Perancangan Simulasi Operasi Angkutan Batubara Berbasis Web Programming (Studi Kasus: Pendangkalan Di Sungai Barito)

OpenAIRE

Alafi, Jauhari; Hadi, Firmanto; Nugroho, Setyo

2012-01-01

Batubara di PT. ZXC diangkut dari dermaga tambang melalui Sungai Barito menggunakan tongkang untuk kemudian di transitkan ke mother vessel. Kendala yang dialami oleh tongkang adalah ketika musim kemarau level air sungai Barito turun drastis, apalagi di daerah dekat hulu sungai. Pada saat hal itu terjadi, sungai yang biasanya bisa dilewati oleh tongkang hingga kapasitas 5.000 ton, hanya bisa dilewati tongkang tersebut apabila mengurangi muatannya hingga 2.000 ton saja. Bahkan ketika pada kondi...

Stochastic modeling for river pollution of Sungai Perlis

International Nuclear Information System (INIS)

Yunus, Nurul Izzaty Mohd.; Rahman, Haliza Abd.; Bahar, Arifah

2015-01-01

River pollution has been recognized as a contributor to a wide range of health problems and disorders in human. It can pose health dangers to humans who come into contact with it, either directly or indirectly. Therefore, it is most important to measure the concentration of Biochemical Oxygen Demand (BOD) as a water quality parameter since the parameter has long been the basic means for determining the degree of water pollution in rivers. In this study, BOD is used as a parameter to estimate the water quality at Sungai Perlis. It has been observed that Sungai Perlis is polluted due to lack of management and improper use of resources. Therefore, it is of importance to model the Sungai Perlis water quality in order to describe and predict the water quality systems. The BOD concentration secondary data set is used which was extracted from the Drainage and Irrigation Department Perlis State website. The first order differential equation from Streeter – Phelps model was utilized as a deterministic model. Then, the model was developed into a stochastic model. Results from this study shows that the stochastic model is more adequate to describe and predict the BOD concentration and the water quality systems in Sungai Perlis by having smaller value of mean squared error (MSE)

Stochastic modeling for river pollution of Sungai Perlis

Energy Technology Data Exchange (ETDEWEB)

Yunus, Nurul Izzaty Mohd.; Rahman, Haliza Abd. [Department of Mathematical Sciences, Faculty of Science, Universiti Teknologi Malaysia,81310 Johor Bahru, Johor (Malaysia); Bahar, Arifah [UTM-Centre of Industrial and Applied Mathematics (UTM-CIAM) Universiti Teknologi Malaysia, 81310 Johor Bahru, Johor (Malaysia)

2015-02-03

River pollution has been recognized as a contributor to a wide range of health problems and disorders in human. It can pose health dangers to humans who come into contact with it, either directly or indirectly. Therefore, it is most important to measure the concentration of Biochemical Oxygen Demand (BOD) as a water quality parameter since the parameter has long been the basic means for determining the degree of water pollution in rivers. In this study, BOD is used as a parameter to estimate the water quality at Sungai Perlis. It has been observed that Sungai Perlis is polluted due to lack of management and improper use of resources. Therefore, it is of importance to model the Sungai Perlis water quality in order to describe and predict the water quality systems. The BOD concentration secondary data set is used which was extracted from the Drainage and Irrigation Department Perlis State website. The first order differential equation from Streeter – Phelps model was utilized as a deterministic model. Then, the model was developed into a stochastic model. Results from this study shows that the stochastic model is more adequate to describe and predict the BOD concentration and the water quality systems in Sungai Perlis by having smaller value of mean squared error (MSE)

Identifikasi Kemiskinan Air Di Daerah Aliran Sungai Citarum Hulu: Kasus Daerah Bandung Raya

OpenAIRE

Maulani, Nova; Sunardi, S; Sumiarsa, Dadan; Djuwansah, D

2013-01-01

Sungai Citarum termasuk salah satu sungai besar danstrategis di Indonesia kondisinya dalam keadaan sangat kritis.Berbagai aktivitas dengan kurang terkendalinya limbah yang dibuang ke sungaimenyebabkan Sungai Citarum menghadapi berbagai permasalahan yang berdampak padasuplai air baku/bersih bagi penduduk sekitar DAS. Kritisnya tersebut sudah terjadi sejakdari bagian hulu. Sementara itu, pertumbuhan penduduk mendorong meningkatnyakebutuhan air baku untuk keperluan air domestik, pertanian, dan i...

STRATEGI PENGEMBANGAN KAWASAN PETERNAKAN KERBAU RAWA DI KABUPATEN HULU SUNGAI SELATAN

Directory of Open Access Journals (Sweden)

Alpianor Alpianor

2017-05-01

Full Text Available This study aims to: 1 analyze the management of swamp buffalo husbandry in Hulu Sungai Selatan, and 2 formulate the strategies for developing swamp-buffalo husbandry in Kabupaten Hulu Sungai Selatan Regency. The research was conducted in four villages, namely: Desa Bajayau Tengah in Kecamatan of Western Daha, Desa Pandak Daun, Desa Hakurung and Desa Hamayung in Kecamatan Daha Utara, Kabupaten Hulu Sungai Selatan, South Kalimantan province from April to July 2016. To investigate the management of swamp-buffalo husbandry in Kabupaten Hulu Sungai Selatan, a descriptive analysis is used by interviewing the farmers and the government concerning the capacity of farmers, the capacity of facilities, and the capacity of management. To find out the strategies needed in developing swamp-buffalo husbandry in Kabupaten Hulu Sungai Selatan, the combination of strengths, weaknesses, opportunities, threats (SWOT analysis with analytical hierarchy process (AHP was applied. The management of swamp buffalo husbandry in Kabupaten Hulu Sungai Selatan in relation to the existing management capacity has not been implemented properly. The management capacity could be developed through non-formal education, such as training and counseling to farmers through the group of farmers because they were supported by a the capacity of farmers. such as age, experience and business scale which were quite good as well as the improvement of education and the farmer responsibilities; and b the capacity of facilities such as the buffalo grass feed, marketing, pretty good institutions as well as the improved buffalo seeds and the swamp- buffalo stall/latch. The strategies for swamp-buffalo husbandry in Kabupaten Hulu Sungai Selatan recommended the strategy of strengths - opportunities (SO. The strategies that can be done are to increase the population of swamp buffaloes supported by technologies for breeding, feeding, management and marketing and agro-tourism development by empowering

ANALISIS KONSENTRASI LOGAM BERAT TIMBAL (Pb DI MUARA SUNGAI PORONG

Directory of Open Access Journals (Sweden)

Dewi Parawita

2009-10-01

Full Text Available Laut merupakan tempat bermuaranya semua sungai, baik sungai kecil maupun sungai besar. Pembuangan lumpur lapindo ke laut yang di alirkan melalui muara sungai Porong mengandung logam berat, salah satunya yaitu timbal. Konsentrasi timbal yang melebihi baku mutu akan berpengaruh pada efek negatif biota. Tujuan dari penelitian adalah mengetahui konsentrasi timbal di muara sungai Porong. Metode yang digunakan adalah observasi, pengambila sampel dilakukan tiga kali tiap minggu pada waktu pagi hari. Hasil dari penelitian ini diketahui bahwa kondisi fisika kimia perairan antara lain : konsentrasi timbal di muara sungai Porong berada jauh di ambang batas dengan nilai konsentrasi timbal yaitu berkisar antara 0-0,490 mg/l, pH berkisar antara 7,6-7,7, suhu berkisar antara 30-32 0C, salinitas berkisar antara 11,3-12,3 ‰, DO berkisar antara 4,7-5,3 mg/l, dan TSS berkisar antara 482,6-926,6 mg/l. Kata Kunci : Konsentrasi, Timbal (Pb, Muara.  HEAVY METAL CONCENTRATION ANALYSIS OF LEAD (Pb IN PORONG RIVER DELTALapindo mud disposed into the sea which is piped through Porong river estuary contain heavy metals, one of which is lead. Lead concentrations that exceeded the quality standard will have the negative effects to biota. The aim of the study was to determine the concentration of lead in the Porong river estuary. The method used is observation, the samples was taken three times per week in the morning. Results of this research showed that the physical condition of the water chemistry, among others: the concentration of lead in the Porong river estuary was above the threshold value of lead concentrations ranging from 0 to 0.490 mg / l, pH ranging from 7.6 to 7.7, the temperature ranging from 30-32 oC, salinity ranged from 11.3 to 12.3 ‰, DO ranged from 4.7 to 5.3 mg / l and TSS ranged from 482.6 to 926.6 mg / l.Keywords: Heavy metals, Concentration, Lead (Pb, Delta

Perancangan Simulasi Operasi Angkutan Batubara Berbasis Web Programming (Studi Kasus: Pendangkalan di Sungai Barito

Directory of Open Access Journals (Sweden)

Jauhari Alafi

2012-09-01

Full Text Available Batubara di PT. ZXC diangkut dari dermaga tambang melalui Sungai Barito menggunakan tongkang untuk kemudian di transitkan ke mother vessel. Kendala yang dialami oleh tongkang adalah ketika musim kemarau level air sungai Barito turun drastis, apalagi di daerah dekat hulu sungai. Pada saat hal itu terjadi, sungai yang biasanya bisa dilewati oleh tongkang hingga kapasitas 5.000 ton, hanya bisa dilewati tongkang tersebut apabila mengurangi muatannya hingga 2.000 ton saja. Bahkan ketika pada kondisi level air terrendah, tongkang-tongkang tidak bisa melaluinya sama sekali. Berdasarkan hasil simulasi, skenario terbaik bagi PT. ZXC dalam mencapai target penjualan sebesar 2,5 juta ton adalah dengan tetap mengoperasikan seluruh tongkang yang ada pada saat terjadi pendangkalan, meskipun tongkang tidak dapat berlayar dengan muatan penuh. Karena total biaya untuk opsi 1 (tidak ada pengangkutan pada saat sungai dangkal adalah sebesar Rp 81.046.464.410, sedangkan total biaya untuk opsi 2 (ada pengangkutan pada saat terjadi pendangkalan adalah Rp 55.091.040.758.

Beban Pencemaran Limbah Industri Dan Status Kualitas Air Sungai Citarum

OpenAIRE

terangna, nana; yusuf, iskandar a

2002-01-01

Sungai Citarum beserta tiga waduk besar yaitu Saguling Cirata dan Juanda (Jatiluhur) memiliki fungsi ekonomi ekologi dan sosial yang sangat penting bagi masyarakat Jawa Barat dan DKI Jakarta. Potensi yang demikian pentingnya tersebut terancam oleh penurunan kualitas air sungai karena beban pencemaran yang terus meningkat telah melampaui daya tampung sumber air tersebut. Beban pencemaran terbesar berasal dari limbah penduduk dan industri sehingga memerlukan prioritas penanganan utama dalam upa...

BEBAN PENCEMARAN LIMBAH INDUSTRI DAN STATUS KUALITAS AIR SUNGAI CITARUM

OpenAIRE

terangna, nana; yusuf, iskandar a

2011-01-01

Sungai Citarum beserta tiga waduk besar yaitu Saguling Cirata dan Juanda (Jatiluhur) memiliki fungsi ekonomi ekologi dan sosial yang sangat penting bagi masyarakat Jawa Barat dan DKI Jakarta. Potensi yang demikian pentingnya tersebut terancam oleh penurunan kualitas air sungai karena beban pencemaran yang terus meningkat telah melampaui daya tampung sumber air tersebut. Beban pencemaran terbesar berasal dari limbah penduduk dan industri sehingga memerlukan prioritas penanganan utama dalam upa...

PENATAAN TEPIAN SUNGAI CENRANAE DENGAN PENDEKATAN EKOLOGIS DI KOTA SENGKANG

Directory of Open Access Journals (Sweden)

Sri Setianingsih

2015-06-01

Full Text Available Abstrak—Tepian Sungai adalah salah satu ruang kota yang sering dimanfaatkan sebagai wadah untuk beragam aktifitas masyarakat kota. Pemanfaatan tepian sungai sudah banyak mengalami perubahan fisik. Sehingga menyebabkan adanya perubahan nilai lingkungan yang semakin tidak teratur. Sekarang ini banyak kota-kota di Indonesia menerapkan aspek Ekologis sebagai salah satu aspek terpenting dalam sebuah perancangan sebuah ruang kota. Dengan pendekatan ekologis terhadap gagasan konsep perancangan kota yang di terapkan pada tepian Sungai Cenranae di harapkan mampu menjadi ruang kota yang berwawasan lingkungan dan memiliki nilai Eco-Sustainable pada kota Sengkang. Kata Kunci : Ruang Kota, Tepian Sungai, Ekologi Abstract— The banks of the river is one of spaces that is often used as a place for a variety of urban community activities. Utilization of the riverbank has undergone many physical changes. In order to cause a change in the environmental value increasing irregularly. Today many cities in Indonesia applying Ecological aspects as one of the most important aspects in designing of an urban space . With an ecological approach to the idea of urban design concept is applied to the banks of the River Cenranae expected to become environmentally sound urban space and has a value of Eco -Sustainable in Sengkang city Key Word : City Hall, River Bank, Ecology

PENGELOLAAN LIMBAH DOMESTIK BERBASIS KOMUNITAS DI KAWASAN DAERAH ALIRAN SUNGAI TAWING: Studi Kasus Di Kabupaten Trenggalek

Directory of Open Access Journals (Sweden)

Windiani Windiani

2011-06-01

Full Text Available Penelitian tentang pengelolaan limbah domestik berbasis komunitas Di kawasan Daerah Aliran Sungai (DAS Tawing ini didasarkan pada fenomena bencana banjir yang terjadi hampir setiap tahun. Faktor penyebabnya tidak hanya karena faktor alam namun juga disebabkan adanya penurunan daya resap dan pendangkalan sungai di berbagai daerah. Hal ini terkait juga dengan kebiasaan, kesadaran, sikap dan perilaku masyarakat terhadap lingkungan yang masih rendah. Sebagian masyarakat di kawasan daerah aliran sungai Tawing masih membuang limbah domestiknya, baik kotoran maupun sampah rumah tangga ke sungai. Hal ini lebih disebabkan persepsi yang berkembang dalam masyarakat bahwa sungai berfungsi sebagai halaman belakang (backyard sehingga sungai digunakan sebagai tempat pembuangan limbah. Di sisi lain keberadaan komunitas pemuda pecinta lingkungan di daerah di Kabupaten Trenggalek berdampak positif jika peran dan kapasitas komunitas tersebut dikembangkan terutama terkait dengan upaya pemberdayaan masyarakat dalam mengelola limbah domestiknya. Hasil penelitian menunjukkan bahwa pengelolaan limbah domestik yang dilakukan adalah aplikasi 3R (Reuse, Reduce dan Recycle dengan kelompok sasaran: komunitas Ibu rumah tangga, Komunitas Petani, komunitas Guru dan pendamping dan Komunitas pemuda karang taruna. Strategi yang dikembangkan dalam pengelolaan limbah domestik meliputi: Perencanaan dan Program Pengembangan, Penguatan kelembagaan dan Pengembangan jaringan dan kerjasama. Hingga saat ini pengolahan limbah domestik menjadi pupuk organik, larangan meracuni sungai Tawing dan pemberian sanksi kepada masyarakat yang membuang sampah merupakan program yang sudah berjalan, namun dipandang perlu untuk dikembangkan dengan sasaran wilayah yang lebih luas. Sosialisasi secara intens dan pendampingan kepada kelompok sasaran perlu terus dilakukan agar terjadi keberlanjutan program.

MENGENAL ARSITEKTUR LOKAL: KONSTRUKSI RUMAH KAYU DI TEPIAN SUNGAI KAPUAS, PONTIANAK

Directory of Open Access Journals (Sweden)

Lestari .

2016-12-01

Full Text Available Keberadaan sungai Kapuas sebagai sumber kehidupan dan jalur transportasi air, memunculkan permukiman-permukiman di tepian sungai Kapuas.Rumah-rumah yang berada di pemukiman tepian sungai Kapuas umumnya didirikan langsung di tepian sungai Kapuas.Rumah tersebut sebagian besar berupa rumah kayu yang terhubung dengan gertak-gertak sebagai jalur penghubung antar rumah.Konstruksi rumah kayu ini menarik untuk diamati mengingat keadaan tepian sungai perlu diselesaikan oleh bangunan agar tetap bertahan.Tulisan ini memaparkan kontruksi rumah kayu pada salah satu kasus daerah tepian sungai kapuas. Daerah kasus yang diambil adalah Kelurahan Bansir Laut, Kecamatan Pontianak Tenggara, Kota Pontianak.Dalam tulisan ini dipaparkan konstruksi kayu berdasarkan bagian-bagian rumah mulai dari pondasi, rangka, dinding, sampai atap.Terdapat beberapa tipe konstruksi pada kasus yang diteliti.Pertimbangan umum terletak pada kemudahan konstruksi, tampilan atau fasad dan lokasi keberadaan rumah   The existence of the Kapuas river as a source of life and water transportation, led to settlements growth on side the Kapuas river. The houses are located on side Kapuas river are generally directly constructed at the river. The houses  mostly made of wood which connected by wooden bridge as connecting lines between houses. Construction of wooden houseis interesting to be identifiedbecause the building must bedurable with the condition around the river. This paper describes the wooden houses construction in one case area of the Kapuas riverside. Case study is taken at Kelurahan Bansir Laut, South East Pontianak District. In this paper described the wooden construction : the foundation, frame, wall, and the roof. There are several types of construction in the cases studied. General considerations is the ease of construction, appearance or facade and location of the house. REFERENCES Abdurachman., Nurwati Hadjib. (2006. Pemanfaatan Kayu Hutan Rakyat Untuk Komponen Bangunan

Studi Angkutan Sedimen Sudetan Pelangwot-Sedayu Lawas Sungai Bengawan Solo

Directory of Open Access Journals (Sweden)

Chandra Murprabowo Mudjib

2013-12-01

Full Text Available Sungai Bengawan Solo merupakan salah satu sungai terpanjang di Indonesia yang mengalir mulai dari area hulu di Kabupaten Wonogiri dan Ponorogo hingga ke area hilir di Kabupaten Gresik. Perubahan fungsi lahan di area hulu dan peningkatan debit yang melalui Sungai Bengawan Solo membuat banjir terjadi di area hilir sungai yakni di Kabupaten Bojonegoro dan Kabupaten Gresik. Sudetan Pelangwot sepanjang 13 km merupakan saluran yang dibuat untuk mengurangi debit banjir yang terjadi dengan mengalirkannya ke laut Jawa. Namun dikarenakan pendangkalan yang terjadi akibat sedimentasi, kapasitas Sudetan Pelangwot dalam mengalirkan debit menurun. Tugas akhir ini bertujuan untuk menganalisa sedimentasi yang terjadi pada sudetan Pelangwot dengan menggunakan program bantu HEC-RAS 4.1.0 Konsep yang digunakan dalam pengerjaan tugas akhir ini adalah dengan memodelkan Sudetan Pelangwot menggunakan program HEC-RAS 4.1.0 kemudian melakukan simulasi aliran sudetan untuk mengetahui sedimentasi yang terjadi. Dari hasil simulasi yang dilakukan dengan menggunakan program HEC-RAS 4.1.0 diketahui perkiraan volume sedimentasi yang terjadi di sudetan selama musim penghujan dari tanggal 1 Desember 2010 hingga 21 Mei 2011 adalah sebesar 325.030,23 m3. Agradasi terjadi di sebagian besar penampang sudetan sedangkan degradasi hanya terjadi di beberapa titik. Kantong sedimen dapat dibuat sebagai upaya pengendalian sedimen pada dasar saluran sudetan di tiga titik yang berbeda dengan kapasitas total 175.875 m3.Pemeliharaan kantong sedimen dilakukan setiap 3 bulan sekali dengan melakukan pengerukan pada kantong sedimen.

PENGARUH PERILAKU MASYARAKAT YANG BERMUKIM DI KAWASAN BANTARAN SUNGAI TERHADAP PENURUNAN KUALITAS AIR SUNGAI KARANG ANYAR KOTA TARAKAN (Influence of The Behavior of Citizens Residing in Riverbanks to The Decrease of Water Quality in The River of Karang

Directory of Open Access Journals (Sweden)

Ira Puspita

2016-07-01

Full Text Available ABSTRAK Data Status Lingkungan Hidup Daerah Kota Tarakan menyatakan bahwa kualitas air Sungai Karang Anyar Kota Tarakan yaitu parameter COD, amoniak dan TSS tahun 2010-2013 melebihi baku mutu. Penurunan kualitas air tersebut disebabkan oleh perilaku masyarakat yang bermukim di kawasan bantaran sungai. Pendekatan penelitian kualitatif dengan menggunakan gabungan metode kualitatif dan kuantitatif. Metode kuantitatif antara lain digunakan untuk teknik pengumpulan data melalui kuesioner dan menghitung status mutu air Sungai Karang Anyar menggunakan metode Indeks Pencemaran. Metode kualitatif antara lain digunakan untuk observasi, wawancara mendalam kepada swasta dan tokoh masyarakat. Hasil penelitian yaitu perilaku masyarakat yang membuang air limbah domestik langsung ke sungai mempengaruhi parameter COD melebihi baku mutu karena air limbah yang dibuang terdapat busa sabun berasal dari buangan air cucian. Air limbah domestik yang dibuang langsung ke sungai berasal dari sisa memasak sehingga diduga menyebabkan amoniak juga melebihi baku mutu. Perilaku masyarakat yang tidak mengolah kotoran ayam dapat mempengaruhi parameter amoniak melebihi baku mutu karena kotoran ayam membusuk dan mengalir ke sungai. Perilaku masyarakat yang mengambil tanah dari bukit/gunung tidak mempengaruhi parameter TSS karena dipengaruhi mengambil tanah dari bukit/gunung dilakukan pada curah hujan menurun/kemarau. Perilaku masyarakat yang menambang pasir di sungai mempengaruhi parameter amoniak melebihi baku mutu karena air limbah domestik yang organik dan kotoran ayam membusuk yang telah tertimbun lama di dasar sungai akan terangkat. Perilaku masyarakat yang menambang pasir di sungai tidak mempengaruhi parameter TSS karena kegiatan menambang pasir tidak dilakukan setiap hari dan bergantung pada curah hujan. Sebagai kesimpulan adalah tidak semua perilaku masyarakat yang bermukim dan berkegiatan di kawasan bantaran sungai mengakibatkan penurunan kualitas air sungai.   ABSTRACT

HASIL AIR PENGGUNAAN LAHAN HUTAN DALAM MENYUMBANG ALIRAN SUNGAI Water yield of Forest Land Use contributing in river stream

Directory of Open Access Journals (Sweden)

Edy Junaidi

2016-09-01

Full Text Available Pemahaman tentang neraca air suatu penggunaan lahan berkaitan dengan hasil air total yang berkontribusi terhadap aliran sungai. Penelitian ini bertujuan mengkaji peranan hidrologi hutan (hutan alam dan hutan tanaman terhadap aliran sungai  ditinjau dari neraca air dengan membandingkan penggunaan lahan hutan dan penggunaan lahan lain. Penelitian yang mengkaji penggunaan lahan hutan dan penggunaan lahan lain (pertanian, pemukiman, kebun campuran dan semak belukar di DAS Cisadane menggunakan model hidrologi Soil and Water Assessment Toll (SWAT dalam mengkaji neraca air penggunaan lahan. Hasil neraca air tahunan untuk penggunaan lahan hutan berupa nilai yang lebih besar untuk evapotranspirasi dan lebih kecil untuk aliran permukaan dibandingkan pengunaan lahan yang lain. Hal ini berpengaruh terhadap kontribusi aliran permukaan lahan hutan pada aliran sungai. Sedangkan nilai perkolasi dan simpanan air tanah berdasarkan perhitungan neraca air yang lebih besar untuk penggunaan lahan hutan. Hal ini juga berpengaruh terhadap kontribusi aliran lateral dan aliran dasar lahan hutan pada aliran sungai. Kata kunci : Neraca air, aliran sungai dan hutan

X-ray fluorescent analysis on Indo-Pacific glass beads from Sungai Mas archaeological sites, Kedah, Malaysia

International Nuclear Information System (INIS)

Zuliskandar Ramli; Nik Hassan Shuhaimi; Nik Abdul Rahman; Abdul Latif Samian

2011-01-01

Sungai Mas was an ancient port-kingdom located on West Coast of Peninsula Malaysia in a district of Kota Kuala Muda, Kedah, Malaysia. The port-kingdom evolved as an entrepot since fifth century AD and continuously visited by international trader from India, China, Middle East and Europe until eighteenth century AD. Sungai Mas was also one of the Indo-Pacific beads making centers in Southeast Asia since sixth to thirteenth century AD and also produced pottery and brick. X-ray fluorescent analysis (XRF) on Sungai Mas Indo-Pacific beads is carried out to determine whether the glass beads originated from Arikamedu, India or locally made by community in Sungai Mas. Totally, twenty-two samples of beads and beads materials assayed by XRF were chosen. Contents of nine major elements and nine trace elements, which might be present of flux, stabilizer, colorants or opacifier were examined. The elements Si, Na, K, Ca, Fe, Al, Ti, Mn, Mg, Cu, Pb, Zr, Sr, Ba, La, U, Ni and Cr were detectable in all samples. The concentration of elements found are discussed in terms of flux, silica or lead base glass, color and/or opacity of the glass beads and glass samples. The result showed that Sungai Mas produced their own Indo-Pacific beads from sixth to thirteenth century AD. (author)

PENGELOLAAN SUNGAI BERBASIS MASYARAKAT LOKAL DI DAERAH LERENG SELATAN GUNUNGAPI MERAPI (River Management Based on Local Community in the Southern Slope of Marapi Volcano

Directory of Open Access Journals (Sweden)

Darmakusuma Darmanto

2013-07-01

Full Text Available ABSTRAK Dalam kehidupan manusia, ternyata ada hubungan yang saling terkait antara manusia dengan sungai. Manusia memerlukan sungai untuk mendukung keperluan dan aktivitasnya, sebaliknya keberadaan sungai juga dapat dipengaruhi oleh aktivitas manusia. Dalam memanfaatkan dan memelihara sungai tidak terlepas dari pemanfaatan air di dalam sungai dan alur sungainya. Dalam memgelola sungai tidak terpisahkan antara pengelolaan air sungai dan alur sungainya. Hal tersebut juga tergantung dari karakteristik sungai dan kondisi sosial budaya masyarakat. Penelitian yang dilakukan di lereng selatan Gunungapi Merapi dengan cara survei di lapangan. Data dikumpulkan dengan observasi lapangan dan wawancara dengan masyarakat. Selanjutnya dikuti dengan analisis data secara deskriptif kualitatif. Sungai sungai besar di daerah penelitian telah dikelola oleh pemerintah, sedangkan masyarakat lebih berperan kepada pemanfaatan dan pemeliharaan sungai kecil. Berbagai penggunaan dilakukan terhadap sungai-sungai kecil, untuk keperluan rumah tangga, irigasi dan perikanan. Teknik pengambilan dan pemanfaatan air dilakukan dengan cara sederhana dengan beaya yang relatif murah, tetapi tetap mengedepankan azas kebersamaan dan keadilan. Pemeliharaan terhadap alur sungai terhadap kerusakkan lingkungan dilakukan berdasarkan atas kesadaran untuk keberlangsungan lingkungan dengan yang dilakukan secara perorangan dan berkelompok. Dalam pemeliharaan dikedepankan asas kegotongroyongan tanpa mengabaikan budaya masyarakat setempat. ABSTRACT In human life, there was a relationship between human activities with rivers. Humans need rivers to support their need and their activities; otherwise the existence of rivers can also be affected by human activities. The management of river cannot be separated from managing water in the river and its channels. It also depends on rivers characteristics as well as social and culture of the community. This research was conducted in the southern slopes of

Environmental Flow for Sungai Johor Estuary

Science.gov (United States)

Adilah, A. Kadir; Zulkifli, Yusop; Zainura, Z. Noor; Bakhiah, Baharim N.

2018-03-01

Sungai Johor estuary is a vital water body in the south of Johor and greatly affects the water quality in the Johor Straits. In the development of the hydrodynamic and water quality models for Sungai Johor estuary, the Environmental Fluid Dynamics Code (EFDC) model was selected. In this application, the EFDC hydrodynamic model was configured to simulate time varying surface elevation, velocity, salinity, and water temperature. The EFDC water quality model was configured to simulate dissolved oxygen (DO), dissolved organic carbon (DOC), chemical oxygen demand (COD), ammoniacal nitrogen (NH3-N), nitrate nitrogen (NO3-N), phosphate (PO4), and Chlorophyll a. The hydrodynamic and water quality model calibration was performed utilizing a set of site specific data acquired in January 2008. The simulated water temperature, salinity and DO showed good and fairly good agreement with observations. The calculated correlation coefficients between computed and observed temperature and salinity were lower compared with the water level. Sensitivity analysis was performed on hydrodynamic and water quality models input parameters to quantify their impact on modeling results such as water surface elevation, salinity and dissolved oxygen concentration. It is anticipated and recommended that the development of this model be continued to synthesize additional field data into the modeling process.

