Super Riemann surfaces

International Nuclear Information System (INIS)

Rogers, Alice

1990-01-01

A super Riemann surface is a particular kind of (1,1)-dimensional complex analytic supermanifold. From the point of view of super-manifold theory, super Riemann surfaces are interesting because they furnish the simplest examples of what have become known as non-split supermanifolds, that is, supermanifolds where the odd and even parts are genuinely intertwined, as opposed to split supermanifolds which are essentially the exterior bundles of a vector bundle over a conventional manifold. However undoubtedly the main motivation for the study of super Riemann surfaces has been their relevance to the Polyakov quantisation of the spinning string. Some of the papers on super Riemann surfaces are reviewed. Although recent work has shown all super Riemann surfaces are algebraic, some areas of difficulty remain. (author)

BREEDING SUPER-EARTHS AND BIRTHING SUPER-PUFFS IN TRANSITIONAL DISKS

Energy Technology Data Exchange (ETDEWEB)

Lee, Eve J.; Chiang, Eugene, E-mail: evelee@berkeley.edu, E-mail: echiang@astro.berkeley.edu [Department of Astronomy, University of California Berkeley, Berkeley, CA 94720-3411 (United States)

2016-02-01

The riddle posed by super-Earths (1–4R{sub ⊕}, 2–20M{sub ⊕}) is that they are not Jupiters: their core masses are large enough to trigger runaway gas accretion, yet somehow super-Earths accreted atmospheres that weigh only a few percent of their total mass. We show that this puzzle is solved if super-Earths formed late, as the last vestiges of their parent gas disks were about to clear. This scenario would seem to present fine-tuning problems, but we show that there are none. Ambient gas densities can span many (in one case up to 9) orders of magnitude, and super-Earths can still robustly emerge after ∼0.1–1 Myr with percent-by-weight atmospheres. Super-Earth cores are naturally bred in gas-poor environments where gas dynamical friction has weakened sufficiently to allow constituent protocores to gravitationally stir one another and merge. So little gas is present at the time of core assembly that cores hardly migrate by disk torques: formation of super-Earths can be in situ. The basic picture—that close-in super-Earths form in a gas-poor (but not gas-empty) inner disk, fed continuously by gas that bleeds inward from a more massive outer disk—recalls the largely evacuated but still accreting inner cavities of transitional protoplanetary disks. We also address the inverse problem presented by super-puffs: an uncommon class of short-period planets seemingly too voluminous for their small masses (4–10R{sub ⊕}, 2–6M{sub ⊕}). Super-puffs most easily acquire their thick atmospheres as dust-free, rapidly cooling worlds outside ∼1 AU where nebular gas is colder, less dense, and therefore less opaque. Unlike super-Earths, which can form in situ, super-puffs probably migrated in to their current orbits; they are expected to form the outer links of mean-motion resonant chains, and to exhibit greater water content. We close by confronting observations and itemizing remaining questions.

BREEDING SUPER-EARTHS AND BIRTHING SUPER-PUFFS IN TRANSITIONAL DISKS

International Nuclear Information System (INIS)

Lee, Eve J.; Chiang, Eugene

2016-01-01

The riddle posed by super-Earths (1–4R ⊕ , 2–20M ⊕ ) is that they are not Jupiters: their core masses are large enough to trigger runaway gas accretion, yet somehow super-Earths accreted atmospheres that weigh only a few percent of their total mass. We show that this puzzle is solved if super-Earths formed late, as the last vestiges of their parent gas disks were about to clear. This scenario would seem to present fine-tuning problems, but we show that there are none. Ambient gas densities can span many (in one case up to 9) orders of magnitude, and super-Earths can still robustly emerge after ∼0.1–1 Myr with percent-by-weight atmospheres. Super-Earth cores are naturally bred in gas-poor environments where gas dynamical friction has weakened sufficiently to allow constituent protocores to gravitationally stir one another and merge. So little gas is present at the time of core assembly that cores hardly migrate by disk torques: formation of super-Earths can be in situ. The basic picture—that close-in super-Earths form in a gas-poor (but not gas-empty) inner disk, fed continuously by gas that bleeds inward from a more massive outer disk—recalls the largely evacuated but still accreting inner cavities of transitional protoplanetary disks. We also address the inverse problem presented by super-puffs: an uncommon class of short-period planets seemingly too voluminous for their small masses (4–10R ⊕ , 2–6M ⊕ ). Super-puffs most easily acquire their thick atmospheres as dust-free, rapidly cooling worlds outside ∼1 AU where nebular gas is colder, less dense, and therefore less opaque. Unlike super-Earths, which can form in situ, super-puffs probably migrated in to their current orbits; they are expected to form the outer links of mean-motion resonant chains, and to exhibit greater water content. We close by confronting observations and itemizing remaining questions

The Super Patalan Numbers

OpenAIRE

Richardson, Thomas M.

2014-01-01

We introduce the super Patalan numbers, a generalization of the super Catalan numbers in the sense of Gessel, and prove a number of properties analagous to those of the super Catalan numbers. The super Patalan numbers generalize the super Catalan numbers similarly to how the Patalan numbers generalize the Catalan numbers.

Grassmann, super-Kac-Moody and super-derivation algebras

International Nuclear Information System (INIS)

Frappat, L.; Ragoucy, E.; Sorba, P.

1989-05-01

We study the cyclic cocycles of degree one on the Grassmann algebra and on the super-circle with N supersymmetries (i.e. the tensor product of the algebra of functions on the circle times a Grassmann algebra with N generators). They are related to central extensions of graded loop algebras (i.e. super-Kac-Moody algebras). The corresponding algebras of super-derivations have to be compatible with the cocycle characterizing the extension; we give a general method for determining these algebras and examine in particular the cases N = 1,2,3. We also discuss their relations with the Ademollo et al. algebras, and examine the possibility of defining new kinds of super-conformal algebras, which, for N > 1, generalize the N = 1 Ramond-Neveu-Schwarz algebra

Research and development of super light water reactors and super fast reactors in Japan

International Nuclear Information System (INIS)

Oka, Y.; Morooka, S.; Yamakawa, M.; Ishiwatari, Y.; Ikejiri, S.; Katsumura, Y.; Muroya, Y.; Terai, T.; Sasaki, K.; Mori, H.; Hamamoto, Y.; Okumura, K.; Kugo, T.; Nakatsuka, T.; Ezato, K.; Akasaka, N.; Hotta, A.

2011-01-01

Super Light Water Reactors (Super LWR) and Super Fast Reactors (Super FR) are the supercritical- pressure light water cooled reactors (SCWR) that are developed by the research group of University of Tokyo since 1989 and now jointly under development with the researchers of Waseda University, University of Tokyo and other organizations in Japan. The principle of the reactor concept development, the results of the past Super LWR and Super FR R&D as well as the R&D program of the Super FR second phase project are described. (author)

The super W∞ symmetry of the Manin-Radul super KP hierarchy

International Nuclear Information System (INIS)

Das, A.; Sin, S.J.

1991-11-01

We show that the Manin-Radul super KP hierarchy is invariant under super W ∞ transformations. These transformations are characterized by time dependent flows which commute with the usual flows generated by the conserved quantities of the super KP hierarchy. (author). 16 refs

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Reduction of 4-dim self dual super Yang-Mills onto super Riemann surfaces

International Nuclear Information System (INIS)

Mendoza, A.; Restuccia, A.; Martin, I.

1990-05-01

Recently self dual super Yang-Mills over a super Riemann surface was obtained as the zero set of a moment map on the space of superconnections to the dual of the super Lie algebra of gauge transformations. We present a new formulation of 4-dim Euclidean self dual super Yang-Mills in terms of constraints on the supercurvature. By dimensional reduction we obtain the same set of superconformal field equations which define self dual connections on a super Riemann surface. (author). 10 refs

Calculus super review

CERN Document Server

2012-01-01

Get all you need to know with Super Reviews! Each Super Review is packed with in-depth, student-friendly topic reviews that fully explain everything about the subject. The Calculus I Super Review includes a review of functions, limits, basic derivatives, the definite integral, combinations, and permutations. Take the Super Review quizzes to see how much you've learned - and where you need more study. Makes an excellent study aid and textbook companion. Great for self-study!DETAILS- From cover to cover, each in-depth topic review is easy-to-follow and easy-to-grasp - Perfect when preparing for

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Supermanifolds and super Riemann surfaces

International Nuclear Information System (INIS)

Rabin, J.M.

1986-09-01

The theory of super Riemann surfaces is rigorously developed using Rogers' theory of supermanifolds. The global structures of super Teichmueller space and super moduli space are determined. The super modular group is shown to be precisely the ordinary modular group. Super moduli space is shown to be the gauge-fixing slice for the fermionic string path integral

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

Deterministic phase measurements exhibiting super-sensitivity and super-resolution

DEFF Research Database (Denmark)

Schäfermeier, Clemens; Ježek, Miroslav; Madsen, Lars S.

2018-01-01

Phase super-sensitivity is obtained when the sensitivity in a phase measurement goes beyond the quantum shot noise limit, whereas super-resolution is obtained when the interference fringes in an interferometer are narrower than half the input wavelength. Here we show experimentally that these two...

Theory of super LIE groups

International Nuclear Information System (INIS)

Prakash, M.

1985-01-01

The theory of supergravity has attracted increasing attention in the recent years as a unified theory of elementary particle interactions. The superspace formulation of the theory is highly suggestive of an underlying geometrical structure of superspace. It also incorporates the beautifully geometrical general theory of relativity. It leads us to believe that a better understanding of its geometry would result in a better understanding of the theory itself, and furthermore, that the geometry of superspace would also have physical consequences. As a first step towards that goal, we develop here a theory of super Lie groups. These are groups that have the same relation to a super Lie algebra as Lie groups have to a Lie algebra. More precisely, a super Lie group is a super-manifold and a group such that the group operations are super-analytic. The super Lie algebra of a super Lie group is related to the local properties of the group near the identity. This work develops the algebraic and super-analytical tools necessary for our theory, including proofs of a set of existence and uniqueness theorems for a class of super-differential equations

Algebra & trigonometry super review

CERN Document Server

2012-01-01

Get all you need to know with Super Reviews! Each Super Review is packed with in-depth, student-friendly topic reviews that fully explain everything about the subject. The Algebra and Trigonometry Super Review includes sets and set operations, number systems and fundamental algebraic laws and operations, exponents and radicals, polynomials and rational expressions, equations, linear equations and systems of linear equations, inequalities, relations and functions, quadratic equations, equations of higher order, ratios, proportions, and variations. Take the Super Review quizzes to see how much y

Melting in super-earths.

Science.gov (United States)

Stixrude, Lars

2014-04-28

We examine the possible extent of melting in rock-iron super-earths, focusing on those in the habitable zone. We consider the energetics of accretion and core formation, the timescale of cooling and its dependence on viscosity and partial melting, thermal regulation via the temperature dependence of viscosity, and the melting curves of rock and iron components at the ultra-high pressures characteristic of super-earths. We find that the efficiency of kinetic energy deposition during accretion increases with planetary mass; considering the likely role of giant impacts and core formation, we find that super-earths probably complete their accretionary phase in an entirely molten state. Considerations of thermal regulation lead us to propose model temperature profiles of super-earths that are controlled by silicate melting. We estimate melting curves of iron and rock components up to the extreme pressures characteristic of super-earth interiors based on existing experimental and ab initio results and scaling laws. We construct super-earth thermal models by solving the equations of mass conservation and hydrostatic equilibrium, together with equations of state of rock and iron components. We set the potential temperature at the core-mantle boundary and at the surface to the local silicate melting temperature. We find that ancient (∼4 Gyr) super-earths may be partially molten at the top and bottom of their mantles, and that mantle convection is sufficiently vigorous to sustain dynamo action over the whole range of super-earth masses.

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

SuperB Progress Report: Detector

Energy Technology Data Exchange (ETDEWEB)

Grauges, E.; /Barcelona U., ECM; Donvito, G.; Spinoso, V.; /INFN, Bari /Bari U.; Manghisoni, M.; Re, V.; Traversi, G.; /INFN, Pavia /Bergamo U., Ingengneria Dept.; Eigen, G.; Fehlker, D.; Helleve, L.; /Bergen U.; Carbone, A.; Di Sipio, R.; Gabrielli, A.; Galli, D.; Giorgi, F.; Marconi, U.; Perazzini, S.; Sbarra, C.; Vagnoni, V.; Valentinetti, S.; Villa, M.; Zoccoli, A.; /INFN, Bologna /Bologna U. /Caltech /Carleton U. /Cincinnati U. /INFN, CNAF /INFN, Ferrara /Ferrara U. /UC, Irvine /Taras Shevchenko U. /Orsay, LAL /LBL, Berkeley /UC, Berkeley /Frascati /INFN, Legnaro /Orsay, IPN /Maryland U. /McGill U. /INFN, Milan /Milan U. /INFN, Naples /Naples U. /Novosibirsk, IYF /INFN, Padua /Padua U. /INFN, Pavia /Pavia U. /INFN, Perugia /Perugia U. /INFN, Perugia /Caltech /INFN, Pisa /Pisa U. /Pisa, Scuola Normale Superiore /PNL, Richland /Queen Mary, U. of London /Rutherford /INFN, Rome /Rome U. /INFN, Rome2 /Rome U.,Tor Vergata /INFN, Rome3 /Rome III U. /SLAC /Tel Aviv U. /INFN, Turin /Turin U. /INFN, Padua /Trento U. /INFN, Trieste /Trieste U. /TRIUMF /British Columbia U. /Montreal U. /Victoria U.

2012-02-14

This report describes the present status of the detector design for SuperB. It is one of four separate progress reports that, taken collectively, describe progress made on the SuperB Project since the publication of the SuperB Conceptual Design Report in 2007 and the Proceedings of SuperB Workshop VI in Valencia in 2008.

SuperB Progress Report: Detector

International Nuclear Information System (INIS)

Grauges, E.; Donvito, G.; Spinoso, V.; Manghisoni, M.; Re, V.; Traversi, G.; Eigen, G.; Fehlker, D.; Helleve, L.; Cheng, C.; Chivukula, A.; Doll, D.; Echenard, B.; Hitlin, D.; Ongmongkolkul, P.; Porter, F.; Rakitin, A.; Thomas, M.; Zhu, R.; Tatishvili, G.; Andreassen, R.; Fabby, C.; Meadows, B.; Simpson, A.; Sokoloff, M.; Tomko, K.; Fella, A.; Andreotti, M.; Baldini, W.; Calabrese, R.; Carassiti, V.; Cibinetto, G.; Cotta Ramusino, A.; Gianoli, A.; Luppi, E.; Munerato, M.; Santoro, V.; Tomassetti, L.; Stoker, D.; Bezshyyko, O.; Dolinska, G.; Arnaud, N.; Beigbeder, C.; Bogard, F.; Breton, D.; Burmistrov, L.; Charlet, D.; Maalmi, J.; Perez Perez, L.; Puill, V.; Stocchi, A.; Tocut, V.; Wallon, S.; Wormser, G.; Brown, D.

2012-01-01

This report describes the present status of the detector design for SuperB. It is one of four separate progress reports that, taken collectively, describe progress made on the SuperB Project since the publication of the SuperB Conceptual Design Report in 2007 and the Proceedings of SuperB Workshop VI in Valencia in 2008.

SuperB Progress Reports Accelerator

CERN Document Server

Biagini, Maria Enrica; Boscolo, M; Buonomo, B; Demma, T; Drago, A; Esposito, M; Guiducci, S; Mazzitelli, G; Pellegrino, L; Preger, M A; Raimondi, P; Ricci, R; Rotundo, U; Sanelli, C; Serio, M; Stella, A; Tomassini, S; Zobov, M; Bertsche, K; Brachman, A; Cai, Y; Chao, A; Chesnut, R; Donald, M.H; Field, C; Fisher, A; Kharakh, D; Krasnykh, A; Moffeit, K; Nosochkov, Y; Pivi, M; Seeman, J; Sullivan, M.K; Weathersby, S; Weidemann, A; Weisend, J; Wienands, U; Wittmer, W; Woods, M; Yocky, G; Bogomiagkov, A; Koop, I; Levichev, E; Nikitin, S; Okunev, I; Piminov, P; Sinyatkin, S; Shatilov, D; Vobly, P; Bosi, F; Liuzzo, S; Paoloni, E; Bonis, J; Chehab, R; Le Meur, G; Lepercq, P; Letellier-Cohen, F; Mercier, B; Poirier, F; Prevost, C; Rimbault, C; Touze, F; Variola, A; Bolzon, B; Brunetti, L; Jeremie, A; Baylac, M; Bourrion, O; De Conto, J M; Gomez, Y; Meot, F; Monseu, N; Tourres, D; Vescovi, C; Chanci, A; Napoly, O; Barber, D P; Bettoni, S; Quatraro, D

2010-01-01

This report details the present status of the Accelerator design for the SuperB Project. It is one of four separate progress reports that, taken collectively, describe progress made on the SuperB Project since the publication of the SuperB Conceptual Design Report in 2007 and the Proceedings of SuperB Workshop VI in Valencia in 2008.

Deformations of super Riemann surfaces

International Nuclear Information System (INIS)

Ninnemann, H.

1992-01-01

Two different approaches to (Konstant-Leites-) super Riemann surfaces are investigated. In the local approach, i.e. glueing open superdomains by superconformal transition functions, deformations of the superconformal structure are discussed. On the other hand, the representation of compact super Riemann surfaces of genus greater than one as a fundamental domain in the Poincare upper half-plane provides a simple description of super Laplace operators acting on automorphic p-forms. Considering purely odd deformations of super Riemann surfaces, the number of linear independent holomorphic sections of arbitrary holomorphic line bundles will be shown to be independent of the odd moduli, leading to a simple proof of the Riemann-Roch theorem for compact super Riemann surfaces. As a further consequence, the explicit connections between determinants of super Laplacians and Selberg's super zeta functions can be determined, allowing to calculate at least the 2-loop contribution to the fermionic string partition function. (orig.)

Deformations of super Riemann surfaces

Energy Technology Data Exchange (ETDEWEB)

Ninnemann, H [Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik

1992-11-01

Two different approaches to (Konstant-Leites-) super Riemann surfaces are investigated. In the local approach, i.e. glueing open superdomains by superconformal transition functions, deformations of the superconformal structure are discussed. On the other hand, the representation of compact super Riemann surfaces of genus greater than one as a fundamental domain in the Poincare upper half-plane provides a simple description of super Laplace operators acting on automorphic p-forms. Considering purely odd deformations of super Riemann surfaces, the number of linear independent holomorphic sections of arbitrary holomorphic line bundles will be shown to be independent of the odd moduli, leading to a simple proof of the Riemann-Roch theorem for compact super Riemann surfaces. As a further consequence, the explicit connections between determinants of super Laplacians and Selberg's super zeta functions can be determined, allowing to calculate at least the 2-loop contribution to the fermionic string partition function. (orig.).

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

Super periodic potential

Science.gov (United States)

Hasan, Mohammd; Mandal, Bhabani Prasad

2018-04-01

In this paper we introduce the concept of super periodic potential (SPP) of arbitrary order n, n ∈I+, in one dimension. General theory of wave propagation through SPP of order n is presented and the reflection and transmission coefficients are derived in their closed analytical form by transfer matrix formulation. We present scattering features of super periodic rectangular potential and super periodic delta potential as special cases of SPP. It is found that the symmetric self-similarity is the special case of super periodicity. Thus by identifying a symmetric fractal potential as special cases of SPP, one can obtain the tunnelling amplitude for a particle from such fractal potential. By using the formalism of SPP we obtain the close form expression of tunnelling amplitude of a particle for general Cantor and Smith-Volterra-Cantor potentials.

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

Frames in super Hilbert modules

Directory of Open Access Journals (Sweden)

Mehdi Rashidi-Kouchi

2018-01-01

Full Text Available In this paper, we define super Hilbert module and investigate frames in this space. Super Hilbert modules are  generalization of super Hilbert spaces in Hilbert C*-module setting. Also, we define frames in a super Hilbert module and characterize them by using of the concept of g-frames in a Hilbert C*-module. Finally, disjoint frames in Hilbert C*-modules are introduced and investigated.

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

(Super Variable Costing-Throughput Costing)

OpenAIRE

Çakıcı, Cemal

2006-01-01

(Super Variable Costing-Throughput Costing) The aim of this study is to explain the super-variable costing method which is a new subject in cost and management accounting and to show it’s working practicly.Shortly, super-variable costing can be defined as a costing method which is use only direct material costs in calculate of product costs and treats all costs except these (direct labor and overhead) as periad costs or operating costs.By using super-variable costing method, product costs ar...

Adhesive bonding of super-elastic titanium-nickel alloy castings with a phosphate metal conditioner and an acrylic adhesive.

Science.gov (United States)

Matsumura, H; Tanoue, N; Yanagida, H; Atsuta, M; Koike, M; Yoneyama, T

2003-06-01

The purpose of the current study was to evaluate the bonding characteristics of super-elastic titanium-nickel (Ti-Ni) alloy castings. Disk specimens were cast from a Ti-Ni alloy (Ti-50.85Ni mol%) using an arc centrifugal casting machine. High-purity titanium and nickel specimens were also prepared as experimental references. The specimens were air-abraded with alumina, and bonded with an adhesive resin (Super-Bond C & B). A metal conditioner containing a phosphate monomer (Cesead II Opaque Primer) was also used for priming the specimens. Post-thermocycling average bond strengths (MPa) of the primed groups were 41.5 for Ti-Ni, 30.4 for Ti and 19.5 for Ni, whereas those of the unprimed groups were 21.6 for Ti, 19.3 for Ti-Ni and 9.3 for Ni. Application of the phosphate conditioner elevated the bond strengths of all alloy/metals (P elastic Ti-Ni alloy castings can be achieved with a combination of a phosphate metal conditioner and a tri-n-butylborane-initiated adhesive resin.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

Directory of Open Access Journals (Sweden)

Kitchen James L

2012-11-01

Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

Science.gov (United States)

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

Electrically tuned super-capacitors

OpenAIRE

Chowdhury, Tazima S.; Grebel, Haim

2015-01-01

Fast charging and discharging of large amounts of electrical energy make super-capacitors ideal for short-term energy storage [1-5]. In its simplest form, the super-capacitor is an electrolytic capacitor made of an anode and a cathode immersed in an electrolyte. As for an ordinary capacitor, minimizing the charge separation distance and increasing the electrode area increase capacitance. In super-capacitors, charge separation is of nano-meter scale at each of the electrode interface (the Helm...

Example-Based Super-Resolution Fluorescence Microscopy.

Science.gov (United States)

Jia, Shu; Han, Boran; Kutz, J Nathan

2018-04-23

Capturing biological dynamics with high spatiotemporal resolution demands the advancement in imaging technologies. Super-resolution fluorescence microscopy offers spatial resolution surpassing the diffraction limit to resolve near-molecular-level details. While various strategies have been reported to improve the temporal resolution of super-resolution imaging, all super-resolution techniques are still fundamentally limited by the trade-off associated with the longer image acquisition time that is needed to achieve higher spatial information. Here, we demonstrated an example-based, computational method that aims to obtain super-resolution images using conventional imaging without increasing the imaging time. With a low-resolution image input, the method provides an estimate of its super-resolution image based on an example database that contains super- and low-resolution image pairs of biological structures of interest. The computational imaging of cellular microtubules agrees approximately with the experimental super-resolution STORM results. This new approach may offer potential improvements in temporal resolution for experimental super-resolution fluorescence microscopy and provide a new path for large-data aided biomedical imaging.

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

Handbook of Super 8 Production.

Science.gov (United States)

Telzer, Ronnie, Ed.

This handbook is designed for anyone interested in producing super 8 films at any level of complexity and cost. Separate chapters present detailed discussions of the following topics: super 8 production systems and super 8 shooting and editing systems; budgeting; cinematography and sound recording; preparing to edit; editing; mixing sound tracks;…

The super-resolution debate

Science.gov (United States)

Won, Rachel

2018-05-01

In the quest for nanoscopy with super-resolution, consensus from the imaging community is that super-resolution is not always needed and that scientists should choose an imaging technique based on their specific application.

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

SuperMAG: Present and Future Capabilities

Science.gov (United States)

Hsieh, S. W.; Gjerloev, J. W.; Barnes, R. J.

2009-12-01

SuperMAG is a global collaboration that provides ground magnetic field perturbations from a long list of stations in the same coordinate system, identical time resolution and with a common baseline removal approach. This unique high quality dataset provides a continuous and nearly global monitoring of the ground magnetic field perturbation. Currently, only archived data are available on the website and hence it targets basic research without any operational capabilities. The existing SuperMAG software can be easily adapted to ingest real-time or near real-time data and provide a now-casting capability. The SuperDARN program has a long history of providing near real-time maps of the northern hemisphere electrostatic potential and as both SuperMAG and SuperDARN share common software it is relatively easy to adapt these maps for global magnetic perturbations. Magnetometer measurements would be assimilated by the SuperMAG server using a variety of techniques, either by downloading data at regular intervals from remote servers or by real-time streaming connections. The existing SuperMAG analysis software would then process these measurements to provide the final calibrated data set using the SuperMAG coordinate system. The existing plotting software would then be used to produce regularly updated global plots. The talk will focus on current SuperMAG capabilities illustrating the potential for now-casting and eventually forecasting.

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Super-quasi-conformal transformation and Schiffer variation on super-Riemann surface

International Nuclear Information System (INIS)

Takahasi, Wataru

1990-01-01

A set of equations which characterizes the super-Teichmueller deformations is proposed. It is a supersymmetric extension of the Beltrami equation. Relations between the set of equations and the Schiffer variations with the KN bases are discussed. This application of the KN bases shows the powerfulness of the KN theory in the study of super-Riemann surfaces. (author)

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Super families

International Nuclear Information System (INIS)

Amato, N.; Maldonado, R.H.C.

1989-01-01

The study on phenomena in the super high energy region, Σ E j > 1000 TeV revealed events that present a big dark spot in central region with high concentration of energy and particles, called halo. Six super families with halo were analysed by Brazil-Japan Cooperation of Cosmic Rays. For each family the lateral distribution of energy density was constructed and R c Σ E (R c ) was estimated. For studying primary composition, the energy correlation with particles released separately in hadrons and gamma rays was analysed. (M.C.K.)

SuperAGILE Services at ASDC

International Nuclear Information System (INIS)

Preger, B.; Verrecchia, F.; Pittori, C.; Antonelli, L. A.; Giommi, P.; Lazzarotto, F.; Evangelista, Y.

2008-01-01

The Italian Space Agency Science Data Center (ASDC) is a facility with several responsibilities including support to all the ASI scientific missions as for management and archival of the data, acting as the interface between ASI and the scientific community and providing on-line access to the data hosted. In this poster we describe the services that ASDC provides for SuperAGILE, in particular the ASDC public web pages devoted to the dissemination of SuperAGILE scientific results. SuperAGILE is the X-Ray imager onboard the AGILE mission, and provides the scientific community with orbit-by-orbit information on the observed sources. Crucial source information including position and flux in chosen energy bands will be reported in the SuperAGILE public web page at ASDC. Given their particular interest, another web page will be dedicated entirely to GRBs and other transients, where new event alerts will be notified and where users will find all the available informations on the GRBs detected by SuperAGILE

The Super-Kamiokande detector

International Nuclear Information System (INIS)

Fukuda, S.; Fukuda, Y.; Hayakawa, T.; Ichihara, E.; Ishitsuka, M.; Itow, Y.; Kajita, T.; Kameda, J.; Kaneyuki, K.; Kasuga, S.; Kobayashi, K.; Kobayashi, Y.; Koshio, Y.; Miura, M.; Moriyama, S.; Nakahata, M.; Nakayama, S.; Namba, T.; Obayashi, Y.; Okada, A.; Oketa, M.; Okumura, K.; Oyabu, T.; Sakurai, N.; Shiozawa, M.; Suzuki, Y.; Takeuchi, Y.; Toshito, T.; Totsuka, Y.; Yamada, S.; Desai, S.; Earl, M.; Hong, J.T.; Kearns, E.; Masuzawa, M.; Messier, M.D.; Stone, J.L.; Sulak, L.R.; Walter, C.W.; Wang, W.; Scholberg, K.; Barszczak, T.; Casper, D.; Liu, D.W.; Gajewski, W.; Halverson, P.G.; Hsu, J.; Kropp, W.R.; Mine, S.; Price, L.R.; Reines, F.; Smy, M.; Sobel, H.W.; Vagins, M.R.; Ganezer, K.S.; Keig, W.E.; Ellsworth, R.W.; Tasaka, S.; Flanagan, J.W.; Kibayashi, A.; Learned, J.G.; Matsuno, S.; Stenger, V.J.; Hayato, Y.; Ishii, T.; Ichikawa, A.; Kanzaki, J.; Kobayashi, T.; Maruyama, T.; Nakamura, K.; Oyama, Y.; Sakai, A.; Sakuda, M.; Sasaki, O.; Echigo, S.; Iwashita, T.; Kohama, M.; Suzuki, A.T.; Hasegawa, M.; Inagaki, T.; Kato, I.; Maesaka, H.; Nakaya, T.; Nishikawa, K.; Yamamoto, S.; Haines, T.J.; Kim, B.K.; Sanford, R.; Svoboda, R.; Blaufuss, E.; Chen, M.L.; Conner, Z.; Goodman, J.A.; Guillian, E.; Sullivan, G.W.; Turcan, D.; Habig, A.; Ackerman, M.; Goebel, F.; Hill, J.; Jung, C.K.; Kato, T.; Kerr, D.; Malek, M.; Martens, K.; Mauger, C.; McGrew, C.; Sharkey, E.; Viren, B.; Yanagisawa, C.; Doki, W.; Inaba, S.; Ito, K.; Kirisawa, M.; Kitaguchi, M.; Mitsuda, C.; Miyano, K.; Saji, C.; Takahata, M.; Takahashi, M.; Higuchi, K.; Kajiyama, Y.; Kusano, A.; Nagashima, Y.; Nitta, K.; Takita, M.; Yamaguchi, T.; Yoshida, M.; Kim, H.I.; Kim, S.B.; Yoo, J.; Okazawa, H.; Etoh, M.; Fujita, K.; Gando, Y.; Hasegawa, A.; Hasegawa, T.; Hatakeyama, S.; Inoue, K.; Ishihara, K.; Iwamoto, T.; Koga, M.; Nishiyama, I.; Ogawa, H.; Shirai, J.; Suzuki, A.; Takayama, T.; Tsushima, F.; Koshiba, M.; Ichikawa, Y.; Hashimoto, T.; Hatakeyama, Y.; Koike, M.; Horiuchi, T.; Nemoto, M.; Nishijima, K.; Takeda, H.; Fujiyasu, H.; Futagami, T.; Ishino, H.; Kanaya, Y.; Morii, M.; Nishihama, H.; Nishimura, H.; Suzuki, T.; Watanabe, Y.; Kielczewska, D.; Golebiewska, U.; Berns, H.G.; Boyd, S.B.; Doyle, R.A.; George, J.S.; Stachyra, A.L.; Wai, L.L.; Wilkes, R.J.; Young, K.K.; Kobayashi, H.

2003-01-01

Super-Kamiokande is the world's largest water Cherenkov detector, with net mass 50,000 tons. During the period April, 1996 to July, 2001, Super-Kamiokande I collected 1678 live-days of data, observing neutrinos from the Sun, Earth's atmosphere, and the K2K long-baseline neutrino beam with high efficiency. These data provided crucial information for our current understanding of neutrino oscillations, as well as setting stringent limits on nucleon decay. In this paper, we describe the detector in detail, including its site, configuration, data acquisition equipment, online and offline software, and calibration systems which were used during Super-Kamiokande I

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

Generation of live offspring from vitrified embryos with synthetic polymers SuperCool X-1000 and SuperCool Z-1000.

Science.gov (United States)

Marco-Jimenez, F; Jimenez-Trigos, E; Lavara, R; Vicente, J S

2014-01-01

Ice growth and recrystallisation are considered important factors in determining vitrification outcomes. Synthetic polymers inhibit ice formation during cooling or warming of the vitrification process. The aim of this study was to assess the effect of adding commercially available synthetic polymers SuperCool X-1000 and SuperCool Z-1000 to vitrification media on in vivo development competence of rabbit embryos. Four hundred and thirty morphologically normal embryos recovered at 72 h of gestation were used. The vitrification media contained 20% dimethyl sulphoxide and 20% ethylene glycol, either alone or in combination with 1% of SuperCool X-1000 and 1% SuperCool. Our results show that embryos can be successfully vitrified using SuperCool X-1000 and SuperCool Z-1000 and when embryos are transferred, live offspring can be successfully produced. In conclusion, our results demonstrated that we succeeded for the first time in obtaining live offspring after vitrification of embryos using SuperCool X-1000 and SuperCool Z-1000 polymers.

Further results on super graceful labeling of graphs

Directory of Open Access Journals (Sweden)

Gee-Choon Lau

2016-08-01

Full Text Available Let G=(V(G,E(G be a simple, finite and undirected graph of order p and size q. A bijection f:V(G∪E(G→{k,k+1,k+2,…,k+p+q−1} such that f(uv=|f(u−f(v| for every edge uv∈E(G is said to be a k-super graceful labeling of G. We say G is k-super graceful if it admits a k-super graceful labeling. For k=1, the function f is called a super graceful labeling and a graph is super graceful if it admits a super graceful labeling. In this paper, we study the super gracefulness of complete graph, the disjoint union of certain star graphs, the complete tripartite graphs K(1,1,n, and certain families of trees. We also present four methods of constructing new super graceful graphs. In particular, all trees of order at most 7 are super graceful. We conjecture that all trees are super graceful.

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

Super cool X-1000 and Super cool Z-1000, two ice blockers, and their effect on vitrification/warming of mouse embryos.

Science.gov (United States)

Badrzadeh, H; Najmabadi, S; Paymani, R; Macaso, T; Azadbadi, Z; Ahmady, A

2010-07-01

To evaluate the survival and blastocyst formation rates of mouse embryos after vitrification/thaw process with different ice blocker media. We used X-1000 and Z-1000 separately and mixed using V-Kim, a closed vitrification system. Mouse embryos were vitrified using ethylene glycol based medium supplemented with Super cool X-1000 and/or Super cool Z-1000. Survival rates for the control, Super cool X-1000, Super cool Z-1000, and Super cool X-1000/Z-1000 groups were 74%, 72%, 68%, and 85% respectively, with no significant difference among experimental and control groups; however, a significantly higher survival rate was noticed in the Super cool X-1000/Z-1000 group when compared with the Super cool Z-1000 group. Blastocyst formation rates for the control, Super cool X-1000, Super cool Z-1000, and Super cool X-1000/Z-1000 groups were 71%, 66%, 65%, and 72% respectively. There was no significant difference in this rate among control and experimental groups. In a closed vitrification system, addition of ice blocker Super cool X-1000 to the vitrification solution containing Super cool Z-1000 may improve the embryo survival rate. We recommend combined ice blocker usage to optimize the vitrification outcome. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

Superstring field theories on super-flag manifolds: superdiff S1/S1 and superdiff S1/super S1

International Nuclear Information System (INIS)

Zhao Zhiyong; Wu, Ke; Saito, Takesi

1987-01-01

We generalize the geometric approach of Bowick and Rajeev [BR] to superstring field theories. The anomaly is identified with nonvanishing of the Ricci curvature of the super-flag manifold. We explicitly calculate the curvatures of superdiff S 1 /S 1 and superdiff S 1 /superS 1 using super-Toeplitz operator techniques. No regularization is needed in this formalism. The critical dimension D=10 is rediscovered as a result of vanishing curvature of the product bundle over the super-flag manifold. (orig.)

