foam. This unique well-designed binder-free electrode exhibits a high specific capacitance (325.5 F g-1 at a current density of 0.3 A g-1), good rate capability (70.7% retention), and excellent cycling stability (90.5% capacitance retention after 5000 cycles), due to the high conductivity of the close contact between CNTs and Ni foam, as well as the moderate specific surface area of the CNTs@MnO2 core-shell nanostructures. The developed synthetic strategy may provide design guidelines for constructing advanced binder-free supercapacitors electrode. © 2014 Elsevier B.V. All rights reserved.

  3. Comparative Assessment of Stabilised Polybutadiene Binder under Accelerated Ageing

    Directory of Open Access Journals (Sweden)

    Luiz Felipe Cannaval Sbegue


    Full Text Available Polybutadiene elastomers are versatile materials, being employed at several applications from rocket propellant binder to adhesives and sealants. The elastomers derived from hydroxyl-terminated polybutadiene are usually stabilised with antioxidants to prevent degradation. In this study, a comparative assessment among 2,2’-methylene-bis (4-methyl-6-tert-butylphenol (AO2246, 2,6-di-tert-butyl-4-methylphenol (BHT, p-phenylenediamine (pPDA, and triphenylphosphine (TPP regarding stabilisation of hydroxyl-terminated polybutadiene binder under accelerated ageing (six months at 65 °C was carried out. Evaluation of antioxidants effectiveness was examined through Oxidation Induction time, sol/gel extraction, swelling and mechanical testing, dynamic mechanical analysis, and mass variation measurement. AO2246 yielded the best performance, meanwhile BHT was poorly protective. TPP acted as prooxidant, causing a severe degradation of the binder, and pPDA was not manageable to be assessed due to the lower curing degree of the resulted polyurethane.

  4. Preparation of carbon brushes with thermosetting resin binder

    Institute of Scientific and Technical Information of China (English)


    Carbon brushes with a resin binder were prepared according to an industrial process and the effects of the molding pressure, grains size and cure temperature on the properties of brush samples were discussed. The results show that the bulk density,bending strength and Rockwell hardness increase, while resistivity decreases with increasing molding pressure. Cure temperature has much more influence on the properties of brushes than molding pressure and grains size. Isothermal differential scanning calorimetry(DSC) was used to estimate the degree of cure of resin binder and a novel method of using the true density to measure the degree of cure of resin binder was presented and discussed briefly. Based on optimal process parameters carbon brushes were manufactured, durability tests for brushes were carried out on an alternate current motor and scanning electron microscope(SEM)was adopted to observe the morphology of worn surface of brushes. The results show that a luster oxide film can be formed on the surface of brushes and their service life reaches 380 h.

  5. Comparative evaluation of an experimental binder in hot-mix asphalt: correlating the predicted performance of the binder with asphalt testing

    CSIR Research Space (South Africa)

    O'Connell, Johannes S


    Full Text Available The binder is an important constituent of an asphalt mix and it affects the overall performance of the mix, especially with regards to permanent deformation and fatigue cracking. The stiffest binder available from the Chevron refinery in the Western...

  6. Microchemical Study of Pigments and Binders in Polychrome Relics from Maiji Mountain Grottoes in Northwestern China. (United States)

    Liu, Luyao; Shen, Wei; Zhang, Bingjian; Ma, Qian


    In this study, an integrated analytical method was developed to investigate the composition of both the inorganic pigments and organic binders of polychrome relics in Maiji Mountain Grottoes in northwestern China. Cross-sections of each sample were prepared at the beginning of the study, and all experiments were carried out on these cross-sections. Polychromic structures were revealed by optical microscopy and scanning electron microscopy-backscattered electron imaging. Inorganic materials were determined by using SEM coupled with an energy dispersive spectrometer and μ-Raman spectrometer, whereas organic materials were identified by staining techniques and highly sensitive and specific immunofluorescence microscopy. Data showed that the red colors are attributed to one or two pigments of red ochre, cinnabar, and minium; the blue pigment is natural lazurite; the green pigment is ascribed to atacamite; the white color is attributed to potassium feldspar; and the black surface is formed by the discoloration of minium to plattnerite under the influence of environmental factors. Regarding organic binders used in painting and preparation layers, mammalian animal glue and chicken egg white were both found alone or in mixture. Finally, the conclusion is made that the Secco technique is employed in polychrome relics from Maiji Mountain Grottoes.

  7. Effect of binders on 500mg metformin hydrochloride tablets produced by wet granulation

    Directory of Open Access Journals (Sweden)



    Full Text Available Metformin hydrochloride (MH is an oral hypoglycemic agent and a high-dose drug that has poor flow and compression properties. In this study, the feasibility of developing adequate, low cost 500mg tablets of metformin hydrochloride by wet granulation was tested with several binders (Starch / PVP K30®; Starch 1500® /PVP K30®, PVP K30® and PVP K90® in a simple tablet press of the type used in small pharmaceutical laboratories. The drug powder was tested for ability to flow, by determining Carr’s Index (CI and the Hausner ratio (HR. Differential scanning calorimetry and thermogravimetric analysis were carried out on isolated MH and 1:1 (w/w binary mixtures with the excipients. The size distribution, friability, flow properties and drug content of the granules were analyzed, as were the hardness, friability, disintegration, dissolution and uniformity of the dosage form. The drug powder showed CI > 22% and HR > 1.25, characteristic of a poor flow powder, and no significant incompatibilities with the excipients. All the granules showed adequate flow properties and were suitable for pressing into tablets, all of which complied with pharmacopeial specifications. The starch /PVP K30® and starch 1500® /PVP K30® mixtures were best for producing 500 mg MH tablets. Keywords: Metformin hydrochloride. Tablets. Wet granulation. Binders.

  8. Additive Manufacturing Processes: Selective Laser Melting, Electron Beam Melting and Binder Jetting-Selection Guidelines. (United States)

    Gokuldoss, Prashanth Konda; Kolla, Sri; Eckert, Jürgen


    Additive manufacturing (AM), also known as 3D printing or rapid prototyping, is gaining increasing attention due to its ability to produce parts with added functionality and increased complexities in geometrical design, on top of the fact that it is theoretically possible to produce any shape without limitations. However, most of the research on additive manufacturing techniques are focused on the development of materials/process parameters/products design with different additive manufacturing processes such as selective laser melting, electron beam melting, or binder jetting. However, we do not have any guidelines that discuss the selection of the most suitable additive manufacturing process, depending on the material to be processed, the complexity of the parts to be produced, or the design considerations. Considering the very fact that no reports deal with this process selection, the present manuscript aims to discuss the different selection criteria that are to be considered, in order to select the best AM process (binder jetting/selective laser melting/electron beam melting) for fabricating a specific component with a defined set of material properties.

  9. Additive Manufacturing Processes: Selective Laser Melting, Electron Beam Melting and Binder Jetting—Selection Guidelines

    Directory of Open Access Journals (Sweden)

    Prashanth Konda Gokuldoss


    Full Text Available Additive manufacturing (AM, also known as 3D printing or rapid prototyping, is gaining increasing attention due to its ability to produce parts with added functionality and increased complexities in geometrical design, on top of the fact that it is theoretically possible to produce any shape without limitations. However, most of the research on additive manufacturing techniques are focused on the development of materials/process parameters/products design with different additive manufacturing processes such as selective laser melting, electron beam melting, or binder jetting. However, we do not have any guidelines that discuss the selection of the most suitable additive manufacturing process, depending on the material to be processed, the complexity of the parts to be produced, or the design considerations. Considering the very fact that no reports deal with this process selection, the present manuscript aims to discuss the different selection criteria that are to be considered, in order to select the best AM process (binder jetting/selective laser melting/electron beam melting for fabricating a specific component with a defined set of material properties.

  10. Clean, agile alternative binders, additives and plasticizers for propellant and explosive formulations

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.M. [Lawrence Livermore National Lab., CA (United States); Hawkins, T.W. [Phillips Lab., Edwards AFB, CA (United States); Lindsay, G.A. [Naval Weapons Station, China Lake, CA (United States)] [and others


    As part of the Strategic Environmental Research and Development Program (SERDP) a clean, agile manufacturing of explosives, propellants and pyrotechniques (CANPEP) effort set about to identify new approaches to materials and processes for producing propellants, explosives and pyrotechniques (PEP). The RDX based explosive PBXN-109 and gun propellant M-43 were identified as candidates for which waste minimization and recycling modifications might be implemented in a short time frame. The binders, additives and plasticizers subgroup identified cast non-curable thermoplastic elastomer (TPE) formulations as possible replacement candidates for these formulations. Paste extrudable explosives were also suggested as viable alternatives to PBXN-109. Commercial inert and energetic TPEs are reviewed. Biodegradable and hydrolyzable binders are discussed. The applicability of various types of explosive formulations are reviewed and some issues associated with implementation of recyclable formulations are identified. It is clear that some processing and weaponization modifications will need to be made if any of these approaches are to be implemented. The major advantages of formulations suggested here over PBXN-109 and M-43 is their reuse/recyclability. Formulations using TPE or Paste could by recovered from a generic bomb or propellant and reused if they met specification or easily reprocessed and sold to the mining industry.

  11. Additive Manufacturing Processes: Selective Laser Melting, Electron Beam Melting and Binder Jetting—Selection Guidelines (United States)

    Konda Gokuldoss, Prashanth; Kolla, Sri; Eckert, Jürgen


    Additive manufacturing (AM), also known as 3D printing or rapid prototyping, is gaining increasing attention due to its ability to produce parts with added functionality and increased complexities in geometrical design, on top of the fact that it is theoretically possible to produce any shape without limitations. However, most of the research on additive manufacturing techniques are focused on the development of materials/process parameters/products design with different additive manufacturing processes such as selective laser melting, electron beam melting, or binder jetting. However, we do not have any guidelines that discuss the selection of the most suitable additive manufacturing process, depending on the material to be processed, the complexity of the parts to be produced, or the design considerations. Considering the very fact that no reports deal with this process selection, the present manuscript aims to discuss the different selection criteria that are to be considered, in order to select the best AM process (binder jetting/selective laser melting/electron beam melting) for fabricating a specific component with a defined set of material properties. PMID:28773031

  12. Application of a bio-binder as a rejuvenator for wet processed asphalt shingles in pavement construction



    This paper investigates the merits of application of bio-binder to enhance rheological properties of asphalt binder in the presence of wet processed recycled asphalt shingles (RAS). It will further examine the performance and workability of asphalt designed with and without a specified percentage of a bio-binder produced from swine manure and RAS. Bio-binder was introduced to liquid asphalt binder modified with four different percentages of RAS; the high and low temperature properties of each...

  13. Why is the electroanalytical performance of carbon paste electrodes involving an ionic liquid binder higher than paraffinic binders? A simulation investigation. (United States)

    Ghatee, M H; Namvar, S; Zolghadr, A R; Moosavi, F


    Recently, carbon paste electrodes (CPE) fabricated using an ionic liquid (IL) binder have shown enhanced electroanalytical performance over conventional paraffinic binders. Molecular dynamics (MD) simulations of graphite mixed with ionic liquid and with paraffin binder can unravel the potential atomistic factors responsible for such enhancement. Based on an experimentally optimized binder/graphite mass ratio, which has been reported to be crucial for such a performance, comprehensive simulations (at 323 K) are performed with the ensembles involving an ionic liquid binder (1-butyl-3-methylimidazolium hexafluorophosphate, [C4mim]PF6) and a paraffin binder (n-C20H42) mixed with graphite comprising large-size hexagonal-shaped double graphene plates. Structural analysis indicates both binders form only a monolayer on the graphite surface, covering the surface locally by IL but all-encompassing by paraffin. With charged and uncharged graphite, the IL monolayer tends to cover mainly the graphite center without approaching the edge planes. On the contrary, a monolayer of the paraffin binder covers uniformly the center, near the center, and the edge planes. Cations and anions of the IL form well-defined two dimensional pentagonal matrixes with characteristic high adsorption energy, almost 2.4 times higher than paraffin adsorption. The cation and anion coordination ability of the IL is responsible for such a local distribution. The simulation of these phenomena under experimental conditions unravels strong two-dimensional coordination properties inherent to the ionic liquid when distributed over the graphite surface. This direct MD simulation comparison of the IL properties with an organic liquid counterpart, made for the first time, can be used to explain the high electroanalytical performance (electron transfer) of CPEs involving an IL binder over paraffin binders.

  14. Pharmaceutical equivalence of gabapentin tablets with various extragranular binders Pharmaceutical equivalence of gabapentin tablets with various extragranular binders

    Directory of Open Access Journals (Sweden)



    Full Text Available Gabapentin is a high-dose drug widely used as an oral anti-epilepticagent. Due to high crystalline and has poor compaction properties it is difficult to form tablets by direct compression. The aim of this study was to develop gabapentin tablets, pharmaceutically equivalent to the reference product Neurontin (marketed in USA. Gabapentin 800mg tablets were produced by wet granulation by keeping intragranular binder as well as its concentration constant and by changing with various extragranular binders with its concentration (A = PVPK 30, B = HPMC 15 cps, C = Kollidon VA 64, D =Klucel EXF.The tablet having no weight, thickness and hardness variation and having appropriate, friability as well as disintegration profile were coated with a 3% film coating solution .Seven formulations F1 (A in lower concentration F2 (A in higher concentration, F3 (B in lower concentration and F4 (B in higher concentration, F5 (C in lower concentration, F6 (C in higher concentration, F7 (D in lower concentration were formulated. Among them F6 demonstrated adequate hardness, friability, disintegration, uniformity of content, and total drug dissolution after 45minutes. The dissimilarity factor (f1 is 5.93 and the similarity factor (f2 is 67.85. So F6 was found to be equivalent to Neurontin.Gabapentin is widely used as an oral anti-epileptic agent. However, owing to its high crystallinity and poor compaction properties, it is difficult to form tablets of this drug by direct compression. The aim of this study was to develop gabapentin tablets, pharmaceutically equivalent to the brand-name pioneer product Neurontin® (marketed in USA. Gabapentin 800mg tablets were produced by wet granulation with a constant concentration of intragranular binder and a varying concentration of extragranular binders (A = polyvinylpyrrolidone K30, B = hydroxypropylmethylcellulose 15 cps, C = Kollidon VA64, D =Klucel EXF. The tablets that did not vary in weight, thickness or hardness and had

  15. Upgrading mild gasification liquids to produce electrode binder pitch. Technical report, December 1, 1992--February 28, 1993

    Energy Technology Data Exchange (ETDEWEB)

    Knight, R.A. [Institute of Gas Technology, Chicago, IL (United States); Banerjee, D. [Illinois Clean Coal Inst., Carterville, IL (United States)


    The objective of this program is to investigate the production of electrode binder pitch from mild gasification liquids. The IGT MILDGAS process pyrolyzes coal in a 1000{degree}--1500{degree}F (538{degree}--816{degree}C) fluidized/entrained bed to produce solid, gas, and liquid co-products. With Illinois coal, the 750{degree} F+ (400{degree}C+) distillation residue (crude pitch) comprises 40--70% of the MILDGAS liquids, representing up to 20 wt % of feed coal. The largest market for pitch made from coal liquids is the aluminum industry, which uses it to make carbon anodes for electrolytic furnaces. Traditionally, binder pitches have only been made from high-temperature coke-oven tars. In this project, crude pitch from the DOE-sponsored MILDGAS process research program is being modified by a flash thermocracking technique to achieve specifications typical of a binder pitch. A pitch thermocracking unit has been constructed for operation at 1200{degree}--1800{degree}F (650{degree}--982{degree}C). Atomization of the pitch at the thermocracker inlet is being examined as a method of optimizing the particle size of polymerized pitch components. With the production of cracked pitch samples, test electrodes will be fabricated using the best performing pitch samples and petroleum coke or calcined pitch coke filler.

  16. Microscopy Characterization of Silica-Rich Agrowastes to be used in Cement Binders: Bamboo and Sugarcane Leaves. (United States)

    Roselló, Josefa; Soriano, Lourdes; Santamarina, M Pilar; Akasaki, Jorge L; Melges, José Luiz P; Payá, Jordi


    Agrowastes are produced worldwide in huge quantities and they contain interesting elements for producing inorganic cementing binders, especially silicon. Conversion of agrowastes into ash is an interesting way of yielding raw material used in the manufacture of low-CO2 binders. Silica-rich ashes are preferred for preparing inorganic binders. Sugarcane leaves (Saccharum officinarum, SL) and bamboo leaves (Bambusa vulgaris, BvL and Bambusa gigantea, BgL), and their corresponding ashes (SLA, BvLA, and BgLA), were chosen as case studies. These samples were analyzed by means of optical microscopy, Cryo-scanning electron microscopy (SEM), SEM, and field emission scanning electron microscopy. Spodograms were obtained for BvLA and BgLA, which have high proportions of silicon, but no spodogram was obtained for SLA because of the low silicon content. Different types of phytoliths (specific cells, reservoirs of silica in plants) in the studied leaves were observed. These phytoliths maintained their form after calcination at temperatures in the 350-850°C range. Owing to the chemical composition of these ashes, they are of interest for use in cements and concrete because of their possible pozzolanic reactivity. However, the presence of significant amounts of K and Cl in the prepared ashes implies a limitation of their applications.

  17. Multivariate chemical mapping of pigments and binders in easel painting cross-sections by micro IR reflection spectroscopy. (United States)

    Rosi, Francesca; Federici, Arianna; Brunetti, Brunetto G; Sgamellotti, Antonio; Clementi, Sergio; Miliani, Costanza


    Paintings are composed of superimposed layers of inorganic and organic materials (pigments and binders). Knowledge of the stratigraphic sequence of these heterogeneous layers is fundamental for understanding the artist's painting technique and for conservation issues. In this study, micro-IR mapping experiments in reflection mode have been carried out on cross-sections taken from simulations of ancient easel paintings. The objective was to locate both organic binders and inorganic pigments. Chemical maps have been re-constructed using the common approach based on the integration of specific infrared bands. However, owing to the complexity of painting materials, this approach is not always applicable when dealing with broad and superimposed spectral features and with reststrahlen or derivative-like bands resulting from acquisition in reflection mode. To overcome these limitations, principal-component analysis has been successfully used for the re-construction of the image, extracting the relevant information from the complex full spectral data sets and obtaining reliable chemical distributions of the stratigraphy materials. Different pigment-binder combinations have been evaluated in order to understand limitations and strengths of the approach. Finally, the method has been applied for stratigraphic characterization of a cross-section from a 17th century wooden sculpture identifying both the original paint layer and the several overpaintings constituting the complex stratigraphy.

  18. Binder fraction reduction in non-ferrous metals concentrates briquetting process

    Directory of Open Access Journals (Sweden)

    M. Jodkowski


    Full Text Available The research results on a method of reducing the amount of binder applied during formation of metal concentrates are presented. Research was done on a model copper concentrate, which was mixed in assumed mass fraction with binder, as well as binder with addition of waste polyols. Such mixtures were formed and tested using static compressive strength, both immediately after forming and after the assumed seasoning times: 24, 96, 192 and 336 hours. The results confirm the possibility of binder dose lowering using high-efficiency system of binder dispersing with small addition of waste polyols and by homogeneous mixing of the binder with the material. In all examined cases increase in seasoning time influenced mechanical strength of the formed shapes advantageously.

  19. Briquetting of coal fines and sawdust. Part 1: binder and briquetting-parameters evaluations

    Energy Technology Data Exchange (ETDEWEB)

    D. Taulbee; D.P. Patil; Rick Q. Honaker; B.K. Parekh [University of Kentucky, Lexington, KY (United States). Center for Applied Energy Research


    Various technical and economic aspects relating to the briquetting of fine coal with sawdust have been evaluated with the results for two segments of that study presented here: binder and briquetting-parameter evaluations. Approximately 50 potential binder formulations were subjected to a series of screening evaluations to identify three formulations that were the most cost effective for briquetting fine coal with sawdust. Two of the binders, guar gum and wheat starch, were selected as most suitable for the pulverized coal market while the third formulation, lignosulfonate/lime, was targeted for the stoker market. Following binder selection, a number of briquetting parameters including binder and sawdust concentration, sawdust type, briquetting pressure and dwell time, coal and sawdust particle size, clay content, moisture content, and cure temperature and cure time were evaluated. Briquetting pressure and dwell time have the least impact while binder and sawdust concentrations, sawdust type, and curing conditions exerted the greatest influence on briquette quality. 7 refs.

  20. Influence of Mycotoxin Binders on the Oral Bioavailability of Doxycycline in Pigs. (United States)

    De Mil, Thomas; Devreese, Mathias; De Saeger, Sarah; Eeckhout, Mia; De Backer, Patrick; Croubels, Siska


    Mycotoxin binders are feed additives that aim to adsorb mycotoxins in the gastrointestinal tract of animals, making them unavailable for systemic absorption. The antimicrobial drug doxycycline (DOX) is often used in pigs and is administered through feed or drinking water; hence, DOX can come in contact with mycotoxin binders in the gastrointestinal tract. This paper describes the effect of four mycotoxin binders on the absorption of orally administered DOX in pigs. Two experiments were conducted: The first used a setup with bolus administration to fasted pigs at two different dosages of mycotoxin binder. In the second experiment, DOX and the binders were mixed in the feed at dosages recommended by the manufacturers (= field conditions). Interactions are possible between some of the mycotoxin binders dosed at 10 g/kg feed but not at 2 g/kg feed. When applying field conditions, no influences were seen on the plasma concentrations of DOX.

  1. Development of water soluble binder systems for low pressure injection molding of alumina

    Energy Technology Data Exchange (ETDEWEB)

    Bakan, H.I.; Gunes, M. [TUBITAK-MRC Materials and Chemical Technologies Research Inst., Kocaeli (Turkey)


    Low pressure injection molding of alumina powder using a water-soluble binder system has been carried out successfully. The water-soluble based binder system consisted of poly (2-ethyl-2-oxaline), low density polyethylene and stearic acid. The critical powder loading of the binder-powder mixture was determined based on torque rheometry experiments. The rheological properties of the powder-binder mixture were investigated systematically. The binder system used provides satisfactory mixture stability, excellent mouldability and reasonably fast water leaching and thermal debinding rates. The water-soluble constituent, poly (2-ethyl-2-oxaline), was removed by leaching in convecting water at 60 C within 6 hour. The remaining binder constituents were thermally removed during heating to 450 C. Sintering of the parts was conducted at 1550 C for an hour in air. (orig.)


    Directory of Open Access Journals (Sweden)

    Osman Sivrikaya


    Full Text Available The use of conventional bentonite binder is favorable in terms of mechanical and metallurgical pellet properties, however, because of its acid constituents bentonite is considered as impurity especially for iron ores with high acidic content. Therefore, alternative binders to bentonite have been tested. Organic binders are the most studied binders and they yield pellets with good wet strength; they fail in terms of preheated and fired pellet strengths. This study was conducted to investigate how insufficient pellet strengths can be improved when organic binders are used as binder. The addition of a low-melting temperature and slag bonding/strength increasing constituent (free in acidic contents into pellet feed was proposed. Addition of boron compounds such as colemanite, tincal, borax pentahydrate, boric acid together with organic binders such as CMC, starch, dextrin and some organic based binders, into iron oxide pellet was tested. Wet and thermally treated pellet physical-mechanical qualities (balling - moisture content - size - shape - drop number - compressive strengths - porosity - dustiness were determined. The results showed that good quality wet, dry, preheated and fired pellets can be produced with combined binders (an organic binder plus a boron compound when compared with bentonite-bonded pellets. While organic binders provided sufficient wet and dry pellet strengths, the boron compounds provided the required preheated and fired pellet strengths at even lower firing temperature. Especially, the contribution of boron compound addition is most pronounced for hematite pellets which do not have strengthening mechanism through oxidation like magnetite pellets during firing. Therefore, addition of boron compound is beneficial to recover the low physical-mechanical qualities of pellets produced with organic binders through slag bonding mechanism. Furthermore, lowering the firing temperature thanks to low-melting boron compounds will be cost

  3. Environmentally-Friendly Geopolymeric Binders Made with Silica (United States)

    Erdogan, S. T.


    Portland cement (PC) is the ubiquitous binding material for constructions works. It is a big contributor to global warming and climate change since its production is responsible for 5-10 % of all anthropogenic CO2 emissions. Half of this emission arises from the calcination of calcareous raw materials and half from kiln fuel burning and cement clinker grinding. Recently there have been efforts to develop alternative binders with lower greenhouse gas emissions. One such class of binders is geopolymers, formed by activating natural or waste materials with suitable alkaline or acidic solutions. These binders use natural or industrial waste raw materials with a very low CO2 footprint from grinding of the starting materials, and some from the production of the activating chemicals. The total CO2 emissions from carefully formulated mixtures can be as low as 1/10th - 1/5th of those of PC concrete mixtures with comparable properties. While use of industrial wastes as raw materials is environmentally preferable, the variability of their chemical compositions over time renders their use difficult. Use of natural materials depletes resources but can have more consistent properties and can be more easily accepted. Silica sand is a natural material containing very high amounts of quartz. Silica fume is a very fine waste from silicon metal production that is mostly non-crystalline silica. This study describes the use of sodium hydroxide and sodium silicate solutions to yield mortars with mechanical properties comparable to those of portland cement mortars and with better chemical and thermal durability. Strength gain is slower than with PC mixtures at room temperature but adequate ultimate strength can be achieved with curing at slightly elevated temperatures in less than 24 h. The consistency of the chemical compositions of these materials and their abundance in several large, developing countries makes silica attractive for producing sustainable concretes with reduced carbon

  4. How to assess the efficacy of phosphate binders. (United States)

    Caravaca, Francisco; Caravaca-Fontán, Fernando; Azevedo, Lilia; Luna, Enrique

    The efficacy of phosphate binders is difficult to be estimated clinically. This study analyzes the changes in serum phosphate and urinary phosphate excretion after the prescription of phosphate binders (PB) in patients with chronic kidney disease stage 4-5 pre-dialysis, and the usefulness of the ratio between total urinary phosphate and protein catabolic rate (Pu/PCR) for estimating the efficacy of PB. This retrospective observational cohort study included adult chronic kidney disease patients. Biochemical parameters were determined baseline and after 45-60 days on a low phosphate diet plus PB ("binder" subgroup=260 patients) or only with dietary advice ("control" subgroup=79 patients). Phosphate load (total urinary excretion) per unit of renal function (Pu/GFR) was the best parameter correlated with serum phosphate levels (R(2)=0.61). Mean±SD level of Pu/PCR was 8.2±2.3mg of urinary phosphate per each g of estimated protein intake. After treatment with PB, serum phosphate levels decreased by 11%, urinary phosphate 22%, protein catabolic rate 7%, and Pu/PCR 15%. In the control subgroup, Pu/PCR increased by 20%. Urinary phosphate and urea nitrogen excretion correlated strongly, both baseline and after PB or dietary advice. The proposed parameter Pu/PCR may reflect the rate of intestinal phosphate absorption, and therefore, its variations after PB prescription may be a useful tool for estimating the pharmacological efficacy of these drugs. Copyright © 2016 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

  5. Sustainable asphalt pavement: Application of slaughterhouse waste oil and fly ash in asphalt binder (United States)

    Sanchez Ramos, Jorge Luis

    Increasing energy costs, lack of sufficient natural resources and the overwhelming demand for petroleum has stimulated the development of alternative binders to modify or replace petroleum-based asphalt binders. In the United States, the petroleum-based asphalt binder is mainly used to produce the Hot Mix Asphalt (HMA). There are approximately 4000 asphalt plants that make 500 million tons of asphalt binder valued at roughly 3 billion/year. The instability of the world's oil market has pushed oil prices to more than 80 per barrel in 2012, which increased the cost of asphalt binder up to $570 per ton. Therefore, there is a timely need to find alternative sustainable resources to the asphalt binder. This paper investigates the possibility of the partial replacement of the asphalt binder with slaughterhouse waste and/or fly ash. In order to achieve this objective, the asphalt binder is mixed with different percentages of waste oil and/or fly ash. In order to investigate the effect of these additives to the performance of the asphalt binder, a complete performance grade test performed on multiple samples. The results of the performance grade tests are compared with a control sample to observe how the addition of the waste oil and/or fly ash affects the sample. Considering the increasing cost and demand of asphalt, the use of slaughterhouse waste oil and/or fly ash as a partial replacement may result in environmental and monetary improvements in the transportation sector.

  6. Next Generation Advanced Binder Chemistries for High Performance, Environmetally DurableThermal Control Material Systems. Project (United States)

    National Aeronautics and Space Administration — This innovative SBIR Phase I proposal will develop new binder systems through the systematic investigations to tailor required unique performance properties and...

  7. Novel anti-flooding poly(dimethylsiloxane) (PDMS) catalyst binder for microbial fuel cell cathodes

    KAUST Repository

    Zhang, Fang


    Poly(dimethylsiloxane) (PDMS) was investigated as an alternative to Nafion as an air cathode catalyst binder in microbial fuel cells (MFCs). Cathodes were constructed around either stainless steel (SS) mesh or copper mesh using PDMS as both catalyst binder and diffusion layer, and compared to cathodes of the same structure having a Nafion binder. With PDMS binder, copper mesh cathodes produced a maximum power of 1710 ± 1 mW m -2, while SS mesh had a slightly lower power of 1680 ± 12 mW m -2, with both values comparable to those obtained with Nafion binder. Cathodes with PDMS binder had stable power production of 1510 ± 22 mW m -2 (copper) and 1480 ± 56 mW m -2 (SS) over 15 days at cycle 15, compared to a 40% decrease in power with the Nafion binder. Cathodes with the PDMS binder had lower total cathode impedance than those with Nafion. This is due to a large decrease in diffusion resistance, because hydrophobic PDMS effectively prevented catalyst sites from filling up with water, improving oxygen mass transfer. The cost of PDMS is only 0.23% of that of Nafion. These results showed that PDMS is a very effective and low-cost alternative to Nafion binder that will be useful for large scale construction of these cathodes for MFC applications. © 2012 Elsevier B.V.

  8. Mapping of egg yolk and animal skin glue paint binders in Early Renaissance paintings using near infrared reflectance imaging spectroscopy. (United States)

    Dooley, Kathryn A; Lomax, Suzanne; Zeibel, Jason G; Miliani, Costanza; Ricciardi, Paola; Hoenigswald, Ann; Loew, Murray; Delaney, John K


    In situ chemical imaging techniques are being developed to provide information on the spatial distribution of artists' pigments used in polychrome works of art such as paintings. The new methods include reflectance imaging spectroscopy and X-ray fluorescence mapping. Results from these new methods have extended the knowledge obtained from site-specific chemical analyses widely in use. While these mapping methods have aided in determining the distribution of pigments, there is a growing interest to develop methods capable of identifying and mapping organic paint binders as well. Near infrared (NIR) reflectance spectroscopy has been extensively used in the remote sensing field as well as in the chemical industry to detect organic compounds. NIR spectroscopy provides a rapid method to assay organics by utilizing vibrational overtones and combination bands of fundamental absorptions that occur in the mid-IR. Here we explore the utility of NIR reflectance imaging spectroscopy to map organic binders in situ by examining a series of panel paintings known to have been painted using distemper (animal skin glue) and tempera (egg yolk) binders as determined by amino acid analysis of samples taken from multiple sites on the panels. In this report we demonstrate the success in identifying and mapping these binders by NIR reflectance imaging spectroscopy in situ. Three of the four panel paintings from Cosimo Tura's The Annunciation with Saint Francis and Saint Louis of Toulouse (ca. 1475) are imaged using a highly sensitive, line-scanning hyperspectral imaging camera. The results show an animal skin glue binder was used for the blue skies and blue robe of the Virgin Mary, and egg yolk tempera was used for the red robes and brown landscape. The mapping results show evidence for the use of both egg yolk and animal skin glue in the faces of the figures. The strongest absorption associated with lipidic egg yolk features visually correlates with areas that appear to have white

  9. Chitosan chemical hydrogel electrode binder for direct borohydride fuel cells

    Energy Technology Data Exchange (ETDEWEB)

    Choudhury, Nurul A.; Sahai, Yogeshwar; Buchheit, Rudolph G. [Department of Materials Science and Engineering, Ohio State University, Columbus, OH (United States)


    A novel and cost-effective electrode binder consisting of chitosan chemical hydrogel (CCH) is reported for direct borohydride fuel cells (DBFCs). The DBFCs have been assembled with Misch-metal-based AB{sub 5} alloy as anode, carbon-supported palladium (Pd/C) as cathode and polyvinyl alcohol (PVA) hydrogel membrane electrolyte (PHME) as well as Nafion {sup registered} -117 membrane electrolyte (NME) as separators. Operating in passive mode without using peristaltic pump and under ambient conditions of temperature as well as pressure, the DBFC exhibited a maximum peak power density of about 81 mW cm{sup -2}. (author)

  10. Hexacyanoferrates and bentonite as binders of radiocaesium for reindeer

    Directory of Open Access Journals (Sweden)

    Knut Hove


    Full Text Available The effects of varying doses of caesium binders (Bentonite and several forms of iron-hexacyanoferrates on radiocaesium accumulation in red blood cells and on radiocaesium transfer to urine and faeces were studied in feeding experiments with reindeer calves. The caesium binders were added to a ration of lichen (containing 9.5 kBq of 134Cs+137Cs originating from the Chernobyl accident and fed together with a pelleted reindeer feed (RF-71 for 42 days. A 50% reduction in red blood cell radiocaesium concentration was obtained with a daily dose of 1 mg/kg body weigth of ammoniumironhexacyanoferrate (AFCF and with 500 mg/kg of bentonite. Three mg/kg of AFCF or 2 g/kg of bentonite reduced both urinary excretion and RBC concentrations with more than 80%. It is concluded that iron-hexacyanoferrates, as a result of their high caesium binding capacity, are particularly useful as caesium binders for free ranging ruminants like the reindeer.Hexacynoferrater og bentonitt som bindere av radiocesium i reinAbstract in Norwegian / Sammendrag: Effekten av bentonitt og ulike typer jernhexacyanoferrater (Berlinerblått på akkumulering av radioaktivt cesium i røde blodlegemer og på utskilling av radioaktivt cesium i urin ble undersøkt i foringsforsøk med reinkalver. Cesiumbinderne ble gitt daglig sammen med lav som inneholdt 9.5 kBq 134Cs+137Cs fra Tsjernobyl ulykken, og 1 kg reinfor (RF-71 i en periode på 42 dager. En daglig dose på 1 mg/kg kroppsvekt av ammoniumjernhexacyano-ferrat (AFCF reduserte radiocesiuminnholdet i blodlegemer med 50%, mens en dose pa 500 mg/kg bentonitt var nødvendig for å oppnå samme effekt. Tre mg/kg AFCF eller 2 g/kg/bentonitt var nødvendig for å oppnå mer enn 80% reduksjon i radiocesium konsentrasjonen i blodlegemer og i radiocesium utskilling med urinen. På grunn av de små daglige mengder som kreves er jern-hexacyanoferratene spesielt velegnete som cesiumbindere for beitedyr.

  11. Nanomodified compositions based on finely dispersed binders for soil reinforcement

    Directory of Open Access Journals (Sweden)

    Alimov Lev


    Full Text Available Theoretical prerequisites on the possibility of improvement of physical and mechanical properties of soils at underground space development, their stability at different aggressive actions by means of their structure impregnation with nanomodified suspensions on the basis of especially finely dispersed mineral binders are developed. The features of influence of plasticizers on penetration ability and sedimentation stability of suspensions are revealed. Soil body reinforcement after its impregnation may achieve considerable values, which is related to the features of interaction of components of impregnating composition with extended surface of soil pore space.

  12. Carbon nanotubes/holey graphene hybrid film as binder-free electrode for flexible supercapacitors. (United States)

    Deng, Lingjuan; Gu, Yuanzi; Gao, Yihong; Ma, Zhanying; Fan, Guang


    The practical application of graphene (GR) has still been hindered because of its unsatisfied physical and chemical properties resulting from the irreversible agglomerates. Preparation of GR-based materials with designed porosities is essential for its practical application. In this work, a facile and scalable method is developed to synthesize carbon nanotubes/holey graphene (CNT/HGR) flexible film using functional CNT and HGR as precursors. Owing to the existence of the small amount CNT, the CNT-5/HGR flexible film with a 3D conductive interpenetrated architecture exhibit significantly improved ion diffusion rate compared to that of the HGR. Moreover, CNT-5/HGR flexible film can be used as binder-free supercapacitor electrodes with ultrahigh specific capacitances of 268Fg(-1), excellent rate capabilities, and superior cycling stabilities. CNT-5/HGR flexible film could be used to fabricate high-performance flexible supercapacitors electrodes. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Design of phage-displayed cystine-stabilized mini-protein libraries for proteinaceous binder engineering. (United States)

    Chang, Hung-Ju; Yang, An-Suei


    Cystine-stabilized mini-proteins are important scaffolds in the combinatorial search of binders for molecular recognition. The structural determinants of a cystine-stabilized scaffold are the critical residues determining the formation of the native disulfide-bonding configuration, and thus should remain unchanged in the combinatorial libraries so as to allow a large portion of the library sequences to be compatible with the scaffold structure. A high-throughput molecular evolution procedure has been developed to select and screen for the polypeptide sequences folding into a specific cystine-stabilized structure. Patterns of sequence preference that emerge from the resultant sequence profiles provide structural determinant information, which facilitates the designs of combinatorial libraries for combinatorial approaches as in phage display. This methodology enables artificial cystine-stabilized proteins to be engineered with enhanced folding and binding properties.

  14. The curious case of zeolite-clay/binder interactions and their consequences for catalyst preparation. (United States)

    Whiting, Gareth T; Chowdhury, Abhishek Dutta; Oord, Ramon; Paalanen, Pasi; Weckhuysen, Bert M


    Zeolite-based catalyst bodies are commonly employed in a range of important industrial processes. Depending on the binder and shaping method chosen, vast differences in the reactivity, selectivity and stability are obtained. Here, three highly complementary micro-spectroscopic techniques were employed to study zeolite ZSM-5-binder interactions in SiO2-, Al2O3-, SiO2 : Al2O3- (2 : 1 mix) and kaolinite-bound catalyst pellets. We establish how their preparation influences the zeolite-clay/binder interactions. Using thiophene as an acid-catalyzed staining reaction, light absorbing oligomers produced in each sample were followed. To our surprise, kaolinite decreased the overall reactivity of the sample due to the phase change of the binder, creating a hard impenetrable outer layer. Aluminum migration to the zeolite was observed when Al2O3 was selected as a binder, creating additional Brønsted acid sites, which favored the formation of ring-opened thiophene oligomers compared to the larger oligomer species produced when SiO2 was used as a binder. In the latter case, the interaction of the Si-OH groups in the binder with thiophene was revealed to have a large impact in creating such large oligomer species. Furthermore, the combination of a SiO2 : Al2O3 mix as a binder enhanced the reactivity, possibly due to the creation of additional Brønsted acid sites between the two binder components during pellet preparation. It is evident that, independent of the shaping method, the intimate contact between the zeolite and binder heavily impacts the reactivity and product selectivity, with the type of binder playing a vital role.

  15. Interpenetrating Polymer Networks as Binders for Solid Composite Propellants

    Directory of Open Access Journals (Sweden)

    S. Parthiban


    Full Text Available A new family of polymeric binders for solid composite propellants is proposed, based on two component interpenetrating polymer networks (IPNs. These networks comprise two different polyurethanes based on hydroxy terminated polybutadiene and ISRO polyol interpenetrated with two different vinyl polymers, viz poly methyl methacrylate and polystyrene. the networks synthesized by the simultaneous interpenetrating technique have been characterized for their properties, such as stress-strain, density, viscosity, thermal degradation, and heat of combustion. Phase morphologies have been determined using electron microscopy. Suitable explanations have been adduced to rationalize the properties of IPNs in terms of their structures and chain interactions. A study of the mechanical properties and burning rates of the ammonium perchlorate (AP-based solid propellant using the newly synthesised IPNs as binders, has been carried out. The results show that both mechanical strength and burning rate of solid propellants could be suitably modified by simply changing the nature and/or the ratio of the two interpenetrating polymer components.

  16. Center for BioBased Binders and Pollution Reduction Technology

    Energy Technology Data Exchange (ETDEWEB)

    Thiel, Jerry [Univ. of Northern Iowa, Cedar Falls, IA (United States)


    Funding will support the continuation of the Center for Advanced Bio-based Binders and Pollution Reduction Technology Center (CABB) in the development of bio-based polymers and emission reduction technologies for the metal casting industry. Since the formation of the center several new polymers based on agricultural materials have been developed. These new materials have show decreases in hazardous air pollutants, phenol and formaldehyde as much as 50 to 80% respectively. The polymers termed bio-polymers show a great potential to utilize current renewable agricultural resources to replace petroleum based products and reduce our dependence on importing of foreign oil. The agricultural technology has shown drastic reductions in the emission of hazardous air pollutants and volatile organic compounds and requires further development to maintain competitive costs and productivity. The project will also research new and improved inorganic binders that promise to eliminate hazardous emissions from foundry casting operations and allow for the beneficial reuse of the materials and avoiding the burdening of overcrowded landfills.

  17. Emissions of tar-containing binders: field studies. (United States)

    Hugener, Martin; Emmenegger, Lukas; Mattrel, Peter


    This study describes the measurement of emissions during field construction of asphalt pavements using tar-containing recycled asphalt pavement (RAP), which is known to release harmful substances, such as polycyclic aromatic hydrocarbons (PAH). At three different test sites, the main emission sources were identified and the total emission rates of fumes and PAHs of the paving process were determined. For this purpose, the paver was temporarily enclosed. While the screed area was the main emission source, the hopper area and freshly compacted pavement were also significant. In comparison with previous laboratory tests, the binder composition and the resulting emissions were comparable, except for Naphthalene. Benzo(a)pyrene (BaP) as a representative for carcinogenic PAHs was identified as a good leading compound, correlating well with the toxicity weighted sum of PAHs. In contrast, the unweighted, mass related sum of all EPA PAHs does not seem to be a good parameter to assess workplace concentrations because emissions by mass are dominated by the less hazardous 2-, 3- and 4-ring PAHs. Workplace concentrations for bitumen fumes and PAHs were below limit values in all three field studies. However, the margin was not large and the field tests were done under favourable meteorological conditions. Therefore, we suggest maintaining the current Swiss limit of 5000 mg EPA-PAH per kg binder in the RAP-containing hot mix.

  18. Predictive cartography of metal binders using generative topographic mapping (United States)

    Baskin, Igor I.; Solov'ev, Vitaly P.; Bagatur'yants, Alexander A.; Varnek, Alexandre


    Generative topographic mapping (GTM) approach is used to visualize the chemical space of organic molecules (L) with respect to binding a wide range of 41 different metal cations (M) and also to build predictive models for stability constants (log K) of 1:1 (M:L) complexes using "density maps," "activity landscapes," and "selectivity landscapes" techniques. A two-dimensional map describing the entire set of 2962 metal binders reveals the selectivity and promiscuity zones with respect to individual metals or groups of metals with similar chemical properties (lanthanides, transition metals, etc). The GTM-based global (for entire set) and local (for selected subsets) models demonstrate a good predictive performance in the cross-validation procedure. It is also shown that the data likelihood could be used as a definition of the applicability domain of GTM-based models. Thus, the GTM approach represents an efficient tool for the predictive cartography of metal binders, which can both visualize their chemical space and predict the affinity profile of metals for new ligands.

  19. New insight into the molecular mechanisms of the biological effects of DNA minor groove binders.

    Directory of Open Access Journals (Sweden)

    Xinbo Zhang

    Full Text Available BACKGROUND: Bisbenzimides, or Hoechst 33258 (H258, and its derivative Hoechst 33342 (H342 are archetypal molecules for designing minor groove binders, and widely used as tools for staining DNA and analyzing side population cells. They are supravital DNA minor groove binders with AT selectivity. H342 and H258 share similar biological effects based on the similarity of their chemical structures, but also have their unique biological effects. For example, H342, but not H258, is a potent apoptotic inducer and both H342 and H258 can induce transgene overexpression in in vitro studies. However, the molecular mechanisms by which Hoechst dyes induce apoptosis and enhance transgene overexpression are unclear. METHODOLOGY/PRINCIPAL FINDINGS: To determine the molecular mechanisms underlying different biological effects between H342 and H258, microarray technique coupled with bioinformatics analyses and multiple other techniques has been utilized to detect differential global gene expression profiles, Hoechst dye-specific gene expression signatures, and changes in cell morphology and levels of apoptosis-associated proteins in malignant mesothelioma cells. H342-induced apoptosis occurs in a dose-dependent fashion and is associated with morphological changes, caspase-3 activation, cytochrome c mitochondrial translocation, and cleavage of apoptosis-associated proteins. The antagonistic effect of H258 on H342-induced apoptosis indicates a pharmacokinetic basis for the two dyes' different biological effects. Differential global gene expression profiles induced by H258 and H342 are accompanied by unique gene expression signatures determined by DNA microarray and bioinformatics software, indicating a genetic basis for their different biological effects. CONCLUSIONS/SIGNIFICANCE: A unique gene expression signature associated with H342-induced apoptosis provides a new avenue to predict and classify the therapeutic class of minor groove binders in the drug

  20. Modeling of human prokineticin receptors: interactions with novel small-molecule binders and potential off-target drugs.

    Directory of Open Access Journals (Sweden)

    Anat Levit

    Full Text Available BACKGROUND AND MOTIVATION: The Prokineticin receptor (PKR 1 and 2 subtypes are novel members of family A GPCRs, which exhibit an unusually high degree of sequence similarity. Prokineticins (PKs, their cognate ligands, are small secreted proteins of ∼80 amino acids; however, non-peptidic low-molecular weight antagonists have also been identified. PKs and their receptors play important roles under various physiological conditions such as maintaining circadian rhythm and pain perception, as well as regulating angiogenesis and modulating immunity. Identifying binding sites for known antagonists and for additional potential binders will facilitate studying and regulating these novel receptors. Blocking PKRs may serve as a therapeutic tool for various diseases, including acute pain, inflammation and cancer. METHODS AND RESULTS: Ligand-based pharmacophore models were derived from known antagonists, and virtual screening performed on the DrugBank dataset identified potential human PKR (hPKR ligands with novel scaffolds. Interestingly, these included several HIV protease inhibitors for which endothelial cell dysfunction is a documented side effect. Our results suggest that the side effects might be due to inhibition of the PKR signaling pathway. Docking of known binders to a 3D homology model of hPKR1 is in agreement with the well-established canonical TM-bundle binding site of family A GPCRs. Furthermore, the docking results highlight residues that may form specific contacts with the ligands. These contacts provide structural explanation for the importance of several chemical features that were obtained from the structure-activity analysis of known binders. With the exception of a single loop residue that might be perused in the future for obtaining subtype-specific regulation, the results suggest an identical TM-bundle binding site for hPKR1 and hPKR2. In addition, analysis of the intracellular regions highlights variable regions that may provide

  1. Inactive enzymatic mutant proteins (phosphoglycerate mutase and enolase as sugar binders for ribulose-1,5-bisphosphate regeneration reactors

    Directory of Open Access Journals (Sweden)

    Giri Ashok


    Full Text Available Abstract Background Carbon dioxide fixation bioprocess in reactors necessitates recycling of D-ribulose1,5-bisphosphate (RuBP for continuous operation. A radically new close loop of RuBP regenerating reactor design has been proposed that will harbor enzyme-complexes instead of purified enzymes. These reactors will need binders enabling selective capture and release of sugar and intermediate metabolites enabling specific conversions during regeneration. In the current manuscript we describe properties of proteins that will act as potential binders in RuBP regeneration reactors. Results We demonstrate specific binding of 3-phosphoglycerate (3PGA and 3-phosphoglyceraldehyde (3PGAL from sugar mixtures by inactive mutant of yeast enzymes phosphoglycerate mutase and enolase. The reversibility in binding with respect to pH and EDTA has also been shown. No chemical conversion of incubated sugars or sugar intermediate metabolites were found by the inactive enzymatic proteins. The dissociation constants for sugar metabolites are in the micromolar range, both proteins showed lower dissociation constant (Kd for 3-phosphoglycerate (655–796 μM compared to 3-phosphoglyceraldehyde (822–966 μM indicating higher affinity for 3PGA. The proteins did not show binding to glucose, sucrose or fructose within the sensitivity limits of detection. Phosphoglycerate mutase showed slightly lower stability on repeated use than enolase mutants. Conclusions The sugar and their intermediate metabolite binders may have a useful role in RuBP regeneration reactors. The reversibility of binding with respect to changes in physicochemical factors and stability when subjected to repeated changes in these conditions are expected to make the mutant proteins candidates for in-situ removal of sugar intermediate metabolites for forward driving of specific reactions in enzyme-complex reactors.