Cryptosporidium sebagai Indikator Biologi dan Indeks Nsf-Wqi untuk Mengevaluasi Kualitas Air (Studi Kasus: Hulu Sungai Citarum, Kabupaten Bandung

Directory of Open Access Journals (Sweden)

Tastaptyani Kurnia Nufutomo

2017-11-01

Full Text Available Kualitas air yang menurun di Hulu Sungai Citarum dapat disebabkan oleh banyak faktor. Faktor-faktor tersebut dapat diketahui dari parameter fisika, kimia dan biologi. Parameter biologi yang digunakan untuk mengevaluasi kualitas air adalah  mikroorganisme patogen yang menimbulkan penyakit di sistem pencernaan seperti diare akut, yaitu Coliform dan Cryptosporidium. Tujuan penelitian ini adalah untuk mengetahui status kualitas air di Hulu Sungai Citarum dengan indeks kualitas air NSF-WQI, mengetahui hubungan dan pengaruh parameter fisik dan kimia air terhadap parameter biologi, menentukan faktor utama dari parameter air yang paling berpengaruh dan mengetahui hubungan serta pengaruh faktor utama tersebut terhadap Cryptosporidium. Metode yang digunakan adalah  mengambil sampel di tiap stasiun dengan composite, mengidentifikasi dan analisis Coliform dengan MPN dan identifikasi Crytosporidium dengan Ziehl Neelsen staining, kemudian menganalisis parameter kimia dan fisika dengan indeks NSF-WQI, lalu data tersebut diolah menggunakan metode statistik PCA. Hasil pengukuran kualitas air berdasarkan NSF-WQI adalah kualitas air di Hulu Sungai Citarum termasuk kategori buruk dan medium. Keberadaan Cryptosporidium di Hulu Sungai Citarum disebabkan oleh 2 (dua faktor utama, yaitu faktor pertama terdiri dari DO, turbiditas, NO2, NH4 dan total Colifom, sedangkan faktor kedua terdiri dari TSS, COD dan PO4. Kedua faktor tersebut tidak signifikan dengan keberadaan Cryptosporidium di Hulu Sungai Citarum. Kata kunci: Cryptosporidium, Hulu Sungai Citarum, Indeks NSF-WQI, Kualitas Air

COMMUNITY ENGAGEMENT WITH URBAN RIVER IMPROVEMENT: THE CASE OF YOGYAKARTA CITY (Melibatkan Masyarakat dalam Memperbaiki Lingkungan Sungai Perkotaan : Kasus Kota Yogyakarta

Directory of Open Access Journals (Sweden)

Hari Kusnanto

2016-09-01

Full Text Available ABSTRACT The restoration of urban rivers has shifted from predominantly physical and ecological to community oriented social and economic improvement. Community engagement is needed in the people approach of development. Information sharing and public consultation are not enough. A case study among the riverside communities living in Yogyakarta city indicated that these communities need to move out of poverty and destitution through coaching and mentoring by various experts, and at the same time they would assure the ecosystem functioning of urban rivers.   ABSTRACT Restorasi sungai-sungai perkotaan telah bergeser dari peningkatan fisik dan ekologis menjadi lebih berorientasi pada sosial dan ekonomi. Keterlibatan masyarakat dibutuhkan dalam pendekatan manusiawi pembangunan. Pemberian informasi dan konsultasi public tidak cukup studi kasus pada komunitas-komunitas yang hidup di pinggir sungai di kota Yogyakarta menunjukkan bahwa komunitas tersebut perlu mengentaskan diri dari kemiskinan dan keterbelaknagn dengan bantuan ahli, dan pada saat yang sama menjaga fungsi ekosistem sungai-sungai perkotaan.

Analisis Karakteristik Hujan untuk Pendugaan Debit Aliran Rencana Sungai Anafri di Kota Jayapura

Directory of Open Access Journals (Sweden)

Nurfaijin Nurfaijin

2016-10-01

Full Text Available ABSTRAK Penelitian ini bertujuan mengkaji karakteristik hujan wilayah DAS Anafri, menghitung debit aliran rencana, dan mengkaji kapasitas Sungai Anafri dalam merespon pengalihragaman hujan menjadi aliran permukaan. Kajian karakteristik hujan yakni ketebalan, intensitas, dan durasi hujan dilakukan dengan analisis statistik data hujan. Analisis distribusi data hujan diasumsikan sesuai dengan Metode Gumbel, sehingga untuk menentukan hujan periode ulang 2 tahun, 5 tahun, 10 tahun, dan 25 tahun menggunakan persamaan Gumbel. Hujan periode ulang digunakan untuk menghitung debit aliran rencana Metode Rasional. Analisis kapasitas sungai dilakukan dengan membandingkan debit aliran rencana dalam periode ulang T dengan kapasitas sungai. Penghitungan kapasitas sungai dilakukan pada penampang PI (bagian hulu, P2,dan P3 (bagian hilir. Debit aliran rencana yang digunakan dalam analisis kapasitas sungai adalah debit aliran Q25tahun (107,478 m³/detikdan 163,726 m³/detik. Hasil analisis menunjukan bahawa, terjadinya limpasan pada penampang sungai PI dan P2 pada saat menampung debit banjir yang diketahui penyebab utamanya adalah bank full capacity kecil, maka alternat! ( penanganan yang direkomendasikan adalah peninggian tanggul sungai. Analisis kapasitas sungai menggunakan debit banjir periode ulang 25 tahun menunjukan bahwa, terjadi limpasan pada lokasi penampang PI sampai P2 dengan panjang ruas 400 m yang terjadi pada tanggul sisi kanan dan tanggul sisi kiri dengan panjang ruas 40 meter. Limpasan terjadi setinggi 0,1 m hingga 1,6 m pada tanggul sisi kanan dan 0,1 m hingga 0,3 m pada tanggul sisi kiri, sehingga peninggian tanggul yang direkomendasikan adalah setinggi 1,6 mpada sisi kanan dan 0,3 m pada tanggul sisi kiri. ABSTRACT This study aims to examine the characteristics of rainfall watershed of Anafri calculate the flow rate plan, and assess the river capacity to respond diversion of rain to be surface runoff. In this study, the analysis of rainfall

Fatty Alcohol Variations in Surface Sediments of Sungai Sepang Besar, Sepang, Selangor

International Nuclear Information System (INIS)

Masni Mohd Ali; Norfariza Humrawali; Ying, P.Q.; Mohd Talib Latif; Mohamad Pauzi Zakaria

2011-01-01

Composition of fatty alcohols from 19 surface sediment samples collected along Sungai Sepang Besar, Sepang, Selangor were determined. The sediments were extracted and analysed using the Gas Chromatography-Mass Spectrometry (GC-MS) technique. A total of 19 fatty alcohols from C 12 to C 30 including 4 branched compounds were identified with concentrations in the range 0.02 μg/ g - 9.01 μg/ g dry weight. C 26 fatty alcohols dominated most sampling stations with concentrations ranging from 0.29 to 5.43 μg/ g dry weight and constituted 15.5 % of total fatty alcohols. According to individual compounds of fatty alcohols and the [Σ(C 12 - C 20 )/ Σ(C 22 - C 30 )] ratio, Sungai Sepang Besar has a high composition of short-chain fatty alcohols (C 12 - C 20 ) which mainly originate from marine organisms. However, the Alcohol Sources Index (ASI) showed that terrestrial derived fatty alcohols dominated the area due to high concentration of C 26 compounds in most sampling stations. The value of (odd chain length)/ (even chain length) ratios were high for almost all the sampling stations due to high bacterial activities. It can be concluded that the surface sediments of Sungai Sepang Besar contained organic materials from marine, terrestrial and bacterial sources. (author)

PELAKSANAAN PROGRAM CORPORATE SOCIAL RESPONSIBILITY (CSR PT. VIZI UTAMA MANDIRI (VUM DI JORONG SUNGAI KUNYIT, KAB. SOLOK SELATAN

Directory of Open Access Journals (Sweden)

Yesi Herlina

2014-06-01

Full Text Available This article talks about Corporate Social Responsibility (CSR PT. Visi Utama Mandir (PT. VUM. The company is engaged in mining iron ore. This article describes the company's CSR programs implemented, and to describe the impact of CSR programs to the community Jorong Koto Sungai Kunyit subdistrict Sangir Balai Janggo. The approach used in this study is a qualitative approach and descriptive. Determination of informants done Snowbolling Sampling. Collect data through interviews, observation and document study. The results showed that the company's CSR prorgam: the first, physical program, which the company provided assistance to the opening of new roads, road repair help communities, disaster relief, assistance for sports facilities, places of worship aid, and assistance every month. Second, non-physical program: health education and entrepreneurship training. Help the opening of new roads, easier access to public transportation. Help community road improvement, repair roads damaged in a residential area residents Jorong Koto Sungai Kunyit, to meet the public demand for transportation smoothly. Disaster relief, PT. VUM provide assistance such as: issuing machine, giving money, giving them the tools kitchen utensils, and others. Sporting equipments, awarded when a proper sports venues to be renovated in order to better the welfare of society. Help places of worship, giving donations and assistance to local houses of worship, with the aim of increasing public worship and religious knowledge. Help regularly every month, every month the implementation of assistance is provided to all households in Jorong Turmeric and Jorong Koto Sungai Sungai Sungkai, to help meet the basic needs of society Tulisan ini mengulas tentang program Corporate Social Responsibility (CSR PT.VUM. Perusahaan ini bergerak dalam bidang tambang biji besi. Artikel ini mendeskripsikan program CSR yang dilaksanakan perusahaan, serta mendeskripsikan dampak program CSR kepada

Karakter Pemukiman Lahan Basah Abad VI - XV Masehi di Daerah Aliran Sungai (DAS Barito

Directory of Open Access Journals (Sweden)

nfn Sunarningsih

2017-07-01

Full Text Available One of the great rivers that flow in Kalimantan region is Barito River, precisely in the southeast region. Barito drainage basin crosses two different provinces, namely South Kalimantan and Central Kalimantan. Archaeological researches of wetland ancient settlements on Barito Basin are mainly in the downstream area. The result of this research obtained a varied data, such as artifacts, settlement form, and environmental supports. There seemed to be such character differences in each site. Therefore, this article examine the factors that influence the character differences of each wetland site. The research use descriptive analytic, with inductive reasoning. The result shows that there are some characters of wetland residential sites in the Barito basin, which is influenced by the function of site, the mastery of technology, environmental carrying capacity, and the intensity interaction with outside community. Salah satu sungai besar yang mengalir di wilayah Kalimantan adalah Sungai Barito, tepatnya di wilayah Kalimantan bagian Tenggara. Daerah Aliran Sungai Barito melintasi dua wilayah propinsi yang berbeda, yaitu Kalimantan Selatan dan Kalimantan Tengah. Penelitian arkeologi terhadap pemukiman lahan basah (abad ke 6-15 M di Daerah Aliran Sungai Barito berada terutama di daerah hilir. Dari hasil penelitian tersebut didapatkan data yang beragam, baik dari artefak, bentuk pemukimannya, dan lingkungan pendukungnya. Tampaknya ada karakter yang berbeda dari masing-masing situs. Oleh karena itu, tulisanini berusaha untuk mengkaji faktor yang mempengaruhi terjadinya perbedaan karakter dari masing-masing situs di lahan basah tersebut. Metode yang digunakan adalah deskriptif-analisis, dengan penalaran induktif. Hasil penelitian menunjukkan bahwa ada beberapa macam karakter dari situs pemukiman lahan basah di DAS Barito, yang dipengaruhi oleh fungsi situs, penguasaan teknologi, daya dukung lingkungan, dan intensitas terjadinya interaksi dengan masyarakat

Studi Perbandingan Komposisi Asam Lemak Daging Ikan Sidat (Anguilla marmorata (Q. Gaimard Fase Yellow Eel Dari Sungai Palu Dan Danau Poso

Directory of Open Access Journals (Sweden)

Jamaluddin Jamaluddin

2018-04-01

Full Text Available Ikan sidat (Anguilla marmorata (Q. Gaimard memiliki keunggulan gizi atau nutrisi yang tinggi seperti vitamin A, vitamin B, vitamin C, vitamin D, vitamin E, protein, mineral, dan asam lemak yang baik bagi kesehatan. Penelitian ini bertujuan untuk menentukan kadar asam lemak, dan membandingkan komposisi asam lemak dari ikan sidat fase yellow eel asal sungai Palu dan danau Poso. Penelitian ini menggunakan metode kromatografi gas dengan mengubah ekstrak lemak menjadi metil ester asam lemak. Hasil analisis komposisi asam lemak daging ikan sidat (Anguilla marmorata (Q. Gaimard fase yellow eel asal sungai Palu dan Danau Poso menunjukan kadar asam lemak jenuh masing-masing 2,766g/100g dan 0,275g/100g; asam lemak tak jenuh tunggal 4,029g/100g dan 0,276g/100g; dan asam lemak tak jenuh ganda 0,541g/100g dan 0,102g/100g. Terdapat perbedaan secara statistik (p<0.05 komposisi dan kadar asam lemak antara daging ikan sidat fase yellow eel asal sungai Palu dan danau Poso. Komposisi asam lemak ikan sidat fase yellow eel asal sungai Palu dan danau Poso masing-masing adalah 23 dan 18 jenis. Asam lemak yang ditemukan pada daging ikan sidat sungai Palu dan tidak ditemukan pada ikan sidat danau Poso adalah asam heneikosenoat, asam miristoleat, Cis-10-pentadekanoat, asam gamma linoleat, dan Cis-11,14,17-eikosatrinoat.

AKUMULASI CADMIUM (CD PADA IKAN WADER MERAH (PUNTIUS BRAMOIDES C.V, DI SUNGAI KALIGARANG

Directory of Open Access Journals (Sweden)

R. Prabowo

2016-11-01

Full Text Available Kadmium merupakan bahan beracun yang menyebabkan keracunan kronik pada manusia, maka tingkat maksimun yang diperbolehkan di perairan adalah 0,01 mg/L (PP No 82 Th 2001 Tentang Kualitas Air. Penelitian ini bertujuan (1 mengidentifikasi gambaran umum kualitas air Sungai Kaligarang, (2 Mengidentifikasi konsentrasi logam berat Kadmium (Cd di Sungai Kaligarang, serta (3 mengidentifikasi akumulasi logam berat Cd pada ikan wader merah (Puntius bramoides C.V yang hidup di Sungai Kaligarang. Penelitian ini merupakan penelitian observasi eksploratif dengan pendekatan kuantitatif yang bertujuan untuk menggambarkan kandungan logam berat Cd pada air dan ikan wader merah di Sungai Kaligarang. Penentuan lokasi pengambilan sampel secara purposif sampling. Hasil penelitian menunjukkan bahwa parameter lingkungan berupa Suhu, pH, BOD, DO di Sungai Kaligarang tidak melebihi baku mutu berdasarkan mutu air penggolongan kelas I. Parameter logam berat Cd dalam air tidak melebihi aturan yang ditetapkan PP Nomor 82 Th 2001 tentang Pengelolaan Kualitas Air dan Pengendalian Pencemaran Air. Kadar logam berat yang terkandung pada ikan wader merah masih berada di bawah baku mutu yang ditetapkan baik dari FDR New Zealand, FAO, Serta SNI. 7387.2009, Tentang Batas Maksimum Cemaran logam Berat Dalam Pangan.Cadmium is a toxic substance that causes chronic poisoning in humans and the maximum permissible level in the water is 0.01 mg / L. (Th Government Regulation No. 82 of 2001 on water quality. This study aimes to (1 identify general description of Kaligarang water quality, (2 heavy metalconcentrations of Cadmium (Cd in Kaligarang river and (3 identifying Cd accumulation of heavy metal in red Wader fish. This research is an observational exploration with a quantitative approach that aims to describe the level of heavy metal Cd in water and wader in Kaligarang. The location is determined by sampling study with purposive sampling. The result shows that the environmental parameters

Water Quality and Heavy Metal Concentrations in Sediment of Sungai Kelantan, Kelantan, Malaysia: A Baseline Study

International Nuclear Information System (INIS)

Ahmad, A.K.; Mushrifah, I.; Mohamad Shuhaimi Othman

2009-01-01

A study on water quality and heavy metal concentration in sediment at selected sites of Sungai Kelantan was carried out. Ten water samples were collected along the river for physical and chemical analysis and twenty-six water and sediment samples were collected for heavy metal analysis. Water was sampled at three different dates throughout the study period whereas sediments were collected once. In addition to heavy metal analysis, sediment samples were also analysed for texture, ph and organic content. The physical and chemical water quality analyses were carried out according to the ALPHA procedures. Result of water quality analysis (physico-chemical) indicated that Sungai Kelantan is characterised by excellent water quality and comparable to pristine ecosystems such as the National Park and Kenyir Lake. This river was classified into class I - class III based on Malaysian interim water quality standard criteria (INWQS). Heavy metals Pb, Zn, Cu and Cd was detected at low concentration in sediment samples, except for Fe and Mn. The presence of Fe and Mn in sediment samples was though to be of natural origin from the soil. Anthropogenic metal concentrations in sediment were low indicating that Sungai Kelantan has not experienced extreme pollution. (author)

POLA PENGELOLAAN SANITASI DI PERKAMPUNGAN BANTARAN SUNGAI CODE, YOGYAKARTA (Pattern of Sanitation Management in Code Riverside Settlements, Yogyakarta

Directory of Open Access Journals (Sweden)

Atyanto Dharoko

2005-11-01

Full Text Available ABSTRAK Bantaran Sungai Code merupakan wilayah pusat kota Yogyakarta yang dipenuhi oleh perkampungan padat penduduknya. Sistem kehidupan masyarakat kampung bantaran Sungai Code sudah terintegrasi dengan kehidupan sosial ekonomi masyarakat kota Yogyakarta. Permasalahan yang muncul adalah rendahnya kualitas intrastruktur terutama fasilitas sanitasi karena kendala terbatasnya kemampuan ekonomi masyarakat dan bentuk topograti yang terjal. Akhirnya sungai merupakan tujuan pembuangan akhir limbah sanitasi lingkungan tanpa proses terlebih dahulu. Penelitian ini menyimpulkan bahwa pola sanitasi komunal lebih dapat diterima oleh masyarakat dari pertimbangan sosial, ekonomi dan kondisi lingkungan yang terjal. Di masa mendatang sistem ini perlu dijadikan dasar pengembangan teknis sistem sanitasi bantaran sungai untuk memperoleh sustainability yang tinggi.   ABSTRACT Code riverside is part of central business district in Yogyakarta composed by densely populated kampungs. Community way of life in the kampungs have been successfully integrated with social-economic of the urban community. The crusial problem faced by the community is lack of infrastructure facilities especially sanitation. This situation is very much related to social-economic constraints of the community and topographical situation as fisical constraints. Finally, sanitation disposals have to be discharged into Code River without pre processing. The study concludes that communal sanitation system becomes the most acceptable system based on socio-economic and topographical constraints. In the future communal sanitation system may become a basic technical considerations to develop sanitation system in the riverside settlements and to achieve sustainability.

Iktiofauna Sungai Sangkir Kabupaten Rokan Hulu Provinsi Riau (Ichthyofauna of Sangkir River, Rokan Hulu District Riau Province

Directory of Open Access Journals (Sweden)

Nunuk Dian Pranata

2016-12-01

Full Text Available This study was conducted in Sangkir river branch of Rokan Kiri river Sangkir village, Rokan Hulu district, Riau Province from May of July 2016. The aim of this study was to inventory the fish species in Sangkir river branch of Rokan Kiri River with direct observation (survey. Five sampling locations were determined purposely based on the environmental condition that could be represented by the river condition. A total of 288 individuals of fish belonging to 3 orders, 7 families, 13 genera and 16 species were recorded in this study, namely Barbodes balleroides, Barbodes gonionotus, Barbichthys leavis, Channa striata, Cyclocheilichthys apogon, Labiobarbus fasciatus, Mystus nigriceps, Ompok eugeneiatus, Osteochilus hasseltii, Osteochilus mycrocephalus, Pangio semicincta, Pristolepis grooti, Thynnichthys polylepis, Trichogaster leerii, Trichogaster trichopterus and Trichopsis vittata. Cyprinidae was the most abundance fish in this study. Penelitian ini telah dilaksanakan di sungai Sangkir, anak sungai Rokan Kiri, desa Sangkir, Kabupaten Rokan Hulu, Provinsi Riau pada bulan Mei sampai Juli 2016. Penelitian ini bertujuan untuk mengetahui jenis-jenis ikan di sungai Sangkir anak Sungai Rokan Kiri dengan metode pengamatan langsung (survei dengan penetapan stasiun pengambilan sampel secara purposive sampling. Penetapan stasiun berdasarkan kondisi lingkungan yang terdiri dari 5 stasiun penelitian. Hasil penelitian  didapatkan sebanyak 288 individu ikan yang terdiri dari 3 ordo, 7 famili 13 genus dan 16 spesies. Spesies yang didapatkan yaitu Barbodes balleroides, Barbodes gonionotus, Barbichthys leavis, Channa striata, Cyclocheilichthys apogon, Labiobarbus fasciatus, Mystus nigriceps, Ompok eugeneiatus, Osteochilus hasseltii, Osteochilus mycrocephalus, Pangio semicincta, Pristolepis grooti, Thynnichthys polylepis Trichogaster leerii, Trichogaster trichopterus dan Trichopsis vittata. Cyprinidae merupakan kelompok ikan yang paling banyak dalam penelitian ini.

Water and suspended sediment dynamics in the Sungai Selangor estuary

International Nuclear Information System (INIS)

Abdul Kadir Ishak; Kamarudin Samuding; Nazrul Hizam Yusoff

2000-01-01

Observations of salinity, temperature, suspended sediment concentration (SSC) and tidal current velocity were made in the lower and along the longitudinal axis sungai Selangor estuary over near-spring cycles. The variations of these parameters at the measurement stations and along the channel are presented to illustrate the water and sediment dynamics in the estuary. The results shows that the Sungai Selangor estuary changes from a partially-mixed type during neaps to a well-mixed one during springs. promoted by stronger tidal energy during the higher tidal ranges. The strong neap density stratification is also promoted by the high river discharges during the measurement period maximum concentration of suspended sediment 2000 mg,'/) occurs during maximum current velocities both during flood and ebb. The maximum salinity was achieved during high water slack but the salt water was totally flushed out of estuary during low water springs. The longitudinal axis measurement indicates that a partially-developed zone of turbidity maximum with a sediment concentration over 1000 mg/l was observed at the limit of salt water intrusion in salinity range less than 1 ppt. Tidal pumping as oppose to the estuarine circulation is the more dominant factor in the maximum formation as the salt water is totally excluded at low water. (author)

Identifying Resistivity Anomalies of Sungai Batu Ancient River using 3D Contour Map

Science.gov (United States)

Yusoh, R.; Saad, R.; Saidin, M.; Muhammad, S. B.; Anda, S. T.; Ismail, M. A. M.; Hazreek, Z. A. M.

2018-04-01

Electrical resistivity method was undertaken at archeological site at Sungai Batu in Lembah Bujang, located at Sungai Merbok in northwestern of Malaysia. The survey was implemented near the excavation site. This paper shows the results of 5 ground resistivity survey line was carry out using SAS4000 equipment. The wenner-schlumberger array was applied for measurement. Resistivity data are used to obtain valuable information to identify the remain buried archeology. The ground resistivity data were presented in contour map for various depth by using Surfer 13 software visualized clearly the anomalies evidenced for every single depth section. The results from the survey has found the appearance of sedimentation formation that believe happen long time ago after ancient river was buried by sediment from weathering process due to increasing sea level. Otherwise, another anomaly was found in the middle of the survey area which shows high resistivity value about 1000 – 2000 ohm.m

DAMPAK LINGKUNGAN PEMANFAATAN ALUR SUNGAI DI KALI BOYONG, KALI KUNING DAN KALI GENDOL (Environmental Impact of Utulization River Courses in Boyong River, Kuning River and Gendol River

Directory of Open Access Journals (Sweden)

Darmakusuma Darmanto

2011-07-01

Full Text Available ABSTRAK Penelitian ini merupakan sebagian dari hasil studi Program Doktor (S3 pada lokasi penelitian di Kali Boyong, Kali Kuning dan Kali Gendol yang merupakan sungai yang secara periodik merupakan jalur limpahan material sedimen yang berasal dari aktivitas Gunungapi Merapi. Sehingga muncul permasalahan: (a dampak erupsi terhadap fungsi alur sungai sebagai tempat menyimpan, mengalirkan dan memanfaatkan air pada wilayah yang padat penduduk dan (b pemanfaatan alur sungai untuk kegiatan penambangan sirtu dan pertanian, sehingga perlu dikembangkan model pengelolaan lingkungan alur yang dapat meminimalkan dampak yang terjadi, sehingga fungsi alur sungai tetap optimal. Metodologi yang digunakan adalah metoda survei dengan cara melakukan pengamatan lingkungan dan pengukuran profil penampang sungai, pengambilan sampel material sedimen yang kemudian dianalisis di laboratorium mengenai diameter butir, berat jenis dan warna, wawancara kepada masyarakat penambang di sekitar wilayah penelitian pada setiap penggal sungai, pengambilan gambar dengan menggunakan foto-digital dan pengumpulan data sekunder. Data yang telah dikumpulkan kemudian dianalisis secara deskriptif pada setiap sungai dan antar sungai dengan pendekatan ekologis dan spasial. Berdasarkan kajian hasil dan pembahasan yang diperoleh dalam penelitian ini dan sesuai dengan tujuan penelitian yang ingin dicapai, maka dapat ditarik kesimpulan sebagai berikut: (a Mendasarkan pada pendekatan ekologis subDas antara hulu-tengah-hilir dan antar subDas kondisi geometrik dari faktor-faktor fisik maupun biotik relatif sama antara Kali Boyong dan Kali Gendol/ Opak sedangkan untuk Kali Kuning agak berbeda karena merupakan “lokasi antara” perpindahan waktu aktivitas Gunungapi Merapi; dan (b Pemanfaatan alur sungai oleh masyarakat sekitar lokasi maupun usaha pemerintah daerah menimbulkan gangguan kelancaran penyimpanan dan penyaluran air sungai pada alurnya dari hulu ke hilir, kegiatan tersebut adalah

SEBARAN KANDUNGAN LOGAM BERAT Cd PADA SEDIMEN DI MUARA SUNGAI WAY KUALA BANDAR LAMPUNG

Directory of Open Access Journals (Sweden)

Diky Hidayat

2012-05-01

Full Text Available Penelitian penentuan penyebaran konsentrasi logam berat Cd pada sedimen di muara sungai Way Kuala telah dilakukan. Tujuan penelitian ini adalah untuk melihat penyebaran konsentrasi logam berat pada sedimen di muara tersebut. Konsentrasi Cd ditentukan dengan menggunakan spektrofotometer serapan atom (SSA, dengan menggunakan empat validasi metode yaitu batas deteksi, presisi, akurasi, dan linieritas. Hasil menunjukkan bahwa konsentrasi logam berat Cd dalam sampel sedimen di hulu, badan, dan hilir dari muara sungai Way Kuala berada dalam kisaran 20.73 ± 0.18 sampai 23.00 ± 0.81 ppm diatas kualitas standar sedimen (0.65 sampai 2.49 ppm yang telah ditetapkan oleh National Sediment Quality Survey USEPA pada tahun 2004. Validasi metode pada penentuan logam berat Cd dalam sedimen menunjukkan presisi dengan nilai simpangan baku relatif lebih kecil dari 5% (RSD <5%; akurasi 80-120%; batas deteksi dan koefisien korelasi pada logam Cd sebesar 0.01 dan 0.998.