SuperB Progress Report for Physics

Energy Technology Data Exchange (ETDEWEB)

O' Leary, B.; /Aachen, Tech. Hochsch.; Matias, J.; Ramon, M.; /Barcelona, IFAE; Pous, E.; /Barcelona U.; De Fazio, F.; Palano, A.; /INFN, Bari; Eigen, G.; /Bergen U.; Asgeirsson, D.; /British Columbia U.; Cheng, C.H.; Chivukula, A.; Echenard, B.; Hitlin, D.G.; Porter, F.; Rakitin, A.; /Caltech; Heinemeyer, S.; /Cantabria Inst. of Phys.; McElrath, B.; /CERN; Andreassen, R.; Meadows, B.; Sokoloff, M.; /Cincinnati U.; Blanke, M.; /Cornell U., Phys. Dept.; Lesiak, T.; /Cracow, INP /DESY /Zurich, ETH /INFN, Ferrara /Frascati /INFN, Genoa /Glasgow U. /Indiana U. /Mainz U., Inst. Phys. /Karlsruhe, Inst. Technol. /KEK, Tsukuba /LBL, Berkeley /UC, Berkeley /Lisbon, IST /Ljubljana U. /Madrid, Autonoma U. /Maryland U. /MIT /INFN, Milan /McGill U. /Munich, Tech. U. /Notre Dame U. /PNL, Richland /INFN, Padua /Paris U., VI-VII /Orsay, LAL /Orsay, LPT /INFN, Pavia /INFN, Perugia /INFN, Pisa /Queen Mary, U. of London /Regensburg U. /Republica U., Montevideo /Frascati /INFN, Rome /INFN, Rome /INFN, Rome /Rutherford /Sassari U. /Siegen U. /SLAC /Southern Methodist U. /Tel Aviv U. /Tohoku U. /INFN, Turin /INFN, Trieste /Uppsala U. /Valencia U., IFIC /Victoria U. /Wayne State U. /Wisconsin U., Madison

2012-02-14

SuperB is a high luminosity e{sup +}e{sup -} collider that will be able to indirectly probe new physics at energy scales far beyond the reach of any man made accelerator planned or in existence. Just as detailed understanding of the Standard Model of particle physics was developed from stringent constraints imposed by flavour changing processes between quarks, the detailed structure of any new physics is severely constrained by flavour processes. In order to elucidate this structure it is necessary to perform a number of complementary studies of a set of golden channels. With these measurements in hand, the pattern of deviations from the Standard Model behavior can be used as a test of the structure of new physics. If new physics is found at the LHC, then the many golden measurements from SuperB will help decode the subtle nature of the new physics. However if no new particles are found at the LHC, SuperB will be able to search for new physics at energy scales up to 10-100 TeV. In either scenario, flavour physics measurements that can be made at SuperB play a pivotal role in understanding the nature of physics beyond the Standard Model. Examples for using the interplay between measurements to discriminate New Physics models are discussed in this document. SuperB is a Super Flavour Factory, in addition to studying large samples of B{sub u,d,s}, D and {tau} decays, SuperB has a broad physics programme that includes spectroscopy both in terms of the Standard Model and exotica, and precision measurements of sin{sup 2} {theta}{sub W}. In addition to performing CP violation measurements at the {Upsilon}(4S) and {phi}(3770), SuperB will test CPT in these systems, and lepton universality in a number of different processes. The multitude of rare decay measurements possible at SuperB can be used to constrain scenarios of physics beyond the Standard Model. In terms of other precision tests of the Standard Model, this experiment will be able to perform precision over

SuperB Progress Report for Physics

International Nuclear Information System (INIS)

O'Leary, B.; Matias, J.; Ramon, M.

2012-01-01

SuperB is a high luminosity e + e - collider that will be able to indirectly probe new physics at energy scales far beyond the reach of any man made accelerator planned or in existence. Just as detailed understanding of the Standard Model of particle physics was developed from stringent constraints imposed by flavour changing processes between quarks, the detailed structure of any new physics is severely constrained by flavour processes. In order to elucidate this structure it is necessary to perform a number of complementary studies of a set of golden channels. With these measurements in hand, the pattern of deviations from the Standard Model behavior can be used as a test of the structure of new physics. If new physics is found at the LHC, then the many golden measurements from SuperB will help decode the subtle nature of the new physics. However if no new particles are found at the LHC, SuperB will be able to search for new physics at energy scales up to 10-100 TeV. In either scenario, flavour physics measurements that can be made at SuperB play a pivotal role in understanding the nature of physics beyond the Standard Model. Examples for using the interplay between measurements to discriminate New Physics models are discussed in this document. SuperB is a Super Flavour Factory, in addition to studying large samples of B u,d,s , D and τ decays, SuperB has a broad physics programme that includes spectroscopy both in terms of the Standard Model and exotica, and precision measurements of sin 2 θ W . In addition to performing CP violation measurements at the Υ(4S) and φ(3770), SuperB will test CPT in these systems, and lepton universality in a number of different processes. The multitude of rare decay measurements possible at SuperB can be used to constrain scenarios of physics beyond the Standard Model. In terms of other precision tests of the Standard Model, this experiment will be able to perform precision over-constraints of the unitarity triangle through

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

Architectural Engineering to Super-Light Structures

DEFF Research Database (Denmark)

Castberg, Niels Andreas

The increasing global urbanisation creates a great demand for new buildings. In the aim to honour this, a new structural system, offering flexibility and variation at no extra cost appears beneficial. Super-Light Structures constitute such a system. This PhD thesis examines Super-Light Structures...... with architectural engineering as a starting point. The thesis is based on a two stringed hypothesis: Architectural engineering gives rise to better architecture and Super-Light Structures support and enables a static, challenging architecture. The aim of the thesis is to clarify architectural engineering's impact...... on the work process between architects and engineers in the design development. Using architectural engineering, Super-Light Structures are examined in an architectural context, and it is explained how digital tools can support architectural engineering and design of Super-Light Structures. The experiences...

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Detecting Water on Super-Earths Using JAVST

Science.gov (United States)

Deming, D.

2010-01-01

Nearby lower train sequence stars host a class of planets known as Super-Earths, that have no analog in our own solar system. Super-Earths are rocky and/or icy planets with masses up to about 10 Earth masses, They are expected to host atmospheres generated by a number of processes including accretion of chondritic material. Water vapor should be a common constituent of super-Earth atmospheres, and may be detectable in transiting super-Earths using transmission spectroscopy during primar y eclipse, and emission spectroscopy at secondary eclipse. I will discuss the prospects for super-Earth atmospheric measurements using JWST.

Supergrassmannians, super τ-functions and strings

International Nuclear Information System (INIS)

Dolgikh, S.N.; Schwarz, A.S.

1989-03-01

Recently, infinite-dimensional grassmannians and their supergeneralizations were used to study conformal two-dimensional fields and strings. In particular, the super Mumford form (holomorphic square root from the superstring measure on moduli space) was expressed through super analog of Sato τ-function. In this paper we present results of supergrassmannians and super τ-functions. 8 refs

Toolbox for super-structured and super-structure free multi-disciplinary building spatial design optimisation

NARCIS (Netherlands)

Boonstra, S.; van der Blom, K.; Hofmeyer, H.; Emmerich, M.T.M.; van Schijndel, A.W.M.; de Wilde, P.

2018-01-01

Multi-disciplinary optimisation of building spatial designs is characterised by large solution spaces. Here two approaches are introduced, one being super-structured and the other super-structure free. Both are different in nature and perform differently for large solution spaces and each requires

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

Super Virasoro algebra and solvable supersymmetric quantum field theories

International Nuclear Information System (INIS)

Yamanaka, Itaru; Sasaki, Ryu.

1987-09-01

Interesting and deep relationships between super Virasoro algebras and super soliton systems (super KdV, super mKdV and super sine-Gordon equations) are investigated at both classical and quantum levels. An infinite set of conserved quantities responsible for solvability is characterized by super Virasoro algebras only. Several members of the infinite set of conserved quantities are derived explicitly. (author)

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Is Quantum Gravity a Super-Quantum Theory?

OpenAIRE

Chang, Lay Nam; Lewis, Zachary; Minic, Djordje; Takeuchi, Tatsu

2013-01-01

We argue that quantum gravity should be a super-quantum theory, that is, a theory whose non-local correlations are stronger than those of canonical quantum theory. As a super-quantum theory, quantum gravity should display distinct experimentally observable super-correlations of entangled stringy states.

Learning from errors in super-resolution.

Science.gov (United States)

Tang, Yi; Yuan, Yuan

2014-11-01

A novel framework of learning-based super-resolution is proposed by employing the process of learning from the estimation errors. The estimation errors generated by different learning-based super-resolution algorithms are statistically shown to be sparse and uncertain. The sparsity of the estimation errors means most of estimation errors are small enough. The uncertainty of the estimation errors means the location of the pixel with larger estimation error is random. Noticing the prior information about the estimation errors, a nonlinear boosting process of learning from these estimation errors is introduced into the general framework of the learning-based super-resolution. Within the novel framework of super-resolution, a low-rank decomposition technique is used to share the information of different super-resolution estimations and to remove the sparse estimation errors from different learning algorithms or training samples. The experimental results show the effectiveness and the efficiency of the proposed framework in enhancing the performance of different learning-based algorithms.

Superparticle on the 'super' Poincare upper half plane

Energy Technology Data Exchange (ETDEWEB)

Uehara, S; Yasui, Yukinora

1988-03-17

A non-relativistic superparticle moving freely on the 'super' Poincare upper half plane is investigated. The lagrangian is invariant under the super Moebius transformations SPL (2, R), so that it can be projected into the lagrangian on the super Riemann surface. The quantum hamiltonian becomes the 'super' Laplace-Beltrami operator in the curved superspace.

Super boson-fermion correspondence

International Nuclear Information System (INIS)

Kac, V.G.; Leur van de, J.W.

1987-01-01

Since the pioneering work of Skyrme, the boson-fermion correspondence has been playing an increasingly important role in 2-dimensional quantum field theory. More recently, it has become an important ingredient in the work of the Kyoto school on the KP hierarchy of soliton equations. In the present paper we establish a super boson-fermion correspondence, having in mind its applications to super KP hierarchies

The Solution Construction of Heterotic Super-Liouville Model

Science.gov (United States)

Yang, Zhan-Ying; Zhen, Yi

2001-12-01

We investigate the heterotic super-Liouville model on the base of the basic Lie super-algebra Osp(1|2).Using the super extension of Leznov-Saveliev analysis and Drinfeld-Sokolov linear system, we construct the explicit solution of the heterotic super-Liouville system in component form. We also show that the solutions are local and periodic by calculating the exchange relation of the solution. Finally starting from the action of heterotic super-Liouville model, we obtain the conserved current and conserved charge which possessed the BRST properties.

Super-radiance in Nuclear Physics

International Nuclear Information System (INIS)

Auerbach, N

2015-01-01

The theory of the super-radiant mechanism as applied to various phenomena in nuclear physics is presented. The connection between super-radiance and the notion of doorway is presented. The statistics of resonance widths in a many-body Fermi system with open channels is discussed. Depending on the strength of the coupling to the continuum such systems show deviations from the standard Porter-Thomas distribution. The deviations result from the process of increasing interaction of the intrinsic states via the common decay channels. In the limit of very strong coupling this leads to super-radiance. (paper)

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Super-hydrophobic surfaces of SiO₂-coated SiC nanowires: fabrication, mechanism and ultraviolet-durable super-hydrophobicity.

Science.gov (United States)

Zhao, Jian; Li, Zhenjiang; Zhang, Meng; Meng, Alan

2015-04-15

The interest in highly water-repellent surfaces of SiO2-coated SiC nanowires has grown in recent years due to the desire for self-cleaning and anticorrosive surfaces. It is imperative that a simple chemical treatment with fluoroalkylsilane (FAS, CF3(CF2)7CH2CH2Si(OC2H5)3) in ethanol solution at room temperature resulted in super-hydrophobic surfaces of SiO2-coated SiC nanowires. The static water contact angle of SiO2-coated SiC nanowires surfaces was changed from 0° to 153° and the morphology, microstructure and crystal phase of the products were almost no transformation before and after super-hydrophobic treatment. Moreover, a mechanism was expounded reasonably, which could elucidate the reasons for their super-hydrophobic behavior. It is important that the super-hydrophobic surfaces of SiO2-coated SiC nanowires possessed ultraviolet-durable (UV-durable) super-hydrophobicity. Copyright © 2014 Elsevier Inc. All rights reserved.

Performing the Super Instrument

DEFF Research Database (Denmark)

Kallionpaa, Maria

2016-01-01

can empower performers by producing super instrument works that allow the concert instrument to become an ensemble controlled by a single player. The existing instrumental skills of the performer can be multiplied and the qualities of regular acoustic instruments extended or modified. Such a situation......The genre of contemporary classical music has seen significant innovation and research related to new super, hyper, and hybrid instruments, which opens up a vast palette of expressive potential. An increasing number of composers, performers, instrument designers, engineers, and computer programmers...... have become interested in different ways of “supersizing” acoustic instruments in order to open up previously-unheard instrumental sounds. Super instruments vary a great deal but each has a transformative effect on the identity and performance practice of the performing musician. Furthermore, composers...

Deriving Global Convection Maps From SuperDARN Measurements

Science.gov (United States)

Gjerloev, J. W.; Waters, C. L.; Barnes, R. J.

2018-04-01

A new statistical modeling technique for determining the global ionospheric convection is described. The principal component regression (PCR)-based technique is based on Super Dual Auroral Radar Network (SuperDARN) observations and is an advanced version of the PCR technique that Waters et al. (https//:doi.org.10.1002/2015JA021596) used for the SuperMAG data. While SuperMAG ground magnetic field perturbations are vector measurements, SuperDARN provides line-of-sight measurements of the ionospheric convection flow. Each line-of-sight flow has a known azimuth (or direction), which must be converted into the actual vector flow. However, the component perpendicular to the azimuth direction is unknown. Our method uses historical data from the SuperDARN database and PCR to determine a fill-in model convection distribution for any given universal time. The fill-in data process is driven by a list of state descriptors (magnetic indices and the solar zenith angle). The final solution is then derived from a spherical cap harmonic fit to the SuperDARN measurements and the fill-in model. When compared with the standard SuperDARN fill-in model, we find that our fill-in model provides improved solutions, and the final solutions are in better agreement with the SuperDARN measurements. Our solutions are far less dynamic than the standard SuperDARN solutions, which we interpret as being due to a lack of magnetosphere-ionosphere inertia and communication delays in the standard SuperDARN technique while it is inherently included in our approach. Rather, we argue that the magnetosphere-ionosphere system has inertia that prevents the global convection from changing abruptly in response to an interplanetary magnetic field change.

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Super-Hamiltonian Structures and Conservation Laws of a New Six-Component Super-Ablowitz-Kaup-Newell-Segur Hierarchy

Directory of Open Access Journals (Sweden)

Fucai You

2014-01-01

Full Text Available A six-component super-Ablowitz-Kaup-Newell-Segur (-AKNS hierarchy is proposed by the zero curvature equation associated with Lie superalgebras. Supertrace identity is used to furnish the super-Hamiltonian structures for the resulting nonlinear superintegrable hierarchy. Furthermore, we derive the infinite conservation laws of the first two nonlinear super-AKNS equations in the hierarchy by utilizing spectral parameter expansions. PACS: 02.30.Ik; 02.30.Jr; 02.20.Sv.

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

A novel super-resolution camera model

Science.gov (United States)

Shao, Xiaopeng; Wang, Yi; Xu, Jie; Wang, Lin; Liu, Fei; Luo, Qiuhua; Chen, Xiaodong; Bi, Xiangli

2015-05-01

Aiming to realize super resolution(SR) to single image and video reconstruction, a super resolution camera model is proposed for the problem that the resolution of the images obtained by traditional cameras behave comparatively low. To achieve this function we put a certain driving device such as piezoelectric ceramics in the camera. By controlling the driving device, a set of continuous low resolution(LR) images can be obtained and stored instantaneity, which reflect the randomness of the displacements and the real-time performance of the storage very well. The low resolution image sequences have different redundant information and some particular priori information, thus it is possible to restore super resolution image factually and effectively. The sample method is used to derive the reconstruction principle of super resolution, which analyzes the possible improvement degree of the resolution in theory. The super resolution algorithm based on learning is used to reconstruct single image and the variational Bayesian algorithm is simulated to reconstruct the low resolution images with random displacements, which models the unknown high resolution image, motion parameters and unknown model parameters in one hierarchical Bayesian framework. Utilizing sub-pixel registration method, a super resolution image of the scene can be reconstructed. The results of 16 images reconstruction show that this camera model can increase the image resolution to 2 times, obtaining images with higher resolution in currently available hardware levels.

Quantization of super Teichmueller spaces

International Nuclear Information System (INIS)

Aghaei, Nezhla

2016-08-01

The quantization of the Teichmueller spaces of Riemann surfaces has found important applications to conformal field theory and N=2 supersymmetric gauge theories. We construct a quantization of the Teichmueller spaces of super Riemann surfaces, using coordinates associated to the ideal triangulations of super Riemann surfaces. A new feature is the non-trivial dependence on the choice of a spin structure which can be encoded combinatorially in a certain refinement of the ideal triangulation. We construct a projective unitary representation of the groupoid of changes of refined ideal triangulations. Therefore, we demonstrate that the dependence of the resulting quantum theory on the choice of a triangulation is inessential. In the quantum Teichmueller theory, it was observed that the key object defining the Teichmueller theory has a close relation to the representation theory of the Borel half of U q (sl(2)). In our research we observed that the role of U q (sl(2)) is taken by quantum superalgebra U q (osp(1 vertical stroke 2)). A Borel half of U q (osp(1 vertical stroke 2)) is the super quantum plane. The canonical element of the Heisenberg double of the quantum super plane is evaluated in certain infinite dimensional representations on L 2 (R) x C 1 vertical stroke 1 and compared to the flip operator from the Teichmueller theory of super Riemann surfaces.

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

SuperSegger

DEFF Research Database (Denmark)

Stylianidou, Stella; Brennan, Connor; Nissen, Silas B

2016-01-01

-colonies with many cells, facilitating the analysis of cell-cycle dynamics in bacteria as well as cell-contact mediated phenomena. This package has a range of built-in capabilities for characterizing bacterial cells, including the identification of cell division events, mother, daughter, and neighboring cells......Many quantitative cell biology questions require fast yet reliable automated image segmentation to identify and link cells from frame-to-frame, and characterize the cell morphology and fluorescence. We present SuperSegger, an automated MATLAB-based image processing package well......-suited to quantitative analysis of high-throughput live-cell fluorescence microscopy of bacterial cells. SuperSegger incorporates machine-learning algorithms to optimize cellular boundaries and automated error resolution to reliably link cells from frame-to-frame. Unlike existing packages, it can reliably segment micro...

Super-Lagrangians

International Nuclear Information System (INIS)

Beyl, L.M.

1979-01-01

It is shown that the Einstein, Weyl, supergravity and superconformal theories are special cases of gauge transformations in SU(4vertical-barN). This group is shown to contain SU(2,2) x SU(N) x U(1) for its commuting or Bose part, and to contain 8N supersymmetry generators for its anticommuting or Fermi part. Using the electromagnetic Lagrangian as a model, a super-Lagrangian is constructed for vector potentials. Invariance is automatic in free space, but, in the presence of matter, restrictions on the supersymmetry transformations are necessary. The Weyl action and the Einstein cosmological field equations are obtained in the appropriate limits. Finally, a super-Lagrangian is constructed from nongeometric principles which includes the Dirac Lagrangian and except for a sum over symmetry indices resembles the electron-electromagnetic Lagrangian

SuperB A High-Luminosity Asymmetric $e^+ e^-$ Super Flavour Factory : Conceptual Design Report

CERN Document Server

Bona, M.; Grauges Pous, E.; Colangelo, P.; De Fazio, F.; Palano, A.; Manghisoni, M.; Re, V.; Traversi, G.; Eigen, G.; Venturini, M.; Soni, N.; Bruschi, M.; De Castro, S.; Faccioli, P.; Gabrieli, A.; Giacobbe, B.; Semprini Cesare, N.; Spighi, R.; Villa, M.; Zoccoli, A.; Hearty, C.; McKenna, J.; Soni, A.; Khan, A.; Barniakov, A.Y.; Barniakov, M.Y.; Blinov, V.E.; Druzhinin, V.P.; Golubev, V.B.; Kononov, S.A.; Koop, I.A.; Kravchenko, E.A.; Levichev, E.B.; Nikitin, S.A.; Onuchin, A.P.; Piminov, P.A.; Serednyakov, S.I.; Shatilov, D.N.; Skovpen, Y.I.; Solodov, E.A.; Cheng, C.H.; Echenard, B.; Fang, F.; Hitlin, D.J.; Porter, F.C.; Asner, D.M.; Pham, T.N.; Fleischer, R.; Giudice, G.F.; Hurth, T.; Mangano, M.; Mancinelli, G.; Meadows, B.T.; Schwartz, A.J.; Sokoloff, M.D.; Soffer, A.; Beard, C.D.; Haas, T.; Mankel, R.; Hiller, G.; Ball, P.; Pappagallo, M.; Pennington, M.R.; Gradl, W.; Playfer, S.; Abada, A.; Becirevic, D.; Descotes-Genon, S.; Pene, O.; Andreotti, D.; Andreotti, M.; Bettoni, D.; Bozzi, C.; Calabresi, R.; Cecchi, A.; Cibinetto, G.; Franchini, P.; Luppi, E.; Negrini, M.; Petrella, A.; Piemontese, L.; Prencipe, E.; Santoro, V.; Stancari, G.; Anulli, F.; Baldini-Ferroli, R.; Biagini, M.E.; Boscolo, M.; Calcaterra, A.; Drago, A.; Finocchiaro, G.; Guiducci, S.; Isidori, G.; Pacetti, S.; Patteri, P.; Peruzzi, I.M.; Piccolo, M.; Preger, M.A.; Raimondi, P.; Rama, M.; Vaccarezza, C.; Zallo, A.; Zobov, M.; De Sangro, R.; Buzzo, A.; Lo Vetere, M.; Macri, M.; Monge, M.R.; Passaggio, S.; Patrignani, C.; Robutti, E.; Tosi, S.; Matias, J.; Panduro Vazquez, W.; Borzumati, F.; Eyges, V.; Prell, S.A.; Pedlar, T.K.; Korpar, S.; Pestonik, R.; Staric, M.; Neubert, M.; Denig, A.G.; Nierste, U.; Agoh, T.; Ohmi, K.; Ohnishi, Y.; Fry, J.R.; Touramanis, C.; Wolski, A.; Golob, B.; Krizan, P.; Flaecher, H.; Bevan, A.J.; Di Lodovico, F.; George, K.A.; Barlow, R.; Lafferty, G.; Jawahery, A.; Roberts, D.A.; Simi, G.; Patel, P.M.; Robertson, S.H.; Lazzaro, A.; Palombo, F.; Kaidalov, A.; Buras, A.J.; Tarantino, C.; Buchalla, G.; Sanda, A.I.; D'Ambrosio, G.; Ricciardi, G.; Bigi, I.; Jessop, C.P.; Losecco, J.M.; Honscheid, K.; Arnaud, N.; Chehab, R.; Fedala, Y.; Polci, F.; Roudeau, P.; Sordini, V.; Soskov, V.; Stocchi, A.; Variola, A.; Vivoli, A.; Wormser, G.; Zomer, F.; Bertolin, A.; Brugnera, R.; Gagliardi, N.; Gaz, A.; Margoni, M.; Morandin, M.; Posocco, M.; Rotondo, M.; Simonetto, F.; Stroili, R.; Bonneaud, G.R.; Lombardo, V.; Calderini, G.; Ratti, L.; Speziali, V.; Biasini, M.; Covarelli, R.; Manoni, E.; Servoli, L.; Angelini, C.; Batignani, G.; Bettarini, S.; Bosi, F.; Carpinelli, M.; Cenci, R.; Cervelli, A.; Dell'Orso, M.; Forti, F.; Giannetti, P.; Giorgi, M.; Lusiani, A.; Marchiori, G.; Massa, M.; Mazur, M.A.; Morsani, F.; Neri, N.; Paoloni, E.; Raffaelli, F.; Rizzo, G.; Walsh, J.; Braun, V.; Lenz, A.; Adams, G.S.; Danko, I.Z.; Baracchini, E.; Bellini, F.; Cavoto, G.; D'Orazio, A.; Del Re, D.; Di Marco, E.; Faccini, R.; Ferrarotto, F.; Gaspero, Mario; Jackson, P.; Martinelli, G.; Mazzoni, M.A.; Morganti, Silvio; Piredda, G.; Renga, F.; Silvestrini, L.; Voena, C.; Catani, L.; Di Ciaccio, A.; Messi, R.; Santovetti, E.; Satta, A.; Ciuchini, M.; Lubicz, V.; Wilson, F.F.; Godang, R.; Chen, X.; Liu, H.; Park, W.; Purohit, M.; Trivedi, A.; White, R.M.; Wilson, J.R.; Allen, M.T.; Aston, D.; Bartoldus, R.; Brodsky, S.J.; Cai, Y.; Coleman, J.; Convery, M.R.; DeBarger, S.; Dingfelder, J.C.; Dubois-Felsmann, G.P.; Ecklund, S.; Fisher, A.S.; Haller, G.; Heifets, S.A.; Kaminski, J.; Kelsey, M.H.; Kocian, M.L.; Leith, D.W.G.S.; Li, N.; Luitz, S.; Luth, V.; MacFarlane, D.; Messner, R.; Muller, D.R.; Nosochkov, Y.; Novokhatski, A.; Pivi, M.; Ratcliff, B.N.; Roodman, A.; Schwiening, J.; Seeman, J.; Snyder, A.; Sullivan, M.; Va'Vra, J.; Wienands, U.; Wisniewski, W.; Stoeck, H.; Cheng, H.Y.; Li, H.N.; Keum, Y.Y.; Gronau, M.; Grossman, Y.; Bianchi, F.; Gamba, D.; Gambino, P.; Marchetto, F.; Menichetti, Ezio A.; Mussa, R.; Pelliccioni, M.; Dalla Betta, G.F.; Bomben, M.; Bosisio, L.; Cartaro, C.; Lanceri, L.; Vitale, L.; Azzolini, V.; Bernabeu, J.; Lopez-March, N.; Martinez-Vidal, F.; Milanes, D.A.; Oyanguren, A.; Paradisi, P.; Pich, A.; Sanchis-Lozano, M.A.; Kowalewski, Robert V.; Roney, J.M.; Back, J.J.; Gershon, T.J.; Harrison, P.F.; Latham, T.E.; Mohanty, G.B.; Petrov, A.A.; Pierini, M.; INFN

2007-01-01

The physics objectives of SuperB, an asymmetric electron-positron collider with a luminosity above 10^36/cm^2/s are described, together with the conceptual design of a novel low emittance design that achieves this performance with wallplug power comparable to that of the current B Factories, and an upgraded detector capable of doing the physics in the SuperB environment.

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

Super capacitor modeling with artificial neural network (ANN)

Energy Technology Data Exchange (ETDEWEB)

Marie-Francoise, J.N.; Gualous, H.; Berthon, A. [Universite de Franche-Comte, Lab. en Electronique, Electrotechnique et Systemes (L2ES), UTBM, INRETS (LRE T31) 90 - Belfort (France)

2004-07-01

This paper presents super-capacitors modeling using Artificial Neural Network (ANN). The principle consists on a black box nonlinear multiple inputs single output (MISO) model. The system inputs are temperature and current, the output is the super-capacitor voltage. The learning and the validation of the ANN model from experimental charge and discharge of super-capacitor establish the relationship between inputs and output. The learning and the validation of the ANN model use experimental results of 2700 F, 3700 F and a super-capacitor pack. Once the network is trained, the ANN model can predict the super-capacitor behaviour with temperature variations. The update parameters of the ANN model are performed thanks to Levenberg-Marquardt method in order to minimize the error between the output of the system and the predicted output. The obtained results with the ANN model of super-capacitor and experimental ones are in good agreement. (authors)

sl(1|2) Super-Toda Fields

Science.gov (United States)

Yang, Zhan-Ying; Xue, Pan-Pan; Zhao, Liu; Shi, Kang-Jie

2008-11-01

Explicit exact solution of supersymmetric Toda fields associated with the Lie superalgebra sl(2|1) is constructed. The approach used is a super extension of Leznov Saveliev algebraic analysis, which is based on a pair of chiral and antichiral Drienfeld Sokolov systems. Though such approach is well understood for Toda field theories associated with ordinary Lie algebras, its super analogue was only successful in the super Liouville case with the underlying Lie superalgebra osp(1|2). The problem lies in that a key step in the construction makes use of the tensor product decomposition of the highest weight representations of the underlying Lie superalgebra, which is not clear until recently. So our construction made in this paper presents a first explicit example of Leznov Saveliev analysis for super Toda systems associated with underlying Lie superalgebras of the rank higher than 1.

sl(1|2) Super-Toda Fields

International Nuclear Information System (INIS)

Yang Zhanying; Xue Panpan; Zhao Liu; Shi Kangjie

2008-01-01

Explicit exact solution of supersymmetric Toda fields associated with the Lie superalgebra sl(2|1) is constructed. The approach used is a super extension of Leznov-Saveliev algebraic analysis, which is based on a pair of chiral and antichiral Drienfeld-Sokolov systems. Though such approach is well understood for Toda field theories associated with ordinary Lie algebras, its super analogue was only successful in the super Liouville case with the underlying Lie superalgebra osp(1|2). The problem lies in that a key step in the construction makes use of the tensor product decomposition of the highest weight representations of the underlying Lie superalgebra, which is not clear until recently. So our construction made in this paper presents a first explicit example of Leznov-Saveliev analysis for super Toda systems associated with underlying Lie superalgebras of the rank higher than 1

A superparticle on the 'super' Poincare upper half plane

International Nuclear Information System (INIS)

Uehara, S.; Yasui, Yukinora

1988-01-01

A non-relativistic superparticle moving freely on the 'super' Poincare upper half plane is investigated. The lagrangian is invariant under the super Moebius transformations SPL (2, R), so that it can be projected into the lagrangian on the super Riemann surface. The quantum hamiltonian becomes the 'super' Laplace-Beltrami operator in the curved superspace. (orig.)

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

BEWARE OF...SUPER GLUES!!

CERN Multimedia

2006-01-01

What happened? A number of accidents have occurred with the use of 'Super Glues'. Some individuals have suffered injuries - severe irritation, or skin bonded together - through getting glue on their face and in their eyes. What are the hazards associated with glues? 'Super Glues' (i.e. cyanoacrylates): Are harmful if swallowed and are chemical irritants to the eyes, respiratory system and skin. Present the risk of polymerization (hardening) leading to skin damage. Be careful ! 'Super Glues' can bond to skin and eyes in seconds. Note: Other glues, resins and hardeners are also chemicals and as such can cause serious damage to the skin, eyes, respiratory or digestive tract. (For example: some components can be toxic, harmful, corrosive, sensitizing agents, etc.). How to prevent accidents in the future? Read the Material Safety Data Sheet (MSDS) for all of the glues you work with. Check the label on the container to find out which of the materials you work with are hazardous. Wear the right Per...

Recovery of the SuperTIGER Instrument and Preparations for the Flight of SuperTIGER-2

Science.gov (United States)

Walsh, N. E.; Supertiger Collaboration

2016-03-01

On December 8, 2012, the SuperTIGER (Trans-Iron Galactic Element Recorder) instrument began its long-duration balloon flight from Williams Field, Antarctica. Flying for a record-breaking 55 days at a mean altitude of 125,000 feet, the instrument successfully measured the relative elemental abundances of Galactic cosmic ray nuclei having charge (Z) greater than Z=10, showing very well resolved individual element peaks up to Z=40. The instrument measures particle charge and energy through the combined use of two Cherenkov detectors and three scintillation detectors, and determines particle trajectory with a scintillating fiber hodoscope. After cutdown and two years on the ice, SuperTIGER was successfully recovered in January, 2015. Its detectors and hodoscopes are being tested and refurbished, and are expected to be used again for a second flight, SuperTIGER-2. The second flight is aimed at improving SuperTIGER's already excellent charge resolution as well as at accumulating more data to be combined with that of SuperTIGER for improved statistics. In November 2015, a test of the scintillator saturation effect was performed at CERN using a beam of interacted Pb nuclei to help create more accurate charge reconstruction models that will help resolve elements in the range Z=41 to Z=60. This research was supported by NASA under Grants NNX09AC17G, NNX14AB25G, the Peggy and Steve Fossett Foundation and the McDonnell Center for the Space Sciences at Washington University.

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

SuperHILAC

International Nuclear Information System (INIS)

Nemetz, R.; Selph, F.; Barnes, A.C.

1976-01-01

A brief discussion is given of improvements, operations, and research programs at the SuperHILAC. Improvements were made in beam injection, ion sources, and computer control systems. The research efficiency ranged between 70 and 90 percent during most of the year

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Two-reduction of the super-KP hierarchy

International Nuclear Information System (INIS)

McArthur, I.N.

1994-01-01

Recursion relations are established for the residues of fractional powers of a two-reduced super-KP operator making use of the Baker-Akhiezer function. These show the integrability of the two-reduced even (or bosonic) flows of the super-KP hierarchy. Similar recursion relations are also proven for the residues of operators associated with the odd (or fermionic) flows of the Mulase-Rabin super-KP hierarchy. Due to the presence of a spectral parameter and itts fermionic partner in the Baker-Akhiezer function, these recursion relations should be relevant to any attempt to prove or disprove a recent proposal that the integrable hierarchy underlying two-dimensional quantum supergravity is the Mulase-Rabin super-KP hierarchy. (orig.)