  2. Effects of binders on the electrochemical performance of rechargeable magnesium batteries (United States)

    Wang, Nan; NuLi, Yanna; Su, Shuojian; Yang, Jun; Wang, Jiulin


    A comparative study on the effects of different binders on the electrochemical performance of rechargeable magnesium batteries with Mo6S8 cathode is conducted for the first time. The selected binders are commercial organic-soluble polyvinylidene fluoride (PVDF), water-soluble poly(acrylic acid) (PAA), poly(vinyl alcohol) (PVA), gelatin, sodium alginate (SA) and Beta-cyclodextrin (β-CD). The binders significantly affect the physical properties, thus the electrochemical performance of Mo6S8 cathode. Compared with those using traditional PVDF binder, Mo6S8 electrodes with PAA and PVA exhibit enhanced cycling stabilities and rate capabilities, which are attributed to the improved cohesion among the electrode constituents and adhesion between the electrode laminate and the current collector. In addition, the anodic stability of these binders is not only related to the chemical structure of binders, but also to the uniformity of electrode surface. SA binder shows low anodic stability duo to containing easily oxidized groups. Non-uniform electrode surface decreases the anodic stability of PVDF based Mo6S8 electrode. Gelatin can be used as a binder in the formulation of high voltage cathodes for rechargeable magnesium batteries.

  3. Setup of Columellar Height with Costal Cartilage Graft Modification in a Patient with Binder Syndrome

    Directory of Open Access Journals (Sweden)

    Şafak Uygur


    Full Text Available Binder syndrome is an uncommon disorder of unknown etiology. It is characterized by hypoplasia of the nose and maxilla and altered morphology of the associated soft tissue. We present a surgical technique for setting up the columellar height in a patient with Binder syndrome.

  4. 14 CFR 198.15 - Non-premium insurance-payment of registration binders. (United States)


    ... OF TRANSPORTATION (CONTINUED) WAR RISK INSURANCE AVIATION INSURANCE § 198.15 Non-premium insurance... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Non-premium insurance-payment of...-premium insurance must be accompanied by the proper binder, payable to the FAA. A binder is not...

  5. Evaluation of bitumen-rubber asphalt manufactured from modified binder at lower viscosity

    CSIR Research Space (South Africa)

    O'Connell, Johannes S


    Full Text Available In South Africa, crumb tyre-modified bitumen commnly known as bitumen-rubber binder has viscosity limits specified by the current edition of TG1: The Use of Modified Bituminous Binders in Road Construction. As the crumb rubber is 'digested...

  6. The influence of metakaolin substitution by slag in alkali-activated inorganic binders for civil engineering (United States)

    Kadlec, J.; Rieger, D.; Kovářík, T.; Novotný, P.; Franče, P.; Pola, M.


    In this study the effect of metakaolin replacement by milled blast furnace slag in alkali-activated geopolymeric binder was investigated in accordance to their rheological and mechanical properties. It was demonstrated that slag addition into the metakaolin binder can improve mechanical properties of final products. Our investigation was focused on broad interval of metakaolin substitution in the range from 100 to 40 volume per cents of metakaolin so that the volume content of solids in final binder was maintained constant. Prepared binders were activated by alkaline solution of potassium silicate with silicate module of 1.61. The particle size analyses were performed for determination of particle size distribution. The rheological properties were determined in accordance to flow properties by measurements on Ford viscosity cup and by oscillatory measurements of hardening process. For the investigation of hardening process, the strain controlled small amplitude oscillatory rheometry was used in plane-plate geometry. For determination of applied mechanical properties were binders filled by ceramic grog in the granularity range 0-1 mm. The filling was maintained constant at 275 volume per cents in accordance to ratio of solids in dry binder. The mechanical properties were investigated after 1, 7 and 28 days and microstructure was documented by scanning electron microscopy. The results indicate that slag addition have beneficial effect not only on mechanical properties of hardened binder but also on flow properties of fresh geopolymer paste and subsequent hardening kinetics of alkali-activated binders.

  7. High cycling stability of anodes for lithium-ion batteries based on Fe3O4 nanoparticles and poly(acrylic acid) binder (United States)

    Maroni, F.; Gabrielli, S.; Palmieri, A.; Marcantoni, E.; Croce, F.; Nobili, F.


    Fe3O4 nanoparticles synthesized by a base catalyzed method are tested as anode material for Li-ion batteries. The pristine nanoparticles are morphologically characterized showing an average size of 11 nm. Electrodes are prepared using high-molecular weight Poly (acrylic acid) as improved binder and ethanol as low cost and environmentally friendly solvent. The evaluation of electrochemical properties shows high specific capacity values of 857 mA hg-1 after 200 cycles at a specific current of 462 mAg-1, as well as an excellent rate capability with specific current values up to 18480 mAg-1. To the best of our knowledge, this is the first report of Fe3O4 nanoparticles cycling with PAA as binder.

  8. Binder-Free and Carbon-Free Nanoparticle Batteries: A Method for Nanoparticle Electrodes without Polymeric Binders or Carbon Black

    KAUST Repository

    Ha, Don-Hyung


    In this work, we have developed a new fabrication method for nanoparticle (NP) assemblies for Li-ion battery electrodes that require no additional support or conductive materials such as polymeric binders or carbon black. By eliminating these additives, we are able to improve the battery capacity/weight ratio. The NP film is formed by using electrophoretic deposition (EPD) of colloidally synthesized, monodisperse cobalt NPs that are transformed through the nanoscale Kirkendall effect into hollow Co 3O 4. EPD forms a network of NPs that are mechanically very robust and electrically connected, enabling them to act as the Li-ion battery anode. The morphology change through cycles indicates stable 5-10 nm NPs form after the first lithiation remained throughout the cycling process. This NP-film battery made without binders and conductive additives shows high gravimetric (>830 mAh/g) and volumetric capacities (>2100 mAh/cm 3) even after 50 cycles. Because similar films made from drop-casting do not perform well under equal conditions, EPD is seen as the critical step to create good contacts between the particles and electrodes resulting in this significant improvement in battery electrode assembly. This is a promising system for colloidal nanoparticles and a template for investigating the mechanism of lithiation and delithiation of NPs. © 2012 American Chemical Society.

  9. Production of Steel Casts in Two-Layer Moulds with Alkaline Binders Part 1. Backing sand with the alkaline inorganic binder RUDAL

    Directory of Open Access Journals (Sweden)

    M. Holtzer


    Full Text Available Steel casts in Z.N. POMET were produced in moulds made of the moulding sand Floster. This sand did not have good knocking outproperties, required a significant binder addition (4.5-5.0 parts by weight, and the casting surface quality gave rise to clients objections.Therefore a decision of implementing two-layer moulds, in which the facing sand would consist of the moulding sand with an alkalineorganic binder while the backing sand would be made of the moulding sand with an inorganic binder also of an alkaline character - wasundertaken. The fraction of this last binder in the moulding sand mass would be smaller than that of the binder used up to now (waterglass. The application of two moulding sands of the same chemical character (highly alkaline should facilitate the reclamation processand improve the obtained reclaimed material quality, due to which it would be possible to increase the reclaim fraction in the mouldingsand (up to now it was 50%. The results of the laboratory investigations of sands with the RUDAL binder are presented in the paper.

  10. Investigation of binder distribution in graphite anodes for lithium-ion batteries (United States)

    Müller, Marcus; Pfaffmann, Lukas; Jaiser, Stefan; Baunach, Michael; Trouillet, Vanessa; Scheiba, Frieder; Scharfer, Philip; Schabel, Wilhelm; Bauer, Werner


    Energy dispersive x-ray spectroscopy (EDS) is evaluated regarding its applicability for revealing the binder distribution in lithium-ion battery electrode films. Graphite anodes comprising carbon black and PVDF binder are subject to varying drying conditions during solvent removal in order to adjust different binder distributions; fluorine is used as a marker for the presence of PVDF. For electrodes of about 70 μm thickness the fluorine concentration is detected at the surface of the electrode film as well as at the interface between electrode film and current collector foil. It is clearly visible by EDS that increasing drying temperatures (and drying rates) result in an accumulation of binder at the surface and a corresponding depletion at the interface. It is demonstrated on the basis of ion-milled cross-sections of thick electrodes (ca. 400 μm) that a quantitative mapping of the binder distribution delivers additional information about concentration gradients in dependence of the drying parameters.

  11. Study of chloride ion transport of composite by using cement and starch as a binder

    Energy Technology Data Exchange (ETDEWEB)

    Armynah, Bidayatul; Halide, Halmar; Zahrawani,; Reski, Nurhadi; Tahir, Dahlang, E-mail: [Department of Physics, Hasanuddin University, Makassar 90245 Indonesia (Indonesia)


    This study presents the chemical bonding and the structural properties of composites from accelerator chloride test migration (ACTM). The volume fractions between binder (cement and starch) and charcoal in composites are 20:80 and 60:40. The effect of the binder to the chemical composition, chemical bonding, and structural properties before and after chloride ion passing through the composites was determined by X-ray fluorescence (XRF), by Fourier transform infra-red (FTIR), and x-ray diffraction (XRD), respectively. From the XRD data, XRF data, and the FTIR data shows the amount of chemical composition, the type of binding, and the structure of composites are depending on the type of binder. The amount of chloride migration using starch as binder is higher than that of cement as a binder due to the density effects.

  12. Development of partitioning method: adsorption behavior of Sr on titanic acid pelletized with binder

    Energy Technology Data Exchange (ETDEWEB)

    Mizoguchi, Kenichi; Yamaguchi, Isoo; Morita, Yasuji; Yamagishi, Isao; Fujiwara, Takeshi; Kubota, Masumitsu [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment


    The adsorption behavior of Sr was examined with the titanic acid with the binder and with binderless titanic acid. Then the effect of the difference of the neutralizer was also examined. When the initial concentration of Sr was constant, distribution coefficient (Kd) increased with pH after adsorption. At pH 4, Kd decreased in order of the titanic acid neutralized with NH{sub 4}OH solution without the binder > the titanic acid neutralized with NH{sub 4}OH solution and pelletized with the binder > the titanic acid neutralized with KOH solution and pelletized with the binder. At pH 6, Kd decreased with increasing the concentration of Sr in the solution, but the decreasing tendency of Kd for each titanic acid was the same. Adsorption kinetics was examined with titanic acids neutralized with NH{sub 4}OH solution, keeping the initial concentration of Sr and the initial pH constant. It took about one hour to reach Kd of 100mL/g for the titanic acid without the binder but over 10 hours for the titanic acid pelletized with the binder. It was confirmed that by pelletizing titanic acid with the binder, Kd of Sr became small and it took very long time to reach the adsorption equilibrium. However, by sufficient conditioning with water of the titanic acid pelletized with the binder, 1) it took about half time of titanic acid without conditioning to reach Kd of 100mL/g, 2) after 24 hours mixing, Kd for the titanic acid pelletized with the binder was almost equal to that for the titanic acid without the binder, 3) apparent ion exchange capacity obtained through a column test became over about 1meq/g. (J.P.N.)

  13. Thermal Degradation Studies of A Polyurethane Propellant Binder

    Energy Technology Data Exchange (ETDEWEB)

    Assink, R.A.; Celina, M.; Gillen, K.T.; Graham, A.C.; Minier, L.M.


    The thermal oxidative aging of a crosslinked hydroxy-terminated polybutadiene (HTPB)/isophorone diisocyanate (IPDI) based polyurethane rubber, used as a polymeric binder in solid propellant grain, was investigated at temperatures from 25 C to 125 C. The changes in tensile elongation, polymer network properties and chain dynamics, mechanical hardening and density were determined with a range of techniques including modulus profiling, solvent swelling, NMR relaxation and O{sub 2} permeability measurements. We critically evaluated the Arrhenius methodology that is commonly used with a linear extrapolation of high temperature aging data using extensive data superposition and highly sensitive oxygen consumption experiments. The effects of other constituents in the propellant formulation on aging were also investigated. We conclude that crosslinking is the dominant process at higher temperatures and that the degradation involves only limited hardening in the bulk of the material. Significant curvature in the Arrhenius diagram of the oxidation rates was observed. This is similar to results for other rubber materials.

  14. Thermal Degradation Studies of A Polyurethane Propellant Binder

    Energy Technology Data Exchange (ETDEWEB)

    Assink, R.A.; Celina, M.; Gillen, K.T.; Graham, A.C.; Minier, L.M.


    The thermal oxidative aging of a crosslinked hydroxy-terminated polybutadiene (HTPB)/isophorone diisocyanate (IPDI) based polyurethane rubber, used as a polymeric binder in solid propellant grain, was investigated at temperatures from 25 C to 125 C. The changes in tensile elongation, polymer network properties and chain dynamics, mechanical hardening and density were determined with a range of techniques including modulus profiling, solvent swelling, NMR relaxation and O{sub 2} permeability measurements. We critically evaluated the Arrhenius methodology that is commonly used with a linear extrapolation of high temperature aging data using extensive data superposition and highly sensitive oxygen consumption experiments. The effects of other constituents in the propellant formulation on aging were also investigated. We conclude that crosslinking is the dominant process at higher temperatures and that the degradation involves only limited hardening in the bulk of the material. Significant curvature in the Arrhenius diagram of the oxidation rates was observed. This is similar to results for other rubber materials.

  15. Zeolite and bentonite as caesium binders in reindeer feed

    Directory of Open Access Journals (Sweden)

    Birgitta Åhman


    Full Text Available The effects of zeolite and bentonite on the accumulation and excretion of radiocaesium (Cs-137 in reindeer were studied in two feeding experiments. Six animals in each experiment were given lichens contaminated with radiocaesium from fallout after the Chernobyl nuclear power plant accident. In addition, they were fed pellets containing bentonite (Experiment I or zeolite (Experiment II. Two animals, controls, in each experiment received no caesium-binder. The activity concentration of radiocaesium in blood was used to evalute the radiocaesium level in the body. Faeces and urine were collected to measue the excration of radiocaesium. The animals in Experiment I were depleted of radiocaesium before the start of the experiment. After three weeks, with an intake of 17 - 18 kBq Cs-137/day, the controls had reached activity concentrations of radiocaesium in blood corresponding to 4 - 4.5 kBq Cs-137/kg in muscle. Reindeer fed 23 or 46 g of bentonite per day stabilized at values below 0.8 kfiq/kg in muscle. In Experiment II, the reindeer started with radiocaesium activity concentrations in blood corresponding to 2 - 4.5 kBq Cs-137/kg in muscle. After four weeks of feeding, with an intake at about 8.5 kBq Cs-137/day, controls had increased their radiocaesium values by an average of 40%. Reindeer receiving 25 or 50 g zeolite per day decreased with 18 and 45%, respectively. Net absorption of radiocaesium from the gastro-intestinal tract was calculated at 50 -70% in animals receiving no caesium-binder. Reindeer fed bentonite had an absorption below 10% while those fed zeolite absorbed around 35%.

  16. Pharmaceutical equivalence of metformin tablets with various binders

    Directory of Open Access Journals (Sweden)

    L. C. Block


    Full Text Available

    Metformin hydrochloride is a high-dose drug widely used as an oral anti-hyperglycemic agent. As it is highly crystalline and has poor compaction properties, it is difficult to form tablets by direct compression. The aim of this study was to develop adequate metformin tablets, pharmaceutically equivalent to the reference product, Glucophage® (marketed as Glifage® in Brazil. Metformin 500mg tablets were produced by wet granulation with various binders (A = starch, B = starch 1500®, C = PVP K30®, D = PVP K90®. The tablets were analyzed for their hardness, friability, disintegration, dissolution, content uniformity and dissolution profile (basket apparatus at 50 rpm, pH 6.8 phosphate buffer. The 4 formulations, F1 (5% A and 5% C, F2 (5% B and 5% C, F3 (10% C and F4 (5% D, demonstrated adequate uniformity of content, hardness, friability, disintegration and total drug dissolution after 30 minutes (F1, F2 and F4, and after 60 minutes (F3. The drug release time profiles fitted a Higuchi model (F1, F2 and F3, similarly to the pharmaceutical reference, or a zero order model (F4. The dissolution efficiency for all the formulations was 75%, except for F3 (45%. F1 and F2 were thus equivalent to Glifage®. Keywords: dissolution; metformin; tablet; binder; pharmaceutical equivalence


    Directory of Open Access Journals (Sweden)

    J Brian Copley


    The availability of binding capacity data for P binders, presents physicians with the possibility of tailoring doses of binder to a patient’s diet, facilitating sufficient intake of dietary protein while maintaining a neutral P balance. Use of high-capacity binders, such as lanthanum carbonate, would minimize the tablet burden faced by patients and this may also encourage adherence.


    Directory of Open Access Journals (Sweden)

    Felipe Coutinho Onofre


    Full Text Available

    Quando se comparam as metodologias de dosagem Superpave e Marshall de misturas asfálticas, uma das vantagens da primeira é a obtenção do gráfico de compactação. Tem sido verificado para misturas densas e contínuas do tipo Concreto Asfáltico (CA que determinadas áreas observadas nesse gráfico podem diferenciar estas misturas quanto à trabalhabilidade e à resistência à deformação permanente. No presente estudo, os parâmetros Compaction Densification Index (CDI e Traffic Densification Index (TDI foram utilizados como indicadores da compactabilidade. Desenvolveu-se um estudo de correlação entre estas variáveis e a resistência à deformação permanente de misturas asfálticas. Foram avaliadas três misturas asfálticas contendo: (i apenas agregados graníticos, (ii 50% de agregados graníticos e 50% de escória de aciaria e (iii 50% de agregados graníticos e 50% de Resíduo de Construção e Demolição (RCD. As variáveis escolhidas para determinação da resistência à deformação permanente foram o ensaio uniaxial de carga repetida (amostras compactadas para dois percentuais de Volume de vazios e o ensaio com um simulador de tráfego do tipo LCPC. Foi utilizado também o Processamento Digital de Imagens (PDI para a determinação da esfericidade dos agregados estudados, propriedade que influencia na resistência à deformação permanente. Os resultados indicam que as variáveis CDI e TDI podem ser usadas como parâmetros de estudo para prever a resistência à deformação permanente, mesmo para misturas com utilização de resíduos. A caracterização pela técnica do PDI mostrou que o agregado de origem granítica possui uma forma menos próxima a uma esfera em relação aos res

  19. Characterization of early-age hydration processes in lime-ceramic binders using isothermal calorimetry, X-ray diffraction and scanning electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Jerman, Miloš; Tydlitát, Vratislav; Keppert, Martin; Čáchová, Monika; Černý, Robert, E-mail:


    Highlights: • Early age hydration processes in lime-ceramic binders are analyzed within a wide range of component ratios. • The applied waste ceramic dust exhibits partial hydraulic properties, ettringite and calcite are formed. • Transition from tobermorite- to jennite-like structures is identified by SEM within the first 48 h. • The highest specific hydration heat after 300 h, 63 J/g, is measured for the binder containing 70% ceramic. • Substantial effect of the heat of wetting is observed, ranging from 10 J/g for lime to 3.9 J/g for ceramic. - Abstract: Early-age hydration processes in a lime-ceramic-water system are analyzed within the whole range of possible lime/ceramic ratios. The isothermal calorimetry shows a substantial effect of the heat of wetting on the total heat evolved, ranging from 10 J/g for lime to 3.9 J/g for ceramic. The highest specific hydration heat of 63 J/g during the analyzed 300-h hydration period exhibits the blended binder containing 70% ceramic and 30% lime which correlates well with the highest compressive and bending strengths of the paste prepared using this blend. Portlandite, ettringite and calcite are the main phases identified by the X-ray diffraction analysis after the hydration of ceramic-rich blends. According to the results of scanning electron microscopy, the initial course of pozzolanic reaction is for this type of binders characterized by the transition from tobermorite-like calcium-silicate-hydrate structures into jennite-like structures within the first 48 h. Blends with the ceramic content lower than 70% show a high portion of portlandite, calcite is present in low amount, and the jennite-like structures are observed after 48 h, following the initial formation of components with a very high Ca content. The favorable properties of the ceramic-rich blended binders can be explained by the partial hydraulic character of the ceramic. With the specific hydration heat of 29 J/g after 300 h and compressive strength

  20. Time-dependent deformation behavior of polyvinylidene fluoride binder: Implications on the mechanics of composite electrodes (United States)

    Santimetaneedol, Arnuparp; Tripuraneni, Rajasekhar; Chester, Shawn A.; Nadimpalli, Siva P. V.


    The majority of existing battery models that simulate composite electrode behavior assume the binder as a linear elastic material due to lack of a thorough understanding of time-dependent mechanical behavior of binders. Here, thin films of polyvinylidene fluoride binder, prepared according to commercial battery manufacturing method, are subjected to standard monotonic, load-unload, and relaxation tests to characterize the time-dependent mechanical behavior. The strain in the binder samples is measured with the digital image correlation technique to eliminate experimental errors. The experimental data showed that for (charging/discharging) time scales of practical importance, polyvinylidene fluoride behaves more like an elastic-viscoplastic material as opposed to a visco-elastic material; based on this observation, a simple elastic-viscoplastic model, calibrated against the data is adopted to represent the deformation behavior of binder in a Si-based composite electrode; the lithiation/delithiation process of this composite was simulated at different C rates and the stress/strain behavior was monitored. It is observed that the linear elastic assumption of the binder leads to inaccurate results and the time-dependent constitutive behavior of the binder not only leads to accurate prediction of the mechanics but is an essential step towards developing advanced multi-physics models for simulating the degradation behavior of batteries.

  1. Characterization of zirconia-based slurries with different binders for titanium investment casting

    Directory of Open Access Journals (Sweden)

    Zhao Ertuan


    Full Text Available The materials and physical properties of primary slurry are crucial to the surface quality of the finished castings, especially for high reactivity titanium alloys. The aim of this study is to investigate the influence of different binders on the physical properties of primary slurry for titanium alloy investment casting. The zirconia-based slurries with different binders were evaluated by comparing the parameters: viscosity, bulk density, plate weight, suspensibility, gel velocity and strength. The results indicate that a higher viscosity of binder leads to a higher viscosity and suspensibility of slurry with the same powder/binder ratio. The retention rate and thickness of primary layer increase with an increase in the viscosity of the slurry, and a higher retention rate is associated with a thicker primary layer. The gel velocity of the slurry is correlated with the gel velocity of the binder. The green strength and the baked strength of the primary layer are determined by the properties of the binder after gel and by the production of the binder after fired, respectively.

  2. Application of Microbial Biopolymers as an Alternative Construction Binder for Earth Buildings in Underdeveloped Countries

    Directory of Open Access Journals (Sweden)

    Ilhan Chang


    Full Text Available Earth buildings are still a common type of residence for one-third of the world’s population. However, these buildings are not durable or resistant against earthquakes and floods, and this amplifies their potential harm to humans. Earthen construction without soil binders (e.g., cement is known to result in poor strength and durability performance of earth buildings. Failure to use construction binders is related to the imbalance in binder prices in different countries. In particular, the price of cement in Africa, Middle East, and Southwest Asia countries is extremely high relative to the global trend of consumer goods and accounts for the limited usage of cement in those regions. Moreover, environmental concerns regarding cement usage have recently risen due to high CO2 emissions. Meanwhile, biopolymers have been introduced as an alternative binder for soil strengthening. Previous studies and feasibility attempts in this area show that the mechanical properties (i.e., compressive strength of biopolymer mixed soil blocks (i.e, both 1% xanthan gum and 1% gellan gum satisfied the international criteria for binders used in earthen structures. Economic and market analyses have demonstrated that the biopolymer binder has high potential as a self-sufficient local construction binder for earth buildings where the usage of ordinary cement is restricted.

  3. Comparison of cathode catalyst binders for the hydrogen evolution reaction in microbial electrolysis cells

    KAUST Repository

    Ivanov, Ivan


    Nafion is commonly used as a catalyst binder in many types of electrochemical cells, but less expensive binders are needed for the cathodes in microbial electrolysis cells (MECs) which are operated in neutral pH buffers, and reverse electrodialysis stacks (RED),which use thermolytic solutions such as ammonium bicarbonate. Six different binders were examined based on differences in ion exchange properties (anionic: Nafion, BPSH20, BPSH40, S-Radel; cationic: Q-Radel; and neutral: Radel, BAEH) and hydrophobicity based on water uptake (0%, Radel; 17–56% for the other binders). BPSH40 had similar performance to Nafion based on steady-state polarization single electrode experiments in a neutral pH phosphate buffer, and slightly better performance in ammonium bicarbonate. Three different Mo-based catalysts were examined as alternatives to Pt, with MoB showing the best performance under steady-state polarization. In MECs, MoB/BPSH40 performed similarly to Pt with Nafion or Radel binders. The main distinguishing feature of the BPSH40 was that it is very hydrophilic, and thus it had a greater water content (56%) than the other binders (0–44%). These results suggest the binders for hydrogen evolution in MECs should be designed to have a high water content without sacrificing ionic or electronic conductivity in the electrode.

  4. Experimental evaluation on high temperature rheological properties of various fiber modified asphalt binders

    Institute of Scientific and Technical Information of China (English)

    陈筝; 吴少鹏; 朱祖煌; 刘杰胜


    High temperature rheological properties of fiber modified asphalt binders and impact of the type and content on such properties were studied.Three types of fiber,including polyester(PET),polyacrylonitrile(PAN) and cellulose(CEL),a control content(0%) and four levels of fiber content(2%,4%,6% and 8% by total asphalt binder mass) were used with asphalt binders.The high temperature rheological properties,consisting of complex modulus(G*) and phase angle δ,were measured using SHRP’s dynamic shear rheometer(DSR) between 46-82 ℃.Experimental results indicate that the changes of G* and tan δ of fiber modified asphalt binders with the increase of test temperature tend to slow down,and the temperature susceptibility is improved obviously compared to that of original asphalt binder.Fiber modification results in the increase of rutting parameter(G*/sin δ) at high temperatures,the decrease of temperature susceptibility,and further improved high temperature performance of asphalt binder.An excellent correlation exhibits between fiber content and high temperature performance of asphalt binder.Moreover,fiber type also has different influences on the improvement of G*/sin δ,G*/sin δ of PET and PAN fiber asphalt binders are both higher than that of CEL fiber,but G*/sin δ of CEL fiber is still higher than that of original asphalt.However,there is a critical fiber content when fibers start to interact with each other.Therefore,based on the critical fiber content and economic consideration,the optimum fiber contents for various fiber-modified asphalt binders are obtained.

  5. Shear resistance properties of TPS modified bitumen binders and asphalt mixtures

    Institute of Scientific and Technical Information of China (English)

    曹庭维; 吴少鹏; 刘聪慧; 张涛


    Shear resistance properties of the virgin bitumen and modified bitumen binders with Tafpack Super(TPS) modifier and SBS modified bitumen were discussed.Dynamic shear rheometer(DSR) was used to measure the laboratory creep data for these binders over a wide range of constant shear stresses at 20 ℃ to characterize the shear creep behaviors of all kinds of asphalt binders,and the rutting test system was used to investigate the permanent deformation of porous asphalt mixtures using the above bitumen binders for a fixed compressive stress.The shear strain rate and shear creep modulus were used to characterize the shear creep behavior of the TPS modified bitumen,and the rutting test results were used to show the consistency of porous asphalt mixtures with the bitumen binders.Results indicate that a distinction of shear creep strain can be made among different contents of TPS modified bitumen at the same stress level,where the shear creep strain-time response curve of the SBS modified bitumen binder is between the curves of the 8% TPS and 12% TPS modified bitumen binders.The shear strain rate and the shear creep modulus of the TPS modified bitumen binders are obtained to compare with those of the SBS modified bitumen binder which results in the same trend as the shear creep strain-time response curve.Permanent deformation results of all the porous asphalt mixtures from the rutting test show reasonable agreement with the findings of the shear strain rates and shear creep modulus over the range of shear stress levels.

  6. Multispectroscopic and Isotopic Ratio Analysis To Characterize the Inorganic Binder Used on Pompeian Pink and Purple Lake Pigments. (United States)

    Marcaida, Iker; Maguregui, Maite; Morillas, Héctor; García-Florentino, Cristina; Knuutinen, Ulla; Carrero, Jose Antonio; Fdez-Ortiz de Vallejuelo, Silvia; Pitarch Martı́, Africa; Castro, Kepa; Madariaga, Juan Manuel


    Because of the fact that pigments are not ubiquitous in the archeological record, the application of noninvasive analytical methods is a necessity. In this work, pink and purple lake pigments recovered from the excavations of the ancient city of Pompeii (Campania, Italy) and preserved in their original bowls at the Naples National Archaeological Museum (Italy) were analyzed to characterize the composition of their inorganic binders (mordants). In situ preliminary analyses using a hand-held energy dispersive X-ray fluorescence spectrometer (HH-ED-XRF) allowed us to determine the use of an aluminosilicate enriched in Cu and Pb. Scanning electron microscopy coupled to energy dispersive X-ray spectrometry (SEM-EDS) and benchtop ED-XRF analyses confirmed these results, while inductively coupled plasma mass spectrometry (ICPMS) allowed one to determine the concentration of major, minor, and trace elements. The use of other techniques such as X-ray diffraction (XRD), and micro-Raman and infrared spectroscopies allowed one to characterize the pigments at the molecular level. The high concentration of Cu detected in the pigments (1228-12937 μg g(-1)) could be related to the addition of Cu salts to obtain the desired final hue. The concentrations of Pb (987-2083 μg g(-1)) was also remarkable. Lead isotopic ratio analysis ((206)Pb/(207)Pb) suggested a possible origin related to the leaching of the ancient lead pipes from Pompeii and the subsequent transfer to the buried pigments or to the inorganic binder. Molecular analysis also showed that the binder is composed of an allophane-like clay. Moreover, it was possible to determine that to obtain the final purple hue of a specific pigment, Pompeian blue pigment was also mixed into the dyed clay.


    Directory of Open Access Journals (Sweden)

    Ezio Santagata


    Full Text Available Magneto-rheological fluids are materials that exhibit a significant change in their rheological properties in the presence of a magnetic field. Because of such a field-dependent behavior, they can act as smart materials in applications in which changeable performances are desired. In road pavement engineering, the use of bitumen-based magneto-rheological fluids may open innovative scenarios related to the construction of smart pavement sections and to the investigation of damage mechanisms in binders and mixtures. The research work presented in this study explored magneto-rheological properties of several field-responsive bituminous binders obtained from two different base bitumens combined with multi-wall carbon nanotubes and powder iron. The experimental program included oscillatory shear loading tests at different temperatures, performed in the strain controlled mode by means of a dynamic shear rheometer equipped with a magneto-rheological device. The investigation was carried out with the specific goal of identifying critical issues which should be taken into account in materials preparation, testing procedures and data analysis. Undesired overheating of specimens during testing was identified and taken into account for a correct interpretation of experimental data. Thus, while the field-sensitivity of carbon nanotubes was found to be negligible as a result of the magnetic shielding action of bitumen, it was shown that powder iron can significantly affect the magneto-rheological properties of bituminous binders when employed in sufficiently high amounts. Moreover, obtained results indicated that selection of base bitumen is a key factor in designing bituminous-based smart materials. Practical implications which derive from the study are mainly relative to the fine-tuning of laboratory characterization procedures which should necessarily overcome current limitations in temperature regulation and magnetic field generation. Experimental data

  8. Influence of microcrystalline wax on properties of MIM multi-component wax matrix binder

    Institute of Scientific and Technical Information of China (English)

    张健; 黄伯云; 李益民; 李松林


    The properties of PW-EVA-HDPE binder with the addition of MW were studied. It shows that the addition of MW from 1% to 20%(mass fraction) causes an increase in the tensile strength and a decrease in shrinkage of the binder. After blending PW with MW, the crystallation behavior of wax base changes, which results in fine grain for the binder and more isotropic microstructure for the feedstock. The powder loading capacity increases and homogeneity of feedstock becomes better. The reason of the modification is also discussed.

  9. Polyolefin Backbone Substitution in Binders for Low Temperature Powder Injection Moulding Feedstocks

    Directory of Open Access Journals (Sweden)

    Berenika Hausnerova


    Full Text Available This paper reports the substitution of polyolefin backbone binder components with low melting temperature carnauba wax for powder injection moulding applications. The effect of various binder compositions of Al2O3 feedstock on thermal degradation parameters is investigated by thermogravimetric analysis. Within the experimental framework 29 original feedstock compositions were prepared and the superiority of carnauba wax over the polyethylene binder backbone was demonstrated in compositions containing polyethylene glycol as the initial opening agent and governing the proper mechanism of the degradation process. Moreover, the replacement of synthetic polymer by the natural wax contributes to an increase of environmental sustainability of modern industrial technologies.

  10. Burn Rate Studies on AN-Based Propellants: Effect of N-N Bonded Binders.

    Directory of Open Access Journals (Sweden)

    C. Oommen


    Full Text Available New epoxy resins having N-N bonds in their structures have been employed as binders for ammonium nitrate (AN-based propellants. The resins have been characterized by various analytical techniques. The effect of the new binders on the burn rates of AN-based compositions including the metallized systems has been examined. The overall enhancement in the burn rate, as compared to that observed with conventional binders, has been explained in terms of the combustion reactivity of the N-N bondwiththe oxidizing speciesproduced duringcombustion. Furtherincreasein burn rate canbe achieved by inclusion of magnesium metal or ammonium perchlorate into these compositions.

  11. Do aluminium-based phosphate binders continue to have a role in contemporary nephrology practice? (United States)

    Mudge, David W; Johnson, David W; Hawley, Carmel M; Campbell, Scott B; Isbel, Nicole M; van Eps, Carolyn L; Petrie, James J B


    Aluminium-containing phosphate binders have long been used for treatment of hyperphosphatemia in dialysis patients. Their safety became controversial in the early 1980's after reports of aluminium related neurological and bone disease began to appear. Available historical evidence however, suggests that neurological toxicity may have primarily been caused by excessive exposure to aluminium in dialysis fluid, rather than aluminium-containing oral phosphate binders. Limited evidence suggests that aluminium bone disease may also be on the decline in the era of aluminium removal from dialysis fluid, even with continued use of aluminium binders. The K/DOQI and KDIGO guidelines both suggest avoiding aluminium-containing binders. These guidelines will tend to promote the use of the newer, more expensive binders (lanthanum, sevelamer), which have limited evidence for benefit and, like aluminium, limited long-term safety data. Treating hyperphosphatemia in dialysis patients continues to represent a major challenge, and there is a large body of evidence linking serum phosphate concentrations with mortality. Most nephrologists agree that phosphate binders have the potential to meaningfully reduce mortality in dialysis patients. Aluminium is one of the cheapest, most effective and well tolerated of the class, however there are no prospective or randomised trials examining the efficacy and safety of aluminium as a binder. Aluminium continues to be used as a binder in Australia as well as some other countries, despite concern about the potential for toxicity. There are some data from selected case series that aluminium bone disease may be declining in the era of reduced aluminium content in dialysis fluid, due to rigorous water testing. This paper seeks to revisit the contemporary evidence for the safety record of aluminium-containing binders in dialysis patients. It puts their use into the context of the newer, more expensive binders and increasing concerns about the risks of

  12. The curious case of zeolite-clay/binder interactions and their consequences for catalyst preparation


    Whiting, Gareth T.; Chowdhury, Abhishek Dutta; Oord, R. van; Paalanen, Pasi; Weckhuysen, Bert M.


    Zeolite-based catalyst bodies are commonly employed in a range of important industrial processes. Depending on the binder and shaping method chosen, vast differences in the reactivity, selectivity and stability are obtained. Here, three highly complementary micro-spectroscopic techniques were employed to study zeolite ZSM-5-binder interactions in SiO2-, Al2O3-, SiO2 : Al2O3- (2 : 1 mix) and kaolinite-bound catalyst pellets. We establish how their preparation influences the zeolite-clay/binder...

  13. Study on catalysis effect of TEPB on the curing reaction of HTPB binder system (United States)

    Chang, S. J.; Tang, J.; Liu, X.; Yan, W.


    The catalysis effect of tri (exhoxyphenyl) bismuthine (TEPB) on the curing reaction of HTPB binder system was studied by using DSC method. The curing peak temperatures of the catalyst systems were measured to calculate kinetic parameters by using Kissinger and Crane methods, respectively. Two curing reaction kinetic equations were established. The results show that TEPB has high catalytic activity and can decrease the curing temperature of HTPB binder system, down to 35 °C, in which the optimum volume of TEPB is 0.5% of HTPB binder system.

  14. Influence of crumb rubber and digestion time on the asphalt rubber binders


    Neto, Silvrano Adonias Dantas; De Farias, Márcio Muniz; Pais, Jorge C.; Pereira, Paulo A. A.; Sousa, Jorge B.


    This paper shows the results of a study about the mechanical behavior of dense graded asphalt-rubber hot mixes prepared with two different types of asphalt-rubber binders. These asphalt-rubber binders were obtained with penetration grade asphalt (AC 50/70) mixed with 21% and 25% of crumb rubber in weight. The rubber was recycled from unserviceable tires using the ambient grinding process. Hot mixes made with the conventional binder AC 50/70 were also studied for comparison. The...

  15. A Binder Viscosity Effect on the Wet-Wounded Composite Porosity in the Impregnating Bath

    Directory of Open Access Journals (Sweden)

    M. A. Komkov


    Full Text Available The aim of this work is to define experimentally an impregnation rate of VM-1 glass fibers and CBM aramid bundles with the epoxy binder EDB-10 using wet method of winding. During the impregnation process of the fibrous fillers by the liquid binder, air is displaced from the interfiber space of fiber and bundle. With the composite product winding a fiber impregnation process is short. That is why gas inclusions or pores are formed in the polymer-fiber compositeThe impregnation rate or porosity of wound material will depend directly on the binder viscosity. To reduce an epoxy binder viscosity temporarily is possible by two ways. The first is to heat a liquid epoxy composition EDB-10 to the maximum possible temperature during the winding process of the product. The second method is to dilute the binder by a solvent, such as acetone or alcohol. However, the solvent reduces its strength.The paper presents experimental data to show the volumetric content of pores in the wound composite affected only by the viscosity of the epoxy binder. Heating a binder allowed us to regulate a changing conditional viscosity of the binder in the impregnating bath for the normal conditions of impregnation. Other impacts on the impregnation and filament-winding processes, such as filler kinks, squeeze, vacuuming binder, highly tensioned winding, and others were not used.Experimentally obtained dependences of the porosity value of wound composite on the conditional viscosity of binder are nonlinear and can be used to design heaters for impregnating devices of winders. The research technique and results can be used in development of technological processes to manufacture composite structures by winding from the other reinforcing fibrous fillers and thermo-active binders.The results show that the volumetric content of pores can significantly vary within 8 - 14 % of material volume. Therefore, to reduce the number of pores in the wound composite to 1-2 %, auxiliary

  16. FTIR spectroscopy of water glass - the binder moulding modified by ZnO nanoparticles

    Directory of Open Access Journals (Sweden)

    A. Bobrowski


    Full Text Available The subject of the paper is the determination of the infl uence of the colloidal nanoparticles of zinc oxide on the structure of sodium water glass. Nanoparticles of zinc oxide in ethanol solvent were introduced into the water glass. The modification and structural changes were determined by means of the FT-IR absorption spectra. In order to determine the kind of infl uence: binder-modifier the spectroscopic FTIR analysis of samples of a fresh binder and of a binder hardened for 24 h in the air was performed by means of the spectrometer Digilab Excalibur with a standard DTGS detector.

  17. Cirugía ortognática y rinoplastia en el síndrome de Binder Orthognathic surgery and rhinoplasty in Binder syndrome

    Directory of Open Access Journals (Sweden)

    M. Tito


    Full Text Available El síndrome de Binder es una patología caracterizada por hipoplasia nariz-maxilar, ángulo naso-frontal plano, senos frontales hipoplasicos, ausencia de la espina nasal anterior, columela corta y ángulo nasolabial agudo. El tratamiento del los pacientes con síndrome de Binder puede ser ortodóntico o quirúrgico según la gravedad de la malformación. En este trabajo hemos realizado una revision bibliográfica sobre la etiología, el diagnóstico diferential y el tratamiento de la sindrome de Binder y presentamos un caso clínico de un paciente binderiano sometido a intervención de cirugía ortognática y rinoplastia con injerto de cartílago costal para recostruir el dorso y la punta nasal.Binder syndrome is a disorder characterized by nasomaxillary hypoplasia that results in a short nose, a frontonasal angle of almost 180 degrees, hypoplasia of the frontal sinuses, an absent anterior nasal spine, a short columella and an acute nasolabial angle. The patient can be treated orthodontically or surgically depending on the seriousness of the malformation. We review the literature on the etiology, differential diagnosis and treatment of Binder syndrome. We present the case of a boy with this syndrome surgically treated with orthognatic surgery and rhinoplasty with an L-shaped rib cartilage graft.

  18. Influence of the ZnO nanoarchitecture on the electrochemical performances of binder-free anodes for Li storage (United States)

    Dall'Asta, V.; Tealdi, C.; Resmini, A.; Anselmi Tamburini, U.; Mustarelli, P.; Quartarone, E.


    Zinc oxide nanoarchitectures may be employed as binder-free, high specific capacity anodes for lithium batteries. By means of simple and low-impact wet chemistry approaches, we synthesized 1D (nanorods), 2D (single- and multi-layered nanosheets), and 3D (nanobrushes) ZnO arrays. These nanoarchitectures were compared as far as concerns their electrochemical properties and the structural modifications upon lithiation/delithiation. The best results were offered by 2D nanosheets, which showed reversible capacity of the order of 400 mAhg-1 after 100 cycles at 1 Ag-1. This was due to: i) small nanoparticles, with average diameter of about 10 nm, which maximize the array specific surface area and favor the formation of the LiZn alloy; ii) the presence of a mesoporous texture, which allows larger space for accommodating the volume changes upon lithiation/delithiation. However, also these 2D structures showed large irreversible capacity losses. Our work highlights the need for more efficient buffering solutions in ZnO binder-free nanostructured anodes.

  19. Effect of different binders and encapsulation techniques in the structure and functional properties of microdiets for fish larvae

    Directory of Open Access Journals (Sweden)

    Ana Grenha


    effects towards nutrient leaching and physical stability of the micro-pellets after immersion in water are highly dependent on binder type and less markedly on binder dose. Through the use of selected binders (e.g. guar gum and gelatin in association to a spray-drying encapsulation process, we were able to significantly alter the release profile of Zn, Mn and taurine. Some of these prototypes were also tested in vivo with gilthead seabream larvae and clearly suggest that microencapsulation technologies that allow a controlled release profile of nutrients result in beneficial effects to larval growth and quality criteria. The results of several specific scenarios will be presented.

  20. Facile synthesis of porous graphene as binder-free electrode for supercapacitor application

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Guangsheng [Nanjing National Laboratory of Microstructures and Department of Physics, Jiangsu Key Laboratory for Nanotechnology, Nanjing University, Nanjing 210093 (China); Academy of Space Technolgy, Nanchang University, Nanchang, Jiangxi 330031 (China); Huang, Haifu, E-mail: [Nanjing National Laboratory of Microstructures and Department of Physics, Jiangsu Key Laboratory for Nanotechnology, Nanjing University, Nanjing 210093 (China); College of Physics Science and Engineering, Guangxi University, Nanning 530004 (China); Lei, Chenglong; Cheng, Zhenzhi; Wu, Xiaoshan [Nanjing National Laboratory of Microstructures and Department of Physics, Jiangsu Key Laboratory for Nanotechnology, Nanjing University, Nanjing 210093 (China); Tang, Shaolong, E-mail: [Nanjing National Laboratory of Microstructures and Department of Physics, Jiangsu Key Laboratory for Nanotechnology, Nanjing University, Nanjing 210093 (China); Du, Youwei [Nanjing National Laboratory of Microstructures and Department of Physics, Jiangsu Key Laboratory for Nanotechnology, Nanjing University, Nanjing 210093 (China)


    Graphical abstract: - Highlights: • Our results provide a facile method to fabricate a binder-free porous rGO electrode for supercapacitors. • Polystyrene (PS) colloidal particles were used as spacers to prepare high-performance porous grapheme deposited directly on Ni foam substrate. • The specific capacitance of the rGO/NF electrode decreased by 7% after 2000 cycles and high rate capability of 53% capacitance retention at 100 A g{sup −1}. - Abstract: Here, porous grapheme oxide (GO) gel deposited on nickel foam was prepared by using polystyrene (PS) colloidal particles as spacers for use as electrodes in high rate supercapacitors, then reduced by Vitamin C aqueous solution in ambient condition. The PS particles were surrounded by reduced graphene oxide (rGO) sheets, forming crinkles and rough textures. When PS particles were selectively removed, rGO gel coated on the skeleton of Ni foam can formed an open porous structure, which prevents elf-aggregation and restacking of graphene sheets. The porous rGO-based supercapacitors exhibit excellent electrochemical performances such as a specific capacitance of 152 F g{sup −1} at 1 A g{sup −1}, high rate capability of 53% capacitance retention upon a current increase to 100 A g{sup −1} and good cycle stability, due to effective rapid and short pathways for ionic and electronic transport provided by the sub-micrometer structure of rGO gel and 3D interconnected network of Ni foam.

  1. Grb2-associated binder-1 is required for extrafusal and intrafusal muscle fiber development. (United States)

    Park, So Y; Jang, So Y; Shin, Yoon K; Yoon, Byeol A; Lee, Hye J; Park, Hwan T


    The neuregulin-1 (NRG1) signaling pathway plays an important role in the development of the peripheral neuromuscular system, including in muscle spindle and postnatal myelination. We previously showed that NRG1 on the axonal membrane regulates peripheral nerve myelination through Grb2-associated binder 1 (Gab1), a scaffolding mediator of receptor tyrosine kinase signaling. Here, we determined the role of Gab1 in the development of muscles and the muscle spindle using muscle-specific conditional Gab1 knockout mice. The mutant mice showed general retardation in muscular growth and hypotrophy of extrafusal muscle fibers. In addition, the muscle-specific Gab1 knockout mutant exhibited significant underdevelopment of muscle spindles, which are normally regulated by NRG1, and abnormal proprioceptive behavior. Furthermore, the selective knockdown of Gab1 in C2C12 muscle cells reduced NRG1-induced expression of Egr3, a critical transcription factor for muscle spindle development. However, Gab2 knockout mice did not show any defects in the development of muscles or muscle spindles. Our findings suggest that Gab1 is an essential signaling molecule in mediating axonal NRG1 signaling for the development of both extrafusal and intrafusal muscle fibers.