KELIMPAHAN FITOPLANKTON DAN KONSENTRASI TSS SEBAGAI INDIKATOR PENENTU KONDISI PERAIRAN MUARA SUNGAI PORONG

Directory of Open Access Journals (Sweden)

Ulung Jantama Wisha

2016-11-01

Full Text Available Pembuangan limbah dan lumpur ke Sungai Porong diduga akan berdampak bagi lingkungan sekitarnya, khususnya meningkatnya konsentrasi padatan tersuspensi (TSS dan mempengaruhi sebaran fitoplankton di wilayah tersebut. Tujuan dari dilakukannya penelitian ini adalah untuk mengetahui konsentrasi muatan padatan tersuspensi, kekeruhan dan kelimpahan fitoplankton di perairan muara Sungai Porong, Kabupaten Sidoarjo. Metode penelitian yang digunakan adalah metode deskriptif. Data yang dikumpulkan sebagai variabel ukur adalah muatan padatan tersuspensi, kekeruhan, kelimpahan fitoplankton dan kecepatan serta arah arus. Variabel pendukung meliputi data pasang surut dan peta bathimetri wilayah muara Sungai Porong. Data yang diperoleh selanjutnya dianalisis menggunakan program Arc GIS 10, sehingga menghasilkan output berupa distribusi spasial. Konsentrasi muatan padatan tersuspensi 542-885 mg/l. konsentrasi kekeruhan 3.7-20.5 NTU. Kelimpahan fitoplankton 153-238 ind/l. Berdasarkan data tersebut dapat diketahui bahwa sebaran muatan padatan tersuspensi dan kekeruhan memiliki kaitan dengan kelimpahan fitoplankton pada saat surut, meskipun pada kuantitas yang tidak selalu sama. Arah sebaran bergerak ke arah Timur atau menjauhi muara sungai. ABUNDANCE OF PHYTOPLANKTON AND TSS VALUE AS AN INDICATOR FOR PORONG RIVER ESTUARY WATER CONDITIONSDisposal of waste and mud into Porong River is expected to have an impact to the surrounding environment, particularly the increasing concentration of suspended solids (TSS and affect the distribution of phytoplankton in the region. The purpose of this study was to determine the correlation between the concentration of TSS and abundance of phytoplankton as an indicator for determinate condition of Porong River Estuary. Determining the location of sampling by purposive sampling method. The data were then analyzed with statistical methods and spatially using ArcGIS 10 program. The concentration of suspended solids charge 542-885 mg

PENGARUH FLUKTUASI TINGGI MUKA AIR TERHADAP HASIL TANGKAPAN IKAN DI SUNGAI DAN RAWA MAHAKAM HULU KALIMANTAN TIMUR

Directory of Open Access Journals (Sweden)

Kamaluddin Kasim

2015-12-01

Full Text Available Beberapa penelitian menyebutkan bahwa fluktuasi tinggi muka air (TMA dapat mempengaruhi hasil tangkapan ikan di perairan sungai dan rawa namun tidak terhadap semua jenis ikan.  Penelitian ini dilakukan dengan tujuan untuk mengetahui hasil tangkapan jenis ikan sungai dan rawa sungai Mahakam yang mendapat pengaruh fluktuasi TMA dan jenis ikan yang tidak mendapatkan pengaruh langsung oleh fluktuasi TMA. Data mengenai hasil tangkapan ikan yang berasal dari alat tangkap pancing dan jaring diperoleh melalui enumerator di Tempat Pendaratan Ikan (TPI Selili Kota Samarinda pada periode 2007-2012, sedangkan nilai rata-rata Tinggi Muka Air (TMA DAS Mahakam secara bulanan diperlukan sebagai salah satu faktor yang diduga berpengaruh terhadap hasil tangkapan beberapa jenis ikan sungai dan rawa. Data dianalisis dengan metode regresi linear sederhana dan penentuan perbedaan hasil tangkapan pada musim hujan, peralihan dan kemarau dilakukan dengan Analysis of Variance (ANOVA. Hasil penelitian menunjukkan bahwa jumlah hasil tangkapan ikan berkorelasi kuat (r=0,7 terhadap Tinggi Muka air (TMA dengan arah hubungan negatif atau berkebalikan, yakni semakin tinggi nilai TMA maka hasil tangkapan semakin rendah. Jenis ikan sungai dan rawa seperti patin, nila, sepat siam (Trichogaster pectoralis, lais dan betok (Anabas testudineus merupakan jenis ikan yang hasil tangkapannya dipengaruhi secara signifikan (P0,05 oleh fluktuasi TMA.   Some studies have showed that water level fluctuation may have a significant correlation to the catch of several commercial fish target in inland fishery and does not influence directly the cath of some commercial fish. This study aimed to determine which species are directly influenced and such species not inluenced by water level fluctuation for its catches. Catch data obtained from hand line and gill net are recorded by enumerators at Fish Landing Sites of Selili, Samarinda during the period of 2007-2012, while the data of surface water

Modelling the Solid Waste Flow into Sungai Ikan Landfill Sites by Material Flow Analysis Method

Science.gov (United States)

Ghani, Latifah A.; Ali, Nora'aini; Hassan, Nur Syafiqah A.

2017-12-01

The purpose of this paper is to model the material flow of solid waste flows at Kuala Terengganu by using Material Flow Analysis (MFA) method, generated by STAN Software Analysis. Sungai Ikan Landfill has been operated for about 10 years. Average, Sungai Ikan Landfill receive an amount around 260 tons per day of solid waste. As for the variety source of the solid waste coming from, leachates that accumulated has been tested and measured. Highest reading of pH of the leachate is 8.29 which is still in the standard level before discharging the leachate to open water which pH in between 8.0-9.0. The percentages of the solid waste has been calculated and seven different types of solid waste has been segregated. That is, plastics, organic waste, paper, polystyrene, wood, fabric and can. The estimation of the solid waste that will be end as a residue are around 244 tons per day.

Remote Sensing for Mapping RAMSAR Heritage Site at Sungai Pulai Mangrove Forest Reserve, Johor, Malaysia

International Nuclear Information System (INIS)

Hasmadi, I.M.; Pakhriazad, H.Z.; Norlida, K.

2011-01-01

The Sungai Pulai Mangrove Forest Reserve (SPMFR) is the largest reverin mangrove system in Johore. In 2003 about 9,126 ha of the Sungai Pulai mangrove was designated as a RAMSAR site. RAMSAR sites are wetland areas that are deemed to have international importance and are included in the List of Wetlands of International Importance. The SPMFR plays a significant socio-economic role to the adjacent 38 villages. Satellite remote sensing is a useful source of information where it provides timely and complete coverage for vegetation mapping especially in mangroves where the accessibility is difficult. This study was carried out to identify and map land cover types using SPOT-4 imagery at the Sungai Pulai-RAMSAR site and its surrounding areas. Through unsupervised classification technique a total of seven classes of land cover type were mapped, where about 90 % mapping accuracy was gained from the accuracy assessment. Later, vegetation densities were classified into five levels namely very high, high, medium, low and very low based on crown density scale using vegetation indices model such as NDVI, AVI and OSAVI. Results from NDVI and OSAVI model were almost similar but AVI model detected more on medium vegetation which did not show the real ground condition. The study concludes that SPOT-4 imagery was able to discriminate mangrove area clearly from other land covers type. Vegetation indices model can be used as a tool for mapping vegetation density level in the SPMFR and its surrounding area. Therefore VIs models from remote sensing are useful to monitor and manage the mangrove forest for sustainable management and preserve the SPMFR as a RAMSAR site in Peninsular Malaysia. (author)

AKUMULASI KROMIUM (Cr PADA DAGING IKAN NILA MERAH (Oreochromis ssp. DALAM KARAMBA JARING APUNG DI SUNGAI WINONGO YOGYAKARTA

Directory of Open Access Journals (Sweden)

RI Handayani

2015-07-01

Full Text Available Sungai Winongo merupakan salah satu sungai penting di Yogyakarta, karena berperan dalam menunjang dan memenuhi kebutuhan hidup masyarakat sekitarnya. Tujuan penelitian ini adalah mengetahui kandungan logam berat kromium (Cr pada air dan daging ikan nila merah di Sungai Winongo Yogyakarta serta mengetahui kelayakannya untuk dikonsumsi. Penelitian menggunakan rancangan eksplorasi dengan metode survai, dengan penetapan pengambilan sampel menggunakan teknik Purposive Random Sampling. Metode analisis uji kandungan logam berat Cr pada air dan ikan nila merah menggunakan AAS. Konsentrasi Cr pada air di Sungai Winongo Yogyakarta adalah 0,0213 mg/L, nilai ini masih berada di bawah ambang batas yang sudah ditetapkan PPRI No. 82 Tahun 2001 yakni  sebesar 0,05 mg/L. Pada ikan nila merah diketahui akumulasi tertinggi pada stasiun 1 sebesar 10,2265 mg/Kg; kemudian pada stasiun 3 dan 2 sebesar 9,81075 mg/Kg dan 9,2245 mg/Kg. Nilai ini melebihi baku mutu yang sudah ditetapkan oleh Dirjen POM 1989 yakni sebesar 2,5 mg/Kg. Simpulan dari penelitian ini adalah kandungan Cr dalam air masih di bawah ambang batas. Ikan nila merah di sungai Winongo sudah mengakumulasi Cr di atas ambang batas, sehingga tidak layak konsumsi.Winongo river is one of the important rivers in Yogyakarta because this supports and fulfils the people’s needs. The purpose of this study was to determine the heavy metal content of Cr in water and red tilapia fish meat captured in Winongo Yogyakarta and to know whether the meat is edible or not. The study design was used exploration design with survey method, in which the determination of sampling was using purposive random sampling. Method of test analysis of heavy metals Cr in water and red tilapia was using AAS. Chromium concentration in water of Winongo river was 0.0213 mg/l, this value remains below the threshold set by PPRI No. 82 year 2001 which was 0.05 mg/L, the highest accumulation of Cr in red tilapia meat was at station 1 i.e. 10

Identification of Sungai Batu Sediment using 2-D Resistivity Imaging and Seismic Refraction Methods for Ancient River Mapping at Kedah, Malaysia

Science.gov (United States)

Andika, F.; Saad, R.; Saidin, M. M.; Muztaza, N. M.; Amsir

2018-04-01

Sungai Batu is an earliest civilization in Southeast Asia with evidenced by the discovery of riverside jetty, iron smelting, and ritual monuments. The evidences can lead to prediction of buried river caused by geological and sedimentation process. This study was conducted to study sediment deposit characteristic and to map thickness of the sediments using 2-D resistivity imaging and seismic refraction for ancient river mapping. A total of thirty, 2-D resistivity and nine seismic survey lines were conducted at the study area. Four of the lines R1-R4 and S1-S4 were correlated and validated with existing on site boreholes BH1-BH4 to identify sediment type and thickness. The validated values applied to the remaining survey lines which no borehole record to map the subsurface of the study area. Based on the results, Sungai Batu area consist of clay with resistivity value of 6.6-25.9 Ω.m and velocity value of 716.9-1606.9 m/s; sandy clay with resistivity value of 6-265.1 Ω.m and velocity value of 1003.6-1901.4 m/s; while shale was identified with resistivity value of >668.6 Ω.m and velocity value of >2051.7 m/s. Boundary between clay/sandy clay with shale was identified with resistivity value of 314 Ω.m and velocity value of 1822 m/s. The integration of the 2-D resistivity and seismic refraction identified that the thickness of Sungai Batu sediment is 0-150 m and Sungai Batu ancient river was successfully map based on thickness of sediment which is >45 m.

Interpretasi Struktur Bawah Tanah pada Sistem Sungai Bribin dengan Metode Geo

Directory of Open Access Journals (Sweden)

Khafidh Nur Aziz

2016-09-01

Full Text Available This research was aimed to determine the distribution pattern of magnetic field anomaly and to identify the lithology of underground structure in Bribin Karst using geomagnetic method. Research location was Semanu Sub-district, Gunungkidul Regency at UTM coordinate of 464061 mT-464929 mT and 9111097 mU-9111970 mU. The data were taken using G-5 Proton Precession Magnetometer (PPM by looping method. The result showed that the distribution pattern of the magnetic field anomaly in Karst Bribin has value of 330 nT - 530 nT and anomaly values reflecting the system of Bribin River has value of 400 nT-460 nT. The lithology of underground structure in Karst Bribin has susceptibility value of -0.069 (in SI - 0.0661 (in SI with depth 200 m associated with limestone, tuff, gypsum, rock salt, and minerals calcite and anhydrite and the lithology associated with the system of Bribin River has susceptibility value -0.069 (in SI associated with gypsum, rock salt, and minerals anhydrite.

Macrobenthos composition, distribution and abundance within Sungai Pulai estuary, Johor, Malaysia

Science.gov (United States)

Shi, Guan Wan; Min, Lee Di; Ghaffar, Mazlan Abd; Ali, Masni Md; Cob, Zaidi Che

2014-09-01

Macrobenthos are very useful organisms for monitoring marine environmental and widely use in marine ecology research. They are able to monitor the difference phase in the recovery stage of disturbed sites by appear different species macrobenthos after the cessation of the impact. Univariate and multivariate methods were use to study the macrobenthos community within Sungai Pulai estuary, Johor, Malaysia. Five sub-samples were taken at each sampling sites by using 10 cm diameter corer. Crustaceans were the most abundant at Tanjung Adang (St. 1) and the station of non-seagrass area (St. 2) while polychaetes were the most abundant at Merambong Shoal (St. 3). Higher density of macrobenthos was found at St.3 followed by St. 1 and St. 2. The commonly used population indices such as diversity, richness, evenness and dominance were employed to determine the differences in diversity and abundance of macrobenthos. The diversity, richness and evenness index values showed slight increment from Station 1 to Station 3, while the dominance index decreasing trend from Station 1 to Station 3. A total 21 polychaete families were collected in Sungai Pulai estuary, which was dominated by the Spionidae, Capitellidae and Glyceridae. Cluster (Bray-Curtis similarities) analyses revealed that the Tanjung Adang and Merambong Shoal population were clearly separated from the station non-seagrass. For the time being factors that influence the pattern of distribution of the macrobenthos cannot be determined and subjected to further studies.

Peran Perempuan dalam Perencanaan Keluarga Responsif Gender Berbasis Agama di Desa Mulyo Rejo Kecamatan Sungai Lilin Kabupaten Musi Banyuasin

Directory of Open Access Journals (Sweden)

Rina Antasari

2016-12-01

Full Text Available Tulisan ini judul “Peran Perempuan Dalam Perencanaan Keluarga Responsif Gender Berbasis Agama Di Desa Mulyo Rejo Kecamatan Sungai Lilin Kabupaten Musi Banyuasin”. Diawali dari hasil observasi dan pemikiran tentang perlunya dilakukan pengkajian lebih mendalam tentang hukum keluarga dalam kaitannya dengan hubungan relasi gender dalam keluarga pada masyarakat Desa Mulyo Rejo Kecamatan Sungai Lilin. Agar tujuan PAR tercapai yakni: (1 agar terwujudnya keluarga yang responsive gender yakni keluarga yang telah memperhatikan kebutuhan keluarga tanpa adanya diskriminasi, (2 adanya perubahan dan perilaku/tindakan sosial langsung yang bermula dari keluarga, (3 penambahan pengetahuan mengenai situasi keluarga yang responsif gender yang terencana dan penambahan kemampuan bagi dampingan untuk mengubah situasi mereka mewujudkan keluarga yang responsif gender berbasis agama, maka program aksi riset ini dilakukan dengan menggunakan strategi dan langkah-langkah PAR. Sebagaian kecil warga dampingan sudah mulai menerapkan pengetahuan mengenai perencanaan keluarga responsif gender berbasis agama dalam keluarga mereka terutama melalui peran isteri bersama suami. This paper entitled "The Role of Women in Responsive Gender of Family Planning Based on Religion in Mulyo Rejo Village Sungai Lilin Musi Banyuasin". Starting from the observation and thought about the need to do much broader about family law in relation to gender relationships within the family in society of Mulyo Rejo village in Sungai Lilin. For the purpose of PAR achieved as follows: (1 for the realization of the family that has responsive gender, i.e families who have noticed the family's needs without discrimination, (2 the changes and behavioral / social action directly originate from the family, (3 the addition of knowledge concerning the family situation on responsive gender planned and the addition of capabilities for assistance to change their situation embodies responsive gender in family based

Measuring a Level of Water Pollution in Sungai Pinang Using a Mathematical Model

OpenAIRE

Mahamud, Mohd Amirul; Ramasamy, Rajasegeran

2013-01-01

Mathematical models are now a popular tool in many applications such as physics, economics and engineering; and provide useful information for decision making and planning. Water pollution in Malaysia has reached a level that needs attention and intervention from environmental department and government. In order to make a strong case, this paper has done a study on measuring the pollution level of Sungai Pinang which is located in Penang Island, Malaysia. Advection-Dispersion equation is one ...

Penerapan Pembelajaran Model Kooperatif Tipe Think-Pair-Share Dalam Materi Usaha Dan Energi Ditinjau Dari Gender Siswa Kelas Xi Ipa Sma Negeri 1 Sungai Ambawang

Directory of Open Access Journals (Sweden)

Ira Nofita Sari

2016-09-01

Full Text Available Penelitian ini bertujuan untuk mengetahui penerapan pembelajaran model kooperatif tipe think-pair-share dalam materi usaha dan energi ditinjau dari gender siswa kelas XI IPA SMA Negeri 1 Sungai Ambawang. Adapun variabel dalam penelitian ini adalah hasil belajar siswa laki-laki dan hasil belajar siswa perempuan. Metode yang digunakan dalam peneltian ini adalah metode eksperimen dan bentuk penelitian eksperimen yang digunakan adalah Pre-Eksperimental Designs dengan rancangan penelitian The One-Shot Case Study.Sampel yang digunakan ialah kelas XI IPA 1 yang diambil secara purposive sampling.. Teknik pengumpul data yang digunakan dalam penelitian ini adalah teknik pengukuran dengan alat pengumpul data berupa tes yang berbentuk essay. Berdasarkan hasil analisis data penelitian diperoleh kesimpulan: (1 Rata-rata hasil belajar siswa laki-laki yang diajarkan model pembelajaran kooperatif tipe think-pair-share dalam materi usaha dan energi siswa kelas XI IPA SMA Negeri 1 Sungai Ambawang mencapai KKM (72 dengan nilai signifikansi lebih besar dari taraf signifikansi 5% (0,715 > 0,05. (2 Rata-rata hasil belajar siswa perempuan yang diajarkan model pembelajaran kooperatif tipe think-pair-share dalam materi usaha dan energi siswa kelas XI IPA SMA Negeri 1 Sungai Ambawang mencapai KKM (72 dengan nilai signifikansi lebih besar dari taraf signifikansi 5% (0,185 > 0,05. (3 Terdapat perbedaan antara rata-rata hasil belajar siswa laki-laki dengan rata-rata hasil belajar siswa perempuan yang diajarkan model pembelajaran kooperatif tipe Think-Pair-Share dalam materi usaha dan energi siswa kelas XI IPA SMA Negeri 1 Sungai Ambawang dengan nilai signifikansi lebih besar dari taraf signifikansi 5% (0,101 > 0,05.

DISTRIBUSI, KELIMPAHAN DAN VARIASI UKURAN LARVA IKAN DI ESTUARIA SUNGAI MUSI

Directory of Open Access Journals (Sweden)

Eko Prianto

2016-03-01

Full Text Available Penelitian tentang distribusi, kelimpahan dan ukuran larva ikan dilakukan pada bulan Maret, Mei, Juni dan Oktober 2011. Stasiun pengambilan contoh meliputi Muara Delta Upang (stasiun 1, Muara Sungai Musi (stasiun 2 dan Pulau Payung (stasiun 3. Pengambilan larva pada siang hari menggunakan Bongo net yang berukuran mata jaring 250 µm. Hasil identifikasi diperoleh 13 famili ditinjau menurut musim, pada bulan Mei dan Oktober masing-masing diperoleh 7 famili, dan pada bulan juni sebanyak 3 famili. Kelimpahan larva ikan berkisar antara 9-46 ind/m3 dengan jumlah yang tertinggi (46 ind/m3 pada bulan Mei dan terendah pada bulan Juni (9 ind/m3. Larva ikan dari famili Gobiidae memiliki sebaran yang cukup luas baik spasial maupun temporal. Variasi ukuran larva ikan menurut famili setiap bulannya memiliki variasi ukuran yang hampir sama.  Research about the distribution, abundance and size of fish larvae was conducted in March, May, June and October 2011. Sampling stations encompasses Delta Upang (station 1, Muara Sungai Musi (station 2 and Pulau Payung (station 3. Larvae taken during the daytime using a Bongo net with mesh size of 250 µm. Identification results obtained 13 families based on the season, in May and October respectively 7 families, and in June as many as 3 families. Abundance of fish larval around 9-46 ind/m3 with the highest number (46 ind/m3 in May and the lowest in June (9 ind/m3. Larvae of Gobiidae family have a large distribution on spatial and temporal. The variation in size of fish larvae by family on each month are the same.

Composition and Sources of Fatty Alcohols in Estuarine Sediments of Sungai Kapar, Selangor

International Nuclear Information System (INIS)

Norfariza Humrawali; Kwan, Y.L.; Mohd Talib Latif; Masni Mohd Ali; Mohamad Pauzi Zakaria

2010-01-01

A total of 13 fatty alcohols (C 12 - C 24 ) including six branched compounds have been identified in seven surface sediment samples taken from Sungai Kapar, Selangor using computerized gas chromatography-mass spectrometry (GC-MS). Generally 65 % of total fatty alcohols determined were short chain compounds (C 12 - C 20 ) derived from marine organisms, 14 % were long chained compounds (C 21 - C 24 ) input of terrestrial plants and the rest were branched compounds from bacterial activity. C 16 compound dominated all the sampling stations with concentrations ranged from 29.69 to 164.35 μgg -1 dry weight which constitute 32 % of total fatty alcohols. Short chain/long chain fatty alcohols ratio [Σ(C 12 - C 20 )/ Σ(C 21 - C 22 )] of each sampling stations had the value >1; indicating high content of short chain compounds from marine sources. Meanwhile, Alcohol Source Index (ASI) calculated using C 22 / C 14 and C 22 / C 16 ratios. C 22 / C 14 ratio showed that stations Kp1, Kp2, Kp5 and Kp6 had a value >1 indicating the amount of C 22 was higher than C 14 . Ratio of C 22 / C 16 showed that all the sampling stations dominated by C 16 compared to C 22 . The estuary of Sungai Kapar, Selangor was dominated by short chain fatty alcohols (C 12 - C 20 ) especially C 16 compound rather than long chain fatty alcohol (C 21 - C 24 ). (author)

Sedimentation rate in the Sungai Linggi estuary using excess 210Pb and 137Cs

International Nuclear Information System (INIS)

Zal U'yun Wan Mahmood; Mei Wo Yii

2013-01-01

The purpose of this study was to estimate the sedimentation rate in the Sungai Linggi estuary using the constant initial concentration of unsupported or excess 210 Pb model and verified with 137 Cs method. Five sediment cores were collected on 25 January 2011 using gravity corer with the inner tube of 50 cm length and 7.5 cm diameter. The total 210 Pb activities in the sediment cores profile at all sampling stations were varied and upper than those obtained for supported 210 Pb i.e. 226 Ra, indicated disequilibrium among 210 Pb and its grandparents in the 238 U decay series. Meanwhile, the lower 137 Cs activities were observed at all sampling stations due to no significant sources of 137 Cs releases were transferred into Malaysian marine. The estimation of sedimentation rate indicated the agreement of 210 Pb and 137 Cs method with a general presence of deep mixing in the Sungai Linggi estuary. Therefore, the apparent sedimentation rates calculated from 210 Pb profiles generally reflect the true value with the range from 0.70 to 1.97 cmyr -1 . High sedimentation rate was observed at some sampling stations which are located in river channel, estuary and closer to mainland. This suggested that land-use development, agriculture activities, channelization etc. introduced a large amount of sediment loaded into those areas. (author)

Characteristics and Outcomes of Patients with Anterior Circulation Intracranial Aneurysm Managed with Clipping in Hospital Sungai Buloh.

Science.gov (United States)

Ab Ghani, Ailani; Nayan, Saiful Azli Mat; Kandasamy, Regunath; Rosman, Azmin Kas; Ghani, Abdul Rahman Izani

2016-11-01

The annual incidence of intracranial aneurysm in Malaysia is estimated to be 1.1-1.7 per 100,000 population based on a study done conducted in 1988. Since then, little epidemiological research has been conducted in Malaysia, and the real incidence is therefore probably unreported despite advancements in the diagnosis and treatment of this disorder. Intracranial aneurysm may be treated by microsurgical clipping or embolisation depending on its location and the surgeon's preference. This study aims to report the characteristics and outcomes of patients with a clipped anterior circulation aneurysm in Hospital Sungai Buloh. We retrospectively collected the data of patients with anterior circulation aneurysms who underwent clipping from 1 January 2013 until 30 June 2014 in Hospital Sungai Buloh. The mean age of the patients was 48.9 years old, and 56.7% of the study population were male and 63.3% were Malay. There were almost equal numbers of patients with (46.7%) and without (53.3%) co-morbidities such as hypertension and ischaemic heart disease. Half of the study population fell under Fisher grade 3 (50.0%), whereas 46.7% were Fisher grade 4. With respect to the Navarro score, 20% of patients scored 10, 16.7% scored 5 or 7, 13.3% scored 11, 10% scored 9, 6.7% scored 1 and 3.3% scored 2, 3 or 8. Most of the patients fell under grade I (33.3%) of the World Federation of Neurological Societies grading (WFNS), and the fewest number of patients were grade III (3.3%). Most (56.7%) patients had an intracranial aneurysm located at the anterior communicating artery (ACOM), followed by the anterior cerebral artery (ACA) and the middle cerebral artery (MCA) (16.7% each), the posterior communicating artery (PCOM) (6.7%) and, finally, the internal carotid artery (ICA) (3.3%). Neurological outcomes at three and six months were assessed using the Modified Rankin Scale (mRS). At three months follow-up, the majority of the participants (33.3%) scored 0 or 6, whereas at six months

AKUMULASI MERKURI PADA IKAN BAUNG (Mytus nemurus DI SUNGAI KAHAYAN KALIMANTAN TENGAH (The Accumulation of Mercure on Baung Fish (Mytus nemurus in The Kahayan Rice of Central Kalimantan, Indonesia

Directory of Open Access Journals (Sweden)

Adventus Panda

2015-01-01

Full Text Available ABSTRAK Sungai Kahayan di Kalimantan Tengah mengalami tekanan lingkungan karena adanya limbah merkuri yang berasal dari aktivitas penambangan emas tradisional. Di tempat tersebut terdapat 10a4 tempat penambangan emas sepanjang sungai dari hulu sampai hilir. Merkuri dalam sedimen sungai secara berturut-turut mengalami metilasi (methylation oleh reduksi sulfat bakteri. Riset ini merupakan studi akumulasi merkuri (FIg dalam Mytus nemurus, sedimen dan air, dari hulu ke hilir di sungai Kahayan. Total jarak dari hulu sekitar 296 km. Data dikumpulkan dari 3 lokasi sepanjang sungai. Dalam tiap lokasi tapak sampling berada di dataran baniir (floodplain. Penelitian dilaksanakan selama musim hujan. lkan ditangkap menggunakan rengge (gillnet. Penentuan metil merkuri digunakan metode modified CV-AAS (cold vapor atomic absorption spectrophotometry. Hasil penelitian menunjukkan bahwa diantara sample yang diukur, akumulasi tertinggi masing-masing berada dalam sedimen sungai (0,336 mg. dikutip dengan daging M. numerus (0,303 mg.g-1 + 0.342. dan air (0.058 mg-1. Merkuri memiliki tendensi meninggi menuju hilir. Hal ini disebabkan oleh tekstur sedimen yang didominasi oleh silt. Kondisi ini berpotensi untuk metilasi. Turbiditas, arus, dan pH menyumbangkan kenaikan tingkat merkuri di hilir. Asupan merkuri mingguan yang dapat ditoleransi menurut WHO adalah 171,42 mg adalah sama dengan 24,4 mg sehari jika seseorang mengkonsumsi 100 g daging M. numerus sehari. dimungkinkan bahwa akan ada 30,3 mg.g-1 yang masuk ke tubuh. Hal ini berarti bahwa merkuri disepanjang sungai Kahayan mengancam penduduk yang mengkonsumsi ikan dari sungai tersebut.   ABSTRACT The Kahayan River of Central Kalimantan had environmental stress due to mercury waste. This waste came from the traditional gold mining activities. There were 1014 gold mining sites along the river from upstream to downstream. Mercury in river sediment was subsequently methylated by sulfated reduction bacteria. This

APLIKASI MODEL QUAL2Kw UNTUK MENENTUKAN STRATEGI PENANGGULANGAN PENCEMARAN AIR SUNGAI GAJAHWONG YANG DISEBABKAN OLEH BAHAN ORGANIK (Aplication of Qual2Kw Model to Determine the Strategy in Solving Gajahwong River Water Pollution Caused by Organic Matter

Directory of Open Access Journals (Sweden)

Agnes Dyah Novitasari Lestari

2013-11-01

Full Text Available ABSTRAK Telah dilakukan pemodelan kualitas air terhadap Sungai Gajahwong menggunakan model QUAL2Kw untuk parameter DO-BOD. Diselidiki dinamika DO-BOD sungai tersebut pada kondisi eksisting tahun 2011. Oleh karena beban pencemar pada kondisi hujan dan tanpa hujan berbeda, maka prediksi dilakukan pada kedua kondisi tersebut. Hasil pemodelan QUAL2Kw untuk kondisi eksisting Sungai Gajahwong tahun 2011 menunjukkan bahwa pada kondisi hujan dan tanpa hujan, konsentrasi BOD sungai telah melebihi bakumutu air kelas II. Hasil simulasi menunjukkan bahwa (1 Pembangunan perumahan yang membuang limbah cairnya ke Sungai Gajahwong pada debit total 0,1 m3/s dengan konsentrasi BOD 10 mg/L dapat meningkatkan BOD serta menurunkan DO Sungai Gajahwong, dan (2 Pengelolaan kualitas air dan penanggulangan pencemaran air oleh bahan organik pada Sungai Gajahwong dapat dilakukan dengan strategi pembuatan IPAL komunal di setiap kabupaten dengan penurunan konsentrasi BOD hulu hingga 2 mg/L.   ABSTRACT Water quality modelling of Gajahwong River has been done using QUAL2Kw model for DO-BOD parameters. The dynamics of DO-BOD of the river on the existing conditions in 2011 has been investigated. Because of  the load of pollutants in the rainy condition and no rain condition was different, then the predictions made on both conditions. QUAL2Kw modelling results for Gajahwong River in year 2011 showed that the BOD concentration of the river on both conditions has exceeded water quality standards class II. The simulation results showed that: (1 Housing construction that discharge its liquid waste into Gajahwong River on total discharge 0,1 m3/s with concentration of BOD 10 mg/L, increased the BOD and decreased the DO of Gajahwong River, and (2 Water quality management and organic pollution control of Gajahwong River can be done by a strategy of making communal WWTP in each district with reduction of the upstream BOD concentration to 2 mg /L.