Super-resolution imaging applied to moving object tracking

Science.gov (United States)

Swalaganata, Galandaru; Ratna Sulistyaningrum, Dwi; Setiyono, Budi

2017-10-01

Moving object tracking in a video is a method used to detect and analyze changes that occur in an object that being observed. Visual quality and the precision of the tracked target are highly wished in modern tracking system. The fact that the tracked object does not always seem clear causes the tracking result less precise. The reasons are low quality video, system noise, small object, and other factors. In order to improve the precision of the tracked object especially for small object, we propose a two step solution that integrates a super-resolution technique into tracking approach. First step is super-resolution imaging applied into frame sequences. This step was done by cropping the frame in several frame or all of frame. Second step is tracking the result of super-resolution images. Super-resolution image is a technique to obtain high-resolution images from low-resolution images. In this research single frame super-resolution technique is proposed for tracking approach. Single frame super-resolution was a kind of super-resolution that it has the advantage of fast computation time. The method used for tracking is Camshift. The advantages of Camshift was simple calculation based on HSV color that use its histogram for some condition and color of the object varies. The computational complexity and large memory requirements required for the implementation of super-resolution and tracking were reduced and the precision of the tracked target was good. Experiment showed that integrate a super-resolution imaging into tracking technique can track the object precisely with various background, shape changes of the object, and in a good light conditions.

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Mapping ionospheric backscatter measured by the SuperDARN HF radars – Part 2: Assessing SuperDARN virtual height models

Directory of Open Access Journals (Sweden)

T. K. Yeoman

2008-05-01

Full Text Available The Super Dual Auroral Radar Network (SuperDARN network of HF coherent backscatter radars form a unique global diagnostic of large-scale ionospheric and magnetospheric dynamics in the Northern and Southern Hemispheres. Currently the ground projections of the HF radar returns are routinely determined by a simple rangefinding algorithm, which takes no account of the prevailing, or indeed the average, HF propagation conditions. This is in spite of the fact that both direct E- and F-region backscatter and 1½-hop E- and F-region backscatter are commonly used in geophysical interpretation of the data. In a companion paper, Chisham et al. (2008 have suggested a new virtual height model for SuperDARN, based on average measured propagation paths. Over shorter propagation paths the existing rangefinding algorithm is adequate, but mapping errors become significant for longer paths where the roundness of the Earth becomes important, and a correct assumption of virtual height becomes more difficult. The SuperDARN radar at Hankasalmi has a propagation path to high power HF ionospheric modification facilities at both Tromsø on a ½-hop path and SPEAR on a 1½-hop path. The SuperDARN radar at Þykkvibǽr has propagation paths to both facilities over 1½-hop paths. These paths provide an opportunity to quantitatively test the available SuperDARN virtual height models. It is also possible to use HF radar backscatter which has been artificially induced by the ionospheric heaters as an accurate calibration point for the Hankasalmi elevation angle of arrival data, providing a range correction algorithm for the SuperDARN radars which directly uses elevation angle. These developments enable the accurate mappings of the SuperDARN electric field measurements which are required for the growing number of multi-instrument studies of the Earth's ionosphere and magnetosphere.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

Super-leadership and work enjoyment: direct and moderated influences.

Science.gov (United States)

Müller, Günter F; Georgianna, Sibylle; Schermelleh-Engel, Karin; Roth, Anne C; Schreiber, Walter A; Sauerland, Martin; Muessigmann, Michael J; Jilg, Franziska

2013-12-01

Super-leadership is part of an approach called 'empowering leadership.' Within this approach, super-leadership is assumed to enable subordinates to lead themselves. The current study examined correlates of super-leadership. A questionnaire measuring two dimensions of super-leadership was used to analyze relationships between super-leadership and subordinates' work enjoyment, i.e., job satisfaction, subjective well-being, and emotional organizational commitment. In addition, moderating effects of the organizational context, i.e., organizational decentralization, on the relationships between super-leadership and work enjoyment were explored. 198 German employees from different occupations participated in the study. Latent moderator structural equation analysis revealed that the two factors of super-leadership, "coaching and communicative support" and "facilitation of personal autonomy and responsibility," had direct positive effects on subordinates' work enjoyment. Organizational decentralization moderated the effect of "coaching and communicative support" on work enjoyment but not the relations involving "facilitation of personal autonomy and responsibility." Conclusions for further research and practical applications were discussed.

Optimal super dense coding over memory channels

OpenAIRE

Shadman, Zahra; Kampermann, Hermann; Macchiavello, Chiara; Bruß, Dagmar

2011-01-01

We study the super dense coding capacity in the presence of quantum channels with correlated noise. We investigate both the cases of unitary and non-unitary encoding. Pauli channels for arbitrary dimensions are treated explicitly. The super dense coding capacity for some special channels and resource states is derived for unitary encoding. We also provide an example of a memory channel where non-unitary encoding leads to an improvement in the super dense coding capacity.

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

Science.gov (United States)

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Super-insulation

International Nuclear Information System (INIS)

Gerold, J.

1985-01-01

The invention concerns super-insulation, which also acts as spacing between two pressurized surfaces, where the crossing bars in at least two layers are provided, with interposed foil. The super-insulation is designed so that it can take compression forces and limits thermal radiation and thermal conduction sufficiently, where the total density of heat flow is usually limited to a few watts per m 2 . The solution to the problem is characterized by the fact that the bars per layer are parallel and from layer to layer they are at an angle to each other and the crossover positions of the bars of different layers are at fixed places and so form contact columns. The basic idea is that bars crossing over each other to support compression forces are used so that contact columns are formed, which are compressed to a certain extent by the load. (orig./PW) [de

UniPrime2: a web service providing easier Universal Primer design.

Science.gov (United States)

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Characterising Super-Earths

Directory of Open Access Journals (Sweden)

Valencia D.

2011-02-01

Full Text Available The era of Super-Earths has formally begun with the detection of transiting low-mass exoplanets CoRoT-7b and GJ 1214b. In the path of characterising super-Earths, the first step is to infer their composition. While the discovery data for CoRoT-7b, in combination with the high atmospheric mass loss rate inferred from the high insolation, suggested that it was a rocky planet, the new proposed mass values have widened the possibilities. The combined mass range 1−10 M⊕ allows for a volatile-rich (and requires it if the mass is less than 4 M⊕ , an Earth-like or a super-Mercury-like composition. In contrast, the radius of GJ 1214b is too large to admit a solid composition, thus it necessarily to have a substantial gas layer. Some evidence suggests that within this gas layer H/He is a small but non-negligible component. These two planets are the first of many transiting low-mass exoplanets expected to be detected and they exemplify the limitations faced when inferring composition, which come from the degenerate character of the problem and the large error bars in the data.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Charm Physics at SuperB

International Nuclear Information System (INIS)

Meadows, Brian; Bevan, Adrian

2010-01-01

The study of Charm Decays at SuperB provide unique opportunities to understand the Standard Model and constrain new physics, both at the Y(4S), and at charm threshold. We discuss the physics potential of such measurements from the proposed SuperB experiment with 75 ab -1 of data at the Y(4S) and a subsequent run dedicated to exploiting quantum correlations at the charm threshold. (author)

NETL Super Computer

Data.gov (United States)

Federal Laboratory Consortium — The NETL Super Computer was designed for performing engineering calculations that apply to fossil energy research. It is one of the world’s larger supercomputers,...

Microsphere-based super-resolution scanning optical microscope.

Science.gov (United States)

Huszka, Gergely; Yang, Hui; Gijs, Martin A M

2017-06-26

High-refractive index dielectric microspheres positioned within the field of view of a microscope objective in a dielectric medium can focus the light into a so-called photonic nanojet. A sample placed in such nanojet can be imaged by the objective with super-resolution, i.e. with a resolution beyond the classical diffraction limit. However, when imaging nanostructures on a substrate, the propagation distance of a light wave in the dielectric medium in between the substrate and the microsphere must be small enough to reveal the sample's nanometric features. Therefore, only the central part of an image obtained through a microsphere shows super-resolution details, which are typically ∼100 nm using white light (peak at λ = 600 nm). We have performed finite element simulations of the role of this critical distance in the super-resolution effect. Super-resolution imaging of a sample placed beneath the microsphere is only possible within a very restricted central area of ∼10 μm 2 , where the separation distance between the substrate and the microsphere surface is very small (∼1 μm). To generate super-resolution images over larger areas of the sample, we have fixed a microsphere on a frame attached to the microscope objective, which is automatically scanned over the sample in a step-by-step fashion. This generates a set of image tiles, which are subsequently stitched into a single super-resolution image (with resolution of λ/4-λ/5) of a sample area of up to ∼10 4 μm 2 . Scanning a standard optical microscope objective with microsphere therefore enables super-resolution microscopy over the complete field-of-view of the objective.

The SuperB Project: Status and the Physics Reach

International Nuclear Information System (INIS)

Neri, Nicola

2012-01-01

The SuperB experiment is a next generation Super Flavour Factory expected to accumulate 75 ab −1 of data at the Υ(4S) in five years of nominal running, and will be built at the recently established Cabibbo Laboratory on the outskirts of Rome. In addition to running data at the Υ(4S), SuperB will be able to accumulate data from the ψ(3770) up to the Υ(6S). A polarized electron beam enables unique physics opportunities at SuperB. The large samples of B, D and τ decays that will be recorded at SuperB can be used to provide both stringent constraints on new physics scenarios, and over-constraints on the Standard Model. We present the status of the project as well as the physics potential of SuperB.

Super-resolution

DEFF Research Database (Denmark)

Nasrollahi, Kamal; Moeslund, Thomas B.

2014-01-01

Super-resolution, the process of obtaining one or more high-resolution images from one or more low-resolution observations, has been a very attractive research topic over the last two decades. It has found practical applications in many real world problems in different fields, from satellite...

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

FPGA-based quench detection system for super-FRS super-ferric dipole prototype

International Nuclear Information System (INIS)

Yang Tongjun; Wu Wei; Yao Qinggao; Yuan Ping; He Yuan; Han Shaofei; Ma Lizhen

2011-01-01

The quench detection system for Super-FRS super-ferric dipole prototype magnet of FAIR has been designed and built. The balance bridge was used to detect quench signal. In order to avoid blind zone of quench detection, two independent bridges were used. NI PXI-7830R FPGA was used to implement filter to quench signal and algorithm of quench decision and to produce quench trigger signal. Pre-sample technique was used in quench data acquisition. The data before and after quench could be recorded for analysis later. The test result indicated that the quench of the dipole's superconducting coil could be reliably detected by the quench detection module. (authors)

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

Oblique reconstructions in tomosynthesis. II. Super-resolution

International Nuclear Information System (INIS)

Acciavatti, Raymond J.; Maidment, Andrew D. A.

2013-01-01

Purpose: In tomosynthesis, super-resolution has been demonstrated using reconstruction planes parallel to the detector. Super-resolution allows for subpixel resolution relative to the detector. The purpose of this work is to develop an analytical model that generalizes super-resolution to oblique reconstruction planes.Methods: In a digital tomosynthesis system, a sinusoidal test object is modeled along oblique angles (i.e., “pitches”) relative to the plane of the detector in a 3D divergent-beam acquisition geometry. To investigate the potential for super-resolution, the input frequency is specified to be greater than the alias frequency of the detector. Reconstructions are evaluated in an oblique plane along the extent of the object using simple backprojection (SBP) and filtered backprojection (FBP). By comparing the amplitude of the reconstruction against the attenuation coefficient of the object at various frequencies, the modulation transfer function (MTF) is calculated to determine whether modulation is within detectable limits for super-resolution. For experimental validation of super-resolution, a goniometry stand was used to orient a bar pattern phantom along various pitches relative to the breast support in a commercial digital breast tomosynthesis system.Results: Using theoretical modeling, it is shown that a single projection image cannot resolve a sine input whose frequency exceeds the detector alias frequency. The high frequency input is correctly visualized in SBP or FBP reconstruction using a slice along the pitch of the object. The Fourier transform of this reconstructed slice is maximized at the input frequency as proof that the object is resolved. Consistent with the theoretical results, experimental images of a bar pattern phantom showed super-resolution in oblique reconstructions. At various pitches, the highest frequency with detectable modulation was determined by visual inspection of the bar patterns. The dependency of the highest

Oblique reconstructions in tomosynthesis. II. Super-resolution

Science.gov (United States)

Acciavatti, Raymond J.; Maidment, Andrew D. A.

2013-01-01

Purpose: In tomosynthesis, super-resolution has been demonstrated using reconstruction planes parallel to the detector. Super-resolution allows for subpixel resolution relative to the detector. The purpose of this work is to develop an analytical model that generalizes super-resolution to oblique reconstruction planes. Methods: In a digital tomosynthesis system, a sinusoidal test object is modeled along oblique angles (i.e., “pitches”) relative to the plane of the detector in a 3D divergent-beam acquisition geometry. To investigate the potential for super-resolution, the input frequency is specified to be greater than the alias frequency of the detector. Reconstructions are evaluated in an oblique plane along the extent of the object using simple backprojection (SBP) and filtered backprojection (FBP). By comparing the amplitude of the reconstruction against the attenuation coefficient of the object at various frequencies, the modulation transfer function (MTF) is calculated to determine whether modulation is within detectable limits for super-resolution. For experimental validation of super-resolution, a goniometry stand was used to orient a bar pattern phantom along various pitches relative to the breast support in a commercial digital breast tomosynthesis system. Results: Using theoretical modeling, it is shown that a single projection image cannot resolve a sine input whose frequency exceeds the detector alias frequency. The high frequency input is correctly visualized in SBP or FBP reconstruction using a slice along the pitch of the object. The Fourier transform of this reconstructed slice is maximized at the input frequency as proof that the object is resolved. Consistent with the theoretical results, experimental images of a bar pattern phantom showed super-resolution in oblique reconstructions. At various pitches, the highest frequency with detectable modulation was determined by visual inspection of the bar patterns. The dependency of the highest

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Shear bond strengths of an indirect composite layering material to a tribochemically silica-coated zirconia framework material.

Science.gov (United States)

Iwasaki, Taro; Komine, Futoshi; Fushiki, Ryosuke; Kubochi, Kei; Shinohara, Mitsuyo; Matsumura, Hideo

2016-01-01

This study evaluated shear bond strengths of a layering indirect composite material to a zirconia framework material treated with tribochemical silica coating. Zirconia disks were divided into two groups: ZR-PRE (airborne-particle abrasion) and ZR-PLU (tribochemical silica coating). Indirect composite was bonded to zirconia treated with one of the following primers: Clearfil Ceramic Primer (CCP), Clearfil Mega Bond Primer with Clearfil Porcelain Bond Activator (MGP+Act), ESPE-Sil (SIL), Estenia Opaque Primer, MR. Bond, Super-Bond PZ Primer Liquid A with Liquid B (PZA+PZB), and Super-Bond PZ Primer Liquid B (PZB), or no treatment. Shear bond testing was performed at 0 and 20,000 thermocycles. Post-thermocycling shear bond strengths of ZR-PLU were higher than those of ZR-PRE in CCP, MGP+Act, SIL, PZA+PZB, and PZB groups. Application of silane yielded better durable bond strengths of a layering indirect composite material to a tribochemically silica-coated zirconia framework material.

Super-cool Dark Matter arXiv

CERN Document Server

Hambye, Thomas; Teresi, Daniele

In dimension-less theories of dynamical generation of the weak scale, the Universe can undergo a period of low-scale inflation during which all particles are massless and super-cool. This leads to a new mechanism of generation of the cosmological Dark Matter (DM) relic density: super-cooling can easily suppress the amount of DM to the desired level. This is achieved for TeV-scale DM, if super-cooling ends when quark condensates form at the QCD phase transition. Along this scenario, the baryon asymmetry can be generated either at the phase transition or through leptogenesis. We show that the above mechanism takes place in old and new dimension-less models.

A note on the super AKNS equations

International Nuclear Information System (INIS)

Li Yishen; Zhang Lining.

1986-10-01

We find some relationships between the usual AKNS scheme with the super one, when its elements take value from the Grassmann algebra on a two-dimensional vector space. The solutions of these super AKNS equations are discussed. (author)

N=2 super - W3(2) algebra in superfields

International Nuclear Information System (INIS)

Krivonos, S.; Sorin, A.

1995-05-01

It is presented a manifestly N=2 supersymmetric formulation of N=2 super-W 3 (2) algebra (its classical version) in terms of the spin 1 unconstrained generating a N=2 superconformal subalgebra and the spins 1/2, 2 fermionic constrained supercurrents. It is considered a superfield reduction of N=2 super-W 3 (2) to N=2 super-W 3 and construct a family of evolution equations for which N=2 super-W 3 (2) provides the second Hamiltonian structure

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Exact solution of super Liouville model

International Nuclear Information System (INIS)

Yang Zhanying; Zhao Liu; Zhen Yi

2000-01-01

Using Leznov-Saveliev algebraic analysis and Drinfeld-Sokolov construction, the authors obtained the explicit solutions to the super Liouville system in super covariant form and component form. The explicit solution in component form reduces naturally into the Egnchi-Hanson instanton solution of the usual Liouville equation if all the Grassmann odd components are set equal to zero

Siting the superconducting super collider

International Nuclear Information System (INIS)

Price, R.; Rooney, R.C.

1988-01-01

At the request of the Department of Energy, the National Academy of Sciences and the National Academy of Engineering established the Super Collider Site Evaluation Committee to evaluate the suitability of proposed sites for the Superconducting Super Collider. Thirty-six proposals were examined by the committee. Using the set of criteria announced by DOE in its Invitation for Site Proposals, the committee identified eight sites that merited inclusion on a ''best qualified list.'' The list represents the best collective judgment of 21 individuals, carefully chosen for their expertise and impartiality, after a detailed assessment of the proposals using 19 technical subcriteria and DOE's life cycle cost estimates. The sites, in alphabetical order, are: Arizona/Maricopa; Colorado; Illinois; Michigan/Stockbridge; New York/Rochester; North Carolina; Tennessee; and Texas/Dallas-Fort Worth. The evaluation of these sites and the Superconducting Super Collider are discussed in this book

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

The elastic buckling of super-graphene and super-square carbon nanotube networks

International Nuclear Information System (INIS)

Li Ying; Qiu Xinming; Yin Yajun; Yang Fan; Fan Qinshan

2010-01-01

The super-graphene (SG) and super-square (SS) carbon nanotube network are built by the straight single-walled carbon nanotubes and corresponding junctions. The elastic buckling behaviors of these carbon nanotube networks under different boundary conditions are explored through the molecular structural mechanics method. The following results are obtained: (a) The critical buckling forces of the SG and SS networks decrease as the side lengths or aspect ratios of the networks increase. The continuum plate theory could give good predictions to the buckling of the SS network but not the SG network with non-uniform buckling modes. (b) The carbon nanotube networks are more stable structures than the graphene structures with less carbon atoms.

One-dimensional super Calabi-Yau manifolds and their mirrors

Energy Technology Data Exchange (ETDEWEB)

Noja, S. [Dipartimento di Matematica, Università degli Studi di Milano,Via Saldini 50, I-20133 Milano (Italy); Cacciatori, S.L. [Dipartimento di Scienza e Alta Tecnologia, Università dell’Insubria, Via Valleggio 11, I-22100 Como (Italy); INFN, Sezione di Milano,Via Celoria 16, I-20133 Milano (Italy); Piazza, F. Dalla [Dipartimento di Scienza e Alta Tecnologia, Università dell’Insubria, Via Valleggio 11, I-22100 Como (Italy); Marrani, A. [Centro Studi e Ricerche ‘Enrico Fermi’,Via Panisperna 89A, I-00184 Roma (Italy); Dipartimento di Fisica e Astronomia ‘Galileo Galilei’, Università di Padova,and INFN, Sezione di Padova,Via Marzolo 8, I-35131 Padova (Italy); Re, R. [Dipartimento di Matematica e Informatica, Università degli Studi di Catania,Viale Andrea Doria 6, 95125 Catania (Italy)

2017-04-18

We apply a definition of generalised super Calabi-Yau variety (SCY) to supermanifolds of complex dimension one. One of our results is that there are two SCY’s having reduced manifold equal to ℙ{sup 1}, namely the projective super space ℙ{sup 1|2} and the weighted projective super space Wℙ{sub (2)}{sup 1|1}. Then we compute the corresponding sheaf cohomology of superforms, showing that the cohomology with picture number one is infinite dimensional, while the de Rham cohomology, which is what matters from a physical point of view, remains finite dimensional. Moreover, we provide the complete real and holomorphic de Rham cohomology for generic projective super spaces ℙ{sup n|m}. We also determine the automorphism groups: these always match the dimension of the projective super group with the only exception of ℙ{sup 1|2}, whose automorphism group turns out to be larger than the projective super group. By considering the cohomology of the super tangent sheaf, we compute the deformations of ℙ{sup 1|m}, discovering that the presence of a fermionic structure allows for deformations even if the reduced manifold is rigid. Finally, we show that ℙ{sup 1|2} is self-mirror, whereas Wℙ{sub (2)}{sup 1|1} has a zero dimensional mirror. Also, the mirror map for ℙ{sup 1|2} naturally endows it with a structure of N=2 super Riemann surface.

75 FR 77670 - SuperMedia, LLC, Formerly Known as Idearc Media, LLC, a Subsidiary of SuperMedia Information...

Science.gov (United States)

2010-12-13

... Known as Idearc Media, LLC, a Subsidiary of SuperMedia Information Services, LLC Publishing Group, Troy... Subsidiary of SuperMedia Information Services, LLC, Troy, New York, to apply for Trade Adjustment Assistance..., Publishing Group, Troy, New York, who became totally or partially separated from employment on or after...

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Analysing 'super-participation' in online third spaces

NARCIS (Netherlands)

Graham, Todd; Wright, Scott; Cantijoch, Marta; Gibson, Rachel; Ward, Stephen

2014-01-01

This chapter focuses on our attempts to overcome the methodological challenges of 'super-participation' in online discussion forums, focusing on the participatory patterns and discursive activity of what we call 'super-participants'. Our principal contribution in this area (Graham and Wright 2013)

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Quantisation of super Teichmueller theory

International Nuclear Information System (INIS)

Aghaei, Nezhla; Hamburg Univ.; Pawelkiewicz, Michal; Techner, Joerg

2015-12-01

We construct a quantisation of the Teichmueller spaces of super Riemann surfaces using coordinates associated to ideal triangulations of super Riemann surfaces. A new feature is the non-trivial dependence on the choice of a spin structure which can be encoded combinatorially in a certain refinement of the ideal triangulation. By constructing a projective unitary representation of the groupoid of changes of refined ideal triangulations we demonstrate that the dependence of the resulting quantum theory on the choice of a triangulation is inessential.

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

Super-entropic black holes and the Kerr-CFT correspondence

Energy Technology Data Exchange (ETDEWEB)

Sinamuli, Musema [Department of Physics and Astronomy, University of Waterloo,200 University Ave., Waterloo, Ontario N2L 3G1 (Canada); Perimeter Institute for Theoretical Physics,31 Caroline St., Waterloo, Ontario, N2L 2Y5 (Canada); Mann, Robert B. [Department of Physics and Astronomy, University of Waterloo,200 University Ave., Waterloo, Ontario N2L 3G1 (Canada)

2016-08-24

We demonstrate that Kerr-CFT duality can be extended to super-entropic black holes, which have non-compact horizons with finite area. We demonstrate that this duality is robust insofar as the ultra-spinning limit of a Kerr-AdS black hole (which yields the super-entropic class) commutes with the near-horizon limit (which yields the Kerr-CFT duality). Consequently the Bekenstein-Hawking and the CFT entropies are equivalent. We show that the duality holds for both singly-spinning super-entropic black holes in 4 dimensions and for doubly-spinning super-entropic black holes of gauged supergravity in 5 dimensions. In both cases we obtain not only the expected left/right temperatures, but also temperatures associated with electric charge and with a new thermodynamic parameter specific to super-entropic black holes.

Super-entropic black holes and the Kerr-CFT correspondence

International Nuclear Information System (INIS)

Sinamuli, Musema; Mann, Robert B.

2016-01-01

We demonstrate that Kerr-CFT duality can be extended to super-entropic black holes, which have non-compact horizons with finite area. We demonstrate that this duality is robust insofar as the ultra-spinning limit of a Kerr-AdS black hole (which yields the super-entropic class) commutes with the near-horizon limit (which yields the Kerr-CFT duality). Consequently the Bekenstein-Hawking and the CFT entropies are equivalent. We show that the duality holds for both singly-spinning super-entropic black holes in 4 dimensions and for doubly-spinning super-entropic black holes of gauged supergravity in 5 dimensions. In both cases we obtain not only the expected left/right temperatures, but also temperatures associated with electric charge and with a new thermodynamic parameter specific to super-entropic black holes.

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

Introduction of a super speed network in JNC

International Nuclear Information System (INIS)

Nosaki, Nobuhisa; Aoki, Kazuhisa; Narita, Nobuiku

2002-01-01

The construction of a super speed and broadband network with high cost performance is now possible through the resent remarkable development of information-communication technologies. Under such circumstances, the modification of LAN and WAN to the super speed network was required in accordance with the recent network demand in JNC. The trend of the information-communication technologies and the needs of information-communication infrastructure were reviewed as the first step. A modification of WAN to the super speed network with high cost performance was established in fiscal year 2000. This paper introduces the work procedures and the modification of the WAN in order to acquire a reduction in the running cost and the super speed network in the fiscal year. (author)

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

Super-Laplacians and their symmetries

Energy Technology Data Exchange (ETDEWEB)

Howe, P.S. [Department of Mathematics, King’s College London,The Strand, London, WC2R 2LS (United Kingdom); Lindström, University [Department of Physics and Astronomy, Theoretical Physics, Uppsala University,Uppsala, SE-751 20 (Sweden); Theoretical Physics, Imperial College London,Prince Consort Road, London, SW7 2AZ (United Kingdom)

2017-05-22

A super-Laplacian is a set of differential operators in superspace whose highest-dimensional component is given by the spacetime Laplacian. Symmetries of super-Laplacians are given by linear differential operators of arbitrary finite degree and are determined by superconformal Killing tensors. We investigate these in flat superspaces. The differential operators determining the symmetries give rise to algebras which can be identified in many cases with the tensor algebras of the relevant superconformal Lie algebras modulo certain ideals. They have applications to Higher Spin theories.

Super-preshowers (DPG-Fruehjahrstagung 2016)

Energy Technology Data Exchange (ETDEWEB)

Kaeaepae, Alex [Bergische Universitaet Wuppertal, Gaussstr. 20, 42119 Wuppertal (Germany); Collaboration: Pierre-Auger-Collaboration

2016-07-01

Based on the current data from the Pierre Auger Observatory, no evidence of cosmic ray photon primaries has been found. However, photon primaries could induce so-called ''super-preshowers'', which have not been considered sofar, but are a promising candidate for explaining the ''composition puzzle'' at ultra-high energies. In this presentation, possible super-preshower processes are examined, and their effects on important Auger parameters, such as the energy deposit and muon production, are studied via simulations.

Super-Laplacians and their symmetries

International Nuclear Information System (INIS)

Howe, P.S.; Lindström, University

2017-01-01

A super-Laplacian is a set of differential operators in superspace whose highest-dimensional component is given by the spacetime Laplacian. Symmetries of super-Laplacians are given by linear differential operators of arbitrary finite degree and are determined by superconformal Killing tensors. We investigate these in flat superspaces. The differential operators determining the symmetries give rise to algebras which can be identified in many cases with the tensor algebras of the relevant superconformal Lie algebras modulo certain ideals. They have applications to Higher Spin theories.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

Migration-driven diversity of super-Earth compositions

Science.gov (United States)

Raymond, Sean N.; Boulet, Thibault; Izidoro, Andre; Esteves, Leandro; Bitsch, Bertram

2018-06-01

A leading model for the origin of super-Earths proposes that planetary embryos migrate inward and pile up on close-in orbits. As large embryos are thought to preferentially form beyond the snow line, this naively predicts that most super-Earths should be very water-rich. Here we show that the shortest-period planets formed in the migration model are often purely rocky. The inward migration of icy embryos through the terrestrial zone accelerates the growth of rocky planets via resonant shepherding. We illustrate this process with a simulation that provided a match to the Kepler-36 system of two planets on close orbits with very different densities. In the simulation, two super-Earths formed in a Kepler-36-like configuration; the inner planet was pure rock while the outer one was ice-rich. We conclude from a suite of simulations that the feeding zones of close-in super-Earths are likely to be broad and disconnected from their final orbital radii.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Pinching parameters for open (super) strings

Science.gov (United States)

Playle, Sam; Sciuto, Stefano

2018-02-01

We present an approach to the parametrization of (super) Schottky space obtained by sewing together three-punctured discs with strips. Different cubic ribbon graphs classify distinct sets of pinching parameters; we show how they are mapped onto each other. The parametrization is particularly well-suited to describing the region within (super) moduli space where open bosonic or Neveu-Schwarz string propagators become very long and thin, which dominates the IR behaviour of string theories. We show how worldsheet objects such as the Green's function converge to graph theoretic objects such as the Symanzik polynomials in the α ' → 0 limit, allowing us to see how string theory reproduces the sum over Feynman graphs. The (super) string measure takes on a simple and elegant form when expressed in terms of these parameters.

CLOUDS IN SUPER-EARTH ATMOSPHERES: CHEMICAL EQUILIBRIUM CALCULATIONS

Energy Technology Data Exchange (ETDEWEB)

Mbarek, Rostom; Kempton, Eliza M.-R., E-mail: mbarekro@grinnell.edu, E-mail: kemptone@grinnell.edu [Department of Physics, Grinnell College, Grinnell, IA 50112 (United States)

2016-08-20

Recent studies have unequivocally proven the existence of clouds in super-Earth atmospheres. Here we provide a theoretical context for the formation of super-Earth clouds by determining which condensates are likely to form under the assumption of chemical equilibrium. We study super-Earth atmospheres of diverse bulk composition, which are assumed to form by outgassing from a solid core of chondritic material, following Schaefer and Fegley. The super-Earth atmospheres that we study arise from planetary cores made up of individual types of chondritic meteorites. They range from highly reducing to oxidizing and have carbon to oxygen (C:O) ratios that are both sub-solar and super-solar, thereby spanning a range of atmospheric composition that is appropriate for low-mass exoplanets. Given the atomic makeup of these atmospheres, we minimize the global Gibbs free energy of formation for over 550 gases and condensates to obtain the molecular composition of the atmospheres over a temperature range of 350–3000 K. Clouds should form along the temperature–pressure boundaries where the condensed species appear in our calculation. We find that the composition of condensate clouds depends strongly on both the H:O and C:O ratios. For the super-Earth archetype GJ 1214b, KCl and ZnS are the primary cloud-forming condensates at solar composition, in agreement with previous work. However, for oxidizing atmospheres, K{sub 2}SO{sub 4} and ZnO condensates are favored instead, and for carbon-rich atmospheres with super-solar C:O ratios, graphite clouds appear. For even hotter planets, clouds form from a wide variety of rock-forming and metallic species.

On some classes of super quasi-Einstein manifolds

International Nuclear Information System (INIS)

Ozguer, Cihan

2009-01-01

Quasi-Einstein and generalized quasi-Einstein manifolds are the generalizations of Einstein manifolds. In this study, we consider a super quasi-Einstein manifold, which is another generalization of an Einstein manifold. We find the curvature characterizations of a Ricci-pseudosymmetric and a quasi-conformally flat super quasi-Einstein manifolds. We also consider the condition C ∼ .S=0 on a super quasi-Einstein manifold, where C ∼ and S denote the quasi-conformal curvature tensor and Ricci tensor of the manifold, respectively.

SuperB Bunch-By-Bunch Feedback R&D

Energy Technology Data Exchange (ETDEWEB)

Drago, A.; Beretta, M.; /Frascati; Bertsche, K.; Novokhatski, A.; /SLAC; Migliorati, M.; /Rome U.

2011-08-12

The SuperB project has the goal to build in Italy, in the Frascati or Tor Vergata area, an asymmetric e{sup +}/e{sup -} Super Flavor Factory to achieve a peak luminosity > 10**36 cm{sup -2} s{sup -1}. The SuperB design is based on collisions with extremely low vertical emittance beams and high beam currents. A source of emittance growth comes from the bunch by bunch feedback systems producing high power correction signals to damp the beams. To limit any undesirable effect, a large R&D program is in progress, partially funded by the INFN Fifth National Scientific Committee through the SFEED (SuperB Feedback) project approved within the 2010 budget. The SuperB project [1] has the goal to build in Italy, in the Frascati or Tor Vergata area, an asymmetric e{sup +}/e{sup -} Super Flavor Factory to achieve a peak luminosity > 10**36 cm{sup -2} s{sup -1}. In the last and current years, the machine layout has been deeply modified, in particular the main rings are now shorter and an option with high currents has been foreseen. In the fig.1 the new SuperB layout is shown. From bunch-by-bunch feedback point of view, the simultaneous presence in the machine parameters, of very low emittance, of the order of 5-10 pm in the vertical plane, and very high currents, at level of 4 Ampere for the Low Energy Ring, asks for designing very carefully the bunch-by-bunch feedback systems. The parameter list is presented in Fig. 2. The bunch-by-bunch feedback design must take care of the risky and exciting challenges proposed in the SuperB specifications, but it should consider also some other important aspects: flexibility in terms of being able to cope to unexpected beam behaviours [2], [3] legacy of previous version experience [4], [5] and internal powerful diagnostics [6] as in the systems previously used in PEP-II and DAFNE [7].

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Identifying Galactic Cosmic Ray Origins With Super-TIGER

Science.gov (United States)

deNolfo, Georgia; Binns, W. R.; Israel, M. H.; Christian, E. R.; Mitchell, J. W.; Hams, T.; Link, J. T.; Sasaki, M.; Labrador, A. W.; Mewaldt, R. A.;

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

SuperB Progress Reports - Physics

CERN Document Server

O'Leary, B.; Ramon, M.; Pous, E.; De Fazio, F.; Palano, A.; Eigen, G.; Asgeirsson, D.; Cheng, C.H.; Chivukula, A.; Echenard, B.; Hitlin, D.G.; Porter, F.; Rakitin, A.; Heinemeyer, S.; McElrath, B.; Andreassen, R.; Meadows, B.; Sokoloff, M.; Blanke, M.; Lesiak, T.; Shindou, T.; Ronga, F.; Baldini, W.; Bettoni, D.; Calabrese, R.; Cibinetto, G.; Luppi, E.; Rama, M.; Bossi, F.; Guido, E.; Patrignani, C.; Tosi, S.; Davies, C.; Lunghi, E.; Haisch, U.; Hurth, T.; Westhoff, S.; Crivellin, A.; Hofer, L.; Goto, T.; Brown, David Nathan; Branco, G.C.; Zupan, J.; Herrero, M.; Rodriguez-Sanchez, A.; Simi, G.; Tackmann, F.J.; Biassoni, P.; Lazzaro, A.; Lombardo, V.; Palombo, F.; Stracka, S.; Lindemann, D.M.; Robertson, S.H.; Duling, B.; Gemmler, K.; Gorbahn, M.; Jager, S.; Paradisi, P.; Straub, D.M.; Bigi, I.; Asner, D.M.; Fast, J.E.; Kouzes, R.T.; Morandin, M.; Rotondo, M.; Ben-Haim, E.; Arnaud, N.; Burmistrov, L.; Kou, E.; Perez, A.; Stocchi, A.; Viaud, B.; Domingo, F.; Piccinini, F.; Manoni, E.; Batignani, G.; Cervelli, A.; Forti, F.; Giorgi, M.; Lusiani, A.; Oberhof, B.; Paoloni, E.; Neri, N.; Walsh, J.; Bevan, A.; Bona, M.; Walker, C.; Weiland, C.; Lenz, A.; Gonzalez-Sprinberg, G.; Faccini, R.; Renga, F.; Polosa, A.; Silvestrini, L.; Virto, J.; Ciuchini, M.; Lubicz, V.; Tarantino, C.; Wilson, F.F.; Carpinelli, M.; Huber, T.; Mannel, T.; Graham, M.; Ratcliff, B.N.; Santoro, V.; Sekula, S.; Shougaev, K.; Soffer, A.; Shimizu, Y.; Gambino, P.; Mussa, R.; Nardecchia, M.; Stal, O.; Bernabeu, J.; Botella, F.; Jung, M.; Lopez March, N.; Martinez Vidal, F.; Oyanguren, A.; Pich, A.; Lozano, M.A.Sanchis; Vidal, J.; Vives, O.; Banerjee, S.; Roney, J.M.; Petrov, A.A.; Flood, K.