  2. Force measurements reveal how small binders perturb the dissociation mechanisms of DNA duplex sequences (United States)

    Burmistrova, Anastasia; Fresch, Barbara; Sluysmans, Damien; de Pauw, Edwin; Remacle, Françoise; Duwez, Anne-Sophie


    The force-driven separation of double-stranded DNA is crucial to the accomplishment of cellular processes like genome transactions. Ligands binding to short DNA sequences can have a local stabilizing or destabilizing effect and thus severely affect these processes. Although the design of ligands that bind to specific sequences is a field of intense research with promising biomedical applications, so far, their effect on the force-induced strand separation has remained elusive. Here, by means of AFM-based single molecule force spectroscopy, we show the co-existence of two different mechanisms for the separation of a short DNA duplex and demonstrate how they are perturbed by small binders. With the support of Molecular Dynamics simulations, we evidence that above a critical pulling rate one of the dissociation pathways becomes dominant, with a dramatic effect on the rupture forces. Around the critical threshold, we observe a drop of the most probable rupture forces for ligand-stabilized duplexes. Our results offer a deep understanding of how a stable DNA-ligand complex behaves under force-driven strand separation.The force-driven separation of double-stranded DNA is crucial to the accomplishment of cellular processes like genome transactions. Ligands binding to short DNA sequences can have a local stabilizing or destabilizing effect and thus severely affect these processes. Although the design of ligands that bind to specific sequences is a field of intense research with promising biomedical applications, so far, their effect on the force-induced strand separation has remained elusive. Here, by means of AFM-based single molecule force spectroscopy, we show the co-existence of two different mechanisms for the separation of a short DNA duplex and demonstrate how they are perturbed by small binders. With the support of Molecular Dynamics simulations, we evidence that above a critical pulling rate one of the dissociation pathways becomes dominant, with a dramatic effect

  3. Chemical Characterization of Lime-Based Binders in Historic Buildings of Latvia (United States)

    Kirilovica, I.; Gulbe, L.; Vitina, I.; Igaune-Blumberga, S.


    The aim of this research is to investigate the chemical composition of stone materials of several local historic buildings with a purpose of elaboration of restoration strategy, including the choice of restoration materials. Most of the examined mortars are lime- based hydraulic mortars, characteristic of the architecture of 19th/20th century. Pure aerial lime binders show reduced compatibility with historic materials, that is why lime binders with pozzolan additive (cement) are an appropriate choice for restoration. In order to examine the changes of hydraulicity (i.e. the property of binders to harden when exposed to water) of perspective restoration binders, a series of blended lime-cement mixtures were synthesized with growing content of cement (up to 10% by weight). A significant relationship between cement content and hydraulic properties has been shown.

  4. Optimum Parameters for the Formulation of Charcoal Briquettes Using Bagasse and Clay as Binder

    National Research Council Canada - National Science Library

    M.S. Rao; B.N. Chikamai; J.M. Onchieku


    ... for the formulation of charcoal briquettes for household use tosupplement wood charcoal. In this study briquettes were formulated usingcarbonized bagasse, clay as a binder and molasses as a filler...

  5. Optimum Parameters for the Formulation of Charcoal Briquettes Using Bagasse and Clay as Binder

    National Research Council Canada - National Science Library

    J.M. Onchieku; B.N. Chikamai; M.S. Rao


    ... for the formulation of charcoal briquettes for household use tosupplement wood charcoal. In this study briquettes were formulated usingcarbonized bagasse, clay as a binder and molasses as a filler...

  6. Study of Rheological Properties of Bituminous Binders in Middle and High Temperatures

    Directory of Open Access Journals (Sweden)

    Remišová Eva


    Full Text Available The bitumen binders in road pavements are exposed traffic loading effect at different climatic conditions. A resistance to these stresses depends on bitumen properties as well. The paper presents rheological properties (G*, δ, ν* determined and compared for four bituminous binders (unmodified and polymer modified bitumen at temperature 46 – 60 (80 °C and dynamic viscosity at temperature 130 – 190 °C (Brookfield viscometer. On the basis of viscosity results it is possible to set optimal production and compaction temperatures. Elastic and viscous behavior of binder in the middle temperature is determined in rheometers. The higher value of complex modulus, the stiffer bitumen binder is able to resist deformation. The greater content of elastic components (e.g. polymer in bitumen varies mainly elastic-viscous properties of primary bitumen.

  7. Tungsten carbide coatings with different binders prepared by low power plasma spray system

    Institute of Scientific and Technical Information of China (English)

    GAO Yang; M.F.Morks; FU Ying-qing


    Thermal spraying of cermet coatings is widely used for protection of machining parts against wear and corrosion. These coatings consist of WC particles in metal binders such as Co, Cr and Ni. Three kinds of WC powders with different metal binders (Co, NiCr and CoCr) were sprayed by low power plasma spray system on Al-Si-Cu alloy substrate. Fundamental aspects of sprayed cermet coatings, including (i) the effects of binder type on the coating structure, (ii) the hardness and (iii) the microstructure, were investigated. All cermet coatings have the same phase structure such as WC and W2 C. However, the intensities of these phases are different in each coating, mainly due to the difference in solidification rate in each case. Moreover, the hardness measurements are found to be different in each coating. The results show that, binder type has a significant effect on the physical and mechanical properties of the sprayed coatings.

  8. Some aspects on improvement of water resistant perfornace of gypsum binders

    Directory of Open Access Journals (Sweden)

    Fomina Ekaterina


    Full Text Available The study reports that control of water resistant and strength performance of composite binder can be accomplished by using nanostructured gypsum silicate binder and portland cement and reduction of calcium sulfate dihydrate. Formation of an arranged more dense packing in crystal matrix of binder structure can be achieved through polydispersity of nanostructured silicon component. Highly reactive silica particles participate in synthesis of microcrystalline compounds such as hydroxylellestadite and serve as nucleation sites providing an increase of surface contact area between crystal structures. Cement in the system provides conditions to synthesis of stable flat-like hydroxysulfoaluminates. Upon hydration of a binder crystals of calcium sulfate dihydrate impound to a mass of water resistant crystalhydrate new formations, type and morphology of which promotes decreasing of intercrystal porosity followed by density, strength and water resistance increase of the composite.

  9. Testing a Novel Geopolymer Binder as a Refractory Material for Rocket Plume Environments at SSC Project (United States)

    National Aeronautics and Space Administration — The project involved the development and testing of a new alumina-silicate based multi-purpose, cost-effective, ‘green’ cementitious binder (geopolymer)...

  10. Organically modified clays as binders of fumonisins in feedstocks. (United States)

    Baglieri, Andrea; Reyneri, Amedeo; Gennari, Mara; Nègre, Michèle


    This study reports an investigation on the ability of organically modified clays to bind mycotoxins, fumonisins B1 (FB1) and B2 (FB2). Organically modified clays are commercia materials prepared from natural clays, generally montmorillonite, by exchanging the inorganic cation with an ammonium organic cation. A screening experiment conducted on 13 organically modified clays and 3 nonmodified clays, used as controls, has confirmed that the presence of an organic cation in the clay interlayer promoted the adsorption of both fumonisins. On the basis of the results of the screening test, four modified clays and a Na-montmorillonite were selected for the determination of the adsorption kinetics and isotherms. On all the tested materials adsorption took place within one hour of contact with fumonisins solutions. Adsorption isotherms have pointed out that the modified clays exhibited a higher adsorptive capacity than the unmodified clay. It was also demonstrated that, notwithstanding the reduced structural difference between FB1 and FB2, they were differently adsorbed on the modified clays. Addition of 2% modified clays to contaminated maize allowed a reduction of more than 70% and 60% of the amount of FB1and FB2 released in solution. Although in vivo experiments are required to confirm the effectiveness of the organically modified clays, these preliminary results suggest that these materials are promising as fumonisins binders.

  11. Poly(lactic acid) degradable plastics, coatings, and binders

    Energy Technology Data Exchange (ETDEWEB)

    Bonsignore, P.V.; Coleman, R.D.; Mudde, J.P.


    Biochemical processes to derive value from the management of high carbohydrate food wastes, such as potato starch, corn starch, and cheese whey permeate, have typically been limited to the production of either ethanol or methane. Argonne National Laboratory (ANL) believes that lactic acid presents an attractive option for an alternate fermentation end product, especially in light of lactic acids' being a viable candidate for conversion to environmentally safe poly(lactic acid) (PLA) degradable plastics, coatings, and binders. Technology is being developed at ANL to permit a more cost effective route to modified high molecular weight PLA. Preliminary data on the degradation behavior of these modified PLAs shows the retention to the inherent hydrolytic degradability of the PLA modified, however, by introduced compositional variables. A limited study was done on the hydrolytic stability of soluble oligomers of poly(L-lactic acid). Over a 34 day hold period, water-methanol solutions of Pl-LA oligomers in the 2-10 DP range retained some 75% of their original molecular weight.

  12. Poly(lactic acid) degradable plastics, coatings, and binders

    Energy Technology Data Exchange (ETDEWEB)

    Bonsignore, P.V.; Coleman, R.D.; Mudde, J.P.


    Biochemical processes to derive value from the management of high carbohydrate food wastes, such as potato starch, corn starch, and cheese whey permeate, have typically been limited to the production of either ethanol or methane. Argonne National Laboratory (ANL) believes that lactic acid presents an attractive option for an alternate fermentation end product, especially in light of lactic acids` being a viable candidate for conversion to environmentally safe poly(lactic acid) (PLA) degradable plastics, coatings, and binders. Technology is being developed at ANL to permit a more cost effective route to modified high molecular weight PLA. Preliminary data on the degradation behavior of these modified PLAs shows the retention to the inherent hydrolytic degradability of the PLA modified, however, by introduced compositional variables. A limited study was done on the hydrolytic stability of soluble oligomers of poly(L-lactic acid). Over a 34 day hold period, water-methanol solutions of Pl-LA oligomers in the 2-10 DP range retained some 75% of their original molecular weight.

  13. Recent developments in binder design for advanced media (United States)

    Kim, K. J.; Farkas, J.; Hasman, D.; Miller, T.; Zellia, J.; Jacobs, P.


    This study is aimed to examine the technical issue, the rheological requirements, in accomplishing successful processing of the dispersion made with wetting binders to produce tapes with excellent mechanical properties. The results indicate that the dispersions made with DTPU or NTPU (new dispersing TPU for metal pigments), can be characterized using RFS 8400 and Bolin CSM. For this type of dispersion, a higher strain is required to start flow or to break the primary structure, a wider range of shear rate is needed for the structural breakdown. It also shows that the recovery time is shorter with longer time to reach a steady state that is a lower recovery compliance level. G'/ G″ cross-over point was defining the needed strain level and the strain rate for the structural breakdown. It is expected that the results of the study could be applied to define the mechanical properties of the final tape affected by various operations such as mixing/agitation, high coating speed, drying/calendering, and curing and high speed duplicating process.

  14. Quality of buffalo meat burger containing legume flours as binders. (United States)

    Modi, V K; Mahendrakar, N S; Narasimha Rao, D; Sachindra, N M


    The effect of addition of different decorticated legume flours, viz., soya bean, bengal gram, green gram and black gram, on the quality of buffalo meat burger was studied. The burgers consisted of optimized quantities of roasted or unroasted legume flour, spices and common salt. Inclusion of roasted black gram flour registered the highest yield of 95.7%, lowest shrinkage of 5% and lowest fat absorption of 26.6% on frying. Protein content of 18-20% was highest in the soya flour formulation. Free fatty acid (FFA) values (as% oleic) increased from 14.3 to 17.3 in freshly prepared samples (before frying) to 16.0-19.4 in 4 m frozen (-16±2 °C) stored samples and fried samples had about 25% lower FFA values. Formulations with roasted flours registered lower thiobarbituric acid (TBA) values (mg malonaldehyde/kg sample) of 0.6-1.5 as against 0.6-2.1 for unroasted flours before frying. The burgers prepared with any of these binders were organoleptically acceptable even after storage at -16±2 °C for 4 months., However, the burger with black gram dhal (dehulled split legume) flour had better sensory quality attributes compared to other legumes.

  15. Study on the hardening mechanism of cement asphalt binder

    Institute of Scientific and Technical Information of China (English)


    The hydration and hardening mechanism of cement asphalt binder(CAB) was studied.The early hydration process,hydration products and paste microstructure of CAB made by Portland cement and anionic asphalt emulsion were investigated by calorimetry,X-ray diffraction,and environmental scanning electron microscopy.The early hydration process of CAB can be characterized as 5 stages similar to those of Portland cement.There is no chemical reaction detected between cement and asphalt,hence no new hydration products other than those of Portland cement are produced.The hardening of CAB begins with the hydration of cement.When the hydration of cement comes into the acceleration period and its exothermic rate comes to the maximum,the coalescence of asphalt particles in asphalt emulsion is triggered.In the hardened system of CAB,it was found that the hydration products of cement form the skeleton and are covered by the continuous asphalt film.They formed an interpenetrating network system.The emulsifiers in the asphalt emulsion may retard the hydration process of cement.

  16. Characterization of hydrocarbon emissions from green sand foundry core binders by analytical pyrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Yujue Wang; Fred S. Cannon; Magda Salama; Jeff Goudzwaard; James C. Furness [Pennsylvania State University, University Park, PA (United States). Department of Civil and Environmental Engineering


    Analytical pyrolysis was conducted to compare the hydrocarbon and greenhouse gas emissions of three foundry sand binders: (a) conventional phenolic urethane resin, (b) biodiesel phenolic urethane resin, and (c) collagen-based binder. These binders are used in the metal casting industry to create internal cavities within castings. Green sand contains silica sand, clay, carbonaceous additives (eg bituminous coal) and water. The core samples were flash pyrolyzed in a Curie-point pyrolyzer at 920{sup o}C with a heating rate of about 3000{sup o}C/sec. This simulated some key features of the fast heating conditions that the core binders would experience at the metal-core interface when molten metal is poured into green sand molds. The core samples were also pyrolyzed in a thermogravimetric analyzer (TGA) from ambient temperature to 1000{sup o}C with a heating rate of 30{sup o}C/min, and this simulated key features of the slow heating conditions that the core binders would experience at distances that are further away from the metal-core interface during casting cooling. Hydrocarbon emissions from flash pyrolysis were analyzed with a gas chromatography-flame ionization detector, while hydrocarbon and greenhouse gas emissions from TGA pyrolysis were monitored with mass spectrometry. The prominent hazardous air pollutant emissions during pyrolysis of the three binders were phenol, cresols, benzene, and toluene for the conventional phenolic urethane resin and biodiesel resin, and benzene and toluene for the collagen-based binder. Bench-scale analytical pyrolysis techniques could be a useful screening tool for the foundries to compare the relative emissions of alternative core binders and to choose proper materials in order to comply with air-emission regulations. 20 refs., 4 figs., 1 tab.

  17. Characterization of zirconia-based slurries with different binders for titanium investment casting


    Zhao Ertuan; Kong Fantao; Chen Yanfei


    The materials and physical properties of primary slurry are crucial to the surface quality of the finished castings, especially for high reactivity titanium alloys. The aim of this study is to investigate the influence of different binders on the physical properties of primary slurry for titanium alloy investment casting. The zirconia-based slurries with different binders were evaluated by comparing the parameters: viscosity, bulk density, plate weight, suspensibility, gel velocity and streng...

  18. Water-soluble binders for MCMB carbon anodes for lithium-ion batteries

    Energy Technology Data Exchange (ETDEWEB)

    Courtel, Fabrice M.; Niketic, Svetlana; Duguay, Dominique; Abu-Lebdeh, Yaser; Davidson, Isobel J. [National Research Council Canada, 1200 Montreal Road, Ottawa, Ontario, K1A 0R6 (Canada)


    We have investigated the suitability of four different binders for the conventional mesocarbon microbeads (MCMBs) anode material in Li-ion batteries. Unlike the conventional polyvinylidene fluoride (PVDF), the binders were water soluble and were either cellulose based, such as the lithium and sodium salts of carboxymethyl cellulose (NaCMC, and LiCMC) and Xanthan Gum (XG), or the conjugated polymer: poly(3,4-ethylendioxythiophene) (PEDOT, a.k.a. Baytron). All binders were commercially available except LiCMC, which was synthesized and characterized by FTIR and NMR. Thermal studies of the binders by TGA and DSC showed that, in air, the binders have a broad melting event at 100-150 C, with an onset temperature for decomposition above 220 C. Li/MCMB half-cell batteries were assembled using the studied binders. Slow scan voltammograms of all cells showed characteristic lithium insertion and de-insertion peaks including that of the SEI formation which was found to be embedded into the insertion peaks during the first cycle. Cycling of the cells showed that the one containing XG binder gave the highest capacities reaching 350 mAh g{sup -1} after 100 cycles at C/12, while the others gave comparable capacities to those of the conventional binder PVDF. The rate capabilities of cells were examined and found to perform well up to the studied C/2 rate with more than 50% capacity retained. Further studies of the XG-based MCMB electrodes were performed and concluded that an optimal thickness of 300-365 {mu}m gave the highest capacities and sustained high C-rates. (author)

  19. Time dependent viscoelastic rheological response of pure, modified and synthetic bituminous binders (United States)

    Airey, G. D.; Grenfell, J. R. A.; Apeagyei, A.; Subhy, A.; Lo Presti, D.


    Bitumen is a viscoelastic material that exhibits both elastic and viscous components of response and displays both a temperature and time dependent relationship between applied stresses and resultant strains. In addition, as bitumen is responsible for the viscoelastic behaviour of all bituminous materials, it plays a dominant role in defining many of the aspects of asphalt road performance, such as strength and stiffness, permanent deformation and cracking. Although conventional bituminous materials perform satisfactorily in most highway pavement applications, there are situations that require the modification of the binder to enhance the properties of existing asphalt material. The best known form of modification is by means of polymer modification, traditionally used to improve the temperature and time susceptibility of bitumen. Tyre rubber modification is another form using recycled crumb tyre rubber to alter the properties of conventional bitumen. In addition, alternative binders (synthetic polymeric binders as well as renewable, environmental-friendly bio-binders) have entered the bitumen market over the last few years due to concerns over the continued availability of bitumen from current crudes and refinery processes. This paper provides a detailed rheological assessment, under both temperature and time regimes, of a range of conventional, modified and alternative binders in terms of the materials dynamic (oscillatory) viscoelastic response. The rheological results show the improved viscoelastic properties of polymer- and rubber-modified binders in terms of increased complex shear modulus and elastic response, particularly at high temperatures and low frequencies. The synthetic binders were found to demonstrate complex rheological behaviour relative to that seen for conventional bituminous binders.

  20. A Review on Decomposition Deflagration of Oxidizer and Binders in Composite Solid Propellants

    Directory of Open Access Journals (Sweden)

    K. Kishore


    Full Text Available Binder and oxidizer decomposition play very significant role during the combustion of composite solid propellants. Ammonium perchlorate (AP is the practical oxidizer in composite propellant formulations. Available information on binder decomposition in general and AP decomposition in particular have been collected and reviewed from the viewpoint of their application in propellants. This review may be useful in understanding the mechanism of propellant combustion.

  1. A new low carbon cementitious binder for stabilising weak ground conditions through deep soil mixing.


    Sargent, P.; Hughes, P. N.; Rouainia, M.


    Soft alluvial soils present unfavourable conditions for engineering developments due to their poor bearing capacities and high potential for experiencing shrinkage and swelling. This paper focusses on deep dry soil mixing (DDSM), which introduces cementitious binders to soft soils via a rotating auger drill, thereby producing soil-cement columns. Ordinary Portland cement (CEM-I) is globally used across the construction industry and is the most commonly used binder for DDSM applications due to...

  2. Research of gypsum binder of phosphogypsum and dry mortar on its basis


    Казимагомедов, Ибрагим Эмирчубанович; Дехтярюк, Ольга Игоревна


    Gypsum binder was received by the method of intensive dehydration and the influence of admixture in phosphogypsum on the hydration process of gypsum binder was researched. Phase composition of phosphogypsum before and after calcination, using XFA, IR-spectroscopy and crystal optic analysis was defined. Dry mortar for plaster of interior walls of buildings on the basis of CaSO4·0,5H2O obtained from phosphogypsum is investigated. Its advantages and physical and chemical characteristics are shown


    Directory of Open Access Journals (Sweden)

    Pustovgar Andrey Petrovich


    Full Text Available The authors considered the gypsum binder obtained in a kettle SMA-158A in the enterprise LLC “MaykopGipsStroy”. The initial gypsum binder burnt at a temperature of 120 °Сwith the following unloading out of the kettle possessed unstable physical, mechanical and operational characteristics, that’s why the grade of gypsum binder was changed from G4-AII to G5-BII for different lots, which greatly reduced its application in the composition of dry mortars. It was stated, that instability of the features of gypsum binder is determined by the essential underburning of the system, which was characterized by residual content of calcium sulfate dihydrate in amount from 2 to 7 % by weight. In frames of the investigation the authors succeeded in raising the grade of the produced gypsum binder (from G4-5 to G6 due to optimization of the technological parameters of the burning process, as well as to stabilize the composition and features, to lay down temperature and time parameters allowing to control the technological process in order to obtain the gypsum binder with specified characteristics.

  4. Application of gelatin as a binder for the sulfur cathode in lithium-sulfur batteries

    Energy Technology Data Exchange (ETDEWEB)

    Sun Jing [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China); Huang Yaqin [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China)], E-mail:; Wang Weikun; Yu Zhongbao; Wang Anbang; Yuan Keguo [Military Power Sources Research and Development Center, Chemical Defense Institute, 35 Huayuan North Road, Beijing 100083 (China)


    Gelatin, a natural biological macromolecule, was successfully used as a new binder in place of poly(ethylene oxide) (PEO) in the fabrication of the sulfur cathode in lithium-sulfur batteries. The structure and electrochemical performance of the two types of sulfur cathodes, with gelatin and PEO as binders, respectively, were compared in 1 M LiClO{sub 4} DME/DOL (V/V = 1/1) electrolyte. The results showed that the gelatin binder had multifunctional effects on the sulfur cathode: it not only functioned as a highly adhesive agent and an effective dispersion agent for the cathode materials, but also an electrochemically stable binder. The gelatin binder-sulfur cathode achieved a high initial capacity of 1132 mAh g{sup -1}, and remained at a reversible capacity of 408 mAh g{sup -1} after 50 cycles, all of which were better than with the PEO binder-sulfur cathode under the same conditions.

  5. Application of gelatin as a binder for the sulfur cathode in lithium-sulfur batteries

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Jing; Huang, Yaqin [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China); Wang, Weikun; Yu, Zhongbao; Wang, Anbang; Yuan, Keguo [Military Power Sources Research and Development Center, Chemical Defense Institute, 35 Huayuan North Road, Beijing 100083 (China)


    Gelatin, a natural biological macromolecule, was successfully used as a new binder in place of poly(ethylene oxide) (PEO) in the fabrication of the sulfur cathode in lithium-sulfur batteries. The structure and electrochemical performance of the two types of sulfur cathodes, with gelatin and PEO as binders, respectively, were compared in 1 M LiClO{sub 4} DME/DOL (V/V = 1/1) electrolyte. The results showed that the gelatin binder had multifunctional effects on the sulfur cathode: it not only functioned as a highly adhesive agent and an effective dispersion agent for the cathode materials, but also an electrochemically stable binder. The gelatin binder-sulfur cathode achieved a high initial capacity of 1132 mAh g{sup -1}, and remained at a reversible capacity of 408 mAh g{sup -1} after 50 cycles, all of which were better than with the PEO binder-sulfur cathode under the same conditions. (author)

  6. An improved sodium silicate binder modified by ultra-fine powder materials

    Institute of Scientific and Technical Information of China (English)

    WANG Ji-na; FAN Zi-tian; WANG Hua-fang; DONG Xuan-pu; HUANG Nai-yu


    This paper presents a new method of modifying sodium silicate binder with ultra-fine powders. The sodium silicate binder modified by ultra-fine powder A and the organic B can reduce the addition amount of the binder. The results indicate that the 24 h strength has increased by 39.9% at room temperature and the residual strength has decreased by 30.7% at 800℃, compared to the conventional sodium silicate. An available material to improve the moisture resistance was also found by adding about 2% more inorganic C, and it can increase the moist strength by 20%. In the end, the microanalyses are given to explain the modifying machanism, i. e., the ultra-fine powder A can refine the sodium silicate binder to avoid holes in the binder bond, which can increase the 24 h strength at room temperture, and can lead to more cracks in the bond after the molding sand is heated to 800℃. This is because of the stress caused by the new eutectic complex of modified sodium silicate binder.

  7. Effects of an abdominal binder and electrical stimulation on cough in patients with spinal cord injury. (United States)

    Lin, K H; Lai, Y L; Wu, H D; Wang, T Q; Wang, Y H


    We explored the effect of an abdominal binder, with or without electrical stimulation, on peak expiratory flow rate (PEFR) in 12 paraplegics with complete thoracic cord (T2-T12) injury (mean age 36.0 +/- 1.5 yr) and 12 quadriplegics with complete cervical cord (C4-C8) injury (mean age 36.2 +/- 1.9 yr). The cough was assessed by measuring the PEFR during forceful expiration in a sitting position. The subjects underwent the following experimental maneuvers in a random order with a 10-minute interval between any two maneuvers: 1) voluntary coughing, 2) voluntary coughing with an abdominal binder, and 3) voluntary coughing with an abdominal binder and electrical stimulation. The electrical stimulator (50 Hz with 300 microseconds pulse width) was applied to the abdominal wall. Data were analyzed using multivariate analysis of variance for repeated measures. The abdominal binder did not significantly increase PEFR in either paraplegics or quadriplegics; the abdominal binder combined with electrical stimulation significantly increased PEFR by 15% in the paraplegics and 18% in the quadriplegics. These results indicate that electrical stimulation combined with an abdominal binder improves the cough ability in patients with cervical or thoracic spinal cord injury.

  8. Investigation of film solidification and binder migration during drying of Li-Ion battery anodes (United States)

    Jaiser, Stefan; Müller, Marcus; Baunach, Michael; Bauer, Werner; Scharfer, Philip; Schabel, Wilhelm


    The property determining micro-structure of battery electrodes essentially evolves during drying, appointing it a paramount, yet insufficiently understood processing step in cell manufacturing. The distribution of functional additives such as binder or carbon black throughout the film strongly depends on the drying process. A representative state-of-the-art model system comprising graphite, polymeric binder, carbon black and solvent is investigated to gain an insight into the underlying processes. A new experimental approach is introduced that allows for revelation of the evolution of binder concentration gradients throughout the film during drying. Binder is detected by means of energy-dispersive x-ray spectroscopy (EDS) at the top and bottom surface. Drying kinetics is investigated and the impact of the drying process on electrochemical performance is disclosed. The enrichment of binder at the surface, which is observed while applying high drying rates, is shown to depend on two fundamental processes, namely capillary action and diffusion. The findings reveal characteristic drying stages that provide fundamental insights into film solidification. Based on that, a top-down consolidation mechanism capable of explaining the experimental findings is disclosed. Adhesion of the active layer to the substrate is shown to strongly depend on the local binder concentration in the vicinity of the substrate.

  9. Influence of Binder Adhesion Ability on the Performance of Silicon/Carbon Composite as Li-Ion Battery Anode (United States)

    Kierzek, Krzysztof


    A series of anodes for Li-ion battery was prepared by conventional homogenization of active material, percolator, and Na-CMC or several kinds of PVDF as a binder. Si/C composite was synthesized by embedding micro-sized silicon and synthetic battery-grade graphite in a pitch-derived carbon matrix and taken as active material. Adhesion strength of anodic film to a current collector was determined by peeling test. Thermal relaxation (120-180 °C) after calendering of PVDF-based anode slightly increases the adhesion of the film to the collector. The highest peeling strength was recorded for ultrahigh molecular weight PVDF (~0.05 N cm-1) but without advantage for cycling stability of the cell. An initial reversible capacity of 512 mAh g-1, with average capacity decay only of 0.5% per cycle, was achieved for CMC-based anode of moderate peeling strength (~0.035 N cm-1). Such good performance was attributed to a specific Si/C composite structure as well as profitable physicochemical properties of the binder.

  10. Facile synthesis of ultrathin manganese dioxide nanosheets arrays on nickel foam as advanced binder-free supercapacitor electrodes

    KAUST Repository

    Huang, Ming


    © 2014 Elsevier B.V. Ultrathin MnO2 nanosheets arrays on Ni foam have been fabricated by a facile hydrothermal approach and further investigated as the binder-free electrode for high-performance supercapacitors. This unique well-designed binder-free electrode exhibits a high specific capacitance (595.2 F g-1 at a current density of 0.5 A g-1), good rate capability (64.1% retention), and excellent cycling stability (89% capacitance retention after 3000 cycles). Moreover, an asymmetric supercapacitor is constructed using the as-prepared MnO2 nanosheets arrays as the positive electrode and activated microwave exfoliated graphite oxide (MEGO) as the negative electrode. The optimized asymmetric supercapacitor displays excellent electrochemical performance with an energy density of 25.8 Wh kg-1 and a maximum power density of 223.2 kW kg-1. These impressive performances suggest that the MnO2 nanosheet array is a promising electrode material for supercapacitors.

  11. NiO/LaNiO{sub 3} film electrode with binder-free for high performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xi; Du, Guo; Zhu, Jiliang, E-mail:; Zeng, Zifan; Zhu, Xiaohong


    Graphical abstract: This figure shows the charge-discharge curves of the P{sub 0}, P{sub 5}, P{sub 10} and P{sub 15} electrodes at the current density of 0.5 A/g in 2 M KOH electrolyte, respectively. From the figure, the specific capacitance of P{sub 10} electrode is as high as 2030 F/g. - Highlights: • Novel NiO/LaNiO{sub 3} film electrode with binder-free was prepared by spin-coating technique. • The NiO/LaNiO{sub 3} electrode with appropriate LNO content exhibited a high specific capacitance of 2030 F/g at 0.5A/g and superior cycling stability (83% retention of the initial capacitance after 1000 cycles) in 2 M KOH aqueous solution. • The NiO is directly anchored on the Pt/Ti/SiO{sub 2}/Si(100) substratewith binder-free, which is favorable for obtaining a larger specific surface. - Abstract: NiO/LaNiO{sub 3} (NiO/LNO) film electrode was prepared by spin-coating technique on Pt/Ti/SiO{sub 2}/Si(100) substrates. The crystal structure and surface morphology were characterized by X-ray diffraction (XRD) and scanning electron microscopy (SEM), respectively. Cyclic voltammetry (CV), galvanostatic charge/discharge, electrochemical impedance spectroscopy (EIS) and cyclic charge-discharge measurements were employed to evaluate the electrochemical performance of the electrode. The effect of LNO layer on the performance of the NiO/LNO electrode was also investigated. The NiO/LNO electrode with appropriate LNO content possesses high specific capacitance (2030 F/g at 0.5 A/g) and good cyclability (specific capacitance retention of 83% after 1000 cycles). The present study suggests that NiO/LNO film is a promising electrode material for supercapacitor.

  12. Clinical pharmacokinetics of the phosphate binder lanthanum carbonate. (United States)

    Damment, Stephen J P; Pennick, Michael


    Lanthanum carbonate is considered to be the most potent of a new generation of noncalcium phosphate binders used to treat hyperphosphataemia in chronic kidney disease (CKD), a condition associated with progressive bone and cardiovascular pathology and a markedly elevated risk of death. Its phosphate-binding action involves ionic binding and precipitation of insoluble complexes within the lumen of the intestine, thereby preventing absorption of dietary phosphate. While pharmacokinetics have little relevance to the efficacy of lanthanum carbonate, they are of fundamental importance when it comes to evaluating safety. When administered as lanthanum carbonate, the oral bioavailability of lanthanum is low (approximately 0.001%). The small absorbed fraction is excreted predominantly in bile, with less than 2% being eliminated by the kidneys. Predictably, therefore, plasma exposure and pharmacokinetics have been shown to be similar in healthy human volunteers and CKD stage 5 patients. With almost complete plasma protein binding, free lanthanum concentrations in patients at steady state are carbonate has a low propensity to cause systemic drug interactions due to its poor absorption. However, the higher concentrations present in the gastrointestinal tract can form chelates with some drugs, such as fluoroquinolones, and reduce their absorption. The improved understanding of the pharmacokinetics of lanthanum that has emerged in recent years has helped to explain why the myriad of calcium-like effects described in vitro for lanthanum have little if any relevance in vivo. The pharmacokinetic investigations of lanthanum carbonate formed an important part of the stringent premarketing safety assessment process and have been influential in reassuring both regulators and physicians that the agent can be used safely and effectively in this vulnerable dialysis population.

  13. Highly flexible binder-free core-shell nanofibrous electrode for lightweight electrochemical energy storage using recycled water bottles (United States)

    Shi, HaoTian H.; Naguib, Hani E.


    The creation of a novel flexible nanocomposite fiber with conductive polymer polyaniline (PAni) coating on a polyethylene terephthalate (PET) substrate allowed for increased electrochemical performance while retaining ideal mechanical properties such as very high flexibility. Binder-free PAni-wrapped PET (PAni@PET) fiber with a core-shell structure was successfully fabricated through a novel technique. The PET nanofiber substrate was fabricated through an optimized electrospinning method, while the PAni shell was chemically polymerized onto the surface of the nanofibers. The PET substrate can be made directly from recycled PETE1 grade plastic water bottles. The resulting nanofiber with an average diameter of 121 nm ± 39 nm, with a specific surface area of 83.72 m2 g-1, led to better ionic interactions at the electrode/electrolyte interface. The PAni active layer coating was found to be 69 nm in average thickness. The specific capacitance was found to have increased dramatically from pure PAni with carbon binders. The specific capacitance was found to be 347 F g-1 at a relatively high scan rate of 10 mV s-1. The PAni/PET fiber also experienced very little degradation (4.4%) in capacitance after 1500 galvanostatic charge/discharge cycles at a specific current of 1.2 A g-1. The mesoporous structure of the PAni@PET fibrous mat also allowed for tunable capacitance by controlling the pore sizes. This novel fabrication method offers insights for the utilization of recycled PETE1 based bottles as a high performance, low cost, highly flexible supercapacitor device.

  14. Temperature effect on the binder-free nickel copper oxide nanowires with superior supercapacitor performance. (United States)

    Zhang, Liuyang; Tang, Chunhua; Gong, Hao


    Although the use of nickel oxide in supercapacitor electrodes has been reported extensively, the effect of incorporating copper in the binary compound is not known. Arrays of nickel copper oxide nanowires on the current collector via a simple and industrially compatible route have been successfully synthesized. A systematic study on the effect of temperature is also presented. Strikingly, through conductivity modification and binder-free growth, the as-grown nanowires show high specific capacitance (2.24 F cm(2) at 10 mA; 1955 F g(-1) at 1 mV s(-1)), good rate capability (still 2.18 F cm(2) at 50 mA, 1542 F g(-1) at 50 mV s(-1)), and excellent cycle life (90% after 1000 cycles at a high charging-discharging rate 10 A g(-1)). An asymmetric full cell is then prepared and tested, and very high energy density (30 Wh kg(-1)) is achieved. Ideal capacitive behavior (rectangular shape of cyclic voltammetry) is shown with this tailored architecture of the full cell.

  15. Stainless steel binder for the development of novel TiC-reinforced steel cermets

    Institute of Scientific and Technical Information of China (English)

    Akhtar Farid; Shiju Guo; Xia Yang; Yudong Lian


    Steel reinforced TiC composites are an attractive choice for wear resistance and corrosion resistance applications. TiCreinforced 17-4PH maraging stainless matrix composites were processed by conventional powder metallurgy (P/M). TiC-reinforced maraging stainless steel composites with >97% of theoretical density were fabricated. The microstructure, mechanical and wear properties of the composites were evaluated. The microstructure of these composites consisted of spherical and semi-spherical TiC particles.A few microcracks appeared in the composites, showing the presence of tensile stress in the composites produced during sintering.Typical properties, namely, hardness and bend strength were reported for the sintered composites. After heat treatment and aging, the increase of hardness was observed. The increase of hardness was attributed to the aging reaction in the 17-4PH stainless steel. The precipitates appeared in the microstructure and were responsible for the increase in hardness. The specific wear behavior of the composites was strongly dependent on the content of TiC particles, the interparticle spacing, and the presence of hard precipitates in the binder phase.

  16. Investigation of hydrogel isolated from seeds of Ocimum basilicum as binder

    Directory of Open Access Journals (Sweden)

    Bhosale A


    Full Text Available Ayurvedic powders are widely used as therapeutic agents but most of them have unpleasant taste and large doses. One of the possible approach to overcome these drawbacks is to represent them in unit dosage form i.e. tablet dosage form. The purpose of this study is to elucidate and quantify the compressibility and compactibility of herbal granules prepared by using hydrogel isolated from whole seeds of Ocimum basilicum as a novel binder. The compressibility is the ability of the powder to deform under pressure and the compactibility is the ability of a powder to form coherent compacts. To test the functionality of novel excipients, Sonnergaard proved a simple linear model to confirm compactability, which is an uncomplicated tool for quantification. The tablets were compressed at increasing compression pressures and were evaluated for various mechanical properties. The linear relationship between specific crushing strength and compression pressure revealed the compactibility of the herbal granules and the linear relationship between porosity and logarithm of compression pressure revealed the compressible nature of the herbal granules according to the model developed by Sonnergaard. Thus the hydrogel isolated from whole seeds of Ocimum basillicum had potential as a granulating and binding agent.

  17. Functional porous carbon/nickel oxide nanocomposites as binder-free electrodes for supercapacitors. (United States)

    Madhu, Rajesh; Veeramani, Vediyappan; Chen, Shen-Ming; Veerakumar, Pitchaimani; Liu, Shang-Bin


    High-surface-area, guava-leaf-derived, heteroatom-containing activated carbon (GHAC) materials were synthesized by means of a facile chemical activation method with KOH as activating agent and exploited as catalyst supports to disperse nickel oxide (NiO) nanocrystals (average size (2.0±0.1) nm) through a hydrothermal process. The textural and structural properties of these GHAC/NiO nanocomposites were characterized by various physicochemical techniques, namely, field-emission SEM, high-resolution TEM, elemental analysis, X-ray diffraction, X-ray photoelectron spectroscopy, thermogravimetric analysis, and Raman spectroscopy. The as-synthesized GHAC/NiO nanocomposites were employed as binder-free electrodes, which exhibited high specific capacitance (up to 461 F g(-1) at a current density of 2.3 A g(-1)) and remarkable cycling stability, which may be attributed to the unique properties of GHAC and excellent electrochemical activity of the highly dispersed NiO nanocrystals. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Hierarchical ZnO@MnO2 Core-Shell Pillar Arrays on Ni Foam for Binder-Free Supercapacitor Electrodes

    KAUST Repository

    Huang, Ming


    © 2014 Elsevier Ltd. All rights reserved. Hierarchical ZnO@MnO2 core-shell pillar arrays on Ni foam have been fabricated by a facile two-step hydrothermal approach and further investigated as the binder-free electrode for supercapacitors. The core-shell hybrid nanostructure is achieved by decorating ultrathin self-standing MnO2 nanosheets on ZnO pillar arrays grown radically on Nickel foam. This unique well-designed binder-free electrode exhibits a high specific capacitance (423.5 F g-1 at a current density of 0.5 A g-1), and excellent cycling stability (92% capacitance retention after 3000 cycles). The improved electrochemical results show that the ZnO@MnO2 core-shell nanostructure electrode is promising for high-performance supercapacitors. The facile design of the unique core-shell array architectures provides a new and effective approach to fabricate high-performance binder-free electrode for supercapacitors.

  19. Physically cross-linked polymer binder based on poly(acrylic acid) and ion-conducting poly(ethylene glycol-co-benzimidazole) for silicon anodes (United States)

    Lim, Sanghyun; Lee, Kukjoo; Shin, Inseop; Tron, Artur; Mun, Junyoung; Yim, Taeeun; Kim, Tae-Hyun


    The practical applications of Si electrodes in lithium-ion batteries are limited since they undergo large changes in volume during charge and discharge, and consequently become highly deteriorated. A novel binder system holding silicon particles together and preventing disintegration of the electrode during operation hence needs to be developed to enable reliable cycleability. In the current work, such a new polymer binder system, based on poly(acrylic acid) (PAA) and poly(ethylene glycol-co-benzimidazole) (PEGPBI), is developed for silicon anodes. The physical crosslinking using acid-base interactions between PAA and PBI, together with the ion-conducting PEG group, yields physical properties for the resulting PAA-PEGPBI-based anodes that are better than those of electrodes based on the currently available PAA binder, and yields good cell performances. A Si-based electrode with high loading levels of 1.0-1.3 mg cm-2 (0.7-0.91 Si mg cm-2) is reliably manufactured using specifically PAA-PEGPBI-2, which is made with 2 wt% of PEGPBI relative to PAA, and shows a very high capacity value of 1221 mAh g-1 at a rate of 0.5 C after 50 cycles, and a high capacity value of more than 1600 mAh g-1 at a high rate of 2 C.

  20. Method to Produce Durable Pellets at Lower Energy Consumption Using High Moisture Corn Stover and a Corn Starch Binder in a Flat Die Pellet Mill (United States)

    Tumuluru, Jaya Shankar; Conner, Craig C.; Hoover, Amber N.


    A major challenge in the production of pellets is the high cost associated with drying biomass from 30 to 10% (w.b.) moisture content. At Idaho National Laboratory, a high-moisture pelleting process was developed to reduce the drying cost. In this process the biomass pellets are produced at higher feedstock moisture contents than conventional methods, and the high moisture pellets produced are further dried in energy efficient dryers. This process helps to reduce the feedstock moisture content by about 5-10% during pelleting, which is mainly due to frictional heat developed in the die. The objective of this research was to explore how binder addition influences the pellet quality and energy consumption of the high-moisture pelleting process in a flat die pellet mill. In the present study, raw corn stover was pelleted at moistures of 33, 36, and 39% (w.b.) by addition of 0, 2, and 4% pure corn starch. The partially dried pellets produced were further dried in a laboratory oven at 70 °C for 3-4 hr to lower the pellet moisture to less than 9% (w.b.). The high moisture and dried pellets were evaluated for their physical properties, such as bulk density and durability. The results indicated that increasing the binder percentage to 4% improved pellet durability and reduced the specific energy consumption by 20-40% compared to pellets with no binder. At higher binder addition (4%), the reduction in feedstock moisture during pelleting was 510 kg/m3 and >98%, respectively, and the percent fine particles generated was reduced to <3%. PMID:27340875

  1. Evolution of microstructure and dimension of as-molded parts during thermal removal process of wax-based MIM binder

    Institute of Scientific and Technical Information of China (English)


    The evolution of the microstructure and the dimension of as-molded parts were studied on the basis of the thermogravimetric analysis of wax-based MIM binder. The results show that the binder removal speeds are different in different temperature ranges during binder removal process. The evolution of the microstructure of as-molded parts during binder removal process clearly showed the initiation and formation of connected pore structure, which is the removal channel of the binder. The as-molded parts almost continuously shrank through binder removal process, except an expansion stage during 320~440  ℃, which is the dissolution expansion effect due to the dissolution of VPW in the polymer melt.

  2. [Use of the aluminum phosphate-binders in hemodialysis in the ultrapure water era]. (United States)

    Arenas, Maria D; Malek, T; Gil, M T; Moledous, A; Núñez, C; Alvarez-Ude, F


    Aluminium binder has been ill-advised, but his use remain applicable in the clinique practice in very seleccionated and particular patients. The repercussion of prolonged treatment with low doses of aluminium phosphate-binders in haemodialysis was studied. The haemodialysis unit had a double osmosis inverse and the aluminium levels in haemodialysis liquid was less than 2 micrograms/liter. 41 patients of the 295 on haemodialysis received aluminium phosphate-binders since the 2005 January to the 2007 November. The mean time of treatment was 17.8 months, and the doses was 3.9 tablets day (mean of 463 grams in the studied period). The association of low doses of aluminium phosphate-binders permitted a better control of phosphorus (6.8 to 4.8 mg/dl; p<0.0001), with a reduction of the others phosphate-binders: sevelamer (10.4 a 8 tablets/day; p<0.0001) and calcium phosphate-binders (4.6 to 3.1 tablets/day; p<0.0001). The serum aluminium increased after the aluminium treatment (6.8 to 13.8 mcg/l; p<0.0001), and no toxicity indirect signs were observed on CMV, haemoglobin, none PTH. Five patients (12.1%) reached aluminium serum levels higher 20 mcg/l, and none reached the 40 mcg/l. The aluminium phosphate-binders were effective, economical and, now, with an apparent better security profile than in a previous time, but it is very important to be careful with this use and to follow a vigilance strict on patients and haemodialysis liquid.

  3. Comparison of the activities of binder-added and binder-free Mo/HZSM-5 catalysts in methane dehydroaromatization at 1073 K in periodic CH4-H2 switch operation mode

    Institute of Scientific and Technical Information of China (English)

    Yuebing Xu; Hongtao Ma; Yo Yamamoto; Yoshizo Suzuki; Zhanguo Zhang


    Three industry-supplied,well-shaped Mo/HZSM-5 catalysts,two binder-added and one binder-free,were tested for the first time in methane dehydroaromatization to benzene at 1073 K and 10000 mL/(g.h) in periodic CH4-H2 switch operation mode,and their catalytic performances were compared with those of three self-prepared,binder-free powder Mo/HZSM-5 catalysts.XRD,27Al NMR,SEM,BET and NH3-TPD characterizations of all the catalysts show that the zeolites in the two binder-added catalysts are comparable to those in the three binder-free powder catalysts in crystallinity,crystal size,micropore volume and Br(¢)nsted acidity.The test results,on the other hand,show that the catalytic performances of the two binder-added catalysts are worse than those of the four binder-free catalysts on both catalyst mass and zeolite mass bases.Then,TPO and BET measurements of all spent samples were conducted to get a deep insight into the negative effects of binder addition,and the results suggest that the binder additives functioned mainly to enhance the polyaromatization of formed aromatics to coke on their external surfaces and consequently lower the benzene formation activity and selectivity of the catalyst.

  4. Influence of fluoropolymer binders on the electrochemical performance of C-LiFePO4 based cathodes


    A. Goren; Costa, C M; Silva, Maria Manuela; Lanceros-Méndez, S.


    The polymer binder plays a relevant role in the performance of battery electrodes. This work proposes poly(vinylidene fluoride-co-trifluoroethylene), PVDF-TrFE, as a polymer binder for C-LiFePO4 based cathodes and investigates its effect in the electrochemical properties of the cathodes. Morphological, electrical, swelling and electrochemical properties were investigated for this polymer binder and the results were compared with the ones from two other fluoropolymers, poly(v...