Risk factors for typhoid outbreak in Sungai Congkak Recreational Park, Selangor 2009.

Science.gov (United States)

Anita, S; Amir, K M; Fadzilah, K; Ahamad, J; Noorhaida, U; Marina, K; Paid, M Y; Hanif, Z

2012-02-01

Typhoid fever continues to pose public health problems in Selangor where cases are found sporadically with occasional outbreaks reported. In February 2009, Hospital Tengku Ampuan Rahimah (HTAR) reported a cluster of typhoid fever among four children in the pediatric ward. We investigated the source of the outbreak, risk factors for the infection to propose control measures. We conducted a case-control study to identify the risk factors for the outbreak. A case was defined as a person with S. typhi isolated from blood, urine or stool and had visited Sungai Congkak recreational park on 27th January 2010. Controls were healthy household members of cases who have similar exposure but no isolation of S. typhi in blood, urine or stool. Cases were identified from routine surveillance system, medical record searching from the nearest clinic and contact tracing other than family members including food handlers and construction workers in the recreational park. Immediate control measures were initiated and followed up. Twelve (12) cases were identified from routine surveillance with 75 household controls. The Case-control study showed cases were 17 times more likely to be 12 years or younger (95% CI: 2.10, 137.86) and 13 times more likely to have ingested river water accidentally during swimming (95% CI: 3.07, 58.71). River water was found contaminated with sewage disposal from two public toilets which effluent grew salmonella spp. The typhoid outbreak in Sungai Congkak recreational park resulted from contaminated river water due to poor sanitation. Children who accidentally ingested river water were highly susceptible. Immediate closure and upgrading of public toilet has stopped the outbreak.

UPAYA PENCEGAHAN DAN PENANGGULANGAN PENCEMARAN AIR AKIBAT PENAMBANGAN EMAS DI SUNGAI KAHAYAN

Directory of Open Access Journals (Sweden)

Mrs. Heriamariaty

2012-02-01

Full Text Available The absence of Public Mining Area and continued use of mercury is responsible for the illegal gold mining and water pollution in Kahayan river. Efforts must be made to avoid and overcome environmental impact by strengthening coordination in central and regional level; empowering local community; and imposing sanction as law enforcement method. Belum adanya Wilayah Pertambangan Rakyat serta penggunaan merkuri mendorong terjadinya penambangan emas tanpa izin dan pencemaran air di Sungai Kahayan. Untuk mencegah dan menanggulangi pencemaran ini diperlukan koordinasi di tingkat pusat dan daerah; penyuluhan dan pendekatan di bidang sosial, ekonomi, budaya, hukum, dan teknologi; serta penegakan hukum secara tegas melalui penerapan sanksi.

Strategic Planning of small and medium industries. Case study: Hulu Sungai Selatan Regency, South Borneo Province

Science.gov (United States)

Elya, N.; Shoimah, F.; Kartika, A. P.; Sukanto, A. B.

2017-06-01

Hulu Sungai Selatan Regency has a potential of SMI (Small and Medium Industries) sectors can be developed as economic development. Based on RTRW of Hulu Sungai Selatan Regency, the region has 14 SMI are a propeller, pottery, blacksmith, dried fish, purun webbing, pastries, dodol, crackers, imitation jewelry, woven water hyacinth, bamboo, syrup, brown sugar, and saber. There are several issues related to SMI development such as low quality and quantity of human resources, local raw material, limited capital, low competitiveness, conventional production equipment, and lack of media for marketing the product. The purpose of this study is to develop the leading sectors of SMI and improve the economy and quality of the resident. The research method is descriptive qualitative, leading sectors analysis and force field analysis. Data were obtained from primary and secondary survey of relevant institutions and interview to the community. Based on leading sectors analysis, there is six leading sector is a propeller, blacksmith, dodol, dried fish, pottery, and crackers. Based on force field analysis, determined the strategy for using operational excellence’s concept, so that we can develop the industrial sector by minimizing productions cost so SMI’s product can compete by the price and efficient production process.

A Baseline Measure of Tree and Gastropod Biodiversity in Replanted and Natural Mangrove Stands in Malaysia: Langkawi Island and Sungai Merbok

Science.gov (United States)

Hookham, Brenda; Shau-Hwai, Aileen Tan; Dayrat, Benoit; Hintz, William

2014-01-01

The diversities of mangrove trees and of their associated gastropods were assessed for two mangrove regions on the west coast of Peninsular Malaysia: Langkawi Island and Sungai Merbok. The mangrove area sampled on Langkawi Island was recently logged and replanted, whereas the area sampled in Sungai Merbok was part of a protected nature reserve. Mangrove and gastropod diversity were assessed in four 50 m2 (10 × 5 m) sites per region. The species richness (S), Shannon Index (H’) and Evenness Index (J’) were calculated for each site, and the mean S, H’ and J’ values were calculated for each region. We report low tree and gastropod S, H’ and J’ values in all sites from both regions. For Langkawi Island, the mean S, H’ and J’ values for mangrove trees were S = 2.00±0, H’ = 0.44±0.17 and J’ = 0.44±0.17; the mean S, H’ and J’ values for gastropods were S = 4.00±1.63, H’ = 0.96±0.41 and J’ = 0.49±0.06. In Sungai Merbok, the mean S, H’ and J’ values for mangrove trees were S = 1.33±0.58, H’ = 0.22±0.39 and J’ = 0.22 ±0.39; the mean S, H’ and J’ values for gastropods were S = 4.75±2.22, H’ = 1.23±0.63 and J’ = 0.55±0.12. This study emphasises the need for baseline biodiversity measures to be established in mangrove ecosystems to track the impacts of anthropogenic disturbances and to inform management and restoration efforts. PMID:25210584

Integration of Magnetic and Geotechnical methods for Shallow Subsurface Soil Characterization at Sungai Batu, Kedah, Malaysia

Science.gov (United States)

Samuel, Y. M.; Saad, R.; Muztaza, N. M.; Saidin, M. M.; Muhammad, S. B.

2018-04-01

Magnetic and geotechnical methods were used for shallow subsurface soil characterization at Sungai Batu, Kedah, (Malaysia). Ground magnetic data were collected along a survey line of length 160 m long at 2 m constant station spacing, while soil drilling using hand auger was conducted at 21 m on the survey line using 0.2 m sampling interval drilled to a depth of 5 m. Result from the processed magnetic profile data shows distribution of magnetic residuals in the range of -4.55 to 1.61 nT, with magnetic low (-4.55 nT to -0.058 nT) and were identified at distances 4 m, 10 to 16 m, 20 to 26 m, 58 m, 82 m, 104 to 106 m, 118 m, and 124 to 140 m. The magnetic lows are attributes of sediments. The result from the soil drilling shows sticky samples with variable sizes, greyish to brownish / reddish in colour, and some of the samples show the presence of shiny and black spots. The characteristics of the samples suggest the soil as a by-product of completely weathered rock; weak with high water content and classified as Grade V soil. The study concludes; integration of geophysical and geotechnical methods aided in characterizing the subsurface soil at Sungai Batu. The result was correlated with previous studies and confirms the importance of integrated approach in minimising ambiguity in interpretation.

Community-Based Rural Tourism in Inter-Organizational Collaboration: How Does It Work Sustainably? Lessons Learned from Nglanggeran Tourism Village, Gunungkidul Regency, Yogyakarta, Indonesia

Directory of Open Access Journals (Sweden)

Asnawi Manaf

2018-06-01

Full Text Available In recent years, socio-economic disparities, especially between rural and urban areas (Gini index up to 0.4 have attracted significant concern from the Government of Indonesia, which developed a community-based rural tourism program as one of the attempts to overcome this problem. Though the program seems quite promising, the implementation was challenging, especially regarding sustainability. Therefore, successful and sustainable practical examples are needed. This paper analyzes the results of a case study from the experiences of community-based tourism implementation in Nglanggeran Tourism Village, Gunungkidul Regency, Yogyakarta, Indonesia, which was considered as successful and sustainable. The main focus of this research is on how the collaboration and involvement of the related inter-organizational stakeholders, initiated by the local community, particularly the youth, has contributed to the program sustainability. Data and information for this study were obtained through in-depth interviews, observation, and documents review. This study found that the local community has a major role in implementing the program, among those various entities of stakeholders. Hence, the paper states this is the key to the success and sustainability of the program.

IMPACT ON ECONOMIC SECTOR DEVELOPMENT TO POTENTIAL CONFLICT IN DELTA MAHAKAM FPMU (PRODUCTION AND SUNGAI BERAM HITAM FPMU (PROTECTION

Directory of Open Access Journals (Sweden)

Sylviani

2017-12-01

Full Text Available Regional economic growth is determined by the potential of existing natural resources, including for fisheries and mining. The development of the two sectors also opens up potential for conflict with other sectors. The aim of the study is to determine the role of the sectors and the impact of economic growth to potential conflict in the research area. This research was conducted at Delta Mahakam Forest Production Management Unit (FPMU and Sungai Beram Hitam Forest Protection Management Unit (FPMU . Base sector approach was conducted to determine the superior sector by Location Quotient (LQ using GDP variable. The results showed that at Delta Mahakam, mining sector was the dominant, and the second largest was fisheries with LQ ≥1. While at the Sungai Beram Hitam fisheries sector was the dominant sector, and the mining sector was non base since its value ≤1. Process of forest area utilization for mining in Jambi was done through leasing of forest lands, but not in East Kalimantan. Conflict resolution between mining and fisheries sector with community was done through compensation. FMU status and position can be enhanced by granting authority on the leasing of forest area for strategic sector development and national interests.

Pemberdayaan Ekonomi Rakyat Berbasis Pesantren di Kabupaten Hulu Sungai Utara

Directory of Open Access Journals (Sweden)

Surya Supi

2015-11-01

Full Text Available Pesantren are widely spread in Indonesia reaching to the most remote areas, hence have the potential to empower people’s economy. Pesantren are involved in fostering self sufficiency among its members as well as the general society, which makes them a potential capital for empowering people’s economy. Using the integrity and capacity to mobilize resources. Pesantren are an important source in effort to increase community production and productivity. The study focused on two Pesantren Nurul Fajri of pesantren and Kholidiyah of pesantren located in Hulu Sungai Utara Regency, as example to evaluate the interchange and interactive between Islamic institutes / school and society. Society benefit from the existence of pesantren through various services and products of its business unit which contribute to solving their economic problems, contribute to community capital through the nurturing and promoting of cooperatives and employment. In addition, in the context capacity development, pesantren education contributes to community rejuvenation and society development, instill values and norm of hardworking, diligence, commitment, which vital for harmonious human existence, self actualization, and development.

DISTRIBUSI PARASIT USUS PROTOZOA DI KABUPATEN HULU SUNGAI UTARA KALIMANTAN SELATAN

Directory of Open Access Journals (Sweden)

Anorital Anorital

2012-07-01

Full Text Available The intestinal infection disease caused by protozoa: amoeba is one of the public health problem with high incidence in the community. From the research activity conducted in Hulu Sungai Utara Regency in the year 2002, to obtain of prevalence of protozoa infection from stool examination from resident in 6 villages at 3 subdistrict in Hulu Sungai Utara Regency. The research has conducted to be carry out survey parasite to the community. Sample size will be examination are 230 persons per village, so that to 6 villages will be examed as 1.600 persons. The examination directly by using lugol 2% and checked on the microscope with magnification 10x10 and 10x40. For resident which its sample stool is positive the protozoa to be given a treatment by metronidazol. From stool examination result obtained prevalence resident which are positive the amoeba intestine protozoa is Entamoeba coli 19,8%, Endolimax nana 15,8%, and Entamoeba histolityca 15,4%. While prevalence resident which are positive the intestine flagellata/B. hominis is Blastocystis hominis 25,5% and Giardia lamblia 11,6%. From 5 micro-organism on the intestine. Entamoeba histolityca, Blastocystis hominis and Giardia lamblia are cause diarrhoea because having the pathogenic. From survey ot socio-cultural, known also the resident percentage which drinking no safe water 43,3%, source of drinking water obtained from river or swamp is 67,7%, human waste disposal in river and swamp is 79,5%, and take a bath and brush the teeth with water of river and swamp is 78,6%; showing bad condition of environmental sanitation, personal hygiene, and life behavior. Good personal hygiene and environmental sanitation practices are the major factors of this disease prevention. The main principle to prevent the spreading of protozoa infection is to cut off the link of infection sources to human beings. Personal hygiene is focused on the management of individual behaviour, meanwhile environmental sanitation

Correlation of Self Potential and Ground Magnetic Survey Techniques to Investigate Fluid Seepage in Archaeological site, Sungai Batu, Lembah Bujang, Kedah, Malaysia

OpenAIRE

Tajudeen O. Adeeko; Nordiana M. Muztaza; Taqiuddin M. Zakaria; Nurina Ismail

2018-01-01

One of the substantial of geophysics is to investigate the subsurface condition of the earth (groundwater) using appropriate geophysical techniques. In this research the correlation of self potential (SP) and ground magnetic methods was used to investigate fluid seepage in Archaeological site, Sungai Batu, Lembah Bujang, Kedah, Malaysia. Self-potential method was used to determine flow of water, and Ground magnetic method was used to find object that can influence the result of self potential...

Pengembangan Transportasi Sungai Kota Semarang Sebagai Transportasi Perintis Tujuan Wisata Air (Studi Kasus Kanal Banjir Barat Kota Semarang

Directory of Open Access Journals (Sweden)

Ismiyati Ismiyati

2016-12-01

Full Text Available Perkembangan pariwisata di kota Semarang ditandai dengan tersedianya fasilitas shuttle bus gratis. Rute shuttle bus tersebut melewati rute Kuliner Pekunden, Pusat oleh-oleh Pandanaran, Gedung Lawang Sewu dan Daerah Kota Lama Semarang.Sejak tahun 2012, wisata di tepi Sungai Kanal Banjir Barat mulai dikembangkan pemerintah Kota Semarang. Namun, sampai saat ini Kanal Banjir Barat hanya difungsikan sebagai sungai pengendali banjir, sehingga fungsi pariwisatanya belum optimal seperti objek wisata lain di Kota Semarang. Tujuan dari penelitian ini adalah untuk mengembangkan transportasi wisata air, khususnya di Kanal Banjir Barat. Penelitian ini menggunakan metode deskriptif dengan kuesioner dan observasi lapangan. Metode kuantitatif penentuan alur pelayaran menggunakan analisis hidrologi dan simulasi hidrolika sungai dengan program HEC-RAS. Penelitian ini merekomendasikan bahwa lokasi pengembangan transportasi untuk wisata air di Kanal Banjir Barat akan efektif jika berada diantara Bendung Simongan hingga muara Kanal Banjir Barat. Tipe angkutan wisata yang ideal adalah menggunakan 2 kapal speedboat terbuka dengan dimensi panjang 8 m, lebar 2,2 m, dan draft 0,4 m. Biaya Operasional Kapal per tahun untuk 8 trip per hari dan biaya pengelolaannya adalah sebesar Rp 901,2 juta dengan estimasi tarif per orang sebesar untuk Rp 17.070,- per trip.  [Title: River Transportation Development of Semarang City for Water Tourism: A Case Study West Flood Canal] Tourism development of Semarang city is identified by the facilities of free shuttle bus. The shuttle bus service passes through Pekunden culinary route, a central souvenir of Pandanaran, Lawang Sewu and Old City of Semarang. Since 2012, local government has developed riverside tourism object of the West Flood Canal Semarang. However, until then the West Flood Canal only was functioned as flood control. Thus, the tourism function is not optimum as other tourism attractions in Semarang city. This research aims

Correlation of Geophysical and Geotechnical Methods for Sediment Mapping in Sungai Batu, Kedah

Science.gov (United States)

Zakaria, M. T.; Taib, A.; Saidin, M. M.; Saad, R.; Muztaza, N. M.; Masnan, S. S. K.

2018-04-01

Exploration geophysics is widely used to map the subsurface characteristics of a region, to understand the underlying rock structures and spatial distribution of rock units. 2-D resistivity and seismic refraction methods were conducted in Sungai Batu locality with objective to identify and map the sediment deposit with correlation of borehole record. 2-D resistivity data was acquire using ABEM SAS4000 system with Pole-dipole array and 2.5 m minimum electrode spacing while for seismic refraction ABEM MK8 seismograph was used to record the seismic data and 5 kg sledgehammer used as a seismic source with geophones interval of 5 m spacing. The inversion model of 2-D resistivity result shows that, the resistivity values 500 Ωm as the hard layer for this study area. The seismic result indicates that the velocity values 3600 m/s interpreted as the hard layer in this locality.

A population based survey on knowledge and awareness of breast cancer in the suburban females of Sungai Petani, Kedah, Malaysia

OpenAIRE

Mirza Rafi Baig; Vikneswari Subramaniam; Annaliza Anusha Chandrasegar; Tahir Mehmood Khan

2011-01-01

Background: Globally breast cancer is one of the most common cancers and a major public health challenge to women health. Malaysia is also one of the Asian nations that is facing the dilemma breast cancer with an Age Standardised Rate (ASR) of female breast cancer among Malaysian women was 47.4 per 100,000 populations. Objectives: To evaluate the knowledge and awareness of Breast Cancer among the women of different age groups and various races in the sub-urban town of Sungai Petani, Malaysia...

BIOLOGI REPRODUKSI IKAN SUMPIT (Toxotes microlepis Gunther 1860 DI PERAIRAN SUNGAI MUSI SUMATERA SELATAN

Directory of Open Access Journals (Sweden)

Ni Komang Suryati

2015-12-01

Full Text Available Kegiatan penangkapan ikan sumpit sebagai ikan hias secara terus menerus di SungaiMusi oleh para nelayan akan mengakibatkan penurunan populasi ikan tersebut. Ikan sumpit termasuk ikan yang bernilai ekonomis tinggi, harganya di pasaran Rp 150.000,-. Oleh karena itu perlu dilakukan penelitian untuk mengetahui aspek biologi reproduksi ikan sumpit sebagai salah satu informasi untuk mendukung pelestarian ikan sumpit agar populasi ikan sumpit tetap terjaga. Penelitian dilakukan pada setiap bulan sejak Juni hingga Oktober 2011. Pengambilan sampel Ikan sumpit dilaksanakan di Perairan Sungai Musi dari Borang sampai Sungsang. Hasil penelitianmenunjukkan rasio kelamin antara ikan jantan dan ikan betina terjadi ketidakseimbangan dimana rasio kelamin ikan jantan jauh lebih banyak dibandingkan rasio kelamin ikan betina (2:1. Rata-rata nilai Indeks Gonad Somatik ikan sumpit berkisar antara 4,27±1,27. Nilai dari fekunditas ikan sumpit betina secara keseluruhan berkisar 6.655-72.726 butir/individu. Kisaran diameter telurnya antara 0,27 – 0,95 mm. Ukuran pertama kali matang gonad pada panjang total 134,97 mm untuk ikan jantan dan 116,31 mm untuk ikan betina. Fishing activity of archer fish as ornamental fish continuously in Musiriver by fisher will decrease it population. The price is Rp 150.000,-/fish in market so that Archer fish has high economy value. Therefore it was necessary to study the reproductive biology of archerfish that may be used as a reference for better management in order to achieve stability of its population. The research was conducted every month from June to October 2011 in downstream ofMusiriver South Sumatera. Result of this research showed that proportion between male and female were not equal (2:1. Gonad Somatic Index of archer fish values ranged 4,27 ± 1,27 and the fecundity of the female is estimated between 6655 to 72726 eggs. The average diameter of mature egss ranged form 0.27 to 0.95 mm. Length of first

PEMIJAHAN DAN PERKEMBANGAN EMBRIO IKAN PELANGI (Melanotaenia spp. ASAL SUNGAI SAWIAT, PAPUA

Directory of Open Access Journals (Sweden)

Bastiar Nur

2016-11-01

Full Text Available Ikan pelangi asal Sungai Sawiat, Papua merupakan ikan hias endemik yang belum diketahui data biologinya. Penelitian ini bertujuan untuk mengetahui jumlah telur yang dihasilkan, fertilitas dan daya tetas telur serta tahapan perkembangan embrio ikan pelangi asal Sungai Sawiat. Induk jantan dan betina ukuran 10–15 cm sebanyak 20 ekor, dipelihara dalam bak beton berukuran 2,5 x 2,5 x 1,0 m3 dengan sistem resirkulasi dan diberi pakan berupa cacing darah (bloodworm dengan frekuensi 3 kali sehari secara ad libitum. Dua ekor induk betina dan satu ekor induk jantan yang matang gonad dipijahkan dalam bak beton berukuran 1,0 x 1,0 x 0,75 m3 dan diberi tanaman air berupa eceng gondok sebagai pelindung serta media penempelan telur. Pengamatan ada tidaknya telur dilakukan setiap pagi dan sore hari selama 14 hari. Telur yang didapat dicatat baik fertile maupun infertile. Sebanyak 20 butir telur ditetaskan dalam basket plastik berukuran 13 x 10 x 5 cm dan selanjutnya diamati perkembangan embrionya dengan menggunakan mikroskop. Hasil pengamatan menunjukkan bahwa jumlah telur yang dihasilkan sebanyak 436 butir per dua ekor induk betina (218 butir per ekor, fertilitas 77,06%; daya tetas telur 74,71%; dan telur menetas setelah 8.579 menit (142 jam 59 menit pada suhu air inkubasi 27,6 – 28,3oC. Rainbow fish species originated from Sawiat River of Papua is one of Indonesian endemic species which its biological data has not been catalogued properly. The objectives of this research were to know the number of eggs (fecundity, fertility and hatchability and also the stages of embryonic development of the fish. Total of 20 male and female broodstock around 10–15 cm in size, reared in concrete tank sized 2.5 x 2.5 x 1.0 m3 equipped with closed recirculating water system and fed with bloodworm  ad libitum 3 times daily. Two already matured females and one male were selected for natural breeding and then transferred to another concrete tank (1.0 x 1.0 x 0.75 m3 in

Perencanaan Penerapan Konsep Zero run-off dan Agroforestri Berdasarkan Kajian Debit Sungai di Sub DAS Belik, Sleman, Daerah Istimewa Yogyakarta

Directory of Open Access Journals (Sweden)

Arnellya Fitri

2015-09-01

Full Text Available Daerah Aliran Sungai (DAS Belik merupakan salah satu Daerah Tampungan Air (DTA yang berada di daerah perkotaan Kabupaten Sleman. Akibat alih fungsi lahan pertanian menjadi lahan pemukiman yang padat menyebabkan semakin berkurangnya area resapan air hujan. Kurangnya area resapan air hujan menyebabkan kapasitas saluran drainase Sub Daerah Aliran Sungai (DAS Belik pada saat hujan  tidak mampu menampung air sehingga banjir di sekitar saluran drainase terjadi. Tujuan penelitian ini untuk memberikan solusi dengan menggunakan konsep zero run-off  dalam upaya  mencegah genangan banjir di perkotaan yang kurang memiliki ruang terbuka hijau dan area resapan air hujan. Kajian debit banjir yang dilakukan pada sungai Belik menggunakan metode rasional dan metode SCS CN yaitu metode yang digunakan dalam penentuan debit puncak pada satu kejadian hujan. Perhitungan debit diperlukan untuk mengetahui besar limpasan maksimum pada drainase saluran DAS Belik. Metode hidrograf  SCS CN  menggunakan parameter tekstur tanah, tebal hujan, CN wilayah, retensi potensial maksimum air oleh tanah, dan kedalaman hujan efektif. Sedangkan metode rasional menggunakan parameter koefesien aliran, intensitas hujan, dan luas daerah pengaliran dalam menghitung debit limpasan. Keseluruhan hasil perhitungan kedua metode melebihi besar debit pengukuran langsung menggunakan Metode Slope Area, artinya keseluruhan hasil menunjukkan banjir atau limpasan permukaan yang melebihi kapasitas drainase.Kata kunci. Limpasan permukaan, metode SCS CN, metode rasional, zero run-off Belik Watershed is one of the Water Catchment Areas  located in urban areas of Sleman District. Land conversion from agricultural to residential area cause the descending of rain water catchment area. Lack of rain water catchment area can cause drainage channel capacity of Belik sub zone cannot hold rain water, so that flooding occurred around the drainage channel. The aim of this research is to give a way out to

HULU SUNGAI PERAK BED SEDIMENT MAPPING USING UNDERWATER ACOUSTIC SONAR

Directory of Open Access Journals (Sweden)

N. Arriafdi

2016-09-01

Full Text Available Development in acoustic survey techniques in particular side scan sonar have revolutionized the way we are able to image, map and understand the riverbed environment. It is now cost effective to image large areas of the riverbed using these techniques and the backscatter image created from surveys provides base line data from which thematic maps of the riverbed environment including maps of morphological geology, can be derived when interpreted in conjunction with in situ sampling data. This article focuses on investigation characteristics of sediments and correlation of side scan backscatter image with signal strength. The interpretation of acoustic backscatter rely on experienced interpretation by eye of grey scale images produced from the data. A 990F Starfish Side Scan Sonar was used to collect and develop a series of sonar images along 6 km of Hulu Sungai Perak. Background sediments could be delineated accurately and the image textures could be linked to the actual river floor appearance through grab sampling. A major difference was found in the acoustic returns from the two research area studies: the upstream area shows much rougher textures. This is due to an actual differences in riverbed roughness, caused by a difference in bottom currents and sediment dynamics in the two areas. The highest backscatter correlates with coarsest and roughness sediment. Result suggest that image based backscatter classification shows considerable promise for interpretation of side scan sonar data for the production of geological maps.

SITUS “KOTO RAYO” DAN KEARIFAN TRADISIONAL DI TEPI SUNGAI TABIR JAMBI

Directory of Open Access Journals (Sweden)

Pahrudin -

2013-04-01

Full Text Available Dalam penelitian ini, penulis  membahas  ‘Koto Rayo’, sebuah pemukiman kuno di sisi Sungai Tabir, Jambi sebagai sebuah budaya dan kearifan lokal. Penelitian difokuskan pada nilai kearifan lokal yang dimiliki masyarakat dalam kaitan dengan situs ini. Hasil penelitian dan pembahasan memunculkan fakta-fakta sebagai berikut. Pulau Sumatera memiliki peradaban tinggi di masa lalu, khususnya melalui Kerajaan Sriwijaya yang mengontrol dan mendominasi seluruh pulau ini dan sebagian besar wilayah Asia Tenggara. Salah satu wilayah Kerajaan Sriwijaya di Pulau Sumatera adalah Jambi, yang dahulu memiliki banyak Kerajaan Melayu. ‘Koto Rayo’ yang terletak di sisi Sungai Tabir ‘mungkin’ salah satu peradaban yang berhubungan dengan sejarah Kerajaan Melayu Jambi dan atau Kerajaan Sriwijaya di masa lalu. Situs ini mempengaruhi beberapa perilaku kearifan lokal pada masyarakat sekitar dalam wujud perilaku yang tegas dalam melestarikan lingkungan dan menjaga warisan budaya. Kearifan lokal ini penting untuk meminimalisir efek negatif globalisasi.The objective of this study is to discuss ’Koto Rayo’, an ancient settlement on the side of Tabir river, Jambi as a culture and local wisdom. The study focused on the value of local knowledge in the communities in connection with this site. Data was collected through observation, interviews and document analysis. The results and discussion led to the following facts. The island of Sumatra has a high civilization in the past, particularly through the kingdom of Srivijaya that controls and dominates the entire island and most of the Southeast Asia region. One of the kingdom of Srivijaya in Sumatra is Jambi, which once had many Malay kingdom. ’Rayo Koto’ located on the side of Tabir river is ’probably’ one of civilization associated with the history of the Malay kingdom of Srivijaya kingdom of Jambi in the past. This site affects some local

KEBERTAHANAN RUMAH GADANG DAN PERUBAHAN SOSIAL DI WILAYAH BUDAYA ALAM SURAMBI SUNGAI PAGU, KABUPATEN SOLOK SELATAN

Directory of Open Access Journals (Sweden)

Syafwan Syafwan

2016-03-01

Artikel ini merupakan intisari dari penelitian yang dilaksanakan di sebuah wilayah yang pernah diusulkan kepada UNESCO sebagai salah satu warisan budaya dunia tentang kebertahanan rumah gadang yang terdapat di wilayah budaya Alam Surambi Sungai Pagu, Kabupaten Solok Selatan, Provinsi Sumatera Barat. Fenomena ini unik, karena kontradikitif dengan fenomena umumnya di wilayah-wilayah lain di Minangkabau, di mana terdapat kecendrungan rumah gadang makin lama makin punah sebagai dampak perubahan sosio-kultural pada masyarakat Minangkabau. Penelitian ini merupakan penelitian kualitatif dengan pendekatan naturalistik. Penelitian ini menemukan enam faktor penyebab fenomena kebertahanan rumah gadang di wilayah ini, yaitu 1 faktor menegakkan harkat, martabat dan kehormatan kaum dan gelar kepenghuluan yang melekat pada kaum, 2 faktor merantau, 3 faktor asas patah tumbuh hilang berganti, 4 faktor lokal jenius “mangguntiang sibak baju”, 5 faktor lokal jenius “balah pinang” dan 6 faktor kawasan destinasi wisata. Kata Kunci: warisan dunia, budaya, kebertahanan, rumah gadang.