2010-01-01

SuperB is a high luminosity e+e- collider that will be able to indirectly probe new physics at energy scales far beyond the reach of any man made accelerator planned or in existence. Just as detailed understanding of the Standard Model of particle physics was developed from stringent constraints imposed by flavour changing processes between quarks, the detailed structure of any new physics is severely constrained by flavour processes. In order to elucidate this structure it is necessary to perform a number of complementary studies of a set of golden channels. With these measurements in hand, the pattern of deviations from the Standard Model behavior can be used as a test of the structure of new physics. If new physics is found at the LHC, then the many golden measurements from SuperB will help decode the subtle nature of the new physics. However if no new particles are found at the LHC, SuperB will be able to search for new physics at energy scales up to 10-100 TeV. In either scenario, flavour physics measure...

SuperB Technical Design Report

CERN Document Server

Baszczyk, M.; Kolodziej, J.; Kucewicz, W.; Sapor, M.; Jeremie, A.; Grauges Pous, E.; Bruno, G.E.; De Robertis, G.; Diacono, D.; Donvito, G.; Fusco, P.; Gargano, F.; Giordano, F.; Loddo, F.; Loparco, F.; Maggi, G.P.; Manzari, V.; Mazziotta, M.N.; Nappi, E.; Palano, A.; Santeramo, B.; Sgura, I.; Silvestris, L.; Spinoso, V.; Eigen, G.; Zalieckas, J.; Zhuo, Z.; Jenkovszky, L.; Balbi, G.; Boldini, M.; Bonacorsi, D.; Cafaro, V.; D'Antone, I.; Dallavalle, G.M.; Di Sipio, R.; Fabbri, F.; Fabbri, L.; Gabrielli, A.; Galli, D.; Giacomelli, P.; Giordano, V.; Giorgi, F.M.; Grandi, C.; Lax, I.; Lo Meo, S.; Marconi, U.; Montanari, A.; Pellegrini, G.; Piccinini, M.; Rovelli, T.; Semprini Cesari, N.; Torromeo, G.; Tosi, N.; Travaglini, R.; Vagnoni, V.M.; Valentinetti, S.; Villa, M.; Zoccoli, A.; Caron, J. -F.; Hearty, C.; Lu, P. F. -T.; Mattison, T.S.; McKenna, J.A.; So, R. Y.; Barnyakov, M. Yu.; Blinov, V.E.; Botov, A.A.; Druzhinin, V.P.; Golubev, V.B.; Kononov, S.A.; Kravchenko, E.A.; Levichev, E.B.; Onuchin, A.P.; Serednyakov, S.I.; Shtol, D.A.; Skovpen, Y.I.; Solodov, E.P.; Cardini, A.; Carpinelli, M.; Chao, D. S. -T.; Cheng, C.H.; Doll, D.A.; Echenard, B.; Flood, K.; Hanson, J.; Hitlin, D.G.; Ongmongkolkul, P.; Porter, F.C.; Zhu, R.Y.; Randazzo, N.; De La Cruz Burelo, E.; Zheng, Y.; Campos, P.; De Silva, M.; Kathirgamaraju, A.; Meadows, B.; Pushpawela, B.; Shi, Y.; Sokoloff, M.; Lopez Castro, G.; Ciaschini, V.; Franchini, P.; Giacomini, F.; Paolini, A.; Calderon Polania, G. A.; Laczek, S.; Romanowicz, P.; Szybinski, B.; Czuchry, M.; Flis, L.; Harezlak, D.; Kocot, J.; Radecki, M.; Sterzel, M.; Szepieniec, T.; Szymocha, T.; Wójcik, P.; Andreotti, M.; Baldini, W.; Calabrese, R.; Carassiti, V.; Cibinetto, G.; Cotta Ramusino, A.; Evangelisti, F.; Gianoli, A.; Luppi, E.; Malaguti, R.; Manzali, M.; Melchiorri, M.; Munerato, M.; Padoan, C.; Santoro, V.; Tomassetti, L.; Beretta, M.M.; Biagini, M.; Boscolo, M.; Capitolo, E.; de Sangro, R.; Esposito, M.; Felici, G.; Finocchiaro, G.; Gatta, M.; Gatti, C.; Guiducci, S.; Lauciani, S.; Patteri, P.; Peruzzi, I.; Piccolo, M.; Raimondi, P.; Rama, M.; Sanelli, C.; Tomassini, S.; Fabbricatore, P.; Delepine, D.; Reyes Santos, M. A.; Chrzaszcz, M.; Grzymkowski, R.; Knap, P.; Kotula, J.; Lesiak, T.; Ludwin, J.; Michalowski, J.; Pawlik, B.; Rachwal, B.; Stodulski, M.; Wiechczynski, J.; Witek, M.; Zawiejski, L.; Zdybal, M.; Aushev, V.Y.; Ustynov, A.; Arnaud, N.; Bambade, P.; Beigbeder, C.; Bogard, F.; Borsato, M.; Breton, D.; Brossard, J.; Burmistrov, L.; Charlet, D.; Chaumat, V.; Dadoun, O.; El Berni, M.; Maalmi, J.; Puill, V.; Rimbault, C.; Stocchi, A.; Tocut, V.; Variola, A.; Wallon, S.; Wormser, G.; Grancagnolo, F.; Ben-Haim, E.; Sitt, S.; Baylac, M.; Bourrion, O.; Deconto, J. -M.; Gomez Martinez, Y.; Monseu, N.; Muraz, J. -F.; Real, J. -S.; Vescovi, C.; Cenci, R.; Jawahery, A.; Roberts, D.; Twedt, E.W.; Cheaib, R.; Lindemann, D.; Nderitu, S.; Patel, P.; Robertson, S.H.; Swersky, D.; Warburton, A.; Cuautle Flores, E.; Toledo Sanchez, G.; Biassoni, P.; Bombelli, L.; Citterio, M.; Coelli, S.; Fiorini, C.; Liberali, V.; Monti, M.; Nasri, B.; Neri, N.; Palombo, F.; Sabatini, F.; Stabile, A.; Berra, A.; Giachero, A.; Gotti, C.; Lietti, D.; Maino, M.; Pessina, G.; Prest, M.; Martin, J. -P.; Simard, M.; Starinski, N.; Taras, P.; Drutskoy, A.; Makarychev, S.; Nefediev, A.V.; Aloisio, A.; Cavaliere, S.; De Nardo, G.; Della Pietra, M.; Doria, A.; Giordano, R.; Ordine, A.; Pardi, S.; Russo, G.; Sciacca, C.; Bigi, I.I.; Jessop, C.P.; Wang, W.; Bellato, M.; Benettoni, M.; Corvo, M.; Crescente, A.; Dal Corso, F.; Dosselli, U.; Fanin, C.; Gianelle, A.; Longo, S.; Michelotto, M.; Montecassiano, F.; Morandin, M.; Pengo, R.; Posocco, M.; Rotondo, M.; Simi, G.; Stroili, R.; Gaioni, L.; Manazza, A.; Manghisoni, M.; Ratti, L.; Re, V.; Traversi, G.; Zucca, S.; Bizzaglia, S.; Bizzarri, M.; Cecchi, C.; Germani, S.; Lebeau, M.; Lubrano, P.; Manoni, E.; Papi, A.; Rossi, A.; Scolieri, G.; Batignani, G.; Bettarini, S.; Casarosa, G.; Cervelli, A.; Fella, A.; Forti, F.; Giorgi, M.; Lilli, L.; Lusiani, A.; Oberhof, B.; Paladino, A.; Pantaleo, F.; Paoloni, E.; Perez Perez, A. L.; Rizzo, G.; Walsh, J.; Fernández Téllez, A.; Beck, G.; Berman, M.; Bevan, A.; Gannaway, F.; Inguglia, G.; Martin, A.J.; Morris, J.; Bocci, V.; Capodiferro, M.; Chiodi, G.; Dafinei, I.; Drenska, N.V.; Faccini, R.; Ferroni, F.; Gargiulo, C.; Gauzzi, P.; Luci, C.; Lunadei, R.; Martellotti, G.; Pellegrino, F.; Pettinacci, V.; Pinci, D.; Recchia, L.; Ruggeri, D.; Zullo, A.; Camarri, P.; Cardarelli, R.; De Santis, C.; Di Ciaccio, A.; Di Felice, V.; Di Palma, F.; Di Simone, A.; Marcelli, L.; Messi, R.; Moricciani, D.; Sparvoli, R.; Tammaro, S.; Branchini, P.; Budano, A.; Bussino, S.; Ciuchini, M.; Nguyen, F.; Passeri, A.; Ruggieri, F.; Spiriti, E.

2013-01-01

In this Technical Design Report (TDR) we describe the SuperB detector that was to be installed on the SuperB e+e- high luminosity collider. The SuperB asymmetric collider, which was to be constructed on the Tor Vergata campus near the INFN Frascati National Laboratory, was designed to operate both at the Upsilon(4S) center-of-mass energy with a luminosity of 10^{36} cm^{-2}s^{-1} and at the tau/charm production threshold with a luminosity of 10^{35} cm^{-2}s^{-1}. This high luminosity, producing a data sample about a factor 100 larger than present B Factories, would allow investigation of new physics effects in rare decays, CP Violation and Lepton Flavour Violation. This document details the detector design presented in the Conceptual Design Report (CDR) in 2007. The R&D and engineering studies performed to arrive at the full detector design are described, and an updated cost estimate is presented. A combination of a more realistic cost estimates and the unavailability of funds due of the global economic ...

Pioneering SUPER - Small Unit Passively-safe Enclosed Reactor - 15559

International Nuclear Information System (INIS)

Bhownik, P.K.; Gairola, A.; Shamim, J.A.; Suh, K.Y.; Suh, K.S.

2015-01-01

This paper presents the basic features of the Small Unit Passively-safe Enclosed Reactor abbreviated as SUPER, a new reactor system that has been designed and proposed at the Seoul National University's Department of Energy Systems Engineering. SUPER is a small modular reactor system or SMR that is cooled by sub-cooled as well as supercritical water. As a new member of SMRs, SUPER is a small-scale nuclear plant that is designed to be factory-manufactured and shipped as modules to be assembled at a site. The concept offers promising answers to many questions about nuclear power including proliferation resistance, waste management, safety, and startup costs. SUPER is a customized paradigm of a supercritical water reactor or SCWR, a type sharing commonalities with the current fleet of light water reactors, or LWRs. SUPER has evolved from the System-integrated Modular Advance Reactor, or SMART, being developed at the Korea Atomic Energy Research Institute, or KAERI. SUPER enhanced the safety features for robustness, design/equipment simplification for natural convection, multi-purpose application for co-generation flexibilities, suitable for isolated or small electrical grids, just-in-time capacity addition, short construction time, and last, but not least, lower capital cost per unit. The primary objectives of SUPER is to develop the conceptual design for a safe and economic small, natural circulation SCWR, to address the economic and safety attributes of the concept, and to demonstrate its technical feasibilities. (authors)

Super-resolution fluorescence microscopy by stepwise optical saturation

Science.gov (United States)

Zhang, Yide; Nallathamby, Prakash D.; Vigil, Genevieve D.; Khan, Aamir A.; Mason, Devon E.; Boerckel, Joel D.; Roeder, Ryan K.; Howard, Scott S.

2018-01-01

Super-resolution fluorescence microscopy is an important tool in biomedical research for its ability to discern features smaller than the diffraction limit. However, due to its difficult implementation and high cost, the super-resolution microscopy is not feasible in many applications. In this paper, we propose and demonstrate a saturation-based super-resolution fluorescence microscopy technique that can be easily implemented and requires neither additional hardware nor complex post-processing. The method is based on the principle of stepwise optical saturation (SOS), where M steps of raw fluorescence images are linearly combined to generate an image with a M-fold increase in resolution compared with conventional diffraction-limited images. For example, linearly combining (scaling and subtracting) two images obtained at regular powers extends the resolution by a factor of 1.4 beyond the diffraction limit. The resolution improvement in SOS microscopy is theoretically infinite but practically is limited by the signal-to-noise ratio. We perform simulations and experimentally demonstrate super-resolution microscopy with both one-photon (confocal) and multiphoton excitation fluorescence. We show that with the multiphoton modality, the SOS microscopy can provide super-resolution imaging deep in scattering samples. PMID:29675306

Focusing super resolution on the cytoskeleton [version 1; referees: 3 approved

Directory of Open Access Journals (Sweden)

Eric A. Shelden

2016-05-01

Full Text Available Super resolution imaging is becoming an increasingly important tool in the arsenal of methods available to cell biologists. In recognition of its potential, the Nobel Prize for chemistry was awarded to three investigators involved in the development of super resolution imaging methods in 2014. The availability of commercial instruments for super resolution imaging has further spurred the development of new methods and reagents designed to take advantage of super resolution techniques. Super resolution offers the advantages traditionally associated with light microscopy, including the use of gentle fixation and specimen preparation methods, the ability to visualize multiple elements within a single specimen, and the potential to visualize dynamic changes in living specimens over time. However, imaging of living cells over time is difficult and super resolution imaging is computationally demanding. In this review, we discuss the advantages/disadvantages of different super resolution systems for imaging fixed live specimens, with particular regard to cytoskeleton structures.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

The structure of the super-W∞(λ) algebra

International Nuclear Information System (INIS)

Bergshoeff, E.; Wit, B. de; Vasiliev, M.

1991-01-01

We give a comprehensive treatment of the super-W ∞ (λ) algebra, an extension of the super-Virasoro algebra that contains generators of spin S ≥ 1/2. The parameter λ defines the embedding of the Virasoro subalgebra. We describe how to obtain the super-W ∞ (λ) algebra from the associative algebra of superspace differential operators. We discuss the structure of this associative algebra and its relation with the so-called wedge algebra, in which the generators for given spin are restricted to finite-dimensional representations of sl(2). From the super-W ∞ (λ) algebra one can obtain a variety of W ∞ algebras by consistent truncations for specific values of λ. Without truncation the algebras are formally isomorphic for different values of λ. We present a realization in terms of the currents of a supersymmetric bc system. (orig.)

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Superfield realizations of N=2 super-W3

International Nuclear Information System (INIS)

Ivanov, E.; Krivonos, S.

1992-04-01

We present a manifestly N=2 supersymmetric formulation of N=2 super-W 3 algebra (its classical version) in terms of the spin 1 and spin 2 supercurrents. Two closely related types of the Feigin-Fuchs representation for these supercurrents are found: via two chiral spin 1/2 superfields generating N=2 extended U(1) Kac-Moody algebras and via two free chiral spin 0 superfields. We also construct a one-parameter family of N=2 super Boussinesq equations for which N=2 super-W 3 provides the second Hamiltonian structure. (author). 17 refs

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Nonlinear super-resolution nano-optics and applications

CERN Document Server

Wei, Jingsong

2015-01-01

This book covers many advances in the subjects of nano-optics and nano photonics. The author describes the principle and technical schematics of common methods for breaking through the optical diffraction limit and focuses on realizing optical super-resolution with nonlinear effects of thin film materials. The applications of nonlinear optical super-resolution effects in nano-data storage, nanolithography, and nano-imaging are also presented. This book is useful to graduate students majoring in optics and nano science and also serves as a reference book for academic researchers, engineers, technical professionals in the fields of super-resolution optics and laser techniques, nano-optics and nano photonics, nano-data storage, nano imaging, micro/nanofabrication and nanolithography and nonlinear optics.

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

Super-stable Poissonian structures

International Nuclear Information System (INIS)

Eliazar, Iddo

2012-01-01

In this paper we characterize classes of Poisson processes whose statistical structures are super-stable. We consider a flow generated by a one-dimensional ordinary differential equation, and an ensemble of particles ‘surfing’ the flow. The particles start from random initial positions, and are propagated along the flow by stochastic ‘wave processes’ with general statistics and general cross correlations. Setting the initial positions to be Poisson processes, we characterize the classes of Poisson processes that render the particles’ positions—at all times, and invariantly with respect to the wave processes—statistically identical to their initial positions. These Poisson processes are termed ‘super-stable’ and facilitate the generalization of the notion of stationary distributions far beyond the realm of Markov dynamics. (paper)

Super-stable Poissonian structures

Science.gov (United States)

Eliazar, Iddo

2012-10-01

In this paper we characterize classes of Poisson processes whose statistical structures are super-stable. We consider a flow generated by a one-dimensional ordinary differential equation, and an ensemble of particles ‘surfing’ the flow. The particles start from random initial positions, and are propagated along the flow by stochastic ‘wave processes’ with general statistics and general cross correlations. Setting the initial positions to be Poisson processes, we characterize the classes of Poisson processes that render the particles’ positions—at all times, and invariantly with respect to the wave processes—statistically identical to their initial positions. These Poisson processes are termed ‘super-stable’ and facilitate the generalization of the notion of stationary distributions far beyond the realm of Markov dynamics.

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

From heavy nuclei to super-heavy nuclei; Des noyaux lourds aux super-lourds

Energy Technology Data Exchange (ETDEWEB)

Theisen, Ch

2003-01-01

The existence of super-heavy nuclei has been predicted nearly fifty years ago. Due to the strong coulomb repulsion, the stabilisation of these nuclei is possible only through shell effects. The reasons for this fragile stability, as well as the theoretical predictions concerning the position of the island of stability are presented in the first part of this lecture. In the second part, experiments and experimental techniques which have been used to synthesize or search for super-heavy elements are described. Spectroscopic studies performed in very heavy elements are presented in the following section. We close this lecture with techniques that are currently being developed in order to reach the superheavy island and to study the structure of very-heavy nuclei. (author)

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

The Formation of Super-Earths by Tidally Forced Turbulence

Science.gov (United States)

Yu, Cong

2017-12-01

The Kepler observations indicate that many exoplanets are super-Earths, which brings about a puzzle for the core-accretion scenario. Since observed super-Earths are in the range of critical mass, they accrete gas efficiently and become gas giants. Theoretically, super-Earths are predicted to be rare in the core-accretion framework. To resolve this contradiction, we propose that the tidally forced turbulent diffusion may affect the heat transport inside the planet. Thermal feedback induced by turbulent diffusion is investigated. We find that the tidally forced turbulence generates pseudo-adiabatic regions within radiative zones, which pushes the radiative-convective boundaries inward. This decreases the cooling luminosity and enhances the Kelvin-Helmholtz (KH) timescale. For a given lifetime of protoplanetary disks (PPDs), there exists a critical threshold for the turbulent diffusivity, ν critical. If ν turb > ν critical, the KH timescale is longer than the disk lifetime and the planet becomes a super-Earth, rather than a gas giant. We find that even a small value of turbulent diffusion has influential effects on the evolution of super-Earths. The ν critical increases with the core mass. We further ascertain that, within the minimum-mass extrasolar nebula, ν critical increases with the semimajor axis. This may explain the feature that super-Earths are common in inner PPD regions, while gas giants are common in outer PPD regions. The predicted envelope mass fraction is not fully consistent with observations. We discuss physical processes, such as late core assembly and mass-loss mechanisms, that may be operating during super-Earth formation.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

Terrestrial planet formation in the presence of migrating super-Earths

International Nuclear Information System (INIS)

Izidoro, André; Morbidelli, Alessandro; Raymond, Sean N.

2014-01-01

Super-Earths with orbital periods less than 100 days are extremely abundant around Sun-like stars. It is unlikely that these planets formed at their current locations. Rather, they likely formed at large distances from the star and subsequently migrated inward. Here we use N-body simulations to study the effect of super-Earths on the accretion of rocky planets. In our simulations, one or more super-Earths migrate inward through a disk of planetary embryos and planetesimals embedded in a gaseous disk. We tested a wide range of migration speeds and configurations. Fast-migrating super-Earths (τ mig ∼ 0.01-0.1 Myr) only have a modest effect on the protoplanetary embryos and planetesimals. Sufficient material survives to form rocky, Earth-like planets on orbits exterior to the super-Earths'. In contrast, slowly migrating super-Earths shepherd rocky material interior to their orbits and strongly deplete the terrestrial planet-forming zone. In this situation any Earth-sized planets in the habitable zone are extremely volatile-rich and are therefore probably not Earth-like.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

Autonomous Operation of Super-Regenerative Receiver in BAN

NARCIS (Netherlands)

Kalyanasundaram, P.; Huang, L.; Dolmans, G.; Imamura, K.

2012-01-01

Super-regenerative receiver is one of the potential candidates to achieve ultra low power wireless communication in body area network (BAN). The main limitations of the super-regenerative receiver include the difficulty in choosing a good quench waveform to optimize its sensitivity and selectivity,

Stacked generalization: an introduction to super learning.

Science.gov (United States)

Naimi, Ashley I; Balzer, Laura B

2018-04-10

Stacked generalization is an ensemble method that allows researchers to combine several different prediction algorithms into one. Since its introduction in the early 1990s, the method has evolved several times into a host of methods among which is the "Super Learner". Super Learner uses V-fold cross-validation to build the optimal weighted combination of predictions from a library of candidate algorithms. Optimality is defined by a user-specified objective function, such as minimizing mean squared error or maximizing the area under the receiver operating characteristic curve. Although relatively simple in nature, use of Super Learner by epidemiologists has been hampered by limitations in understanding conceptual and technical details. We work step-by-step through two examples to illustrate concepts and address common concerns.

Super-resolution Microscopy in Plant Cell Imaging.

Science.gov (United States)

Komis, George; Šamajová, Olga; Ovečka, Miroslav; Šamaj, Jozef

2015-12-01

Although the development of super-resolution microscopy methods dates back to 1994, relevant applications in plant cell imaging only started to emerge in 2010. Since then, the principal super-resolution methods, including structured-illumination microscopy (SIM), photoactivation localization microscopy (PALM), stochastic optical reconstruction microscopy (STORM), and stimulated emission depletion microscopy (STED), have been implemented in plant cell research. However, progress has been limited due to the challenging properties of plant material. Here we summarize the basic principles of existing super-resolution methods and provide examples of applications in plant science. The limitations imposed by the nature of plant material are reviewed and the potential for future applications in plant cell imaging is highlighted. Copyright © 2015 Elsevier Ltd. All rights reserved.

Extreme super-resolution using the spherical geodesic waveguide

Science.gov (United States)

Miñano, Juan Carlos; González, Juan Carlos; Benítez, Pablo; Grabovičkić, Dejan

2012-06-01

Leonhardt demonstrated (2009) that the 2D Maxwell Fish Eye lens (MFE) can focus perfectly 2D Helmholtz waves of arbitrary frequency, i.e., it can transport perfectly an outward (monopole) 2D Helmholtz wave field, generated by a point source, towards a "perfect point drain" located at the corresponding image point. Moreover, a prototype with λ/5 super-resolution (SR) property for one microwave frequency has been manufactured and tested (Ma et al, 2010). Although this prototype has been loaded with an impedance different from the "perfect point drain", it has shown super-resolution property. However, neither software simulations nor experimental measurements for a broad band of frequencies have yet been reported. Here we present steady state simulations for two cases, using perfect drain as suggested by Leonhardt and without perfect drain as in the prototype. All the simulations have been done using a device equivalent to the MFE, called the Spherical Geodesic Waveguide (SGW). The results show the super-resolution up to λ/3000, for the system loaded with the perfect drain, and up to λ /500 for a not perfect load. In both cases super-resolution only happens for discrete number of frequencies. Out of these frequencies, the SGW does not show super-resolution in the analysis carried out.

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

EUROv Super Beam Studies

International Nuclear Information System (INIS)

Dracos, Marcos

2011-01-01

Neutrino Super Beams use conventional techniques to significantly increase the neutrino beam intensity compared to the present neutrino facilities. An essential part of these facilities is an intense proton driver producing a beam power higher than a MW. The protons hit a target able to accept the high proton beam intensity. The produced charged particles are focused by a system of magnetic horns towards the experiment detectors. The main challenge of these projects is to deal with the high beam intensity for many years. New high power neutrino facilities could be build at CERN profiting from an eventual construction of a high power proton driver. The European FP7 Design Study EUROv, among other neutrino beams, studies this Super Beam possibility. This paper will give the latest developments in this direction.

Steam generator development in France for the Super Phenix project; Generateurs de vapeur developpes en France pour Super Phenix

Energy Technology Data Exchange (ETDEWEB)

Robin, M G

1975-07-01

'Steam Generator Development for Super Phenix Project'. The development program of steam generators studied by Fives-Cail Babcock and Stein Industrie Companies, jointly with CEA end EDF, for the Super Phenix 1200 MWe Fast Breeder Power Plant, is presented. The main characteristics of both sodium heated steam generators are emphasized and experimental studies related to their key features are reported. (author)

Face Recognition by Metropolitan Police Super-Recognisers.

Science.gov (United States)

Robertson, David J; Noyes, Eilidh; Dowsett, Andrew J; Jenkins, Rob; Burton, A Mike

2016-01-01

Face recognition is used to prove identity across a wide variety of settings. Despite this, research consistently shows that people are typically rather poor at matching faces to photos. Some professional groups, such as police and passport officers, have been shown to perform just as poorly as the general public on standard tests of face recognition. However, face recognition skills are subject to wide individual variation, with some people showing exceptional ability-a group that has come to be known as 'super-recognisers'. The Metropolitan Police Force (London) recruits 'super-recognisers' from within its ranks, for deployment on various identification tasks. Here we test four working super-recognisers from within this police force, and ask whether they are really able to perform at levels above control groups. We consistently find that the police 'super-recognisers' perform at well above normal levels on tests of unfamiliar and familiar face matching, with degraded as well as high quality images. Recruiting employees with high levels of skill in these areas, and allocating them to relevant tasks, is an efficient way to overcome some of the known difficulties associated with unfamiliar face recognition.

Hot super-Earths stripped by their host stars.

Science.gov (United States)

Lundkvist, M S; Kjeldsen, H; Albrecht, S; Davies, G R; Basu, S; Huber, D; Justesen, A B; Karoff, C; Silva Aguirre, V; Van Eylen, V; Vang, C; Arentoft, T; Barclay, T; Bedding, T R; Campante, T L; Chaplin, W J; Christensen-Dalsgaard, J; Elsworth, Y P; Gilliland, R L; Handberg, R; Hekker, S; Kawaler, S D; Lund, M N; Metcalfe, T S; Miglio, A; Rowe, J F; Stello, D; Tingley, B; White, T R

2016-04-11

Simulations predict that hot super-Earth sized exoplanets can have their envelopes stripped by photoevaporation, which would present itself as a lack of these exoplanets. However, this absence in the exoplanet population has escaped a firm detection. Here we demonstrate, using asteroseismology on a sample of exoplanets and exoplanet candidates observed during the Kepler mission that, while there is an abundance of super-Earth sized exoplanets with low incident fluxes, none are found with high incident fluxes. We do not find any exoplanets with radii between 2.2 and 3.8 Earth radii with incident flux above 650 times the incident flux on Earth. This gap in the population of exoplanets is explained by evaporation of volatile elements and thus supports the predictions. The confirmation of a hot-super-Earth desert caused by evaporation will add an important constraint on simulations of planetary systems, since they must be able to reproduce the dearth of close-in super-Earths.

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Pulsating stars in SuperWASP

Directory of Open Access Journals (Sweden)

Holdsworth Daniel L.

2017-01-01

Full Text Available SuperWASP is one of the largest ground-based surveys for transiting exoplanets. To date, it has observed over 31 million stars. Such an extensive database of time resolved photometry holds the potential for extensive searches of stellar variability, and provide solid candidates for the upcoming TESS mission. Previous work by e.g. [15], [5], [12] has shown that the WASP archive provides a wealth of pulsationally variable stars. In this talk I will provide an overview of the SuperWASP project, present some of the published results from the survey, and some of the on-going work to identify key targets for the TESS mission.

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Isospin impurity and super-allowed {beta} transitions; Impurite d`isospin et transitions {beta} super-permises

Energy Technology Data Exchange (ETDEWEB)

Sagawa, H. [Center for Mathematical Science, University of Aizu, Aizu-Wakamatsu, Fukushima 965 (Japan); Van Giai Nguyen [Theoretical Physics Division, Inst. de Physique Nucleaire, Paris-11 Univ., 91 - Orsay (France); Suzuki, T. [Department of Physics, Nihon University, Tokyo 156 (Japan)

1999-10-01

We study the effect of isospin impurity on the super-allowed Fermi {beta} decay using microscopic HF and RPA (or TDA) model taking into account CSB and CIB interactions. It is found that the isospin impurity of N = Z nuclei gives enhancement of the sum rule of Fermi transition probabilities. On the other hand, the super-allowed transitions between odd-odd J = 0 nuclei and even-even J = 0 nuclei are quenched because on the cancellation of the isospin impurity effects of mother and daughter nuclei. An implication of the calculated Fermi transition rate on the unitarity of Cabbibo-Kobayashi-Maskawa mixing matrix is also discussed. (authors) 3 refs., 1 fig.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

A new six-component super soliton hierarchy and its self-consistent sources and conservation laws

International Nuclear Information System (INIS)

Wei Han-yu; Xia Tie-cheng

2016-01-01

A new six-component super soliton hierarchy is obtained based on matrix Lie super algebras. Super trace identity is used to furnish the super Hamiltonian structures for the resulting nonlinear super integrable hierarchy. After that, the self-consistent sources of the new six-component super soliton hierarchy are presented. Furthermore, we establish the infinitely many conservation laws for the integrable super soliton hierarchy. (paper)

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Impressive Super Phenix

International Nuclear Information System (INIS)

Olds, F.C.

1979-01-01

The 1200-MWe fast breeder reactor, Super Phenix at Creys-Malville, is scheduled for commercial operation in 1983. This is the world's first near-commercial-sized fast breeder. As a near-commercial-sized unit, it represents essentially the technology and hardware of the first fully commercial follow-on units. In its size, its components, its design, the technology it represents, and its project schedule, it is impressive. As of May 1979, the Super Phenix nuclear steam boiler in the Creys-Malville plant bore an estimated cost of $700 million, without fuel. The total cost of the Creys-Malville plant now is estimated at about $1.4 billion. This is about twice the cost of a comparable standardized PWR being built in France today. However, it should be borne in mind that Creys-Malville carries the high cost of a first-of-the-line prototype, and that France's PWRs are standardized, second-generation units. Electricity from Creys-Malville is estimated to cost a little more than electricity would cost from a coal-fired plant complete with flue gas scrubbing

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

Super-Group Field Cosmology in Batalin-Vilkovisky Formulation

Science.gov (United States)

Upadhyay, Sudhaker

2016-09-01

In this paper we study the third quantized super-group field cosmology, a model in multiverse scenario, in Batalin-Vilkovisky (BV) formulation. Further, we propose the superfield/super-antifield dependent BRST symmetry transformations. Within this formulation we establish connection between the two different solutions of the quantum master equation within the BV formulation.

Nonlinear super-W algebras at fixed central charge

NARCIS (Netherlands)

Bergshoeff, E.

1991-01-01

We discuss how a class of nonlinear higher-spin superalgebras, containing a Virasoro subalgebra at fixed central charge, can be obtained from a realisation of the super-W∞(λ) algebra in terms of a supersymmetric BC system. We explicitly work out the example of the nonlinear super-W2 algebra.

Conservation laws and self-consistent sources for a super-CKdV equation hierarchy

International Nuclear Information System (INIS)

Li Li

2011-01-01

From the super-matrix Lie algebras, we consider a super-extension of the CKdV equation hierarchy in the present Letter, and propose the super-CKdV hierarchy with self-consistent sources. Furthermore, we establish the infinitely many conservation laws for the integrable super-CKdV hierarchy.

Conservation laws and self-consistent sources for a super-CKdV equation hierarchy

Energy Technology Data Exchange (ETDEWEB)

Li Li, E-mail: li07099@163.co [College of Maths and Systematic Science, Shenyang Normal University, Shenyang 110034 (China)

2011-03-14

From the super-matrix Lie algebras, we consider a super-extension of the CKdV equation hierarchy in the present Letter, and propose the super-CKdV hierarchy with self-consistent sources. Furthermore, we establish the infinitely many conservation laws for the integrable super-CKdV hierarchy.

Acoustic Design of Super-light Structures

DEFF Research Database (Denmark)

Christensen, Jacob Ellehauge; Hertz, Kristian Dahl; Brunskog, Jonas

in a controlled laboratory environment have been conducted with the element in order to evaluate its performance in airborne and impact sound insulation. These results have been employed in simulations of the flanking transmission to estimate the in-situ performance of the super-light slab element. The flanking...... aggregate (leca) along with a newly developed technology called pearl-chain reinforcement, which is a system for post-tensioning. Here, it is shown how to combine these technologies within a precast super-light slab element, while honoring the requirements of a holistic design. Acoustic experiments...

Covariant super reggeon calculus for superstrings

International Nuclear Information System (INIS)

Petersen, J.L.; Sidenius, J.R.; Tollsten, A.K.

1988-07-01

A previously developed formalism for the bosonic string is extended to the Neveu-Schwarz-Ramond string using 2-d superspace techniques throughout. 3-string vertices for NS- and R-strings are constructed, sewing rules developed, and the technique of quasi-superconformal modes is set up for constructing the measure on super moduli space. Symmetries, such as superconformal invariance and BRST-invariance, are guaranteed ab initio. Picture changing and bosonization are avoided. Examples are given. The formalism should allow a superstring loop calculus based on supermoduli. Results concerning the ensuing super-Schottky description are given. (orig.)

Performance Evaluations for Super-Resolution Mosaicing on UAS Surveillance Videos

Directory of Open Access Journals (Sweden)

Aldo Camargo

2013-05-01

Full Text Available Abstract Unmanned Aircraft Systems (UAS have been widely applied for reconnaissance and surveillance by exploiting information collected from the digital imaging payload. The super-resolution (SR mosaicing of low-resolution (LR UAS surveillance video frames has become a critical requirement for UAS video processing and is important for further effective image understanding. In this paper we develop a novel super-resolution framework, which does not require the construction of sparse matrices. The proposed method implements image operations in the spatial domain and applies an iterated back-projection to construct super-resolution mosaics from the overlapping UAS surveillance video frames. The Steepest Descent method, the Conjugate Gradient method and the Levenberg-Marquardt algorithm are used to numerically solve the nonlinear optimization problem for estimating a super-resolution mosaic. A quantitative performance comparison in terms of computation time and visual quality of the super-resolution mosaics through the three numerical techniques is presented.