  5. Towards performance-related design criteria and specifications for modified binders

    CSIR Research Space (South Africa)

    Rust, FC


    Full Text Available stream_source_info Rust_1990.pdf.txt stream_content_type text/plain stream_size 1088 Content-Encoding ISO-8859-1 stream_name Rust_1990.pdf.txt Content-Type text/plain; charset=ISO-8859-1 PDF compression, OCR, web...-optimization with CVISION's PdfCompressor PDF compression, OCR, web-optimization with CVISION's PdfCompressor PDF compression, OCR, web-optimization with CVISION's PdfCompressor PDF compression, OCR, web-optimization with CVISION's PdfCompressor PDF compression, OCR, web...

  6. Evaluation of strength-enhancing factors of a ductile binder in direct compression of sodium bicarbonate and calcium carbonate powders. (United States)

    Mattsson, S; Nyström, C


    This study evaluated the effectiveness of a ductile binder in direct compression of sodium bicarbonate and calcium carbonate powders. Properties associated with both the binder and the compound were studied. The addition of binder materials, such as polyethylene glycols (PEGs) of differing molecular weights or microcrystalline cellulose, generally resulted in an increase in the axial tensile strength of the corresponding compacts. The increase in tablet strength was generally greater with the PEGs than with microcrystalline cellulose. The results indicate that the improvement in tablet strength caused by the binder is dependent on properties of both the binder and the compound. By utilising different methods it was established that the fracture during tablet strength testing mainly occurred around the compound particles. As a consequence of this, it appears that the ability of the binder to fill the voids between the compound particles is a determinative factor for increasing tablet strength. The binder appeared to have less effect when added to compounds that fragmented during compaction. Characteristics of the binder resulting in the greatest decrease in porosity, and thus the greatest increase in the tensile strength of the compound, included a high degree of plastic deformation with a limited elastic component and a small particle size. Obviously, the amount of binder added to the mixture also affected the results.

  7. Adhesive Bonding and Self-Curing Characteristics of α-Starch Based Composite Binder for Green Sand Mould/Core

    Institute of Scientific and Technical Information of China (English)

    Xia ZHOU; Jinzong YANG; Guohui QU


    Interactions between different components in α-starch based composite binder for green sand mould/core were investigated by using XRD, IR spectra, 1H NMR spectra and SEM. Several adhesive hardening structures and theories of the binder at room temperature were proposed according to the interactions between various compositions. Thus,the reasons for the binder to have excellent combination properties and unique adhesive bonding and self-curing characteristics were explained by these theories successfully. And the theories are of great directive importance to design and development of composite binder for green sand mould/core.

  8. Emission of organic compounds from mould and core binders used for casting iron, aluminium and bronze in sand moulds. (United States)

    Tiedje, Niels; Crepaz, Rudolf; Eggert, Torben; Bey, Niki


    Emissions from mould and core sand binders commonly used in the foundry industry have been investigated. Degradation of three different types of binders was investigated: Furfuryl alcohol (FA), phenolic urethane (PU) and resol-CO2 (RC). In each group of binders, at least two different binder compositions were tested. A test method that provides uniform test conditions is described. The method can be used as a general test method to analyse off gases from binders. Moulds, containing a standard size casting, were produced and the amount and type of organic compounds, resulting from thermal degradation of binders, was monitored when cast iron, bronze and aluminium was poured in the moulds. Binder degradation was measured by collecting off gases in a specially designed ventilation hood at a constant flow rate. Samples were taken from the ventilation system and analysed for hydrocarbons and CO content. It is shown how off-gases vary with time after pouring and shake out. Also the composition of off-gases is analysed and shown. It is further shown how the composition of off-gasses varies between different types of binders and with varying composition of the binders as well as function of the thermal load on the moulding sand.

  9. Strength loss in MA-MOX green pellets from radiation damage to binders (United States)

    Lessing, Paul A.; Cannon, W. Roger; Egeland, Gerald W.; Zuck, Larry D.; Jewell, James K.; Akers, Douglas W.; Groenewold, Gary S.


    The fracture strength of green Minor Actinides (MA)-MOX pellets containing 75 wt.% DUO2, 20 wt.% PuO2, 3 wt.% AmO2 and 2 wt.% NpO2 was studied as a function of storage time, after mixing with the binder and before sintering, to test the effect of radiation damage on binders. Fracture strength degraded continuously over the 10 days of the study for all three binders studied: PEG binder (Carbowax 8000), microcrystalline wax (Mobilcer X) and styrene-acrylic copolymer (Duramax B1022) but the fracture strength of Duramax B1022 degraded the least. For instance, for several hours after mixing Carbowax 8000 with MA-MOX, the fracture strength of a pellet was reasonably high and pellets were easily handled without breaking but the pellets were too weak to handle after 10 days. Strength measured using diametral compression test showed that strength degradation was more rapid in pellets containing 1.0 wt.% Carbowax PEG 8000 compared to those containing only 0.2 wt.%, suggesting that irradiation not only left the binder less effective but also reduced the pellet strength. In contrast the strength of pellets containing Duramax B1022 degraded very little over the 10 days period. It was suggested that the styrene portion present in the Duramax B1022 copolymer provided the radiation resistance.

  10. Strength Loss in MA-MOX Green Pellets from Radiation Damage to Binders

    Energy Technology Data Exchange (ETDEWEB)

    Paul A. Lessing; W.R. Cannon; Gerald W. Egeland; Larry D. Zuck; James K. Jewell; Douglas W. Akers; Gary S. Groenewold


    The fracture strength of green Minor Actinides (MA)-MOX pellets containing 75 wt.% DUO2, 20 wt. % PuO2, 3 wt. % AmO2 and 2 wt. % NpO2 was studied as a function of storage time, after mixing in the binder and before sintering, to test the effect of radiation damage on binders. Fracture strength degraded continuously over the 10 days of the study for all three binders studied: PEG binder (Carbowax 8000), microcrystalline wax (Mobilcer X) and Styrene-acrylic copolymer (Duramax B1022) but the fracture strength of Duramax B1022 degraded the least. For instance, for several hours after mixing Carbowax 8000 with MA MOX, the fracture strength of a pellet was reasonably high and pellets were easily handled without breaking but the pellets were too weak to handle after 10 days. Strength measured using diametral compression test showed strength degradation was more rapid in pellets containing 1.0 wt. % Carbowax PEG 8000 compared to those containing only 0.2 wt. %, suggesting that irradiation not only left the binder less effective but also reduced the pellet strength. In contrast the strength of pellets containing Duramax B1022 degraded very little over the 10 day period. It was suggested that the styrene portion of the Duramax B1022 copolymer provided the radiation resistance.

  11. Strength loss in MA-MOX green pellets from radiation damage to binders

    Energy Technology Data Exchange (ETDEWEB)

    Lessing, Paul A. [Idaho National Laboratory, Idaho Falls, ID 83415 (United States); Cannon, W. Roger, E-mail: [Idaho National Laboratory, Idaho Falls, ID 83415 (United States); Egeland, Gerald W.; Zuck, Larry D.; Jewell, James K.; Akers, Douglas W.; Groenewold, Gary S. [Idaho National Laboratory, Idaho Falls, ID 83415 (United States)


    The fracture strength of green Minor Actinides (MA)-MOX pellets containing 75 wt.% DUO{sub 2}, 20 wt.% PuO{sub 2}, 3 wt.% AmO{sub 2} and 2 wt.% NpO{sub 2} was studied as a function of storage time, after mixing with the binder and before sintering, to test the effect of radiation damage on binders. Fracture strength degraded continuously over the 10 days of the study for all three binders studied: PEG binder (Carbowax 8000), microcrystalline wax (Mobilcer X) and styrene–acrylic copolymer (Duramax B1022) but the fracture strength of Duramax B1022 degraded the least. For instance, for several hours after mixing Carbowax 8000 with MA-MOX, the fracture strength of a pellet was reasonably high and pellets were easily handled without breaking but the pellets were too weak to handle after 10 days. Strength measured using diametral compression test showed that strength degradation was more rapid in pellets containing 1.0 wt.% Carbowax PEG 8000 compared to those containing only 0.2 wt.%, suggesting that irradiation not only left the binder less effective but also reduced the pellet strength. In contrast the strength of pellets containing Duramax B1022 degraded very little over the 10 days period. It was suggested that the styrene portion present in the Duramax B1022 copolymer provided the radiation resistance.

  12. Evaluation of the rheological behavior of asphaltic binder modified with zeolite material

    Energy Technology Data Exchange (ETDEWEB)

    Silveira, E.M. da; Sant' ana, Hosiberto B.; Soares, Sandra A.; Soares, Jorge B. [Federal University of Ceara, Fortaleza, CE (Brazil)


    Several new processes have been developed to reduce mixing and compaction temperatures of hot mix asphalt without sacrificing the quality of the resulting pavement. One of these processes utilizes the zeolite, a crystalline hydrated aluminum silicate. A laboratory study was conducted to determine the applicability of zeolite to improve the rheological and chemical behavior of an asphaltic binder. The synthetic asphaltic binder was produced with different zeolite contents (0,1; 0.3; and 0.5% w/w) by wet process. The rheological and chemical behavior was verified by Dynamic Shear Rheometer and Infrared Spectroscopy, respectively. The zeolite's chemical composition and morphology was studied by Dispersive X-ray Spectroscopy (EDX). Additionally, the scanning electron microscope (SEM) was utilized to establish the zeolite elemental composition. The results showed that investigated zeolite was classified as a sodium aluminum silicate and it was able to modify the rheological properties of the neat asphalt binder. The G*/sin{delta} parameter was affected by the zeolite presence, indicating better performance for the binders with zeolite. The results show that synthetic binders can partly replicate the rheological properties of conventional AB. Comparable complex modulus values was obtained. No significant difference was found in viscoelastic response, given by the phase angles as a function of both temperature and frequency. (author)

  13. Physical and Combustion Characteristics of Briquettes Made from Water Hyacinth and Phytoplankton Scum as Binder

    Directory of Open Access Journals (Sweden)

    R. M. Davies


    Full Text Available The study investigated the potential of water hyacinths and phytoplankton scum, an aquatic weed, as binder for production of fuel briquettes. It also evaluated some physical and combustion characteristics. The water hyacinths were manually harvested, cleaned, sun-dried, and milled to particle sizes distribution ranging from <0.25 to 4.75 mm using hammer mill. The water hyacinth grinds and binder (phytoplankton scum at 10% (B1, 20% (B2, 30% (B3, 40% (B4, and 50% (B5 by weight of each feedstock were fed into a steel cylindrical die of dimension 14.3 cm height and 4.7 cm diameter and compressed by hydraulic press at pressure 20 MPa with dwell time of 45 seconds. Data were analysed using analysis of variance and descriptive statistics. Initial bulk density of uncompressed mixture of water hyacinth and phytoplankton scum at different binder levels varied between 113.86 ± 3.75 (B1 and 156.93 ± 4.82 kg/m3 (B5. Compressed and relaxed densities of water hyacinth briquettes at different binder proportions showed significant difference . Durability of the briquettes improved with increased binder proportion. Phytoplankton scum improved the mechanical handling characteristics of the briquettes. It could be concluded that production of water hyacinth briquettes is feasible, cheaper, and environmentally friendly and that they compete favourably with other agricultural products.

  14. Influence of Cellulosic Binders on Sensitivity and Combustion Behaviour of B-KNO3 Ignition System

    Directory of Open Access Journals (Sweden)

    Varsha Bhingarkar


    Full Text Available Boron-potassium nitrate (B-KNO3-based compositions have been used as an effective ignitersystem for solid rocket propellants. A systematic study was undertaken to generate exhaustivedata on B-KNO3 (25:65-based ignition systems with cellulosic binders, viz., nitrocellulose, ethylcellulose and plasticised ethyl cellulose. In addition, detailed investigations were carried outwith PEC as binder by varying its concentration from 2-10 per cent in the same system. Theexperimental compositions (B-KNO3: binder were evaluated by closed-vessel firing, thermalanalysis, sensitivity, mechanical properties and cal-val determination. The binders significantlyinfluenced the sensitivity and combustion behaviour of B-KNO3 compositions. The compositionwith nitrocellulose as binder produced high flame temperature and cal-val as compared to ethylcellulose and plasticised ethyl cellulose-based compositions. The data indicated that thecalculated flame temperature for all compositions was in the range 2716 K to 2957 K. As theplasticised ethyl cellulose content increased from 2 per cent to 10 per cent, the maximum pressureincreased with decrease in heat of combustion.

  15. Rheological and thermal performance of newly developed binder systems for ceramic injection molding (United States)

    Hausnerova, Berenika; Kasparkova, Vera; Hnatkova, Eva


    In a novel binder system, carnauba wax was considered to replace the synthetic backbone polymers (polyolefins) enhancing the environmental sustainability of Ceramic Injection Molding (CIM) technology. The paper presents comparison of the rheological performance and thermal behavior of the aluminum oxide CIM feedstocks based on a binder containing carnauba wax with those consisting of a commercial binder. Further, acrawax (N, N'-Ethylene Bis-stearamide) has been considered as another possible substitute of polyolefins. For both proposed substitutes there is a significant reduction in viscosity, and in case of carnauba wax based feedstock also in processing temperature, which is essential for injection molding of reactive powders. Thermal characterization comprised analyses of single neat binders, their mixtures and mixtures with aluminum oxide. The presence of powder lowered melting temperatures of all tested binders except of polyolefin. Further depression in melting point of poly(ethylene glycol) is observed in combination with polyolefin in the presence of powder, and it is related to changes in size of the crystalline domains.

  16. Influence of binder droplet dimension on granulation rate during fluidized bed granulation. (United States)

    Fujiwara, Maya; Dohi, Masafumi; Otsuka, Tomoko; Yamashita, Kazunari; Sako, Kazuhiro


    Here, we statistically identified the critical factor of the granulation rate during the fluidized bed granulation process. Lactose was selected as the excipient and was granulated with several binders, including hydroxypropyl cellulose, hydroxypropyl methyl cellulose, and polyvinylpyrrolidone. The viscosity, density, and surface tension of the binder solution, contact angle, and the work done during adhesion and cohesion between the binder and lactose, mist diameter, Stokes number, and the dimension of the droplet were considered. The Stokes number was defined as the ratio of the inertial force to the viscous-damping force of a particle. We confirmed that droplet diameter after adhesion had the highest correlation coefficient with the granulation rate constant in our investigated parameters. Partial least squares regression revealed two critical principal components of the granulation rate: one relating to the droplet dimension, which is composed of mist diameter and diameter and thickness of the droplet after adhesion of the binder to the lactose surface; and the other relating to wettability, which involves the work done during adhesion and cohesion, surface tension, and the thickness of the droplet after adhesion of the binder to the lactose surface.

  17. Influence of solidification accelerators on structure formation of anhydrite-containing binders

    Energy Technology Data Exchange (ETDEWEB)

    Anikanova, L., E-mail:; Volkova, O., E-mail:; Kudyakov, A.; Sarkisov, Y.; Tolstov, D. [Tomsk State University of Architecture and Building, 2 Solyanaya sq., Tomsk, 634003 (Russian Federation)


    The article presents results of scientific analysis of chemical additives influence on acid fluoride binder. It was found that the influence of sulfate nature additives on the process of hydration and solidification of the binder is similar to influence of additives on indissoluble anhydrite. Additives with SO{sub 4}{sup 2−} anion NO{sup −} are more efficient. The mentioned additives according to accelerating effect belong to the following succession: K{sub 2}SO{sub 4} > Na{sub 2}SO{sub 4} > FeSO{sub 4} > MgSO{sub 4}. Facilitation of the process of hydration and solidification of the binder, increase in density and durability of the binder (32 MPa) is to the greatest extent achieved with the introduction of 2% sodium sulfate additive of the binder’s mass into the composition of the binder along with the ultrasonic treatment of water solution. Directed crystal formation process with healing of porous structure by new growths presented as calcium sulfate dehydrate and hydroglauberite provides positive effect.

  18. Control of binder viscosity and hygroscopicity on particle aggregation efficiency (United States)

    Mueller, Sebastian B.; Kueppers, Ulrich; Ayris, Paul M.; Jacob, Michael; Delmelle, Pierre; Dingwell, Donald B.


    In the course of explosive volcanic eruptions, large amounts of ash are released into the atmosphere and may subsequently pose a threat to infrastructure, such as aviation industry. Ash plume forecasting is therefore a crucial tool for volcanic hazard mitigation but may be significantly affected by aggregation, altering the aerodynamic properties of particles. Models struggle with the implementation of aggregation since external conditions promoting aggregation have not been completely understood; in a previous study we have shown the rapid generation of ash aggregates through liquid bonding via the use of fluidization bed technology and further defined humidity and temperature ranges necessary to trigger aggregation. Salt (NaCl) was required for the recovery of stable aggregates, acting as a cementation agent and granting aggregate cohesion. A numerical model was used to explain the physics behind particle aggregation mechanisms and further predicted a dependency of aggregation efficiency on liquid binder viscosity. In this study we proof the effect of viscosity on particle aggregation. HCl and H2SO4 solutions were diluted to various concentrations resulting in viscosities between 1 and 2 mPas. Phonolitic and rhyolitic ash samples as well as soda-lime glass beads (serving as analogue material) were fluidized in the ProCell Lab® of Glatt Ingenieurtechnik GmbH and treated with the acids via a bottom-spray technique. Chemically driven interaction between acid liquids and surfaces of the three used materials led to crystal precipitation. Salt crystals (e.g. NaCl) have been confirmed through scanning electron microscopy (SEM) and leachate analysis. Both volcanic ash samples as well as the glass beads showed a clear dependency of aggregation efficiency on viscosity of the sprayed HCl solution. Spraying H2SO4 provoked a collapse of the fluidized bed and no aggregation has been observed. This is accounted by the high hygroscopicity of H2SO4. Dissolving CaCl2 (known to be

  19. Influence of Binders and Lightweight Aggregates on the Properties of Cementitious Mortars: From Traditional Requirements to Indoor Air Quality Improvement. (United States)

    Giosuè, Chiara; Pierpaoli, Mattia; Mobili, Alessandra; Ruello, Maria Letizia; Tittarelli, Francesca


    Innovative and multifunctional mortars for renders and panels were manufactured using white photocatalytic and non-photocatalytic cement as binder. Unconventional aggregates, based on lightweight materials with high specific surface and adsorbent properties, were adopted in order to investigate the possible ability to passively improve indoor air quality. The reference mortar was manufactured with traditional calcareous sand. Results show that even if the mechanical properties of mortars with unconventional aggregates generally decrease, they remain acceptable for application as render. The innovative mortars were able to passively improve indoor air quality in terms of transpirability (70% higher), moisture buffering ability (65% higher) and depolluting capacity (up to 75% higher) compared to traditional ones under the current test conditions.

  20. Preparation of NiCo2S4 flaky arrays on Ni foam as binder-free supercapacitor electrode (United States)

    Yang, Zeheng; Zhu, Xiao; Wang, Kun; Ma, Guo; Cheng, He; Xu, Feifei


    NiCo2S4 flaky structured arrays on nickel foam were prepared hydrothermally by means of an anion-exchange method, with NiCo2O4 nanorod arrays as precursors, and were directly applied as a binder-free supercapacitor electrode. Such a 3D structured electrode combines the advantages of both one dimensional and two dimensional materials, and can effectively improve the electrochemical performance. As a result, the as-prepared NiCo2S4 flaky structure electrode shows much enhanced electrochemical performance, with a high specific capacitance (2044 F g-1 at 1 A g-1) and good cycling stability (capacity retention of 77% after 2000 cycles), suggesting its promising application for electrochemical capacitors.

  1. Binders and Hosts for High-Capacity Lithium-ion Battery Anodes (United States)

    Dufficy, Martin Kyle

    ≤ 20 wt% tin result in small tin (metallic and tin oxide) particles (≤ 15 nm) within the composite-CNF matrix, which yield long cycle-lives; large reversible capacities of ˜ 600 mAh g-1 are observed at 0.2-C rates, while capacities of ˜ 400 mAh g-1 (double the capacity of CNFs) are observed after hundreds of cycles at 2-C rates. The second method comprises an approach to enhance the cycle life of silicon anodes. Many researchers believe that Si is the future anode material of LIBs, and Si is capable of providing a much needed boost in overall cell performance. Silicon has the highest known charge capacity at ˜ 3579 mAh g-1, nearly an order of magnitude larger than graphite (372 mAh g-1). In attempt to realize the entire capacity of Si anodes, we use binding agents to prolong cycle life. Binding agents enhance capacity retention via favorable interactions with cell components such as active materials and electrolytes. In this study, we introduce galactomannans (specifically, guar) as viable, inexpensive, biopolymer binders for Si electrodes. In attempt to elucidate the role of the binder in Si electrodes, we study guar-electrode and -electrolyte interactions that lead to electrochemical performance enhancements. We recognize that there are deficiencies in guar-silicon systems, which we address in our following approach. Notably, we develop a guar-derived binder to increase the strength and conductivity of Si-based electrodes by crosslinking guar and carbon black dispersions. The crosslinked binders, in effect, enhance electrode adhesion and hinder electrode cracking by self-healing. This study monitors gelation via rheological methods and assesses effects of crosslinking density on physical and electrochemical properties. Lastly, we consider a vacancy-induced manganese vanadate as high-capacity, high-power anodes for LIBs. Rather than assessing nanoparticles, we tailored molecular structure to enhance electrochemical performances. X-ray diffraction studies

  2. Binary cobalt ferrite nanomesh arrays as the advanced binder-free electrode for applications in oxygen evolution reaction and supercapacitors (United States)

    Liu, Li; Zhang, Huijuan; Mu, Yanping; Bai, Yuanjuan; Wang, Yu


    The porous CoFe2O4nanomesh arrays are successfully synthesized on nickel foam substrate through a high temperature and pressure hydrothermal method, following by the thermal post-treatment in air. The CoFe2O4 nanomesh arrays own numerous pores and large specific surface area, which is in favor of exposing more active sites. In consideration of the structural preponderances and versatility of the materials, the CoFe2O4 nanomesh arrays have been researched as the binder-free electrode materials for electrocatalysis and supercapacitors. When the CoFe2O4nanomesh arrays on nickel foam (CoFe2O4 NM-As/Ni) directly act as the free-binder catalyst toward catalyzing the oxygen evolution reaction (OER) of electrochemical water splitting, CoFe2O4 NM-As/Ni exhibits an admirable OER property with a low onset potential of 1.47 V(corresponding to the onset overpotential of 240 mV), a minimal overpotential (η10 = 253 mV), a small Tafel slope (44 mV dec-1), large anodic currents and long-term durability for 35 h in alkaline media. In addition, as an electrode of supercapacitors, CoFe2O4 NM-As/Ni obtains a desired specific capacitance (1426 F/g at the current density of 1 A/g), remarkable rate capability (1024 F/g at the current density of 20 A/g) and eminent capacitance retention (92.6% after 3000 cycles). The above results demonstrate the CoFe2O4 NM-As/Ni possesses great potential application in electrocatalysis and supercapacitors.

  3. Effect of Tar-resin Binder on Properties of MgO-C Monolithic Refractories

    Institute of Scientific and Technical Information of China (English)

    Hady EFENDY; Wan Mohd.Farid BIN WAN MOHAMAD


    Based on the newly developed bonding system,a new generation of carbon-bonded MgO-C monolithic refractories product with low toxic potential has been developed.Results of an on-going investigation on properties of MgO-C monolithic refractories with tar-resin as binder are presented.Furthermore,the binder is an extremely strong carbon bonding.Further significant advantages of this system are high oxidation resistance of the highly-ordered carbon structure and the excellent stress-absorbing structure.To improve the strength and erosion resistance,and to decrease evaporation during heating,a preliminary treated tar-resin with higher melting temperature and lower content of volatile component was investigated.The binder specimens were treated at 800 ℃ and the mechanical properties of MgO-C refractories specimens treated at 200,400,and 1 200 ℃ were determined.

  4. The role of the binder phase in the WC-Co sintering

    Directory of Open Access Journals (Sweden)

    Silva A.G.P. da


    Full Text Available The sintering of hardmetal in the solid state is studied. The influence of the WC particle size on the sintering kinetics, the role of the binder phase in the densification process and how sintering depends on the heating conditions are investigated. It is observed that alloys with different WC particle size show quite different structural evolution during sintering, although the densification mechanisms are the same. This is explained by the formation of agglomerates of WC and Co. Hardmetal alloys can sinter very rapidly when high heating rates are used, since rapid heating accelerates the binder spreading and the formation of WC-Co agglomerates. The binder phase (Co spreads on the WC particles initially as a thin layer. Subsequently, more Co spreads on this layer and WC-Co agglomerates are formed.


    Directory of Open Access Journals (Sweden)

    CHUMAK Anastasia Gennadievna


    Full Text Available The aim of this work is to carry out a number of studies in the area of nanomodi­fication of gypsum binder matrix and to investigate the influence of multilayer carbon nanotubes on the structure, physical and mechanical properties of obtained compos­ites. The study of the gypsum binders structure formation mechanisms with the use of nanoadditives makes it possible to control the production processes of gypsum materi­als and articles with the given set of properties. The main tasks of the binder nanomodification are: even distribution of carbon nanostructures over the whole volume of material and provision of stability for the nanodimensional modifier during production process of the construction composite.

  6. Springback Control With Variable Binder Force — Experiments And FEA Simulation (United States)

    Du, Changqing; Wu, Jin; Militisky, Marcio; Principe, James; Garnett, Mark; Zhang, Li


    Side-wall-curl is a springback phenomena in typical automotive structural components, such as channel like rails and cross members. Minimizing or eliminating the side-wall-curl is one of the major challenges in stamping production. This challenge is exasperated when the component is formed from advanced high strength steels (AHSS). In this study a standard three-piece draw die is used, in a series of experimental tests, to form a stamping with a hat-shaped section from dual phase 590 (DP590). During the forming stroke, the binder force is varied to evaluate its influence on side-wall-curl. FEA springback simulations for two types of experiments with varied binder forces are also performed. The binder force profiles for several sheet materials are discussed and the correlation between the simulation results and the actual part measurements are illustrated.

  7. Studying asphalt binder fatigue pattern by using a dynamic shear rheometer

    Directory of Open Access Journals (Sweden)

    Oscar Javier Reyes Ortiz


    Full Text Available This article was aimed at determining fatigue test results regarding different types of binder when using a dynamic shear rheometer (DSR. The tests were carried out in stress conditions at 20ºC. The stress input signal was a constant amplitude, 1.59 Hz frequency sine wave. Asphalt binders B-13/22, B-40/50, B-60/70, B-80/00, B-150/200 and BM-3c (modified asphalt were studied. The test measured strain, complex modulus (G*, dissipated energy and dissipated energy ratio (DER with the number of cycles. Strain criteria were used for determining binder fatigue failure (DER. Failure was defined as the point at which (DER dropped 10% after peaking. Laws of asphalt fatigue were obtained from the strain and failure cycle results.

  8. Chloride accelerated test: influence of silica fume, water/binder ratio and concrete cover thickness

    Directory of Open Access Journals (Sweden)

    E. Pereira

    Full Text Available In developed countries like the UK, France, Italy and Germany, it is estimated that spending on maintenance and repair is practically the same as investment in new constructions. Therefore, this paper aims to study different ways of interfering in the corrosion kinetic using an accelerated corrosion test - CAIM, that simulates the chloride attack. The three variables are: concrete cover thickness, use of silica fume and the water/binder ratio. It was found, by analysis of variance of the weight loss of the steel bars and chloride content in the concrete cover thickness, there is significant influence of the three variables. Also, the results indicate that the addition of silica fume is the path to improve the corrosion protection of low water/binder ratio concretes (like 0.4 and elevation of the concrete cover thickness is the most effective solution to increase protection of high water/binder ratio concrete (above 0.5.

  9. Development of a Polyuretbane Binder System Giving a 'Knottable' Composite Solid Propellant

    Directory of Open Access Journals (Sweden)

    E. Devadoss


    Full Text Available Polyurethane propellants, which constitute one of the 'work-horse' binder systems in modern solid rocketry are easily amenable for tailoring the mechanical properties in terms of variations in the molecular structure of the backbone polyols, the isocyanates and stoichiometry of the reactants. The paper deals with studies in developing an advanced binder system based on poly (oxy propylene glycol and toluene-di-isocyanate, which is capable of accommodating high solids loading and conceding elongatlon at maximum stress, of more than 125 per cent. The gum-stock properties of the binder are related with those of a low molecular weight version and the results are explained based on the network theory of condensation polymers.

  10. Effect of Hydration Aging and Water Binder Ratio on Microstructure and Mechanical Properties of Sprayed Concrete

    Institute of Scientific and Technical Information of China (English)

    NIU Ditao; WANG Jiabin; WANG Yan


    In order to study the durability of sprayed concrete (shotcrete), effects of different hydration aging and water-binder ratio (w/b) on the microstructure of cement paste and basic mechanical properties of test specimens were investigated. The phase composition, mass percentage of ettringite and portland in hydration production and microstructure were characterized by X-ray diffraction (XRD), thermo gravimetry-differential scanning calorimetry (TG-DSC) and scanning electron microscopy (SEM), respectively. The experimental results showed that changes in phase composition was more signiifcant than those of water-binder ratio. With hydration aging and water-binder ratio increased, the mass percentage of ettringite and portland was decreased from 4.42%, 1.49% to 3.31%, 1.35%, respectively and the microstructure of paste was signiifcantly compacted. Likewise, the mechanical properties including cubic compressive strength and splitting tensile strength were rised obviously.

  11. Potential of the application of the modified polysaccharides water solutions as binders of moulding sands

    Directory of Open Access Journals (Sweden)

    K. Kaczmarska


    Full Text Available The results of preliminary tests of selected properties of the moulding sands with the binder in the form of a 5 % water solution of the sodium salt of carboxymethyl starch (with a degree of substitution (DS of 0,2 and 0,87 arepresented in this study. The moulding sand properties such as permeability, abrasion resistance, tensile and bendingstrength - after curing - are shown in series of tests. The cure process was conducted in a field of electromagnetic radiation within the microwave range. The effect of the microwave treatment on the moulding sand was evaporating of water (solvent in a binder and cross-linking of the polymeric binder. As a result the cured moulding sands with particular properties, essential in the context of its application in the mould technology in the foundry industry, were obtained.

  12. The estimation of ability to reclame of moduling sands with biopolymer binders

    Directory of Open Access Journals (Sweden)

    J. Jakubski


    Full Text Available Applied up till now organic binding materials, on the basis of synthetic resins are characterised by good technological properties, but cause high emission of harmful substances. That’s why contemporary scientific researches are leading to progressive replacing the binders obtained from petrochemical materials with polymer biocomposites coming from renewable resources. Increasing concern of aliphatic polyesters such as polylactide, polycaprolactone, poly(hydroxyalkanoates and aliphatic-aromatic polyesters is caused by the possibility of using them for producing many biodegradable products. In that context it is important to expand the researches connected to using biopolymers as moulding sands binders. Contemporary authors’ papers were focused on technological properties and harmfulness for the environment of this ecological moulding sands. TThis article takes into consideration the ability to reclamation of moulding sands with biopolymer binders.

  13. Linking asphalt binder fatigue to asphalt mixture fatigue performance using viscoelastic continuum damage modeling (United States)

    Safaei, Farinaz; Castorena, Cassie; Kim, Y. Richard


    Fatigue cracking is a major form of distress in asphalt pavements. Asphalt binder is the weakest asphalt concrete constituent and, thus, plays a critical role in determining the fatigue resistance of pavements. Therefore, the ability to characterize and model the inherent fatigue performance of an asphalt binder is a necessary first step to design mixtures and pavements that are not susceptible to premature fatigue failure. The simplified viscoelastic continuum damage (S-VECD) model has been used successfully by researchers to predict the damage evolution in asphalt mixtures for various traffic and climatic conditions using limited uniaxial test data. In this study, the S-VECD model, developed for asphalt mixtures, is adapted for asphalt binders tested under cyclic torsion in a dynamic shear rheometer. Derivation of the model framework is presented. The model is verified by producing damage characteristic curves that are both temperature- and loading history-independent based on time sweep tests, given that the effects of plasticity and adhesion loss on the material behavior are minimal. The applicability of the S-VECD model to the accelerated loading that is inherent of the linear amplitude sweep test is demonstrated, which reveals reasonable performance predictions, but with some loss in accuracy compared to time sweep tests due to the confounding effects of nonlinearity imposed by the high strain amplitudes included in the test. The asphalt binder S-VECD model is validated through comparisons to asphalt mixture S-VECD model results derived from cyclic direct tension tests and Accelerated Loading Facility performance tests. The results demonstrate good agreement between the asphalt binder and mixture test results and pavement performance, indicating that the developed model framework is able to capture the asphalt binder's contribution to mixture fatigue and pavement fatigue cracking performance.

  14. Application of microwave energy for curing of molding sands containing oil binders

    Directory of Open Access Journals (Sweden)

    M. Stachowicz


    Full Text Available This works presents the results of studies concerning possibility of application of microwave heating in the curing process of molding sands containing oil binders. Molding sands prepared with three kinds of binders, that is oils C, DL and Retanol, have been subject to experiments. The sands have been dried with two methods: in a microwave chamber of 750W power and, for comparison, with classical method at the temperature of 200°C for 120 minutes. Tensile and bending strength of the samples have been determined after cooling down. It has been found that microwave drying in the low-power device used for experiments is effective only in case of molding sand prepared with addition of DL binder. The temperature of heated, even up to 32 minutes in a microwave chamber, blocks prepared from the remaining two masses, was insufficient to initiate binding process. The undertaken attempts of binder modification and introduction of additives intensifying microwave heating process allowed for achievement of satisfactory results. It has been found that power of the heating device is the main factor determining efficiency of microwave curing of molding sands containing oil binders. An additional experiment has been conducted on a laboratory workstation allowing for microwave heating of small mass samples with a high output power of magnetron concentrated in a small substrate volume. It has been observed that microwave drying process of molding sands was of dynamic character over a short period of time, not exceeding 120 seconds, thus assuring efficient curing of the sands containing the used oil binders. Therefore, application of devices of properly high microwave output power allows for efficient drying of oil molding sands, while simultaneously assuring the possibility to reduce time and energy consumption necessary for production of foundry cores of proper functional characteristics.



    Patil Basawaraj S; Soodam Srinivas R.; Kulkarni Upendra; Korwar Prakassh G.


    Various plant gums have been used as binders in tablet formulations. But still finding novel binder for the manufacture of tablets, in pharmaceutical industry. The Moringa oleifera gum was found its binding property. In the present study Moringa oleifera gum was employed as a binding agent in Chloroquine phosphate tablets at concentrations of 4.0, 6.0 and 8.0 % w/w, in comparison with potato starch. The properties of Moringa oleifera gum were evaluated for angle of repose, bulk density, tappe...

  16. Guanidine based vehicle/binders for use with oxides, metals and ceramics (United States)

    Philipp, Warren H. (Inventor); Weitch, Lisa C. (Inventor); Jaskowiak, Martha H. (Inventor)


    The use of guanidine salts of organic fatty acids (guanidine soaps) as vehicles and binders for coating substrate surfaces is disclosed. Being completely organic, the guanidine soaps can be burned off leaving no undesirable residue. Of special interest is the use of guanidine 2-ethyl hexanoate as the vehicle and binder for coating problematic surfaces such as in coating alumina fibers with platinum or zirconia. For this application the guanidine soap is used as a melt. For other applications the guanidine soap may be used in a solution with a variety of solvents, the solution containing chlorometalates or powdered metals, refractories or ceramics.

  17. Selective catalytic reduction system and process using a pre-sulfated zirconia binder (United States)

    Sobolevskiy, Anatoly; Rossin, Joseph A.


    A selective catalytic reduction (SCR) process with a palladium catalyst for reducing NOx in a gas, using hydrogen as a reducing agent is provided. The process comprises contacting the gas stream with a catalyst system, the catalyst system comprising (ZrO.sub.2)SO.sub.4, palladium, and a pre-sulfated zirconia binder. The inclusion of a pre-sulfated zirconia binder substantially increases the durability of a Pd-based SCR catalyst system. A system for implementing the disclosed process is further provided.

  18. Azidated Ether-Butadiene-Ether Block Copolymers as Binders for Solid Propellants (United States)

    Cappello, Miriam; Lamia, Pietro; Mura, Claudio; Polacco, Giovanni; Filippi, Sara


    Polymeric binders for solid propellants are usually based on hydroxyl-terminated polybutadiene (HTPB), which does not contribute to the overall energy output. Azidic polyethers represent an interesting alternative but may have poorer mechanical properties. Polybutadiene-polyether copolymers may combine the advantages of both. Four different ether-butadiene-ether triblock copolymers were prepared and azidated starting from halogenated and/or tosylated monomers using HTPB as initiator. The presence of the butadiene block complicates the azidation step and reduces the storage stability of the azidic polymer. Nevertheless, the procedure allows modifying the binder properties by varying the type and lengths of the energetic blocks.

  19. ISRO Polyol - The Versatile Binder for Composite Solid Propellants for Launch Vehicles and Missiles

    Directory of Open Access Journals (Sweden)

    V. N. Krishnamurthy


    Full Text Available A family of propellants based on a low cost hydroxy terminated binder has been developed and proved in large size motors. It can meet the requirements of Apogee motors as well as large boosters. The system offers advantages comparable with HTPB propellants in terms of high ballistic performance, stringent mechanical properties, ease and reliability of cure even at ambient conditions and high storage stability. The near-Newtonian flow behaviour, simplicity and processing characteristics of this saturated binder propellant are particularly note-worthy.

  20. Study on Heat Hardening Mechanism of Starch Composite Binder for Sand Mold (Core) by IR Spectra

    Institute of Scientific and Technical Information of China (English)

    Xia ZHOU; Jinzong YANG; Qin GAO; Guohui QU


    The heat hardening mechanism of starch composite binder for sand mold (core) was studied by way of IR spectra. It is thought that the bonding strength of molding sand is mainly depended on the strength of the adhesive membrane itself. During heating the binder at certain temperature between 160~200℃ for one hour, a special composite structure is formed because of the interactions between different components, thus, it has higher low-temperature drying strength,better humidity resistance and higher high-temperature strength.


    The systematic study of the effect of binder viscosity on the sensitivity of a tyrosinase-based carbon paste electrode (CPE) biosensor for phenol and catechol is reported. Silicon oil binders with similar (polydimethylsiloxane) chemical composition were used to represent a wid...

  2. Effects of Nanosilica on Compressive Strength and Durability Properties of Concrete with Different Water to Binder Ratios

    Directory of Open Access Journals (Sweden)

    Forood Torabian Isfahani


    Full Text Available The effects of the addition of different nanosilica dosages (0.5%, 1%, and 1.5% with respect to cement on compressive strength and durability properties of concrete with water/binder ratios 0.65, 0.55, and 0.5 were investigated. Water sorptivity, apparent chloride diffusion coefficient, electrical resistivity, and carbonation coefficient of concrete were measured. The results showed that compressive strength significantly improved in case of water/binder = 0.65, while for water/binder = 0.5 no change was found. Increasing nanosilica content, the water sorptivity decreased only for water/binder = 0.55. The addition of 0.5% nanosilica decreased the apparent chloride diffusion coefficient for water/binder = 0.65 and 0.55; however, higher nanosilica dosages did not decrease it with respect to reference value. The resistivity was elevated by 0.5% nanosilica for all water/binder ratios and by 1.5% nanosilica only for water/binder = 0.5. The carbonation coefficient was not notably affected by increasing nanosilica dosages and even adverse effect was observed for water/binder = 0.65. Further information of microstructure was also provided through characterization techniques such as X-ray diffraction, thermal gravimetric analysis, mercury intrusion porosimetry, and scanning electron microscopy. The effectiveness of a certain nanosilica dosage addition into lower strength mixes was more noticeable, while, for the higher strength mix, the effectiveness was less.

  3. First Observation of the Blending Zone Morphology at the Interface of Reclaimed Asphalt Binder and Virgin Bitumen

    NARCIS (Netherlands)

    Nahar, S.N.; Mohajeri, M.; Schmets, A.J.M.; Scarpas, T.; Van de Ven, M.F.C.; Schitter, G.


    One of the challenges in designing recycled asphalt mixtures with a high amount of RAP is to estimate the blending degree between RAP binder and the added virgin bitumen. The extent of blending is crucial in this case as asphalt concrete response is influenced by the final binder properties. This pa

  4. Low toxicity binder systems for tape cast Ce0.9Gd0.1O1.95 laminates

    DEFF Research Database (Denmark)

    Klemensø, Trine; Menon, Mohan; Ramousse, Severine


    Conventional binder systems for tape casting contain toxic phthalate plasticizers and butanone (MEK) as part of the solvent. The effects of exchanging the phthalate with a non-toxic alternative, and butanone with ethanol, were studied on laminates of high-green density CGO (Ce0.9Gd0.1O1.95) tapes....... Samples were prepared with a binder system containing DBP (dibutyl phthalate) plasticizer and MEK solvent, and with a binder system based on a non-toxic non-phthalate plasticizer and ethanol. In both systems, the weight ratio of plasticizer to the PVB (polyvinyl butyral) binder was varied between 0.......4 and 0.7. Substitution to the less toxic binder system had no adverse impacts on the microstructure. In fact, denser packing and improved homogeneity were observed with the non-phthalate-based system at ratio 0.5 indicating improved dispersion in this system. The denser packing also coincided...

  5. A facile approach to derive binder protective film on high voltage spinel cathode materials against high temperature degradation (United States)

    Chou, Wei-Yu; Jin, Yi-Chun; Duh, Jenq-Gong; Lu, Cheng-Zhang; Liao, Shih-Chieh


    The electrochemical performance of spinel LiNi0.5Mn1.5O4 cathode combined with different binders at elevated temperature is firstly investigated. The water soluble binder, such as sodium carboxymethyl cellulose (CMC) and sodium alginate (SA), is compared with the polyvinylidene difluoride (PVdF) binder used in non-aqueous process. The aqueous process can meet the need of Li-ion battery industry due to environmental-friendly and cost effectiveness by replacing toxic organic solvent, such as N-methyl-pyrrolidone (NMP). In this study, a significantly improved high temperature cycling performance is successfully obtained as compared to the traditional PVdF binder. The aqueous binder can serve as a protective film which inhibits the serious Ni and Mn dissolution especially at elevated temperature. Our result demonstrates a facile approach to solve the problem of capacity fading for high voltage spinel cathodes.

  6. Design of a novel system allowing the selection of an adequate binder for solidification/stabilization of wastes

    Energy Technology Data Exchange (ETDEWEB)

    Pera, J.; Thevenin, G.; Chabannet, M. [INSA de Lyon, Villeurbanne (France)


    Literature review shows that there is a lack of complete and consistent data on waste-binder interactions. Few links exist between research on the Solidification/Stabilization (S/S) mechanisms and the formulation of binders for immobilization. Therefore, a twofold program was developed allowing both to be done in parallel. This protocol had two targets: understanding the mechanisms involved in the S/S of heavy metals for each type of binder and rating the binder capacity for fixing heavy metals. The experimental procedure relies on two substrates: (1) the study of suspensions by means of conductimetry, XRD, FTIR, DTA, SEM-EDXA, ICP, ion chromatography, and colorimetry; and (2) the study of pure pastes for leaching tests and microstructural characterization (XRD, FTIR, DTA, SEM-EDXA). Results confirm whether the pollutant modifies the hydration or not, give access to the extent of binder stabilization without taking into account the solidification part, and elucidate the mechanisms involved.

  7. In Vitro Adsorption and in Vivo Pharmacokinetic Interaction between Doxycycline and Frequently Used Mycotoxin Binders in Broiler Chickens. (United States)

    De Mil, Thomas; Devreese, Mathias; Broekaert, Nathan; Fraeyman, Sophie; De Backer, Patrick; Croubels, Siska


    Mycotoxin binders are readily mixed in feeds to prevent uptake of mycotoxins by the animal. Concerns were raised for nonspecific binding with orally administered veterinary drugs by the European Food Safety Authority in 2010. This paper describes the screening for in vitro adsorption of doxycycline-a broad-spectrum tetracycline antibiotic-to six different binders that were able to bind >75% of the doxycycline. Next, an in vivo pharmacokinetic interaction study of doxycycline with two of the binders, which demonstrated significant in vitro binding, was performed in broiler chickens using an oral bolus model. It was shown that two montmorillonite-based binders were able to lower the area under the plasma concentration-time curve of doxycycline by >60% compared to the control group. These results may indicate a possible risk for reduced efficacy of doxycycline when used concomitantly with montmorillonite-based mycotoxin binders.

  8. Flexible Paper Electrodes for Li-Ion Batteries Using Low Amount of TEMPO-Oxidized Cellulose Nanofibrils as Binder. (United States)

    Lu, Huiran; Behm, Mårten; Leijonmarck, Simon; Lindbergh, Göran; Cornell, Ann


    Flexible Li-ion batteries attract increasing interest for applications in bendable and wearable electronic devices. TEMPO-oxidized cellulose nanofibrils (TOCNF), a renewable material, is a promising candidate as binder for flexible Li-ion batteries with good mechanical properties. Paper batteries can be produced using a water-based paper making process, avoiding the use of toxic solvents. In this work, finely dispersed TOCNF was used and showed good binding properties at concentrations as low as 4 wt %. The TOCNF was characterized using atomic force microscopy and found to be well dispersed with fibrils of average widths of about 2.7 nm and lengths of approximately 0.1-1 μm. Traces of moisture, trapped in the hygroscopic cellulose, is a concern when the material is used in Li-ion batteries. The low amount of binder reduces possible moisture and also increases the capacity of the electrodes, based on total weight. Effects of moisture on electrochemical battery performance were studied on electrodes dried at 110 °C in a vacuum for varying periods. It was found that increased drying time slightly increased the specific capacities of the LiFePO4 electrodes, whereas the capacities of the graphite electrodes decreased. The Coulombic efficiencies of the electrodes were not much affected by the varying drying times. Drying the electrodes for 1 h was enough to achieve good electrochemical performance. Addition of vinylene carbonate to the electrolyte had a positive effect on cycling for both graphite and LiFePO4. A failure mechanism observed at high TOCNF concentrations is the formation of compact films in the electrodes.

  9. In Vitro and In Vivo Assessment of Humic Acid as an Aflatoxin Binder in Broiler Chickens

    National Research Council Canada - National Science Library

    van Rensburg, C. Jansen; Van Rensburg, C. E. J; Van Ryssen, J. B. J; Casey, N. H; Rottinghaus, G. E


    ..., and 11.9 mg of AFB1/g of oxihumate at pH 3, 5, and 7, respectively, were calculated. The in vivo efficacy of oxihumate as an aflatoxin binder in male broiler chickens exposed to aflatoxin-contaminated feed from 7 to 42 d of age was also assessed...