Application of Cs-137 techniques to problems of sediment redistribution in Sungai Lui representative basin, Selangor, Malaysia (Part 1)

International Nuclear Information System (INIS)

Daud bin Mohamad.

1982-11-01

Since the beginning of the nuclear age, Cesium-137 has become a part of the world's ecosystems. Cs-137 is carried from the atmosphere to the ground by rainfall. On reaching the earth's surface, 137 Cs becomes strongly adsorbed to soil profiles and is concentrated predominantly in the surface layer, particularly in clayey soils. Systematic measurements of Cs-137 levels will therefore permit estimates to be made of the cumulative effects of soil redistribution over the past 25 years. Sediment movement in river catchments and coastal areas is a very old problem in Malaysia. In view of rapid development of urban and agricultural areas in Malaysia it was realised tha soil loss problems are particularly serious. The Sungai Lui catchment was chosen to be the investigational site. Geologically, the area comprises of granite and granitic schist. The area is mostly covered by forest (approx. 83%) and rubber (13%), padi (2%) and others (2%). The climate is considered to be typical of Peninsular Malaysia (equatorial) characterised by uniform temperature, high humidity and high rainfall. The area is mainly drained by the Lui River. Soil samples were collected from the catchment area at 4 sampling points in April 1981. The results of analyses of Cs-137 in soil samples from Sungai Lui catchment area ranged from 1.3 to 6.8 M Bq g -1 of sample and they could still be detected even up to 20 cm depth. A general pattern of Cs-137 distribution was observed in the soil profile at each site. The highest activity being in the top 3 cm layer and then decreasing up to about 6 cm. The activity increases again up to about 9 cm layer. From there onwards, it decreases. Based on these results, the estimated rate of sediment accumulation in the area was found to be about 0.47 cm/year. Since the samples were only collected from the depositional sites, further sampling especially from erosional site should therefore be carried out in order to obtain more complete data

ANALISIS PERMIBILITAS KERUANGAN DAN DINAMIKA FLUIDA ANGIN DAN SUHU KAWASAN PERMUKIMAN TROPIS SUNGAI DI BANJARMASIN, INDONESIA (An Analysis on Spatial Permeability and Fluid Dynamics of Wind and Thermal in Tropical Riverside Residential Areas

Directory of Open Access Journals (Sweden)

Budi Prayitno

2013-07-01

Full Text Available ABSTRAK Permukiman tepian sungai di Banjarmasin secara alami merupakan permukiman berbasis pada alam dan budaya huni sungai, saat ini mengalami degradasi kualitas kehidupan dan alamnya. Hal ini diakibatkan oleh bencana kebakaran, banjir dan tinggi resiko terjadinya urban heat island. Secara konfigurasi keruangan tidak terjadi hubungan dan keterpaduan antara ruang arsitektur dan infrastruktur kawasan yang berbasis daratan dan perairan. Fenomena yang terjadi adalah kepadatan, hubungan kawasan darat dan sungai yang lemah serta degradasi kualitas lingkungan. Selain itu kenyamanan termal kawasan pun sangat rendah, yaitu: aliran angin yang tidak lancar, kelembaban cukup tinggi dan suhu yang tidak nyaman. Penelitian ini mencoba melakukan eksperimen melalui pendekatan simulasi permibilitas ruang dan kenyamanan termal dengan menggunakan metode analisis ruang dengan program Space Syntax dan metode analisis kenyamanan termal dengan program Envimet. Penelitian ini membandingkan kondisi eksisiting dan usulan model arsitektur permukiman kampung beringkat yang berbasis arsitektur permukiman vernakular tepi sungai Banjarmasin. Kesimpulan dari penelitian ini adalah melalui pendekatan permibilitas keruangan yang mensimbiosiskan konfigurasi antara ruang darat dan air serta arsitektur kawasan dapat ditingkatkan kinerja kejelasan keruangannya tetapi secara kenyamanan termal tidak menunjukkan peningkatan kinerja secara signifikan karena morfologi kawasan yang relatif datar dan dengan proporsi ketinggian rata-rata bangunan yang rendah sehingga tidak terbentuk jalur pergerakan angin sebagai sarana ventilasi dan kenyamanan termal kawasan. ABSTRACT Riverside settlements in Banjarmasin that were initially based on their river culture and nature are currently experiencing degradation of life quality and nature. This is caused by fires, floods, and a high risk of urban heat island. In terms of spatial configuration there are no interrelation and integration between regional

PENGELOLAAN TEMBAWANG SUKU DAYAK IBAN DI DESA SUNGAI MAWANG, PURING KENCANA, KAPUAS HULU, KALIMANTAN BARAT

Directory of Open Access Journals (Sweden)

Yasri Syarifatul Aini

2017-04-01

Full Text Available Dayak Iban Ethnic cannot be separated of interaction with the forest (tembawang as a place to fulfill of variety needs such as food source, building material, traditional medicine, traditional ceremonies, craft and so on. It is important to know all aspect about tembawang and existence. The data were collected by in depth interviews to the village officials, officials and indigenous community representative, analyze with descriptive qualitative and SWOT. Sungai Mawang Village has 15 tembawang, spacious 12.52 ha and 147 types of plants with complete stratification such as natural forests. Tembawang management is governed by customary law. Access unlimited use but require a permit customs officials. Tembawang has the function and value is very important because it is part of the tradition, culture and customs of the people, economic needs and conservation. The Dayak Iban manage tembawang in good condition, with the result that maximizing managemen and potential for achieve maximum progress. Sustainability of tembawang management needs the support of the government as the policy holder and indigenous peoples itself, besides strengthening traditional values/culture in various aspects. Keywords: Dayak Iban ethnic, management, sustainability, SWOT, tembawang 

Hydrological assessment for mini hydropower potential at Sungai Pahang - Temerloh

International Nuclear Information System (INIS)

Sidek, L M; Zaki, A Z A; Muda, Z C; Basri, H; Mustaffa, Z; Ibrahim, M I H; Thiruchelvam, S

2013-01-01

Sg Pahang at Temerloh was considered for assessment of hydropower potential using hydrological analysis method and hydrological model. The available data related to topography, soil, land use, weather and discharge pertaining to the study catchment were used to characterize the catchment. The characterization was required for water resources hence hydropower assessment. The hydrology of the study catchment was simulated through the model. This hydrological study is required due to the proposed mini hydroelectric power plant at Pulau Temerloh. It is essential to evaluate the existing river flow characteristic and to model the environmental flow assessment of the river. Two rainfalll stations, JPS Temerloh and Pintu Kawalan Paya Kertam Station are selected to develop the Rainfall Intensity Duration frequency (RIDF) Curve to determine the rainfall intensity of the area. Daily river flow were recorded at Sg Pahang at Temerloh and Sg Pahang at Lubok Paku were used to develop the Flow Duration Curve (FDC) to study the characteristic of Sungai Pahang flow. The 7 days low flow with 10 years return period (7Q10 low flow) was obtained using both Gumbel Method and Log Pearson Type III Method. The results from FDC shows that 50% percentage of time the Sg Pahang - Temerloh is exceeded over a historical period is 400 m 3 /s and 50% percentage of time the Sg Pahang - Lubok Paku is exceeded over a historical period is 650 m 3 /s. The required environmental flow are set to be 7Q10 low flow which is 64.215 m 3 /s for Sg Pahang at Temerloh and 79.24 m 3 /s for Sg Pahang at Lubok Paku. The results show the water resources are abundant and hence boost the mini hydropower potentiality at Sg Pahang.

POLA PERMUKIMAN TEPIAN AIR, STUDI KASUS: DESA SEPUK LAUT, PUNGUR BESAR DAN TANJUNG SALEH KECAMATAN SUNGAI KAKAP, KABUPATEN KUBU RAYA

Directory of Open Access Journals (Sweden)

Jawas Dwijo Putro

2015-01-01

Full Text Available Proses terbentuknya lingkungan permukiman dimungkinkan karena adanya proses penciptaan lingkungan hunian sebagai wadah fungsional yang menampung segala kebutuhan manusia dan dilandasi oleh pola aktifitas serta merupakan hasil interaksi antara manusia atau kelompok masyarakat dengan setting (rona lingkungan baik bersifat fisik maupun non fisik (sosial budaya. Manusia dalam menempati lingkungan huniannya disesuaikan dengan preferensi lingkungan yang menyangkut pemahaman karakteristik alam dan manusia serta hubungan timbal baliknya. Penyesuaian ini memunculkan konsep bermukim yang memperlihatkan cara masyarakat beradaptasi dengan lingkungan dan membentuk pola permukiman. Seperti halnya yang dibahas dalam penelitian ini dengan mengambil kasus masyarakat di tiga desa yaitu ; Desa Sepuk Laut, Desa Tanjung Saleh, dan Desa Punggur Besar Kecamatan Sungai Kakap Kabupaten Kubu Raya, yang beradaptasi dengan lingkungan dan membentuk pola pemukiman pada kawasan tepian air. Hasil penelitian ini memperlihatkan bahwa pola permukiman yang terbentuk pada tiga desa diatas mengacu pada tahapan perkembangan kawasan pinggiran sungai atau air, struktur pola permukiman kawasan yang linier, orientasi kearah tepian air, kepadatan dan kualitas bangunan, serta topografi tepian air   The process of settlements formation was possibly made by the process of creating dwelling environment as a functional space that accommodate all human needs, These condition are based on the patterns of activity and interaction between people or society with the their environmen setting; both physical and non-physical (social and cultural. In occupied their environment, humans are adapt  to the  environment  preferences  concerning their understanding  to  the natural  characteristics  and  vice-versa.  This adaptation  led to  the concept of  living  that shows  how  people adapt  to the environment  and  creating  their settlement patterns. This study used case

PERSEPSI DAN MAKNA PERUBAHAN IKLIM TERHADAP USAHA PERTANIAN: STUDI KASUS DI DESA SUNGAI RANGAS TENGAH KABUPATEN BANJAR

Directory of Open Access Journals (Sweden)

Akhmad Rozami Syahru Alam

2016-10-01

Full Text Available This research was aimed to explore the society perception to climate change impacts which related to agricultural activities, rice productivity and farmers’ income; to do in-depth study about farmers’ definition related with climate change; and to absorb ideas and identification to agricultural alternatives. Survey method, interview and questionnaires were conducted to samples (respondent which purposively chosen. This research was divided into three terms. At the first term, we use perceptional value test, chi square and contingentional coefficient. Second term, we applied the marker (sign test. At the final term we applied focus group discussion technique. The result showed that: perception of farmer society was climate change have impacts to their agricultural activities, so that decrease rice productivity and income, but it have small effect to farmers’ innovation effort. Climate change was already realized by farmer society in Sungai Rangas Tengah Village Banjar Regency. Agricultural alternatives for farmer society to overcome these problems, were: poultries (42.65%, non-rice agriculture (26.47%, others (marketing, handcrafter, labor (20.59%, fisheries (17.65%.

Determination of organic and inorganic mercury species in Sungai Kinta, Perak by reversed-phase high performance liquid chromatography (HPLC) on-line coupled with ICP-MS

International Nuclear Information System (INIS)

Norshidah Baharuddin; Norashikin Saim; Rozita Osman; Sharifuddin Mohd Zain

2012-01-01

This paper describes a simple method for mercury speciation in river water samples of Sungai Kinta, Perak. Separation and measurement were done by high-performance liquid chromatography on-line with inductively coupled plasma mass spectrometry (HPLC/ ICP-MS). Separation of mercury species was accomplished within 6 minutes on an AQ C18 4.6 mm i.d x 150 mm, 5 μm reversed phase column with 0.1 % (w/ v) L-cysteine as mobile phase. Under the optimum instrumental conditions, recoveries of 101-104 % for MeHg + and 96 - 104 % for Hg 2+ were obtained with experimental detection limits of 1ngL -1 for inorganic mercury and 1.5 μgL -1 for organic mercury. (author)

Detection of Shallow Buried Archaeological Remains Structure using 2-D Resistivity Method at Sungai Batu, Lembah Bujang, Kedah

Science.gov (United States)

Ismail, Nurina; Nordiana, M. M.; Saidin, M.; Masnan, S. S. K.; Abir, I. A.

2018-04-01

In an archaeological study, 2-D resistivity becomes important tools for the scientific investigation and also can be applied to map shallow subsurface structures at the archaeological site. The main purpose of the research is to locate the shallow buried archaeological remains structure in the area of Sungai Batu, Lembah Bujang, Kedah (Malaysia). Resistivity surveys have been applied using a Pole-dipole array with both 5 survey lines for SB1 and SB2 sites using 0.75 m electrode spacing. Both results revealed high resistivity zone with ≥ 3000 Ωm at a depth ranging from 0-1.5 m at the study area. SB1 site conducting an excavation to validate the result obtain while SB2 is not conducting any excavation. Besides that, the other characteristics of the buried archaeological remains are indicated as mound area and there is exposed remain found on top of the surface. Based on the archaeological evidence, the higher resistivity value indicates the interesting anomaly which is clay bricks for archaeological excavation.

Perhitungan Volume dan Karakterisasi Material Endapan Erupsi Gunungapi Kelud Tahun 2014, di Sungai Bladak Bagian Hulu Dengan Metode Geofisika

Directory of Open Access Journals (Sweden)

Anastasia Neni Candra Purnamasari

2016-09-01

Full Text Available ABSTRAK Erupsi Gunungapi Kelud pada 13 Februari 2014 menghasilkan material endapan di hulu Sungai Bladak dalam jumlah yang sangat besar.Endapan hasil erupsi yang terdapat di hulu sungai berpotensi sebagai material lahar bagi wilayah di hilir.Upaya mitigasi untuk mengurangi bencana banjir lahar memerlukan informasi volume material endapan. Selain itu, informasi karakteristik fisik material endapan juga penting untuk pemanfaatannya bagi masyarakat. Penelitian untuk mengetahui volume material endapan dilakukan dengan menggunakan metode geofisika pada pengukuran ketebalan dari material endapan.Metode geofisika yang digunakan adalah metode mikroseismik dan metode seismik refraksi.Hasil yang didapatkan dari pengolahan data lapangan mikroseismik adalah nilai frekuensi natural (f0 dari setiap titik pengukuran mikroseismik. Hasil yang didapatkan dari pengolahan data lapangan seismik refraksi adalah kecepatan gelombang P dari material endapan, dimana kecepatan gelombang P akan diturunkan sehingga didapatkan kecepatan gelombang S. Kecepatan gelombang S akan digunakan untuk penghitungan ketebalan material endapan yang digabungkan dengan nilai frekuensi natural dengan rumus h=Vs/4f0. Berdasarkan ketebalan material endapan yang didapatkan dari hasil penghitungan setiap titik mikroseismik, kemudian dibuat kontur ketebalan material endapan dan dilakukan penghitungan volume material endapan. Karakterisasi material endapan dilakukan dengan cara menghitung persentase pumice dan nonpumice secara fisual menggunakan foto lapangan. Ketebalan endapan pumice di permukaan lahan dianalisis persebarannya menurut satuan-satuan lereng. Volume material endapan yang didapatkan dari hasil penelitian sebesar 27,6 juta m3. Hasil karakterisasi material diketahui bahwa pumice pada material endapan yang ada di hulu Sungai Bladak 91,82 % dan sisanya 7,18 % adalah nonpumice. Jumlah pumice yang sangat banyak tersebut merupakan sumberdaya alam yang bernilai ekonomi tinggi. Pumice dapat

Optimization of Archeological Anomalies using GIS method for Magnetic and Resistivity Study at Sungai Batu, Lembah Bujang, Kedah (Malaysia)

Science.gov (United States)

Yusoh, R.; Saad, R.; Saidin, M.; Anda, S. T.; Muhammad, S. B.; Ashraf, M. I. M.; Hazreek, Z. A. M.

2018-04-01

Magnetic and resistivity method has become a reliable option in archeological exploration. The use of both method has become popular these day. However, both method gives different type of sensing in detecting anomalies and direct interpret from the anomalies will result large coverage area for excavation. Therefore, to overcome this issue, both anomalies can be extracted using ArcGIS software to reduce excavated coverage area. The case study located at Sungai Batu, Lembah Bujang near SB2ZZ lot expected buried clay brick monument which will be a perfect case to apply this technique. Magnetic and resistivity method was implemented at the study area where the anomalies coverage area for magnetic and resistivity is 531.5 m2 and 636 m2 respectively which total area of both anomalies was 764 m2. By applying combine technique, the anomalies area reduce to 403.7 m2 which reduce the suspected anomalies by 47.16 %. The unsuspected clay brick monument area was increase from 15.86% to 55.54% which improve the cost and labor work for excavation.

Visualizing Sungai Batu Ancient River, Lembah Bujang Archeology Site, Kedah – Malaysia using 3-D Resistivity Imaging

Science.gov (United States)

Yusoh, R.; Saad, R.; Saidin, M.; Muhammad, S. B.; Anda, S. T.; Ashraf, M. A. M.; Hazreek, Z. A. M.

2018-04-01

Sungai Batu at lembah bujang has become an interest spot for archeologist since it was discover as earliest entrepot in history of Malaysia. It is believe that there was a large lost river near the ancient jetty remain. Ground resistivity method was implement with large coverage area to locate the ancient river direction. Eleven ground resistivity survey line was carry out using SAS4000 equipment and wenner-schlumberger array was applied for measurement. Ground resistivity method was used to detect the alluvial deposit made by the ancient river deposition. The ground resistivity data were produce in 2D image and presented in 3D contour map for various selected depth by using Rockwork 15 and Surfer 8 software to visualize the alluvial deposits area. The results from the survey has found the appearance of sedimentation formation due to low resistivity value (0 – 330 ohm.m) was found near the existing river. However, the width of alluvial deposition was 1400 m which too wide for river width unless it was a deposition happen form age to age by movement of river meander. It’s conclude that the river was still at the same direction and its direction was change due to sediment dumping factor waking it shifting to the east.

Analisa Persediaan Material Pada Proyek Pembangunan Jembatan Sungai Brantas Di Ruas Tol Kertosono-Mojokerto

Directory of Open Access Journals (Sweden)

Titis Wahyu Pratiwi

2014-09-01

Full Text Available Proyek Pembangunan Jembatan Sungai Brantas merupakan tahap dari pelaksanaan proyek Jalan Tol Kertosono-Mojokerto dimana jalan tol ini akan terhubung dengan Jalan Tol Surabaya-Mojokerto. Dalam pelaksanaannya, proyek ini dibangun diatas lahan yang sempit dengan luas lahan sisi utara 5.219 m2 dan sisi selatan 5.105 m2 sehingga tidak terdapat ruang yang cukup untuk menyimpan material dalam jumlah yang besar, selain itu terdapat material yang mengalami keterlambatan kedatangan sehingga berpengaruh pada biaya persediaan proyek. Oleh karena itu diperlukan suatu analisa persediaan material dengan menggunakan teknik lot sizing (penentuan jumlah pemesanan pada metode Material Requirement Planning (MRP. Dengan metode ini dilakukan pengolahan data berupa biaya pesan, biaya simpan dan jumlah kebutuhan material guna memperoleh jumlah pesanan yang optimal dengan biaya persediaan minimum. Penelitian ini bertujuan untuk mengetahui teknik lot sizing dalam analisa persediaan material yang menghasilkan biaya persediaan material paling minimum pada Pembangunan Jalan Tol Kertosono – Mojokerto. Metode Material Requirement Planning (MRP yang digunakan terdiri dari beberapa tahapan mendasar yaitu perhitungan kebutuhan kotor (explosion, perhitungan kebutuhan bersih (netting serta perhitungan jumlah pemesanan (lotting. Pada tahapan lotting digunakan empat teknik lot sizing yaitu Lot for Lot, Economic Order Quantity (EOQ, Period Order Quantity (POQ dan Part Period Balancing (PPB. Dari hasil analisa MRP yang dilakukan, didapat bahwa teknik lot sizing yang membentuk biaya persediaan minimum untuk semua material pada pekerjaan Pile Cap P2, P2’, P1 dan P1’ yang meliputi Bekisting, Besi D 16, Besi D 19 dan Besi D 32 serta Beton K 350 adalah teknik Lot for Lot.

Kecernaan In Vitro Fraksi Serat (NDF, ADF dan Selulosa Lima Jenis Rumput Laut Coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat

Directory of Open Access Journals (Sweden)

Y.L. Dewi

2015-10-01

Full Text Available Penelitian ini bertujuan untuk mengetahui kecernaan fraksi serat (NDF, ADF dan Selulosa lima jenis rumput laut coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat secara in vitro. Metode penelitian yang digunakan adalah metode eksperimen dengan Rancangan Acak Kelompok (RAK terdiri dari lima perlakuan rumput laut coklat yang berbeda jenis ( A = Padina australis, B = Turbinaria decurrens, C = Turbinaria murayana, D = Sargassum crassifolium dan E = Sargassum binderi dan masing-masing perlakuan diulang 3 kali sebagai kelompok. Kelompok didasarkan atas tiga kali pengambilan cairan rumen kambing yang berbeda. Parameter yang diamati pada penelitian ini adalah kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian menunjukkan 5 jenis rumput laut coklat berpengaruh sangat nyata (P<0,01 terhadap kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian ini dapat disimpulkan bahwa rumput laut Sargassum crassifolium dan Sargassum binderi memiliki kecernaan NDF tertinggi (15,65% dan 20,56% dan ADF tertinggi (15,43% dan 17,80% dibandingkan dengan jenis rumput laut coklat lainnya.

Screening of Thermophilic Bacteria Produce Xylanase from Sapan Sungai Aro Hot Spring South Solok

Science.gov (United States)

Irdawati, I.; Syamsuardi, S.; Agustien, A.; Rilda, Y.

2018-04-01

xylanase is one of the enzymes with great prospects as hemicellulose hydrolyzing enzyme. Global annual market demand for this enzyme reach US 200 million. This enzyme catalyzes the xylan (hemicellulose) reactions breaking into xilooligosakarida and xylose. Xylanase can be applied to various industrial sectors such as bread, sugar xylose, biofuels, especially in bleaching paper (bleaching) pulp. Xylanase Isable to replace conventional chemical bleaching using chlorine that is not friendly for the environment. Currently xylanase production is extracted from the thermophilic bacteria for enzyme stability at high temperatures that are suitable for industrial applications. Thermophilic bacteria can be isolated from a hot spring, one of the which is a source of Sapan Sungai Aro Hot Spring, located in the district South Solok. The aim of this study was to select and identification of thermophilic bacteria can produce xylanase.This roomates is a descriptive study, which was Carried out in the Laboratory of Microbiology, Mathematic and Science Faculty of Padang State University, and Laboratory of Bacteriology, BasoVeterinary Research Center. The research procedure consisted of the preparation and sterilization of materials and tools, medium manufacturing, regeneration, selection and identification. Selection is performed by using a semiquantitative screening plate that contains xylan substrate. Identification is based on microscopic and biochemical characteristics until the genus level.Selection results Showed 12 out of 16 isolates had xilanolitik activity, with the highest activity is SSA2 with xilanolitik index of 0.74. The top five index producehigestxilanolitik isolates that are SSA2, SSA3 and SSA4 identified as Bacillus sp. 1., and SSAS6 and SSA7 is Bacillus sp. 2.

Utilizing of 2-D resistivity with geotechnical method for sediment mapping in Sungai Batu, Kedah

Science.gov (United States)

Taqiuddin, Z. M.; Rosli, S.; Nordiana, M. M.; Azwin, I. N.; Mokhtar, S.

2017-07-01

Sungai Batu is Lembah Bujang subdistrict, located at northern region of Peninsular Malaysia, recognized as an international cultural and commercial crossroad for 2000 years ago, and recorded as the oldest archaeological site in southeast Asia. The discovering of iron smelting area (1st-4th century) shows the evidence of important iron industry in Malay Peninsular to others civilization. Nowadays, a lot of interdisciplinary research was conducted in this area including geophysical prospect to understand the subsurface profile for this locality. Geophysical approach such as 2-D resistivity was performed with the main objective is to identify sediment deposit for this area. Three 2-D resistivity survey lines were design across borehole and data acquired using ABEM SAS4000 system with Pole-dipole array using 2.5 m minimum electrode spacing. The data obtained was process using Res2Dinv software to produce inversion model and Surfer10 software used for interpretation and correlation with respective borehole record. The 2-D resistivity inversion model shows that, the area dominated by clay soil with resistivity values of values of >500 Ωm interpreted as hard layer. The saturated zone (25 m which consider large volume of soil deposit during sedimentation process. The correlation with the borehole record shows that clay profile distributed at depth of >20 m. The present of shale in certain borehole record indicate that the environment deposit is clam/stagnant water condition during the formation process which suspected controlled by the deposition process from the land deposit.

RESPON MASYARAKAT DAN DAMPAKNYA TERHADAP LINGKUNGAN DARI PROGRAM SL-PTT PADI NON HIBRIDA DI KABUPATEN HULU SUNGAI SELATAN PROVINSI KALIMANTAN SELATAN

Directory of Open Access Journals (Sweden)

Ria Normanita

2016-10-01

Full Text Available Increasing the productivity of rice through the approach of Sekolah Lapang Pengelolaan Tanaman Terpadu (SL-PTT is one of the strategies that is expected to provide a greater contribution to the national rice production. Based on the results of research, the public response to the program of SL-PTT Non Hybrid Rice in Hulu Sungai Selatan was in the high category (85.71%. Factors affecting the public response to the program were the information, the field guides, the assistance component whereas those having no effects to the public response were the education, the practice, and the application of PTT. The environmental impact of the program of SLPTT Non Hybrid Rice was positive in the economic aspect, which could create welfare for farmers implementing the program. The Social aspect giving a positve impact was  through the transmission of technology adoption that could be applied to non-rice farmers who lived around the area of SL-PTT. The negative impact was the social jealousy among the people who could all not get involved in the program of SL-PTT Non Hybrid Rice.