Impedance measurement and modelling of super-capacitors for railway applications

Energy Technology Data Exchange (ETDEWEB)

Hammar, A.; Chabas, J. [Societe Nationale des Chemins de fer Francais (SNCF), Dir. de la Recherche, 75 - Paris (France); Coquery, G.; Lallemand, R. [Institut National de Recherche sur les Transports et leur Securite (INRETS), Lab. des Technologies Nouvelles, 94 - Arcueil (France); Rojat, G.; Venet, P. [Lyon-1 Univ. Claude Bernard, CEGELY, 69 - Villeurbanne (France)

2004-07-01

Railways and electrical traction systems require high power rates to achieve their operating performances. Systems of power supply based on super-capacitors should offer high power density along with good energy efficiency and expected operating safety. We investigate general behaviours of super-capacitors with two powerful methods of analysis. The first is constant charge/discharge current at high level value (500 A), the second is impedance spectroscopy which leads to the acquisition of a set of parameters that are considered sufficient to describe general properties of super-capacitor, in particular the state of health and the available energy in any operating conditions. An electrical circuit model is defined for super-capacitors based on activated carbon and organic electrolyte. It takes into account the dependence of super-capacitor to voltage and current. The mixture of data of the two methods permits to obtain a representative model for power applications. Matlab/Simulink simulations are shown to verify the validity of the model. (authors)

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

The 2015 super-resolution microscopy roadmap

International Nuclear Information System (INIS)

Hell, Stefan W; Sahl, Steffen J; Bates, Mark; Jakobs, Stefan; Zhuang, Xiaowei; Heintzmann, Rainer; Booth, Martin J; Bewersdorf, Joerg; Shtengel, Gleb; Hess, Harald; Tinnefeld, Philip; Honigmann, Alf; Testa, Ilaria; Cognet, Laurent; Lounis, Brahim; Ewers, Helge; Davis, Simon J; Eggeling, Christian; Klenerman, David; Willig, Katrin I

2015-01-01

Far-field optical microscopy using focused light is an important tool in a number of scientific disciplines including chemical, (bio)physical and biomedical research, particularly with respect to the study of living cells and organisms. Unfortunately, the applicability of the optical microscope is limited, since the diffraction of light imposes limitations on the spatial resolution of the image. Consequently the details of, for example, cellular protein distributions, can be visualized only to a certain extent. Fortunately, recent years have witnessed the development of ‘super-resolution’ far-field optical microscopy (nanoscopy) techniques such as stimulated emission depletion (STED), ground state depletion (GSD), reversible saturated optical (fluorescence) transitions (RESOLFT), photoactivation localization microscopy (PALM), stochastic optical reconstruction microscopy (STORM), structured illumination microscopy (SIM) or saturated structured illumination microscopy (SSIM), all in one way or another addressing the problem of the limited spatial resolution of far-field optical microscopy. While SIM achieves a two-fold improvement in spatial resolution compared to conventional optical microscopy, STED, RESOLFT, PALM/STORM, or SSIM have all gone beyond, pushing the limits of optical image resolution to the nanometer scale. Consequently, all super-resolution techniques open new avenues of biomedical research. Because the field is so young, the potential capabilities of different super-resolution microscopy approaches have yet to be fully explored, and uncertainties remain when considering the best choice of methodology. Thus, even for experts, the road to the future is sometimes shrouded in mist. The super-resolution optical microscopy roadmap of Journal of Physics D: Applied Physics addresses this need for clarity. It provides guidance to the outstanding questions through a collection of short review articles from experts in the field, giving a thorough

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

N=2 super - W{sub 3}{sup (2)} algebra in superfields

Energy Technology Data Exchange (ETDEWEB)

Krivonos, S; Sorin, A [Joint Inst. for Nuclear Research, Dubna (Russian Federation). Lab. of Theoretical Physics; [Istituto Nazionale di Fisica Nucleare, Frascati (Italy); Ivanov, E [Joint Inst. for Nuclear Research, Dubna (Russian Federation). Lab. of Theoretical Physics

1995-05-01

It is presented a manifestly N=2 supersymmetric formulation of N=2 super-W{sub 3}{sup (2)} algebra (its classical version) in terms of the spin 1 unconstrained generating a N=2 superconformal subalgebra and the spins 1/2, 2 fermionic constrained supercurrents. It is considered a superfield reduction of N=2 super-W{sub 3}{sup (2)} to N=2 super-W{sub 3} and construct a family of evolution equations for which N=2 super-W{sub 3}{sup (2)} provides the second Hamiltonian structure.

Super Bowli teooria soovitab aktsiaid osta / Fredy-Edwin Esse

Index Scriptorium Estoniae

Esse, Fredy-Edwin

2011-01-01

Super Bowli teooria kohaselt tõuseb Dow Jones, kui võidab algupärase NFL-i meeskond. MarketWatchi peaökonomist Irwin Keller avaldab arvamust, miks tasuks investoritel Super Bowli tulemustele tähelepanu pöörata

Super-resolution Phase Tomography

KAUST Repository

Depeursinge, Christian; Cotte, Yann; Toy, Fatih; Jourdain, Pascal; Boss, Daiel; Marquet, Pierre; Magistretti, Pierre J.

2013-01-01

Digital Holographic Microscopy (DHM) yields reconstructed complex wavefields. It allows synthesizing the aperture of a virtual microscope up to 2π, offering super-resolution phase images. Live images of micro-organisms and neurons with resolution less than 100 nm are presented.

Super-resolution Phase Tomography

KAUST Repository

Depeursinge, Christian

2013-04-21

Digital Holographic Microscopy (DHM) yields reconstructed complex wavefields. It allows synthesizing the aperture of a virtual microscope up to 2π, offering super-resolution phase images. Live images of micro-organisms and neurons with resolution less than 100 nm are presented.

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

New idea on the classification of world super-large deposits

International Nuclear Information System (INIS)

Tong Hangshou

2012-01-01

According to the theory of 'multi factors and compound genesis', 'complexity of mineralization' and 'metallogenic series', this paper proposed a new classification idea on the world super-large deposits with the combination of new results on the study of global background for super-large deposits and the model of 'conjugation of multi-source and focus of multi-factors'. 15 super-large deposits with the reserve over 50000 t were studied as the ases, 6 types and 13 sub-types of economics-genesis have been divided for the super-large deposit. The classification is discoursed with symbols and worlds and brief introduction on typical deposit. (authors)

Research Advances in High-Yielding Cultivation and Physiology of Super Rice

Directory of Open Access Journals (Sweden)

Jing FU

2012-09-01

Full Text Available In 1996, China launched a program to breed super rice or super hybrid rice by combining intersubspecific heterosis with ideal plant types. Today, approximately 80 super rice varieties have been released and some of them show high grain yields of 12–21 t/hm2 in field experiments. The main reasons for the high yields of super rice varieties, compared with those of conventional varieties, can be summarized as follows: more spikelets per panicle and larger sink size (number of spikelets per square meter; larger leaf area index, longer duration of green leaf, greater photosynthetic rate, higher lodging resistance, greater dry matter accumulation before the heading stage, greater remobilization of pre-stored carbohydrates from stems and leaves to grains during the grain-filling period; and larger root system and greater root activity. However, there are two main problems in super rice production: poor grain-filling of the later-flowering inferior spikelets (in contrast to earlier-flowering superior spikelets, and low and unstable seed-setting rate. Here, we review recent research advances in the crop physiology of super rice, focusing on biological features, formation of yield components, and population quality. Finally, we suggest further research on crop physiology of super rice.

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

SINGLE FRAME SUPER RESOLUTION OF NONCOOPERATIVE IRIS IMAGES

Directory of Open Access Journals (Sweden)

Anand Deshpande

2016-11-01

Full Text Available Image super-resolution, a process to enhance image resolution, has important applications in biometrics, satellite imaging, high definition television, medical imaging, etc. The long range captured iris identification systems often suffer from low resolution and meager focus of the captured iris images. These degrade the iris recognition performance. This paper proposes enhanced iterated back projection (EIBP method to super resolute the long range captured iris polar images. The performance of proposed method is tested and analyzed on CASIA long range iris database by comparing peak signal to noise ratio (PSNR and structural similarity index (SSIM with state-of-the-art super resolution (SR algorithms. It is further analyzed by increasing the up-sampling factor. Performance analysis shows that the proposed method is superior to state-of-the-art algorithms, the peak signal-to-noise ratio improved about 0.1-1.5 dB. The results demonstrate that the proposed method is well suited to super resolve the iris polar images captured at a long distance

The Super-Seniors Study: Phenotypic characterization of a healthy 85+ population.

Science.gov (United States)

Halaschek-Wiener, Julius; Tindale, Lauren C; Collins, Jennifer A; Leach, Stephen; McManus, Bruce; Madden, Kenneth; Meneilly, Graydon; Le, Nhu D; Connors, Joseph M; Brooks-Wilson, Angela R

2018-01-01

To understand why some people live to advanced age in good health and others do not, it is important to study not only disease, but also long-term good health. The Super-Seniors Study aims to identify factors associated with healthy aging. 480 healthy oldest-old 'Super-Seniors' aged 85 to 105 years and never diagnosed with cancer, cardiovascular disease, diabetes, dementia, or major pulmonary disease, were compared to 545 mid-life controls aged 41-54, who represent a group that is unselected for survival from late-life diseases. Health and lifestyle information, personal and family medical history, and blood samples were collected from all participants. Super-Seniors also underwent four geriatric tests. Super-Seniors showed high cognitive (Mini-Mental State Exam mean = 28.3) and functional capacity (Instrumental Activities of Daily Living Scale mean = 21.4), as well as high physical function (Timed Up and Go mean = 12.3 seconds) and low levels of depression (Geriatric Depression Scale mean = 1.5). Super-Seniors were less likely to be current smokers than controls, but the frequency of drinking alcohol was the same in both groups. Super-Seniors were more likely to have 4 or more offspring; controls were more likely to have no children. Female Super-Seniors had a mean age of last fertility 1.9 years older than controls, and were 2.3 times more likely to have had a child at ≥ 40 years. The parents of Super-Seniors had mean ages of deaths of 79.3 years for mothers, and 74.5 years for fathers, each exceeding the life expectancy for their era by a decade. Super-Seniors are cognitively and physically high functioning individuals who have evaded major age-related chronic diseases into old age, representing the approximately top 1% for healthspan. The familiality of long lifespan of the parents of Super-Seniors supports the hypothesis that heritable factors contribute to this desirable phenotype.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

SuperCDMS Underground Detector Fabrication Facility

Energy Technology Data Exchange (ETDEWEB)

Platt, M.; Mahapatra, R.; Bunker, Raymond A.; Orrell, John L.

2018-03-01

The SuperCDMS SNOLAB dark matter experiment processes Ge and Si crystals into fully tested phonon and ionization detectors at surface fabrication and test facilities. If not mitigated, it is anticipated that trace-level production of radioisotopes in the crystals due to exposure to cosmic rays at (or above) sea level will result in the dominant source of background events in future dark matter searches using the current SuperCDMS detector technology. Fabrication and testing of detectors in underground facilities shielded from cosmic radiation is one way to directly reduce production of trace levels of radioisotopes, thereby improving experimental sensitivity for the discovery of dark matter beyond the level of the current experiment. In this report, we investigate the cost and feasibility to establish a complete detector fabrication processing chain in an underground location to mitigate cosmogenic activation of the Ge and Si detector substrates. For a specific and concrete evaluation, we explore options for such a facility located at SNOLAB, an underground laboratory in Sudbury, Canada hosting the current and future experimental phases of SuperCDMS.

The Super-Kamiokande experiment

International Nuclear Information System (INIS)

Nishijima, K.

2000-01-01

The Super-Kamiokande experiment is a multi purpose experiment using a large imaging water Cherenkov detector with 50,000 tons of pure water. The detector is located 1000 m underground in the Kamioka mine in Japan, and it can detect particle interactions whose visible energies are between 5 MeV and 100 GeV, so that we can study many physics subjects as follows. Solar neutrino problem is one of the most important unsolved problems in astrophysics. Kamiokande experiment confirmed the deficit of neutrino flux compared to the standard Solar model prediction, which was first reported by R. Davis's pioneering work. Currently it is widely believed that the deficit is due to the neutrino oscillation. The Super-Kamiokande is a unique detector to measure the distortion of the energy spectrum of neutrinos, variation of the neutrino flux between day and night, and the seasonal variation of the flux. Those are related to the neutrino oscillation and independent of the Solar model uncertainty. Atmospheric neutrino anomaly was first announced by Kamiokande experiment, and the Super-Kamiokande recently provided clear evidence for neutrino oscillation as the solution to the anomaly. Observed ratio of muons to electrons is significantly smaller than what is expected. Moreover, zenith-angle distribution of observed muon neutrinos shows the strong up-down asymmetry. The zenith angle distribution of upward-going muons provides another information and the result also supports the oscillation hypothesis. We investigate not only the Solar neutrino problem and atmospheric neutrino anomaly, but also other astrophysical neutrino phenomena such as neutrino bursts from supernova explosions, high energy neutrino emission from point sources, neutrino events in correlation with Solar flares, and gamma-ray bursts. Search for nucleon decay is also one of the primary objectives of our experiment. However no evidence for nucleon decay has been observed yet, and we only set a lower limit on the partial

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Conformal anomaly of super Wilson loop

Energy Technology Data Exchange (ETDEWEB)

Belitsky, A.V., E-mail: andrei.belitsky@asu.edu [Department of Physics, Arizona State University, Tempe, AZ 85287-1504 (United States)

2012-09-11

Classically supersymmetric Wilson loop on a null polygonal contour possesses all symmetries required to match it onto non-MHV amplitudes in maximally supersymmetric Yang-Mills theory. However, to define it quantum mechanically, one is forced to regularize it since perturbative loop diagrams are not well defined due to presence of ultraviolet divergences stemming from integration in the vicinity of the cusps. A regularization that is adopted by practitioners by allowing one to use spinor helicity formalism, on the one hand, and systematically go to higher orders of perturbation theory is based on a version of dimensional regularization, known as Four-Dimensional Helicity scheme. Recently it was demonstrated that its use for the super Wilson loop at one loop breaks both conformal symmetry and Poincare supersymmetry. Presently, we exhibit the origin for these effects and demonstrate how one can undo this breaking. The phenomenon is alike the one emerging in renormalization group mixing of conformal operators in conformal theories when one uses dimensional regularization. The rotation matrix to the diagonal basis is found by means of computing the anomaly in the Ward identity for the conformal boost. Presently, we apply this ideology to the super Wilson loop. We compute the one-loop conformal anomaly for the super Wilson loop and find that the anomaly depends on its Grassmann coordinates. By subtracting this anomalous contribution from the super Wilson loop we restore its interpretation as a dual description for reduced non-MHV amplitudes which are expressed in terms of superconformal invariants.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Team Performance and Sport Attendance of South African Super ...

African Journals Online (AJOL)

In professional rugby, competitions such as the Super Rugby and Currie Cup benefit from the lucrative money-generating opportunities offered. This study focuses on team performance and spectator attendance of the Super Rugby and Currie Cup competitions. Results indicated some interesting relationships between ...

Temporal super resolution using variational methods

DEFF Research Database (Denmark)

Keller, Sune Høgild; Lauze, Francois Bernard; Nielsen, Mads

2010-01-01

Temporal super resolution (TSR) is the ability to convert video from one frame rate to another and is as such a key functionality in modern video processing systems. A higher frame rate than what is recorded is desired for high frame rate displays, for super slow-motion, and for video/film format...... observed when watching video on large and bright displays where the motion of high contrast edges often seem jerky and unnatural. A novel motion compensated (MC) TSR algorithm using variational methods for both optical flow calculation and the actual new frame interpolation is presented. The flow...

RF system for the super conducting proton linac

International Nuclear Information System (INIS)

Touchi, Y.

2001-01-01

In this paper, we introduce the several types of RF sources used for proton liner accelerators. Also we discus the undesirable characteristics of super-conducting cavities, and the influence of the large beam loading for an accelerating field. We propose the RF system for the super-conducting proton linear accelerators using the Diacrode or IOT taking these effects into account. (author)

Super-resolved terahertz microscopy by knife-edge scan

Science.gov (United States)

Giliberti, V.; Flammini, M.; Ciano, C.; Pontecorvo, E.; Del Re, E.; Ortolani, M.

2017-08-01

We present a compact, all solid-state THz confocal microscope operating at 0.30 THz that achieves super-resolution by using the knife-edge scan approach. In the final reconstructed image, a lateral resolution of 60 μm ≍ λ/17 is demonstrated when the knife-edge is deep in the near-field of the sample surface. When the knife-edge is lifted up to λ/4 from the sample surface, a certain degree of super-resolution is maintained with a resolution of 0.4 mm, i.e. more than a factor 2 if compared to the diffraction-limited scheme. The present results open an interesting path towards super-resolved imaging with in-depth information that would be peculiar to THz microscopy systems.

"The Battery" designed with Super-Light (concrete) Decks

DEFF Research Database (Denmark)

Castberg, Niels Andreas; Hertz, Kristian Dahl

This paper describes how Super-Light structures can be used as a structural principle for the buildings in the project ‘The Battery’ designed by Bjarke Ingels Group. The overall structural concept is described and the advantages of using super-light slabs for the project are explored. Especially...... the cantilevered internal corridors are investigated. Super-Light Structures is a newly patented structural concrete concept. Slabs based on the concept are the first structural element developed under the patent. The slabs called SL-decks have multiple advantages compared to traditional hollow core slabs....... The paper aims to describe the concept of how the deck can be used in these innovative buildings and how the special advantages of the SL-decks are applied....

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Validation of Shielding Analysis Capability of SuperMC with SINBAD

Directory of Open Access Journals (Sweden)

Chen Chaobin

2017-01-01

Full Text Available Abstract: The shielding analysis capability of SuperMC was validated with the Shielding Integral Benchmark Archive Database (SINBAD. The SINBAD was compiled by RSICC and NEA, it includes numerous benchmark experiments performed with the D-T fusion neutron source facilities of OKTAVIAN, FNS, IPPE, etc. The results from SuperMC simulation were compared with experimental data and MCNP results. Very good agreement with deviation lower than 1% was achieved and it suggests that SuperMC is reliable in shielding calculation.

Report on workshop"Structure and evolution of Eurasia (super- continent"

Directory of Open Access Journals (Sweden)

Masaki Kanao

2004-11-01

Full Text Available A workshop on Structure and evolution of Eurasia (super- continent" was held on 23rd February 2004, at the National Institute of Polar Research with 29 participants. This provided an opportunity to review the history of amalgamation and breakup of past super-continents in the Earth's evolution, and speculate on the possibility of future super-continent formation. The largest continent on the present Earth, Eurasia, has been formed from an assembly of several sub-continental blocks including Asia, India and Europe, etc: it is also considered to be the nucleus of a future super-continent expected to form 250 m.y. after the present. In this workshop, several interesting topics were presented regarding the formation process, structure and dynamics of Eurasia, in particular in the deep crust and upper mantle. The first half of the workshop covered structural geology, shallow and deep seismic structure, and a simulation model of the Himalaya-Tibet region, known as a typical ongoing continent-continent collision zone. Inner crustal deformation of Eurasia was demonstrated by a newly developed Discrete Element method. In the latter half of the workshop, the possibility of formation of a future super-continent in the Western Pacific Triangular Zone was introduced with geological interpretation associated with an origin of the hot super-plumes. Seismic tomographic studies, particularly in China, which have revealed interesting features such as low velocity anomalies beneath the volcanic area, together with the presence of subducting Indian plates beneath the Tibet region were introduced. In the northwest Pacific region, remnant subducted slabs of the Kula plate have been found by local seismic tomography. Finally, a review of continental dynamics from gravity studies, and broadband seismic observations in the Baikal rift zones, were presented associated with the tectonics and evolution of central Eurasia. The formation mechanism of a hot super-plume in the

Super-iron Nanoparticles with Facile Cathodic Charge Transfer

Energy Technology Data Exchange (ETDEWEB)

M Farmand; D Jiang; B Wang; S Ghosh; D Ramaker; S Licht

2011-12-31

Super-irons contain the + 6 valence state of iron. One advantage of this is that it provides a multiple electron opportunity to store additional battery charge. A decrease of particle size from the micrometer to the nanometer domain provides a higher surface area to volume ratio, and opportunity to facilitate charge transfer, and improve the power, voltage and depth of discharge of cathodes made from such salts. However, super-iron salts are fragile, readily reduced to the ferric state, with both heat and contact with water, and little is known of the resultant passivating and non-passivating ferric oxide products. A pathway to decrease the super-iron particle size to the nano-domain is introduced, which overcomes this fragility, and retains the battery capacity advantage of their Fe(VI) valence state. Time and power controlled mechanosynthesis, through less aggressive, dry ball milling, leads to facile charge transfer of super-iron nanoparticles. Ex-situ X-ray Absorption Spectroscopy is used to explore the oxidation state and structure of these iron oxides during discharge and shows the significant change in stability of the ferrate structure to lower oxidation state when the particle size is in the nano-domain.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Adaptive Markov Random Fields for Example-Based Super-resolution of Faces

Directory of Open Access Journals (Sweden)

Stephenson Todd A

2006-01-01

Full Text Available Image enhancement of low-resolution images can be done through methods such as interpolation, super-resolution using multiple video frames, and example-based super-resolution. Example-based super-resolution, in particular, is suited to images that have a strong prior (for those frameworks that work on only a single image, it is more like image restoration than traditional, multiframe super-resolution. For example, hallucination and Markov random field (MRF methods use examples drawn from the same domain as the image being enhanced to determine what the missing high-frequency information is likely to be. We propose to use even stronger prior information by extending MRF-based super-resolution to use adaptive observation and transition functions, that is, to make these functions region-dependent. We show with face images how we can adapt the modeling for each image patch so as to improve the resolution.

Adaptive Markov Random Fields for Example-Based Super-resolution of Faces

Science.gov (United States)

Stephenson, Todd A.; Chen, Tsuhan

2006-12-01

Image enhancement of low-resolution images can be done through methods such as interpolation, super-resolution using multiple video frames, and example-based super-resolution. Example-based super-resolution, in particular, is suited to images that have a strong prior (for those frameworks that work on only a single image, it is more like image restoration than traditional, multiframe super-resolution). For example, hallucination and Markov random field (MRF) methods use examples drawn from the same domain as the image being enhanced to determine what the missing high-frequency information is likely to be. We propose to use even stronger prior information by extending MRF-based super-resolution to use adaptive observation and transition functions, that is, to make these functions region-dependent. We show with face images how we can adapt the modeling for each image patch so as to improve the resolution.

A new six-component super soliton hierarchy and its self-consistent sources and conservation laws

Science.gov (United States)

Han-yu, Wei; Tie-cheng, Xia

2016-01-01

A new six-component super soliton hierarchy is obtained based on matrix Lie super algebras. Super trace identity is used to furnish the super Hamiltonian structures for the resulting nonlinear super integrable hierarchy. After that, the self-consistent sources of the new six-component super soliton hierarchy are presented. Furthermore, we establish the infinitely many conservation laws for the integrable super soliton hierarchy. Project supported by the National Natural Science Foundation of China (Grant Nos. 11547175, 11271008 and 61072147), the First-class Discipline of University in Shanghai, China, and the Science and Technology Department of Henan Province, China (Grant No. 152300410230).

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

Study on the Rule of Super Strata Movement and Subsidence

Science.gov (United States)

Yao, Shunli; Yuan, Hongyong; Jiang, Fuxing; Chen, Tao; Wu, Peng

2018-01-01

The movement of key strata is related to the safety of the whole earth’s surface for coal mining under super strata. Based on the key strata theory, the paper comprehensively analyzes the characteristics of the subsidence before and after the instability of the super strata by studing through FLAC3D and microseismic dynamic monitoring of the surface rock movement observation. The stability of the super strata movement is analyzed according to the characteristic value of the subsidence. The subsidence law and quantitative indexes under the control of the super rock strata that provides basis for the prevention and control of surface risk, optimize mining area and face layout and reasonably set mining boundary around mining area. It provides basis for the even growth of mine safety production and regional public safety.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

Core temperature in super-Gaussian pumped air-clad photonic ...

Indian Academy of Sciences (India)

In this paper we investigate the core temperature of air-clad photonic crystal fiber (PCF) lasers pumped by a super-Gaussian (SG) source of order four. The results are compared with conventional double-clad fiber (DCF) lasers pumped by the same super-Gaussian and by top-hat pump profiles.

On the monodromy group for the super Schwarzian differential equation

International Nuclear Information System (INIS)

Uehara, Shozo; Yasui, Yukinori.

1991-03-01

We calculate the first variation of the monodromy group associated with a super Schwarzian differential equation. The relation between the monodromy period and the Fenchel-Nielsen deformation of a super Riemann surface is presented. (author)

Properties of super stainless steels for orthodontic applications.

Science.gov (United States)

Oh, Keun-Taek; Kim, Young-Sik; Park, Yong-Soo; Kim, Kyoung-Nam

2004-05-15

Orthodontic stainless-steel appliances are considered to be corrosion resistant, but localized corrosion can occur in the oral cavity. This study was undertaken to evaluate the properties of super stainless steels in orthodontic applications. Accordingly, the metallurgical properties, mechanical properties, corrosion resistance, amount of the released nickel, cytotoxicity, and characteristics of the passive film were investigated. Corrosion resistances of the specimens were high and in the following order: super austenitic stainless steel (SR-50A) > super ferritic stainless steel (SFSS) = super duplex stainless steel (SR-6DX) > 316L SS > super martensitic stainless steel (SR-3Mo) in artificial saliva, 37 degrees C. At 500 mV (SCE), current densities of SR-50A, SFSS, SR-6DX, 316L SS, and SR-3Mo were 5.96 microA/cm(2), 20.3 microA/cm(2), 31.9 microA/cm(2), 805 microA/cm(2), and 5.36 mA/cm(2), respectively. Open circuit potentials of SR-50A, 316L SS, SR-6DX, SR-3Mo, and SFSS were - 0.2, - 0.22, - 0.24, - 0.43, and - 0.46 V (SCE), respectively. SR-50A, SFSS, and SR-6DX released below 3 ng/ml nickel for 8 weeks, and increased a little with immersion time, and 316L SS released about 3.5 ng/ml nickel, but SR-3Mo released a large amount of nickel, which increased with immersion time. The study demonstrated that SR-50A, SR-6DX, and SFSS have high corrosion resistance and mild or no cytotoxicity, due to the passive film enhanced by synergistic effect of Mo + N or by high addition effect of Cr + W. All super stainless steels showed very low cytotoxicity regardless of their nickel contents, although SR-3Mo was found to be relatively cytotoxic. From these studies, these steels are considered suitable for orthodontic applications. Copyright 2004 Wiley Periodicals, Inc.

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

Arbitrarily high super-resolving phase measurements at telecommunication wavelengths

International Nuclear Information System (INIS)

Kothe, Christian; Bjoerk, Gunnar; Bourennane, Mohamed

2010-01-01

We present two experiments that achieve phase super-resolution at telecommunication wavelengths. One of the experiments is realized in the space domain and the other is realized in the time domain. Both experiments show high visibility and are performed with standard lasers and single-photon detectors. The first experiment uses six-photon coincidences, whereas the latter experiment needs no coincidence measurements, is easy to perform, and achieves, in principle, arbitrarily high phase super-resolution. Here, we demonstrate a 30-fold increase of the resolution. We stress that neither entanglement nor joint detection is needed in these experiments, which demonstrates that neither is necessary to achieve phase super-resolution.

HD 97658 and its super-Earth

Directory of Open Access Journals (Sweden)

Van Grootel V.

2015-01-01

Full Text Available Super-Earths transiting nearby bright stars are key objects that simultaneously allow for accurate measurements of both their mass and radius, providing essential constraints on their internal composition. We present the confirmation, based on Spitzer observations, that the super-Earth HD 97658 b transits its host star. HD 97658 is a low-mass (M* = 0.77 ± 0.05 M⊙ K1 dwarf, as determined from the Hipparcos parallax and stellar evolution modeling. To constrain the planet parameters, we carry out Bayesian global analyses of Keck-HIRES radial velocities, and MOST and Spitzer photometry. HD 97658 b is a massive (MP = 7.55−0.79+0.83 M⊕ and large (RP = 2.247−0.095+0.098 R⊕ at 4.5 μm super-Earth. We investigate the possible internal compositions for HD 97658 b. Our results indicate a large rocky component, by at least 60% by mass, and very little H-He components, at most 2% by mass. We also discuss how future asteroseismic observations can improve the knowledge of the HD 97658 system, in particular by constraining its age.

Predicting the occurrence of super-storms

Directory of Open Access Journals (Sweden)

N. Srivastava

2005-11-01

Full Text Available A comparative study of five super-storms (Dst<-300 nT of the current solar cycle after the launch of SoHO, to identify solar and interplanetary variables that influence the magnitude of resulting geomagnetic storms, is described. Amongst solar variables, the initial speed of a CME is considered the most reliable predictor of the strength of the associated geomagnetic storm because fast mass ejections are responsible for building up the ram pressure at the Earth's magnetosphere. However, although most of the super-storms studied were associated with high speed CMEs, the Dst index of the resulting geomagnetic storms varied between -300 to -472 nT. The most intense storm of 20 November 2003, (Dst ~ -472 nT had its source in a comparatively smaller active region and was associated with a relatively weaker, M-class flare while all other super-storms had their origins in large active regions and were associated with strong X-class flares. However, this superstorm did not show any associated extraordinary solar and interplanetary characteristics. The study also reveals the challenge in the reliable prediction of the magnitude of a geomagnetic storm from solar and interplanetary variables.

The influence of polycarboxylate-type super-plasticizers on alkali-free liquid concrete accelerators performance

Science.gov (United States)

Guo, Wenkang; Yin, Haibo; Wang, Shuyin; He, Zhifeng

2017-04-01

Through studying on the setting times, cement mortar compressive strength and cement mortar compressive strength ratio, the influence of alkali-free liquid accelerators polycarboxylate-type super-plasticizers on the performance of alkali-free liquid accelerators in cement-based material was investigated. The results showed that the compatibility of super-plasticizers and alkali-free liquid accelerators was excellent. However, the dosage of super-plasticizers had a certain impact on the performance of alkali-free liquid accelerators as follows: 1) the setting times of alkali-free liquid accelerators was in the inverse proportional relationship to the dosage of super-plasticizers; 2)the influence of super-plasticizers dosage on the cement mortar compressive strength of alkali-free liquid accelerators was related to the types of accelerators, where exist an optimum super-plasticizers dosage for cement mortar compressive strength at 28d; 3)the later cement mortar compressive strength with alkali-free liquid accelerators were decreasing with the increment of the super-plasticizers dosage. In the practical application of alkali-free liquid accelerators and super-plasticizer, the dosage of super-plasticizer must be determined by dosage optimization test results.

Shedding light on endocytosis with optimized super-resolution microscopy

NARCIS (Netherlands)

Leyton Puig, D.M.

2017-01-01

Super-resolution microscopy is a relatively new microscopy technique that is still under optimization. In this thesis we focus on the improvement of the quality of super-resolution images, to apply them to the study of the processes of cell signaling and endocytosis. First, we show that the use of a

KML Super Overlay to WMS Translator

Science.gov (United States)

Plesea, Lucian

2007-01-01

This translator is a server-based application that automatically generates KML super overlay configuration files required by Google Earth for map data access via the Open Geospatial Consortium WMS (Web Map Service) standard. The translator uses a set of URL parameters that mirror the WMS parameters as much as possible, and it also can generate a super overlay subdivision of any given area that is only loaded when needed, enabling very large areas of coverage at very high resolutions. It can make almost any dataset available as a WMS service visible and usable in any KML application, without the need to reformat the data.

Evaluation of mini super computers for nuclear design applications

International Nuclear Information System (INIS)

Altomare, S.; Baradari, F.

1987-01-01

The evolution of the mini super computers will force changes from the current environment of performing nuclear design calculations on mainframe computers (such as a CRAY) to mini super computers. This change will come about for a number of reasons. First, the mini super computers currently available in the marketplace offer the power and speed comparable to mainframes and can provide the capability to support highly computer intensive calculations. Second, the equipment is physically smaller and can easily be installed and operated without extensive investments in facilities and operations support. Third, the computer capacity can be acquired with as much needed memory, disk, and tape capacity as may be needed. Another reasons is that the performance/cost ratio has increased drastically as hardware costs have decreased. A study was conducted at the Westinghouse Commercial Nuclear Fuel Division (CNFD) to evaluate the mini super computers for use in nuclear core design. As a result of this evaluation, Westinghouse CNFD is offering a combined hardware/software technology transfer package for core design. This package provides the utility designer with a totally dedicated mini super computer comparable in speed to the CRAY 1S with sufficient capacity for a sizable design group to perform the engineering activities related to nuclear core design and operations support. This also assures the utility of being totally compatible with the CNFD design codes, thus assuring total update compatibility

Universal R-matrix for quantized (super) algebras

International Nuclear Information System (INIS)

Khoroshkin, S.M.; Tolstoj, V.N.

1991-01-01

For quantum deformations of finite-dimensional contragredient Lie (super)algebras an explicit formula for the universal R-matrix is given. This formula generalizes the analogous formulae for quantized semisimple Lie algebras obtained by M. Rosso, A.N. Kirillov and N. Reshetikhin, Yas.S. Soibelman and S.Z. Levendorskii. Approach is based on careful analysis of quantized rank 1 and 2 (super)algebras, a combinatorial structure of the root systems and algebraic properties of q-exponential functions. Quantum Weyl group is not used. 19 refs.; 2 tabs

Spectroscopic Studies of the Super Relaxed State of Skeletal Muscle.

Directory of Open Access Journals (Sweden)

Leonardo Nogara

Full Text Available In the super-relaxed state of myosin, ATPase activity is strongly inhibited by binding of the myosin heads to the core of the thick filament in a structure known as the interacting-heads motif. In the disordered relaxed state myosin heads are not bound to the core of the thick filament and have an ATPase rate that is 10 fold greater. In the interacting-heads motif the two regulatory light chains appear to bind to each other. We have made single cysteine mutants of the regulatory light chain, placed both paramagnetic and fluorescent probes on them, and exchanged them into skinned skeletal muscle fibers. Many of the labeled light chains tended to disrupt the stability of the super-relaxed state, and showed spectral changes in the transition from the disordered relaxed state to the super-relaxed state. These data support the putative interface between the two regulatory light chains identified by cryo electron microscopy and show that both the divalent cation bound to the regulatory light chain and the N-terminus of the regulatory light chain play a role in the stability of the super-relaxed state. One probe showed a shift to shorter wavelengths in the super-relaxed state such that a ratio of intensities at 440nm to that at 520nm provided a measure of the population of the super-relaxed state amenable for high throughput screens for finding potential pharmaceuticals. The results provide a proof of concept that small molecules that bind to this region can destabilize the super-relaxed state and provide a method to search for small molecules that do so leading to a potentially effective treatment for Type 2 diabetes and obesity.