  10. Polyols as filler-binders for disintegrating tablets prepared by direct compaction

    NARCIS (Netherlands)

    Bolhuis, Gerad K.; Rexwinkel, Erik G.; Zuurman, Klaas


    Background: Although polyols are frequently used as tablet excipients in lozenges, chewing tablets, and orodisperse tablets, special directly compressible (DC) forms are recommended as filler-binder in common disintegrating tablets. Aim: In this article, DC types of isomalt, lactitol, mannitol, sorb

  11. Use of Deep Peat-Processing Products for Hydrophobic Modification of Gypsum Binder

    Directory of Open Access Journals (Sweden)

    Misnikov Oleg


    Full Text Available The article deals with the issue of gypsum binder quality reduction during its storage and transportation. The study provides the main methods to protect gypsum from unauthorized exposure to moisture and water vapor. The author proposes hydrophobic modification as a perspective method for the preservation of gypsum activity and its water absorption reduction. The substantiation of cement hydrophobization with the bitumen released during peat thermolysis is provided. The author proposes to use this method in the technology of gypsum binder production. The basic idea is to combine the hydrophobization process with the calcination of calcium sulfate dehydrate. This is facilitated by temperature ranges used for dehydration of natural gypsum and the initial stage of thermal decomposition of the organic matter of peat. The author defined experimentally an optimal concentration of the organic component in gypsum binder. After adding 0.5-1% of the peat additive, the gypsum plaster preserved its grade strength and increased its storage time without caking and hydration, also under adverse conditions. The proposed method is adapted to the technological processes presently used in the production and doesn’t require changing any equipment. The price of mineral raw materials and semi-finished products of peat are approximately equal which reduces the probability of increasing of the cost of hydrophobically modified gypsum binder.

  12. Towards an Accurate Stress Dependant Time & Frequency Domain VE Response Model for Bituminous Binders

    NARCIS (Netherlands)

    Woldekidan, M.F.; Huurman, M.; Pronk, A.C.


    Linear viscoelastic properties of bituminous binders for short loading times are analyzed using dynamic mechanical analysis methods. Dynamic Shear Rheometer (DSR) test with parallel plate (PP) configuration is widely used for this purpose. Due to the complex stress distribution over the cross-sectio

  13. Abdominal binders may reduce pain and improve physical function after major abdominal surgery - a systematic review

    DEFF Research Database (Denmark)

    Rothman, Josephine Philip; Gunnarsson, Ulf; Bisgaard, Thue


    . The PubMed, EMBASE and Cochrane databases were searched for studies on the use of abdominal binders after abdominal surgery or abdominoplasty. All types of clinical studies were included. Two independent assessors evaluated the scientific quality of the studies. The primary outcomes were pain, seroma...

  14. The curious case of zeolite-clay/binder interactions and their consequences for catalyst preparation

    NARCIS (Netherlands)

    Whiting, Gareth T; Chowdhury, Abhishek Dutta|info:eu-repo/dai/nl/412438003; Oord, R.; Paalanen, Pasi|info:eu-repo/dai/nl/370602013; Weckhuysen, Bert M|info:eu-repo/dai/nl/285484397


    Zeolite-based catalyst bodies are commonly employed in a range of important industrial processes. Depending on the binder and shaping method chosen, vast differences in the reactivity, selectivity and stability are obtained. Here, three highly complementary micro-spectroscopic techniques were

  15. Selection of a mineral binder with potentialities for the stabilization/solidification of aluminum metal

    Energy Technology Data Exchange (ETDEWEB)

    Cau Dit Coumes, C., E-mail: [Commissariat à l’Energie Atomique et aux Energies Alternatives, CEA/DEN/MAR/DTCD/SPDE, BP17171, 30207 Bagnols-sur-Cèze cedex (France); Lambertin, D.; Lahalle, H.; Antonucci, P. [Commissariat à l’Energie Atomique et aux Energies Alternatives, CEA/DEN/MAR/DTCD/SPDE, BP17171, 30207 Bagnols-sur-Cèze cedex (France); Cannes, C.; Delpech, S. [Institut de Physique Nucléaire, CNRS, Univ. Paris-Sud 11, 91406 Orsay Cedex (France)


    Highlights: • Binders capable of reducing the pore solution pH compared with Portland cements are reviewed. • The binders are then tested against aluminum corrosion. • Corrosion of aluminum metal is minimal with magnesium phosphate cement. • The H{sub 2} release can be reduced still further by adding LiNO{sub 3} to the mixing solution. • Electrochemical characterizations show that aluminum tends to a passive state. - Abstract: In a strongly alkaline medium, such as that encountered in conventional cementitious materials based on Portland cement, aluminum metal is corroded, with continued production of hydrogen. In order to develop a mineral matrix having enhanced compatibility with aluminum, a literature review was first undertaken to identify binders capable of reducing the pore solution pH compared with Portland cement. An experimental study was then carried out to measure the hydrogen production resulting from corrosion of aluminum metal rods encapsulated in the different selected cement pastes. The best results were achieved with magnesium phosphate cement, which released very little hydrogen over the duration of the study. This production could be reduced still further by adding a corrosion inhibitor (lithium nitrate) to the mixing solution. Open circuit potential measurement and Electrochemical Impedance Spectroscopy of aluminum electrode encapsulated in two pastes based on Portland cement and magnesium phosphate cement showed different redox behaviors. In the Portland cement paste, the electrochemical data confirmed the corrosion of aluminum whereas this latter tended to a passive state in the magnesium phosphate binder.

  16. Towards an Accurate Stress Dependant Time & Frequency Domain VE Response Model for Bituminous Binders

    NARCIS (Netherlands)

    Woldekidan, M.F.; Huurman, M.; Pronk, A.C.


    Linear viscoelastic properties of bituminous binders for short loading times are analyzed using dynamic mechanical analysis methods. Dynamic Shear Rheometer (DSR) test with parallel plate (PP) configuration is widely used for this purpose. Due to the complex stress distribution over the cross-sectio

  17. Creep recovery behaviour of bituminous binders - relevance to permanent deformation of asphalt pavements

    CSIR Research Space (South Africa)

    Mturi, GAJ


    Full Text Available different modifiers has expanded the range of PMBs to select from when designing pavements in order to avoid pavement deformation. The new binder selection criterion using the Multiple Stress Creep and Recovery (MSCR) protocol as per ASTM D7405 is meant...

  18. Advanced Graphene-Based Binder-Free Electrodes for High-Performance Energy Storage. (United States)

    Ji, Junyi; Li, Yang; Peng, Wenchao; Zhang, Guoliang; Zhang, Fengbao; Fan, Xiaobin


    The increasing demand for energy has triggered tremendous research effort for the development of high-performance and durable energy-storage devices. Advanced graphene-based electrodes with high electrical conductivity and ion accessibility can exhibit superior electrochemical performance in energy-storage devices. Among them, binder-free configurations can enhance the electron conductivity of the electrode, which leads to a higher capacity by avoiding the addition of non-conductive and inactive binders. Graphene, a 2D material, can be fabricated into a porous and flexible structure with an interconnected conductive network. Such a conductive structure is favorable for both electron and ion transport to the entire electrode surface. In this review, the main processes used to prepare binder-free graphene-based hybrids with high porosity and well-designed electron conductive networks are summarized. Then, the applications of free-standing binder-free graphene-based electrodes in energy-storage devices are discussed. Future research aspects with regard to overcoming the technological bottlenecks are also proposed.

  19. Interactions between TiAl alloy and AZC/AMT binder systems in investment casting

    Directory of Open Access Journals (Sweden)

    Yi Jia


    Full Text Available In this work, two kinds of binders, Ammonium Zirconium Carbonate (AZC and Ammonium Metatungstate (AMT hydrate, and three kinds of powders (ZrO2, Al2O3 and Y2O3 were mixed to fabricate six kinds of face coating systems. The thermal behaviors of the AZC and AMT dried binders were investigated by TG-DTA, and the phase transformation of the two binders was determined by XRD. Monoclinic ZrO2 phase was formed from AZC at 620 °C and WO3 at 700 °C, and the phase transformation was completed at lower than 1000 °C in both binders, and therefore, the sintering temperature for the molds was selected at 950 °C. The interaction between the ceramic molds with different face coatings and the Ti-48Al-2Cr-2Nb alloy during investment casting was studied. Results showed no α-case reaction in the TiAl-mold reaction, and the AMT + Y2O3 face coating appeared to be the best choice for investment casting of TiAl alloys under the experimental conditions.

  20. Biobased adhesives, gums, emulsions and binders: current trends and future prospects (United States)

    Biopolymers derived from renewable resources are an emerging class of advanced materials that offer many useful properties for a wide range of food and non-food applications. Current state of the art in research and development of renewable polymers as adhesives, gums, binders and emulsions will be ...

  1. Preparation of Granular Red Mud Adsorbent using Different Binders by Microwave Pore - Making and Activation Method (United States)

    Le, Thiquynhxuan; Wang, Hanrui; Ju, Shaohua; Peng, Jinhui; Zhou, Liexing; Wang, Shixing; Yin, Shaohua; Liu, Chao


    In this work, microwave energy is used for preparing a granular red mud (GRM) adsorbent made of red mud with different binders, such as starch, sodium silicate and cement. The effects of the preparation parameters, such as binder type, binder addition ratio, microwave heating temperature, microwave power and holding time, on the absorption property of GRM are investigated. The BET surface area, strength, pore structure, XRD and SEM of the GRM absorbent are analyzed. The results show that the microwave roasting has a good effect on pore-making of GRM, especially when using organic binder. Both the BET surface area and the strength of GRM obtained by microwave heating are significantly higher than that by conventional heating. The optimum conditions are obtained as follows: 6:100 (w/w) of starch to red mud ratio, microwave roasting with a power of 2.6 kW at 500℃ for holding time of 30 min. The BET surface area, pore volume and average pore diameter of GRM prepared at the optimum conditions are 15.58 m2/g, 0.0337 cm3/g and 3.1693 A0, respectively.

  2. Iron-based phosphate binders--a new element in management of hyperphosphatemia. (United States)

    Pai, Amy Barton; Jang, Soo Min; Wegrzyn, Nicole


    Management of serum phosphorus in patients with chronic kidney disease remains a significant clinical challenge. A pivotal component of the clinical approach to maintaining serum phosphorus concentrations towards the normal range is the use of phosphate binding agents in addition to comprehensive dietary counseling. The available agents work similarly by capitalizing on a cation within the agent to bind negatively charged phosphorus, forming an insoluble complex and reducing ingested phosphorus absorption. Despite several effective options for phosphate binder therapies, patient adherence remains an issue, mainly due to adverse effect profiles and large daily pill burdens. Two new iron-based phosphate binder therapies have recently become available in the United States, sucroferric oxyhydroxide and ferric citrate. These agents have both been shown to effectively reduce serum phosphorus comparably to widely used calcium-based binders and sevelamer salts. The two new iron-based binders differ substantially with regard to phosphate binding chemistry and iron absorption profiles. Their place in therapy is still evolving and the impact of pill burden, gastrointestinal adverse effect profiles, potential cost reduction of anemia therapies and physiologic effects of long-term iron exposure need to be further evaluated.

  3. QSAR classification of estrogen receptor binders and pre-screening of potential pleiotropic EDCs. (United States)

    Li, J; Gramatica, P


    Endocrine disrupting chemicals (EDCs) are suspected of posing serious threats to human and wildlife health through a variety of mechanisms, these being mainly receptor-mediated modes of action. It is reported that some EDCs exhibit dual activities as estrogen receptor (ER) and androgen receptor (AR) binders. Indeed, such compounds can affect the normal endocrine system through a dual complex mechanism, so steps should be taken not only to identify them a priori from their chemical structure, but also to prioritize them for experimental tests in order to reduce and even forbid their usage. To date, very few EDCs with dual activities have been identified. The present research uses QSARs, to investigate what, so far, is the largest and most heterogeneous ER binder data set (combined METI and EDKB databases). New predictive classification models were derived using different modelling methods and a consensus approach, and these were used to virtually screen a large AR binder data set after strict validation. As a result, 46 AR antagonists were predicted from their chemical structure to also have potential ER binding activities, i.e. pleiotropic EDCs. In addition, 48 not yet recognized ER binders were in silico identified, which increases the number of potential EDCs that are substances of very high concern (SVHC) in REACH. Thus, the proposed screening models, based only on structure information, have the main aim to prioritize experimental tests for the highlighted compounds with potential estrogenic activities and also to design safer alternatives.

  4. Incinerated sewage sludge ash as alternative binder in cement-based materials

    DEFF Research Database (Denmark)

    Krejcirikova, Barbora; Goltermann, Per; Hodicky, Kamil


    it can minimize the need of ash landfill disposal. The objective of this study is to show potential use of incinerated sewage sludge ash (ISSA), an industrial byproduct, as possible binder in cement-based materials. Chemical and mechanical characteristics are presented and compared with results obtained...

  5. Conductivity Enhancement of Binder-Based Graphene Inks by Photonic Annealing and Subsequent Compression Rolling

    NARCIS (Netherlands)

    Arapov, K.; Bex, G.; Hendriks, R.; Rubingh, E.; Abbel, R.; de With, G.; Friedrich, H.


    This paper describes a combination of photonic annealing and compression rolling to improve the conductive properties of printed binder-based graphene inks. High-density light pulses result in temperatures up to 500 °C that along with a decrease of resistivity lead to layer expansion. The structural

  6. Mimosa pudica seed mucilage: isolation; characterization and evaluation as tablet disintegrant and binder. (United States)

    Ahuja, Munish; Kumar, Ashok; Yadav, Parvinder; Singh, Kuldeep


    In the present study Mimosa pudica seed mucilage was isolated, characterized and evaluated as tablet binder and disintegrant. Several properties of mucilage like high swelling index and gelling nature prompted us to explore its applications as disintegrating and binding agent. Disintegrant properties were evaluated by formulating directly compressed hydrochlorothiazide tablets containing 1%-10% (w/w) of seed mucilage as disintegrant and compared with the standard disintegrants. The disintegration time of mucilage containing tablets was found to be in the order of 3%>1%>5%>7.5%>10%. On comparative evaluation with standard disintegrants, it was observed that the order of disintegration of tablets was Ac-Di-SolMimosa mucilage at 6%, 8%, and 10% (w/w) concentration as the binder and compared with tablets prepared using PVP-K25 (1.7%, w/w) and acacia (6.8%, w/w) as the binder. Mimosa mucilage at 10% (w/w) concentration provided tablets with adequate hardness and friability. In conclusion, M. pudica seed mucilage is a potential tablet disintegrant and binder. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Conductivity Enhancement of Binder-Based Graphene Inks by Photonic Annealing and Subsequent Compression Rolling

    NARCIS (Netherlands)

    Arapov, K.; Bex, G.; Hendriks, R.; Rubingh, E.; Abbel, R.; de With, G.; Friedrich, H.


    This paper describes a combination of photonic annealing and compression rolling to improve the conductive properties of printed binder-based graphene inks. High-density light pulses result in temperatures up to 500 °C that along with a decrease of resistivity lead to layer expansion. The structural

  8. Binder characterisation of mortars used at different ages in the San Lorenzo church in Milan

    Energy Technology Data Exchange (ETDEWEB)

    Bertolini, Luca, E-mail:; Carsana, Maddalena, E-mail:; Gastaldi, Matteo, E-mail:; Lollini, Federica, E-mail:; Redaelli, Elena, E-mail:


    The paper describes a study on the mortars of the basilica of San Lorenzo in Milan, which was carried out to support an archaeological study aimed at dating and documenting the construction techniques used throughout the centuries. The church, which was founded between the 4th and 5th century, at the end of the period when Milan was the capital of the Roman Empire, was subjected in time to extensions, collapses and reconstructions that lasted until the Renaissance period and even later on. Thanks to the good state of conservation, San Lorenzo church is a collection of materials and construction techniques throughout a period of more than a millennium. Mortars were investigated in order to compare the binders used for structural elements built in different historical ages. From an archaeological study, samples of mortars attributed to the late Roman period, the Middle Ages and the Renaissance were available. The binder of each sample was separated by the aggregates and it was characterised on the basis of X-ray diffraction analysis, thermogravimetric analysis and scanning electron microscopy. Constituents of the binder were identified and their origin is discussed in order to investigate if they could be attributed to the original composition of the binder or to possible alteration in time due to atmospheric pollution. Results show that, even though the binder is mainly based on magnesian lime, there are significant differences in the microstructure of the binding matrix used in mortars ascribed to the different historical periods. In the Roman period, in correspondence of the structural elements that required higher strength, also hydraulic cocciopesto mortars were detected. Gypsum was found in most samples, which was maybe added intentionally. - Highlights: • Binders of mortars of San Lorenzo church in Milan were investigated. • Roman, Middle Ages and Renaissance samples were studied by XRD, TG and SEM. • Magnesian-lime binders containing silico

  9. Cold in-place recycling characterization framework for single or multiple component binder systems (United States)

    Cox, Benjamin C.

    Cold in-place recycling (CIR) is a pavement rehabilitation technique which has gained momentum in recent years. This momentum is due partly to its economic and sustainability characteristics, which has led to CIR market expansion. When pavement network deterioration is considered alongside increasing material costs, it is not beyond reason to expect demands on CIR to continue to increase. Historically, single component binder (SCB) systems, those with one stabilization binder (or two if the secondary binder dosage is 1% or less), have dominated the CIR market and could be considered the general state of practice. Common stabilization binders are either bituminous or cementitious. Two example SCB systems would be: 1) 3% portland cement, or 2) 3% asphalt emulsion with 1% hydrated lime. While traditional SCB systems have demonstrated positive economic and sustainability impacts, this dissertation focuses on multiple component binder (MCB) systems (bituminous and cementitious combined) which exhibit the potential to provide better overall economics and performance. Use of MCBs has the potential to alleviate SCB issues to some extent (e.g. cracking with cementitious SCBs, rutting with bituminous SCBs). Furthermore, to fairly represent both binders in an MCB system a universal design method which can accommodate multiple binder types is needed. The main objectives of this dissertation are to develop a universal CIR design framework and, using this framework, characterize multiple SCB and MCB systems. Approximately 1500 CIR specimens were tested herein along with approximately 300 asphalt concrete specimens which serve as a reference data set for CIR characterization. A case study of a high-traffic Mississippi CIR project which included cement SCB and emulsion SCB sections is also presented to support laboratory efforts. Individual components needed to comprise a universal design framework, such as curing protocols, were developed. SCB and MCB characterization indicated

  10. Mechanical strength development of mortars containing volcanic scoria-based binders with different fineness

    Directory of Open Access Journals (Sweden)

    Aref M. al-Swaidani


    Full Text Available The benefits of using natural pozzolan as cement replacement are often associated with shortcomings such as the need to moist-curing for longer time and a reduction of strength at early ages. The objective of the study is to investigate the influence of binder fineness on the mechanical strength development of scoria-based binder mortars. In the study, mortar specimens have been produced with four types of binder: one plain Portland cement (control and three scoria-based binders with three replacement levels: 25%, 30% and 35%, respectively. All scoria-based binders have been inter-ground into four different Blaine fineness: 2400, 3200, 4200 and 5100 cm2/g. The development of the compressive and flexural tensile strength of all mortar specimens with curing time has been investigated. The effects of the Blaine fineness of the scoria-based blended cement on the compressive and flexural strengths of mortar have been evaluated at curing ages of 2, 7, 28 and 90 days, respectively. Particle size distribution measured by a laser diffractometer has been considered in the study. Test results revealed that there is a decrease in strength with increasing amounts of scoria. In addition, there was found an increase in strength with increasing the Blaine fineness values. No direct relationship between Blaine and particle size distribution was observed. Effects of Blaine fineness on some physical properties of blended cements such as water demand, setting times and soundness have also been investigated. Further, an estimation equation for strength development incorporating the effects of fineness measured either by Blaine or by particle size distribution has been derived by the authors.

  11. A review of binders used in cemented paste tailings for underground and surface disposal practices. (United States)

    Tariq, Amjad; Yanful, Ernest K


    Increased public awareness of environmental issues coupled with increasingly stringent environmental regulations pertaining to the disposal of sulphidic mine waste necessitates the mining industry to adopt more competent and efficient approaches to manage acid rock drainage. Cemented paste tailings (CPT) is an innovative form of amalgamated material currently available to the mining industry in developed countries. It is made usually from mill tailings mingled with a small amount of binder (customarily Portland cement) and water. The high cost associated with production and haulage of ordinary Portland cement and its alleged average performance as a sole binder in the long term (due to vulnerability to internal sulphate attack) have prompted users to appraise less expensive and technically efficient substitutes for mine tailings paste formulations. Generally, these binders include but are not limited to sulphate resistant cements, and/or as a partial replacement for Portland cement by artificial pozzolans, natural pozzolans, calcium sulphate substances and sodium silicates. The approach to designing environmentally efficient CPT is to ensure long-term stability and effective control over environmental contaminants through the use of composite binder systems with enhanced engineering properties to cater for inherit deficiencies in the individual constituents. The alkaline pore solution created by high free calcium rich cement kiln dust (CKD) (byproduct of cement manufacturing) is capable of disintegrating the solid glassy network of artificial pozzolans to produce reactive silicate and aluminate species when attacked by (OH(-)) ions. The augmented pozzolanic reactivity of CKD-slag and CKD-fly ash systems may produce resilient CPT. Since cemented paste comprising mine tailings and binders is a relatively new technology, a review of the binding materials used in such formulations and their performance evaluation in mechanical fill behaviour was considered pertinent in

  12. Characterization of 27 Mycotoxin Binders and the Relation with in Vitro Zearalenone Adsorption at a Single Concentration (United States)

    De Mil, Thomas; Devreese, Mathias; De Baere, Siegrid; Van Ranst, Eric; Eeckhout, Mia; De Backer, Patrick; Croubels, Siska


    The aim of this study was to characterize 27 feed additives marketed as mycotoxin binders and to screen them for their in vitro zearalenone (ZEN) adsorption. Firstly, 27 mycotoxin binders, commercially available in Belgium and The Netherlands, were selected and characterized. Characterization was comprised of X-ray diffraction (XRD) profiling of the mineral content and d-spacing, determination of the cation exchange capacity (CEC) and the exchangeable base cations, acidity, mineral fraction, relative humidity (RH) and swelling volume. Secondly, an in vitro screening experiment was performed to evaluate the adsorption of a single concentration of ZEN in a ZEN:binder ratio of 1:20,000. The free concentration of ZEN was measured after 4 h of incubation with each of the 27 mycotoxin binders at a pH of 2.5, 6.5 and 8.0. A significant correlation between the free concentration of ZEN and both the d-spacing and mineral fraction of the mycotoxin binders was seen at the three pH levels. A low free concentration of ZEN was demonstrated using binders containing mixed-layered smectites and binders containing humic acids. PMID:25568976

  13. Characterization of 27 Mycotoxin Binders and the Relation with in Vitro Zearalenone Adsorption at a Single Concentration

    Directory of Open Access Journals (Sweden)

    Thomas De Mil


    Full Text Available The aim of this study was to characterize 27 feed additives marketed as mycotoxin binders and to screen them for their in vitro zearalenone (ZEN adsorption. Firstly, 27 mycotoxin binders, commercially available in Belgium and The Netherlands, were selected and characterized. Characterization was comprised of X-ray diffraction (XRD profiling of the mineral content and d-spacing, determination of the cation exchange capacity (CEC and the exchangeable base cations, acidity, mineral fraction, relative humidity (RH and swelling volume. Secondly, an in vitro screening experiment was performed to evaluate the adsorption of a single concentration of ZEN in a ZEN:binder ratio of 1:20,000. The free concentration of ZEN was measured after 4 h of incubation with each of the 27 mycotoxin binders at a pH of 2.5, 6.5 and 8.0. A significant correlation between the free concentration of ZEN and both the d-spacing and mineral fraction of the mycotoxin binders was seen at the three pH levels. A low free concentration of ZEN was demonstrated using binders containing mixed-layered smectites and binders containing humic acids.

  14. Influence of binder system and temperature on rheological properties of water atomized 316L powder injection moulding feedstocks

    Directory of Open Access Journals (Sweden)

    Uğur GÖKMEN


    Full Text Available In order to obtain a proper powder injection molding the rheological behavior of feedstocks should be known. To determine the binder effect on the rheological behavior of 316L stainless steel powders feedstock two different feedstock were prepared. In the current experiments water atomized 316L stainless steel powders (-20 µm were used. Two types of binders, one of which is mainly paraffin wax can be dissolved in heptane and the other Polietilenglikol (PEG based and can be dissolved in water, were used. Polypropylene was used as binder and steric acid was used as lubricant for both binder systems as skeleton binder. Dry binder system were mixed for 30 min in a three dimensional Turbola. Capillary rheometer was used to characterize the rheological properties of feed stocks at 150-200 °C and a pressures of 0.165-2.069 MPa. Powder loading capacity of PEG and PW based feed stocks were found to be %55 and %61 respectively. The lowest viscosity of PEG and PW based feed stocks were found to be 304.707 Pa.s and 48.857 Pa.s respectively.Keywords: PIM, Binder, Rheological properties

  15. Influence of binder composition on the rheological behavior of injection-molded microsized SiC suspensions

    Institute of Scientific and Technical Information of China (English)

    Shubin Ren; Xinbo He; Xuanhui Qu; Islam S. Humail; Yanping Wei


    The influence of four kinds of binders consisting of paraffin wax (PW), random-polypropylene (RPP), high-density poly-ethylene (HDPE), and stearic acid (SA) on the theological behavior of injection-molded SiC feedstocks was investigated over a tem-perature range of 150℃ to 180℃ and a shear rate range of 4 s-1 to 1259 s-1. The results showed that all the feedstocks exhibited pseudoplastic flow behavior. The wax-based binder of multipolymer components (PW-RPP-HDPE) exhibited better comprehensive rheological properties compared with the binder of monopolymer components (PW-RPP or PW-HDPE). The addition of 5wt% SA to the binder could reduce the viscosity of the feedstock but enhance the rbeological stability by improving the wettability between the binder and the SiC powder. The binder of 65wt% PW + 15wt% HDPE + 15wt% RPP + 5wt% SA was found to be a better binder for microsized SiC injection molding.

  16. Injection Molding of Titanium Alloy Implant For Biomedical Application Using Novel Binder System Based on Palm Oil Derivatives

    Directory of Open Access Journals (Sweden)

    R. Ibrahim


    Full Text Available Problem statement: Titanium alloy (Ti6Al4V has been widely used as an implant for biomedical application. In this study, the implant had been fabricated using high technology of Powder Injection Molding (PIM process due to the cost effective technique for producing small, complex and precision parts in high volume compared with conventional method through machining. Approach: Through PIM, the binder system is one of the most important criteria in order to successfully fabricate the implants. Even though, the binder system is a temporary, but failure in the selection and removal of the binder system will affect on the final properties of the sintered parts. Therefore, the binder system based on palm oil derivative which is palm stearin had been formulated and developed to replace the conventional binder system. Results: The rheological studies of the mixture between the powder and binders system had been determined properly in order to be successful during injection into injection molding machine. After molding, the binder held the particles in place. The binder system had to be removed completely through debinding step. During debinding step, solvent debinding and thermal pyrolysis had been used to remove completely of the binder system. The debound part was then sintered to give the required physical and mechanical properties. The in vitro biocompatibility also was tested using Neutral Red (NR and mouse fibroblast cell lines L-929 for the direct contact assay. Conclusion: The results showed that the properties of the final sintered parts fulfill the Standard Metal Powder Industries Federation (MPIF 35 for PIM parts except for tensile strength and elongation due to the formation of titanium carbide. The in vitro biocompatibility on the extraction using mouse fibroblast cell line L-929 by means of NR assays showed non toxic for the sintered specimen titanium alloy parts.

  17. Ultra-light Hierarchical Graphene Electrode for Binder-Free Supercapacitors and Lithium-Ion Battery Anodes. (United States)

    Zuo, Zicheng; Kim, Tae Young; Kholmanov, Iskandar; Li, Huifeng; Chou, Harry; Li, Yuliang


    A mild and environmental-friendly method is developed for fabricating a 3D interconnected graphene electrode with large-scale continuity. Such material has interlayer pores between reduced graphene oxide nanosheets and in-plane pores. Hence, a specific surface area up to 835 m(2) g(-1) and a high powder conductivity up to 400 S m(-1) are achieved. For electrochemical applications, the interlayer pores can serve as "ion-buffering reservoirs" while in-plane ones act as "channels" for shortening the mass cross-plane diffusion length, reducing the ion response time, and prevent the interlayer restacking. As binder-free supercapacitor electrode, it delivers a specific capacitance up to 169 F g(-1) with surface-normalized capacitance close to 21 μF cm(-2) (intrinsic capacitance) and power density up to 7.5 kW kg(-1), in 6 m KOH aqueous electrolyte. In the case of lithium-ion battery anode, it shows remarkable advantages in terms of the initiate reversible Coulombic efficiency (61.3%), high specific capacity (932 mAh g(-1) at 100 mA g(-1)), and robust long-term retention (93.5% after 600 cycles at 2000 mAh g(-1)). © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Randomized Clinical Trial on the postoperative use of an abdominal binder after laparoscopic umbilical and epigastric hernia repair

    DEFF Research Database (Denmark)

    Christoffersen, Mette; Olsen, B H; Rosenberg, J;


    -reducing effect of an abdominal binder in patients undergoing laparoscopic umbilical or epigastric hernia repair. METHODS: Based on power analysis, a minimum of 54 patients undergoing laparoscopic umbilical and epigastric hernia repair were to be included. Patients were randomized to abdominal binders vs......PURPOSE: Application of an abdominal binder is often part of a standard postoperative regimen after ventral hernia repair to reduce pain and seroma formation. However, there is lack of evidence of the clinical effects. The aim of the present study was to investigate the pain- and seroma...

  19. Emission of organic compounds from mould and core binders used for casting iron, aluminium and bronze in sand moulds

    DEFF Research Database (Denmark)

    Tiedje, Niels Skat; Crepaz, Rudolf; Eggert, Torben;


    of binders was monitored when cast iron, bronze and aluminium was poured in the moulds. Binder degradation was measured by collecting off gasses in a specially designed ventilation hood at a constant flow rate. Samples were taken from the ventilation system and analysed for hydrocarbons and CO content...... compositions were tested. A test method that provides uniform test conditions is described. The method can be used as general test method to analyse off gasses from binders. Moulds containing a standard size casting were produced and the amount and type of organic compounds resulting from thermal degradation...

  20. Stainless steel mesh supported nitrogen-doped carbon nanofibers for binder-free cathode in microbial fuel cells. (United States)

    Chen, Shuiliang; Chen, Yu; He, Guanghua; He, Shuijian; Schröder, Uwe; Hou, Haoqing


    In this communication, we report a binder-free oxygen reduction cathode for microbial fuel cells. The binder-free cathode is prepared by growth of nitrogen-doped carbon nanofibers (NCNFs) on stainless steel mesh (SSM) via simple pyrolysis of pyridine. The interaction force between NCNFs and SSM surface is very strong which is able to tolerate water flush. The NCNFs/SSM cathode shows high and stable electrocatalytic activity for oxygen reduction reaction, which is comparable to that of Pt/SSM and ferricyanide cathode. This study proposes a promising low-cost binder-free cathode for microbial fuel cells.

  1. Glyoxalated polyacrylamide as a covalently attachable and rapidly cross-linkable binder for Si electrode in lithium ion batteries (United States)

    Yoo, Jung-Keun; Jeon, Jaebeom; Kang, Kisuk; Jung, Yeon Sik


    Recently, investigation of Si-based anode materials for rechargeable battery applications garnered much interest due to its exceptionally high capacity. High-capacity Si anode ( 4,200 mAhg-1) is highly desirable for the replacement of conventional graphite anode (acidity of the slurry and has a profound effect on the cell performance using Si anode. The enhanced cycle performance of Si nanoparticles obtained by treating the binder at pH 4 can be explained by its strong interaction between the binder and Si surface and current collector, and also rigidity of binder by cross-linking.

  2. Method for the Accelerated Testing of the Durability of a Construction Binder using the Arrhenius Approach (United States)

    Fridrichová, Marcela; Dvořák, Karel; Gazdič, Dominik


    The single most reliable indicator of a material's durability is its performance in long-term tests, which cannot always be carried out due to a limited time budget. The second option is to perform some kind of accelerated durability tests. The aim of the work described in this article was to develop a method for the accelerated durability testing of binders. It was decided that the Arrhenius equation approach and the theory of chemical reaction kinetics would be applied in this case. The degradation process has been simplified to a single quantifiable parameter, which became compressive strength. A model hydraulic binder based on fluidised bed combustion ash (FBC ash) was chosen as the test subject for the development of the method. The model binder and its hydration products were tested by high-temperature X-ray diffraction analysis. The main hydration product of this binder was ettringite. Due to the thermodynamic instability of this mineral, it was possible to verify the proposed method via long term testing. In order to accelerate the chemical reactions in the binder, four combinations of two temperatures (65 and 85°C) and two different relative humidities (14 and 100%) were used. The upper temperature limit was chosen because of the results of the high-temperature x-ray testing of the ettringite's decomposition. The calculation formulae for the accelerated durability tests were derived on the basis of data regarding the decrease in compressive strength under the conditions imposed by the four above-mentioned combinations. The mineralogical composition of the binder after degradation was also described. The final degradation product was gypsum under dry conditions and monosulphate under wet conditions. The validity of the method and formula was subsequently verified by means of long-term testing. A very good correspondence between the calculated and real values was achieved. The deviation of these values did not exceed 5 %. The designed and verified method

  3. Investigation of carbonate rocks appropriate for the production of natural hydraulic lime binders (United States)

    Triantafyllou, George; Panagopoulos, George; Manoutsoglou, Emmanouil; Christidis, George; Přikryl, Richard


    Cement industry is facing growing challenges in conserving materials and conforming to the demanding environmental standards. Therefore, there is great interest in the development, investigation and use of binders alternatives to Portland cement. Natural hydraulic lime (NHL) binders have become nowadays materials with high added value, due to their advantages in various construction applications. Some of them include compatibility, suitability, workability and the versatility in applications. NHL binders are made from limestones which contain sufficient argillaceous or siliceous components fired at relatively low temperatures, with reduction to powder by slaking with or without grinding. This study is focused in developing technology for small-scale production of cementitious binders, combining the knowledge and experience of geologists and mineral resources engineers. The first step of investigation includes field techniques to the study the lithology, texture and sedimentary structure of Neogene carbonate sediments, from various basins of Crete Island, Greece and the construction of 3D geological models, in order to determine the deposits of each different geological formation. Sampling of appropriate quantity of raw materials is crucial for the investigation. Petrographic studies on the basis of the study of grain type, grain size, types of porosity and depositional texture, are necessary to classify effectively industrial mineral raw materials for this kind of application. Laboratory tests should also include the study of mineralogical and chemical composition of the bulk raw materials, as well as the content of insoluble limestone impurities, thus determining the amount of active clay and silica components required to produce binders of different degree of hydraulicity. Firing of the samples in various temperatures and time conditions, followed by X-ray diffraction analysis and slaking rate tests of the produced binders, is essential to insure the

  4. Comparison between Palm Oil Derivative and Commercial Thermo-Plastic Binder System on the Properties of the Stainless Steel 316L Sintered Parts (United States)

    Ibrahim, R.; Azmirruddin, M.; Wei, G. C.; Fong, L. K.; Abdullah, N. I.; Omar, K.; Muhamad, M.; Muhamad, S.


    Binder system is one of the most important criteria for the powder injection molding (PIM) process. Failure in the selection of the binder system will affect on the final properties of the sintered parts. The objectives of this studied is to develop a novel binder system based on the local natural resources and environmental friendly binder system from palm oil derivative which is easily available and cheap in our country of Malaysia. The novel binder that has been developed will be replaced the commercial thermo-plastic binder system or as an alternative binder system. The results show that the physical and mechanical properties of the final sintered parts fulfill the Metal Powder Industries Federation (MPIF) standard 35 for PIM parts. The biocompatibility test using cell osteosarcoma (MG63) and vero fibroblastic also shows that the cell was successfully growth on the sintered stainless steel 316L parts indicate that the novel binder was not toxic. Therefore, the novel binder system based on palm oil derivative that has been developed as a binder system fulfills the important criteria for the binder system in PIM process.

  5. Development of Novel Environmentally Sustainable Binders for Energetic Formulations (United States)


    Int. 2013, 96, 1372. (b) Sabnis, R. W. Handbook of Biological Dyes and Stains: Synthesis and Industrial Applications, Wiley, 2010. (c) Bieniarz, C...of benzyl alcohol from proto- debromination. The reaction outcome was found to be independent of temperature, phosphine ligand and reaction solvent ...overall sequence from ca. 20-30% to 70%. Specifically, the first improvement made was to replace the solvent of the reaction from toluene to

  6. Instrumentation for studying binder burnout in an immobilized plutonium ceramic wasteform

    Energy Technology Data Exchange (ETDEWEB)

    Mitchell, M; Pugh, D; Herman, C


    The Plutonium Immobilization Program produces a ceramic wasteform that utilizes organic binders. Several techniques and instruments were developed to study binder burnout on full size ceramic samples in a production environment. This approach provides a method for developing process parameters on production scale to optimize throughput, product quality, offgas behavior, and plant emissions. These instruments allow for offgas analysis, large-scale TGA, product quality observation, and thermal modeling. Using these tools, results from lab-scale techniques such as laser dilametry studies and traditional TGA/DTA analysis can be integrated. Often, the sintering step of a ceramification process is the limiting process step that controls the production throughput. Therefore, optimization of sintering behavior is important for overall process success. Furthermore, the capabilities of this instrumentation allows better understanding of plant emissions of key gases: volatile organic compounds (VOCs), volatile inorganics including some halide compounds, NO{sub x}, SO{sub x}, carbon dioxide, and carbon monoxide.

  7. Literature review and binder and coal selection for research studies on coal agglomeration

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, S.G.; Kuby, O.A.; Girimont, J.A.; peterson, C.A.; Saller, E.


    This report discusses the results of a literature survey on coal agglomeration and the approaches that were employed in selecting binders and coals to be studied in a process development program currently being performed for the Department of Energy. The survey is the first step toward the development of a useful process for the agglomeration of coal fines for use in a fixed-bed gasifier. Literature was found and reviewed on the effects of coal composition and physical properties, on agglomeration techniques and operating variables, on binders or additives to promote agglomeration, on pretreatment techniques on agglomerate feedstocks and post-treatment techniques on formed agglomerates, and on test results obtained by researchers in the past using various additives, treatments and agglomeration techniques. Much of this information did not deal directly with agglomerates for fixed-bed gasifiers, but the reported observations and results could be extrapolated to give useful guidelines for research plans. Conclusions and plans for further work are presented.

  8. Abdominal binders may reduce pain and improve physical function after major abdominal surgery - a systematic review

    DEFF Research Database (Denmark)

    Rothman, Josephine Philip; Gunnarsson, Ulf; Bisgaard, Thue


    INTRODUCTION: Evidence for the effect of post-operative abdominal binders on post-operative pain, seroma formation, physical function, pulmonary function and increased intra-abdominal pressure among patients after surgery remains largely un-investigated. METHODS: A systematic review was conducted....... The PubMed, EMBASE and Cochrane databases were searched for studies on the use of abdominal binders after abdominal surgery or abdominoplasty. All types of clinical studies were included. Two independent assessors evaluated the scientific quality of the studies. The primary outcomes were pain, seroma...... to reduce seroma formation after laparoscopic ventral herniotomy and a non-significant reduction in pain. Physical function was improved, whereas evidence supports a beneficial effect on psychological distress after open abdominal surgery. Evidence also supports that intra-abdominal pressure increases...

  9. Enabling aqueous binders for lithium battery cathodes - Carbon coating of aluminum current collector (United States)

    Doberdò, Italo; Löffler, Nicholas; Laszczynski, Nina; Cericola, Dario; Penazzi, Nerino; Bodoardo, Silvia; Kim, Guk-Tae; Passerini, Stefano


    In this manuscript a novel approach to enable aqueous binders for lithium ion battery (LIB) cathodes is reported. Producing LiNi1/3Mn1/3Co1/3O2 (NMC) electrodes using sodium-carboxymethylcellulose (CMC) as a binder and water as a solvent, in fact, results in serious aluminum corrosion during electrode manufacturing due to the high pH of the slurry. In order to prevent the direct contact of the corrosive slurry with aluminum foil, the latter is first coated with a thin carbon layer. The CMC-based electrodes formed on carbon coated aluminum foil show enhanced performance than those made using unprotected aluminum instead. In particular, electrodes using protected aluminum foil are able to deliver a capacity of 126 mAh g-1 at 1C rate, which is rather close to that delivered by polyvinylidene-di-fluoride (PVdF)-based electrode having the same composition.

  10. LiFePO 4 water-soluble binder electrode for Li-ion batteries (United States)

    Guerfi, A.; Kaneko, M.; Petitclerc, M.; Mori, M.; Zaghib, K.

    A new water-soluble elastomer from ZEON Corp. was evaluated as binder with LiFePO 4 cathode material in Li-ion batteries. The mechanical characteristic of this cathode was compared to that with PVdF-based cathode binder. The elastomer-based cathode shows high flexibility with good adhesion. The electrochemical performance was also evaluated and compared to PVdF-based cathodes at 25 and at 60 °C. A lower irreversible capacity loss was obtained with the elastomer-based cathode, however, aging at 60 °C shows a comparable cycle life to that observed with PVdF-based cathodes. The LiFePO 4-WSB at high rate shows a good performance with 120 mAh g -1 at 10 C rate at 60 °C.

  11. LiFePO{sub 4} water-soluble binder electrode for Li-ion batteries

    Energy Technology Data Exchange (ETDEWEB)

    Guerfi, A.; Petitclerc, M.; Zaghib, K. [Institut de Recherche d' Hydro-Quebec, 1800 Lionel-Boulet, Varennes, Que. J3X 1S1 (Canada); Kaneko, M.; Mori, M. [ZEON Corporation, R and D Center, 1-2-1 Yako, Kawasaki, Kanagawa 210-9507 (Japan)


    A new water-soluble elastomer from ZEON Corp. was evaluated as binder with LiFePO{sub 4} cathode material in Li-ion batteries. The mechanical characteristic of this cathode was compared to that with PVdF-based cathode binder. The elastomer-based cathode shows high flexibility with good adhesion. The electrochemical performance was also evaluated and compared to PVdF-based cathodes at 25 and at 60{sup o}C. A lower irreversible capacity loss was obtained with the elastomer-based cathode, however, aging at 60{sup o}C shows a comparable cycle life to that observed with PVdF-based cathodes. The LiFePO{sub 4}-WSB at high rate shows a good performance with 120mAhg{sup -1} at 10C rate at 60{sup o}C. (author)

  12. Complexity of chromatin folding is captured by the strings and binders switch model. (United States)

    Barbieri, Mariano; Chotalia, Mita; Fraser, James; Lavitas, Liron-Mark; Dostie, Josée; Pombo, Ana; Nicodemi, Mario


    Chromatin has a complex spatial organization in the cell nucleus that serves vital functional purposes. A variety of chromatin folding conformations has been detected by single-cell imaging and chromosome conformation capture-based approaches. However, a unified quantitative framework describing spatial chromatin organization is still lacking. Here, we explore the "strings and binders switch" model to explain the origin and variety of chromatin behaviors that coexist and dynamically change within living cells. This simple polymer model recapitulates the scaling properties of chromatin folding reported experimentally in different cellular systems, the fractal state of chromatin, the processes of domain formation, and looping out. Additionally, the strings and binders switch model reproduces the recently proposed "fractal-globule" model, but only as one of many possible transient conformations.

  13. Binder-Jet Printing of Fine Stainless Steel Powder with Varied Final Density (United States)

    Ziaee, Mohsen; Tridas, Eric M.; Crane, Nathan B.


    Binder jetting is an additive manufacturing process that produces weak porous parts that are strengthened through sintering and/or infiltration. This article reports on two different methods of preparing fine 316 stainless steel powder and their impact on the final sintered density and dimensions relative to direct printing into space holder to increase porosity. Sintered density and sintering shrinkage of agglomerate material are shown to vary with the density of the spread powder bed. Nevertheless, with added nylon, the shrinkage correlates with the shrinkage of the base steel powder, whereas the density depends on the quantity of the nylon. Thus, it is possible to create varied sintered density with compatible shrinkage levels—a key step toward creating binder-jetting systems with spatially controlled porosity.

  14. Critical roles of binders and formulation at multiscales of silicon-based composite electrodes (United States)

    Mazouzi, D.; Karkar, Z.; Reale Hernandez, C.; Jimenez Manero, P.; Guyomard, D.; Roué, L.; Lestriez, B.


    In this review we try to shed a comprehensive understanding on the influence of the different parameters of the formulation of silicon-based composite electrode on its cyclability, i.e. the binder, the conductive additives, the current collector, the electrode porosity and solid loading, in view of a more rational assessment of the relevancy of these parameters for the battery technology. The reasons of the better efficiency of carboxymethyl cellulose and alternative new binders than PVdF are first addressed into details. The critical effects of the active mass loading and porosity on the cyclability are highlighted. Then the influence of the conductive additive type and current collector texture are discussed. Putting everything together shows that it is required to meticulously optimize all the different scales of the composite electrode to hopefully raise the performance of silicon-based electrode above that of graphite commercial ones.

  15. The Influence of Benzoyl Peroxide on Gelation Rate of Silica Binder for Precision Casting

    Directory of Open Access Journals (Sweden)

    M. Nadolski


    Full Text Available Substituting of ethyl silicate with ecologic sols of colloidal silica in the investment casting technology, resulting from the increased demands concerning environmental protection, caused the prolongation of production cycle for precision castings produced in multi-layer thin-walled ceramic shell moulds. Modification of Sizol 030 binder with benzoyl peroxide, proposed in the paper, was aimed at restriction of time needed for realization of a single layer of the shell mould, and by the same, of such a mould as a whole. Examination of kinetics of the drying process were held for the layers made of prepared moulding material and the influence of binder modification on the mould curing time was determined.

  16. Influence of surface modified nano silica on alkyd binder before and after accelerated weathering

    DEFF Research Database (Denmark)

    Nikolic, Miroslav; Nguyen, Hiep Dinh; Daugaard, Anders Egede


    Introduction of nano fillers in exterior wood coatings is not straight forward. Influence on aging of polymer binder needs to be taken into account along with possible benefits that nano fillers can provide immediately after application. This study shows the influence of two differently modified...... hydrophobic nano silica on an alkyd binder for exterior wood coatings. One month after application, the highest strength and energy required to break the films was obtained with addition of 3% disilazane modified silica. Changes in tensile properties were accompanied with a small increase in glass transition...... temperature. However, the highest stability upon accelerated weathering, measured by ATR-IR and DMA, was for nano composites with the highest amount of nano filler. The reasons for the observed changes are discussed together with the appearance of a feature that is possibly a secondary relaxation of alkyd...

  17. The Influence of Benzoyl Peroxide on Gelation Rate of Silica Binder for Precision Casting

    Directory of Open Access Journals (Sweden)

    Nadolski M.


    Full Text Available Substituting of ethyl silicate with ecologic sols of colloidal silica in the investment casting technology, resulting from the increased demands concerning environmental protection, caused the prolongation of production cycle for precision castings produced in multi-layer thin-walled ceramic shell moulds. Modification of Sizol 030 binder with benzoyl peroxide, proposed in the paper, was aimed at restriction of time needed for realization of a single layer of the shell mould, and by the same, of such a mould as a whole. Examination of kinetics of the drying process were held for the layers made of prepared moulding material and the influence of binder modification on the mould curing time was determined.