PEMANFAATAN JARINGAN SOSIAL DALAM PENGEMBANGAN USAHA OLEH PELAKU UMKM (Studi Kasus: 8 Pelaku UMKM pada Sentra Makanan Rendang di Kelurahan Sungai Durian, Kecamatan Lamposi Tigo Nagari, Kota Payakumbuh

Directory of Open Access Journals (Sweden)

Zeni Eka Putri

2018-05-01

Full Text Available Abstrak: Makanan rendang khas Kota Payakumbuh, Provinsi Sumatera Barat, merupakan salah satu kuliner yang diharapkan menjadi salah satu dari tiga kuliner yang diunggulkan di Indonesia seperti yang dinyatakan Deputi Bidang Pemasaran dan Jaringan Usaha Kementerian Koperasi dan UKM Emilia Suhaimi. Modal sosial seperti jaringan merupakan salah satu hal yang perlu dikembangkan oleh pelaku UMKM. Sudah ada kampung rendang di Kel. Sungai Durian, Kec. Lamposi Tigo Nagari, Kota Payakumbuh bagi pelaku UMKM rendang. Tujuan penelitian adalah mendeskripsikan jaringan sosial yang dimiliki dan pemanfaatannya oleh pelaku UMKM. Metode penelitian yang digunakan adalah metode penelitian kualitatif, merupakan studi kasus terhadap 8 pelaku UMKM pada sentra makanan rendang. Hasil dari penelitian adalah;1Pelaku usaha sudah memiliki jaringan sosial mikro yaitu  dalam hal produksi dan pemasaran; 2 Pelaku usaha sudah memiliki jaringan meso, baik dengan Dinas Koperasi dan UMKM, dengan pihak bank, IWAPI, maupun dengan pihak lainnya seperti perguruan tinggi, LIPI, maupun PERTAMINA; 3 Pemanfataan jaringan sodial belum dilakukan secara maksimal karena berbagai keterbatasan; 4 Ada hambatan yang dimiliki oleh pelaku baik secara ekternal maupun internal. Kata kunci: UMKM, rendang, jaringan social   Abstract: Rendang is a wellknown dish originated from West Sumatra. Rendang from Payakumbuh, one of the city that produce rendang in West Sumatra, is  expected to be the top three in Indonesian culinary, as declared by Deputy of Marketing and Business Network Ministry of Coorporatives and SME, Emilia Suhaimi. Social capital like social networking is the primary capital that need to be developed in SME. In line with this purpose, Kampung Rendang has been developed in one of the district in Payakumbuh, located in Sungai Durian, Lamposi Tigo Nagari, Payakumbuh for SME. The aims of this study are to desribe the social network in this SME and the utilization of the network. This study

DUCK (Anas platyrhincos Borneo CULTIVATIONIN HULU SUNGAI UTARA SOUTH KALIMANTAN (OVERVIEW OF MARKET, HUMAN RESOURCES AND FINANCING

Directory of Open Access Journals (Sweden)

Muhammad Riza Firdaus

2016-04-01

Full Text Available Given Alabio ducks ( Anas platyrinchos Borneo is a commodity that can be developed on wetlands , the study aims to illustrate the potential and development of duck farms that can be relied upon by the provincial government in making policies for the advancement of this duck commodities , especially in the aspect of  markets  ,  human  resources  ,  and  fi nancial  aspects  .  These  three  aspects have been given the results of several previous studies that the three aspects mentioned  this  is  still  an  issue  in  the  development  of  duck  and  production results  .  Hulu  Sungai  Utara  as  duck  production  centers  serve  as  a  test  site  . Qualitative  analysis  of  the  domain  and  toksonomi  method  used  as  a  tool  in analyzing the data of this study . The results show : First , aspects of fi nancing shows that the business is viable and profi table , especially on a large scale . Second , the market requires a lot of innovation in creating related products. Third , explain aspects of human resource regeneration is still a problem and also the managerial constraints such as planning , standardization and quality in all phases . Keywords: Ducks  Alabio,  Financial  Aspects,  Aspects  of  Market  and  Marketing,  Human Resource Aspects

Community Structure of Riparian Community of Sematang Borang River of South Sumatera

Directory of Open Access Journals (Sweden)

Yetty Hastiana

2015-12-01

Full Text Available Vegetasi riparian adalah sebagai ekoton antara habitat teresterial dengan sistem perairan (sungai. Penyangga riparian berfungsi untuk menjaga kelestarian fungsi sungai dengan cara menahan atau menangkap tanah (lumpur yang tererosi serta unsur hara dan bahan kimia termasuk pestisida yang terbawa dari lahan dibagian kiri kanan sungai agar tidak masuk ke perairan. Sungai Sematang Borang merupakan bagian dari Daerah Aliran Sungai (DAS Musi, Sungai Sematang Borang memiliki karaketeristik struktur sungai dengan panjang seitar 5 km, lebar sungai mencapai 70 m dan kedalaman sekitar 10 m. Saat ini sungai ini mulai terancam mengalami penurunan kualitas baik fisik, kimia maupun biologi Selain kehilangan habitat alami ikan yang akan berdampak pada penurunan kelimpahan dan biodiversity, perairan ini juga mengalami abrasi pada sisi kiri kanan tebing sungai. Keberadaan vegetasi riparian menjadi penting, selain untuk mencegah abrasi, juga berperan dalam produksi serasah. Produksi serasah berkontribusi dalam transfer bahan organik vegetasi ke dalam tanah. Unsur hara yang dhasilkan dari proses dekomposisi serasah dalam tanah sangat penting bagi kelangsungan hidup vegetasi dan sebagai sumber detritus bagi ekosistem dalam menyokong kehidupan organisme akuatik. Pentingnya kontribusi vegetasi riparian dalam suatu ekosistem, maka perlu dilakukan penelitian terhadap diversitas dan profil vegetasi. Kajian aspek vegetasi, diperkuat dengan melakukan pengamatan terhadap kondisi fisik kimia perairan Sematang Borang. Parameter fisik kimiaperairan yang diamati meliputi: suhu, kedalaman, kecepatan arus, COD, BOD, DO, pH, dan Salinitas. Penelitian menerapkan metode ekologi deskriptif kuantitatif dan kualitatif, untuk analisis kualitas fisik kimia perairan didukung analisis laboratorium dan survei. Hasil penelitian teridentifikasi 15 species riparian dengan kategori indeks keanekaragaman riparian 0,09-1,03 dan memiliki pola penyebaran cenderung berkelompok

CISADANE RIVER WATER POLLUTION

Directory of Open Access Journals (Sweden)

Kumoro Palupi

2012-09-01

Full Text Available Sungai Cisadane berfungsi sebagai sumber air baku untuk sistem penyediaan air bersih wilayah Serpong dan Tangerang, Kabupaten Tangerang. Meskipun demikian, sungai Cisadane berfungsi pula sebagai tempat pembuangan limbah bagi rumah tangga dan industri yang berlokasi di sepanjang sungai tersebut. Untuk memperoleh gambaran mengenai tingkat pencemaran airnya, pada bulan September 1992 telah dilakukan pengambilan sampel air sungai Cisadane. Sampel air diambil di sebelah hulu intake instalasi pengolahan air di Cikokol (Tangerang dan Serpong, masing-masing sebanyak lima dan tiga lokasi. Sebanyak 21 parameter dianalisis, kemudian dihitung Individual Index (II dan Pollution Index (PI - nya. Hasil yang diperoleh, yang menggambarkan kualitas pencemaran air sungai Cisadane pada saat itu, adalah sebagai berikut : Tangerang PI=1891. Pencemar utama adalah fenol, dengan II- 110 dan lemak & minyak, dengan II = 2670.Serpong, PI=574. Pencemar utama adalah fenol, dengan 11 = 810 Parameter lain yang mempunyai II > 1 adalah oksigen terlarut, fosfat, zat besi, fecal coli, nitrat, COD dan zat padat tersuspensi. Hasil tersebut menggambarkan baliwa sungai Cisadane telah tercemar oleh limbah industri dan rumah tangga, serta mungkin pula telah tercemar oleh limbah pertanian, peternakan dan perbengkelan.

Karakter Geoarkeologis dan Proses Budaya Prasejarah Zona Poros Ponjong – Rongkop di Blok Tengah

Directory of Open Access Journals (Sweden)

Jarwo Susetyo Edy Yuwono

2016-09-01

Full Text Available ABSTRAK Penelitian ini dilakukan di Zona Poros Ponjong - Rongkop, yaitu bagian dari Blok Tengah Gunungsewu di Pegunungan Selatan Jawa, yang posisinya diapit oleh dua depresi bekas danau purba, yaitu Ledok Wonosari dan Ledok Baturetno. Morfologinya berupa punggungan perbukitan karst berarah utara-selatan antara daerah Ponjong dan Rong-kop, membentuk semacam poros hampir tegak lurus terhadap bentangan umum Gunungsewu. Bagian paling utara ber-batasan dengan pegunungan non-karst dan memiliki topografi tertinggi di Blok Tengah Gunungsewu, sehingga menjadi wilayah hulu bagi sungai-sungai bawahtanah di Gunungkidul. Melalui beberapa survei ditemukan sejumlah 56 gua yang memiliki potensi arkeologis, tujuh di antaranya sudah diekskavasi dan terbukti menyimpan jejak-jejak hunian prase-jarah dari Kala Pleistosen Akhir - Holosen Awal. Pendekatan geoarkeologis sebagai studi gabungan antara arkeologi dan geomorfologi, dilakukan untuk membangun model-model integral mengenai hubungan sistematik antara manusia dengan bentanglahan karst Gunungsewu di area penelitian. Dua hal yang menjadi tujuan utama penelitian ini adalah: Pertama, menjelaskan karakter geoarkeologis Zona Poros Ponjong - Rongkop sebagai perpaduan antara aspek-aspek geomorfologis (morfologi, morfogenesis, morfokronologi, dan morfoaransemen dan aspek-aspek arkeologis (distri-busi gua dan potensi arkeologisnya. Tujuan ini dicapai melalui penilaian dan pemetaan distribusi potensi gua sebagai situs arkeologis, kemudian menganalisis hubungannya dengan aspek-aspek geomorfologis setempat. Kedua, menjelas-kan proses budaya prasejarah, yaitu bentuk dinamis dari budaya penghunian gua beserta faktor-faktor yang mempen-garuhinya. Metode untuk mencapai tujuan ini adalah dengan menganalisis konteks data arkeologis dan stratigrafi lantai gua yang pernah diekskavasi. Sintesis kajian atas kedua capaian tujuan ini memberikan penjelasan integral atas karakter geoarkeologis dan proses budaya prasejarah di area

FAKTOR-FAKTOR YANG BERHUBUNGAN DENGAN PERILAKU IBU DALAM MEMILIH PENOLONG PERSALINAN DI NAGARI SUNGAI BULUH WILAYAH KERJA PUSKESMAS PASAR USANG KABUPATEN PADANG PARIAMAN TAHUN 2007

Directory of Open Access Journals (Sweden)

Fatmi Arma

2008-09-01

Full Text Available Mortality and morbidity of woman in pregnancy and delivery time is still becoming a big problem in development country. Death due to delivery was a common factor of young woman death in her top reproduction cycle. 75,6% delivery process in Padang Pariaman 2006 was helped by midwife. This number is still lower than national target (85%. Pasar Usang Health Centre is a Health Center in Padang Pariaman which has the lowest number of birth aid by nonprofessional medicine officer (27,9%. There is 7 traditional practitioner in Pasar Usang Health Center Region who still active helping delivery process. 6 traditional practitioner live in Sungai Buluh. It is a descriptive analytic research with cross sectional design. Population included all mother who had delivery process from January till June 2007 (n=116. Data were collected from August 6th till 13'h using questionnaire. There were no significant relationship on educational grade with mother option of delivery assistant. But there were significant relationship on mother’s knowledge and medicine officer service with mother option of delivery assistant.

POTENSI KELEMBAGAAN LOKALDALAM PENGELOLAAN DAERAH ALIRAN SUNGAI (Studi Kasus di Desa Cemplang

Directory of Open Access Journals (Sweden)

Messalina L Salampessy

2018-01-01

kasus dimana data dikumpulkan melalui wawancara mendalam, diskusi kelompok terarah dan observasi partisipan. Analisis data dilakukan dengan menggunakan metode pendekatan kerangka kerja Situasi - Struktur - perilaku - kinerja. Hasil penelitian menunjukkan bahwa pemanfaatan SDA DAS dianggap sebagai sumber akses terbuka gratis dimana setiap orang bebas mengeksploitasi sumber daya alam di dalamnya. Hal ini terkait dengan kondisi yang ada yang menunjukkan adanya saling ketergantungan antara pemerintah, sektor swasta dan masyarakat yang terlibat dalam pemanfaatan sumber daya bersama. Perilaku para pihak terkait pemanfaatan DAS sangat mempengaruhi kondisi DAS yang ada; Dimana kinerja pengelolaan sub DAS Cisadane hulu belum memberikan hasil yang maksimal karena pengelolaannya masih berlangsung secara sektoral. Kata kunci: Kelembagaan Lokal; Pengelolaan Daerah Aliran Sungai; Sub DAS Ciaten Cisadane Hulu.

DAMPAK LIMBAH CAIR HASIL PENGOLAHAN EMAS TERHADAP KUALITAS AIR SUNGAI DAN CARA MENGURANGI DAMPAK DENGAN MENGGUNAKAN ZEOLIT (The Impact of Liquid Waste of Gold Processing in the River Water Quality and The Method for Minimizing the Impact by Using Zeolite

Directory of Open Access Journals (Sweden)

Candra Agus

2005-03-01

Full Text Available ABSTRAK Kegiatan penambangan emas oleh masyarakat di desa Jendi telah dilakukan sejak 1993. Meskipun telah menyediakan lapangan kerja untuk masyarakat lokal, kegiatan tersebut menurunkan kualitas lingkungan, khususnya sungai, karena penggunaan merkuri. Dalam hal ini penggunaan merkuri dalam proses pengambilan emas murni dari batuan telah mempengaruhi air sungai sehingga memiliki kandungan 0,002-1 mg/l Hg;0,05 mg/l Pb; 0,4 mg/l Cu and 28,39 mg/l Fe. Berdasarkan peraturan -pemerintah No. 822001 tentang pengelolaan kualitas air dan air irigasi, konstituen metal tersebut telah melebihi baku mutu air. Penggunaan mineral zeolite sebagai adsorben pada proses penambangan emas tradisional menunjukkan bahwa zeolit dengan ukuran 80- 100 mesh dapat mengurangi kadar hg sehingga masuk ke dalam baku mutu air.   ABSTRACT The gold mine activity of people in jendi village has been conducted since 1993. Even though this activity provide job for the local people. It will degrade the environmental quality especially river, because of Mercury use. The use of Mercury in the process to extract natural gold from concentrate of rock mill affects river water because it contains 0.002-1 mg/l Hg; 0,05 mg/l Pb; 0,4 mg/l Cu and 28,39 mg/l Fe. Based on the Government Regulation No. 82/2001 Concerning the Management of Water Quality and Irrigation water, those metal constituents have already been above the water standard quality. Using mineral zeolite as adsorbent on the traditional gold processing showed that zeolite with size 80-100 mesh could reduce the content of Hg, Pb, Cu, and Fe, which fall within the water standard quality.

Study of radon concentration and toxic elements in drinking and irrigated water and its implications in Sungai Petani, Kedah, Malaysia

Directory of Open Access Journals (Sweden)

Nisar Ahmad

2015-07-01

Full Text Available The radon activity concentration and toxic elements have been assessed in drinking and irrigated water samples collected from different locations of Sungai Petani, Kedah, Malaysia. The water samples were collected from wells, streams and taps. A calibrated alpha spectrometer RAD-7 (Model 2890 and Atomic Absorption Spectrometers (Perkin–Elmer, Model AAnalyst 200, Shimadzu, Model AA-700 were used to estimate radon activity concentration and toxic elements, respectively. Maximum average value of radon concentration among the various types of water sources was found 14.7 ± 1.44 Bq/l in well water used for drinking and irrigation and minimum was found 5.37 ± 0.58 Bq/l in tap water used for drinking. Contribution of radon in drinking water to indoor air and age dependent associated annual effective doses were calculated from the measured radon concentration and were found less than lower limit of recommended action level. The activity concentrations of Ni > Pb > Cd > As > Cr were found higher for streams water as compared to wells and tap water. Values of radon concentration in well water were found higher than EPA recommended level and lower than WHO action level while the annual effective doses and level of toxic elements in water reported in this study were found lower than recommended level.

Adsorption-desorption, mobility and degradation of 14C-Glyphosate in two soil series

International Nuclear Information System (INIS)

Ismail, B. S.; Zaifah Abdul Kadir; Khairiah Jusoh; Nashriyah Mat

2002-01-01

The adsorption desorption and degradation of glyphosate (Roundup) have been studied using 14 C glyphosate in two soils, namely Serdang Series and Sungai Buloh Series. The percentage of adsorption was not significantly different (p 14 C- glyphosate was detected in 0-10 cm zone of the two soils studied. However, in Sungai Buloh Series, a significant amount of 14 C-glyphosate was detected in the 10-20 cm zone. A small amount of 14 C radioactivity was also detected in the leachate of the two soils. The percentage of degradation in the Sungai Buloh and Serdang Series soils was higher at 10 μg/ml and 50 μg/ml, concentration, respectively. At 50 μg/ml concentration the Sungai Buloh Series soil showed higher glyphosate residue (83%) as compared to Serdang Series (48%). In contrast, the glyphosate residue was found to be higher in the Serdang Series (73916) as compared to the Sungai Buloh Series (30%) at 10 μg/ml concentration. (Author)

PENGELOLAAN DAS CITARUM BERKELANJUTAN

OpenAIRE

kurniasih, nia

2011-01-01

Sungai citarum merupakan sungai utama di DAS Citarum yang dimanfaatkan untuk berbagai keperluan, tidak hanya digunakan oleh 7 kabupaten dan 2 Kota di Jawa Barat tetapi juga sebagai sumber air baku air minum Kota Jakarta. Penurunan kualitas maupun kuantitas Sungai Citarum sudah sangat memprihatinkan, kondisi tersebut diakibatkan oleh kesadaran masyarakat dan pemerintah yang belu optimal. Peraturan-peraturan Pemerintah sudah ada tetapi pelaksanaan dilapangan belum maksimal dibarengi penegakan h...

ANALISIS KADAR LOGAM DAN CARA MUDAH MENGENALI UDANG YANG TERAKUMULASI LOGAM: STUDI KASUS TENTANG UDANG DI SUNGAI DONAN CILACAP, JAWA TENGAH (Metal Content Analysis and Easily Recognize for Shrimps that Accumulates of Metal: Case Study about Shrimps

Directory of Open Access Journals (Sweden)

Tumisem Tumisem

2011-07-01

Full Text Available ABSTRAK Penelitian tentang Analisis Kadar Logam dan Cara Mudah Mengenali Berbagai Udang yang Terakumulasi Logam dilakukan dengan: mengidentifikasi berbagai jenis udang, menganalisis kadar logam dan menganalisis secara morfologi berbagai jenis udang terkait dengan morfologi tubuhnya. Penelitian dilakukan di sepanjang Sungai Donan Cilacap dengan cara menangkap berbagai jenis udang di sepanjang sungai tersebut setiap musim. Analisis kadar logam dilakukan di Laboratorium Kimia Analitik UGM, identifikasi dan analisis morfologi udang dilakukan di Laboratorium Teknik Kimia UMP. Hasil identifikasi diperoleh enam jenis udang yaitu udang Tepus, Pletok, Jahe, Peci, Sikat, dan Wuku. Berdasarkan hasil analisis morfologi (warna tubuh menunjukkan semua jenis udang yang berasal dari lokasi sekitar tailing semen dan pertamina berwarna lebih gelap (kehitaman atau hitam kemerahan, dan yang berasal dari lokasi sungai yang memiliki tanaman bakau adalah cerah dan segar (warna lebih kelihatan bening. Hasil analisis kadar logam jenis Cd dan Pb pada semua udang tidak terdeteksi, sedangkan analisis kadar Cu terdeteksi pada udang Pletok, Wuku dan Sikat dengan kadar melebihi baku mutu kesehatan 0,1 ppm. Rata-rata kadar Cu pada udang tersebut sebesar 66,256 ppm per 1000 gram udang kering. Dari hasil analisis morfologi (bentuk tubuh dari semua jenis udang baik yang terakumulasi logam maupun tidak memiliki bentuk yang sama, sehingga tidak dapat menjadi patokan dalam mengenali udang yang tercemar logam. Berdasarkan penelitian di atas dapat disimpulkan udang yang terakumulasi bahan pencemar di atas standar keamanan pangan berwarna hijau kehitaman dan merah kehitaman, sedangkan udang yang tidak terakumulasi bahan pencemar berwarna putih segar. ABSTRACT Research on the metal content analysis and Easily Recognize for shrimps that accumulates of metal have done by identify various types of shrimps, metal content analysis, and analyzed morphologically various types of shrimp related

Sistem Pemantauan Kadar pH, Suhu dan Warna pada Air Sungai Melalui Web Berbasis Wireless Sensor Network

Directory of Open Access Journals (Sweden)

Ahmad Sabiq

2017-07-01

Full Text Available Water is a very important natural resource for human life and other living things. Water pollution, especially in river water, should be controlled because of the rapid development. One technology to monitor multiple physical quantities scattered in a region is the Wireless Sensor Network (WSN. WSN technology has the ability to transmit data from sensor readings and forward data received from other nodes. In this study, prototype monitoring system of pH level, temperature, and color based on WSN that can be monitored through the developed web. The sensors at each node are connected to Arduino Uno as a processing unit, data read from the sensor is sent to the sync node via XBee wireless device. In the sink, the PC also serves as a database server and a web server is used. Test results with two different dispersion indicate that sensor readings can be read by all nodes and received by the sync node and can be displayed on web pages that have been built. Air merupakan sumber daya alam yang sangat penting bagi kehidupan manusia dan mahluk hidup lainnya. Pencemaran air khususnya air sungai perlu dikendalikan seiring makin cepatnya pembangunan. Salah satu teknologi untuk melakukan pemantauan besaran fisik dalam wilayah yang tersebar adalah Wireless Sensor Network (WSN, yang memiliki kemampuan untuk mengirimkan data hasil pembacaan sensor serta meneruskan data yang diterima dari node lain. Pada penelitian ini dikembangkan purwarupa sistem pemantauan kadar pH, suhu dan warna berbasis WSN yang dapat dipantau melalui web. Sensor pada setiap node dihubungkan ke Arduino Uno sebagai unit pemroses, data yang dibaca dari sensor dikirimkan ke node sink melalui perangkat XBee nirkabel. Pada sink digunakan PC yang berfungsi juga sebagai database server dan web server. Hasil dari pengujian dengan dua penyebaran yang berbeda didapatkan hasil bahwa pembacaan sensor dapat dibaca oleh seluruh node dan diterima oleh sink serta dapat ditampilkan melalui laman web yang

studies of action of heavy metals on caffeine degradation

African Journals Online (AJOL)

User

2015-12-02

Dec 2, 2015 ... Sungai Berembang (Perlis), Pantai Teluk Air Tawar and. Sungai Layar ... (0.75% w/v) was added to 100 mL deionised water and heated to 75 °C. Then, .... derived from 36 waste generators and comprised of metal hydroxide ...

PENGUATAN INFORMASI EKOWISATA MELALUI FILM DOKUMENTER DI KELURAHAN SEI MEMPURA

Directory of Open Access Journals (Sweden)

Mohd. Fauzi

2016-10-01

Full Text Available AbstrakPenelitian ini bertujuan untuk mensinergikan kegiatan tri darma perguruan tinggi dengan ekowisata di kelurahan Sei Mempura dengan memberikan wawasan baru tentang penguatan informasi ekowisata melalui film dokumenter di kelurahan Sei Mempura serta menerapkan pendekatan partisipatif bagi masyarakat lokal dalam rangka penguatan informasi ekowisata melalui film dokumenter di kelurahan Sei Mempura. Penelitian ini menggunakan metode deskriptif kualitatif dengan menggunakan beberapa tahapan. tahap pertama membuat film dokumenter di kelurahan Sungai Mempura dan mewawancarai dinas terkait. Tahap kedua membuat laporan hasil penelitian. Hasil penelitian menunjukkan bahwa potensi ekowisata yang ada di kelurahan Sungai Mempura sangat potensial untuk dikembangkan terutama. Promosi yang terus menerus harus dilakukan, salah satunya adalah dengan pembuatan film dokumenter.Kata kunci: Ekowisata, film, penelitian AbstractThis research aimed to sinchronize the university services to the society by producing documenter film about Sungai Mempura village. This research used descriptive-qualitative by using two steps. Firstly, we produced the documenter film of Sungai Mempura village. Secondly, we made a report about the research. The result of the reasearch shown that the ecotourist in Sungai Mempura village was very potential and exotic and needed to be developed. The continuous promotion should be made and this film will give useful contribution to promote this natural richness which giving benefits to people. Keywords: ecotouris, film, research

Correlation of Self Potential and Ground Magnetic Survey Techniques to Investigate Fluid Seepage in Archaeological site, Sungai Batu, Lembah Bujang, Kedah, Malaysia

Directory of Open Access Journals (Sweden)

Tajudeen O. Adeeko

2018-05-01

Full Text Available One of the substantial of geophysics is to investigate the subsurface condition of the earth (groundwater using appropriate geophysical techniques. In this research the correlation of self potential (SP and ground magnetic methods was used to investigate fluid seepage in Archaeological site, Sungai Batu, Lembah Bujang, Kedah, Malaysia. Self-potential method was used to determine flow of water, and Ground magnetic method was used to find object that can influence the result of self potential measurement and the aquifer depth, the lines were spread 0m ≤ x ≤ 9m, 0m ≤ y ≤ 30m with a trace intervals of 1.5m and 0.75m per electrode spacing respectively. The result display by Self Potential signals gives a clear understand that water flow from higher value (central towards the lower value which is mostly at the southwest part than other areas and distinct level of feasible flow at different part ranges from -30mV to +35mV,which are very related to seepage flow patterns, negative SP anomalies were related with subsurface seepage flow paths (recharge zone and positive SP anomalies were related with areas of seepage outflow (discharge zone; and Ground Magnetic signals shows good details of the buried materials with high magnetic values which was interpreted as baked clay bricks and low magnetic values indicate groundwater seepage with depth of 5m. Therefore, the two results have correlation significant at 0.8 which show good correlation in groundwater investigation in this study, which validates the results.

Analisis Potensi Sumberdaya Air Daerah Aliran Sungai Singkil Menggunakan Model Tangki

Directory of Open Access Journals (Sweden)

Mustafril Mustafril

2014-04-01

Full Text Available Abstrak. Kebutuhan air terus meningkat seiring pertumbuhan penduduk, sedangkan air yang tersedia tidak selalu sejalan antara kebutuhannya menurut volume, tempat, waktu dan kualitasnya. Model-model hidrologi berdasarkan Tank Model telah dikembangkan dalam penelitian di Indonesia dan di dunia untuk memprediksi potensi sumberdaya air dalam suatu DAS. Optimasi parameter Tank Model dapat menggunakan Artificial Neural Network (ANN yang mempunyai kemampuan untuk belajar dari data dan tidak membutuhkan waktu yang lama untuk mencapai model optimal. Tujuan analisis ini untuk menentukan seberapa besar potensi sumberdaya air di DAS Singkil berdasarkan optimasi parameter Tank Model. Hasil optimasi keseimbangan air parameter Tank Model DAS Singkil meliputi: karakteristik hidrologi DAS Singkil meliputi debit minimum 3,60 mm/hari, debit maksimum 17,80 mm/hari, dan rasio debit maksimum/minimum 4,94. Indikator kesalahan Tank Model DAS Singkil meliputi: R (Coefficient of Correlation sebesar 0,6471, MAE (Mean Absolute Error dan RMSE (Root Square Mean Error masing-masing 2,18 dan 2,73. Total inflow 3.189,48 mm/tahun dan total outflow 3.155,64 mm/tahun, yang terdiri dari: surface flow 11,75 mm/tahun, subsurface flow 669,84 mm/tahun, intermediate flow 62,05 mm/tahun, subbase flow 0,74 mm/tahun, dan base flow 2.411,26 mm/tahun. Berdasarkan total baseflow volume ketersediaan air total yang mengalir di Sungai Singkil mencapai 12.164 x 106 m3/tahun. Potensi sumberdaya air DAS Singkil untuk keperluan pertanian mencapai 3.438,4 x 106 m3/tahun   Analysis of Potential Water Resources at Singkil Watershed using Tank Model Abstract. Water demand continues to increase as the population growth, while the availability of water is not always consistent with the needs in terms of volume, place, time and its quality. Tank based hydrological models have been developed in many researches in Indonesia and in the world to predict the potential of water resources in a watershed. The

Topographic data acquisition in tsunami-prone coastal area using Unmanned Aerial Vehicle (UAV)

Science.gov (United States)

Marfai, M. A.; Sunarto; Khakim, N.; Cahyadi, A.; Rosaji, F. S. C.; Fatchurohman, H.; Wibowo, Y. A.

2018-04-01

The southern coastal area of Java Island is one of the nine seismic gaps prone to tsunamis. The entire coastline in one of the regencies, Gunungkidul, is exposed to the subduction zone in the Indian Ocean. Also, the growing tourism industries in the regency increase its vulnerability, which places most of its areas at high risk of tsunamis. The same case applies to Kukup, i.e., one of the most well-known beaches in Gunungkidul. Structurally shaped cliffs that surround it experience intensive wave erosion process, but it has very minimum access for evacuation routes. Since tsunami modeling is a very advanced analysis, it requires an accurate topographic data. Therefore, the research aimed to generate the topographic data of Kukup Beach as the baseline in tsunami risk reduction analysis and disaster management. It used aerial photograph data, which was acquired using Unmanned Aerial Vehicle (UAV). The results showed that the aerial photographs captured by drone had accurate elevation and spatial resolution. Therefore, they are applicable for tsunami modeling and disaster management.