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Computational singular perturbation analysis of super-knock in SI engines

KAUST Repository

Jaasim, Mohammed

2018-04-02

Pre-ignition engine cycles leading to super-knock were simulated with a 48 species skeletal iso-octane mechanism to identify the dominant reaction pathways that are present in super-knock. To mimic pre-ignition, a deflagration front was generated via a hot spot that is placed over the piston at close proximity to the end-wall. Computational singular perturbation (CSP) was used to analyze the chemical dynamics at various in-cylinder locations: a point at the center of the cylinder where the deflagration front consumes the air/fuel mixture and two points located at 3 mm from the end-wall where super-knock and mild knock occur. The CSP analysis of the point at the center of the cylinder reveals weak two-stage ignition-like dynamics with a short second stage. At the other points, a pronounced two-stage ignition is displayed with a long second stage. A distinct contribution of formaldehyde (CHO) at the second stage of ignition that adds to fast explosive modes in the super-knock points is not observed in the point at the center. A comparison between knock and super-knock analysis indicates that a similar set of reactions is responsible for the abnormal behavior but the fast explosive time scales are comparatively slower for knock, indicating lower reactivity, which results in the reduced intensity of knock. The analyzed results decoded important reactions responsible for the occurrence of super-knock.

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

Periodicity and quasi-periodicity for super-integrable hamiltonian systems

International Nuclear Information System (INIS)

Kibler, M.; Winternitz, P.

1990-01-01

Classical trajectories are calculated for two Hamiltonian systems with ring shaped potentials. Both systems are super-integrable, but not maximally super-integrable, having four globally defined single-valued integrals of motion each. All finite trajectories are quasi-periodical; they become truly periodical if a commensurability condition is imposed on an angular momentum component

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

Overcoming Registration Uncertainty in Image Super-Resolution: Maximize or Marginalize?

Directory of Open Access Journals (Sweden)

Andrew Zisserman

2007-01-01

Full Text Available In multiple-image super-resolution, a high-resolution image is estimated from a number of lower-resolution images. This usually involves computing the parameters of a generative imaging model (such as geometric and photometric registration, and blur and obtaining a MAP estimate by minimizing a cost function including an appropriate prior. Two alternative approaches are examined. First, both registrations and the super-resolution image are found simultaneously using a joint MAP optimization. Second, we perform Bayesian integration over the unknown image registration parameters, deriving a cost function whose only variables of interest are the pixel values of the super-resolution image. We also introduce a scheme to learn the parameters of the image prior as part of the super-resolution algorithm. We show examples on a number of real sequences including multiple stills, digital video, and DVDs of movies.

Super-heptazethrene

KAUST Repository

Zeng, Wangdong

2016-05-30

The challenging synthesis of a laterally extended heptazethrene molecule, the super-heptazethrene derivative SHZ-CF3, is reported. This molecule was prepared using a strategy involving a multiple selective intramolecular Friedel–Crafts alkylation followed by oxidative dehydrogenation. Compound SHZ-CF3 exhibits an open-shell singlet diradical ground state with a much larger diradical character compared with the heptazethrene derivatives. An intermediate dibenzo-terrylene SHZ-2H was also obtained during the synthesis. This study provides a new synthetic method to access large-size quinoidal polycyclic hydrocarbons with unique physical properties.

WS_2-Super P nanocomposites anode material with enhanced cycling stability for lithium ion batteries

International Nuclear Information System (INIS)

Huang, Jianfeng; Wang, Xin; Li, Jiayin; Cao, Liyun; Xu, Zhanwei; Wei, Hao

2016-01-01

WS_2-Super P nanocomposites are prepared for lithium battery anodes by a simple two-step process consisting of hydrothermal and sulfide reduction reactions. The addition of Super P (50 nm) as a conductive addictive is beneficial for decreasing the size of nanocomposites and improving their dispersibility, which could accelerate the insertion/extraction reaction between WS_2-Super P nanocomposite electrode and electrolyte. Compared to the pure WS_2, the WS_2-Super P nanocomposites exhibit highly improved electrochemical performance with initial discharge capacity of 421 mAh g"−"1, high initial Coulombic efficiency (81%), low charge transfer impedance (53 Ω) and good retentive capacity of 389 mAh g"−"1 after 200th cycles. The much improved electrochemical performance can be attributed to the incorporation of Super P, which facilitates the interface charge transfer and Li"+ diffusion. - Graphical abstract: The addition of Super P (50 nm) is beneficial for decreasing the size of WS_2-Super P nanocomposites, improving their dispersibility, accelerating the Li"+ transportation and the insertion/extraction reaction. The WS_2-Super P nanocomposites show higher cycling stability and rate performances than pure WS_2. - Highlights: • WS_2-Super P nanocomposites are prepared for LIBs anodes with good performances. • Super P as a conductive addictive is added into the WS_2 nanosheets. • The incorporation of Super P is beneficial for decreasing the size of composites. • Super P were embedded in WS_2 nanosheets for improving their dispersibility.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Fabrication of TiO2/EP super-hydrophobic thin film on filter paper surface.

Science.gov (United States)

Gao, Zhengxin; Zhai, Xianglin; Liu, Feng; Zhang, Ming; Zang, Deli; Wang, Chengyu

2015-09-05

A composite filter paper with super-hydrophobicity was obtained by adhering micro/nano structure of amorphous titanium dioxide on the filter paper surface with modifying low surface energy material. By virtue of the coupling agent, which plays an important part in bonding amorphous titanium dioxide and epoxy resin, the structure of super-hydrophobic thin film on the filter paper surface is extremely stable. The microstructure of super-hydrophobic filter paper was characterized by scanning electron microscopy (SEM), the images showed that the as-prepared filter paper was covered with uniform amorphous titanium dioxide particles, generating a roughness structure on the filter paper surface. The super-hydrophobic performance of the filter paper was characterized by water contact angle measurements. The observations showed that the wettability of filter paper samples transformed from super-hydrophilicity to super-hydrophobicity with the water contact angle of 153 ± 1°. Some experiments were also designed to test the effect of water-oil separation and UV-resistant by the super-hydrophobic filter paper. The prepared super-hydrophobic filter paper worked efficiently and simply in water-oil separation as well as enduringly in anti-UV property after the experiments. This method offers an opportunity to the practical applications of the super-hydrophobic filter paper. Copyright © 2015 Elsevier Ltd. All rights reserved.

The Refining Mechanism of Super Gravity on the Solidification Structure of Al-Cu Alloys

Directory of Open Access Journals (Sweden)

Yuhou Yang

2016-12-01

Full Text Available There is far less study of the refining effect of super gravity fields on solidification structures of metals than of the effects of electrical currents, magnetic and ultrasonic fields. Moreover, the refining mechanisms of super gravity are far from clear. This study applied a super gravity field to Al-Cu alloys to investigate its effect on refining their structures and the mechanism of interaction. The experimental results showed that the solidification structure of Al-Cu alloys can be greatly refined by a super gravity field. The major refining effect was mainly achieved when super gravity was applied at the initial solidification stage; only slight refinement could be obtained towards the end of solidification. No refinement was obtained by the super gravity treatment on pure liquid or solid stages. The effectiveness of super gravity results from its promoting the multiplication of crystal nuclei, which we call “Heavy Crystal Rain”, thereby greatly strengthening the migration of crystal nuclei within the alloy. Increasing the solute Cu content can increase nucleation density and restrict the growth of crystals, which further increases the refining effect of super gravity. Within this paper, we also discuss the motile behavior of crystals in a field of super gravity.

Quantum energy duplication using super high output pulse laser

International Nuclear Information System (INIS)

Sugisaki, Kiwamu; Koyama, Kazuyoshi; Tanimoto, Mitsumori; Saito, Naoaki

2000-01-01

This study aims at elucidation on phenomena induced by strong electric field of super high output ultra short laser pulse to carry out development of basic technology required for promotion of a study on generation of high energy particle and photon using them, in order to contribute to application of super high output ultra short laser pulse and high energy plasma formed by it. In 1998 fiscal year of the last fiscal year in this study, by intending to increase the output by narrowing pulse width of the super high output laser, some basic experiments such as verification due to experiment on relativity theoretical self-convergence, generation of high energy particles, and so forth were carried out to establish a forecasting on future application. And, by conducting plasma generation experiment, self-guide and high energy particle formation experiment in plasma of super high intensity laser pulse important for its applications, and so forth, various technologies constituting foundation of future developments were developed, and more results could be obtained than those at proposal of this study. (G.K.)

The Impact of SuperB on Flavor Physics

International Nuclear Information System (INIS)

Meadows, B.

2012-01-01

This report provides a succinct summary of the physics programme of SuperB, and describes that potential in the context of experiments making measurements in flavour physics over the next 10 to 20 years. Detailed comparisons are made with Belle II and LHCb, the other B physics experiments that will run in this decade. SuperB will play a crucial role in defining the landscape of flavour physics over the next 20 years. SuperB is an approved high luminosity e + e - collider intended to search for indirect and some direct signs of new physics (NP) at low energy, while at the same time, enabling precision tests of the Standard Model (SM). This experiment will be built at a new laboratory on the Tor Vergata campus near Rome, Italy named after Nicola Cabibbo. The project has been described in a Conceptual Design Report, and more recently by a set of three white papers on the accelerator, detector, and physics programme. The main focus of the physics programme rests in the study of so-called Golden Modes, these are decay channels that provide access to measurements of theoretically clean observables that can provide both stringent constraints on models of NP, and precision tests of the SM. A number of ancillary measurements that remain important include those with observables that may not be theoretically clean, and those that can be used to provide stringent constraints on the SM but are not sensitive to NP. The remainder of this section introduces SuperB before discussing the golden modes for SuperB, precision CKM measurement modes, and an outline of the rest of this report.

Super-Hydrophobic Green Corrosion Inhibitor On Carbon Steel

Science.gov (United States)

Hassan, H.; Ismail, A.; Ahmad, S.; Soon, C. F.

2017-06-01

There are many examples of organic coatings used for corrosion protection. In particular, hydrophobic and super-hydrophobic coatings are shown to give good protection because of their enhanced ability to slow down transport of water and ions through the coating. The purpose of this research is to develop water repellent coating to avoid direct contact between metal and environment corrosive and mitigate corrosion attack at pipeline system. This water repellent characteristic on super-hydrophobic coating was coated by electrodeposition method. Wettability of carbon steel with super-hydrophobic coating (cerium chloride and myristic acid) and oxidized surface was investigated through contact angle and inhibitor performance test. The inhibitor performance was studied in 25% tannin acid corrosion test at 30°C and 3.5% sodium chloride (NaCl). The water contact angle test was determined by placing a 4-μL water droplet of distilled water. It shows that the wettability of contact angle super-hydrophobic with an angle of 151.60° at zero minute can be classified as super-hydrophobic characteristic. By added tannin acid as inhibitor the corrosion protection on carbon steel becomes more consistent. This reveals that the ability of the coating to withstand with the corrosion attack in the seawater at different period of immersions. The results elucidate that the weight loss increased as the time of exposure increased. However, the corrosion rates for uncoated carbon steel is high compared to coated carbon steel. As a conclusion, from both samples it can be seen that the coated carbon steel has less corrosion rated compared to uncoated carbon steel and addition of inhibitor to the seawater provides more protection to resist corrosion attack on carbon steel.

Double and super-exchange model in one-dimensional systems

International Nuclear Information System (INIS)

Vallejo, E.; Navarro, O.; Avignon, M.

2010-01-01

We present an analytical and numerical study of the competition between double and super-exchange interactions in a one-dimensional model. For low super-exchange interaction energy we find phase separation between ferromagnetic and anti-ferromagnetic phases. When the super-exchange interaction energy gets larger, the conduction electrons are self-trapped within separate small magnetic polarons. These magnetic polarons contain a single electron inside two or three sites depending on the conduction electron density and form a Wigner crystallization. A new phase separation is found between these small polarons and the anti-ferromagnetic phase. Spin-glass behavior is obtained consistent with experimental results of the nickelate one-dimensional compound Y 2-x Ca x BaNiO 5 .

Chebyshev super spectral viscosity method for water hammer analysis

Directory of Open Access Journals (Sweden)

Hongyu Chen

2013-09-01

Full Text Available In this paper, a new fast and efficient algorithm, Chebyshev super spectral viscosity (SSV method, is introduced to solve the water hammer equations. Compared with standard spectral method, the method's advantage essentially consists in adding a super spectral viscosity to the equations for the high wave numbers of the numerical solution. It can stabilize the numerical oscillation (Gibbs phenomenon and improve the computational efficiency while discontinuities appear in the solution. Results obtained from the Chebyshev super spectral viscosity method exhibit greater consistency with conventional water hammer calculations. It shows that this new numerical method offers an alternative way to investigate the behavior of the water hammer in propellant pipelines.

Super-GCA connection with tensionless strings: Addendum to “Super-GCA from N=(2,2 super-Virasoro” [Phys. Lett. B 754 (2016 195–200

Directory of Open Access Journals (Sweden)

Ipsita Mandal

2016-09-01

Full Text Available In this addendum, we consider the connection between certain 2d super-GCA, obtained from the parametric contractions of 2d SCFTs, which can describe the constraint algebra of null spinning strings.

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

Fabrication of super-hydrophobic duo-structures

Science.gov (United States)

Zhang, X. Y.; Zhang, F.; Jiang, Y. J.; Wang, Y. Y.; Shi, Z. W.; Peng, C. S.

2015-04-01

Recently, super-hydrophobicity has attracted increasing attention due to its huge potential in the practical applications. In this paper, we have presented a duo-structure of the combination of micro-dot-matrix and nano-candle-soot. Polydimethylsiloxane (PDMS) was used as a combination layer between the dot-matrix and the soot particles. Firstly, a period of 9-μm dot-matrix was easily fabricated on the K9 glass using the most simple and mature photolithography process. Secondly, the dot-matrix surface was coated by a thin film of PDMS (elastomer: hardener=10:1) which was diluted by methylbenzene at the volume ratio of 1:8. Thirdly, we held the PDMS modified surface over a candle flame to deposit a soot layer and followed by a gentle water-risen to remove the non-adhered particles. At last, the samples were baked at 85°C for 2 hours and then the duo-structure surface with both micro-size dot-matrix and nano-size soot particles was obtained. The SEM indicated this novel surface morphology was quite like a lotus leaf of the well-know micro-nano-binary structures. As a result, the contact angle meter demonstrated such surface exhibited a perfect super-hydrophobicity with water contact angle of 153° and sliding angle of 3°. Besides, just listed as above, the fabrication process for our structure was quite more easy, smart and low-cost compared with the other production technique for super-hydrophobic surfaces such as the phase separation method, electrochemical deposition and chemical vapor deposition etc. Hence, this super-hydrophobic duo-structure reported in this letter was a great promising candidate for a wide and rapid commercialization in the future.

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

Hot super-Earths stripped by their host stars

OpenAIRE

Lundkvist, M. S.; Kjeldsen, H.; Albrecht, S.; Davies, G. R.; Basu, S.; Huber, D.; Justesen, A. B.; Karoff, C.; Aguirre, V. Silva; Van Eylen, V.; Vang, C.; Arentoft, T.; Barclay, T.; Bedding, T. R.; Campante, T. L.

2016-01-01

Simulations predict that hot super-Earth sized exoplanets can have their envelopes stripped by photoevaporation, which would present itself as a lack of these exoplanets. However, this absence in the exoplanet population has escaped a firm detection. Here we demonstrate, using asteroseismology on a sample of exoplanets and exoplanet candidates observed during the Kepler mission that, while there is an abundance of super-Earth sized exoplanets with low incident fluxes, none are found with high...

The structure of the super-W sub infinity (. lambda. ) algebra

Energy Technology Data Exchange (ETDEWEB)

Bergshoeff, E [CERN, Geneva (Switzerland). Theory Div.; Wit, B de [Utrecht Univ. (Netherlands). Inst. for Theoretical Physics; Vasiliev, M [AN SSSR, Moscow (USSR). Theoretical Dept., P.N. Lebedev Inst.

1991-12-02

We give a comprehensive treatment of the super-W{sub {infinity}}({lambda}) algebra, an extension of the super-Virasoro algebra that contains generators of spin S {>=} 1/2. The parameter {lambda} defines the embedding of the Virasoro subalgebra. We describe how to obtain the super-W{sub {infinity}}({lambda}) algebra from the associative algebra of superspace differential operators. We discuss the structure of this associative algebra and its relation with the so-called wedge algebra, in which the generators for given spin are restricted to finite-dimensional representations of sl(2). From the super-W{sub {infinity}}({lambda}) algebra one can obtain a variety of W{sub {infinity}} algebras by consistent truncations for specific values of {lambda}. Without truncation the algebras are formally isomorphic for different values of {lambda}. We present a realization in terms of the currents of a supersymmetric bc system. (orig.).

q-deformations of noncompact Lie (super-) algebras: The examples of q-deformed Lorentz, Weyl, Poincare' and (super-) conformal algebras

International Nuclear Information System (INIS)

Dobrev, V.K.

1992-01-01

We review and explain a canonical procedure for the q-deformation of the real forms G of complex Lie (super-) algebras associated with (generalized) Cartan matrices. Our procedure gives different q-deformations for the non-conjugate Cartan subalgebras of G. We give several in detail the q-deformed Lorentz and conformal (super-) algebras. The q-deformed conformal algebra contains as a subalgebra a q-deformed Poincare algebra and as Hopf subalgebras two conjugate 11-generator q-deformed Weyl algebras. The q-deformed Lorentz algebra in Hopf subalgebra of both Weyl algebras. (author). 24 refs

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Non-standard quantum groups and superization

Energy Technology Data Exchange (ETDEWEB)

Majid, S. [Cambridge Univ. (United Kingdom). Dept. of Applied Mathematics and Theoretical Physics (DAMTP); Rodriguez-Plaza, M.J. [Nationaal Inst. voor Kernfysica en Hoge-Energiefysica (NIKHEF), Amsterdam (Netherlands). Sectie H

1995-12-31

We obtain the universal R-matrix of the non-standard quantum group associated to the Alexander-Conway knot polynomial. We show further that this nonstandard quantum group is related to the super-quantum group U{sub q}gl(1 vertical stroke 1) by a general process of superization, which we describe. We also study a twisted variant of this non-standard quantum group and obtain, as a result, a twisted version uf U{sub q}gl(1 vertical stroke 1) as a q-supersymmetry of the exterior differential calculus of any quantum plane of Hecke type, acting by mixing the bosonic x{sub i} co-ordinates and the forms dx{sub i}. (orig.).

Complete super-sample lensing covariance in the response approach

Science.gov (United States)

Barreira, Alexandre; Krause, Elisabeth; Schmidt, Fabian

2018-06-01

We derive the complete super-sample covariance (SSC) of the matter and weak lensing convergence power spectra using the power spectrum response formalism to accurately describe the coupling of super- to sub-survey modes. The SSC term is completely characterized by the survey window function, the nonlinear matter power spectrum and the full first-order nonlinear power spectrum response function, which describes the response to super-survey density and tidal field perturbations. Generalized separate universe simulations can efficiently measure these responses in the nonlinear regime of structure formation, which is necessary for lensing applications. We derive the lensing SSC formulae for two cases: one under the Limber and flat-sky approximations, and a more general one that goes beyond the Limber approximation in the super-survey mode and is valid for curved sky applications. Quantitatively, we find that for sky fractions fsky ≈ 0.3 and a single source redshift at zS=1, the use of the flat-sky and Limber approximation underestimates the total SSC contribution by ≈ 10%. The contribution from super-survey tidal fields to the lensing SSC, which has not been included in cosmological analyses so far, is shown to represent about 5% of the total lensing covariance on multipoles l1,l2 gtrsim 300. The SSC is the dominant off-diagonal contribution to the total lensing covariance, making it appropriate to include these tidal terms and beyond flat-sky/Limber corrections in cosmic shear analyses.

Super-ranging. A new ranging strategy in European badgers.

Directory of Open Access Journals (Sweden)

Aoibheann Gaughran

Full Text Available We monitored the ranging of a wild European badger (Meles meles population over 7 years using GPS tracking collars. Badger range sizes varied seasonally and reached their maximum in June, July and August. We analysed the summer ranging behaviour, using 83 home range estimates from 48 individuals over 6974 collar-nights. We found that while most adult badgers (males and females remained within their own traditional social group boundaries, several male badgers (on average 22% regularly ranged beyond these traditional boundaries. These adult males frequently ranged throughout two (or more social group's traditional territories and had extremely large home ranges. We therefore refer to them as super-rangers. While ranging across traditional boundaries has been recorded over short periods of time for extraterritorial mating and foraging forays, or for pre-dispersal exploration, the animals in this study maintained their super-ranges from 2 to 36 months. This study represents the first time such long-term extra-territorial ranging has been described for European badgers. Holding a super-range may confer an advantage in access to breeding females, but could also affect local interaction networks. In Ireland & the UK, badgers act as a wildlife reservoir for bovine tuberculosis (TB. Super-ranging may facilitate the spread of disease by increasing both direct interactions between conspecifics, particularly across social groups, and indirect interactions with cattle in their shared environment. Understanding super-ranging behaviour may both improve our understanding of tuberculosis epidemiology and inform future control strategies.

Research and development of a super fast reactor (12). Considerations for the reactor characteristics

International Nuclear Information System (INIS)

Goto, Shoji; Ishiwatari, Yuki; Oka, Yoshiaki

2008-01-01

A research program aimed at developing the Super Fast Reactor (Super FR) has been entrusted by the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan since December 2005. It includes the following three projects. (A) Development of the Super Fast Reactor concept. (B)Thermal-hydraulic experiments. (C) Materials development. Tokyo Electric Power Company (TEPCO) has joined this program and works on part (A) together with the University of Tokyo. From the utility's viewpoint, it is important to consider the most desirable characteristics for Super FR to have. Four issues were identified in project (A), (1) Fuel design, (2) Reactor core design, (3) Safety, and (4) Plant characteristics of Super FR. This report describes the desired characteristics of Super FR with respect to item (1) fuel design and item (2) Reactor core design, as compared with a boiling water reactor (BWR) plant. The other two issues will be discussed in this project, and will also be considered in the design process of Super FR. (author)

Status and prospect of super-heavy nuclei research at IMP

International Nuclear Information System (INIS)

Xu Hushan; Sun Zhiyu; Zhan Wenlong; Zhou Xiaohong; Huang Wenxue; Zhang Hongbin; Gan Zaiguo; Li Junqing; Ma Xinwen; Qin Zhi; Xiao Guoqing; Guo Zhongyan; Li Zhihui; Zhang Yuhu; Jin Genming; Huang Tianheng; Hu Zhengguo; Zhang Xueheng; Zheng Chuan; Chinese Academy of Sciences, Beijing

2006-01-01

The history and the international status of the super-heavy nuclei synthesis are briefly described. The related research work carried out at the Institute of Modern Physics (IMP) has been reviewed. The prospect of the super-heavy nuclei research at IMP has been introduced. (authors)

Status report of BL08 superHRPD

International Nuclear Information System (INIS)

Torii, Shuki

2010-01-01

At the end of May in 2008, the first neutron was produced successfully from a spallation neutron source in Japan Proton Accelerator Research Complex (J-PARC). High resolution Bragg reflections were obtained using the Sirius diffractometer chamber at Super High Resolution Powder Diffractometer (SuperHARD) beam line at Materials and Life Science Experimental Facility (MLF). We started up quickly by using the existing Sirius chamber, and had succeeded in achieving resolution as Δd/d=0.035 %, the best among all the entire neutron powder diffractometers in the world. About 300 detectors had been installed in the backward detector bank, and several standard samples had been measured. Simultaneously, we were carrying out basic study to design and construct a new SuperHRPD chamber, and the Sirius chamber had been exchanged for new one in summer of 2009. In the design of a new chamber, a detector solid angle is increased, d-range/Q-range is expanded, and also has options of high-intensity mode and high-resolution mode with incident collimations. (author)

Calibration of Super-Kamiokande using an electron LINAC The Super-Kamiokande Collaboration

CERN Document Server

Nakahata, M; Hayakawa, T

1999-01-01

In order to calibrate the Super-Kamiokande experiment for solar neutrino measurements, a linear accelerator (LINAC) for electrons was installed at the detector. LINAC data were taken at various positions in the detector volume, tracking the detector response in the variables relevant to solar neutrino analysis. In particular, the absolute energy scale is now known with less than 1% uncertainty.

Application Of The Bertlmann-Martin Inequalities To Super Symmetric Partners

International Nuclear Information System (INIS)

IGHEZOU, F.Z.; KERRIS, A.T.; MESSAMAH, J.; LOMBARD, R.J.

2011-01-01

The purpose of the present study is to discuss some general aspects of the Bertlmann and Martin inequalities (BMI) in the case of the super symmetric partners. The (BMI) have been established by minoring the multipole sum rules according to a method initiated by Bertlmann and Martin. Application to different potentials and generalizations were derived and tested in various papers. We present new concepts of super symmetry in quantum mechanics (SUSYQM) and apply them to two exactly solvable potentials in the one dimensional space. We apply the (BMI) to their super symmetric partners and we examine the degree of saturation of the (BMI)

Super Refractory Status Epilepticus

African Journals Online (AJOL)

user

et al did retrospective cohort study from 1 January st. 1994 to 31 March 1998 at Presbyterian Medical. Centre in Columbia, to determine the frequency, risk factors and impact on the outcome of RSE. They found out that 69% of seizures recurred after. Key Words: Super refractory status epilepticus, Zambia. Medical Journal of ...

Predicting the occurrence of super-storms

Directory of Open Access Journals (Sweden)

N. Srivastava

2005-11-01

Full Text Available A comparative study of five super-storms (D_st<-300 nT of the current solar cycle after the launch of SoHO, to identify solar and interplanetary variables that influence the magnitude of resulting geomagnetic storms, is described. Amongst solar variables, the initial speed of a CME is considered the most reliable predictor of the strength of the associated geomagnetic storm because fast mass ejections are responsible for building up the ram pressure at the Earth's magnetosphere. However, although most of the super-storms studied were associated with high speed CMEs, the D_st index of the resulting geomagnetic storms varied between -300 to -472 nT. The most intense storm of 20 November 2003, (D_st ~ -472 nT had its source in a comparatively smaller active region and was associated with a relatively weaker, M-class flare while all other super-storms had their origins in large active regions and were associated with strong X-class flares. However, this superstorm did not show any associated extraordinary solar and interplanetary characteristics. The study also reveals the challenge in the reliable prediction of the magnitude of a geomagnetic storm from solar and interplanetary variables.

A study of degradation resistance and cytocompatibility of super-hydrophobic coating on magnesium.

Science.gov (United States)

Zhang, Yufen; Feyerabend, Frank; Tang, Shawei; Hu, Jin; Lu, Xiaopeng; Blawert, Carsten; Lin, Tiegui

2017-09-01

Calcium stearate based super-hydrophobic coating was deposited on plasma electrolytic oxidation (PEO) pre-treated magnesium substrate. The pre-treated magnesium and super-hydrophobic coating covered sample were characterized by scanning electron microscopy, X-ray diffraction and electrochemical corrosion measurements. The cytocompatibility and degradation resistance of magnesium, pre-treated magnesium and super-hydrophobic coating were analysed in terms of cell adhesion and osteoblast differentiation. The results indicate that the calcium stearate top coating shows super-hydrophobicity and that the surface is composed of micro/nanostructure. The super-hydrophobic coating covered sample shows higher barrier properties compared with the PEO pre-treated magnesium and bare magnesium. Human osteoblast proliferation, but not differentiation is enhanced by the PEO coating. Contrary, the super-hydrophobic coating reduces proliferation, but enhances differentiation of osteoblast, observable by the formation of hydroxyapatite. The combination of corrosion protection and cell reaction indicates that this system could be interesting for biomedical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Super-structure and building performance

CSIR Research Space (South Africa)

Van Wyk, Llewellyn V

2010-11-01

Full Text Available The super-structure consists predominantly of the load- and no-load-bearing walls-including all doors and windows and suspended floor slabs. The building envelope plays a significant role in the performance of a building, especially with regard...

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

Detectability of planetary rings around super-earths by direct infrared imaging

International Nuclear Information System (INIS)

Morel, Carine

2013-01-01

Super-Earths, of which more than 80 have already been discovered, draw a lot of attention. With masses between those of the Earth and Neptune, they are ideal targets for searching for bio-signatures. All the gas giants of the solar system have a ring system, and even the Earth is suspected to have had rings in the past; their presence around super-Earths is thus expected and could give information on the formation process of these planets. The characterization of Super-Earths and their environment has thus become an important goal of modern astronomy. They are still difficult to study because of their small size, but the potential presence of planetary rings can make them easier to observe by the transit method and by direct imaging. This PhD evaluates the possibilities of detecting and characterizing rings around super-Earths by direct infrared imaging with the ELT-METIS instrument. To do this, a model to simulate the thermal emission of a super-Earth and its rings is developed. It is then used to study the influence of physical parameters and orientation of the rings and of planetary orbit on their detectability. The results show that ELT-METIS will be able to detect rings similar to the B and C rings of Saturn, extended within the Roche limit. The super-Earths surrounded by rings will be observable in middle orbit, between about 0.4 and 1 AU, around hot stars within 20 pc of the Sun. It is also shown that the photometric monitoring along the orbit of a super-Earth surrounded by rings should help constrain some of their physical characteristics. (author) [fr

Covariant currents in N=2 super-Liouville theory

International Nuclear Information System (INIS)

Gomis, J.; Suzuki, Hiroshi

1993-01-01

Based on a path-integral prescription for anomaly calculation, we analyze an effective theory of the two-dimensional N=2 supergravity, i.e. N=2 super-Liouville theory. We calculate the anomalies associated with the BRST supercurrent and the ghost-number supercurrent. From those expressions of anomalies, we construct covariant BRST and ghost-number supercurrents in the effective theory. We then show that the (super-)coordinate BRST current algebra forms a superfield extension of the topological conformal algebra for an arbitrary type of conformal matter or, in terms of the string theory, for an arbitrary number of space-time dimensions. This fact is in great contrast with N=0 and N=1 (super-)Liouville theory, where the topological algebra singles out a particular value of dimensions. Our observation suggests a topological nature of the two-dimensional N=2 supergravity as a quantum theory. (orig.)

A super-version of quasi-free second quantization. 1. Charged particles

International Nuclear Information System (INIS)

Grosse, H.; Langmann, E.

1990-01-01

We present a formalism comprising and extending quasi-free second quantization of charged bosons and fermions. The second quantization of one-particle observables leads to current superalgebras and a super Schwinger term shows up. We introduce anticommuting parameters in order to construct super Bogoliubov transformations mixing bosons and fermion. As an application, we give representations of Lie superalgebras which are semidirect products of extensions of affine Kac-Moody algebras and the Virasoro algebra, and of the super Virasoro algebra. (Authors) 36 refs

Preparation and characterization of super absorbent polymer from sugarcane bagasse

International Nuclear Information System (INIS)

Wiwien Andriyanti; Suyanti; Ngasifudin

2012-01-01

Sugarcane bagasse is a source of biomass which large enough numbers and has not been fully exploited. At this time has developed a super absorbent polymer material of sugarcane bagasse that can absorb water up to several times of its own weight and keep this water. Super absorbent polymers can be used as a soil conditioner that can be used as an absorber and storage of ground water, the giver of nutrients for plants, and can improve soil properties. The purpose of this study is to make and characterization of super absorbent polymer (PCS) from sugarcane bagasse. Preparation of super absorbent polymers (PCS) has been done by grafting method using ionizing radiation from Electron Beam Engineering (MBE) 350 mA keV/10. Irradiation process carried out with a dose variation of 20, 35, and 50 kGy. Increasing doses of radiation will increase the percentage fraction of transplantation (grafting) and the fraction of water absorption ability (swelling ratio). (author)

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

Optimal Super Dielectric Material

Science.gov (United States)

2015-09-01

plate capacitor will reduce the net field to an unprecedented extent. This family of materials can form materials with dielectric values orders of... Capacitor -Increase Area (A)............8 b. Multi-layer Ceramic Capacitor -Decrease Thickness (d) .......10 c. Super Dielectric Material-Increase...circuit modeling, from [44], and B) SDM capacitor charge and discharge ...................................................22 Figure 15. Dielectric

Microsphere-aided optical microscopy and its applications for super-resolution imaging

Science.gov (United States)

Upputuri, Paul Kumar; Pramanik, Manojit

2017-12-01

The spatial resolution of a standard optical microscope (SOM) is limited by diffraction. In visible spectrum, SOM can provide ∼ 200 nm resolution. To break the diffraction limit several approaches were developed including scanning near field microscopy, metamaterial super-lenses, nanoscale solid immersion lenses, super-oscillatory lenses, confocal fluorescence microscopy, techniques that exploit non-linear response of fluorophores like stimulated emission depletion microscopy, stochastic optical reconstruction microscopy, etc. Recently, photonic nanojet generated by a dielectric microsphere was used to break the diffraction limit. The microsphere-approach is simple, cost-effective and can be implemented under a standard microscope, hence it has gained enormous attention for super-resolution imaging. In this article, we briefly review the microsphere approach and its applications for super-resolution imaging in various optical imaging modalities.

Super-Efficiency and Sensitivity Analysis Based on Input-Oriented DEA-R

Directory of Open Access Journals (Sweden)

M. R. Mozaffari∗

2012-03-01

Full Text Available This paper suggests a method of finding super-efficiency scores and modification of input-oriented models for sensitivity analysis of decision making units. First, by using DEA-R (ratiobased DEA models in the input orientation, the models of superefficiency and also models of super-efficiency modification are suggested. Second, the worst-case scenarios are considered where the efficiency of the test DMU is deteriorating while the efficiencies of the other DMUs are improving. Then, by combining these two ideas, a model is suggested which increases the super-efficiency score and modifies the change ranges in order to preserve the performance class. In the end, the super-efficiency and change interval of efficient decision making units for 23 branches of Zone 1 of the Islamic Azad University are calculated

Ryoji Ikeda (unistus) supersümmeetriast = Ryoji Ikeda's (dream of) supersymmetry / Andi Hektor

Index Scriptorium Estoniae

Hektor, Andi, 1975-

2016-01-01

Jaapani päritolu kunstnikust Ryoji Ikedast ja tema audiovisuaalsest installatsioonist "supersümmeetria". Ka CERN-i kunstiresidentuurist Arts@CERN, kus Ikeda aastatel 2014-2015 "supersümmeetria" lõplikult välja töötas. Installatsioon "supersümmeetria" oli 11.12.2015 - 28.02.2016 eksponeeritud Kumus

Super-Kamiokande worth full restoration

CERN Multimedia

Mishima, I

2002-01-01

While prospects are good that the SuperKamiokande facility will be partially repaired after an accident last November, the government has yet to confirm whether it will spend the estimated 2.5 billion yen needed for a full-scale restoration (1 page).