  18. Studies on Some Nitramine based Low Vulnerability Ammunition Propellants with Cellulose Acetate as a Binder

    Directory of Open Access Journals (Sweden)

    A.G.A. Pillai


    Full Text Available Several formulations of propellants based on RDX as an energetic solid ingredients and cellulose acetate (CA as a binder were processed using either dioctyl pthalate(DOP or tracetin(TA as plastisizer and a small amount of nitrocellulose(NC. The Performance of these propellants was evaluated on the basis of closed vessel firing data. The vulnerability aspects of these formulations were compared with those of conventional picrite propellant, NQ on the basis of their ignition temperatures and sensitivity to friction and impact. Triacetin was found to be better plasticizer than DOP for CA binder. Some RDX/CA/TA/NC/-based propellants were found to have energy levels comparable with NQ propellant and had less sensitivity to heat, impact and friction, and therefore have the potential for being used as low-vulnerability ammunition propellants for gun applications.

  19. Prediction of crosslink density of solid propellant binders. [curing of elastomers (United States)

    Marsh, H. E., Jr.


    A quantitative theory is outlined which allows calculation of crosslink density of solid propellant binders from a small number of predetermined parameters such as the binder composition, the functionality distributions of the ingredients, and the extent of the curing reaction. The parameter which is partly dependent on process conditions is the extent of reaction. The proposed theoretical model is verified by independent measurement of effective chain concentration and sol and gel fractions in simple compositions prepared from model compounds. The model is shown to correlate tensile data with composition in the case of urethane-cured polyether and certain solid propellants. A formula for the branching coefficient is provided according to which if one knows the functionality distributions of the ingredients and the corresponding equivalent weights and can measure or predict the extent of reaction, he can calculate the branching coefficient of such a system for any desired composition.

  20. Distribution of binder in granules produced by means of twin screw granulation. (United States)

    Fonteyne, Margot; Fussell, Andrew Luke; Vercruysse, Jurgen; Vervaet, Chris; Remon, Jean Paul; Strachan, Clare; Rades, Thomas; De Beer, Thomas


    According to the quality by design principle processes may not remain black-boxes and full process understanding is required. The granule size distribution of granules produced via twin screw granulation is often found to be bimodal. The aim of this study was to gain a better understanding of binder distribution within granules produced via twin screw granulation in order to investigate if an inhomogeneous spread of binder is causing this bimodal size distribution. Theophylline-lactose-polyvinylpyrrolidone K30 (PVP) (30-67.5-2.5%, w/w) was used as a model formulation. The intra-granular distribution of PVP was evaluated by means of hyperspectral coherent anti-Stokes Raman scattering (CARS) microscopy. For the evaluated formulation, no PVP rich zones were detected when applying a lateral spatial resolution of 0.5 μm, indicating that PVP is homogenously distributed within the granules.

  1. Concrete containing ternary blended binders: Resistance to chloride ingress and carbonation

    Energy Technology Data Exchange (ETDEWEB)

    Jones, M.R.; Dhir, R.K.; Magee, B.J. [Univ. of Dundee (United Kingdom). Dept. of Civil Engineering


    This study examined the chloride and carbonation durability performance of concrete containing ternary blended binders in comparison to PC and binary PC/PFA concrete of equivalent standard 28 day cube strengths of 20, 40 and 60 N/mm{sup 2}. In addition, the nature of the near surface pore structure of the concrete has been inferred from its initial surface absorption. It has been shown that the chloride resistance of all the ternary binder concrete (TBC) is significantly higher than corresponding PC and PC/PFA mixes. On the other hand, however, under worst case conditions it was found that after 30 weeks accelerated exposure, carbonation depths were generally greater in the TBC mixes. The degree to which this occurred was found to relate to the amount of PC replaced.

  2. Investigations of the Quality of The Reclaim of Spent Moulding Sands with Organic Binders

    Directory of Open Access Journals (Sweden)

    Dańko R.


    Full Text Available Modern investigation methods and equipment for the quality estimation of the moulding sands matrices with organic binders, in their circulation process, are presented in the paper. These methods, utilising the special equipment combined with the authors investigation methods developed in the Faculty of Foundry Engineering, AGH the University of Science and Technology, allow for the better estimation of the matrix quality. Moulding sands systems with organic binders require an in-depth approach to factors deciding on the matrix technological suitability as well as on their environmental impact. Into modern methods allowing for the better assessment of the matrix quality belongs the grain size analysis of the reclaimed material performed by means of the laser diffraction and also the estimation of the moulding sand gas evolution rate and identification of the emitted gases and their BTEX group gases content, since they are specially hazardous from the point of view of the Occupational Safety and Health.

  3. A mathematical model for mechanically-induced deterioration of the binder in lithium-ion electrodes

    CERN Document Server

    Foster, Jamie M; Richardson, Giles; Protas, Bartosz


    This study is concerned with modeling detrimental deformations of the binder phase within lithium-ion batteries that occur during cell assembly and usage. A two-dimensional poroviscoelastic model for the mechanical behavior of porous electrodes is formulated and posed on a geometry corresponding to a thin rectangular electrode, with a regular square array of microscopic circular electrode particles, stuck to a rigid base formed by the current collector. Deformation is forced both by (i) electrolyte absorption driven binder swelling, and; (ii) cyclic growth and shrinkage of electrode particles as the battery is charged and discharged. The governing equations are upscaled in order to obtain macroscopic effective-medium equations. A solution to these equations is obtained, in the asymptotic limit that the height of the rectangular electrode is much smaller than its width, that shows the macroscopic deformation is one-dimensional. The confinement of macroscopic deformations to one dimension is used to obtain boun...

  4. Liquid crystalline graphene oxide/PEDOT:PSS self-assembled 3D architecture for binder-free supercapacitor electrodes

    Directory of Open Access Journals (Sweden)

    Monirul eIslam


    Full Text Available Binder-free self-assembled 3D architecture electrodes have been fabricated by a novel convienient method. Liquid crystalline graphene oxide (LC GO was used as precursor to interact with poly(3,4-ethylene-dioxythiophene:poly(styrenesulfonate (PEDOT:PSS in dispersion in order to form a conductive polymer entrapped, self-assembled layer-by-layer structure. This advanced network containing PEDOT:PSS enabled us to ascribe the superior electrochemical properties of particular graphene sheets. This layer-by-layer self-assembled 3D architecture of best performing composite (rGO-PEDOT:PSS 25 showed excellent electrochemical performance of 434 F g-1 through chemical treatment. To highlight these advances, we further explored the practicality of the as-prepared electrode by varying the composite material content. An asymmetric supercapacitor device using aqueous electrolyte was also studied of this same composite. The resulting performance from this set up included a specific capacitance of 132 F g-1. Above all, we observed an increase in specific capacitance (19% with increase in cycle life emphasizing the excellent stability of this device.

  5. The use of bentonite and zeolite as caesium-binders in feed to reindeer - experiences from Sweden

    Directory of Open Access Journals (Sweden)

    Birgitta Åhman


    Full Text Available Feeding is used in Sweden to lower radiocaesium levels in reindeer before slaughter. In feeds used for this purpose, bentonite is added as a caesium-binder to prevent absorption of radiocaesium, since the animals usually have som access to contaminated pasture in their corrals. Bentonite is efficient as a caesium-binder but increases water consumption and excretion of urine. Zeolite has been used as a caesium-binder to reindeer in a few experiments. The effect, however, has been inferior to that of bentonite. It seems that zeolite, mixed in feeds, loose some of its effect as the feed is stored. The need of a caesium-binder is demonstrated by results from practical feeding of reindeer where radiocaesium levels have not decreased as expected when feed without bentonite has been used.

  6. Factors associated with serum fetuin-A concentrations after long-term use of different phosphate binders in hemodialysis patients

    National Research Council Canada - National Science Library

    Lin, Hsin-Hung; Liou, Hung-Hsiang; Wu, Ming-Shiou; Huang, Chiu-Ching


    Fetuin-A is known as a circulating inhibitor of vascular calcification. Factors associated with serum fetuin-A concentrations after long-term use of different phosphate binders in hemodialysis patients is still uncertain...

  7. Lanthanum carbonate vs conventional phosphate binders for the treatment of hyperphosphatemia in maintenance hemodialysis patients: a meta-analysis

    Institute of Scientific and Technical Information of China (English)



    Objective To assess the effect and safety of lanthanum carbonate vs conventional phosphate binders for hyperphosphatemia in patients undergoing maintenance hemodialysis.Methods According to the collaborative search strategy,MEDLINE (1996 to 2012.12) ,EBCO

  8. Experimental and modeling study of fluidized bed granulation: Effect of binder flow rate and fluidizing air velocity

    Directory of Open Access Journals (Sweden)

    U. Vengateson


    Full Text Available Fluidized bed granulation is a widely used technique of producing granules in pharmaceutical, food, detergent, and fertilizer industries. In this study, fluidized bed granulation of two powders – wheat flour and rice powder – with water as binder is studied experimentally and by modeling. The effects of two process parameters – binder flow rate, fluidizing air velocity – are determined. Experimental results show that increasing the binder flow rate favors the formation of bigger granules while increasing fluidizing air velocity leads to a decrease in average granule diameter. Population balance model with suitable form of coalescence kernel (β has been used to describe the granule growth. Later, this kernel is linked with process parameters – binder flow rate and fluidizing air velocity.

  9. Technological and ecological studies of moulding sands with new inorganic binders for casting of non-ferrous metal alloys

    Directory of Open Access Journals (Sweden)

    I. Izdebska-Szanda


    Full Text Available The article presents the results of studies which form a part of broader research programme executed under the project POIG.01.01.02-00-015/09 "Advanced materials and technologies".In a concise manner, the results of studies on the effect of chemical modification of inorganic binders on the technological properties ofmoulding sands containing these binders were presented.Special attention was paid to the effect of modification of inorganic binders on their thermal destruction behaviour in the range of pouringtemperatures of the non-ferrous metals and their alloys.Also the results of comparative studies of the thermal emission of toxic gases and odours from moulding sands with new inorganic andorganic binders were discussed.

  10. Fibroblast Growth Factor 23 in Hemodialysis Patients: Effects of Phosphate Binder, Calcitriol and Calcium Concentration in the Dialysate

    National Research Council Canada - National Science Library

    Cancela, Ana L.E; Oliveira, Rodrigo B; Graciolli, Fabiana G; dos Reis, Luciene M; Barreto, Fellype; Barreto, Daniela V; Cuppari, Lilian; Jorgetti, Vanda; Carvalho, Aluizio B; Canziani, Maria Eugênia; Moysés, Rosa M.A

    ...: In this post-hoc analysis of a randomized clinical trial, phosphate binders and calcitriol were washed out of 72 hemodialysis patients who were then submitted to bone biopsy, coronary tomography...

  11. Black curves and creep behaviour of crumb rubber modified binders containing warm mix asphalt additives (United States)

    Gallego, Juan; Rodríguez-Alloza, Ana María; Giuliani, Felice


    Warm mix asphalt (WMA) is a new research topic in the field of road pavement materials. This technology allows lower energy consumption and greenhouse gas (GHG) emissions by reducing compaction and placement temperatures of the asphalt mixtures. However, this technology is still under study, and the influence of the WMA additives has yet to be investigated thoroughly and clearly identified, especially in the case of crumb rubber modified (CRM) binders.

  12. The Influence of Polymer Binders on the Performance of Cathodes for Lithium-Ion Batteries


    Barsykov, V; V. Khomenko


    A systematic electrochemical investigation is performed to study the effect of polyvinylidene difluoride (PVDF) based polymer binders on the performance of different cathodes for lithium-ion batteries in ionic liquid (IL) based electrolytes. Electrochemical tests indicate that the nature of PVDF effects significantly on cathode stability in IL based electrolytes. The copolymer such as hexafluoropropylene (HFP) plays a significant role in the interfacial resistance. Application of PVDF-HFP bi...

  13. Binder model system to be used for determination of prepolymer functionality (United States)

    Martinelli, F. J.; Hodgkin, J. H.


    Development of a method for determining the functionality distribution of prepolymers used for rocket binders is discussed. Research has been concerned with accurately determining the gel point of a model polyester system containing a single trifunctional crosslinker, and the application of these methods to more complicated model systems containing a second trifunctional crosslinker, monofunctional ingredients, or a higher functionality crosslinker. Correlations of observed with theoretical gel points for these systems would allow the methods to be applied directly to prepolymers.

  14. A comparative study of phosphate binders in patients with end stage kidney disease undergoing hemodialysis. (United States)

    Prajapati, Viken A; Galani, Varsha J; Shah, Pankaj R


    In the present study, a comparative evaluation of the effects of calcium acetate, calcium carbonate, sevelamer hydrochloride and lanthanum carbonate was carried out in 120 patients with end stage kidney disease (ESKD) undergoing hemodialysis. Biochemical parameters, like serum phosphorous, serum calcium and serum alkaline phosphatase level and intact parathyroid hormone level, were measured. A statistically significant reduction in serum phosphorous, serum calcium, calcium × phosphorous and serum alkaline phosphatase level were observed with all phosphate binders during 3 months of treatment. Reduction in serum phosphorous were observed with calcium acetate (1.5 mg/dL), calcium carbonate (1.3 mg/dL), sevelamer hydrochloride (2.1 mg/dL) and lanthanum carbonate (1.79 mg/dL). The reduction of serum alkaline phosphatase was observed more commonly with sevelamer (107.37 IU/L) and lanthanum (104.33 IU/L) treatments than with calcium acetate (93.9 IU/L) and calcium carbonate (86.57 IU/L). There was no statistically significant change in serum calcium observed with sevelamer and lanthanum treatments, while calcium-based phosphate binders caused a significant rise in the serum calcium level. Serum intact parathyroid hormone level was significantly reduced with all phosphate binder treatments. This decline was highest with sevelamer and lowest with calcium carbonate. All treatments were well tolerated and safety profiles were consistent with previous reports in hemodialysis patients. It is concluded that all phosphate binders are safe and effective for the treatment of hyperphosphatemia in patients with ESKD undergoing hemodialysis. However, sevelamer hydrochloride seems to be superior among all with lowering incidence of hypercalcemia.

  15. Structural change of the porous sulfur cathode using gelatin as a binder during discharge and charge

    Energy Technology Data Exchange (ETDEWEB)

    Wang You [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China); Huang Yaqin [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China)], E-mail:; Wang Weikun [Military Power Sources Research and Development Center, Chemical Defense Institute, 35 Huayuan North Road, Beijing 100083 (China); Huang Chongjun [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China); Yu Zhongbao; Zhang, Hao [Military Power Sources Research and Development Center, Chemical Defense Institute, 35 Huayuan North Road, Beijing 100083 (China); Sun Jing [Department of Material Science and Engineering, Beijing University of Chemical Technology, 15 BeiSanhuan East Road, Beijing 100029 (China); Wang Anbang; Yuan Keguo [Military Power Sources Research and Development Center, Chemical Defense Institute, 35 Huayuan North Road, Beijing 100083 (China)


    The structural change of the porous sulfur cathode using gelatin as a binder was studied by means of scanning electron microscopy (SEM) and X-ray diffractometry (XRD). The original sulfur cathode exhibited a homogenous distribution of sulfur, carbon and pores. During the discharge process, the pores and elemental sulfur disappeared gradually. However, those changes were reversed and elemental sulfur was reformed after the charge process, which improved the electrochemical performance of lithium-sulfur batteries.

  16. Low-CO2 Acid-Base Binders Made with Fly Ash (United States)

    Erdogan, S. T.


    Portland cement (PC) is the ubiquitous binding material for constructions works in urban areas. It is, however, responsible for 5-10 % of all anthropogenic CO2 emissions, nearly half of which arise from the decomposition of calcareous raw materials, and the other half from kiln fuel combustion and cement clinker grinding operations. As such, PC production contributes to global warming and climate change. Lately, efforts to develop alternative binders with lower greenhouse gas emissions have gained interest. An important class of such binders is geopolymers, typically formed by activating natural or waste materials with suitable alkaline solutions. These binders can have very low CO2 emissions from grinding of the starting materials, and some from the production of the activating chemical but the total CO2 emissions can be as low as 1/5th - 1/10th of those of PC concrete mixtures with comparable properties. Less commonly researched, acidic activating chemicals can also be used with powder materials to produce pastes that can set and harden into durable solids. One such powder is fly ash from coal-burning power plants. This ash is mostly stockpiled and can be an environmental hazard such as exacerbating air pollution in cities. This study investigates the chemical activation of fly ashes from Turkey using solutions of acids such as orthophosphoric acid. Amorphous and crystalline reaction products are observed to form, yielding a strong binder that sets much more rapidly than PC-based mixtures or alkali-activated geopolymers. As the change in the rheological properties and mechanical properties of these pastes can be balanced by combining different ashes, as well as by adjusting solution properties, they can offer environmental, energetic, and economical advantages over conventional PC-based mixtures.

  17. Complexity of chromatin folding is captured by the strings and binders switch model


    Barbieri, Mariano; Chotalia, Mita; Fraser, James; Lavitas, Liron-Mark; Dostie, Josée; Pombo, Ana; Nicodemi, Mario


    Chromatin has a complex spatial organization in the cell nucleus that serves vital functional purposes. A variety of chromatin folding conformations has been detected by single-cell imaging and chromosome conformation capture-based approaches. However, a unified quantitative framework describing spatial chromatin organization is still lacking. Here, we explore the “strings and binders switch” model to explain the origin and variety of chromatin behaviors that coexist and dynamically change wi...

  18. Partition of biocides between water and inorganic phases of renders with organic binder

    DEFF Research Database (Denmark)

    Urbanczyk, Michal M; Bollmann, Ulla E; Bester, Kai


    , the partition of biocides between water and inorganic phases of render with organic binder was investigated. The partition constants of carbendazim, diuron, iodocarb, isoproturon, cybutryn (irgarol), octylisothiazolinone, terbutryn, and tebuconazole towards minerals typically used in renders, e.g. barite...... with render-water distribution constants of two artificially made renders showed that the distribution constants can be estimated based on partition constants of compounds for individual components of the render....

  19. Hexagonal Boron Nitride Nanosheets as High-Performance Binder-Free Fire-Resistant Wood Coatings. (United States)

    Liu, Juanjuan; Kutty, Rajendrannair Govindan; Zheng, Qingshen; Eswariah, Varrla; Sreejith, Sivaramapanicker; Liu, Zheng


    Hexagonal boron nitride (h-BN) nanosheets are synthesized through a facile shear force liquid phase exfoliation method and their use as a binder-free oxidation and fire-resistant wood coating is demonstrated. Characterized by intrinsic low thermal diffusivity and thermal effusivity, h-BN nanosheet coatings show an excellent fire resistance and oxidation resistance up to 900 °C in air.

  20. The effects of starches on mechanical properties of paracetamol tablet formulations. I. Pregelatinization of starch binders. (United States)

    Alebiowu, Gbenga; Itiola, Oludele Adelanwa


    A study has been made of the effects of pregelatinization of native sorghum and plantain starches on the mechanical properties of a paracetamol tablet formulation in comparison with corn starch BP. The mechanical properties tested, viz. tensile strength (T) and brittle fracture index (BFI) of the paracetamol tablets were affected by pregelatinization of the starch. The results suggest that pregelatinized starches may be useful as binders when a particular degree of bond strength and brittleness is desired.

  1. Behaviour of asphalt rubber mixtures with different crumb rubber and asphalt binder sources


    Fontes, Liseane P. T. L.; Pereira, Paulo A. A.; Pais, Jorge C.; Trichês, Glicério


    This study evaluates the performance in laboratory of gap graded mixture prepared with different crumb rubber types and different conventional grade asphalt binders. The asphalt rubbers were prepared via wet process (continuous blend) and their properties were measured through the current tests: (i) penetration;(ii) softening point: (iii) resilience; (iv) apparent viscosity using a Brookfield viscometer. The rheological properties for conventional asphalts were measured too, in order to evalu...

  2. Immediate release pellets with lipid binders obtained by solvent-free cold extrusion. (United States)

    Krause, Julia; Thommes, Markus; Breitkreutz, Jörg


    Lipid-based drug delivery systems have spread in their use in pharmaceutical drug development. This work focuses on the use of lipid binders as alternative non-toxic extrusion aid for pellet formulations. The preparation of immediate release pellets with solid lipid binders through a solvent-free cold extrusion/spheronisation process was investigated in this study. Various binary, ternary and quaternary mixtures of powdered lipids and the model drug sodium benzoate were investigated and compared to well-known wet extrusion binders like microcrystalline cellulose and kappa-carrageenan. The cold lipid extrusion process offers multiple advantages as it is suitable for thermal sensitive as well as for hygroscopic drugs, furthermore no drying process to evaporate the solvent is needed and the process is feasible for different extruder types. Some of the developed pellets showed favourable properties like spherical shape, narrow size distribution, a high drug load of 80% sodium benzoate and a drug release of more than 90% within 40 min. The stability of drug release, which can be problematic when using lipid excipients, was sufficient for some mixtures, as storage under elevated temperatures changed the release profiles only slightly and no formulation released less than 80% within the first 60 min. A formulation with a mixture of hard fat, glycerol distearate and glycerol trimyristate showed the best results, as pellets with a low aspect ratio, narrow size distribution and complete drug release were obtained. Using appropriate mixtures of acylglycerides it becomes possible to produce pharmaceutical pellets with immediate release characteristics by cold extrusion and subsequent spheronisation. Thus, lipids are very promising alternatives to commonly used extrusion/spheronisation binders.

  3. Studies on Some Nitramine based Low Vulnerability Ammunition Propellants with Cellulose Acetate as a Binder


    A.G.A. Pillai; C. R. Dayanandan; B. R. Gandhe; J. S. Karir


    Several formulations of propellants based on RDX as an energetic solid ingredients and cellulose acetate (CA) as a binder were processed using either dioctyl pthalate(DOP) or tracetin(TA) as plastisizer and a small amount of nitrocellulose(NC). The Performance of these propellants was evaluated on the basis of closed vessel firing data. The vulnerability aspects of these formulations were compared with those of conventional picrite propellant, NQ on the basis of their ignition temperat...

  4. Investigation of pitch-sulphur mixtures used as binder in the preparation of black ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Clausse, V.; Bastien, T.; Hoppe, S.; Mareche, J.F.; Fierro, V.; Celzard, A. [Nancy University, Nancy (France)


    Since tens of years, sulphur is a very classical additive in the composition of black ceramics because, if added in small amounts (i.e., less than 10 wt.% of the binder), it improves their mechanical properties without strongly degrading their graphitability and their conductivity. Macroscopic properties of black ceramics strongly depend on the quality of the interfaces between grains of solid filler (graphite, carbon black) and coke originating from the pyrolysis of the binder; thus, the binder should correctly wet the filler prior to the carbonisation process. Coal-tar pitch usually exhibits a high affinity for carbon grains. In the effect of the amount of sulphur on the viscosity of the molten binder and on the way the present work, it wets the solid filler was investigated. For that purpose, the penetration of mixtures of coal-tar pitch and sulphur inside a bed of carbon particles was studied as a function of temperature. The influence of the sulphur content on composition, optical texture, and transport properties of the derived black ceramics, as well as the way it was mixed with the other constituents, were also examined. It was found that the preparation of black ceramics may be achieved easily and in safe conditions, without evolution of H{sub 2}S, using pitch-sulphur mixtures first molten in a bladed mixer, and having sulphur contents within the range 10-20 wt.%. The presence of sulphur increases the coke yield but lowers the ability to graphitise, thus limiting the transport properties of the resultant black ceramic. The optimal concentration of sulphur should thus be a compromise between mechanical strength and other physical properties.

  5. The estimation of harmfulness for environment of moulding sand with biopolymer binder based on polylactide

    Directory of Open Access Journals (Sweden)

    K. Major-Gabryś


    Full Text Available The article takes into consideration technological and ecological aspects of IV generation moulding sands. Investigations concerning anapplication of biopolymer materials as binders for moulding sands are presented in the paper. These investigations are the continuation ofexaminations related to applications of various biopolymers as binding agents and to the properties of the moulding sands with biopolymerbinders. In the paper there are the researches concerning analyzing gases emitted from moulding sands during heating.

  6. Development of a rubber-modified fractionated bio-oil for use as noncrude petroleum binder in flexible pavements



    The increasing demand for petroleum-derived products coupled with decreasing world crude reserves has led to substantial increases in asphalt pricing. Society’s additional interest in energy independence and use of renewable sources of energy is also a motivation for developing and using more sustainable materials such as binders derived from noncrude petroleum sources for use in highway applications. Iowa State University has been developing noncrude petroleum binders derived from the produc...


    Directory of Open Access Journals (Sweden)

    Patil Basawaraj S.


    Full Text Available Various plant gums have been used as binders in tablet formulations. But still finding novel binder for the manufacture of tablets, in pharmaceutical industry. The Moringa oleifera gum was found its binding property. In the present study Moringa oleifera gum was employed as a binding agent in Chloroquine phosphate tablets at concentrations of 4.0, 6.0 and 8.0 % w/w, in comparison with potato starch. The properties of Moringa oleifera gum were evaluated for angle of repose, bulk density, tapped density, carr’s compressibility index and hausner’s ratio. The granules were evaluated for moisture content, angle of repose, bulk and tapped densities. The tablets were evaluated for thickness, weight variation, hardness, friability, disintegration time and dissolution profiles. Studies showed that increase in binding concentration of Moringa oleifera gum, increases the hardness, increases the disintegration time, decreases the percentage friability and decreases % cumulative release. Results obtained indicated that Moringa oleifera gum performed as good as potato starch as a binder to Chloroquine phosphate tablets.

  8. Hemp Thermal Insulation Concrete with Alternative Binders, Analysis of their Thermal and Mechanical Properties (United States)

    Sinka, M.; Sahmenko, G.; Korjakins, A.; Radina, L.; Bajare, D.


    One of the main challenges that construction industry faces today is how to address the demands for more sustainable, environmentally friendly and carbon neutral construction materials and building upkeep processes. One of the answers to these demands is lime-hemp concrete (LHC) building materials - carbon negative materials that have sufficient thermal insulation capabilities to be used as thermal insulation materials for new as well as for existing buildings. But one problem needs to be overcome before these materials can be used on a large scale - current manufacturing technology allows these materials to be used only as self-bearing thermal insulation material with large labour intensity in the manufacturing process. In order to lower the labour intensity and allow the material to be used in wider applications, a LHC block and board production is necessary, which in turn calls for the binders different from the classically used ones, as they show insufficient mechanical strength for this new use. The particular study focuses on alternative binders produced using gypsum-cement compositions ensuring they are usable in outdoor applications together with hemp shives. Physical, mechanical, thermal and water absorption properties of hemp concrete with various binders are addressed in the current study.

  9. Performance of adsorbent-embedded heat exchangers using binder-coating method

    KAUST Repository

    Li, Ang


    The performance of adsorption (AD) chillers or desalination cycles is dictated by the rates of heat and mass transfer of adsorbate in adsorbent-packed beds. Conventional granular-adsorbent, packed in fin-tube heat exchangers, suffered from poor heat transfer in heating (desorption) or cooling (adsorption) processes of the batch-operated cycles, with undesirable performance parameters such as higher footprint of plants, low coefficient of performance (COP) of AD cycles and higher capital cost of the machines. The motivation of present work is to mitigate the heat and mass "bottlenecks" of fin-tube heat exchangers by using a powdered-adsorbent cum binder coated onto the fin surfaces of exchangers. Suitable adsorbent-binder pairs have been identified for the silica gel adsorbent with pore surface areas up to 680 m2/g and pore diameters less than 6 nm. The parent silica gel remains largely unaffected despite being pulverized into fine particles of 100 μm, and yet maintaining its water uptake characteristics. The paper presents an experimental study on the selection and testing processes to achieve high efficacy of adsorbent-binder coated exchangers. The test results indicate 3.4-4.6 folds improvement in heat transfer rates over the conventional granular-packed method, resulting a faster rate of water uptake by 1.5-2 times on the suitable silica gel type. © 2015 Elsevier Ltd. All rights reserved.

  10. Influence of Binder Composition and Concrete Pore Structure on Chloride Diffusion Coefficient in Concrete

    Institute of Scientific and Technical Information of China (English)

    LI Pengping; SU Dagen; WANG Shengnian; FAN Zhihong


    The influence of binder composition and pore structure of concrete on chloride diffusion coefficient in concrete were investigated by the natural immersion test, MIP test, SEM and EDS test, respectively. The experimental results showed that the effect of binder composition on chloride diffusion coefficient was the comprehensive result of concrete pore structure and binder hydration products, and the porosity and pore size distribution were the main factors that influence the changes of diffusion coefficient. The chloride diffusion coefficient decreased with increasing the curing temperature and the relative humidity. The hydration degree were promoted by improving curing temperatures, and then the porosity of concrete decreased and the proportion of gel pore and transitional pore increased, respectively. But the water evaporation decreased with increasing the relative humidity and then decreased porosity and increased the proportion of gel pore and transitional pore. Additionally, The chloride diffusion coefficient of concrete got the lower value when the appropriate replacement of fly ash in the ranges of 10%-20%, when the double-adding fly ash and slag content was 50%. The porosity increased and the ratio of C/S in C-S-H decreased with further increasing the fly ash content, which led to increase the chloride diffusion coefficient in concrete.

  11. High-carbon fly-ash as a binder for iron ore pellets

    Energy Technology Data Exchange (ETDEWEB)

    Kawatra, S.K.; Eisele, T.C.; Ripke, S.J.; Ramirez, G.


    The goal of this project was to convert currently unusable fly-ashes into a material that can be used as a binder for iron ore. Such a binder would also be useful for other high-volume markets, including foundry sand mold binders. Previously, the investigators used fly-ash in combination with calcium hydroxide as an additive while calcium chloride was added as a hardening accelerator. However, the addition of chloride salts have a detrimental effect because chlorine causes corrosion in processing equipment. Therefore, other potential hardening accelerators were investigated during this project. During production, dried iron-ore pellets are required to have crushing strength of at least 22.2 newtons (5 pounds force) per 12.7 mm (1/2 inch) diameter pellet. The pellets are then sintered at temperatures up to 1300 C and must not exhibit a significant degree of spalling or cracking. Pellets will therefore be tested to determine whether acceptable dry crushing strengths can be achieved.

  12. Properties of concretes and wood composites using a phosphate-based binder (United States)

    Hong, Luong Thanh

    Magnesium potassium phosphate ceramics are from the family of phosphate-based cements which can be used as alternatives to Portland cements. In this study, concretes and wood composites were produced using magnesium potassium phosphate ceramic binders and supplementary materials including fly ash, sand, silica fume and sawdust. Bentonite, Delvo Stabilizer and baking soda were used as additives to increase the workability and the setting time of the fresh mixutres and decrease the density of the hardened products. The materials were then reinforced with chopped glass-fibers or textile glass-fabrics to increase their hardened properties. At 50% fly ash by total mass of the binder, the concretes had compressive strength and density of 33 MPa and 2170 kg/m3, respectively, after 90 days of simple curing. At 20% fly ash by total mass of the binder, the wood composites had compressive strength and density of 13 MPa and 1320 kg/m3, respectively, after 90 days. The flexural strengths were about 10% to 47% of the corresponding cylinder compressive strengths for these mixes. Increases in both compressive and flexural strengths for these mixes were observed with the addition of chopped glass-fibers or textile glass-fabrics.

  13. A Study of Moisture Damage in Plastomeric Polymer Modified Asphalt Binder Using Functionalized AFM Tips

    Directory of Open Access Journals (Sweden)

    Rafiqul Tarefder


    Full Text Available In this study, moisture damage in plastomeric polymer modified asphalt binder is investigated using Atomic Force Microscopy (AFM with chemically functionalized AFM tips. Four different percentages of plastomeric polymers and two antistripping agents such as Kling Beta and Lime are used to modify a base asphalt binder. Chemical functional groups such as -COOH, -CH3, -NH3, and –OH, that are commonly present in plastomeric polymer modified asphalt system, are used to functionalize the AFM tips. The force distance mode of AFM is used to measure the adhesion forces between a modified asphalt sample surface and the functionalized AFM tips. This enables the measurement of adhesion within an asphalt binder system. It is shown that the adhesion force values in dry sample changed substantially from that in wet conditioned samples. It is evident from this study that plastomeric modification does not help reduce moisture damage in asphalt. The percentage change in adhesion forces due to moisture is about 20 nN for the lime modified samples, and about 50 nN for the Kling Beta modified samples. This indicates that lime is more effective than Kling Beta for reducing moisture damage in plastomeric polymer modified asphalt.

  14. 机制盘香粘合剂研发%Development of binder for incense coil

    Institute of Scientific and Technical Information of China (English)



    The binder for incense coil was developed to support use of incense cod processing machines,and the processing machines were briefly introduced.The influence of the factors, including binder formulation,weight ratio of wood powder and adhesive and weight ratio of powder and water,were studied,as a result the optimal composition and processing parameter were obtained.The binder has been realized industrialized production.%为配合专用盘香加工机的普及使用,研发了机制盘香粘合剂.对盘香加工设备进行了简要说明,对影响盘香性能的主要因素包括粘合剂配方、木粉和粘合剂比例、干粉和水的比例等进行了分析,得到了理想的配比和工艺参数.该粘合剂已经实现工业化生产.

  15. Development of microwave absorbing materials prepared from a polymer binder including Japanese lacquer and epoxy resin (United States)

    Iwamaru, T.; Katsumata, H.; Uekusa, S.; Ooyagi, H.; Ishimura, T.; Miyakoshi, T.

    Microwave absorption composites were synthesized from a poly urushiol epoxy resin (PUE) mixed with one of microwave absorbing materials; Ni-Zn ferrite, Soot, Black lead, and carbon nano tube (CNT) to investigate their microwave absorption properties. PUE binders were specially made from Japanese lacquer and epoxy resin, where Japanese lacquer has been traditionally used for bond and paint because it has excellent beauty. Japanese lacquer solidifies with oxygen contained in air's moisture, which has difficulty in making composite, but we improved Japanese lacquer's solidification properties by use of epoxy resin. We made 10 mm thickness composite samples and cut them into toroidal shape to measure permittivity, permeability, and reflection loss in frequencies ranging from 50 Hz to 20 GHz. Electric magnetic absorber's composites synthesized from a PUE binders mixed either with Soot or CNT showed significantly higher wave absorption over -27 dB than the others at frequencies around 18 GHz, although Japanese lacquer itself doesn't affect absorption. This means Japanese lacquer can be used as binder materials for microwave absorbers.

  16. Mechanically activated fly ash as a high performance binder for civil engineering (United States)

    Rieger, D.; Kullová, L.; Čekalová, M.; Novotný, P.; Pola, M.


    This study is aimed for investigation of fly ash binder with suitable properties for civil engineering needs. The fly ash from Czech brown coal power plant Prunerov II was used and mechanically activated to achieve suitable particle size for alkaline activation of hardening process. This process is driven by dissolution of aluminosilicate content of fly ash and by subsequent development of inorganic polymeric network called geopolymer. Hardening kinetics at 25 and 30 °C were measured by strain controlled small amplitude oscillatory rheometry with strain of 0.01 % and microstructure of hardened binder was evaluated by scanning electron microscopy. Strength development of hardened binder was investigated according to compressional and flexural strength for a period of 180 days. Our investigation finds out, that mechanically activated fly ash can be comparable to metakaolin geopolymers, according to setting time and mechanical parameters even at room temperature curing. Moreover, on the bases of long time strength development, achieved compressional strength of 134.5 after 180 days is comparable to performance of high grade Portland cement concretes.

  17. Cold-Setting Inkjet Printed Titania Patterns Reinforced by Organosilicate Binder

    Directory of Open Access Journals (Sweden)

    Marcela Králová


    Full Text Available A hybrid organo-silica sol was used as a binder for reinforcing of commercial titanium dioxide nanoparticles (Evonic P25 deposited on glass substrates. The organo-silica binder was prepared by the sol-gel process and mixtures of titania nanoparticles with the binder in various ratios were deposited by materials printing technique. Patterns with both positive and negative features down to 100 µm size and variable thickness were reliably printed by Fujifilm Dimatix inkjet printer. All prepared films well adhered onto substrates, however further post-printing treatment proved to be necessary in order to improve their reactivity. The influence of UV radiation as well as of thermal sintering on the final electrochemical and photocatalytic properties was investigated. A mixture containing 63 wt % of titania delivered a balanced compromise of mechanical stability, generated photocurrent density and photocatalytic activity. Although the heat treated samples yielded generally higher photocurrent, higher photocatalytic activity towards model aqueous pollutant was observed in the case of UV cured samples because of their superhydrophilic properties. While heat sintering remains the superior processing method for inorganic substrates, UV-curing provides a sound treatment option for heat sensitive ones.

  18. Utilization of Palm Oil Fuel Ash as Binder in Lightweight Oil Palm Shell Geopolymer Concrete

    Directory of Open Access Journals (Sweden)

    Michael Yong Jing Liu


    Full Text Available Traditionally fly ash (FA has been used to replace cement as binder in the geopolymer concrete. The utilization of palm oil industrial waste materials known as palm oil fuel ash (POFA and oil palm shell (OPS that are abundantly available in South East Asia as binder and coarse aggregate in geopolymer concrete would give an added advantage in both the environmental and economic aspects. The mechanical properties of the OPS geopolymer concrete (OPSGC through the use of POFA, FA, and OPS are investigated and reported. A total of ten OPSGC mixtures were prepared with varying percentages of POFA and FA such as 0, 10, 20, 40, and 100%. The specimens prepared with two alkaline solution to binder (AK/B ratios of 0.35 and 0.55 were oven cured at 65°C for 48 hours. The experimental results showed that the highest compressive strength of 30 MPa was obtained for the mix with 20% replacement of FA by POFA and AK/B ratio of 0.55, which underwent oven curing. Further, the mix of up to 20% POFA (with AK/B ratio of 0.55 can be categorized as structural lightweight concrete. An increase of the POFA content beyond 20% decreases the mechanical properties, and hence this mix is recommended to be used.

  19. Cold-Setting Inkjet Printed Titania Patterns Reinforced by Organosilicate Binder. (United States)

    Králová, Marcela; Dzik, Petr; Kašpárek, Vít; Veselý, Michal; Cihlář, Jaroslav


    A hybrid organo-silica sol was used as a binder for reinforcing of commercial titanium dioxide nanoparticles (Evonic P25) deposited on glass substrates. The organo-silica binder was prepared by the sol-gel process and mixtures of titania nanoparticles with the binder in various ratios were deposited by materials printing technique. Patterns with both positive and negative features down to 100 µm size and variable thickness were reliably printed by Fujifilm Dimatix inkjet printer. All prepared films well adhered onto substrates, however further post-printing treatment proved to be necessary in order to improve their reactivity. The influence of UV radiation as well as of thermal sintering on the final electrochemical and photocatalytic properties was investigated. A mixture containing 63 wt % of titania delivered a balanced compromise of mechanical stability, generated photocurrent density and photocatalytic activity. Although the heat treated samples yielded generally higher photocurrent, higher photocatalytic activity towards model aqueous pollutant was observed in the case of UV cured samples because of their superhydrophilic properties. While heat sintering remains the superior processing method for inorganic substrates, UV-curing provides a sound treatment option for heat sensitive ones.

  20. Glass binder development for a glass-bonded sodalite ceramic waste form

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Brian J.; Vienna, John D.; Frank, Steven M.; Kroll, Jared O.; Peterson, Jacob A.; Canfield, Nathan L.; Zhu, Zihua; Zhang, Jiandong; Kruska, Karen; Schreiber, Daniel K.; Crum, Jarrod V.


    This paper discusses work to develop Na2O-B2O3-SiO2 glass binders for immobilizing LiCl-KCl eutectic salt waste in a glass-bonded sodalite waste form following electrochemical reprocessing of used metallic nuclear fuel. Here, five new glasses with high Na2O contents were designed to generate waste forms having higher sodalite contents and fewer stress fractures. The structural, mechanical, and thermal properties of the new glasses were measured using variety of analytical techniques. The glasses were then used to produce ceramic waste forms with surrogate salt waste. The materials made using the glasses developed during this study were formulated to generate more sodalite than materials made with previous baseline glasses used. The coefficients of thermal expansion for the glass phase in the glass-bonded sodalite waste forms made with the new binder glasses were closer to the sodalite phase in the critical temperature region near and below the glass transition temperature. These improvements should result in lower probability of cracking in the full-scale monolithic ceramic waste form, leading to better long-term chemical durability. Additionally, a model generated during this study for predicting softening temperature of silicate binder glasses is presented.

  1. Evolution of the microstructure of unmodified and polymer modified asphalt binders with aging in an accelerated weathering tester. (United States)

    Menapace, Ilaria; Masad, Eyad


    This paper presents findings on the evolution of the surface microstructure of two asphalt binders, one unmodified and one polymer modified, directly exposed to aging agents with increasing durations. The aging is performed using an accelerated weathering tester, where ultraviolet radiation, oxygen and an increased temperature are applied to the asphalt binder surface. Ultraviolet and dark cycles, which simulated the succession of day and night, alternated during the aging process, and also the temperature varied, which corresponded to typical summer day and night temperatures registered in the state of Qatar. Direct aging of an exposed binder surface is more effective in showing microstructural modifications than previously applied protocols, which involved the heat treatment of binders previously aged with standardized methods. With the new protocol, any molecular rearrangements in the binder surface after aging induced by the heat treatment is prevented. Optical photos show the rippling and degradation of the binder surface due to aging. Microstructure images obtained by means of atomic force microscopy show gradual alteration of the surface due to aging. The original relatively flat microstructure was substituted with a profoundly different microstructure, which significantly protrudes from the surface, and is characterized by various shapes, such as rods, round structures and finally 'flower' or 'leaf' structures.

  2. Effect of treatment temperature on the microstructure of asphalt binders: insights on the development of dispersed domains. (United States)

    Menapace, I; Masad, E; Bhasin, A


    This paper offers important insights on the development of the microstructure in asphalt binders as a function of the treatment temperature. Different treatment temperatures are useful to understand how dispersed domains form when different driving energies for the mobility of molecular species are provided. Small and flat dispersed domains, with average diameter between 0.02 and 0.70 μm, were detected on the surface of two binders at room temperature, and these domains were observed to grow with an increase in treatment temperature (up to over 2 μm). Bee-like structures started to appear after treatment at or above 100°C. Moreover, the effect of the binder thickness on its microstructure at room temperature and at higher treatment temperatures was investigated and is discussed in this paper. At room temperature, the average size of the dispersed domains increased as the binder thickness decreased. A hypothesis that conciliates current theories on the origin and development of dispersed domains is proposed. Small dispersed domains (average diameter around 0.02 μm) are present in the bulk of the binder, whereas larger domains and bee-like structures develop on the surface, following heat treatment or mechanical disturbance that reduces the film thickness. Molecular mobility and association are the key factors in the development of binder microstructure.

  3. Quantitation of nasal development in the early prenatal period using geometric morphometrics and MRI: a new insight into the critical period of Binder phenotype. (United States)

    Katsube, Motoki; Yamada, Shigehito; Miyazaki, Reina; Yamaguchi, Yutaka; Makishima, Haruyuki; Takakuwa, Tetsuya; Yamamoto, Akira; Fujii, Yosuke; Morimoto, Naoki; Ito, Tsuyoshi; Imai, Hirohiko; Suzuki, Shigehiko


    Disturbance of the development of the nasal septum in the early prenatal period causes congenital facial anomalies characterized by a flat nose and defects of the anterior nasal spine (ANS), such as Binder phenotype. The present research aimed to assess the development of the nasal septum and the ANS with growth in the early prenatal period. Magnetic resonance images were obtained from 56 specimens. Mid-sagittal images were analyzed by using geometric morphometrics for the development of the nasal septum, and angle analysis was performed for the development of the ANS. Additionally, we calculated and visualized the ontogenetic allometry of the nasal septum. Our results showed that the nasal septum changed shape in the anteroposterior direction in smaller specimens, while it maintained an almost isometric shape in larger specimens. Furthermore, mathematical evidence revealed that the maturation periods of the shapes of the ANS and the nasal septum were around 12 and 14 weeks of gestation, respectively. The anteroposterior development of the nasal septum is specific until 14 weeks of gestation, and it is important for nasal protrusion and the development of the ANS. Therefore, the disturbance of such development could induce low nasal deformity, including Binder phenotype. © 2017 John Wiley & Sons, Ltd. © 2017 John Wiley & Sons, Ltd.

  4. Effects of the Use of Non-Calcium Phosphate Binders in the Control and Outcome of Vascular Calcifications: A Review of Clinical Trials on CKD Patients

    Directory of Open Access Journals (Sweden)

    Piergiorgio Bolasco


    Full Text Available Vascular calcifications produce a high impact on morbidity and mortality rates in patients affected by chronic kidney disease and mineral bone disorder (CKD-MBD. Effects are manifested from the more advanced stages of CKD (stages 3-4, particularly in patients undergoing dialysis (CKD5D. In recent years, a large number of therapeutic options have been successfully used in the treatment of secondary hyperparathyroidism (SHPT, despite eliciting less marked effects on nonbone calcifications associated with CKD-MBD. In addition to the use of Vitamin D and analogues, more recently treatment with calcimimetic drugs has also been undertaken. The present paper aims to analyze comparative and efficacy studies undertaken to assess particularly the impact on morbidity and mortality rates of non-calcium phosphate binders. Moreover, the mechanism of action underlying the depositing of calcium and phosphate along blood vessel walls, irrespective of the specific contribution provided in reducing the typical phosphate levels observed in CKD largely at more advanced stages of the disease, will be investigated. The aim of this paper therefore is to evaluate which phosphate binders are characterised by the above action and the mechanisms through which these are manifested.