Laku Gunung Sagara: Perubahan Sosial dengan Pendekatan Koreografi Lingkungan

Directory of Open Access Journals (Sweden)

Hendro Martono

2013-11-01

Laku Gunung Sagara Dance. A social phenomenon has occurred in Suru Kumadang village, Tanjungsari Gunungkidul. For the past ten years, many villagers who were originally farmers have switched their professions into merchants in marine sector, pioneered by women who previously work as part-timers but now work as full-timers. The purpose aims at transforming the inner turmoil of Gunungkidul villagers’ social phenomenon into a work of art. The work of art uses environmental choreography approach to dissect the earth and sky repertoires, gayuh bumi and segara gunung. Based on the choreography analysis and theater semiotics, Laku Gunung Segara is the manifestation of Labuhan in the daily lives of villagers in Suru. Furthermore, in the view of the villagers, the South Queen is an incarnation of Goddess Sri so that the villagers are no longer afraid to work at sea. In conclusion, the environmental choreography has managed to interpret and develop the entire phenomenon. The cultural fi nding is that the villagers, who have advanced their arts, consider the importance of training and support active collaboration. Keywords: gunung- segara dance, environmental choreography

OPTIMASI TATA GUNA LAHAN DAN PENERAPAN REKAYASA TEKNIK DALAM ANALISA BANJIR DI DAERAH ALIRAN SUNGAI: STUDI KASUS DAERAH ALIRAN SUNGAI CILIWUNG HULU DI BENDUNG KATULAMPA (The Optimization of Land Use and the Application of Engineering Treatment in Flood

Directory of Open Access Journals (Sweden)

Yohana Lilis Handayani

2005-07-01

Full Text Available ABSTRAK Peningkatan aliran puncak dan volume runoff dari flood hydrograph dapat disebabkan oleh konversi penggunaan lahan. Fenomena ini terjadi di cekungan hulu sungai Ciliwung sebagai daerah konservasi. DAS ini memiliki peran penting dalam memelihara ketersediaan air di cekungan Ciliwung dan untuk pengendalian banjir di daerah hilir. Berdasarkan data yang dicatat dari 1993 sampai dengan 1996, 14,6% kejadian banjir di daerah hilir disebabkan oleh banjir kiriman. Evaluasi konversi penggunaan lahan di daerah hulu Ciliwung dilakukan dengan membandingkan penggunaan lahan tahun 1989 dan 1998. Optimasi tata guna lahan dilakukan dengan optimasi linier untuk meminimasi nilai koefisien composite runoff. Pendekatan teknis dan penerapan rekayasa teknik digunakan untuk simulasi penurunan aliran puncak dan volume runoff dari flood hydrograph. Perlakuan ini meliputi terracing dan normalisasi kolam detensi (detention pond. Simulasi dilakukan untuk periode banjir 10 tahunan. Hasil analisis menunjukkan bahwa dalam periode 10 tahun (1989-1998 penggunaan lahan dikonversi secara signifikan. Konversi ini menyebabkan peningkatan aliran puncak dan volume runoff masing-masing 18,97% dan 18,87%.   ABSTRACT The risk of peak flow and runoff volume of a flood hydrograph may be caused by land use conversion. This phenomenon had happened in upstream of Ciliwung basin. As a conversation area, this catchment has an important role in maintaining the water availability of Ciliwung basin and for flood control in downstream area. Based on the collected flood data recorded from 1993 to 1996, 14.6% of flood events in downstream of Ciliwung basin were caused by delivery flood from upstream area. Evaluation of land use conversion in upstream of Ciliwung basin was carried out by comparing land use in 1989 and in 1998. Land use optimization was done using linear optimization to minimize the value of composite runoff coefficient. Technical approach of engineering treatment was used to

IDENTIFIKASI IKAN SAPU-SAPU (Loricariidae BERDASARKAN KARAKTER POLA ABDOMENDI PERAIRAN CILIWUNG

Directory of Open Access Journals (Sweden)

Fatihah Dinul Qoyyimah

2016-06-01

Full Text Available Ikan sapu-sapu (Loricariidae merupakan invasive species yang terdapat pada beberapa negara, salah satunyaIndonesia. Ikan tersebut dapat ditemukan pada sungai Ciliwung. Bagian hilir dari sungai tersebut adalah Kota Jakarta.Ikan sapu-sapu yang terdapat di Indonesia termasuk pada Genus Pterygoplichthys. Genus Pterygoplichthys masihsulit dibedakan berdasarkan karakter morfologi. Salah satu cara yang dapat dilakukan untuk mengidentifikasi ikantersebut adalah melihat pola abdomen. Sampel yang digunakan berjumlah 28 ekor. Identifikasi berdasarkan polaabdomen yang dapat dilakukan dengan melihat literatur yang ada. Hasil penelitian yang dilakukan menunjukkanterdapat 2 spesies ikan sapu-sapu pada sungai Ciliwung dan jenis inter-grade. Spesies tersebut adalah Pterygoplichthyspardalis dan Pterygoplichthys disjunctivus.

IDENTIFIKASI IKAN SAPU-SAPU (Loricariidae BERDASARKAN KARAKTER POLA ABDOMENDI PERAIRAN CILIWUNG

Directory of Open Access Journals (Sweden)

Fatihah Dinul Qoyyimah

2016-11-01

Full Text Available Ikan sapu-sapu (Loricariidae merupakan invasive species yang terdapat pada beberapa negara, salah satunyaIndonesia. Ikan tersebut dapat ditemukan pada sungai Ciliwung. Bagian hilir dari sungai tersebut adalah Kota Jakarta.Ikan sapu-sapu yang terdapat di Indonesia termasuk pada Genus Pterygoplichthys. Genus Pterygoplichthys masihsulit dibedakan berdasarkan karakter morfologi. Salah satu cara yang dapat dilakukan untuk mengidentifikasi ikantersebut adalah melihat pola abdomen. Sampel yang digunakan berjumlah 28 ekor. Identifikasi berdasarkan polaabdomen yang dapat dilakukan dengan melihat literatur yang ada. Hasil penelitian yang dilakukan menunjukkanterdapat 2 spesies ikan sapu-sapu pada sungai Ciliwung dan jenis inter-grade. Spesies tersebut adalah Pterygoplichthyspardalis dan Pterygoplichthys disjunctivus.

HOSPES PERANTARA DAN HOSPES RESERVOIR FASCIOLOPSIS BUSKI DI INDONESIA Studi Epidemiologi F. buski di Kabupaten Hulu Sungai Utara, Kalimantan Selatan Tahun 2002 dan 2010

Directory of Open Access Journals (Sweden)

Anorital -

2013-12-01

Full Text Available ABSTRACT Buski intestinal worm disease (fasciolopsiosis is an endemic disease in some villages in the Hulu Sungai Utara district. Since the discovery of the case in 1982 until recently, the fasciolopsiosis prevalence has not showed a declining trend. Even in some periods it seems to rise, despite mitigation efforts continue to be implemented through various surveys, which ended with the drugs administration.Unidentified intermediate hosts and reservoir hosts is one constraint in the disease control.To determine the epidemiological cycle of F. buski, two studies were conducted by two research institutions under the Research and Development Agency in 2002 by Anorital, etal. and 2010 by Annida.Results from both studies showed that there were 3 kinds of water plants (second intermediate host consumed by communities; the lily (Nymphea alba, bird lotus(Nymphea lotus and water spinach (Ipomea aquatica which was positive of Metasercariae and Cercariae. Two of four types of freshwater snails (the first intermediate host specimens examined were positive of redia and cercariae; kalambuai snail (Lymnea sp. and flat snails (Indoplanorbis sp.. One of four animal manure specimens examined was positive of F. buski egg (found in buffalo dung. It was also found two egg specimens from chicken and alabio duck manure whichis resembled to F. buski. But in terms ofsize, it was much smaller than the egg of F. buski. Despite these positive findings, the confirmation from experienced research institutions is needed. It is expected that the Buski intestinal worm disease (fasciolopsiosis control can be conducted effectively. An in-depth study is also needed. Key words: Fasciolopsis buski, fasciolopsiosis. ABSTRAK Penyakit kecacingan buski (fasciolopsiosis merupakan penyakit yang endemis di beberapa desa di kabupaten Hulu Sungai Utara. Sejak ditemukan kasus penyakit ini pada tahun 1982 dan sampai saat ini, prevalensi fasciolopsiosis tidak menunjukkan kecenderungan menurun

Persistent organic pollutants in the Muda area

International Nuclear Information System (INIS)

Zuriati Zakaria; Md Pauzi Abdullah; Laily Din

2002-01-01

A screening for the presence of Persistent Organic Pollutants (POP) in Malaysia was undertaken by the Universiti Kebangsaan Malaysia as part of the Department of Environment's assessment process to study the extent of bioaccumulation or the transboundary effect of POPs in the country. Water, sediment and fish samples were tested for the presence of nine compounds which were aldrin, dieldrin, chlordane, DDT, hexachlordane, hexachlorobenzene, mirex, toxaphene and heptachlor. The Muda area was one of the areas investigated where samplings were conducted at Sungai Tajar, Sungai Tala and Sungai Fadang. Analyses of the samples showed that residues of DDT, aldrin, dieldrin, endrin and BHC were present in the sediment.The water samples also showed the presence of aldrin and dieldrin. (Author)

Pengaruh Kepemimpinan Kepala Sekolah, Motivasi Kerja, dan Budaya Sekolah Terhadap Kinerja Guru

Directory of Open Access Journals (Sweden)

Sri Setiyati

2014-10-01

Full Text Available The objective of this study was to determine: (1 the influence of principals’ leadership, work motivation, and school culture on the performance of State Vocational High School teachers in Gunungkidul Regency, (2 the influence of principal’s leadership on the teachers’ performance (3 the influence of job motivation on the teachers’ performance, (4 the influence of school culture on the teachers’ performance. The study was a quantitative descriptive study. The population of the study were 753 teachers of State Vocational High School teachers in Gunungkidul regency. The results of the data analysis showed (1 there is positive and very significant influence of the principal’s leadership, work motivation, and school cultures on the teachers’ performance with the percentage of 42,2 % (2 there is positive and very significant influence of the of principal’s leadership on the teacher’s performance with the percentage of 18,22% (3 there is positive and very significant influence of work motivation on the teachers’ performance with the percentage of 13,03% (4 there is positive and very significant influence of school culture on the teachers’ performance with the percentage of 10,94%.

PENGARUH UMUR TUMBUHAN AREN TERHADAP PRODUKSI NIRA DI DESA MURUNG A KECAMATAN BATU BENAWA KABUPATEN HULU SUNGAI TENGAH KALIMANTAN SELATAN

Directory of Open Access Journals (Sweden)

Fatriani Fatriani

2016-08-01

Full Text Available This study aims to determine the effect of age on the sap of palm plants produced from A Murung Village, Sub Batu Benawa Hulu Sungai Tengah District, South Kalimantan. Based on simple linear regression analysis it can be seen the following equation: Y = 12.6612 - 0.2625999 * age plant. Sap production varies inversely with the mean age of palm plants with increasing age, the more little palm plant sap produced. F hit (15.24> F tab (9:07 means that age has a significant influence on the production of palm juice either at the level of confidence of 5% or 1% of the above regression equation can be estimated (predicted by age palm juice production plant . The results of the calculation of the correlation coefficient (r indicates the closeness of the relationship between age with the production of palm juice, this is indicated by r values of -0.734597 (close to -1, mean age of palm plants have a very close correlation with the production of palm juice, while based on the coefficient of determination (R2 known value is 53.9632%, means the production of palm juice is influenced by the age factor while the remaining 53.96% influenced by other factors. Age factor has a strong relationship with the production of palm wine (the correlation coefficient of -0.734597. Age factor is inversely proportional to the roduction of palm juice, palm sugar The older age of the plants produced less sap, Age 11 years generating plants aren aren at most ( 10.68 liters while the lowest is 30 years old (2.34 liters, Need palm cultivation in the area within the framework of sustainability brown sugar.Technic tapping sugar production in order to maximize the production of palm juice should really be considered, Ways to maximize production Nira through efforts to extend the period of tapping palm bunches of flowers should also be noted. Keywords :Age plants, production, Nira

Assessment of Water Salinity Model Using Hydrodynamic Numerical Modelling in Estuary of Selangor River, Malaysia

International Nuclear Information System (INIS)

Mohd Ekhwan Toriman; Mohd Ekhwan Toriman; Norbaya Hashim; Mohd Khairul Amri Kamarudin; Abdul Jalil Hassan; Ayaari Muhamad; Nor Azlina Abd Aziz

2015-01-01

Issues such as water pollution and extraction of water from Sungai Selangor system has been said to be the cause of fading fireflies. Salinity intrusion into estuary of the Sungai Selangor has been carried out on a hydrodynamic numerical modeling to access the parameter that governed the amount of salt in the river. The berembang trees on the river bank that become the fireflies habitat need some amount of salt for proper growth. Living at the lower reaches of Sungai Selangor, the fireflies are affected not only by the activities in their vicinity, but by activities in the entire river basin. Rapid economic development in the basin and the strong demand for the water resources puts pressure on the ecosystem. This research has been carried out to investigate the effect of water extraction along Sungai Selangor towards altering the amount of salt content in the river. The hydrodynamic modeling with regards to the salt content is expected to support long term assessment that may affect the berembang trees as a result of changes in the flow from upstream because of the water abstraction activity for domestic water supply. (author)

IDENTIFIKASI IKAN SAPU-SAPU (Loricariidae) BERDASARKAN KARAKTER POLA ABDOMENDI PERAIRAN CILIWUNG

OpenAIRE

Fatihah Dinul Qoyyimah; Dewi Elfidasari; Melta Rini Fahmi

2016-01-01

Ikan sapu-sapu (Loricariidae) merupakan invasive species yang terdapat pada beberapa negara, salah satunyaIndonesia. Ikan tersebut dapat ditemukan pada sungai Ciliwung. Bagian hilir dari sungai tersebut adalah Kota Jakarta.Ikan sapu-sapu yang terdapat di Indonesia termasuk pada Genus Pterygoplichthys. Genus Pterygoplichthys masihsulit dibedakan berdasarkan karakter morfologi. Salah satu cara yang dapat dilakukan untuk mengidentifikasi ikantersebut adalah melihat pola abdomen. Sampel yang digu...

ESTIMASI KELIMPAHAN IKAN GABUS (Channa striata Bloch, 1793 DENGAN METODE HIDROAKUSTIK DI SUNGAI LEMPUING, SUMATERA SELATAN

Directory of Open Access Journals (Sweden)

Zulkarnaen Fahmi

2016-03-01

Full Text Available Kegiatan pengkajian stok sumberdaya ikan yang dilakukan secara berkala bertujuan untuk optimasi pemanfaatan sumberdaya perikanan bagi kegiatan perikanan tangkap. Kegiatan pengkajian stok ikandengan survey akustik di perairan Lubuk Lampam telah dilakukan pada tahun 2011 sebanyak 2 (dua kali dengan interval waktu 3 (tiga bulan untuk melihat perubahan kelimpahan ikan gabus (Channa striatadi perairan tersebut. Ekstraksi data akustik meliputi data sebaran kelimpahan dan distribusi ukuran ikan dilakukan untuk melihat keragaman (variance nilai yang diperoleh. Hasil penelitian menunjukkan bahwa estimasi rata-rata kelimpahan ikan pada bulan Maret sebesar 7.53 ± 1.33 ekor/m2  lebih rendah dibandingkan pada bulan Mei sebesar 53.11 ± 9.43  ekor/m2  . Biomass ikan pada bulan Maret sebesar 75.59 ± 30.22 kg/ha lebih rendah dibandingkan pada bulan Mei sebesar 521 ± 65.01 kg/ha. Nilai rataan target strength ikan tunggal yang terdeteksi pada bulan Maret sebesar -54.81 ± 0.9 dB lebih rendah dibandingkan pada bulan Mei sebesar -50.03 ± 0.35 dB. Estimasi kelimpahan dan distribusi ikan di sungai Lempuing menunjukkan nilai keragaman (variance yang lebih rendah pada bulan Maret dibandingkan dengan bulan Mei 2011 untuk parameter kelimpahan dan biomass ikan, sedangkan untuk nilai rataan target strength ikan menunjukkan sebaliknya. Fish assessment using hydroacoustic in inland water was conducted to optimize fish exploitation activity. Successive hydroacoustic survey was conducted twice with interval three months in 2011 to estimated distribution fish abundance and size distribution of snakehead fish (Channa striata Bloch, 1793 in Lempuing River, South Sumatera. Reability test was conducted on hydroacoustic data including data distribution and abundance of fish size distribution to obtain edvariance value. The results showed that the average estimate abundance of fish on March about 7.53 ± 1.33 fish/m2 lower than in the month of May at 53.11 ± 9.43 fish/m2

Sociodemographic profile and predictors of outpatient clinic attendance among HIV-positive patients initiating antiretroviral therapy in Selangor, Malaysia

OpenAIRE

Abdulrahman, Surajudeen Abiola; Rampal, Lekhraj; Othman, Norlijah; Ibrahim, Faisal; Hayati, Kadir Shahar; Radhakrishnan, Anuradha P

2017-01-01

Surajudeen Abiola Abdulrahman,1,2 Lekhraj Rampal,1 Norlijah Othman,3 Faisal Ibrahim,1 Kadir Shahar Hayati,1 Anuradha P Radhakrishnan4 1Department of Community Health, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Selangor, 2Department of Public Health Medicine, Penang Medical College, George Town, Penang, 3Department of Paediatrics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Selangor, 4Infectious Disease Clinic, Hospital Sungai Buloh, Sungai Bulo...

Study on rhizobium interaction with osmoprotectant rhizobacteria for improving mung bean yield

Science.gov (United States)

Maryani, Y.; Sudadi; Dewi, W. S.; Yunus, A.

2018-03-01

Gunungkidul has calcareous soil with limitations including calcareous stone, mostly hilly terrain, and shallow cultivated layer. Furthermore, nowadays we face the disadvantages climates such as long dry seasons, a short rainy season and high temperatures caused by climate change. Climate change leads to irregular rainwater availability for microbes and crops. Research in this field is currently needed as climate change affected directly on crop production, while we need to find the strategy to keep high productivity of the plant. This research aimed to determine the ability of osmoprotectant rhizobacteria and rhizobium to support mung bean yield. Osmoprotectant rhizobacteria were isolated and screened from the calcareous soil in Gunungkidul with disadvantageous climates such as a long dry season, a short rainy season and high temperature. This research was arranged in Completely Randomized Design. The result showed that osmoprotectant rhizobacteria isolate of strain Al24-k and Ver5-k can produce 9.6306 mg g‑1 cell of glycine betaine in a soil density 1.7667 x 107 CFU g‑1 and 11.4870 mg g‑1 cell of glycine betaine in a soil density 1.9667 x 107 CFU g‑1. Inoculation of isolates osmoprotectant rhizobacteria can support mung bean yield. Osmoprotectant rhizobacteria isolate did not effect rhizobium in mung bean rhizosphere.

Difference planted season and creeper-pole on both growth and yield of the two cultivars of velvet bean (Mucuna pruriens (L. DC.

Directory of Open Access Journals (Sweden)

SUPRIYONO

2008-07-01

Full Text Available The aims of this research were to know the effect of different cultivars, planted seasons and creeper poles at velvet bean (Mucuna pruriens (L. DC. growth, yield and their interactions. This research was conducted on litosol soil in Tancep, Ngawen, Gunungkidul on 170 m up sea level and 9-10° elevation. The depth of soil tillage was 5-17 cm. Design utilization was Randomized Completed Block Design (RCBD with factorial 3 factors. The treatment was (i cultivars: rase and putih Gunungkidul (ii planted seasons: dry and rainy seasons and (iii creeper-poles: control, corn 0 weeks old, corn 2 weeks old, corn 4 weeks old and bambu. There is replicated 3 times. The result of this research was the 1st velvet bean growth on rainy season was rapidly but they have long time planted. The 2nd, by splited rase cultivars, rainy season and creeper-pole utilization was yield increased. The 3rd, on the rainy season, the high yield was come by rase cultivar and creeper-pole utilization. The 4th, with the 2 times velvet bean density and without calculated corn yield, rase cultivar planted on rainy season and bamboo creeper-pole coused the highest velvet bean yield but no significant different with 4 weeks corn creeper-pole.

Penanganan Susut Panen dan Pasca Panen Padi Kaitannya dengan Anomali Iklim di Wilayah Daerah Istimewa Yogyakarta

Directory of Open Access Journals (Sweden)

Mahargono Kobarsih

2015-08-01

Full Text Available To reduced losses in rice farming requires the application of modern agricultural machinery in harvesting equipment, postharvest and processing. Varying knowledge of farmers and entrepreneur rice milling unit (RMU in yield loss as well as the impacts of global climate change research should be conducted through a structured survey of farmers and entrepreneurs RMU in Yogyakarta. Results obtained demonstrate the preferred use of new type variety among farmers so that the tool is suitable harvest sickle cutting down system in districts of Bantul and Gunungkidul more popular as straw used for animal feed. More than 70% of farmers do at harvest time by looking at the panicle and leaf color. Utilization of power threshers more developed in Sleman because of such preferred cut up and threshing by stampede way. With the limitations of manpower, the farmer was forced to delay harvest in Gunungkidul. The thickness of the grain is dried in the sun need to be added so as not too thin and can produce more rice intact during milling. Entrepreneur RMU need to complete with seed cleaner to increase the yield, as well as using double-pass system so that quality and yield of rice produced would be better.

Kajian Kerusakan Lingkungan Karst sebagai Dasar Pelestarian Sumberdaya Air (Kasus di DAS Bribin Hulu Kabupaten Gunung Kidul Daerah Istimewa Yogyakarta

Directory of Open Access Journals (Sweden)

Raras Endarto

2016-09-01

ABSTRACT Groundwater resources in Gunung Kidul Regency synonymous with underground system Bribin  (Bribin watershed. Reservoir Bribin 1, Bribin 2, and Seropan located in the Dadapayu village Semanu Sub-District utilize to comply needs of population  in Gunung Kidul Regency. Existance of Bribin Watershed is very important for continuance and welfare of population which must be managed sustainability. Environmental management in order to achieve sustainability of water resources was emphasized on water recharge, namely Bribin Watershed of upstream section. Identification extent of damage in Bribin Watershed into one of urgency things because the area as underground supplier into reservoir river of Bribin, Baron, and Seropan was utilized for the needs of population. Extent damage of karst is assessed based on morphology of karst basin. This research was conducted using field observations and literature studies related to condition os study area. Considered of  karst damage parameters, includes morphology change caused by mining, existance outlet basin, land cover, condition of springs, caves, and existance of building over the karst surface must be conducted assessment in extent of damage. Administratively, extent of damage karst is very high located in Kenteng, Karangasem, and Bedoyo Village, area of 922.27 hectares. The high levels of extent of damage karst is Ponjong, Sawahan, Sumbergiri Village, area of 9424.24 hectares. The high levels of extent of damage karst among others, existance of great mining, springs, and building over the karst surface. Efforts conservation and management strategies commits based on characteristic karst and regional. Karst management policy strategies based on characteristic karst was pressed in surface appearace(eksokarst. Karst management policy strategies based on regional are management karst area plan overall. Water resources management is related to existence of karst component (eksokarst, include management of springs

ENVIRONMENTAL MANAGEMENT AT KUNING RIVER COURSE IN MERAPI VOLCANO YOGYAKARTA SPECIAL REGION (Pengelolaan Lingkungan Alur Kali Kuning di Gunungapi Merapi Daerah Istimewa Yogyakarta

Directory of Open Access Journals (Sweden)

Darmakusuma Darmanto

2013-03-01

Full Text Available ABSTRACT This Research aims at: (a to  study the influence of grain size and amount of sediment to the river course function and geometry, (b analyzing the impact of the using the sediments, water and land to the river channel and (c evaluating the current environmental management and formulating some strategies for future river management. Beside that Merapi Volcano is known as the most active volcano in the world and it is pointed as a National Park because of the amount of vegetation specieses. The methods of this research are threehold: (1 morphometrical measurement of  Kuning River e.g depth and width coupled with the analysis of the sediment (e.g  diameter, specific gravit, percentage of boulders; (2 physical-environmental aspect determination (vegetation, percentage of coverage and (3 social-economic survey in order to determine the household improvements, level of income, socialization of sediment related hazards as well as the sand mining.   These three analysis were conducted in the framework of ecology and spatial concept. The results obtained in this research are: 1 Merapi eruptions materials diturbed the river channel geometry to an abnormal condition following the rules of ecology, also the function of river as: gathering, storage and drainage of water and sediment, 2 utilization of river courses for water supply, agriculture and mining in particular sand, rocks and boulders can be made a spatial planning arrangement and  utilization is also to improve the welfare of local society and the District, 3 evaluation management to catchment or river course is undeveloped and have not even seen, so it requires management that is based on Indonesian regulation and should also noticed the characteristics of Merapi Volcano such as lahar, nuee ardente and the dense of population in the research area. ABSTRAK   Pentelitian ini bertujuam: (a mempelajari pengaruh besaran sedimen terhadap fungsi alur sungai, (b menganalisis dampak terhadap

Analisis Preferensi Visual Lanskap Pesisir Daerah Istimewa Yogyakarta untuk Pengembangan Pariwisata Pesisir Menuju pada Pengelolaan Wilayah Pesisir Berkelanjutan

Directory of Open Access Journals (Sweden)

Nurul Khakhim

2008-07-01

Full Text Available The aim of this research is to analyze of DIY coastal landscape with visual preference analysis for suistanble coastal tourism development and management. The unit of analysis that used is coastal typology. The guideline in deciding the classification of coastal typology is using the Response-Process System with relief/slope, main constructing material, genesis process and dominate process happened in the meantime such as tide, wave and river flow. This response-process system divide the coastal typology into seven classes including coastal typology of land erosion coast, sub aerial deposition coast, volcanic coast, structurally shaped coast, wave erosion coast, marine deposition coast and coast built by organism. The method of SBE (Scenic Beauty Estimation is used for visual preference analysis, and the method used to compose the policy of costal tourism development is SWOT method. Result shows that all seven coastal typology are found in the coastal area. Land erosion coast and coast built by organism dominate in Gunungkidul coastal area and then in Bantul and Kulon Progo coastal area are dominated by marine deposition coast and sub aerial deposition coast. Volcanic coast, structurally shaped coast, wave erosion coast can only be found in a small area of Gunungkidul coast. Each of this coastal typology has a special land characteristic which can be used to develop its potential. Coast built by organism is very suitable for tourism activity proved by the high score of SBE from the respondents. Recommendation for developing coastal area in area of interest is by developing the coastal natural resources suitable to its physical typology, because this will make the management of coastal area for continuous development easier. Recommendations for coastal management in Gunungkidul including mapping and classification of protected karst area and mineable karst area to secure the run of coastal area management, for coastal management in Bantul using

Marketing Communication Strategies of Cultural and Tourism Departments of Gunungk Kidul and Sleman Regencies: a Comparative Analysis

OpenAIRE

Ayu, Resa

2010-01-01

Yogyakarta Special Province has several attractive destinations for tourist. Bantul, Sleman, Kulon Progo, and Gunungkidul regencies have been developing many ways to attract tourists so they desire to come its regency own places. As long as we know, each regency has been working hard to promote and persuade tourists to visit some places that was offere But, in the fact, the result or the amount of tourists that visited each regency was different. Accroding data, the number of tourist who visi...

Monthly streamflow forecasting with auto-regressive integrated moving average

Science.gov (United States)

Nasir, Najah; Samsudin, Ruhaidah; Shabri, Ani

2017-09-01

Forecasting of streamflow is one of the many ways that can contribute to better decision making for water resource management. The auto-regressive integrated moving average (ARIMA) model was selected in this research for monthly streamflow forecasting with enhancement made by pre-processing the data using singular spectrum analysis (SSA). This study also proposed an extension of the SSA technique to include a step where clustering was performed on the eigenvector pairs before reconstruction of the time series. The monthly streamflow data of Sungai Muda at Jeniang, Sungai Muda at Jambatan Syed Omar and Sungai Ketil at Kuala Pegang was gathered from the Department of Irrigation and Drainage Malaysia. A ratio of 9:1 was used to divide the data into training and testing sets. The ARIMA, SSA-ARIMA and Clustered SSA-ARIMA models were all developed in R software. Results from the proposed model are then compared to a conventional auto-regressive integrated moving average model using the root-mean-square error and mean absolute error values. It was found that the proposed model can outperform the conventional model.

KAJIAN STRATEGI PROMOSI KESEHATAN SANITASI TOTAL BERBASIS MASYARAKAT (STBM DI KELURAHAN TIRTO KECAMATAN PEKALONGAN BARAT KOTA PEKALONGAN

Directory of Open Access Journals (Sweden)

Yulis Indriyani

2016-07-01

Full Text Available Latar Belakang: Sanitasi Total Berbasis Masyarakat (STBM merupakan pendekatan untuk mengubah perilaku higienis dan saniter melalui pemberdayaan masyarakat dengan cara pemicuan. Fenomena yang terjadi di Kelurahan Tirto masih terdapat perilaku BABS sebanyak 84 KK, perilaku buang sampah secara sembarangan (di lahan kosong dan sungai, dan mengalirkan limbah cair rumah tangga (limbah deterjen dan air bekas mandi ke sungai. Tujuan penelitian: Mengkaji secara mendalam strategi promosi kesehatan (advokasi, bina suasana, dan pemberdayaan masyarakat STBM di Kelurahan Tirto Kecamatan Pekalongan Barat Kota Pekalongan. Rancangan penelitian ini menggunakan metode studi kasus dengan desain eksploratoris kualitatif. Hasil penelitian: Pencapaian lima pilar  STBM di Kelurahan Tirto belum maksimal yaitu pada pilar stop BABS dan pilar pengelolaan limbah cair rumah tangga secara aman. Terdapat beberapa hambatan yang mempengaruhi hasil capaian tersebut diantaranya konsistensi komitmen yang tegas belum diterapkan bagi pelaku yang mengalirkan pembuangan feses ke sungai, belum adanya pelatihan teknis STBM bagi tokoh masyarakat, metode CLTS bersifat terbatas di satu RW, dan masyarakat Kelurahan Tirto belum mengoptimalkan swadaya atau iuran secara kolektif untuk menyediakan penambahan sarana sanitasi berupa septic tank dan bak penampungan. Saran: Pertama, penerapan punishment dari Kelurahan Tirto untuk mencapai Kelurahan ODF bagi pelaku yang mengalirkan pembuangan feses ke sungai. Kedua, pertemuan untuk menjalin koordinasi antara Pemerintah Kota Pekalongan dan Pemerintah Kabupaten Pekalongan untuk bersama mengelola limbah cair rumah tangga secara aman. Ketiga,  pelatihan teknis STBM bagi tokoh masyarakat untuk mencapai perilaku buang air besar secara sehat di Kelurahan Tirto. Keempat, penambahan bak penampungan limbah cair rumah tangga melalui swadaya masyarakat.

ANALISIS FAKTOR-FAKTOR YANG BERPENGARUH TERHADAP PENGGUNAAN LEMBAGA BANK SYARIAH: STUDI DI PROPINSI DAERAH ISTIMEWA YOGYAKARTA

Directory of Open Access Journals (Sweden)

Duddy Roesmara Donna

2012-12-01

Full Text Available This research aims to analyze factors that affect the using of sharia nance institution in the Province of DIY. This research involved 150 respondents distributed throughout Yogyakarta City, Bantul Regency, Kulon Progo, Gunungkidul Regency, and Sleman Regency. A purposive non-probability sampling method was used to predict population behavior, with factor analysis as a tool of analysis. The preference of using sharia nance institution was affected by institution factor, including institutional ones, loyalty of Islamic law, service, and the suitability of product.