Direct observation, study and control of molecular super rotors

Science.gov (United States)

Korobenko, Aleksey; Milner, Alexander; Hepburn, John; Milner, Valery

2014-05-01

Extremely fast rotating molecules whose rotational energy is comparable with or exceeds the molecular bond strength are known as ``super rotors''. It has been speculated that super rotors may exhibit a number of unique properties, yet only indirect evidence of these molecular objects has been reported to date. We demonstrate the first direct observation of molecular super rotors by detecting coherent unidirectional molecular rotation with extreme frequencies exceeding 10 THz. The technique of an ``optical centrifuge'' is used to control the degree of rotational excitation in an ultra-broad range of rotational quantum numbers, reaching as high as N = 95 in oxygen and N = 60 in nitrogen. State-resolved detection enables us to determine the shape of the excited rotational wave packet and quantify the effect of centrifugal distortion on the rotational spectrum. Femtosecond time resolution reveals coherent rotational dynamics with increasing coherence times at higher angular momentum. We demonstrate that molecular super rotors can be created and observed in dense samples under normal conditions where the effects of ultrafast rotation on many-body interactions, inter-molecular collisions and chemical reactions can be readily explored.

Solar neutrinos at super-Kamiokande

International Nuclear Information System (INIS)

Inoue, K.

1999-01-01

A huge ring imaging water Cherenkov detector, super-Kamiokande, has started data accumulation on April 1st, 1996 as promised. This experiment is expected to give a definite answer to the neutrino oscillation solutions of the long standing solar neutrino problem through high statistics and high precision spectrum and day/night flux measurement. Super-Kamiokande is accumulating 8 B solar neutrino data very quickly and preliminary results obtained from 374 days of data are presented here, instead of 306 days of data presented at the conference. No significant day/night variation nor seasonal variation are found. Systematic errors of energy scale are largely reduced by the LINAC calibrations at various positions. And the experiment is getting closer to the level of the systematic errors where we can definitely discuss about the spectrum distortion. Also implications of those preliminary results are discussed within two neutrino oscillation hypothesis

The Super-TIGER Instrument to Probe Galactic Cosmic Ray Origins

Science.gov (United States)

Mitchell, John W.; Binns, W. R.; Bose, R, G.; Braun, D. L.; Christian, E. R.; Daniels, W. M; DeNolfo, G. A.; Dowkontt, P. F.; Hahne, D. J.; Hams, T.;

A process for selection and training of super-users for ERP implementation projects

DEFF Research Database (Denmark)

Danielsen, Peter; Sandfeld Hansen, Kenneth; Helt, Mads

2017-01-01

The concept of super-users as a means to facilitate ERP implementation projects has recently taken a foothold in practice, but is still largely overlooked in research. In particular, little is known about the selection and training processes required to successfully develop skilled super-users in......The concept of super-users as a means to facilitate ERP implementation projects has recently taken a foothold in practice, but is still largely overlooked in research. In particular, little is known about the selection and training processes required to successfully develop skilled super...

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Albedos of Kepler's Close-in super-Earths

OpenAIRE

Demory, Brice-Olivier

2014-01-01

Exoplanet research focusing on the characterization of super-Earths is currently limited to those handful targets orbiting bright stars that are amenable to detailed study. This Letter proposes to look at alternative avenues to probe the surface and atmospheric properties of this category of planets, known to be ubiquitous in our galaxy. I conduct Markov Chain Monte Carlo lightcurve analyses for 97 Kepler close-in $R_P \\lesssim 2.0 R_{\\oplus}$ super-Earth candidates with the aim to detect the...

Minimal Super Technicolor

DEFF Research Database (Denmark)

Antola, M.; Di Chiara, S.; Sannino, F.

2011-01-01

We introduce novel extensions of the Standard Model featuring a supersymmetric technicolor sector (supertechnicolor). As the first minimal conformal supertechnicolor model we consider N=4 Super Yang-Mills which breaks to N=1 via the electroweak interactions. This is a well defined, economical......, between unparticle physics and Minimal Walking Technicolor. We consider also other N =1 extensions of the Minimal Walking Technicolor model. The new models allow all the standard model matter fields to acquire a mass....

Study on super-long deep-hole drilling of titanium alloy.

Science.gov (United States)

Liu, Zhanfeng; Liu, Yanshu; Han, Xiaolan; Zheng, Wencui

2018-01-01

In this study, the super-long deep-hole drilling of a titanium alloy was investigated. According to material properties of the titanium alloy, an experimental approach was designed to study three issues discovered during the drilling process: the hole-axis deflection, chip morphology, and tool wear. Based on the results of drilling experiments, crucial parameters for the super-long deep-hole drilling of titanium alloys were obtained, and the influences of these parameters on quality of the alloy's machining were also evaluated. Our results suggest that the developed drilling process is an effective method to overcome the challenge of super-long deep-hole drilling on difficult-to-cut materials.

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

The solar neutrino day/night effect in Super-Kamiokande

International Nuclear Information System (INIS)

Smy, Michael B.

2005-01-01

The time variation of the elastic scattering rate of solar neutrinos with electrons in Super-Kamiokande-I was fit to the day/night variations expected from active two-neutrino oscillations in the Large Mixing Angle region. Combining Super-Kamiokande measurements with other solar and reactor neutrino data, the mixing angle is determined as sin 2 θ=0.276 -0.026 +0.033 and the mass squared difference between the two neutrino mass eigenstates as Δm 2 =7.1 -0.5 +0.6 x10 -5 eV 2 . For the best fit parameters, a day/night asymmetry of -1.7+/-1.6(stat) -1.2 +1.3 (syst)% determined from the Super-Kamiokande data, which has improved statistical precision over previous measurements and is in excellent agreement with the expected value of -1.6%

Super-virtual refraction interferometry: an engineering field data example

KAUST Repository

Hanafy, Sherif M.

2012-10-01

The theory of super-virtual refraction interferometry (SVI) was recently developed to enhance the signal-to-noise ratio (SNR) of far-offset traces in refraction surveys. This enhancement of the SNR is proportional to √N and can be as high as N if an iterative procedure is used. Here N is the number of post-critical shot positions that coincides with the receiver locations. We now demonstrate the SNR enhancement of super-virtual refraction traces for one engineering-scale synthetic data and two field seismic data sets. The field data are collected over a normal fault in Saudi Arabia. Results show that both the SNR of the super-virtual data set and the number of reliable first-arrival traveltime picks are significantly increased. © 2012 European Association of Geoscientists & Engineers.

Super-virtual refraction interferometry: an engineering field data example

KAUST Repository

Hanafy, Sherif M.; Alhagan, Ola

2012-01-01

The theory of super-virtual refraction interferometry (SVI) was recently developed to enhance the signal-to-noise ratio (SNR) of far-offset traces in refraction surveys. This enhancement of the SNR is proportional to √N and can be as high as N if an iterative procedure is used. Here N is the number of post-critical shot positions that coincides with the receiver locations. We now demonstrate the SNR enhancement of super-virtual refraction traces for one engineering-scale synthetic data and two field seismic data sets. The field data are collected over a normal fault in Saudi Arabia. Results show that both the SNR of the super-virtual data set and the number of reliable first-arrival traveltime picks are significantly increased. © 2012 European Association of Geoscientists & Engineers.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

Mean proloculus size, delta super(13) C and delta super(18) O variations in recent benthic foraminifera from the west coast of India and their climatic implications

Digital Repository Service at National Institute of Oceanography (India)

Nigam, R.; Sarkar, A.

The interrelationship between mean proloculus size (MPS), delta super(18) O and delta super(13) C vatiations in benthic foraminiferal species Rotalidium annectens and their relation with temperature (T) and salinity (S) have been studied in samples...

Superconducting Super Collider project

International Nuclear Information System (INIS)

Perl, M.L.

1986-04-01

The scientific need for the Superconducting Super Collider (SSC) is outlined, along with the history of the development of the SSC concept. A brief technical description is given of each of the main points of the SSC conceptual design. The construction cost and construction schedule are discussed, followed by issues associated with the realization of the SSC. 8 refs., 3 figs., 3 tabs

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

Science.gov (United States)

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

Volatile Transport in Pluto's Super Seasons

Science.gov (United States)

Earle, Alissa M.; Binzel, Richard; Young, Leslie; Stern, S. Alan; Olkin, Catherine B.; Ennico, Kimberly; Moore, Jeffrey M.; Weaver, Harold A.; NASA New Horizons Composition Team, The NASA New Horizons GGI Team

2016-10-01

The data returned from NASA's New Horizons' reconnaissance of the Pluto system shows striking albedo variations from polar to equatorial latitudes as well as sharp boundaries for longitudinal variations. Pluto has a high obliquity (currently around 119 degrees) which varies by more than 23 degrees (between roughly 103 and 127 degrees) over a period of less than 3 million years. These obliquity properties, combined with Pluto's orbital regression in longitude of perihelion (360 degrees over 3.7 million years), create epochs of "Super Seasons" on Pluto. A "Super Season" occurs, for example, when Pluto happens to be pole-on towards the Sun at the same time as perihelion. In such a case, one pole experiences a short, intense summer (relative to its long-term average) followed by a longer than average period of winter darkness. By complement, the other pole experiences a much longer, but less intense summer and short winter season. We explore the relationship between albedo variations and volatile transport for the current epoch as well as historical epochs during which Pluto experienced these "Super Seasons". Our investigation suggests Pluto's orbit creates the potential for runaway albedo variations, particularly in the equatorial region, which would create and support stark longitudinal contrasts like the ones we see between the informally named Tombaugh and Cthulhu Regios.This work was supported by the NASA New Horizons mission.

Maritime super Wi-Fi coverage based on TVWS

Science.gov (United States)

Ren, Jia; Chen, Baodan; Zhang, Yonghui; Huang, Fang

2014-10-01

After analyzing the occupancy and characteristics of television white space (TVWS), this paper proposes wireless broadband networking by using super Wi-Fi technology in maritime environment operating on TVWS. A sea surface channel model is developed for predicting maritime network coverage of super Wi-Fi technology. This channel model is based on Irregular Terrain Methodology (ITM) model with revised parameters and dual-path propagation effect. The simulations demonstrated that the sea surface channel model can accurately reflect the transmission loss of radio wave in TVWS.

Optical data transmission at the superconducting super collider

International Nuclear Information System (INIS)

Leskovar, B.

1989-02-01

Digital and analog data transmissions via fiber optics for the Superconducting Super Collider have been investigated. The state of the art of optical transmitters, low loss fiber waveguides, receivers and associated electronics components are reviewed and summarized. Emphasis is placed on the effects of the radiation environment on the performance of an optical data transmission system components. Also, the performance of candidate components of the wide band digital and analog transmission systems intended for deployment of the Superconducting Super Collider Detector is discussed. 27 refs., 15 figs

Wideroe pre-accelerator for the SuperHILAC

International Nuclear Information System (INIS)

Staples, J.; Alonso, J.; Behrsing, G.; Clark, D.; Grunder, H.; Olivier, M.; Spence, D.; Yourd, R.

1976-09-01

In 1971 the Bevatron successfully accelerated low-intensity heavy ion beams up to neon to energies of 2.1 GeV/amu. More recently, beams up to argon have been accelerated using the SuperHILAC as an injector to the Bevatron--the Bevalac concept. With increasing scientific interest in high-energy high-intensity beams of heavier ions, plans to upgrade both the Bevatron vacuum system and the SuperHILAC ion sources and injectors have been formulated. A proposed new pre-accelerator based on an air-insulated Cockcroft-Walton and a Wideroe linac is presented. The Wideroe linac uses the design concepts established at UNILAC, modified for frequency and energy requirements. U 7 + from the ion source is accelerated from 12 keV/amu to 113 keV/amu and stripped to a mean charge state acceptable to the first tank of the SuperHILAC. The expected intensity improvement over the present pressurized injector is a factor of 100 at the highest masses. The physical modeling of the Wideroe linac structure will be kept to a minimum. Computer models predicting the characteristics of the structure have improved to the point where the probability of satisfactory performance is high

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

"SuperNoova" jõudis Fashion TVsse!

Index Scriptorium Estoniae

2002-01-01

Klipp "Fashion Designer Contest - SuperNoova (Estonie) - Femme Pret ̉ Porter - Automne-Hiver 2002/2003" jõudis FTV ekraanile. Disaineritest on esile tõstetud võitjad: Jaanus Orgusaar vanemas ja Leelo nooremas kategoorias

Isospin impurity and super-allowed β transitions

International Nuclear Information System (INIS)

Sagawa, H.; Van Giai Nguyen; Suzuki, T.

1999-01-01

We study the effect of isospin impurity on the super-allowed Fermi β decay using microscopic HF and RPA (or TDA) model taking into account CSB and CIB interactions. It is found that the isospin impurity of N = Z nuclei gives enhancement of the sum rule of Fermi transition probabilities. On the other hand, the super-allowed transitions between odd-odd J = 0 nuclei and even-even J = 0 nuclei are quenched because on the cancellation of the isospin impurity effects of mother and daughter nuclei. An implication of the calculated Fermi transition rate on the unitarity of Cabbibo-Kobayashi-Maskawa mixing matrix is also discussed. (authors)

Super ACO FEL oscillation at 300 nm

CERN Document Server

Nutarelli, D; Renault, E; Nahon, L; Couprie, Marie Emmanuelle

2000-01-01

Some recent improvements, involving both the optical cavity mirrors and the positron beam dynamics in the storage ring, have allowed us to achieve a laser oscillation at 300 nm on the Super ACO Storage Ring FEL. The Super ACO storage ring is operated at 800 MeV which is the nominal energy for the usual synchrotron radiation users, and the highest energy for a storage ring FEL. The lasing at 300 nm could be kept during 2 h per injection, with a stored current ranging between 30 and 60 mA. The FEL characteristics are presented here. The longitudinal stability and the FEL optics behaviour are also discussed.

Super(210) Pb based trace element fluxes in the nearshore and estuarine sediments off Bombay, India

Digital Repository Service at National Institute of Oceanography (India)

Sharma, P.; Borole, D.V.; Zingde, M.D.

Seven sediment cores from the Thana Creek-Bombay harbour complex (THC) have been studied for excess super(210) Pb (super(210) Pb sub(exc), that portion of super(210) Pb not supported by decay of super(226) Ra in sediment), C sub(org), Mn, Fe, Co, Ni...

Conformal scalar fields and chiral splitting on super Riemann surfaces

International Nuclear Information System (INIS)

D'Hoker, E.; Phong, D.H.

1989-01-01

We provide a complete description of correlation functions of scalar superfields on a super Riemann surface, taking into account zero modes and non-trivial topology. They are built out of chirally split correlation functions, or conformal blocks at fixed internal momenta. We formulate effective rules which determine these completely in terms of geometric invariants of the super Riemann surface. The chirally split correlation functions have non-trivial monodromy and produce single-valued amplitudes only upon integration over loop momenta. Our discussion covers the even spin structure as well as the odd spin structure case which had been the source of many difficulties in the past. Super analogues of Green's functions, holomorphic spinors, and prime forms emerge which should pave the way to function theory on super Riemann surfaces. In superstring theories, chirally split amplitudes for scalar superfields are crucial in enforcing the GSO projection required for consistency. However one really knew how to carry this out only in the operator formalism to one-loop order. Our results provide a way of enforcing the GSO projection to any loop. (orig.)

Development of a Super-Pressure Balloon with an Improved Design

Science.gov (United States)

Izutsu, Naoki; Akita, Daisuke; Fuke, Hideyuki; Iijima, Issei; Kato, Yoichi; Kawada, Jiro; Matsushima, Kiyoho; Matsuzaka, Yukihiko; Mizuta, Eiichi; Nakada, Takashi; Nonaka, Naoki; Saito, Yoshitaka; Takada, Atsushi; Tamura, Keisuke; Yamada, Kazuhiko; Yoshida, Tetsuya

A zero-pressure balloon used for scientific observation in the stratosphere has an unmanageable limitation that its floating altitude decreases during a nighttime because of temperature drop of the lifting gas. Since a super-pressure balloon may not change its volume, the lifetime can extend very long. We had introduced so called the ‘lobed-pumpkin’ type of super-pressure balloon that can realize a full-scale long-duration balloon and it will be in practical use in the very near future. As for larger super-pressure balloons, however, we still have some potential difficulties to be resolved. We here propose a new design suitable for a larger super-pressure balloon, which is roughly ‘lobed pumpkin with lobed cylinder’ and can adapt a single design for balloons of a wide range of volumes. Indoor inflation tests were successfully carried out with balloons designed and made by the method. It has been shown that the limit of the resisting pressure differential for a new designed balloon is same as that of a normal lobed-pumpkin balloon.

Super-Resolution Microscopy: Shedding Light on the Cellular Plasma Membrane.

Science.gov (United States)

Stone, Matthew B; Shelby, Sarah A; Veatch, Sarah L

2017-06-14

Lipids and the membranes they form are fundamental building blocks of cellular life, and their geometry and chemical properties distinguish membranes from other cellular environments. Collective processes occurring within membranes strongly impact cellular behavior and biochemistry, and understanding these processes presents unique challenges due to the often complex and myriad interactions between membrane components. Super-resolution microscopy offers a significant gain in resolution over traditional optical microscopy, enabling the localization of individual molecules even in densely labeled samples and in cellular and tissue environments. These microscopy techniques have been used to examine the organization and dynamics of plasma membrane components, providing insight into the fundamental interactions that determine membrane functions. Here, we broadly introduce the structure and organization of the mammalian plasma membrane and review recent applications of super-resolution microscopy to the study of membranes. We then highlight some inherent challenges faced when using super-resolution microscopy to study membranes, and we discuss recent technical advancements that promise further improvements to super-resolution microscopy and its application to the plasma membrane.

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

SuperB: A High-Luminosity Asymmetric e+e- Super Flavor Factory

Energy Technology Data Exchange (ETDEWEB)

Bona, M.; /et al.

2007-05-18

We discuss herein the exciting physics program that can be accomplished with a very large sample of heavy quark and heavy lepton decays produced in the very clean environment of an e{sup +}e{sup -} collider; a program complementary to that of an experiment such as LHCb at a hadronic machine. It then presents the conceptual design of a new type of e{sup +}e{sup -} collider that produces a nearly two-order-of-magnitude increase in luminosity over the current generation of asymmetric B Factories. The key idea is the use of low emittance beams produced in an accelerator lattice derived from the ILC Damping Ring Design, together with a new collision region, again with roots in the ILC final focus design, but with important new concepts developed in this design effort. Remarkably, SuperB produces this very large improvement in luminosity with circulating currents and wallplug power similar to those of the current B Factories. There is clear synergy with ILC R&D; design efforts have already influenced one another, and many aspects of the ILC Damping Rings and Final Focus would be operationally tested at SuperB. Finally, the design of an appropriate detector, based on an upgrade of BABAR as an example, is discussed in some detail. A preliminary cost estimate is presented, as is an example construction timeline.

Superconformal structures and holomorphic 1/2-superdifferentials on N=1 super Riemann surfaces

International Nuclear Information System (INIS)

Kachkachi, H.; Kachkachi, M.

1992-07-01

Using the Super Riemann-Roch theorem we give a local expression for a holomorphic 1/2-superdifferential in a superconformal structure parametrized by special isothermal coordinates on an N=1 Super Riemann Surface (SRS). This construction is done by choosing a suitable origin for these coordinates. The holomorphy of the latter with respect to super Beltrami differentials is proven. (author). 26 refs

Ketogenic diet treatment for pediatric super-refractory status epilepticus.

Science.gov (United States)

Appavu, Brian; Vanatta, Lisa; Condie, John; Kerrigan, John F; Jarrar, Randa

2016-10-01

We aimed to study whether ketogenic diet (KD) therapy leads to resolution of super-refractory status epilepticus in pediatric patients without significant harm. A retrospective review was performed at Phoenix Children's Hospital on patients with super-refractory status epilepticus undergoing ketogenic diet therapy from 2011 to 2015. Ten children with super-refractory status epilepticus, ages 2-16 years, were identified. 4/10 patients had immune mediated encephalitis, including Rasmussen encephalitis, anti-N-methyl-d-aspartate receptor encephalitis, and post-infectious mycoplasma encephalitis. Other etiologies included Lennox Gastaut Syndrome, non-ketotic hyperglycinemia, PCDH19 and GABRG2 genetic epilepsy, New Onset Refractory Status Epilepticus, and Febrile Infection-Related Epilepsy Syndrome. 4/10 patients' EEG features suggested focal with status epilepticus, and 6/10 suggested generalized with status epilepticus. Median hospital length was 61days and median ICU length was 27days. The median number of antiepileptic medications prior to diet initiation was 3.0 drugs, and the median after ketogenic diet treatment was 3.5 drugs. Median duration of status epilepticus prior to KD was 18days. 9/10 patients had resolution of super-refractory status epilepticus in a median of 7days after diet initiation. 8/9 patients were weaned off anesthesia within 15days of diet initiation, and within 1day of achieving ketonuria. 1/10 patients experienced side effects on the diet requiring supplementation. Most patients achieved resolution of status epilepticus on KD therapy, suggesting it could be an effective therapy that can be utilized early in the treatment of children with super refractory status epilepticus. Copyright © 2016. Published by Elsevier Ltd.

Low background techniques for SuperNEMO

International Nuclear Information System (INIS)

Liu, Xin Ran; Mott, James

2015-01-01

The UK contribution to achieving the ultra-low background conditions required inside the detectors of the SuperNEMO experiment are described. A dedicated facility has been established for the screening and selection of materials through gamma ray spectroscopy using germanium detectors. Initial results from two detectors are shown. The radon level inside the SuperNEMO detector must be less than 150 μBq/m 3 in order to achieve the target sensitivity. A Radon Concentration Line (RnCL) has been developed capable of measuring radon levels in large gas volumes down to 5 μBq/m 3 , improving on standard state-of-the-art radon detectors by 3 orders of magnitude. The development, commissioning and first measurements of radon content using the RnCL are also presented. (paper)

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

Super-low dose endotoxin pre-conditioning exacerbates sepsis mortality.

Science.gov (United States)

Chen, Keqiang; Geng, Shuo; Yuan, Ruoxi; Diao, Na; Upchurch, Zachary; Li, Liwu

2015-04-01

Sepsis mortality varies dramatically in individuals of variable immune conditions, with poorly defined mechanisms. This phenomenon complements the hypothesis that innate immunity may adopt rudimentary memory, as demonstrated in vitro with endotoxin priming and tolerance in cultured monocytes. However, previous in vivo studies only examined the protective effect of endotoxin tolerance in the context of sepsis. In sharp contrast, we report herein that pre-conditionings with super-low or low dose endotoxin lipopolysaccharide (LPS) cause strikingly opposite survival outcomes. Mice pre-conditioned with super-low dose LPS experienced severe tissue damage, inflammation, increased bacterial load in circulation, and elevated mortality when they were subjected to cecal-ligation and puncture (CLP). This is in opposite to the well-reported protective phenomenon with CLP mice pre-conditioned with low dose LPS. Mechanistically, we demonstrated that super-low and low dose LPS differentially modulate the formation of neutrophil extracellular trap (NET) in neutrophils. Instead of increased ERK activation and NET formation in neutrophils pre-conditioned with low dose LPS, we observed significantly reduced ERK activation and compromised NET generation in neutrophils pre-conditioned with super-low dose LPS. Collectively, our findings reveal a novel mechanism potentially responsible for the dynamic programming of innate immunity in vivo as it relates to sepsis risks.

Super-low Dose Endotoxin Pre-conditioning Exacerbates Sepsis Mortality

Directory of Open Access Journals (Sweden)

Keqiang Chen

2015-04-01

Full Text Available Sepsis mortality varies dramatically in individuals of variable immune conditions, with poorly defined mechanisms. This phenomenon complements the hypothesis that innate immunity may adopt rudimentary memory, as demonstrated in vitro with endotoxin priming and tolerance in cultured monocytes. However, previous in vivo studies only examined the protective effect of endotoxin tolerance in the context of sepsis. In sharp contrast, we report herein that pre-conditioning with super-low or low dose endotoxin lipopolysaccharide (LPS cause strikingly opposite survival outcomes. Mice pre-conditioned with super-low dose LPS experienced severe tissue damage, inflammation, increased bacterial load in circulation, and elevated mortality when they were subjected to cecal-ligation and puncture (CLP. This is in contrast to the well-reported protective phenomenon with CLP mice pre-conditioned with low dose LPS. Mechanistically, we demonstrated that super-low and low dose LPS differentially modulate the formation of neutrophil extracellular trap (NET in neutrophils. Instead of increased ERK activation and NET formation in neutrophils pre-conditioned with low dose LPS, we observed significantly reduced ERK activation and compromised NET generation in neutrophils pre-conditioned with super-low dose LPS. Collectively, our findings reveal a mechanism potentially responsible for the dynamic programming of innate immunity in vivo as it relates to sepsis risks.

Leak detection in Phenix and Super Phenix steam generators

Energy Technology Data Exchange (ETDEWEB)

Cambillard, E [Centre d' Etudes Nucleaires de Saclay, Gif-sur-Yvette (France)

1978-10-01

Water leak detection Phenix and Super Phenix steam generators is based on measurement of the hydrogen produced by the reaction of sodium with water. The hydrogen evolves in the sodium in which the steam generator tubes are completely immersed. Depending on service conditions, however (sodium temperature and flow velocity), the hydrogen may appear in the argon existing above the free levels. This is why, although the Phenix steam generators do not feature free levels, measurement systems were added to measure the hydrogen concentration in the argon in the expansion tanks. Super Phenix steam generators are fitted at their outlet with systems for measuring hydrogen in the sodium, and above their free level with a system for measuring hydrogen in the argon. The measurement systems have nickel tube probes connected to circuits kept under vacuum by an ion pump. The hydrogen partial pressure is measured by a mass spectrometer. Super Phenix measurement systems differ from Phenix systems essentially in the temperature regulation of the sodium reaching the nickel tube probes, and in the centralization of the supply and measurement systems of the ion pumps and mass spectrometers. This paper deals with description, calibration and operating conditions of the hydrogen detection systems in sodium and argon in Phenix and Super Phenix steam generators. (author)

The Analysis of the Properties of Super Solar Proton Events and the Associated Phenomena

Science.gov (United States)

Cheng, L. B.; Le, G. M.; Lu, Y. P.; Chen, M. H.; Li, P.; Yin, Z. Q.

2014-05-01

The solar flare, the propagation speed of shock driven by coronal mass ejection (CME) from the sun to the Earth, the source longitudes and Carrington longitudes, and the geomagnetic storms associated with each super solar proton event with the peak flux equal to or exceeding 10000 pfu have been investigated. The analysis results show that the source longitudes of super solar proton events ranged from E30° to W75°. The Carrington longitudes of source regions of super solar proton events distributed in the two longitude bands, 130°˜220° and 260°˜320°, respectively. All super solar proton events were accompanied by major solar flares and fast CMEs. The averaged speeds of shocks propagated from the sun to the Earth were greater than 1200 km/s. Eight super solar proton events were followed by major geomagnetic storms (Dst≤-100 nT). One super solar proton event was followed by a geomagnetic storm with Dst=-96 nT.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

Super-resolution imaging of subcortical white matter using stochastic optical reconstruction microscopy (STORM) and super-resolution optical fluctuation imaging (SOFI)

Science.gov (United States)

Hainsworth, A. H.; Lee, S.; Patel, A.; Poon, W. W.; Knight, A. E.

2018-01-01

Aims The spatial resolution of light microscopy is limited by the wavelength of visible light (the ‘diffraction limit’, approximately 250 nm). Resolution of sub-cellular structures, smaller than this limit, is possible with super resolution methods such as stochastic optical reconstruction microscopy (STORM) and super-resolution optical fluctuation imaging (SOFI). We aimed to resolve subcellular structures (axons, myelin sheaths and astrocytic processes) within intact white matter, using STORM and SOFI. Methods Standard cryostat-cut sections of subcortical white matter from donated human brain tissue and from adult rat and mouse brain were labelled, using standard immunohistochemical markers (neurofilament-H, myelin-associated glycoprotein, glial fibrillary acidic protein, GFAP). Image sequences were processed for STORM (effective pixel size 8–32 nm) and for SOFI (effective pixel size 80 nm). Results In human, rat and mouse, subcortical white matter high-quality images for axonal neurofilaments, myelin sheaths and filamentous astrocytic processes were obtained. In quantitative measurements, STORM consistently underestimated width of axons and astrocyte processes (compared with electron microscopy measurements). SOFI provided more accurate width measurements, though with somewhat lower spatial resolution than STORM. Conclusions Super resolution imaging of intact cryo-cut human brain tissue is feasible. For quantitation, STORM can under-estimate diameters of thin fluorescent objects. SOFI is more robust. The greatest limitation for super-resolution imaging in brain sections is imposed by sample preparation. We anticipate that improved strategies to reduce autofluorescence and to enhance fluorophore performance will enable rapid expansion of this approach. PMID:28696566

Super-resolution imaging of subcortical white matter using stochastic optical reconstruction microscopy (STORM) and super-resolution optical fluctuation imaging (SOFI).

Science.gov (United States)

Hainsworth, A H; Lee, S; Foot, P; Patel, A; Poon, W W; Knight, A E

2017-07-11

The spatial resolution of light microscopy is limited by the wavelength of visible light (the 'diffraction limit', approximately 250 nm). Resolution of sub-cellular structures, smaller than this limit, is possible with super resolution methods such as stochastic optical reconstruction microscopy (STORM) and super-resolution optical fluctuation imaging (SOFI). We aimed to resolve subcellular structures (axons, myelin sheaths and astrocytic processes) within intact white matter, using STORM and SOFI. Standard cryostat-cut sections of subcortical white matter from donated human brain tissue and from adult rat and mouse brain were labelled, using standard immunohistochemical markers (neurofilament-H, myelin-associated glycoprotein, glial fibrillary acidic protein, GFAP). Image sequences were processed for STORM (effective pixel size 8-32 nm) and for SOFI (effective pixel size 80 nm). In human, rat and mouse, subcortical white matter high-quality images for axonal neurofilaments, myelin sheaths and filamentous astrocytic processes were obtained. In quantitative measurements, STORM consistently underestimated width of axons and astrocyte processes (compared with electron microscopy measurements). SOFI provided more accurate width measurements, though with somewhat lower spatial resolution than STORM. Super resolution imaging of intact cryo-cut human brain tissue is feasible. For quantitation, STORM can under-estimate diameters of thin fluorescent objects. SOFI is more robust. The greatest limitation for super-resolution imaging in brain sections is imposed by sample preparation. We anticipate that improved strategies to reduce autofluorescence and to enhance fluorophore performance will enable rapid expansion of this approach. © 2017 British Neuropathological Society.

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

An Ingenious Super Light Trapping Surface Templated from Butterfly Wing Scales

Science.gov (United States)

Han, Zhiwu; Li, Bo; Mu, Zhengzhi; Yang, Meng; Niu, Shichao; Zhang, Junqiu; Ren, Luquan

2015-08-01

Based on the super light trapping property of butterfly Trogonoptera brookiana wings, the SiO2 replica of this bionic functional surface was successfully synthesized using a simple and highly effective synthesis method combining a sol-gel process and subsequent selective etching. Firstly, the reflectivity of butterfly wing scales was carefully examined. It was found that the whole reflectance spectroscopy of the butterfly wings showed a lower level (less than 10 %) in the visible spectrum. Thus, it was confirmed that the butterfly wings possessed a super light trapping effect. Afterwards, the morphologies and detailed architectures of the butterfly wing scales were carefully investigated using the ultra-depth three-dimensional (3D) microscope and field emission scanning electronic microscopy (FESEM). It was composed by the parallel ridges and quasi-honeycomb-like structure between them. Based on the biological properties and function above, an exact SiO2 negative replica was fabricated through a synthesis method combining a sol-gel process and subsequent selective etching. At last, the comparative analysis of morphology feature size and the reflectance spectroscopy between the SiO2 negative replica and the flat plate was conducted. It could be concluded that the SiO2 negative replica inherited not only the original super light trapping architectures, but also the super light trapping characteristics of bio-template. This work may open up an avenue for the design and fabrication of super light trapping materials and encourage people to look for more super light trapping architectures in nature.

Super-resolution and super-localization microscopy: A novel tool for imaging chemical and biological processes

Energy Technology Data Exchange (ETDEWEB)

Dong, Bin [Iowa State Univ., Ames, IA (United States)

2015-01-01

Optical microscopy imaging of single molecules and single particles is an essential method for studying fundamental biological and chemical processes at the molecular and nanometer scale. The best spatial resolution (~ λ/2) achievable in traditional optical microscopy is governed by the diffraction of light. However, single molecule-based super-localization and super-resolution microscopy imaging techniques have emerged in the past decade. Individual molecules can be localized with nanometer scale accuracy and precision for studying of biological and chemical processes.This work uncovered the heterogeneous properties of the pore structures. In this dissertation, the coupling of molecular transport and catalytic reaction at the single molecule and single particle level in multilayer mesoporous nanocatalysts was elucidated. Most previous studies dealt with these two important phenomena separately. A fluorogenic oxidation reaction of non-fluorescent amplex red to highly fluorescent resorufin was tested. The diffusion behavior of single resorufin molecules in aligned nanopores was studied using total internal reflection fluorescence microscopy (TIRFM).

Super rogue wave in plasma

International Nuclear Information System (INIS)

Pathak, Pallabi; Sharma, Sumita Kumari; Bailung, Heremba

2015-01-01

The evolution of super rogue wave having amplitude ∼5 times the background wave has been observed in multicomponent plasma with critical concentration of negative ions in a double plasma device. In normal electron-ion plasma the ion acoustic solitons are described by the Korteweg-de Vries (KdV) equation. At a critical concentration of negative ions, the ion acoustic modified KdV solitons are found to propagate. Multicomponent plasma also supports the propagation of a special kind of soliton namely 'Peregrine soliton' at critical concentration of negative ions. Peregrine soliton is a doubly localized solution of the nonlinear Schrodinger equation (NLSE) having amplitude 3 times the background carrier wave. In a double plasma device, ion-acoustic Peregrine soliton is excited by applying slowly varying amplitude modulated continuous sinusoidal signal to the source anode and described by the rational solution of NLSE. The ion acoustic wave is modulationally unstable in multicomponent plasma with critical concentration of negative ions and an initial modulated wave perturbation is found to undergo self-modulation to form localized structures by balancing the nonlinearity with the dispersion. In presence of higher order nonlinearity, propagation of a high amplitude (∼5 times of background carrier wave) ion acoustic Peregrine soliton has been observed experimentally. The existence of such types of higher order wave has been reported in other dispersive media. These are considered to be the prototype of super rogue wave in deep water. In this work, experimental results on the evolution of super rogue wave in a double plasma device are presented and compared with the numerical solution of NLSE. (author)

Schwinger terms of the super-Virasoro algebra in (1,0) superspace

International Nuclear Information System (INIS)

Lee, J.; Louis, J.; Ovrut, B.A.