  5. Engineering one-dimensional and two-dimensional birnessite manganese dioxides on nickel foam-supported cobalt–aluminum layered double hydroxides for advanced binder-free supercapacitors

    KAUST Repository

    Hao, Xiaodong


    © The Royal Society of Chemistry. We report a facile decoration of the hierarchical nickel foam-supported CoAl layered double hydroxides (CoAl LDHs) with MnO2 nanowires and nanosheets by a chemical bath method and a hydrothermal approach for high-performance supercapacitors. We demonstrate that owing to the sophisticated configuration of binder-free LDH@MnO2 on the conductive Ni foam (NF), the designed NF/LDH@MnO2 nanowire composites exhibit a highly boosted specific capacitance of 1837.8 F g-1 at a current density of 1 A g-1, a good rate capability, and an excellent cycling stability (91.8% retention after 5000 cycles). By applying the hierarchical NF/LDH@MnO2 nanowires as the positive electrode and activated microwave exfoliated graphite oxide activated graphene as the negative electrode, the fabricated asymmetric supercapacitor produces an energy density of 34.2 Wh kg-1 with a maximum power density of 9 kW kg-1. Such strategies with controllable assembly capability could open up a new and facile avenue in fabricating advanced binder-free energy storage electrodes. This journal is

  6. Carbon nanotube/felt composite electrodes without polymer binders

    Energy Technology Data Exchange (ETDEWEB)

    Rosolen, J. Mauricio; Matsubara, E.Y.; Marchesin, Marcel S.; Lala, Stella M.; Montoro, L.A.; Tronto, S. [Departamento de Quimica-FFCLRP, Universidade de Sao Paulo, Ribeirao Preto 14040-930, SP (Brazil)


    In this work we have investigated the suitability of composite electrodes consisting of cup-stacked and bamboo-like carbon nanotubes (CNT) synthesized directly onto a carbon felt for both lithium storage and double-layer capacitance applications. The CNT/felt composite electrode was prepared using catalytic chemical vapor decomposition on the carbon felt. The microstructure of the electrodes was characterized by scanning electron microscopy. Electrochemical characterization of the CNT/felt, either submitted or not to acid treatment for extraction of the catalytic particles used during the CNT growth, was carried out using 1molL{sup -1} LiPF{sub 6} in mixtures of ethylene carbonate, dimethyl carbonate, diethyl carbonate, and propylene carbonate. The carbon nanotubes loading and the type of CNT, whether open or closed, on the felt were the most significant factors regarding the electrochemical properties of the composite. With respect to the application of the composite to lithium storage, an anomalous behavior in the reversible specific capacity as a function of the current was detected. The capacity was found to be large at higher current values. The best reversible specific capacity was found for the open-CNT/felt (275mAhg{sup -1} at 0.16Ag{sup -1}, and 200mAhg{sup -1} at 0.82Ag{sup -1}), on an area of 0.634mm{sup 2}. The double-layer capacitance of the CNT decreased with increasing current. In the case of the open-CNT with a CNT loading of 13.93mg, the composite provided 40.3{mu}Fcm{sup 2} or about 12Fg{sup -1} at 10mA of polarization current using 1molL{sup -1} LiPF{sub 6} in mixtures of ethylene carbonate and dimethyl carbonate. For the closed-CNT with a CNT loading of 9.3mg, the double-layer capacitance was 30Fg{sup -1} at 20mA in 1M H{sub 2}SO{sub 4}. (author)

  7. Moisture Transfer through Facades Covered with Organic Binder Renders

    Directory of Open Access Journals (Sweden)

    Carmen DICO


    Full Text Available Year after year we witness the negative effect of water over buildings, caused by direct or indirect actions. This situation is obvious in case of old, historical building, subjected to this aggression for a long period of time, but new buildings are also affected. Moisture in building materials causes not only structural damage, but also reduces the thermal insulation capacity of building components.Materials like plasters or paints have been used historically for a long period of time, fulfilling two basics functions: Decoration and Protection. The most acute demands are made on exterior plasters, as they, besides being an important decorative element for the facade, must perform two different functions simultaneously: protect the substrate against weathering and moisture without sealing, providing it a certain ability to “breathe” (Heilen, 2005. In order to accomplish this aim, the first step is to understand the hygrothermal behavior of coating and substrate and define the fundamental principles of moisture transfer; According to Künzel’s Facade Protection Theory, two material properties play the most important role: Water absorption and Vapor permeability.In the context of recently adoption (2009 of the “harmonized” European standard EN 15824 – „Specifications for external renders and internal plasters based on organic binders”, this paper deals extensively with the interaction of the two mentioned above properties for the coating materials, covered by EN 15824.

  8. Scaffold mining of kinase hinge binders in crystal structure database (United States)

    Xing, Li; Rai, Brajesh; Lunney, Elizabeth A.


    Protein kinases are the second most prominent group of drug targets, after G-protein-coupled receptors. Despite their distinct inhibition mechanisms, the majority of kinase inhibitors engage the conserved hydrogen bond interactions with the backbone of hinge residues. We mined Pfizer internal crystal structure database (CSDb) comprising of several thousand of public as well as internal X-ray binary complexes to compile an inclusive list of hinge binding scaffolds. The minimum ring scaffolds with directly attached hetero-atoms and functional groups were extracted from the full compounds by applying a rule-based filtering procedure employing a comprehensive annotation of ATP-binding site of the human kinase complements. The results indicated large number of kinase inhibitors of diverse chemical structures are derived from a relatively small number of common scaffolds, which serve as the critical recognition elements for protein kinase interaction. Out of the nearly 4,000 kinase-inhibitor complexes in the CSDb we identified approximately 600 unique scaffolds. Hinge scaffolds are overwhelmingly flat with very little sp3 characteristics, and are less lipophilic than their corresponding parent compounds. Examples of the most common as well as the uncommon hinge scaffolds are presented. Although the most common scaffolds are found in complex with multiple kinase targets, a large number of them are uniquely bound to a specific kinase, suggesting certain scaffolds could be more promiscuous than the others. The compiled collection of hinge scaffolds along with their three-dimensional binding coordinates could serve as basis set for hinge hopping, a practice frequently employed to generate novel invention as well as to optimize existing leads in medicinal chemistry.

  9. Final Report on Initial Samples Supplied by LLNL for Task 3.3 Binder Burnout and Sintering Schedule Optimisation

    Energy Technology Data Exchange (ETDEWEB)

    Walls, P


    Sixteen of the twenty-one samples have been investigated using the scanning laser dilatometer. This includes all three types of samples with different preparation routes and organic content. Cracks were observed in all samples, even those only heated to 300 C. It was concluded that the cracking was occurring in the early part of the heat treatment before the samples reached 300 C. Increase in the rate of dilation of the samples occurred above 170 C which coincided with the decomposition of the binder/wax additives as determined by differential thermal analysis. A comparison was made with SYNROC C material (Powder Run 143), samples of which had been CIPed and green machined to a similar diameter and thickness as the 089mm SRTC pucks. These samples contained neither binder nor other organic processing aids and had been kept in the same desiccator as the SRTC samples. The CIPed Synroc C samples sintered to high density with zero cracks. As the cracks made up only a small contribution to the change in diameter of the sample compared to the sintering shrinkage, useful information could still be gained from the runs. The sintering curves showed that there was much greater shrinkage of the Type III samples containing only the 5% PEG binder compared to the Type I which contained polyolefin wax as processing aid. Slight changes in gradient of the sintering curve were observed, however, due to the masking effect of the cracking, full analysis of the sintering kinetics cannot be conducted. Even heating the samples to 300 C at 1.0 or 0.5 C/min could not prevent crack formation. This indicated that heating rate was not the critical parameter causing cracking of the samples. Sectioning of green bodies revealed the inhomogeneous nature of the binder/lubricant distribution in the samples. Increased homogeneity would reduce the amount of binder/lubricant required, which should in turn, reduce the degree of cracking observed during heating to the binder burnout temperature. A

  10. Effect of different binders on the physico-chemical, textural, histological, and sensory qualities of retort pouched buffalo meat nuggets. (United States)

    Devadason, I Prince; Anjaneyulu, A S R; Babji, Y


    The functional properties of 4 binders, namely corn starch, wheat semolina, wheat flour, and tapioca starches, were evaluated to improve the quality of buffalo meat nuggets processed in retort pouches at F(0) 12.13. Incorporation of corn starch in buffalo meat nuggets produced more stable emulsion than other binders used. Product yield, drip loss, and pH did not vary significantly between the products with different binders. Shear force value was significantly higher for product with corn starch (0.42 +/- 0.0 Kg/cm(3)) followed by refined wheat flour (0.36 +/- 0.010 Kg/cm(3)), tapioca starch (0.32 +/- 0.010 Kg/cm(3)), and wheat semolina (0.32 +/- 0.010 Kg/cm(3)). Type of binder used had no significant effect on frying loss, moisture, and protein content of the product. However, fat content was higher in products with corn starch when compared to products with other binders. Texture profile indicated that products made with corn starch (22.17 +/- 2.55 N) and refined wheat flour (21.50 +/- 0.75 N) contributed firmer texture to the product. Corn starch contributed greater chewiness (83.8 +/- 12.51) to the products resulting in higher sensory scores for texture and overall acceptability. Products containing corn starch showed higher sensory scores for all attributes in comparison to products with other binders. Panelists preferred products containing different binders in the order of corn starch (7.23 +/- 0.09) > refined wheat flour (6.48 +/- 0.13) > tapioca starch (6.45 +/- 0.14) > wheat semolina (6.35 +/- 0.13) based on sensory scores. Histological studies indicated that products with corn starch showed dense protein matrix, uniform fat globules, and less number of vacuoles when compared to products made with other binders. The results indicated that corn flour is the better cereal binder for developing buffalo meat nuggets when compared to all other binders based on physico-chemical and sensory attributes.

  11. Study of Microstructure Change of Carbon Nanofibers as Binder-Free Anode for High-Performance Lithium-Ion Batteries. (United States)

    Wang, Ting; Shi, Shaojun; Li, Yuhong; Zhao, Mengxi; Chang, Xiaofeng; Wu, Di; Wang, Haiying; Peng, Luming; Wang, Peng; Yang, Gang


    Flexible and binder-free film of N, O-doped carbon nanofibers (CNFs) is the ideal anode for high-energy-density batteries. Here, CNFs flexible films which the N, O dopant give defect in graphite structure results in high specific surface area more than 500 m(2) g(-1). A flexible film of CNF800 carbonized at 800 °C delivers initial capacities of 2000 and 755 mAh g(-1) at the current densities of 5 and 10 A g(-1), respectively. After 500 cycles, CNF800 remains the capacities of 1251, 865, 702, and 305 mAh g(-1) at 0.5, 1, 5, and 10 A g(-1), respectively. The microstructures of CNFs under various state of charge are studied by HRTEM, XPS, (13)C NMR, and so forth. The lithiation/delithiation mainly happens to the interlayer of graphite domain of CNFs. The dopants of nitrogen and oxygen involve in lithiation, but much of Li-N is irreversible. The excellent performances of CNFs film can be attributed to the N, O doped structure of graphite domain that has increased the conductivity and lithium storage ability. Further development of N, O doped CNFs may enable practical applications as flexible anode in high-performance lithium-ion batteries.

  12. Effects of binders combined with glucono-δ-lactone on the quality characteristics of pressure-induced cold-set restructured pork. (United States)

    Chun, Ji-Yeon; Choi, Mi-Jung; Min, Sang-Gi; Hong, Geun-Pyo


    This study investigated the effects of binders and glucono-δ-lactone (GdL) on characteristics of pressure-induced (450MPA for 3min) cold-set restructured pork. Isolated soy protein (SP), wheat flour (WF), and κ-carrageenan (CG) were adopted as binders. The addition of binders improved water-binding properties of restructured pork, and the binders diminished the decrease in water binding properties caused by GdL-induced acidification. Pressure-induced restructured pork prepared with binders showed less harder and more cohesive texture than those of the thermal-treated control (TC). The results indicate that pressure-induced cold-set meat restructuring could be achieved when binders and GdL were used in the formulation. Copyright © 2014. Published by Elsevier Ltd.

  13. Research progress of binders for solid propellants%固体推进剂用粘合剂研究进展

    Institute of Scientific and Technical Information of China (English)

    李小换; 曹付齐


    介绍了固体推进剂用粘合剂的研究进展,着重介绍了丁羟类、叠氮类、HTPE、NEPE以及硝基和硝酸酯类粘合剂的合成、工艺以及性能研究情况,并对未来固体推进剂用粘合剂的发展进行了展望.%Research results of the binders for in solid propellants mainly including the synthesis and performance of hydroxyl terminated polubutadiene (HTPB) binder.azido based energetic binders,hydroxyl terminated polyrther (HTPE) binder.nitro and nitrato group containing binders were introduced.And the prospective development of binders for solid propellants was discussed.

  14. Improvement of desolvation and resilience of alginate binders for Si-based anodes in a lithium ion battery by calcium-mediated cross-linking. (United States)

    Yoon, Jihee; Oh, Dongyeop X; Jo, Changshin; Lee, Jinwoo; Hwang, Dong Soo


    Si-based anodes in lithium ion batteries (LIBs) have exceptionally high theoretical capacity, but the use of a Si-based anode in LIBs is problematic because the charging-discharging process can fracture the Si particles. Alginate and its derivatives show promise as Si particle binders in the anode. We show that calcium-mediated "egg-box" electrostatic cross-linking of alginate improves toughness, resilience, electrolyte desolvation of the alginate binder as a Si-binder for LIBs. Consequently, the improved mechanical properties of the calcium alginate binder compared to the sodium alginate binder and other commercial binders extend the lifetime and increase the capacity of Si-based anodes in LIBs.

  15. Three-year performance of in-situ solidified/stabilised soil using novel MgO-bearing binders. (United States)

    Jin, Fei; Wang, Fei; Al-Tabbaa, Abir


    A new group of MgO-bearing binders has been developed recently which showed improved sustainability and technical performance compared to Portland cement (PC). However, the application of these MgO-bearing binders in the Solidification/Stabilisation (S/S) techniques is very limited. This study investigates the three-year performance of a highly contaminated soil treated by in-situ S/S using MgO-bearing binders and PC. The core quality, strength, permeability and the leaching properties of the S/S materials were evaluated. The effects of binder composition, addition of inorgano-organo-clay (IOC) and the grout content on the properties of the 3-y S/S materials are discussed. It is found that although MgO alone provided negligible strength to the soil, it is superior in immobilising both inorganic and organic contaminants. Replacing MgO by ground granulated blast-furnace slag (GGBS) significantly enhanced the strength while also performed well in immobilising the contaminants. The improved pH buffering capacity was attributed to the low solubilities of brucite and hydrotalcite-like phases formed in the MgO-bearing binders, and was also the reason for the improved performance in stabilising contaminants. The addition of IOC slightly decreased the strength and the permeability of the S/S materials but inconsistent effect on the contaminant immobilisation was found depending on the binder composition. This study showed no degradation of the S/S materials after 3 y exposure to field conditions and has proved the applicability and the advantages of MgO-bearing binders over PC in S/S.


    Directory of Open Access Journals (Sweden)

    S. N. Leonovich


    Full Text Available The paper deals with the effect of sodium citrate on the formation of a cement stone in the aluminous binder. Formation of cement stone framework in cement hydraulic binder is accompanied with complicated physical and chemical processes of interphase interactions and dispersion, these processes are predicated on qualitative and quantitative composition of the cement mortar, continuous changes in its properties from preparation stage till curing. Addition of sodium citrate to tempering water enhances hydration of both Portland cement and calcium aluminate cement. Process pertaining to an increase of cement hydration rate is considered as a consequence of destruction in surface formations and exclusion of damping effect in respect of hydration rate and hydrolysis of products resulted from interaction of clinker material with tempering. It has been established that sodium citrate makes it possible to control processes of hydration, hydrolysis, binding and curing for cement mass. High degree of hydration of aluminous cement in the presence of sodium citrate provides fast binding and curing of binder, low porosity and rather high compression breaking strength of cement stone for all curing stages. An increase in concentration of sodium citrate in cement mixture up to 10 % of the cement mass exerts an influence not only on the process of cement mortar liquefaction, reduction of time for cement mass setting and hardening but also increases compression strength of cement stone. An analysis of the structure for cleavage surface of cement stone gives ground to declare that the addition of sodium citrate provides cement stone sealing and reduces its water absorption.

  17. Nanocomposites Based on Water Glass Matrix as a Foundry Binder: Chosen Physicochemical Properties

    Directory of Open Access Journals (Sweden)

    Kmita A.


    Full Text Available The nanocomposites based on water glass matrix were attempted in the study. Nanoparticles of ZnO, Al2O3 or MgO in organic solutions were applied into water glass matrix in the amounts of: 1.5; 3; 4 or 5 mas. %. Wettability of the quartz sad by the nanocomposites based on water glass matrix was determined by testing changes of the wetting angle θ in time τ for the system: quartz - binder in non-stationary state, by means of the device for measuring wetting angles. Wettability measurements were carried out under isothermal conditions at an ambient temperature (20 - 25°C. The modification improves wettability of quartz matrix by water glass, which is effective in improving strength properties of hardened moulding sands. Out of the considered modifiers in colloidal solution of propyl alcohol water glass modified by MgO nanoparticles indicated the smallest values of the equilibrium wetting angle θr. This value was equal app. 11 degrees and was smaller no less than 40 degrees than θr value determined for not modified water glass. Viscosity η of nanocomposites based on water glass matrix was determined from the flow curve, it means from the empirically determined dependence of the shearing stress τ on shear rate γ: τ = f (γ (1, by means of the rotational rheometer. Measurements were carried out at a constant temperature of 20°C. The modification influences the binder viscosity. This influence is conditioned by: amount of the introduced modifier as well as dimensions and kinds of nanoparticles and organic solvents. The viscosity increase of the modified binder does not negatively influence its functional properties.

  18. A view on organic binder effects on technical properties of ceramic Raschig rings

    Directory of Open Access Journals (Sweden)

    Beygi Khosrowshahi, Y.


    Full Text Available Organic binders such as polyvinyl alcohol, carboxymethyl cellulose and Arabic gum are widely used to control the technological parameters required for green and sintered ceramic bodies. An industrial ceramic Raschig ring composed of kaolinite, illite, pyrophillite and quartz minerals was separately mixed with different content of above binders and formed by extrusion process in the shape of Raschig ring. The dried specimens were sintered at 1270°C and the physicalmechanical characteristics of sintered bodies were evaluated by measuring bulk density, total and closed porosities and compressive strength. In addition, the effect of binder type and amount on reliability of ceramic Raschig rings was evaluated by computing Weibull modulus. The obtained data exhibited optimum strength and reliability in presence 0,75 wt.% carboxymethyl cellulose.

    Los compuestos orgánicos tales como el alcohol polivinilico, la carboxilmetil celulosa y la goma Arábica son ampliamente utilizados para conseguir aglomerar los polvos cerámicos en verde. Se han preparado, por el método de extrusión, materiales cerámicos en forma de anillos Raschig a partir de minerales (caolina, illita, pirofilita y cuarzo mezclados con diferentes contenidos de alguno de los aglomerantes mencionados. Los anillos, una vez secos, fueron sinterizados a 1270 ºC y caracterizados físicamente; se midieron la densidad, porosidad total y cerrada y las propiedades mecánicas. Asimismo se evaluó el efecto del tipo y cantidad de aglomerante empleado en el procesamiento de los anillos calculando el módulo de Weibull para los distintos anillos. Los datos obtenidos indican que la mayor resistencia mecánica se presenta cuando se ha utilizado 0,75% en peso de carboxilmetil celulosa como ligante.

  19. Effect of methionine and lactic acid bacteria as aflatoxin binder on broiler performance (United States)

    Istiqomah, Lusty; Damayanti, Ema; Julendra, Hardi; Suryani, Ade Erma; Sakti, Awistaros Angger; Anggraeni, Ayu Septi


    The use of aflatoxin binder product based amino acids, lacic acid bacteria, and natural product gived the opportunity to be an alternative biological decontamination of aflatoxins. A study was conducted to determine the efficacy of aflatoxin binder administration (amino acid methionine and lactic acid bacteria (Lactobacillus plantarum G7)) as feed additive on broiler performance. In this study, 75 Lohmann unsexed day old chicks were distributed randomly into 5 units of cages, each filled with 15 broilers. Five cages were assigned into 5 treatments groups and fed with feed contained aflatoxin. The treatments as follow: P1 (aflatoxin feed without aflatoxin binder), P3 (aflatoxin feed + 0.8% of methionine + 1% of LAB), P4 (aflatoxin feed + 1.2% of methionine + 1% of LAB), P5 (aflatoxin feed + 1% of LAB), and K0 (commercial feed). The measurement of aflatoxin content in feed was performed by Enzyme Linked Immunosorbent Assay method using AgraQuant® Total Aflatoxin Assay Romer Labs procedure. The experimental period was 35 days with feeding and drinking ad libitum. LAB was administered into drinking water, while methionine into feed. Vaccination program of Newcastle Disease (ND) was using active vaccine at 4 and 18 day old, while Infectious Bursal Disease (IBD) was given at 8 day old. Parameter of body weight was observed weekly, while feed consumption noted daily. The result showed that aflatoxin in feed for 35 days period did not significantly affect the body weight gain and feed conversion. The lowest percentage of organ damage at 21 day old was found in P5 treatment (55%), while at 35day old was found in P4 treatment (64%). It could be concluded that technological process of detoxifying aflatoxin could be applied in an attempt to reduce the effect on the toxicity of aflatoxin in poultry feed.

  20. The effect of a new formaldehyde-free binder on the dissolution rate of glass wool fibre in physiological saline solution. (United States)

    Potter, Russell M; Olang, Nassreen


    The in-vitro dissolution rate of fibres is a good predictor of the in-vivo behavior and potential health effects of inhaled fibres. This study examines the effect of a new formaldehyde-free carbohydrate-polycarboxylic acid binder on the in-vitro dissolution rate of biosoluble glass fibres. Dissolution rate measurements in pH 7.4 physiological saline solution show that the presence of the binder on wool insulation glass fibres has no effect on their dissolution. There is no measurable difference between the dissolution rates of continuous draw fibres before and after binder was applied by dipping. Nor is there a measurable difference between the dissolution rates of a production glass wool sample with binder and that same sample after removal of the binder by low-temperature ashing. Morphological examination shows that swelling of the binder in the solution is at least partially responsible for the development of open channels around the glass-binder interface early in the dissolution. These channels allow fluid to reach the entire glass surface under the binder coating. There is no evidence of any delay in the dissolution rate as a result of the binder coating.

  1. The effect of a new formaldehyde-free binder on the dissolution rate of glass wool fibre in physiological saline solution (United States)


    The in-vitro dissolution rate of fibres is a good predictor of the in-vivo behavior and potential health effects of inhaled fibres. This study examines the effect of a new formaldehyde-free carbohydrate-polycarboxylic acid binder on the in-vitro dissolution rate of biosoluble glass fibres. Dissolution rate measurements in pH 7.4 physiological saline solution show that the presence of the binder on wool insulation glass fibres has no effect on their dissolution. There is no measurable difference between the dissolution rates of continuous draw fibres before and after binder was applied by dipping. Nor is there a measurable difference between the dissolution rates of a production glass wool sample with binder and that same sample after removal of the binder by low-temperature ashing. Morphological examination shows that swelling of the binder in the solution is at least partially responsible for the development of open channels around the glass-binder interface early in the dissolution. These channels allow fluid to reach the entire glass surface under the binder coating. There is no evidence of any delay in the dissolution rate as a result of the binder coating. PMID:23587247

  2. Final report on initial samples supplied by LLNL for task 3.3 binder burnout and sintering schedule optimisation

    Energy Technology Data Exchange (ETDEWEB)

    Walls, P


    Sixteen of the twenty-one samples have been investigated using the scanning laser dilatometer. This includes all three types of samples with different preparation routes and organic content. Cracks were observed in all samples, even those only heated to 300 C. It was concluded that the cracking was occurring in the early part of the heat treatment before the samples reached 300 C. Increase in the rate of dilation of the samples occurred above 170 C which coincided with the decomposition of the binder/wax additives as determined by differential thermal analysis. A comparison was made with SYNROC C material (Powder Run 143), samples of which had been CIPed and green machined to a similar diameter and thickness as the 089 mm SRTC pucks. These samples contained neither binder nor other organic processing aids and had been kept in the same desiccator as the SRTC samples. The CIPed Synroc C samples sintered to high density with zero cracks. As the cracks made up only a small contribution to the change in diameter of the sample compared to the sintering shrinkage, useful information could still be gained from the runs. The sintering curves showed that there was much greater shrinkage of the Type III samples containing only the 5% PEG binder compared to the Type I which contained polyolefin wax as processing aid. Slight changes in gradient of the sintering curve were observed, however, due to the masking effect of the cracking, full analysis of the sintering kinetics cannot be conducted. Even heating the samples to 300 C at 1.0 or 0.5 C/min could not prevent crack formation. This indicated that heating rate was not the critical parameter causing cracking of the samples. Sectioning of green bodies revealed the inhomogeneous nature of the binder/lubricant distribution in the samples. Increased homogeneity would reduce the amount of binder/lubricant required, which should in turn, reduce the degree of cracking observed during heating to the binder burnout temperature. A

  3. Comparison of the effect of recycled crumb rubber and polymer concentration on the performance of binders for asphalt mixtures

    Directory of Open Access Journals (Sweden)

    Jiménez del Barco-Carrión, A.


    Full Text Available Crumb rubber modified binders are environmental-friendly alternatives to polymer modified bitumens in asphalt mixtures. This paper compares the performance of both types of binders with different modifier contents. Six binders were characterised by conventional tests and analysed using the UCL method. This method evaluates different properties of binders regarding their role in asphalt mixtures (cohesion, water and thermal sensitivity and resistance to ageing. Results showed that i crumb rubber concentration has to be higher than that of SBS-polymers in order to obtain a similar performance to that of SBS-polymer modified bitumen; ii crumb rubber modified binders are more stable than SBS-polymer modified binders in terms of modifier concentration; iii crumb rubber modified binders exhibited less water sensitivity and similar thermal and ageing susceptibility to SBS-polymer modified binders; iv linear relationships have been found between modifier concentration and the properties studied for both kind of binders.Los betunes modificados con polvo de neumático (PN son alternativas ambientalmente sostenibles a los betunes modificados con polímeros. Este artículo compara el comportamiento de ambos tipos de betunes con varios contenidos de modificador. Para ello, se caracterizaron seis betunes mediante ensayos convencionales y método UCL. Este método evalúa propiedades de ligantes para su uso en mezclas bituminosas (cohesión, sensibilidad al agua, térmica y al envejecimiento. Los resultados muestran que i la concentración de PN ha de ser más elevada que la de polímeros para obtener comportamiento semejante; ii los betunes con PN son más estables ante cambios en la concentración de modificador que los betunes con polímeros; iii los betunes con PN presentan menor sensibilidad al agua y equivalente susceptibilidad térmica y al envejecimiento que los betunes con polímeros; iv se encontraron buenos ajustes lineales entre la concentraci

  4. Highly robust silicon nanowire/graphene core-shell electrodes without polymeric binders (United States)

    Lee, Sang Eon; Kim, Han-Jung; Kim, Hwanjin; Park, Jong Hyeok; Choi, Dae-Geun


    A large theoretical charge storage capacity along with a low discharge working potential renders silicon a promising anode material for high energy density lithium ion batteries. However, up to 400% volume expansion during charge-discharge cycling coupled with a low intrinsic electronic conductivity causes pulverization and fracture, thus inhibiting silicon's widespread use in practical applications. We report herein on a low cost approach to fabricate hybrid silicon nanowire (SiNW)/graphene nanostructures that exhibit enhanced cycle performance with the capability of retaining more than 90% of their initial capacity after 50 cycles. We also demonstrate the use of hot-pressing in the absence of any common polymer binder such as PVDF to bind the hybrid structure to the current collector. The applied heat and pressure ensure strong adhesion between the SiNW/graphene nano-composite and current collector. This facile yet strong binding method is expected to find use in the further development of polymer-binder free anodes for lithium ion batteries.A large theoretical charge storage capacity along with a low discharge working potential renders silicon a promising anode material for high energy density lithium ion batteries. However, up to 400% volume expansion during charge-discharge cycling coupled with a low intrinsic electronic conductivity causes pulverization and fracture, thus inhibiting silicon's widespread use in practical applications. We report herein on a low cost approach to fabricate hybrid silicon nanowire (SiNW)/graphene nanostructures that exhibit enhanced cycle performance with the capability of retaining more than 90% of their initial capacity after 50 cycles. We also demonstrate the use of hot-pressing in the absence of any common polymer binder such as PVDF to bind the hybrid structure to the current collector. The applied heat and pressure ensure strong adhesion between the SiNW/graphene nano-composite and current collector. This facile yet strong

  5. Evaluating surface energy components of asphalt binders using Wilhelmy Plate and Sessile Drop Techniques


    Bahramian, Anohe


    In this Study, the surface energy was investigated for six penetration grade 70/100 bitumen binders. Wilhelmy Plate and the Sessile Drop were used to determine the contact angles. The purpose of this study was to compare the Wilhelmy Plate method with the Sessile Drop method, and to compare the significance of Owens-Wendt model with the significance of Acid Base model by correlating surface energy components. Better R2 –values were found for surface energy components by using the Owens-Wendt ...

  6. Investigation of Phosphate Cement-based Binder with Super High Early Strength for Repair of Concrete

    Institute of Scientific and Technical Information of China (English)


    Magnesium phosphate cement-based binder (MPB) for repair of concrete was prepared by proportionally mixing over burned MgO powder (M) with NHH2PO4 powder (P) and set modifying admixtures. It is characteristic by excellent properties such as rapid setting,high strength and high bond strength to old concrete.. The study is focused on the key factors influencing the setting time and strength of MPB, the bond property of MPB to old concrete and the kinetic feature of the hydration of MPB.

  7. Maxillo-nasal dysplasia (Binder syndrome) and associated malformations of the cervical spine

    Energy Technology Data Exchange (ETDEWEB)

    Olow-Nordenram, M.A.K.; Raadberg, C.T.


    Forty-three patients with maxillo-nasal dysplasia have been subjected to a radiographic examination of the cervical spine. In 44.2 per cent malformations of the cervical vertebrae of a minor or major type were revealed. Dysplasia of the vertebral bodies related to persistence of the chorda dorsalis, a very rare malformation, was found in six cases. No correlation between the incidence or serverity of the malformations and the degree of malocclusion of the jaws and facial deformity, characteristic of Binder syndrome, were noted. The maxillo-nasal dysplasia and the spinal malformations probably have a common cause during the embryologic stage.

  8. Characteristic of Core Manufacturing Process with Use of Sand, Bonded by Ecological Friendly Nonorganic Binders

    Directory of Open Access Journals (Sweden)

    A. Fedoryszyn


    Full Text Available Mechanization of the process of core making with the use of inorganic and organic binders is based, almost solely, on core blowing machines. Presently the core blowing machines are equipped with tools and devices that allow for application of different technologies of core making. Cold-box, hot-box and warm-air technologies require that core blowing machines shall be additionally equipped with either core-box pre-heating system or gas purging and neutralization system, or hot air purging systems.

  9. Conduction calorimetric studies of ternary binders based on Portland cement, calcium aluminate cement and calcium sulphate


    Torrens Martín, David; Fernández Carrasco, Lucía; Blanco Varela, M.Teresa


    Different binders of Portland cement, calcium aluminate cement and calcium sulphate (PC/CAC/CS) have been investigated to determinate the in¿uence the CAC and CS amount in the reactions mechanism. Several mixtures were studied, ratios of 100, 85/15 and 75/25 of PC/CAC with 0, 3 and 5 % of CS. Conduction calorimetric technique was used to follow the hydration during 100 h. The XRD and FTIR techniques were used as support in the analysis of the hydration products. The results have shown tha...

  10. Evaluation of novel reactive MgO activated slag binder for the immobilisation of lead and zinc. (United States)

    Jin, Fei; Al-Tabbaa, Abir


    Although Portland cement is the most widely used binder in the stabilisation/solidification (S/S) processes, slag-based binders have gained significant attention recently due to their economic and environmental merits. In the present study, a novel binder, reactive MgO activated slag, is compared with hydrated lime activated slag in the immobilisation of lead and zinc. A series of lead or zinc-doped pastes and mortars were prepared with metal to binder ratio from 0.25% to 1%. The hydration products and microstructure were studied by X-ray diffraction, thermogravimetric analysis and scanning electron microscopy. The major hydration products were calcium silicate hydrate and hydrotalcite-like phases. The unconfined compressive strength was measured up to 160 d. Findings show that lead had a slight influence on the strength of MgO-slag paste while zinc reduced the strength significantly as its concentration increased. Leachate results using the TCLP tests revealed that the immobilisation degree was dependent on the pH and reactive MgO activated slag showed an increased pH buffering capacity, and thus improved the immobilisation efficiency compared to lime activated slag. It was proposed that zinc was mainly immobilised within the structure of the hydrotalcite-like phases or in the form of calcium zincate, while lead was primarily precipitated as the hydroxide. It is concluded, therefore, that reactive MgO activated slag can serve as clinker-free alternative binder in the S/S process.

  11. Physically Cross-linked Polymer Binder Induced by Reversible Acid-Base Interaction for High-Performance Silicon Composite Anodes. (United States)

    Lim, Sanghyun; Chu, Hodong; Lee, Kukjoo; Yim, Taeeun; Kim, Young-Jun; Mun, Junyoung; Kim, Tae-Hyun


    Silicon is greatly promising for high-capacity anode materials in lithium-ion batteries (LIBs) due to their exceptionally high theoretical capacity. However, it has a big challenge of severe volume changes during charge and discharge, resulting in substantial deterioration of the electrode and restricting its practical application. This conflict requires a novel binder system enabling reliable cyclability to hold silicon particles without severe disintegration of the electrode. Here, a physically cross-linked polymer binder induced by reversible acid-base interaction is reported for high performance silicon-anodes. Chemical cross-linking of polymer binders, mainly based on acidic polymers including poly(acrylic acid) (PAA), have been suggested as effective ways to accommodate the volume expansion of Si-based electrodes. Unlike the common chemical cross-linking, which causes a gradual and nonreversible fracturing of the cross-linked network, a physically cross-linked binder based on PAA-PBI (poly(benzimidazole)) efficiently holds the Si particles even after the large volume changes due to its ability to reversibly reconstruct ionic bonds. The PBI-containing binder, PAA-PBI-2, exhibited large capacity (1376.7 mAh g(-1)), high Coulombic efficiency (99.1%) and excellent cyclability (751.0 mAh g(-1) after 100 cycles). This simple yet efficient method is promising to solve the failures relating with pulverization and isolation from the severe volume changes of the Si electrode, and advance the realization of high-capacity LIBs.

  12. Gel nanostructure in alkali-activated binders based on slag and fly ash, and effects of accelerated carbonation

    Energy Technology Data Exchange (ETDEWEB)

    Bernal, Susan A., E-mail: [Department of Chemical and Biomolecular Engineering, The University of Melbourne, Victoria 3010 (Australia); Department of Materials Science and Engineering, The University of Sheffield, Sheffield S1 3JD (United Kingdom); Provis, John L., E-mail: [Department of Chemical and Biomolecular Engineering, The University of Melbourne, Victoria 3010 (Australia); Department of Materials Science and Engineering, The University of Sheffield, Sheffield S1 3JD (United Kingdom); Walkley, Brant; San Nicolas, Rackel [Department of Chemical and Biomolecular Engineering, The University of Melbourne, Victoria 3010 (Australia); Gehman, John D. [School of Chemistry and Bio21 Institute, The University of Melbourne, Victoria 3010 (Australia); Brice, David G.; Kilcullen, Adam R. [Department of Chemical and Biomolecular Engineering, The University of Melbourne, Victoria 3010 (Australia); Zeobond Pty Ltd, P.O. Box 23450, Docklands, Victoria 8012 (Australia); Duxson, Peter [Zeobond Pty Ltd, P.O. Box 23450, Docklands, Victoria 8012 (Australia); Deventer, Jannie S.J. van [Department of Chemical and Biomolecular Engineering, The University of Melbourne, Victoria 3010 (Australia); Zeobond Pty Ltd, P.O. Box 23450, Docklands, Victoria 8012 (Australia)


    Binders formed through alkali-activation of slags and fly ashes, including ‘fly ash geopolymers’, provide appealing properties as binders for low-emissions concrete production. However, the changes in pH and pore solution chemistry induced during accelerated carbonation testing provide unrealistically low predictions of in-service carbonation resistance. The aluminosilicate gel remaining in an alkali-activated slag system after accelerated carbonation is highly polymerised, consistent with a decalcification mechanism, while fly ash-based binders mainly carbonate through precipitation of alkali salts (bicarbonates at elevated CO{sub 2} concentrations, or carbonates under natural exposure) from the pore solution, with little change in the binder gel identifiable by nuclear magnetic resonance spectroscopy. In activated fly ash/slag blends, two distinct gels (C–A–S–H and N–A–S–H) are formed; under accelerated carbonation, the N–A–S–H gel behaves comparably to fly ash-based systems, while the C–A–S–H gel is decalcified similarly to alkali-activated slag. This provides new scope for durability optimisation, and for developing appropriate testing methodologies. -- Highlights: •C-A-S-H gel in alkali-activated slag decalcifies during accelerated carbonation. •Alkali-activated fly ash gel changes much less under CO{sub 2} exposure. •Blended slag-fly ash binder contains two coexisting gel types. •These two gels respond differently to carbonation. •Understanding of carbonation mechanisms is essential in developing test methods.

  13. Effect of binders on the release rates of direct molded verapamil tablets using twin-screw extruder in melt granulation. (United States)

    Tan, David Cheng Thiam; Chin, William Wei Lim; Tan, En Hui; Hong, Shiqi; Gu, Wei; Gokhale, Rajeev


    Conventional manufacturing of pharmaceutical tablets often involves single processes such as blending, granulation, milling and direct compression. A process that minimizes and incorporates all these in a single continuous step is desirable. The concept of omitting milling step followed by direct-molding of tablets utilizing a twin-screw extruder in a melt granulation process using thermoplastic binders was explored. The objective of this study was to investigate the effect of combining hydrophilic binder (HPMC K4M, PEO 1M), and hydrophobic binder (Compritol® ATO 888, Precirol® ATO 5) on the release profiles of direct-molded tablets and direct-compressed tablets from milled extrudates using a quality-by-design approach. It was identified that hydrophilic binder type and process significantly affects (p=0.005) the release profiles of verapamil. Moreover, two-way interaction analysis demonstrated that the combination of process with type of hydrophilic polymer (p=0.028) and the type of hydrophilic polymer with polymer ratio (p=0.033) significantly affected the release profiles. The formulation release kinetics correlated to Higuchi release model and the mechanism correlated to a non-Fickian release mechanism. The results of the present study indicated that direct-molded tablets with different release profiles can be manufactured without milling process and through a continuous melt granulation using twin-screw extruder with appropriate thermoplastic binder ratio.

  14. A molecular dynamics study of the role of molecular water on the structure and mechanics of amorphous geopolymer binders (United States)

    Sadat, Mohammad Rafat; Bringuier, Stefan; Asaduzzaman, Abu; Muralidharan, Krishna; Zhang, Lianyang


    In this paper, molecular dynamics simulations are used to study the effect of molecular water and composition (Si/Al ratio) on the structure and mechanical properties of fully polymerized amorphous sodium aluminosilicate geopolymer binders. The X-ray pair distribution function for the simulated geopolymer binder phase showed good agreement with the experimentally determined structure in terms of bond lengths of the various atomic pairs. The elastic constants and ultimate tensile strength of the geopolymer binders were calculated as a function of water content and Si/Al ratio; while increasing the Si/Al ratio from one to three led to an increase in the respective values of the elastic stiffness and tensile strength, for a given Si/Al ratio, increasing the water content decreased the stiffness and strength of the binder phase. An atomic-scale analysis showed a direct correlation between water content and diffusion of alkali ions, resulting in the weakening of the AlO4 tetrahedral structure due to the migration of charge balancing alkali ions away from the tetrahedra, ultimately leading to failure. In the presence of water molecules, the diffusion behavior of alkali cations was found to be particularly anomalous, showing dynamic heterogeneity. This paper, for the first time, proves the efficacy of atomistic simulations for understanding the effect of water in geopolymer binders and can thus serve as a useful design tool for optimizing composition of geopolymers with improved mechanical properties.

  15. Glyoxalated polyacrylamide as a covalently attachable and rapidly cross-linkable binder for Si electrode in lithium ion batteries (United States)

    Yoo, Jung-Keun; Jeon, Jaebeom; Kang, Kisuk; Jung, Yeon Sik


    Recently, investigation of Si-based anode materials for rechargeable battery applications garnered much interest due to its exceptionally high capacity. High-capacity Si anode ( 4,200 mAhg-1) is highly desirable for the replacement of conventional graphite anode (storage applications such as in electric vehicles (EVs) and energy storage systems (ESSs) for renewable energy sources. However, Si-based anodes suffer from poor cycling stability due to their large volumetric changes during repeated Li insertion. Therefore, development of highly efficient binder materials that can suppress the volume change of Si is one of the most essential parts of improving the performance of batteries. We herein demonstrate highly cross-linked polymeric binder (glyoxalated polyacrylamide) with an enhanced mechanical property by applying wet-strengthening chemistry used in paper industry. We found that the degree of cross-linking can be systematically adjusted by controlling the acidity of the slurry and has a profound effect on the cell performance using Si anode. The enhanced cycle performance of Si nanoparticles obtained by treating the binder at pH 4 can be explained by its strong interaction between the binder and Si surface and current collector, and also rigidity of binder by cross-linking. [Figure not available: see fulltext.

  16. Binder-free Co3O4@NiCoAl-layered double hydroxide core-shell hybrid architectural nanowire arrays with enhanced electrochemical performance (United States)

    Li, Xuan; Yang, Zhengchun; Qi, Wen; Li, Yutao; Wu, Ying; Zhou, Shaoxiong; Huang, Shengming; Wei, Jun; Li, Huijun; Yao, Pei


    Herein, binder-free Co3O4@NiCoAl-layered double hydroxide (Co3O4@LDH) core-shell hybrid architectural nanowire arrays were prepared via a two-step hydrothermal synthesis route. LDH nanosheets possessing a large electroactive surface area uniformly dispersed on the surface of Co3O4 nanowires were successfully fabricated allowing for fast electron transport that enhances the electrochemical performance of LDH nanosheets. Co3O4@LDH nanowire arrays of 2 to 1.5 molar ratio (Co3O4:LDH) exhibit high specific capacitance (1104 F g-1 at 1 A g-1), adequate rate capability and cycling stability (87.3% after 5000 cycles), attributed to the synergistic effect between the robust Co3O4 nanowire arrays and LDH nanosheets.

  17. Phage display biopanning and isolation of target-unrelated peptides: in search of nonspecific binders hidden in a combinatorial library. (United States)

    Bakhshinejad, Babak; Zade, Hesam Motaleb; Shekarabi, Hosna Sadat Zahed; Neman, Sara


    Phage display is known as a powerful methodology for the identification of targeting ligands that specifically bind to a variety of targets. The high-throughput screening of phage display combinatorial peptide libraries is performed through the affinity selection method of biopanning. Although phage display selection has proven very successful in the discovery of numerous high-affinity target-binding peptides with potential application in drug discovery and delivery, the enrichment of false-positive target-unrelated peptides (TUPs) without any actual affinity towards the target remains a major problem of library screening. Selection-related TUPs may emerge because of binding to the components of the screening system rather than the target. Propagation-related TUPs may arise as a result of faster growth rate of some phage clones enabling them to outcompete slow-propagating clones. Amplification of the library between rounds of biopanning makes a significant contribution to the selection of phage clones with propagation advantage. Distinguishing nonspecific TUPs from true target binders is of particular importance for the translation of biopanning findings from basic research to clinical applications. Different experimental and in silico approaches are applied to assess the specificity of phage display-derived peptides towards the target. Bioinformatic tools are playing a rapidly growing role in the analysis of biopanning data and identification of target-irrelevant TUPs. Recent progress in the introduction of efficient strategies for TUP detection holds enormous promise for the discovery of clinically relevant cell- and tissue-homing peptides and paves the way for the development of novel targeted diagnostic and therapeutic platforms in pharmaceutical areas.

  18. A facile method for high yield synthesis of carbon nano onions for designing binder-free flexible supercapacitor (United States)

    Mohapatra, Debananda; Badrayyana, Subramanya; Parida, Smrutiranjan


    Carbon nano onion (CNO) is a promising material for diverse application areas such as energy devices, catalysis, lubrication, biology and gas storage, etc. However, its implementation is fraught with the production of high-quality powders in bulk quantity. Herein, we report a facile scalable and one-step "wick-and-oil" flame synthesis of pure and water dispersible CNO nanopowder. Other forms of carbon did not contaminate the as-prepared CNO; hence, a post processing purification procedure was not necessary. Brunauer Emmett Teller (BET) specific surface area of as-prepared CNO was 218 m2/g, which is higher as compared to other reported flame synthesis methods. Locally available daily used cotton wipe has been used for fabrication of such an ideal electrode by "dipping and drying" process providing outstanding strechability and mechanical flexibility with strong adhesion between CNOs and porous wipe. The specific capacitance 102.16 F/g, energy density 14.18 Wh/kg and power density 2448 W/kg at 20 mV/s scan rate are the highest values that ever recorded and reported so far in symmetrical two electrode cell configuration with 1M Na2SO4 electrolyte; indicating a very good synthesis conditions employed with optimum pore size in agreement with electrolyte ion size. This free standing CNOs electrode also showed an excellent cyclic performance and stability retaining 95% original capacity after 5000 charge -discharge cycles. Simple preparation of high-purity CNOs and excellent electrochemical behavior of functionalized CNOs make them a promising electrode material for supercapacitor applications. Furthermore, this unique method not only affords binder free - freestanding electrode, but also provide a general way of fabricating such multifunctional promising CNOs based nanocomposites for their potential device applications in flexible solar cells and lithium ion batteries.

  19. Graphene-nanosheet wrapped cobalt sulphide as a binder free hybrid electrode for asymmetric solid-state supercapacitor (United States)

    Patil, S. J.; Kim, J. H.; Lee, D. W.


    A binder-free graphene-nanosheets wrapped Co3S4 hybrid electrode is prepared on conductive Ni-foam via a simple two-step hydrothermal process. The physicochemical characterization such as X-ray diffraction, Raman spectroscopy, and electron microscopy revealed the formation of a Co3S4-rGO hybrid electrode with a large specific surface area (30 m2 g-1). The integrated structure of the Co3S4-rGO hybrid electrode exhibits an areal and specific capacitance of 8.33 F cm-2 and 2314 F g-1, respectively. The Co3S4-rGO hybrid electrode charges within 30 s, while the energy density remains high as 54.32 Wh kg-1 at an outstanding power density of 6.25 kW kg-1 with 92.6% excellent electrochemical cyclic stability over 1000 cycles. The asymmetric supercapacitor device is fabricated using Co3S4 and Co3S4-rGO as positive and negative electrodes, respectively, which exhibit an areal capacitance of ∼164 mF cm-2 with reasonable cyclic stability (89.56% over 5000 cycles). The Co3S4/Co3S4-rGO supercapacitor reveals a high energy density of 1.09 Wh kg-1 at a power density of 398 W kg-1, and 0.31 Wh kg-1 energy density can be retained even at a power density of 750 W kg-1. The superior electrochemical activities of the Co3S4 based electrode suggest considerable promise for high-performance energy storage applications.

  20. Morphology and photoelectrochemical properties of TiO{sub 2} electrodes prepared using functionalized plant oil binders

    Energy Technology Data Exchange (ETDEWEB)

    Park, Kyung Hee [Department of Electrical Engineering, Chonnam National University, Gwangju 500-757 (Korea); Hong, Chang Kook [Center for Functional Nano Fine Chemicals, Chonnam National University, Yongbong-Dong 300, Buk-Gu, Gwangju 500-757 (Korea)


    Chemically functionalized plant oils, viz. acrylated epoxidized soybean oil (AESO) and maleinized acrylated epoxidized soybean oil (MAESO), were used as bio-based binders for the TiO{sub 2} electrodes of dye-sensitized solar cells (DSSC). The surface roughness and number of appropriate pores were increased in the TiO{sub 2} films prepared using the plant oil binders in comparison with the film prepared using polyethylene glycol (PEG), due to the larger number of functionalities. The short circuit photocurrent (I{sub SC}) and open circuit photovoltage (V{sub OC}) were increased, and the conversion efficiency was significantly improved, in the cell using the plant oil binders. (author)

  1. The Dependence of Castings Quality Produced in Clay Moulding Mixtures from the Properties of Binder Based on a Montmorillonite

    Directory of Open Access Journals (Sweden)

    Vasková I.


    Full Text Available Casting quality depends on many factors including the quality of the input materials, technology, material securing and last but not least, the mould into which the casting is casted. By pouring into a single-shot mould, based mainly on 1st generation binders, is is a very important factor. Basically, a bentonite mixture represents either a three- or four-component system, but each component of the system is a heterogeneous substance. This heterogeneity punctuates mainly a non-stationary heat field, presented throughout the whole process of the casting production. The most important component is a binder and in the case of first generation binders mostly bentonites are used - clays that contain minimum of 80% of montmorillonite.