1988-01-01

We calculate the Schwinger terms of the super-Virasoro algebra for the heterotic string, and the associated anomalous seagull terms, directly from the Lorentz and super-Weyl anomalies using the (1,0) superspace formalism. The various supercurrents in (1,0) superspace are also discussed

Hidden twelve-dimensional super Poincare symmetry in eleven dimensions

International Nuclear Information System (INIS)

Bars, Itzhak; Deliduman, Cemsinan; Pasqua, Andrea; Zumino, Bruno

2004-01-01

First, we review a result in our previous paper, of how a ten-dimensional superparticle, taken off-shell, has a hidden eleven-dimensional super Poincare symmetry. Then, we show that the physical sector is defined by three first-class constraints which preserve the full eleven-dimensional symmetry. Applying the same concepts to the eleven-dimensional superparticle, taken off-shell, we discover a hidden twelve-dimensional super Poincare symmetry that governs the theory

The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

DEFF Research Database (Denmark)

Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

2011-01-01

. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

W∞ gravity and super-W∞ gravity

International Nuclear Information System (INIS)

Bergshoeff, E.; Pope, C.N.; Shen, X.; Sezgin, E.; Romans, L.J.

1991-01-01

In this paper, the authors construct gauge theories of the W ∞ algebra and its super-extension, and discuss their relation to earlier results for the gauging of the classical contraction to the w ∞ algebra

A Brief Taxometrics Primer

Science.gov (United States)

Beauchaine, Theodore P.

2009-01-01

Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

Directory of Open Access Journals (Sweden)

Michael D. Blanton

2012-09-01

Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

On the huge Lie superalgebra of pseudo superdifferential operators and super KP-hierarchies

International Nuclear Information System (INIS)

Sedra, M.B.

1995-08-01

Lie superalgebraic methods are used to establish a connection between the huge Lie superalgebra Ξ of super (pseudo) differential operators and various super KP-hierarchies. We show in particular that Ξ splits into 5 = 2 x 2 + 1 graded algebras expected to correspond to five classes of super KP-hierarchies generalizing the well-known Manin-Radul and Figueroa O'Farrill-Ramos supersymmetric KP-hierarchies. (author). 10 refs

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

JAPAN: Super-Kamiokande

International Nuclear Information System (INIS)

Anon.

1994-01-01

Excavation for the Japanese Super- KAMIOKANDE 50,000-ton water Cherenkov imaging detector was completed at the end of June. The goals include a search for nucleon decay up to a lifetime of 10 33-34 years, high-statistics studies of solar and atmospheric neutrinos, and detection of any nearby supernova explosions. The project was approved in 1991, with the official 'groundbreaking' in December of that year about 1,000 m underground in the Kamioka mine in Gifu Prefecture, about 250 km west of Tokyo

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

Super-Resolution for Color Imagery

Science.gov (United States)

2017-09-01

September 2017 2. REPORT TYPE Technical Report 3. DATES COVERED (From - To) 1 October 2016‒30 September 2017 4. TITLE AND SUBTITLE Super...slightly lighter shade of purple. There is slightly less purple coloring on the white paper than with the other 2 color spaces, and the black font is

Polarization-Dependent Measurements of Molecular Super Rotors with Oriented Angular Momenta

Science.gov (United States)

Murray, Matthew J.; Toro, Carlos; Liu, Qingnan; Mullin, Amy S.

2014-05-01

Controlling molecular motion would enable manipulation of energy flow between molecules. Here we have used an optical centrifuge to investigate energy transfer between molecular super rotors with oriented angular momenta. The polarizable electron cloud of the molecules interacts with the electric field of linearly polarized light that angularly accelerates over the time of the optical pulse. This process drives molecules into high angular momentum states that are oriented with the optical field and have energies far from equilibrium. High resolution transient IR spectroscopy reveals the dynamics of collisional energy transfer for these super excited rotors. The results of this study leads to a more fundamental understanding of energy balance in non-equilibrium environments and the physical and chemical properties of gases in a new regime of energy states. Results will be presented for several super rotor species including carbon monoxide, carbon dioxide, and acetylene. Polarization-dependent measurements reveal the extent to which the super rotors maintain spatial orientation of high angular momentum states.

Pioneer factors govern super-enhancer dynamics in stem cell plasticity and lineage choice

Science.gov (United States)

Adam, Rene C.; Yang, Hanseul; Rockowitz, Shira; Larsen, Samantha B.; Nikolova, Maria; Oristian, Daniel S.; Polak, Lisa; Kadaja, Meelis; Asare, Amma; Zheng, Deyou; Fuchs, Elaine

2015-01-01

Adult stem cells (SCs) reside in niches which balance self-renewal with lineage selection and progression during tissue homeostasis. Following injury, culture or transplantation, SCs outside their niche often display fate flexibility1-4. Here we show that super-enhancers5 underlie the identity, lineage commitment and plasticity of adult SCs in vivo. Using hair follicle (HF) as model, we map the global chromatin domains of HFSCs and their committed progenitors in their native microenvironments. We show that super-enhancers and their dense clusters (‘epicenters’) of transcription factor (TF) binding sites change upon lineage progression. New fate is acquired by decommissioning old and establishing new super-enhancers and/or epicenters, an auto-regulatory process that abates one master regulator subset while enhancing another. We further show that when outside their niche, either in vitro or in wound-repair, HFSCs dynamically remodel super-enhancers in response to changes in their microenvironment. Intriguingly, some key super-enhancers shift epicenters, enabling them to remain active and maintain a transitional state in an ever-changing transcriptional landscape. Finally, we identify SOX9 as a crucial chromatin rheostat of HFSC super-enhancers, and provide functional evidence that super-enhancers are dynamic, dense TF-binding platforms which are acutely sensitive to pioneer master regulators whose levels define not only spatial and temporal features of lineage-status, but also stemness, plasticity in transitional states and differentiation. PMID:25799994

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Steam generator development in France for the Super Phenix project

International Nuclear Information System (INIS)

Robin, M.G.

1975-01-01

'Steam Generator Development for Super Phenix Project'. The development program of steam generators studied by Fives-Cail Babcock and Stein Industrie Companies, jointly with CEA end EDF, for the Super Phenix 1200 MWe Fast Breeder Power Plant, is presented. The main characteristics of both sodium heated steam generators are emphasized and experimental studies related to their key features are reported. (author)

THE SEARCH FOR SUPER-SATURATION IN CHROMOSPHERIC EMISSION

International Nuclear Information System (INIS)

Christian, Damian J.; Arias, Tersi; Mathioudakis, Mihalis; Jess, David B.; Jardine, Moira

2011-01-01

We investigate if the super-saturation phenomenon observed at X-ray wavelengths for the corona exists in the chromosphere for rapidly rotating late-type stars. Moderate resolution optical spectra of fast-rotating EUV- and X-ray-selected late-type stars were obtained. Stars in α Per were observed in the northern hemisphere with the Isaac Newton 2.5 m telescope and Intermediate Dispersion Spectrograph. Selected objects from IC 2391 and IC 2602 were observed in the southern hemisphere with the Blanco 4 m telescope and R-C spectrograph at CTIO. Ca II H and K fluxes were measured for all stars in our sample. We find the saturation level for Ca II K at log (L CaK /L bol ) = -4.08. The Ca II K flux does not show a decrease as a function of increased rotational velocity or smaller Rossby number as observed in the X-ray. This lack of 'super-saturation' supports the idea of coronal stripping as the cause of saturation and super-saturation in stellar chromospheres and coronae, but the detailed underlying mechanism is still under investigation.

Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

Directory of Open Access Journals (Sweden)

Nigel C. Brissett

2013-11-01

Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

Superconductive MRI system, MRT-50A/SUPER

International Nuclear Information System (INIS)

Suzuki, Hirokazu; Goro, Takehiko

1992-01-01

The MRI (magnetic resonance imaging) market has been rapidly growing and more than 1,300 MRI systems are now operating in the Japanese domestic market. An upper-middle range MRI market, which is characterized by high-image quality, has newly appeared between the high-end and middle-range market niches since last year. To be competitive in this upper-middle range market, Toshiba has developed a superconductive MRI system, the MRT-50A/SUPER. The new system featured a high-performance actively shielded gradient coil called the TSGC (twin-shielded gradient coil), installed in a compact superconductive magnet. This paper introduces the MRT-50A/SUPER and describes recent developments in MRI technology. (author)

Super-Memorizers Are Not Super-Recognizers.

Directory of Open Access Journals (Sweden)

Meike Ramon

Full Text Available Humans have a natural expertise in recognizing faces. However, the nature of the interaction between this critical visual biological skill and memory is yet unclear. Here, we had the unique opportunity to test two individuals who have had exceptional success in the World Memory Championships, including several world records in face-name association memory. We designed a range of face processing tasks to determine whether superior/expert face memory skills are associated with distinctive perceptual strategies for processing faces. Superior memorizers excelled at tasks involving associative face-name learning. Nevertheless, they were as impaired as controls in tasks probing the efficiency of the face system: face inversion and the other-race effect. Super memorizers did not show increased hippocampal volumes, and exhibited optimal generic eye movement strategies when they performed complex multi-item face-name associations. Our data show that the visual computations of the face system are not malleable and are robust to acquired expertise involving extensive training of associative memory.

Super-Memorizers Are Not Super-Recognizers.

Science.gov (United States)

Ramon, Meike; Miellet, Sebastien; Dzieciol, Anna M; Konrad, Boris Nikolai; Dresler, Martin; Caldara, Roberto

2016-01-01

Humans have a natural expertise in recognizing faces. However, the nature of the interaction between this critical visual biological skill and memory is yet unclear. Here, we had the unique opportunity to test two individuals who have had exceptional success in the World Memory Championships, including several world records in face-name association memory. We designed a range of face processing tasks to determine whether superior/expert face memory skills are associated with distinctive perceptual strategies for processing faces. Superior memorizers excelled at tasks involving associative face-name learning. Nevertheless, they were as impaired as controls in tasks probing the efficiency of the face system: face inversion and the other-race effect. Super memorizers did not show increased hippocampal volumes, and exhibited optimal generic eye movement strategies when they performed complex multi-item face-name associations. Our data show that the visual computations of the face system are not malleable and are robust to acquired expertise involving extensive training of associative memory.

Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

DEFF Research Database (Denmark)

Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

2005-01-01

A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

Development and applications of Super Monte Carlo Simulation Program for Advanced Nuclear Energy Systems

Energy Technology Data Exchange (ETDEWEB)

Wu, Y., E-mail: yican.wu@fds.org.cn [Inst. of Nuclear Energy Safety Technology, Hefei, Anhui (China)

2015-07-01

'Full text:' Super Monte Carlo Simulation Program for Advanced Nuclear Energy Systems (SuperMC) is a CAD-based Monte Carlo (MC) program for integrated simulation of nuclear system by making use of hybrid MC-deterministic method and advanced computer technologies. The main usability features are automatic modeling of geometry and physics, visualization and virtual simulation and cloud computing service. SuperMC 2.3, the latest version, can perform coupled neutron and photon transport calculation. SuperMC has been verified by more than 2000 benchmark models and experiments, and has been applied in tens of major nuclear projects, such as the nuclear design and analysis of International Thermonuclear Experimental Reactor (ITER) and China Lead-based reactor (CLEAR). Development and applications of SuperMC are introduced in this presentation. (author)

Development and applications of Super Monte Carlo Simulation Program for Advanced Nuclear Energy Systems

International Nuclear Information System (INIS)

Wu, Y.

2015-01-01

'Full text:' Super Monte Carlo Simulation Program for Advanced Nuclear Energy Systems (SuperMC) is a CAD-based Monte Carlo (MC) program for integrated simulation of nuclear system by making use of hybrid MC-deterministic method and advanced computer technologies. The main usability features are automatic modeling of geometry and physics, visualization and virtual simulation and cloud computing service. SuperMC 2.3, the latest version, can perform coupled neutron and photon transport calculation. SuperMC has been verified by more than 2000 benchmark models and experiments, and has been applied in tens of major nuclear projects, such as the nuclear design and analysis of International Thermonuclear Experimental Reactor (ITER) and China Lead-based reactor (CLEAR). Development and applications of SuperMC are introduced in this presentation. (author)

Actinide targets for the synthesis of super-heavy elements

International Nuclear Information System (INIS)

Roberto, J.B.; Alexander, C.W.; Boll, R.A.; Burns, J.D.; Ezold, J.G.; Felker, L.K.; Hogle, S.L.; Rykaczewski, K.P.

2015-01-01

Since 2000, six new super-heavy elements with atomic numbers 113 through 118 have been synthesized in hot fusion reactions of "4"8Ca beams on actinide targets. These target materials, including "2"4"2Pu, "2"4"4Pu, "2"4"3Am, "2"4"5Cm, "2"4"8Cm, "2"4"9Cf, and "2"4"9Bk, are available in very limited quantities and require specialized production and processing facilities resident in only a few research centers worldwide. This report describes the production and chemical processing of heavy actinide materials for super-heavy element research, current availabilities of these materials, and related target fabrication techniques. The impact of actinide materials in super-heavy element discovery is reviewed, and strategies for enhancing the production of rare actinides including "2"4"9Bk, "2"5"1Cf, and "2"5"4Es are described.

The super-ordinate nature of the psychopathy checklist-revised.

Science.gov (United States)

Neumann, Craig S; Hare, Robert D; Newman, Joseph P

2007-04-01

Psychopathy, while perhaps the earliest and most recognized personality disorder, is the subject of intense debate about its nature and measurement. The most recent proposal on its structural nature suggests that it is a multifaceted construct, made up of at least four dimensions reflecting Interpersonal, Affective, Lifestyle, and Antisocial anomalies (Hare & Neumann, 2005, 2006). These dimensions are significantly interrelated, suggesting that they are indicators for a super-ordinate factor. The nature of this higher-order factor may reflect the unifying feature which comprehensively defines the disorder. To examine this super-factor, the current study used several very large data sets of male (N = 4865) and female (N = 1099) offenders, and forensic psychiatric patients (N = 965), who were assessed with the Psychopathy Checklist-Revised (PCL-R; Hare, 2003). Structural equation modeling results indicated that the four first-order factor dimensions could be explained by a single second-order cohesive super-factor.

The evolution of the US ESCO industry: From ESCO to SuperESCO

Energy Technology Data Exchange (ETDEWEB)

Vine, E.; Nakagami, Hidetoshi; Murakoshi, Chiharu

1998-10-01

As the restructuring of the U.S. electric utility industry proceeds, utility companies are expected to be either competing or partnering with Super ESCOs to provide energy-efficiency services and energy to utility customers. In this paper, Super ESCOs and utilities were interviewed to see how these organizations are currently interacting and planning to interact in the future. As part of this investigation, the types of products and services Super ESCOs will be providing in the future and how utility restructuring will affect their business were examined.

Super-leading logarithms in non-global observables in QCD colour basis independent calculation

CERN Document Server

Forshaw, J R; Seymour, M H

2008-01-01

In a previous paper we reported the discovery of super-leading logarithmic terms in a non-global QCD observable. In this short update we recalculate the first super-leading logarithmic contribution to the 'gaps between jets' cross-section using a colour basis independent notation. This sheds light on the structure and origin of the super-leading terms and allows them to be calculated for gluon scattering processes for the first time.

The astrobiology primer: an outline of general knowledge--version 1, 2006.

Science.gov (United States)

Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

2006-10-01

The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

Development of an electro-optic super modulator

International Nuclear Information System (INIS)

Cusack, B; Shaddock, D.

2002-01-01

Full text: Optical phase modulators and amplitude modulators are commonplace in modern laser laboratories. In this talk, we present the development of a device that produces both amplitude modulation (AM) and phase modulation (PM), with a selectable phase relation between the two, on a single free-space Gaussian beam. We term this device a 'super modulator. The device is a version of the Mach-Zehnder modulator, where a beam is split, then separately phase modulated and recombined. Previous work has concentrated on one specific operating point, where the relative modulation phases and the interferometer phase are set to generate single sideband modulation, equivalent to an equal amount of AM and PM in quadrature. Here we are interested in the entire parameter space of amplitude modulation strength, phase modulation strength, and the phase relation between the two. The need for such a super modulator has arisen in the context of control systems for gravitational wave detection interferometers. Typical locking systems are based on the Pound-Drever-Hall method of locking which uses phase modulation. In principle, a super modulator could be used in a PDH configuration, when the locking point of the device will be tunable according to the quantity of AM injected (along with the obligatory PM) into the device

Recent advances in Reltron and Super-Reltron HPM source development

Science.gov (United States)

Miller, Robert B.; Muehlenweg, Carl A.; Habiger, Kerry W.; Smith, John R.; Shiffler, Donald A.

1994-05-01

Reltron and super-reltron microwave tubes use post acceleration of a well-modulated beam and multiple output cavity extraction sections to generate high power microwave pulses with excellent efficiency. We have continued our development of these tubes with emphasis being given to four specific topics: (1) Recent experiments with our 1-GHz super-reltron tube have demonstrated operation at a peak power level of 600 MW. With pulse durations of several hundred nanoseconds, the microwave energy per pulse is about 250 J. (2) We have extracted significant power (several tens of megawatts) at the third multiple (3 GHz) of our 1-GHz super-reltron tube using output cavities designed for operation in S-band. (3) We have fielded a small S-band super-reltron tube on our 260 kV modulator. We have obtained lifetime data for this tube under repetitive (20 Hz), long pulse (2 microsecond(s) ec) operating conditions. (4) We have initiated feasibility experiments of the reltron concept by post accelerating the bunched beam produced by a SLAC XK-5 klystron. In this paper we report our experimental results and discuss relevant theoretical considerations related to each of these four topics.

Signal Characteristics of Super-Resolution Near-Field Structure Disks with 100 GB Capacity

Science.gov (United States)

Kim, Jooho; Hwang, Inoh; Kim, Hyunki; Park, Insik; Tominaga, Junji

2005-05-01

We report the basic characteristics of super resolution near-field structure (Super-RENS) media at a blue laser optical system (laser wavelength 405 nm, numerical aperture 0.85). Using a novel write once read many (WORM) structure for a blue laser system, we obtained a carrier-to-noise ratio (CNR) above 33 dB from the signal of the 37.5 nm mark length, which is equivalent to a 100 GB capacity with a 0.32 micrometer track pitch, and an eye pattern for 50 GB (2T: 75 nm) capacity using a patterned signal. Using a novel super-resolution material (tellurium, Te) with low super-resolution readout power, we also improved the read stability.

Super-Refractory Status Epilepticus: Report of a Case and Review of the Literature.

Science.gov (United States)

Lapenta, Leonardo; Frisullo, Giovanni; Vollono, Catello; Brunetti, Valerio; Giannantoni, Nadia Mariagrazia; Sandroni, Claudio; Di Lella, Giuseppe; Della Marca, Giacomo

2015-10-01

Super-refractory status epilepticus (SE; ie, SE continuing or recurring despite 24 hours of general anesthesia) is a severe condition with high percentage of mortality and morbidity. Usually, this condition occurs because of serious brain damage; nevertheless, some patients develop super-refractory SE without identifiable etiology. Although not uncommonly encountered in neurointensive care, scientific data on this condition are still lacking in terms of treatment and prognosis. Herein, we report a case of super-refractory SE with recovery after 50 days, despite electroencephalographic (EEG) and magnetic resonance imaging (MRI) signs traditionally related to poor prognosis. A review of the literature on super-refractory SE is also presented. © EEG and Clinical Neuroscience Society (ECNS) 2014.

3D super-virtual refraction interferometry

KAUST Repository

Lu, Kai; AlTheyab, Abdullah; Schuster, Gerard T.

2014-01-01

Super-virtual refraction interferometry enhances the signal-to-noise ratio of far-offset refractions. However, when applied to 3D cases, traditional 2D SVI suffers because the stationary positions of the source-receiver pairs might be any place

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

Science.gov (United States)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Promotion primer. Foerderfibel

Energy Technology Data Exchange (ETDEWEB)

1981-01-01

This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

The SuperB Silicon Vertex Tracker and 3D vertical integration

CERN Document Server

Re, Valerio

2011-01-01

The construction of the SuperB high luminosity collider was approved and funded by the Italian government in 2011. The performance specifications set by the target luminosity of this machine (> 10^36 cm^-2 s^-1) ask for the development of a Silicon Vertex Tracker with high resolution, high tolerance to radiation and excellent capability of handling high data rates. This paper reviews the R&D activity that is being carried out for the SuperB SVT. Special emphasis is given to the option of exploiting 3D vertical integration to build advanced pixel sensors and readout electronics that are able to comply with SuperB vertexing requirements.

Super-Resolution Enhancement From Multiple Overlapping Images: A Fractional Area Technique

Science.gov (United States)

Michaels, Joshua A.

With the availability of large quantities of relatively low-resolution data from several decades of space borne imaging, methods of creating an accurate, higher-resolution image from the multiple lower-resolution images (i.e. super-resolution), have been developed almost since such imagery has been around. The fractional-area super-resolution technique developed in this thesis has never before been documented. Satellite orbits, like Landsat, have a quantifiable variation, which means each image is not centered on the exact same spot more than once and the overlapping information from these multiple images may be used for super-resolution enhancement. By splitting a single initial pixel into many smaller, desired pixels, a relationship can be created between them using the ratio of the area within the initial pixel. The ideal goal for this technique is to obtain smaller pixels with exact values and no error, yielding a better potential result than those methods that yield interpolated pixel values with consequential loss of spatial resolution. A Fortran 95 program was developed to perform all calculations associated with the fractional-area super-resolution technique. The fractional areas are calculated using traditional trigonometry and coordinate geometry and Linear Algebra Package (LAPACK; Anderson et al., 1999) is used to solve for the higher-resolution pixel values. In order to demonstrate proof-of-concept, a synthetic dataset was created using the intrinsic Fortran random number generator and Adobe Illustrator CS4 (for geometry). To test the real-life application, digital pictures from a Sony DSC-S600 digital point-and-shoot camera with a tripod were taken of a large US geological map under fluorescent lighting. While the fractional-area super-resolution technique works in perfect synthetic conditions, it did not successfully produce a reasonable or consistent solution in the digital photograph enhancement test. The prohibitive amount of processing time (up to

The super-LHC

CERN Document Server

Mangano, Michelangelo L

2010-01-01

We review here the prospects of a long-term upgrade programme for the Large Hadron Collider (LHC), CERN laboratory's new proton-proton collider. The super-LHC, which is currently under evaluation and design, is expected to deliver of the order of ten times the statistics of the LHC. In addition to a non-technical summary of the principal physics arguments for the upgrade, I present a pedagogical introduction to the technological challenges on the accelerator and experimental fronts, and a review of the current status of the planning.

Characterization of a NIMONIC TYPE super alloy

International Nuclear Information System (INIS)

Zamora Rangel, L.; Martinez Martinez, E.

1985-01-01

Mechanical properties of strength and thermofluence of a NIMONIC type super alloy under thermal treatment was determined. The relationship between microstructure, phases and precipitates was also studied. (author)

Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

DEFF Research Database (Denmark)

Li, H; Shi, B; Li, X

2013-01-01

The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

Solution of the equations of motion for a super non-Abelian sigma model in curved background by the super Poisson-Lie T-duality

International Nuclear Information System (INIS)

Eghbali, Ali

2015-01-01

The equations of motion of a super non-Abelian T-dual sigma model on the Lie supergroup (C_1"1+A) in the curved background are explicitly solved by the super Poisson-Lie T-duality. To find the solution of the flat model we use the transformation of supercoordinates, transforming the metric into a constant one, which is shown to be a supercanonical transformation. Then, using the super Poisson-Lie T-duality transformations and the dual decomposition of elements of Drinfel’d superdouble, the solution of the equations of motion for the dual sigma model is obtained. The general form of the dilaton fields satisfying the vanishing β−function equations of the sigma models is found. In this respect, conformal invariance of the sigma models built on the Drinfel’d superdouble ((C_1"1+A) , I_(_2_|_2_)) is guaranteed up to one-loop, at least.

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Traveling Ionospheric Disturbances Observed by Midlatitude SuperDARN Radars

Science.gov (United States)

Frissell, N. A.; Baker, J. B.; Ruohoniemi, J. M.; West, M. L.; Bristow, W. A.

2012-12-01

Medium Scale Traveling Ionospheric Disturbances (MSTIDs) are wave-like perturbations of the F-region ionosphere with horizontal wavelengths on the order of 100-250 km and periods between ~15 - 60 min, and are generally thought to be the ionospheric manifestation of Atmospheric Gravity Waves (AGWs). High-latitude MSTIDs have been studied using SuperDARN radars since 1989, and are typically attributed to auroral sources and propagated by the Earth Reflected Wave (ERW) mode. Tropospheric sources and earthquakes are also known to be sources of MSTIDs. Observations of MSTIDs using both mid- and high- latitude SuperDARN radars are presented. North American radar data from November 2010 - November 2011 were searched for signatures of MSTIDs. Initial results suggest that MSTIDs are observed at high latitudes primarily in the fall/winter months, which is consistent with published results. This search also reveals that mid-latitude MSTIDs often appear concurrently with high-latitude MSTIDs and share similar wave parameters. During the fall/winter months, SuperDARN mid-latitude MSTIDs appear more often than high-latitude MSTIDs, likely due to calmer ionospheric conditions at mid-latitudes. In the springtime, SuperDARN-observed MSTIDs are less likely to be seen at high-latitudes, but still appear at mid-latitudes. Selected events are analyzed for wave parameters using the Multiple Signal Classification (MUSIC) technique.

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Necessary conditions for super-integrability of Hamiltonian systems

Energy Technology Data Exchange (ETDEWEB)

Maciejewski, Andrzej J. [Institute of Astronomy, University of Zielona Gora, Podgorna 50, PL-65-246 Zielona Gora (Poland)], E-mail: maciejka@astro.ia.uz.zgora.pl; Przybylska, Maria [Torun Centre for Astronomy, N. Copernicus University, Gagarina 11, PL-87-100 Torun (Poland)], E-mail: maria.przybylska@astri.uni.torun.pl; Yoshida, Haruo [National Astronomical Observatory, 2-21-1 Osawa, Mitaka, 181-8588 Tokyo (Japan)], E-mail: h.yoshida@nao.ac.jp

2008-08-18

We formulate a general theorem which gives a necessary condition for the maximal super-integrability of a Hamiltonian system. This condition is expressed in terms of properties of the differential Galois group of the variational equations along a particular solution of the considered system. An application of this general theorem to natural Hamiltonian systems of n degrees of freedom with a homogeneous potential gives easily computable and effective necessary conditions for the super-integrability. To illustrate an application of the formulated theorems, we investigate: three known families of integrable potentials, and the three body problem on a line.

Localization-based super-resolution imaging of cellular structures.

Science.gov (United States)

Kanchanawong, Pakorn; Waterman, Clare M

2013-01-01

Fluorescence microscopy allows direct visualization of fluorescently tagged proteins within cells. However, the spatial resolution of conventional fluorescence microscopes is limited by diffraction to ~250 nm, prompting the development of super-resolution microscopy which offers resolution approaching the scale of single proteins, i.e., ~20 nm. Here, we describe protocols for single molecule localization-based super-resolution imaging, using focal adhesion proteins as an example and employing either photoswitchable fluorophores or photoactivatable fluorescent proteins. These protocols should also be easily adaptable to imaging a broad array of macromolecular assemblies in cells whose components can be fluorescently tagged and assemble into high density structures.

Selective 2'-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis.

Science.gov (United States)

Smola, Matthew J; Rice, Greggory M; Busan, Steven; Siegfried, Nathan A; Weeks, Kevin M

2015-11-01

Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistries exploit small electrophilic reagents that react with 2'-hydroxyl groups to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues by using reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as can be done for simple model RNAs. This protocol describes the experimental steps, implemented over 3 d, that are required to perform SHAPE probing and to construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots and provides useful troubleshooting information. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures and visualize probable and alternative helices, often in under 1 d. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles and entire transcriptomes.

Preparation And Characterization Of Modified Sago Waste Super absorbent For Pome Treatment

International Nuclear Information System (INIS)

Norzita Yacob; Nurul Hidayah Ahmad Zahari; Maznah Mahmud; Norhashidah Talip; Kamaruddin Hashim; Zahid Abdullah; Norafifah Ahmad Fabillah; Mohamad Nalrazmi Mohamad Shukri; Nurul Aizam Idayu Mat Sani

2014-01-01

Palm Oil Mill Effluent (POME) was treated using adsorption technique as a good alternative sustainable management practice of this waste. The adsorbent used is a modified sago waste by grafting technique. Graft polymerization and crosslinking using radiation processing technology are the attractive techniques for modification of chemical and physical properties of polymers. One example of this technique is to produce super adsorbent from agriculture waste, as described in this paper. Super adsorbent polymer from sago waste was prepared using gamma irradiation throughout of this study. The fibre from sago waste mixed with monomer, water soluble polymer and alkaline solution prior to radiation process. Infrared spectroscopy (FTIR) and scanning electron microscopy (SEM) were carried out to confirm the chemical structure and morphology of the super adsorbent. The result obtained showed that this super adsorbent can be used to treat POME. (author)

New Mexico cloud super cooled liquid water survey final report 2009.

Energy Technology Data Exchange (ETDEWEB)

Beavis, Nick; Roskovensky, John K.; Ivey, Mark D.

2010-02-01

Los Alamos and Sandia National Laboratories are partners in an effort to survey the super-cooled liquid water in clouds over the state of New Mexico in a project sponsored by the New Mexico Small Business Assistance Program. This report summarizes the scientific work performed at Sandia National Laboratories during the 2009. In this second year of the project a practical methodology for estimating cloud super-cooled liquid water was created. This was accomplished through the analysis of certain MODIS sensor satellite derived cloud products and vetted parameterizations techniques. A software code was developed to analyze multiple cases automatically. The eighty-one storm events identified in the previous year effort from 2006-2007 were again the focus. Six derived MODIS products were obtained first through careful MODIS image evaluation. Both cloud and clear-sky properties from this dataset were determined over New Mexico. Sensitivity studies were performed that identified the parameters which most influenced the estimation of cloud super-cooled liquid water. Limited validation was undertaken to ensure the soundness of the cloud super-cooled estimates. Finally, a path forward was formulized to insure the successful completion of the initial scientific goals which include analyzing different of annual datasets, validation of the developed algorithm, and the creation of a user-friendly and interactive tool for estimating cloud super-cooled liquid water.

Super-pixel extraction based on multi-channel pulse coupled neural network

Science.gov (United States)

Xu, GuangZhu; Hu, Song; Zhang, Liu; Zhao, JingJing; Fu, YunXia; Lei, BangJun

2018-04-01

Super-pixel extraction techniques group pixels to form over-segmented image blocks according to the similarity among pixels. Compared with the traditional pixel-based methods, the image descripting method based on super-pixel has advantages of less calculation, being easy to perceive, and has been widely used in image processing and computer vision applications. Pulse coupled neural network (PCNN) is a biologically inspired model, which stems from the phenomenon of synchronous pulse release in the visual cortex of cats. Each PCNN neuron can correspond to a pixel of an input image, and the dynamic firing pattern of each neuron contains both the pixel feature information and its context spatial structural information. In this paper, a new color super-pixel extraction algorithm based on multi-channel pulse coupled neural network (MPCNN) was proposed. The algorithm adopted the block dividing idea of SLIC algorithm, and the image was divided into blocks with same size first. Then, for each image block, the adjacent pixels of each seed with similar color were classified as a group, named a super-pixel. At last, post-processing was adopted for those pixels or pixel blocks which had not been grouped. Experiments show that the proposed method can adjust the number of superpixel and segmentation precision by setting parameters, and has good potential for super-pixel extraction.

Unraveling the Thousand Word Picture: An Introduction to Super-Resolution Data Analysis.

Science.gov (United States)

Lee, Antony; Tsekouras, Konstantinos; Calderon, Christopher; Bustamante, Carlos; Pressé, Steve

2017-06-14

Super-resolution microscopy provides direct insight into fundamental biological processes occurring at length scales smaller than light's diffraction limit. The analysis of data at such scales has brought statistical and machine learning methods into the mainstream. Here we provide a survey of data analysis methods starting from an overview of basic statistical techniques underlying the analysis of super-resolution and, more broadly, imaging data. We subsequently break down the analysis of super-resolution data into four problems: the localization problem, the counting problem, the linking problem, and what we've termed the interpretation problem.

Simulation of flanking transmission in super-light structures for airborne and impact sound

DEFF Research Database (Denmark)

Christensen, Jacob Ellehauge; Hertz, Kristian Dahl; Brunskog, Jonas

2012-01-01

. Previously the airborne and impact sound insulation has been measured for a super-light deck element in a laboratory. This paper presents a flanking transmission analysis based on the measured results and are carried out for the Super-light deck elements by means of the acoustical software Bastian...... to design buildings with super-light deck elements while achieving a good acoustical environment in the building, fulfilling various acoustical requirements from the building regulations....

Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

Science.gov (United States)

This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

Directory of Open Access Journals (Sweden)

Cheng-Hong Yang

Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

Science.gov (United States)

Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

2015-06-01

Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparison and flowering valuation of New Guinea Impatiens cultivars from Sonic and Super Sonic groups

Directory of Open Access Journals (Sweden)

Ludmiła Startek

2012-12-01

Full Text Available In the years 2002-2003 the flowering of four New Guinea Impatiens cultivars from Sonic and Super Sonic groups were compared. They were the following cultivars: 'Sonic Pink', 'Sonic Sweet Cherry', 'Super Sonic Cherry Cream' and 'Super Sonic Hot Pink'. The experiments were carried out from the middle of April till the middle of October. Neutralised sphagnum peat with slow release fertiliser Osmocote Plus 5/6 was used as medium. It was found that the cultivar 'Sonic Pink' began blooming 1-4 weeks earlier than the other cultivars. The cultivars 'Sonic Sweet Cherry' and 'Super Sonic Cherry Cream' had significantly more abundant flowering (105.3-113.3 flowers per plant than the cultivars 'Sonic Pink' and 'Super Sonic Hot Pink' (72.0-92.8 flowers per plant. All the cultivars had big flowers (6.3-7.8 cm in diameter. The most similar flowers were found in 'Sonic Sweet Cherry' and the least similar in 'Super Sonic Hot Pink'.

From heavy nuclei to super-heavy nuclei

International Nuclear Information System (INIS)

Theisen, Ch.

2003-01-01

The existence of super-heavy nuclei has been predicted nearly fifty years ago. Due to the strong coulomb repulsion, the stabilisation of these nuclei is possible only through shell effects. The reasons for this fragile stability, as well as the theoretical predictions concerning the position of the island of stability are presented in the first part of this lecture. In the second part, experiments and experimental techniques which have been used to synthesize or search for super-heavy elements are described. Spectroscopic studies performed in very heavy elements are presented in the following section. We close this lecture with techniques that are currently being developed in order to reach the superheavy island and to study the structure of very-heavy nuclei. (author)

Super-light pearl-chain arch vaults

DEFF Research Database (Denmark)