  2. The Dependence of Castings Quality Produced in Clay Moulding Mixtures from the Properties of Binder Based on a Montmorillonite

    Directory of Open Access Journals (Sweden)

    I. Vasková


    Full Text Available Casting quality depends on many factors including the quality of the input materials, technology, material securing and last but notleast, the mould into which the casting is casted. By pouring into a single-shot mould, based mainly on 1st generation binders, is is a very important factor. Basically, a bentonite mixture represents either a three- or four-component system, but each component of the system is a heterogeneous substance. This heterogeneity punctuates mainly a non-stationary heat field, presented throughout the whole process of the casting production. The most important component is a binder and in the case of first generation binders mostly bentonites are used - clays that contain minimum of 80% of montmorillonite.

  3. Evaluation of the effect of mycotoxin binders in animal feed on the analytical performance of standardised methods for the determination of mycotoxins in feed. (United States)

    Kolosova, A; Stroka, J


    Recently, the use of substances that can suppress or reduce absorption, promote the excretion of mycotoxins or modify their mode of action in feed, so-called mycotoxin binders, has been officially allowed in the European Union as technological feed additives. The influence of the addition of mycotoxin binders to animal feed on the analytical performance of the official methods for the determination of mycotoxins was studied and the results are presented. Where possible standardised methods for analysis were applied. Samples of 20 commercial mycotoxin binders were collected from various companies. The following mycotoxins were included in the study: aflatoxin B₁, deoxynivalenol, zearalenone, ochratoxin A, fumonisins B₁ and B₂, T-2 and HT-2 toxins. A binder (or binders combined in a group) was mixed with feed material containing the mycotoxin, and the feed material was analysed. For data evaluation, the mean values were compared by Student's t-test (an independent two-sample t-test with unequal sample sizes and equal variance). The repeatability standard deviation of each method was used as an estimate of method variability. No significant differences (p = 0.05) in mycotoxin levels between binder-free material and the material containing different binders were found. Further, the possible effects of binder addition in combination with processing (pelletising) on the amount of aflatoxin B₁ determined in feed were studied. Three commercial mycotoxin binders containing hydrated sodium calcium aluminosilicate (HSCAS) as the main component were used in these experiments. Feed samples with and without mycotoxin binders were pelletised with and without steam treatment. After pelletising, materials were analysed for AFB₁. Only the combination pelletising and a mixture of binders added at a total level of 1.2% had a significant effect (41% reduction) on the amount of AFB₁ determined.

  4. Effects of egg albumen as binder, on yield and sensory characteristics of frankfurter sausages

    Directory of Open Access Journals (Sweden)

    M. Teye


    Full Text Available This study was conducted to find alternative binders to substitute for polyphosphate in frankfurter-type sausages. Fresh albumen (FA at 32.5 (FA1, 49 (FA2 and 65 (FA3 g/kg meat (equivalent to 5, 7.5 and 10g dry matter/kg meat, and dried albumen (DA at 5 (DA1, 7.5 (DA2 and 10 (DA3 g/kg meat were used to formulate the products, and compared with those formulated with polyphosphate (5g/kg meat as binder. The Completely Randomized Design was used, and products were formulated in triplicates. They were vacuum-packed in transparent packaging bags and stored at 2°C for sensory and laboratory analyses. From the results, egg albumen had no significant (P>0.05 effects on the cooking losses of the FA1, FA2, DA1 and DA2 products, but the losses in these products were significantly (P0.05 different. The egg albumen however, increased the crude protein and reduced fat contents of the DA and FA products. It was cheaper acquiring egg albumen for the FA1 products than acquiring polyphosphates, but it’s more expensive acquiring dried albumen for the DA products, although the products had acceptable yield and sensory characteristics.

  5. Designed protein binders in combination with nanocrystalline diamond for use in high-sensitivity biosensors. (United States)

    Fromell, Karin; Forsberg, Pontus; Karlsson, Mikael; Larsson, Karin; Nikolajeff, Fredrik; Baltzer, Lars


    A platform for diagnostic applications showing signal-to-noise ratios that by far surpass those of traditional bioanalytical test formats has been developed. It combines the properties of modified nanocrystalline diamond (NCD) surfaces and those of polyethylene oxide and polypropylene oxide based block copolymers for surface passivation and binder conjugation with a new class of synthetic binders for proteins. The NCD surfaces were fluorine-, hydrogen-, or oxygen-terminated prior to further biofunctionalization and the surface composition was characterized by X-ray photoelectron spectroscopy. In a proof of principle demonstration targeting the C-reactive protein, an ELISA carried out using an F-terminated diamond surface showed a signal-to-noise ratio of 3,900 which compares well to the signal-to-noise of 89 obtained in an antibody-based ELISA on a polystyrene microtiter plate, a standard test format used in most life science laboratories today. The increase in signal-to-noise ratio is to a large extent the result of extremely efficient passivation of the diamond surface. The results suggest that significant improvements can be obtained in standardized test formats using new materials in combination with new types of chemical coatings and receptor molecules.

  6. Pore- and micro-structural characterization of a novel structural binder based on iron carbonation

    Energy Technology Data Exchange (ETDEWEB)

    Das, Sumanta, E-mail: [School of Sustainable Engineering and the Built Environment, Arizona State University, Tempe, AZ (United States); Stone, David, E-mail: [Iron Shell LLC, Tucson, AZ (United States); Convey, Diana, E-mail: [LeRoy Eyring Center for Solid State Science, Arizona State University, Tempe, AZ (United States); Neithalath, Narayanan, E-mail: [School of Sustainable Engineering and the Built Environment, Arizona State University, Tempe, AZ (United States)


    The pore- and micro-structural features of a novel binding material based on the carbonation of waste metallic iron powder are reported in this paper. The binder contains metallic iron powder as the major ingredient, followed by additives containing silica and alumina to facilitate favorable reaction product formation. Compressive strengths sufficient for a majority of concrete applications are attained. The material pore structure is investigated primarily through mercury intrusion porosimetry whereas electron microscopy is used for microstructural characterization. Reduction in the overall porosity and the average pore size with an increase in carbonation duration from 1 day to 4 days is noticed. The pore structure features are used in predictive models for gas and moisture transport (water vapor diffusivity and moisture permeability) through the porous medium which dictates its long-term durability when used in structural applications. Comparisons of the pore structure with those of a Portland cement paste are also provided. The morphology of the reaction products in the iron-based binder, and the distribution of constituent elements in the microstructure are also reported. - Highlights: • Carbonation of iron produces a dense microstructure. • Pore volume in iron carbonate lower, critical size higher than those in OPC pastes • Reaction product contains iron, carbon, silicon, aluminum and calcium. • Power-law for porosity-moisture permeability relationship was established.

  7. On the characterisation of the corrosion layout of ferrous archaeological analogues in binders

    Energy Technology Data Exchange (ETDEWEB)

    Chitty, Walter-John [Laboratoire Pierre Sue, CEA-CNRS, CEA Saclay, 91191 Gif-sur-Yvette cedex (France); Dillmann, Philippe [LRC CEA DSM 01-27: CNRS IRAMAT UMR5060, IPSE, and Laboratoire Pierre Sue, CEA Saclay, 91191 Gif-sur-Yvette Cedex (France); L' Hostis, Valerie [Laboratoire d' Etude du Comportement des Betons et Argiles, CEA, CE Saclay, 91191 Gif-sur-Yvette cedex (France); Beranger, Gerard [Universite de technologie de Compiegne, BP 60319, 60203 Compiegne (France)


    This paper deals with an analytical study on ferrous reinforcements embedded in hydraulic binders found in ancient buildings from the Middle Age period to the beginning of the 20. c. AD. The study of these kind of archaeological analogues is necessary to improve the knowledge on the long-term corrosion of low carbon steels that could be used in concrete to build the substructure of nuclear wastes reversible storage facilities. The corrosion system can be described as a multi-layer pattern made of the metal, a dense corrosion product layer, a transformed medium and a binder. All the morphological and physicochemical properties as composition, structure and porosities of these different parts were studied with different analytical methods as optical and electron microscopy, EDS coupled to SEM, EPMA, mercury porosimetry, micro Raman spectroscopy and micro Diffraction under Synchrotron Radiation. Moreover, average corrosion rates were evaluated by two different methods. These rates are relatively low compared to the same parameters measured on low alloyed steels immersed in aqueous environments and are comparable with results obtained for passivated systems. (authors)

  8. Characterising the loading direction sensitivity of 3D woven composites: Effect of z-binder architecture

    KAUST Repository

    Saleh, Mohamed Nasr


    Three different architectures of 3D carbon fibre woven composites (orthogonal, ORT; layer-to-layer, LTL; angle interlock, AI) were tested in quasi-static uniaxial tension. Mechanical tests (tensile in on-axis of warp and weft directions as well as 45 degrees off-axis) were carried out with the aim to study the loading direction sensitivity of these 3D woven composites. The z-binder architecture (the through-thickness reinforcement) has an effect on void content, directional fibre volume fraction, mechanical properties (on-axis and off-axis), failure mechanisms, energy absorption and fibre rotation angle in off-axis tested specimens. Out of all the examined architectures, 3D orthogonal woven composites (ORT) demonstrated a superior behaviour, especially when they were tested in 45 degrees off-axis direction, indicated by high strain to failure (similar to 23%) and high translaminar energy absorption (similar to 40 MJ/m(3)). The z-binder yarns in ORT architecture suppress the localised damage and allow larger fibre rotation during the fibre

  9. Galvanic Corrosion of Mg-Zr Alloy and Steel or Graphite in Mineral Binders (United States)

    Lambertin, David; Rooses, Adrien; Frizon, Fabien

    The dismantling of UNGG nuclear reactor generates numerous nuclear wastes such as fuel decanning commonly composed of Mg-Zr alloy. A conditioning strategy consists in encapsulating these wastes into a hydraulic binder in a suitable state for storage. The eventual presence of steel and graphite accompanying the magnesium wastes could imply corrosion by galvanic coupling. This work is an experimental investigation of the galvanic coupling between Mg-Zr alloy and steel or graphite using ZRA electrochemical method in Portland cement or geopolymer pastes. The lowest corrosion activity of magnesium alloy while coupled to graphite or steel cathode has been observed in geopolymer pastes. Indeed, in this binder, an efficient corrosion protection of the magnesium alloy maintains the galvanic current very low during all the hardening process. In geopolymer paste, current densities of anodised Mg-Zr alloy is not dependent of the cathode/anode surface ratio in the range of 0.1 to 5 due to the dominance of the anode resistance.

  10. DSC and TG Analysis of a Blended Binder Based on Waste Ceramic Powder and Portland Cement (United States)

    Pavlík, Zbyšek; Trník, Anton; Kulovaná, Tereza; Scheinherrová, Lenka; Rahhal, Viviana; Irassar, Edgardo; Černý, Robert


    Cement industry belongs to the business sectors characteristic by high energy consumption and high {CO}2 generation. Therefore, any replacement of cement in concrete by waste materials can lead to immediate environmental benefits. In this paper, a possible use of waste ceramic powder in blended binders is studied. At first, the chemical composition of Portland cement and ceramic powder is analyzed using the X-ray fluorescence method. Then, thermal and mechanical characterization of hydrated blended binders containing up to 24 % ceramic is carried out within the time period of 2 days to 28 days. The differential scanning calorimetry and thermogravimetry measurements are performed in the temperature range of 25°C to 1000°C in an argon atmosphere. The measurement of compressive strength is done according to the European standards for cement mortars. The thermal analysis results in the identification of temperature and quantification of enthalpy and mass changes related to the liberation of physically bound water, calcium-silicate-hydrates dehydration and portlandite, vaterite and calcite decomposition. The portlandite content is found to decrease with time for all blends which provides the evidence of the pozzolanic activity of ceramic powder even within the limited monitoring time of 28 days. Taking into account the favorable results obtained in the measurement of compressive strength, it can be concluded that the applied waste ceramic powder can be successfully used as a supplementary cementing material to Portland cement in an amount of up to 24 mass%.

  11. Assessment of Coagulant Synergy for the Depollution of Binder Emulsion Plant Effluent

    Directory of Open Access Journals (Sweden)

    Syed Farman Ali Shah


    Full Text Available Binder emulsion plant effluent is a source of intense pollution when discharged into the environment without proper degree of treatment due to its strong color as well as higher total suspended solids (TSS and chemical oxygen demand (COD contents. An empirical study was conducted to optimize the effect of the coagulants used for the removal of Color, Turbidity, TSS, and COD from binder emulsion effluent. The coagulants, used with and without the induction of Powdered Activated Carbon (PAC to enhance the decrease in pollution concentration, included Ferrous Sulfate, Ferric Chloride, Alum and Lime. Ferric Chloride used in combination with PAC produced a synergistic effect in terms of effluent depollution and transpired into efficient removal of effluent COD (83%, Color (98%, Turbidity (97% and TSS (96%. Induction of PAC with all the coagulants combined proved highly effective as well in decreasing the effluent COD, color, Turbidity and TSS by 91%, 99%, 99% and 97% respectively. In a combined process of coagulation and adsorption, combination of ferric chloride and PAC gave effective results in terms of pollutants removal by around 90% as compared to combination of PAC with other coagulants, yielding removal percentages of lower than 50%.

  12. CHARMM-GUI Ligand Binder for absolute binding free energy calculations and its application. (United States)

    Jo, Sunhwan; Jiang, Wei; Lee, Hui Sun; Roux, Benoît; Im, Wonpil


    Advanced free energy perturbation molecular dynamics (FEP/MD) simulation methods are available to accurately calculate absolute binding free energies of protein-ligand complexes. However, these methods rely on several sophisticated command scripts implementing various biasing energy restraints to enhance the convergence of the FEP/MD calculations, which must all be handled properly to yield correct results. Here, we present a user-friendly Web interface, CHARMM-GUI Ligand Binder ( ), to provide standardized CHARMM input files for calculations of absolute binding free energies using the FEP/MD simulations. A number of features are implemented to conveniently set up the FEP/MD simulations in highly customizable manners, thereby permitting an accelerated throughput of this important class of computations while decreasing the possibility of human errors. The interface and a series of input files generated by the interface are tested with illustrative calculations of absolute binding free energies of three nonpolar aromatic ligands to the L99A mutant of T4 lysozyme and three FK506-related ligands to FKBP12. Statistical errors within individual calculations are found to be small (~1 kcal/mol), and the calculated binding free energies generally agree well with the experimental measurements and the previous computational studies (within ~2 kcal/mol). Therefore, CHARMM-GUI Ligand Binder provides a convenient and reliable way to set up the ligand binding free energy calculations and can be applicable to pharmaceutically important protein-ligand systems.

  13. Selection of a mineral binder with potentialities for the stabilization/solidification of aluminum metal (United States)

    Cau Dit Coumes, C.; Lambertin, D.; Lahalle, H.; Antonucci, P.; Cannes, C.; Delpech, S.


    In a strongly alkaline medium, such as that encountered in conventional cementitious materials based on Portland cement, aluminum metal is corroded, with continued production of hydrogen. In order to develop a mineral matrix having enhanced compatibility with aluminum, a literature review was first undertaken to identify binders capable of reducing the pore solution pH compared with Portland cement. An experimental study was then carried out to measure the hydrogen production resulting from corrosion of aluminum metal rods encapsulated in the different selected cement pastes. The best results were achieved with magnesium phosphate cement, which released very little hydrogen over the duration of the study. This production could be reduced still further by adding a corrosion inhibitor (lithium nitrate) to the mixing solution. Open circuit potential measurement and Electrochemical Impedance Spectroscopy of aluminum electrode encapsulated in two pastes based on Portland cement and magnesium phosphate cement showed different redox behaviors. In the Portland cement paste, the electrochemical data confirmed the corrosion of aluminum whereas this latter tended to a passive state in the magnesium phosphate binder.

  14. Hardening kinetics investigation of alkali-activated binder by small amplitude oscillatory rheometry (United States)

    Rieger, D.; Kullová, L.; Čekalová, M.; Kovářík, T.


    In this study, the rheological behavior of geopolymeric inorganic binder was determined. This binder was synthesized by alkaline activation of mixture, comprising calcined claystone powder and milled blast furnace slag. As an alkaline activator of hardening process, the potassium silicate solution was used. For the investigation of hardening kinetics, the strain controlled small amplitude oscillatory rheometry was used with strain of 0.01%. The reproducibility and versatility of this method is demonstrated for determination of hardening process evolution. The changes of loss tangent shape were studied in this experiment and applied for determination of gelation time. All experiments were conducted at isothermal conditions in temperature range 27-70°C and parallel plate geometry. The results indicate that reaction kinetics is directly depending on temperature. The hardening kinetics was mathematically described and these calculations were compared with self-contained experiment conducted at 2°C. This experiment is described in details and the results of gelation time measurements confirmed calculated data.

  15. Binder Jetting: A Novel NdFeB Bonded Magnet Fabrication Process (United States)

    Paranthaman, M. Parans; Shafer, Christopher S.; Elliott, Amy M.; Siddel, Derek H.; McGuire, Michael A.; Springfield, Robert M.; Martin, Josh; Fredette, Robert; Ormerod, John


    The goal of this research is to fabricate near-net-shape isotropic (Nd)2Fe14B-based (NdFeB) bonded magnets using a three dimensional printing process to compete with conventional injection molding techniques used for bonded magnets. Additive manufacturing minimizes the waste of critical materials and allows for the creation of complex shapes and sizes. The binder jetting process works similarly to an inkjet printer. A print-head passes over a bed of NdFeB powder and deposits a polymer binding agent to bind the layer of particles together. The bound powder is then coated with another layer of powder, building the desired shape in successive layers of bonded powder. Upon completion, the green part and surrounding powders are placed in an oven at temperatures between 100°C and 150°C for 4-6 h to cure the binder. After curing, the excess powder can be brushed away to reveal the completed "green" part. Green magnet parts were then infiltrated with a clear urethane resin to achieve the measured density of the magnet of 3.47 g/cm3 close to 46% relative to the NdFeB single crystal density of 7.6 g/cm3. Magnetic measurements indicate that there is no degradation in the magnetic properties. This study provides a new pathway for preparing near-net-shape bonded magnets for various magnetic applications.

  16. Physical properties and compact analysis of commonly used direct compression binders. (United States)

    Zhang, Yeli; Law, Yuet; Chakrabarti, Sibu


    This study investigated the basic physico-chemical property and binding functionality of commonly used commercial direct compression binders/fillers. The compressibility of these materials was also analyzed using compression parameters derived from the Heckel, Kawakita, and Cooper-Eaton equations. Five classes of excipients were evaluated, including microcrystalline cellulose (MCC), starch, lactose, dicalcium phosphate (DCP), and sugar. In general, the starch category exhibited the highest moisture content followed by MCC, DCP, lactose, and finally sugar; DCP displayed the highest density, followed by sugar, lactose, starch, and MCC; the material particle size is highly processing dependent. The data also demonstrated that MCC had moderate flowability, excellent compressibility, and extremely good compact hardness; with some exceptions, starch, lactose, and sugar generally exhibited moderate flowability, compressibility, and hardness; DCP had excellent flowability, but poor compressibility and hardness. This research additionally confirmed the binding mechanism that had been well documented: MCC performs as binder because of its plastic deformation under pressure; fragmentation is the predominant mechanism in the case of lactose and DCP; starch and sugar perform by both mechanisms.

  17. Immunophotoaffinity labeling of binders of 1-methyladenine, the oocyte maturation-inducing hormone of starfish. (United States)

    Toraya, Tetsuo; Kida, Tetsuo; Kuyama, Atsushi; Matsuda, Shinjiro; Tanaka, Seiichi; Komatsu, Yo; Tsurukai, Taro


    Starfish oocytes are arrested at the prophase stage of the first meiotic division in the ovary and resume meiosis by the stimulus of 1-methyladenine (1-MeAde), the oocyte maturation-inducing hormone of starfish. Putative 1-MeAde receptors on the oocyte surface have been suggested, but not yet been biochemically characterized. Immunophotoaffinity labeling, i.e., photoaffinity labeling combined with immunochemical detection, was attempted to detect unknown 1-MeAde binders including putative maturation-inducing hormone receptors in starfish oocytes. When the oocyte crude membrane fraction or its Triton X-100/EDTA extract was incubated with N(6)-[6-(5-azido-2-nitrobenzoyl)aminohexyl]carboxamidomethyl-1-methyladenine and then photo-irradiated, followed by western blotting with antibody that was raised against a 1-MeAde hapten, a single band with Mr of 47.5 K was detected. The band was lost when extract was heated at 100 °C. A similar 47.5 K band was detected in the crude membrane fraction of testis as well. Upon labeling with whole cells, this band was detected in immature and maturing oocytes, but only faintly in mature oocytes. As judged from these results, this 1-MeAde binder might be a possible candidate of the starfish maturation-inducing hormone receptors.

  18. The Durability and Performance of Short Fibers for a Newly Developed Alkali-Activated Binder

    Directory of Open Access Journals (Sweden)

    Henrik Funke


    Full Text Available This study reports the development of a fiber-reinforced alkali-activated binder (FRAAB with an emphasis on the performance and the durability of the fibers in the alkaline alkali-activated binder (AAB-matrix. For the development of the matrix, the reactive components granulated slag and coal fly ash were used, which were alkali-activated with a mixture of sodium hydroxide (2–10 mol/L and an aqueous sodium silicate solution (SiO2/Na2O molar ratio: 2.1 at ambient temperature. For the reinforcement of the matrix integral fibers of alkali-resistant glass (AR-glass, E-glass, basalt, and carbon with a fiber volume content of 0.5% were used. By the integration of these short fibers, the three-point bending tensile strength of the AAB increased strikingly from 4.6 MPa (no fibers up to 5.7 MPa (carbon after one day. As a result of the investigations of the alkali resistance, the AR-glass and the carbon fibers showed the highest durability of all fibers in the FRAAB-matrix. In contrast to that, the weight loss of E-glass and basalt fibers was significant under the alkaline condition. According to these results, only the AR-glass and the carbon fibers reveal sufficient durability in the alkaline AAB-matrix.

  19. Dependency of Electrochemical Performances of Silicon Lithium-Ion Batteries on Glycosidic Linkages of Polysaccharide Binders. (United States)

    Yoon, Da-Eun; Hwang, Chihyun; Kang, Na-Ri; Lee, Ungju; Ahn, Dongjoon; Kim, Ju-Young; Song, Hyun-Kon


    Molecular structures of polysaccharide binders determining mechanical properties were correlated to electrochemical performances of silicon anodes for lithium-ion batteries. Glycosidic linkages (α and β) and side chains (-COOH and -OH) were selected and proven as the major factors of the molecular structures. Three different single-component polysaccharides were compared: pectin for α-linkages versus carboxylic methyl cellulose (CMC) for β-linkages from the linkage's standpoint, and pectin as a COOH-containing polymer and amylose as its non-COOH counterpart from the side chain's standpoint. Pectin was remarkably superior to CMC and amylose in cyclability and rate capability of battery cells based on silicon anodes. The pectin binder allowed volume expansion of silicon electrodes with keeping high porosity during lithiation due to the elastic nature caused by the chair-to-boat conformation in α-linkages of its backbone. Physical integrity of pectin-based electrodes was not challenged during repeated lithiation/delithiation cycles without crack development that was observed in rigid CMC-based electrodes. Covalent bonds formed between carboxylic side chains of pectin and silicon surface oxide prevented active silicon mass from being detached away from electric pathways. However, hydrogen bonds between hydroxyl side chains of amylose and silicon surface oxide were not strong enough to keep the silicon mass electrochemically active after cyclability tests.

  20. In vitro affinity screening of protein and peptide binders by megavalent bead surface display. (United States)

    Diamante, Letizia; Gatti-Lafranconi, Pietro; Schaerli, Yolanda; Hollfelder, Florian


    The advent of protein display systems has provided access to tailor-made protein binders by directed evolution. We introduce a new in vitro display system, bead surface display (BeSD), in which a gene is mounted on a bead via strong non-covalent (streptavidin/biotin) interactions and the corresponding protein is displayed via a covalent thioether bond on the DNA. In contrast to previous monovalent or low-copy bead display systems, multiple copies of the DNA and the protein or peptide of interest are displayed in defined quantities (up to 10(6) of each), so that flow cytometry can be used to obtain a measure of binding affinity. The utility of the BeSD in directed evolution is validated by library selections of randomized peptide sequences for binding to the anti-hemagglutinin (HA) antibody that proceed with enrichments in excess of 10(3) and lead to the isolation of high-affinity HA-tags within one round of flow cytometric screening. On-bead K(d) measurements suggest that the selected tags have affinities in the low nanomolar range. In contrast to other display systems (such as ribosome, mRNA and phage display) that are limited to affinity panning selections, BeSD possesses the ability to screen and rank binders by their affinity in vitro, a feature that hitherto has been exclusive to in vivo multivalent cell display systems (such as yeast display).

  1. Effect of the properties of natural resin binder in a high friction composite material

    Directory of Open Access Journals (Sweden)

    S. Stephen Bernard


    Full Text Available In this paper, a high-friction composite material based on the combination of binder, friction modifiers, fibers and fillers is investigated. In the binder, up to 20% of phenol are replaced by cardanol with various weight ratios of 100/0, 95/5, 90/10, 85/15, 80/20. Cardanol may react both through the phenolic group and the double bond of the side chain yielding addition, condensation and polymerisation reactions that allow the synthesis of tailor-made products and polymers of high value. In the present work, mechanical, thermal and wear characteristics of cardanol based phenolic resin with organic ingredients were manufactured and tested. An analysis of microstructure characteristics of composites was carried out using scanning electron microscope. The effect of environment on the composite was investigated in water, salty water and oil. The results showed that the addition of cardanol reduces the wear resistance and increases the compressibility which reduces the noise propensity.

  2. [Sucroferric oxyhydroxide, a novel iron-based phosphate binder. Which current use in dialysis patients? (United States)

    Bataille, Pierre; Delattre, Vincent; Daroux, Maité


    International guidelines suggest lowering elevated phosphorus level to the normal range in patients on dialysis. Among the phosphate-lowering strategies, phosphate binder is frequently used in addition to dietary phosphate restriction and an adequate dialysis strategy. However, serum phosphate concentration higher than 1.78mmol/L is observed in more than 40% of patients justifying the quest for new drugs. Sucroferric oxyhydroxide is one of the new iron-based agents and is available in France since May 2016. A recent international multicentre study showed this new drug to be as efficacious and non-inferior to sevelamer carbonate in magnitude of serum phosphate control. The serum phosphorus-lowering effect was maintained over 1year. When compared to carbonate sevelamer, the pill-burden was half with sucroferric oxyhydroxide because of its high phosphate binding capacity. As previously shown by experimental studies, no risk of iron accumulation was observed since iron absorption is negligible. Discolored feces and diarrhea were fairly frequent side effects. When diarrhea subsides, the tolerability of this new phosphate binder is excellent on a long-term basis. Copyright © 2017 Association Société de néphrologie. Published by Elsevier Masson SAS. All rights reserved.

  3. Effect of binder burnout on the sealing performance of glass ceramics for solid oxide fuel cells (United States)

    Ertugrul, Tugrul Y.; Celik, Selahattin; Mat, Mahmut D.


    The glass ceramics composite sealants are among few materials suitable for the solid oxide fuel cells (SOFC) due to their high operating temperatures (600 °C-850 °C). The glass ceramics chemically bond to both the metallic interconnector and the ceramic electrolyte and provide a gas tight connection. A careful and several stages manufacturing procedure is required to obtain a gas tight sealing. In this study, effects of binder burnout process on the sealing performance are investigated employing commercially available glass ceramic powders. The glass ceramic laminates are produced by mixing glass ceramic powders with the organic binders and employing a tape casting method. The laminates are sandwiched between the metallic interconnectors of an SOFC cell. The burnout and subsequent sealing quality are analyzed by measuring leakage rate and final macrostructure of sealing region. The effects of heating rate, dead weight load, solid loading, carrier gas and their flow rates are investigated. It is found that sealing quality is affected from all investigated parameters. While a slower heating rate is required for a better burnout, the mass flow rate of sweep gas must be adequate for removal of the burned gas. The leakage rate is reduced to 0.1 ml min-1 with 2 °C min-1 + 1 °C min-1 heating rate, 86.25% solid loading, 200 N dead weight load and 500 ml min-1 sweep gas flow rate.

  4. Fast redox of composite electrode of nitroxide radical polymer and carbon with polyacrylate binder (United States)

    Komaba, Shinichi; Tanaka, Tatsuya; Ozeki, Tomoaki; Taki, Takayuki; Watanabe, Hiroaki; Tachikawa, Hiroyuki

    For organic radical batteries, poly(2,2,6,6-tetramethylpiperidinyloxy-4-yl methacrylate) (PTMA) has been reported as a promising positive electrode material. The PTMA/C composite electrode prepared with polyacrylate binder demonstrated the fast redox performance for the application to aprotic secondary batteries. When the variation in discharge capacities of the PTMA/C composite electrode was tested galvanostatically at 20 C rates, the electrode retained 96% of the initial capacity after 1000 cycles. This is attributed to the fact that the redox of PTMA is a simple reaction to form the oxoammonium salt doped with ClO 4 - anions in the electrolyte. When the PTMA/C composite electrode was discharged at different C rates, the electrode retained 81% of the theoretical capacity even at 50 C rates. This remarkably high rate capability originates from the fast electron-transfer kinetic of the 2,2,6,6-tetramethylpiperidine- N-oxyl (so-called TEMPO) radical, partially jelled polyacrylate binder, and the improved conductivity throughout the electrode by thoroughly mixing with carbon.

  5. Enhancing mechanical properties of ceramic papers loaded with zeolites using borate compounds as binders

    Directory of Open Access Journals (Sweden)

    Juan P. Cecchini


    Full Text Available NaY zeolite-containing ceramic papers were prepared by a papermaking technique with a dual polyelectrolyte retention system that implied the use of cationic and anionic polymers. To improve their mechanical properties, we found that some borate compounds could be successfully used as ceramic binders. Three types of sodium and/or calcium borates were tested as binders: colemanite, nobleite, and anhydrous ulexite. The improvement in the mechanical properties depends both on the borate used and on the calcination temperature. By XRD it was determined that the faujasite structure collapsed after calcination at 700°C, which limited the final calcination temperature of zeolitic ceramic papers. Different amounts of NaY zeolite were added to ceramic papers and, as observed by SEM, faujasite particles were well distributed throughout the ceramic paper structure. Ceramic papers containing 1.2 wt.% zeolite after calcination at 650°C resulted in structured catalysts that were easy-to-handle, and which can be adapted to different conformations.

  6. Effect of rapid set binder on early strength and permeability of HES latex modified road repair pre-packed concrete (United States)

    Han, J. W.; Lee, S. K.; Yu, C.; Park, C. G.


    The early strength development characteristics and permeability resistance of high early strength (HES) pre-packed road repair concrete incorporating a rapid-set binder material were evaluated for emergency repairs to road pavement. The rapid-set binder is a mixture of rapid-set cement and silica sands whose fluidity improves with the addition of styrene butadiene latex (latex). The resulting mixture has a compressive strength of 21 MPa or higher and a flexural strength of greater than 3.5 MPa after 4 hours, the maximum curing age allowed for emergency repair materials. This study examines the strength development properties and permeability resistance of HES latex-modified pre-packed road repair concrete using a rapid- set binder as a function of the latex-to-binder mixing ratio at values of 0.40, 0.33, 0.29 and 0.25. Both early strength development properties and permeability resistance increased as the ratio of latex to rapid-set binder decreased. The mixture showed a compressive strength of 21 MPa or higher after 4 hours, which is the design standard of emergency repair concrete, only when this ratio was 0.29 or lower. A flexural strength of 3.5 MPa or greater was observed after hours only when this ratio was 0.33 or lower. The standard for permeability resistance, less than 2,000 C of chloride after 7 days of curing, was satisfied by all ratios. The ratio of latex to rapid-set binder satisfying all of the conditions for an emergency road repair material was 0.29 or less.

  7. Influence of the binder types on the electrochemical characteristics of natural graphite electrode in room-temperature ionic liquid (United States)

    Ui, Koichi; Towada, Jun; Agatsuma, Sho; Kumagai, Naoaki; Yamamoto, Keigo; Haruyama, Hiroshi; Takeuchi, Ken; Koura, Nobuyuki

    To improve the electrochemical characteristics of the natural graphite (NG-3) negative electrode in the LiCl saturated AlCl 3-1-ethyl-3-methylimizadolium chloride + thionyl chloride (SOCl 2) melt as the electrolyte for non-flammable lithium-ion batteries, we examined the influence of the binder types on its electrochemical characteristics. The cyclic voltammograms showed that the reduction current at 1.2-3.2 V vs. Li/Li(I) was repressed using polyacrylic acid (PAA) as the binder. The charge-discharge tests showed that the discharge capacity and the charge-discharge efficiency of the NG-3 electrode coated with the PAA binder at the 1st cycle were 322.8 mAh g -1 and 65.6%, respectively. Compared with the NG-3 electrode using the conventional poly(vinylidene fluoride) binder, it showed considerably a better cyclability with the discharge capacity of 302.1 mAh g -1 at the 50th cycle. Li(I) ion intercalation into the graphite layers could be improved because the NG-3 electrode coated with the PAA binder changed to a golden-yellow color after the 1st charging, and the formation of first stage LiC 6 was demonstrated by X-ray diffraction (XRD) measurement. In addition, the XRD and X-ray photoelectron spectroscopy indicated that one of the side reactions during charging was the formation of LiCl on the graphite surface regardless of the binder types.

  8. Effect of Warm Asphalt Additive on the Creep and Recovery Behaviour of Aged Binder Containing Waste Engine Oil (United States)

    Hassan, Norhidayah Abdul; Kamaruddin, Nurul Hidayah Mohd; Rosli Hainin, Mohd; Ezree Abdullah, Mohd


    The use of waste engine oil as an additive in asphalt mixture has been reported to be able to offset the stiffening effect caused by the recycled asphalt mixture. Additionally, the fumes and odor of the waste engine oil has caused an uncomfortable condition for the workers during road construction particularly at higher production temperature. Therefore, this problem was addressed by integrating chemical warm asphalt additive into the mixture which functions to reduce the mixing and compaction temperature. This study was initiated by blending the additive in the asphalt binder of bitumen penetration grade 80/100 prior to the addition of pavement mixture. The effect of chemical warm asphalt additive, Rediset WMX was investigated by modifying the aged binder containing waste engine oil with 0%, 1%, 2% and 3% by weight of the binder. The samples were then tested for determining the rutting behaviour under different loading stress levels of 3Pa (low), 10Pa (medium) and 50Pa (high) using Dynamic Shear Rheometer (DSR). A reference temperature of 60 °C was fixed to reflect the maximum temperature of the pavement. The results found that the addition of Rediset did not affect the creep and recovery behavior of the modified binder under different loading. On the other hand, 2% Rediset resulted a slight decrease in its rutting resistance as shown by the reduction of non-recoverable compliance under high load stress. However, overall, the inclusion of chemical warm asphalt additive to the modified binder did not adversely affect the rutting resistance which could be beneficial in lowering the temperature of asphalt production and simultaneously not compromising the binder properties.

  9. Influence of alumina binder content on catalytic performance of Ni/HZSM-5 for hydrodeoxygenation of cyclohexanone.

    Directory of Open Access Journals (Sweden)

    Xiangjin Kong

    Full Text Available The influence of the amount of alumina binders on the catalytic performance of Ni/HZSM-5 for hydrodeoxygenation of cyclohexanone was investigated in a fixed-bed reactor. N2 sorption, X-ray diffraction, H2-chemisorption and temperature-programmed desorption of ammonia were used to characterize the catalysts. It can be observed that the Ni/HZSM-5 catalyst bound with 30 wt.% alumina binder exhibited the best catalytic performance. The high catalytic performance may be due to relatively good Ni metal dispersion, moderate mesoporosity, and proper acidity of the catalyst.

  10. Preparation and characterization of RuO2/polyaniline/polymer binder composite electrodes for supercapacitor applications

    Directory of Open Access Journals (Sweden)



    Full Text Available The composite electrodes consisting of amorphous and hydrous RuO2, polyaniline and polymeric binder, Nafion® or poly(vinilydene fluoride were prepared. The electro¬chem-ical and pseudocapacitive properties of the prepared electrodes were investigated by cyclic voltammetry and electrochemical impedance spectroscopy. The results show that the responses of composite electrodes are very sensitive to the presence of individual components and their respective ratio in the mixture. The difference in the electro-chemical behavior was explained by the different physico-chemical properties of the polymeric binders.

  11. About the sizes of elastomer particles in the asphalt concrete binder providing the maximum service life of pavements (United States)

    Kaplan, A. M.; Chekunaev, N. I.


    It is noted that the durability of asphalt concrete pavements is determined by the time of the trunk cracks formation in the polymer-containing composites - in the modified by elastomers (e.g., by rubber) bitumenous binder of asphalt. Developed by the authors previously the theory of the cracks propagation in heterosystems [1] has allowed to investigate the problem of the cracks propagation in the rubber-bitumen composite. This investigations show that most effectively to prevente the trunk cracks formation in asphalt concrete can ultrafine rubber particles (150-750 nm) in a bitumenos binder of asphalt.

  12. Influence of alumina binder content on catalytic performance of Ni/HZSM-5 for hydrodeoxygenation of cyclohexanone. (United States)

    Kong, Xiangjin; Liu, Junhai


    The influence of the amount of alumina binders on the catalytic performance of Ni/HZSM-5 for hydrodeoxygenation of cyclohexanone was investigated in a fixed-bed reactor. N2 sorption, X-ray diffraction, H2-chemisorption and temperature-programmed desorption of ammonia were used to characterize the catalysts. It can be observed that the Ni/HZSM-5 catalyst bound with 30 wt.% alumina binder exhibited the best catalytic performance. The high catalytic performance may be due to relatively good Ni metal dispersion, moderate mesoporosity, and proper acidity of the catalyst.

  13. Production of activated charcoal beads or green moldnings useful in stationary or fluidized bed uses rotary stirrer(s) for mixing carbonaceous powder with binder

    DEFF Research Database (Denmark)


    In the production of activated charcoal beads or green moldings by mixing carbonaceous powder with a binder, mixing is carried out in a stirred vessel with rotary stirrer(s).......In the production of activated charcoal beads or green moldings by mixing carbonaceous powder with a binder, mixing is carried out in a stirred vessel with rotary stirrer(s)....

  14. Particle-based N-linked glycan analysis of selected proteins from biological samples using nonglycosylated binders. (United States)

    Sroka-Bartnicka, Anna; Karlsson, Isabella; Ndreu, Lorena; Quaranta, Alessandro; Pijnappel, Matthijs; Thorsén, Gunnar


    Glycosylation is one of the most common and important post-translational modifications, influencing both the chemical and the biological properties of proteins. Studying the glycosylation of the entire protein population of a sample can be challenging because variations in the concentrations of certain proteins can enhance or obscure changes in glycosylation. Furthermore, alterations in the glycosylation pattern of individual proteins, exhibiting larger variability in disease states, have been suggested as biomarkers for different types of cancer, as well as inflammatory and neurodegenerative diseases. In this paper, we present a rapid and efficient method for glycosylation analysis of individual proteins focusing on changes in the degree of fucosylation or other alterations to the core structure of the glycans, such as the presence of bisecting N-acetylglucosamines and a modified degree of branching. Streptavidin-coated magnetic beads are used in combination with genetically engineered immunoaffinity binders, called VHH antibody fragments. A major advantage of the VHHs is that they are nonglycosylated; thus, enzymatic release of glycans from the targeted protein can be performed directly on the beads. After deglycosylation, the glycans are analyzed by MALDI-TOF-MS. The developed method was evaluated concerning its specificity, and thereafter implemented for studying the glycosylation pattern of two different proteins, alpha-1-antitrypsin and transferrin, in human serum and cerebrospinal fluid. To our knowledge, this is the first example of a protein array-type experiment that employs bead-based immunoaffinity purification in combination with mass spectrometry analysis for fast and efficient glycan analysis of individual proteins in biological fluid. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Analysis of serum phosphate control and phosphate binder utilization in incident hemodialysis patients

    Directory of Open Access Journals (Sweden)



    Full Text Available Kimberly F Farrand,1 J Brian Copley,1 Jamie Heise,1 Moshe Fridman,2 Michael S Keith,1 Lynne Poole3 1Shire, Wayne, PA, USA; 2AMF Consulting, Los Angeles, CA, USA; 3Shire, Basingstoke, UK Abstract: The purpose of this study was to conduct a retrospective analysis of serum phosphate level variability in patients new to hemodialysis (HD and to identify patient characteristics associated with this variability. The medical records of 47,742 incident HD patients attending US outpatient dialysis centers between January 1, 2006 and March 31, 2009 were analyzed. Monthly mean serum phosphate levels determined over a 6-month evaluation period (months 4–9 after HD initiation were assigned to one of three strata: low (<1.13 mmol/L [<3.5 mg/dL]; target (1.13–1.78 mmol/L [3.5–5.5 mg/dL]; or high (>1.78 mmol/L [>5.5 mg/dL]. Patients were classified into one of six serum phosphate variability groups based on variability among monthly mean phosphate levels over the 6-month evaluation period: consistently target; consistently high; high-to-target; high-to-low; target-to-low; or consistently low. Only 15% of patients (consistently target group maintained monthly mean serum phosphate levels within the target range throughout the 6-month evaluation period. Age, Charlson comorbidity index, serum phosphate, and intact parathyroid hormone levels prior to HD initiation were strongly associated (P<0.001 with serum phosphate levels after HD initiation. Overall patient-reported phosphate binder usage increased from 35% at baseline to 52% at end of study. The low proportion of patients achieving target phosphate levels and low rates of phosphate binder usage observed during the study suggest that alternative strategies could be developed to control serum phosphate levels. Possible strategies that might be incorporated to help improve the management of hyperphosphatemia in incident HD patients include dietary modification, dialysis optimization, and earlier and sustained

  16. Comparison of efficacy of the phosphate binders nicotinic acid and sevelamer hydrochloride in hemodialysis patients

    Directory of Open Access Journals (Sweden)

    Farrokhlagha Ahmadi


    Full Text Available Hyperphosphatemia is a significant risk factor for the development of ectopic calcification and coronary artery diseases in patients on hemodialysis (HD, and must be controlled with the use of phosphate binders. Studies comparing the effects of sevelamer and nicotinic acid, both similar non-calcium and non-aluminum phosphate binders, are not available. In this study, 40 patients on HD with a serum phosphorus level of more than 6 mg/dL were enrolled. After a two week washout period without phosphate binders, the patients were randomly divided into two equal groups (n = 20 and were started on nicotinic acid or sevelamer for a period of four weeks. The dose of nicotinic acid used was 500 mg and that of sevelamer was 1600 mg daily. Blood samples were drawn for the measurement of the total calcium (Ca, phosphorus (P, alkaline phosphatase (ALP, triglyceride (TG, total cholesterol (Chol, high-density lipoprotein (HDL, low-density lipoprotein (LDL, uric acid and parathyroid hormone (PTH. Patients receiving sevelamer showed a significant reduction in serum P level (2.2 ± 0.69 mg/dL; P <0.0001 in comparison with the nicotinic acid group (1.7 ± 1.06 mg/dL; P = 0.004. Reduction in the Ca-P product was significantly different in the two groups; in the sevelamer group, it was 21 ± 7; (P <0.0001 while in the nicotinic acid group, it was 16 ± 11 (P = 0.007. Also, patients on sevelamer showed greater reduction in the mean TG level (38.9 ± 92 mg/dL; P = 0.005. No significant changes were observed in the mean serum Ca, total Chol, HDL, LDL, ALP and iPTH levels in the two study groups. Our short-term study suggests that although nicotinic acid reduced hyperphosphatemia, sevelamer showed higher efficacy in controlling hyperphosphatemia as well as the Ca-P product.

  17. Evaluation of polycyclic aromatic hydrocarbons in asphalt binder using matrix solid-phase dispersion and gas chromatography. (United States)

    Fernandes, Paulo R N; Soares, Sandra de A; Nascimento, Ronaldo F; Soares, Jorge B; Cavalcante, Rivelino M


    A method developed for the extraction and analysis of polycyclic aromatic hydrocarbons (PAHs) in the asphalt binder using a matrix solid-phase dispersion (MSPD) and gas chromatography is presented. The MSPD method was proposed as a rapid and easy approach to determining PAHs present in the maltenic phase of asphalt binder extracted through a mechanical shaking and sonication of the material. The recovery rates ranged from 62.77-89.92% (shaking) and from 56.54-93.6% (sonication) with relative standard deviations lower than 8.8%. The study shows that the recovery rates using shaking and sonication extractions are not significantly different at the p asphalt binder from Brazil. The main PAHs found were BbF, BaP, Per, IncdP, DahA, and BghiP, with average concentrations of 10.2-20.7 mg/kg, but the PAHs Ace and Acy were not detected. However, Nap, Fl, Phen, Ant, Flr, Pyr, Chry, BaA, and BkF were present in average concentrations amounting to less than 10 mg/kg. The results showed that the MSPD method is potentially a valuable tool for the determination of PAHs in the asphalt binder.

  18. Molecular Dynamics Study of the Separation Behavior at the Interface between PVDF Binder and Copper Current Collector

    Directory of Open Access Journals (Sweden)

    Seungjun Lee


    Full Text Available In Li-ion batteries, the mechanical strengths at the interfaces of binder/particle and binder/current collector play an important role in maintaining the mechanical integrity of the composite electrode. In this work, the separation behaviors between polyvinylidene fluoride (PVDF binders and copper current collectors are studied in the opening and sliding modes using molecular dynamics (MD simulations. The simulation shows that the separation occurs inside the PVDF rather than at the interface due to the strong adhesion between PVDF and copper. This fracture behavior is different from the behavior of the PVDF/graphite basal plane that shows a clear separation at the interface. The results suggest that the adhesion strength of the PVDF/copper is stronger than that of the PVDF/graphite basal plane. The methodology used in MD simulation can directly evaluate the adhesion strength at the interfaces of various materials between binders, substrates, and particles at the atomic scales. The proposed method can therefore provide a guideline for the design of the electrode in order to enhance the mechanical integrity for better battery performance.


    Tyrosinase-based carbon paste electrodes are evaluated with respect to the viscosity and polarity of the binder liquids. The electrodes constructed using a lower viscosity mineral oil or paraffin wax oil yielded a greater response to phenol and catechol than those using the hi...

  20. Using Selected Chemical and Physical Factors to Cross-link a BioCo Polymer Binder - Mineral Matrix System

    Directory of Open Access Journals (Sweden)

    B. Grabowska


    Full Text Available This publication describes research on the course of the process of cross-linking new BioCo polymer binders - in the form of water-based polymer compositions of poly(acrylic acid or poly(sodium acrylate/modified polysaccharide - using selected physical and chemical factors. It has been shown that the type of cross-linking factor used influences the strength parameters of the moulding sand. The crosslinking factors selected during basic research make it possible to obtain sand strengths similar to those of samples of sands bonded with commercial binders. Microwave radiation turned out to be the most effective cross-linking factor in a binder-matrix system. It was proven that adsorption in the microwave radiation field leads to the formation of polymer lattices with hydrogen bonds which play a major role in maintaining the formed cross-linked structures in the binder-matrix system. As a result, the process improves the strength parameters of the sand, whereas the hardening process in a microwave field significantly shortens the setting time.