Application of remote sensing data and geographic information system (GIS) in the selection of a NPP potential site in west Kalimantan

International Nuclear Information System (INIS)

Heni Susiati; Yarianto SBS; Kurnia Anzhar; Bansyah Kironi; June Mellawati

2015-01-01

Potential site selection on spatial basis which applied throughout the coast of West Kalimantan has been performed by adding additional criteria compare to the criteria used in 2014. The objective of research is to get the potential site of nuclear power plants (NPP) in the coastal areas of West Kalimantan Province based on the applicable criteria. Research methods include collecting of primary data, interpretation of remote sensing data, and weighting analysis based on SIG. The research results obtained six of potential site for NPP, i e., Air Besar Village Kendawangan Sub-district Ketapang Regency (first rank), Sie Village Simpang Hilir Sub-district Kayong Regency (second rank), Sungai Kanan Village Muara Sub-district Ketapang Regency (third rank), Sungai Nanjung Village Matan Sodascorbate Ketapang Regency (fourth rank), Kendawangan Kanan Village Kendawangan Sub-district Ketapang Regency (fifth rank) dan Sungai Nanjung Village Matan Sub-district Ketapang Regency, Matang Village Paloh Sub-district, Sambas Regency (sixth rank). Analysis of land suitability showed that all potential has met the general and specific criteria, among other things because it is not a peat and far away from the settlements. (author)

Kajian Pemilihan Sumber Mikroorganisme Solid Phase Microbial Fuel Cell (SMFC Berdasarkan Jenis dan Volume Sampah, Power Density dan Efisiensi Penurunan COD

Directory of Open Access Journals (Sweden)

Ganjar Samudro

2017-06-01

Full Text Available Mikroorganisme merupakan salah satu komponen penting dalam proses Solid Phase Microbial Fuel Cell (SMFC untuk degradasi bahan organik dan transfer elektron. Pemilihan sumber mikroorganisme menjadi metode yang paling sederhana untuk dikaji sebagai informasi awal ketersediaan dan identifikasi jenis mikroorganisme yang mendukung proses SMFC. Tujuan kajian ini adalah untuk memilih sumber mikroorganisme tanah, septic tank dan sedimen sungai yang tepat digunakan dalam proses SMFC berdasarkan jenis dan volume sampah, power density, dan efisiensi penurunan COD. Kajian ini didasarkan pada hasil penelitian menggunakan reaktor SMFC tipe single chamber microbial fuel cell dengan variabel jenis dan volume sampah , serta sumber mikroorganisme. Metode perbandingan secara kuantitatif dilakukan berdasarkan kecenderungan nilai power density dan efisiensi penurunan COD tertinggi di antara jenis dan volume sampah kantin, dedaunan dan komposit kantin-dedaunan. Hasil yang didapatkan adalah sumber mikroorganisme tanah dan sedimen sungai tepat digunakan untuk volume sampah 1/3 dan 2/3 dari volume reaktor, sedangkan sumber mikroorganisme septic tank tepat digunakan untuk volume sampah 1/3 dan 1/2 dari volume reaktor. Sumber mikroorganisme dari septic tank menunjukkan kinerja power density dan efisiensi penurunan COD yang lebih rendah dibandingkan sumber mikroorganisme tanah dan sedimen sungai.

Penentuan Pelabuhan Hub untuk Crude Palm Oil (CPO Ekspor di Indonesia

Directory of Open Access Journals (Sweden)

Eko Andi Haranto

2013-03-01

Full Text Available CPO (Crude Palm Oil merupakan salah satu komoditi ekspor terbesar di Indonesia. Moda angkut darat dan sungai menjadi pilihan untuk didistribusikan menuju calon pelabuhan hub. Tugas Akhir ini bertujuan untuk merencanakan pola operasi armada pengangkut CPO, dan penentuan pelabuhan hub untuk ekspor CPO. Metode Transportasi digunakan untuk memilih pabrik pengolahan CPO sebagai pemasok utama. Dari hasil analisis didapatkan bahwa penggunaan moda darat menggunakan truk lebih optimal dibandingkan menggunakan tongkang hal ini dikarenakan kondisi sungai di Kalimantan Tengah yang dangkal. Dengan menggunakan metode transportasi didapatkan empat lokasi pabrik pengolahan minyak kelapa sawit. Pelabuhan hub yang terpilih berlokasi di Bagendang dan Bumi Harjo. Kedua titik tersebut dipilih karena sudah memiliki tangki timbun dan dermaga untuk ekspor CPO, selain itu pemilihan berdasarkan hasil analisa didapatkan biaya dari Pabrik PT. ATLANTIS ke Pelabuhan Bagendang dengan truk berukuran 10 ton memerlukan biaya sebesar Rp. 333.016,25/TRIP/TRUK. Pabrik PT. ATLANTIS II ke Pelabuhan Bagendang Rp. 237.868,75/TRIP/TRUK. Pabrik PT. TIGER ke Pelabuhan Bumi Harjo Rp. 475.737,50/TRIP/TRUK. PT. TIGER II merupakan pabrik yang dapat melakukan pengiriman langsung menggunakan tongkang berukuran 1800 DWT melewati sungai Barito, dengan biaya Rp.123.007.828,27,- /voyage.

Potensi Bencana Geologi Pada Penambangan Emas dan Lempung di Desa Cihonje Kecamatan Gumelar Kabupaten Banyumas

Directory of Open Access Journals (Sweden)

Asmoro Widagdo

2015-04-01

Full Text Available Desa Cihonje di Kecamatan Gumelar, Kabupaten Banyumas, memiliki sumber daya mineral seperti emas dan tanah liat kaolin. Kedua mineral ini telah dilakukaneksploitasi oleh masyarakat setempat. Pemanfaatan sumber daya ini telah memberikan kemakmuran bagi warga setempat. Namun, upaya pertambangan tidak dalam kondisi baik dan masih belum berlisensi. Penggalian emas dan tanah liat di sekitar area perumahan telah membawa dampak yang sangat mengkhawatirkan terhadap keselamatan para penambang dan lingkungan sekitarnya. Penelitian ini pada potensi bencana yang mungkin menjadi ancaman bagi masyarakat setempat dilakukan dengan pengamatan langsung. observasi lapangan ini dilakukan dengan memetakan lokasi operasi pertambangan, perubahan lingkungan dilakukan deskripsi, mengambil gambar dan wawancara dengan penduduk dan para penambang. pertambangan emas primer mengambil urat mineral dengan membuat sumur vertikal dan horizontal. sumur ini sangat dalam dan mencapai puluhan meter. Hal ini telah mengancam keselamatan para penambang, mengganggu penggunaan lahan sebagai daerah pertanian, yang mempengaruhi ketersediaan sumber air tanah, menyebabkan tanah longsor dan mencemari sumber air sungai. pertambangan emas sekunder pada deposito aluvial di tepi sungai telah menyebabkan kerusakan lahan pertanian, erosi sungai dan pencemaran air. Pertambangan tanah liat telah menyebabkan perubahan dalam pengaturan lingkungan dan potensi longsor.

Sustainable River Water Quality Management in Malaysia

Directory of Open Access Journals (Sweden)

Abdullah Al-Mamun

2013-04-01

, kualiti air di pedalaman Malaysia (terutama sungai semakin merosot. Kebanyakan sungai tercemar akibat pencemaran di punca sumber air dan pencemaran di bukan punca sumber air. Punca sumber air dipantau dan dikawal oleh Jabatan Alam Sekitar (JAS, tetapi sejumlah besar pencemaran adalah sisa yang tidak dirawat dan air larian ribut. Walau bagaimanapun, ia tidak terlambat untuk mengambil beberapa langkah berani untuk mengawal pencemaran di punca sumber air dan sisa tidak dirawat kerana langkah ini memainkan peranan penting bagi kebersihan sungai. Kertas kerja ini mengkaji prosedur dan garis panduan sedia ada berkaitan perlindungan kualiti air sungai di Malaysia. Ada kemungkinan bahawa had kumbahan dan pelepasan efluen dalam Akta Kualiti Alam Sekitar (EQA boleh menimbulkan halangan terhadap mencapai kualiti air yang baik di dalam sungai seperti yang dikehendaki oleh Piawaian Kualiti Kebangsaan Air (NWQS. Sebagai contoh, Ammoniakal Nitrogen (NH3-N dikenal pasti sebagai salah satu bahan pencemar utama yang menyebabkan banyak sungai tercemar tetapi ia tidak dianggap sebagai parameter pemantauan dalam EQA hingga peraturan baru diterbitkan pada tahun 2009. Yang menghairankan, peraturan baru menetapkan had efluen perindustrian dan kumbahan dibenarkan pada kepekatan NH3-N yang agak tinggi (5 mg / l, dan ini mungkin menyebabkan nilai Indeks Kualiti Air (WQI sungai rendah. Persekitaran air adalah sistem dinamik. Menjalankan semakan berkala mengenai syarat pemantauan, mengesan bahan pencemaran di dalam kumbahan, efluen dan aliran, dan semakan piawaian kualiti air yang wajar adalah perlu bagi pengurusan sumber air lestari di negara ini. KEYWORDS:Environmental Quality Act (EQA; point source (PS; non-point source (NPS; sustainable uses; Water Quality Index (WQI

HEDONIC VALUATION OF MARGINAL WILLINGNESS TO PAY FOR AIR QUALITY IMPROVEMENT

Directory of Open Access Journals (Sweden)

Endah Saptutyningsih

2014-10-01

Full Text Available AbstractThis study aims to identify the highest air pollution areas and to estimate household marginal willingness to pay for air quality improvement. The result of Kriging technique indicates that six sub districts in Yogyakarta City and one sub district in Gunungkidul have highest concentration of particle pollution (PM10. The result of hedonic price method conclude that by adopting a two-stage estimation procedure an 1% increase in the level of PM10 reduced property prices in the study area by 0.32%. Marginal implicit price for reducing PM10 is Rp 957,900.00. The households are willing to pay an additional amount of 1.34 percent for a reduction in PM10 by 1%.Keywords: Air pollution, marginal willingness to pay, hedonic price, implicit priceJEL classification numbers: D12, Q53AbstrakPenelitian ini bertujuan mengidentifikasi daerah polusi udara tertinggi dan untuk memperkirakan kesediaan marginal rumah tangga untuk membayar untuk perbaikan kualitas udara. Dengan menggunakan teknik Kriging, hasil penelitian menunjukkan bahwa enam kecamatan di Kota Yogyakarta dan satu kecamatan di Gunungkidul memiliki konsentrasi tertinggi partikel polusi (PM10. Sementara itu, dengan metode harga hedonik yang mengadopsi prosedur dua tahap, paper ini menyimpulkan bahwa setiap peningkatan PM10 sebesar 1% akan menurunkan harga properti di daerah penelitian sebesar 0.32 persen. Harga implisit marjinal untuk mengurangi PM10 adalah Rp 957,900. Rumah tangga bersedia membayar tambahan 1,34 persen untuk pengurangan PM10 sebesar 1%.Kata kunci: Polusi udara, keinginan membayar marjinal, harga hedonik, SIG, harga implisitJEL classification numbers: D12, Q53

Motivasi Belajar Siswa Madrsah Aliyah dalam Mengikuti Mata Pelajaran Bahasa Arab dan Implikasinya dalam Layanan Bimbingan dan Konseling (Studi pada Siswa Madrasah Aliyah Negeri 1 Sungai Penuh yang Berasal dari Sekolah Menengah Pertama

Directory of Open Access Journals (Sweden)

Yasrial Chandra

2016-06-01

Full Text Available Arabic language is the basic of all the religious subjects in Madrasah Aliyah. The student derived from senior high school, Arabic is the new subject in which they did not learn in SMP (junior high school, and it is possibly emerged the difficulty from them. This study describes the student’s learning motivation who derived from SMP in learning Arabic on the terms of  perseverance on learning Arabic, the needs on learning Arabic, the expected of learning Arabic, and interested on learning Arabic. This research was a descriptive research  by using quantitative approach. The population of this research was the Eleventh grade student of MAN 1 Sungai Penuh who derived from SMP in 2014/2015 academic years. The sample of this research was 124 students that had been choosen by proportional random sampling technique. The instrument used likert scale. Then analyzed by using statistic technique. The finding of the research shown that: 1 The level of students motivation derived from SMP on learning Arabic were the average rating, (a On the subvariable of perseverance on learning Arabic was on the low criterion, (b the subvariable of needs on learning Arabic was on the average criterion, (c the subvariable expected on learning Arabic was on the low criterion (d subvariable of interest on learning Arabic was on the low criterion. 2 The counseling services could be given to improve the student motivation on learning Arabic who derived from SMP which based on the result of this research were; oriented service, information service, the individual consult service, the group guiding service and the group consulting service.

Environmental dynamics and carbon accumulation rate of a tropical peatland in Central Sumatra, Indonesia

Science.gov (United States)

Hapsari, Kartika Anggi; Biagioni, Siria; Jennerjahn, Tim C.; Reimer, Peter Meyer; Saad, Asmadi; Achnopha, Yudhi; Sabiham, Supiandi; Behling, Hermann

2017-08-01

Tropical peatlands are important for the global carbon cycle as they store 18% of the total global peat carbon. As they are vulnerable to changes in temperature and precipitation, a rapidly changing environment endangers peatlands and their carbon storage potential. Understanding the mechanisms of peatland carbon accumulation from studying past developments may, therefore, help to assess the future role of tropical peatlands. Using a multi-proxy palaeoecological approach, a peat core taken from the Sungai Buluh peatland in Central Sumatra has been analyzed for its pollen and spore, macro charcoal and biogeochemical composition. The result suggests that peat and C accumulation rates were driven mainly by sea level change, river water level, climatic variability and anthropogenic activities. It is also suggested that peat C accumulation in Sungai Buluh is correlated to the abundance of Freycinetia, Myrtaceae, Calophyllum, Stemonuraceae, Ficus and Euphorbiaceae. Sungai Buluh has reasonable potential for being a future global tropical peat C sinks. However, considering the impact of rapid global climate change in addition to land-use change following rapid economic growth in Indonesia, such potential may be lost. Taking advantage of available palaeoecological records and advances made in Quaternary studies, some considerations for management practice such as identification of priority taxa and conservation sites are suggested.

Phytosociology of aquilaria malaccensis lamk. and its communities from a tropical forest reserve in peninsular malaysia

International Nuclear Information System (INIS)

Razak, S. A.; Haron, N. W.

2015-01-01

A phytosociological study on the floristic and vegetation communities of Aquilaria malaccensis was carried out in Sungai Udang Forest Reserve, Malacca, Malaysia. The main objectives of this study were to identify, characterize and classify the Aquilaria malaccensis communities which were naturally distributed in the Sungai Udang Forest Reserve. A total of 25 plots (40 m x 20 m) in size were constructed according to the line transect method. The vegetation sampling and data analysis were done. A total of 80 species belonging to 79 genera and 40 families were found from all the 25 plots in Sungai Udang Forest Reserve. The most abundant family was the Euphorbiaceae with 220 individual trees, followed by Myrtaceae and Anacardiaceae representing 212 and 197 individual trees, respectively. A community which was Aquilaria malaccensis Artocarpus rigidus community with two new sub-community known as Palaquium gutta sub-community and Barringtonia racemosa sub-community were identified on the basis of statistical and phytosociological analyses. These community and sub-community also showed preference on different geographical and environmental factors such as soils and local relief. This study is useful in providing more information on the growth response of the mixed dipterocarp forest in the development of proper forest management. (author)

Farm Recording Kelompok Tani Timbul Karya Kecamatan Paliyan Kabupaten Gunungkidul

Directory of Open Access Journals (Sweden)

Agus Dwi Nugroho

2017-03-01

Full Text Available Farmers group of “Timbul Karya” has variousassets being rent yet systematically recorded. This community service activity aims to help the farmer group for: (1 preparing the rental activities form filling of assets withitsraining and (2 analyzing the feasibility of soybean farming of the farmer group. Methods used in this community service are training and mentoring. Mentoring is done on making asset management form and analyzingthe farming feasibility, while the training is done with administrative management subject. The administration form consists of on farming activities, save and loan of paddy grain, rental of farm equipment, and rental of partyequipment. The training activity to give a performance description of the group empowerment. The results of the analysis of soybean farming provide R/C value of 2.81 which means that the farming were profitable. Farming analysis also shows that the increasing of soybean production can be solved by enlarge the planted area and the use of urea fertilizer. In addition, given advice to review the increase in revenues, government should giving high soybean prices shifting as well as providing assistance for the production facilities to reduce the productioncost.

Pemetaan Hutan Mangrove di Estuari Sungai Andai, Manokwari Papua Barat Berdasarkan Metode Density Slicing Berbasis Citra Alos Avnir-2

Directory of Open Access Journals (Sweden)

Christian S. Imburi

2016-09-01

Full Text Available ABSTRAK Secara umum julat nilai spektral objek diperoleh melalui perpustakaan spektral (spectral library atau melalui pengukuran langsung di lapangan dengan alat ukur spectroradiometer, spectrometer, dan spectrophotometer, atau alat-alat sejenis yang mahal serta jarang, sehingga sulit untuk memperoleh julat nilai spektral objek tertentu. Studi tentang Metode Density Slicing Berbasis Citra ALOS AVNIR-2 Untuk Pemetaan Hutan Mangrove di Estuari Sungai Andai, Manokwari Papua Barat dilakukan dengan tujuan menghasilkan prosedur analisis perolehan julat nilai spektral melalui analis histogram band inframerah dekat ALOS AVNIR-2.  Penelitian ini dilakukan melalui dua tahapan metode analisis, yakni: 1 Analisis utama untuk menghasilkan julat nilai spektral, yakni analisis histogram band inframerah dekat ALOS AVNIR-2, dan 2 Analisis tambahan untuk menjelaskan tingkat akurasi julat nilai spektral melalui: (a survei lapangan yang menghasilkan data untuk proses uji akurasi reklasifikasi metode density slicing, serta (b melakukan uji akurasi terhadap peta zonasi mangrove berbasis density slicing. Analisis tersebut dijabarkan melalui pendekatan penginderaan jauh multitingkat, dimana citra QuickBird digunakan sebagai referensi untuk masking citra ALOS AVNIR-2, dan juga untuk validasi peta hasil metode density slicing. Hasil dari penelitian ini adalah prosedur analisis perolehan julat nilai spektral dan julat nilai spektral zonasi genus mangrove.  Akurasi pemetan hutan mangrove untuk metode density slicingmenghasilkan nilai 40%. Nilai tersebut masih belum memenuhi standar ketelitian yang diharapkan. Namun demikian, penelitian ini secara keseluruhan dapat menghasilkan julat nilai spektral, dan hal ini memberikan implikasi terhadap pengembangan prosedur untuk menghasilkan julat nilai spektral objek.   ABSTRACT Generally the range of spectral value objects can be obtained through spectral library or through direct measurement in the field with measuring instrument

Desain Penampang Sungai Way Besai Melalui Peningkatan Kapasitas Sungai Menggunakan Softwere HEC-RAS

OpenAIRE

Utami, Tri; Purwadi, Ofik Taufik; Susilo, Gatot Eko

2016-01-01

Way Besai river is located in Sumberjaya subdistrict, West Lampung district, Lampung. It is one of the sub river from Tulang Bawang river. Way Besai river has been used as a the electric power source, known as Besai hydropower. Besai Hydropower has decreased energy supply of 40 MW from the supply optimum can reachs 90 MW. his is due to the catcment area conditions of the Way Besai rivers are "metastable" so which effected in the shallowing of the cross-section quickly. So it needs the capacit...

DAMPAK SEDIMENTASI BENDUNGAN SOEDIRMAN TERHADAP KEHIDUPAN EKONOMI MASYARAKAT

Directory of Open Access Journals (Sweden)

Sucihatiningsih Dian W.P

2012-09-01

Full Text Available Sedimentation is a material precipitation in which transported through water, wind, ice or glacier at a basin. Delta, which is found at the estuary of a river, is resulted from material precipitation process and is carried by watter from the river. Panglima Besar Soedirman (PBS barrage, located in Banjarnegara regency, has undergone a very critical sedimentation. The unstable soil making the trees unable to absorb water which has caused erosion and sedimentation. Sedimentation happened at Bendungan Panglima Besar Soedirman affected economic aspect, especially in the field of fishery and agriculture. Sedimentation will silt up in the dam area causing muddy water. This will badly effect the fishery sector at dam. Besides, this caused Karamba- a raising fishing basket-decreased. Further, agricultural sector, the irrigation system also underwent the impact from sedimentation at the dam. Sedimentasi adalah suatu proses pengendapan material yang ditransport oleh media air, angin, es, atau gletser di suatu cekungan. Delta yang terdapat di mulut-mulut sungai adalah hasil dan proses pengendapan material-material yang diangkut oleh air sungai. Bendungan panglima Besar Soedirman (PBS di kabupaten Banjarnegara merupakan satu lokasi yang terkena sedimentasi sangat parah. Kerusakan lingkungan yang terjadi di daerah aliran sungai merupakan penyebab utama dari sedimentasi di Bendungan PBS. labilnya kondisi tanah akibat tidak adanya pohon penahan air mengakibatkan erosi yang menyebabkan sedimentasi.Sedimentasi di Bendungan PBS ternyata juga sangat berdampak terhadap aspek perekonomian terutama dalam bidang perikanan dan pertanian. Sektor perikanan dan pertanian adalah bidang-bidang yang terdampak dari sedimentasi Bendungan PBS sebab sedimentasi menyebabkan pendangkalan pada area Bendungan yang menyebabkan air menjadi keruh sehingga akan berdampak buruk terhadap sektor perikanan umum bendungan. Dan juga mengakibatkan lokasi untuk kolam karamba ikan air tawar

Removal of Oil and Grease as Emerging Pollutants of Concern (EPC in Wastewater Stream

Directory of Open Access Journals (Sweden)

Alade Abass O

2011-12-01

Full Text Available Wastewater characteristics, which depend on wastewater source, are increasingly becoming more toxic in recent times. The concentrations of oil and grease in wastewater streams have been observed to increase in wastewater stream with increasing adverse effects on the ecology. This results from the increasing use of oil and grease in high-demanded oil-processed foods, establishment and expansion of oil mills and refineries worldwide, as well as indiscriminate discharge of oil and grease into the water drains, domestically and industrially. This study reports the applications, efficiencies and challenges of the wastewater treatment techniques currently employed in the removal of oil and grease from the industrial wastewater and municipal water stream. The results shows that the concentrations of oil and grease injected into the ecosystem are of higher environmental impact and this needs to be given the desired attention. The desired development for effective removal of oil and grease as emerging pollutants of concern (EPC in wastewater stream are thus proposed. ABSTRAK: Ciri-ciri air sisa, bergantung kepada punca air sisa tersebut, menjadi semakin toksik akhir-akhir ini. Kepekatan minyak dan gris dalam air sisa anak sungai dilihat makin bertambah dalam air sisa anak sungai dengan bertambahnya kesan negatif ke atas ekologi. Ini disebabkan oleh peningkatan penggunaan minyak dan gris dalam makanan berproses yang tinggi permintaannya, penubuhan dan perkembangan kilang pertroleum dan loji penapisan di seluruh dunia. Minyak dan gris juga dibuang sewenang-wenangnya ke dalam parit air, dari kalangan domestik dan industry. Kajian ini membentangkan tentang aplikasi, keberkesanan dan teknik cabaran rawatan air buangan yang kini digunakan dalam pembuangan minyak dan gris dari air sisa industry dan air sungai perbandaran. Keputusan menunjukkan kepekatan minyak dan gris yang wujud dibuang ke dalam ekosistem mempunyai impak yang lebih tinggi terhadap persekitaran

PENINGKATAN ASPEK PENGETAHUAN DAN PERILAKU ANAK SEKOLAH DASAR/MADRASAH IBTIDAIYAH MELALUI KOMIK BUSKI PADA TIGA DESA ENDEMIS FASCIOLOPSIS BUSKI DI KABUPATEN HULU SUNGAI UTARA, TAHUN 2003

Directory of Open Access Journals (Sweden)

Anorital Anorital

2012-09-01

Full Text Available Fasciolopsiosis is worm disease which is caused Fasciolopsis buski. The disease is an endemic at some villages in Hulu Sungai Utara Regency with prevalence 1.2-7.8%.The patients are children with age around 1-15 years old. In the year 2002-2003 have been carried out a research "Model of Control Fasciolopsis buski at South Kalimantan with Socio-Cultural Approach". In the first year (2002 of research, the data base of epidemiological and socio-cultural aspect, with cross sectional research design, have been collected. And in the second year (2003 has been done the intervention to the basic school students in three villages (Kalumpang Dalam, Putat Atas, and Talaga Mas, by doing a health campaign using comic books with Banjar language (local language. To find out the intervention has success, the researcher evaluated parasitological and socio cultural data collecting, especially knowledge, attitude and practice (KAP aspect. Data collecting about KAP aspect was executed to the basic school students (grade 3-5. Total samples are 160 basic school students in those three villages. The result of parasitological data collecting in 3 villages after inten>ention is found a prevalence rate 5.2% positive fasciolopsiosis. There is decreased about 6.5% from 11.7% on the first year (2002 into 5.2% at second year (2003. The result of socio-cultural data collecting for KAP aspect as quantitative is found increase. There is knowledge increasing about the worm disease, where before intervention only 86.8% students who know the buski disease, and after intervention become 96.8%. While on practice aspect also increase, before intervention 73.1% basic school students use drugs worm (albendazol and 84.3% after intervention, before intervention 48.7% students never eat raw water plants, after intervention become 19.9%, before intervention 57.5% students wash their hands with soap but after intervention raised up become 85.0% (p<0,05. The Conclusion is there is

PENDEKATAN COOPERATIVE LEARNING DENGAN STRATEGI GAMES COMPETITION SEBAGAI UPAYA MENINGKATKAN AKTIVITAS BELAJAR SISWA

Directory of Open Access Journals (Sweden)

Eka jaya puta utama

2016-05-01

Full Text Available Masalah dalam penelitian ini adalah bagaimana penggunaan pendekatan Cooperative Learning dengan Strategi  Games Competition dapat meningkatkan aktivitas belajar siswa pada Mata Pelajaran IPS Terpadu Materi Sejarah kelas VIII SMP Negeri 2 Sungai Raya?. Metode penelitian yang digunakan adalah penelitian tindakan kelas.  Subyek dalam Penelitian Tindakan Kelas ini adalah siswa kelas VIII SMP Negeri 2 Sungai Raya tahun pelajaran 2015/2016. Alat pengumpulan data yang digunakan dalam penelitian ini adalah angket, panduan observasi, panduan wawancara, dan dokumentasi. Teknik analisis data dalam penellitian ini adalah Analisis hasil penelitian digambarkan dengan cara menggunakan triangulasi data. Indikator keberhasilan didasarkan dari kisi-kisi pengamatan aktivitas siswa yang meliputi :1 semangat siswa untuk mengikuti pembelajaran, 2 keaktifan dalam  menyelesaikan tugas  membuat pertanyaan dan jawaban, 3 keaktifan dalam menjawab pertanyaan, 4 keaktifan dalam menanggapi atas pertanyaan dari kelompok lain, 5 kerjasama dalam kelompok dalam menyelesaikan tugas berkompetisi dengan kelompok lain.Kesimpulan penelitian bahwa Pembelajaran IPS menggunakan pendekatan cooperative learning dengan strategi Games Competition dapat meningkatkan aktivitas belajar siswa kela VIII SMP Negeri 2 Sungai Raya, yaitu peningkatan aktifitas belajar siswa secara klasikal yaitu pada siklus I sebesar 65 % dan pada Siklus II sebesar 85 %, hal ini berarti ada peningkatan sebesar 20%. Pembelajaran dengan menggunakan pendekatan cooperative learning dengan strategi Games Competition dapat memberikan kesempatan kepada siswa untuk aktif dalam mengungkapkan pendapat, menghargai pendapat orang lain,berani bertanya, menanggapi, belajar berkompetisi secara jujur, serta mampu menumbuhkan rasa solidaritas siswa.

A sedimentation study in the Muda catchment area using nuclear techniques

International Nuclear Information System (INIS)

Kamarudin Samuding; Wan Zakaria Wan Muhamad Tahir; Roslan Mohd Ali; Juhari Yusuf

2002-01-01

A study on the sediment size distribution and determination of sediment density profile was conducted in a selected area of the Muda Dam catchment area, Kedah. The objective of the study was to establish baseline data of the input sedimentation with regard to the effects of development within the catchment in the future. Three main sampling locations were identified, namely at Sungai Teliang, Sungai Muda and the Muda Reservoir. Results showed that the grain size distribution of sediment generally ranged from clay to gravel size. In the reservoir and downstream the river, most of the samples studied consisted of fine sediment Le, silt and clay (< 63 μm). However, sediment distribution in the upstream section of Sungai Teliang mainly consisted of fine to coarse sand. Based on the sediment distribution profile analysis, the study site could be divided into two parts comprising the dynamic area (region) covering selected locations along the river and the deposited sediment in the reservoir. Measurement of sediment thickness was performed using nuclear gauges, i.e. direct transmission and backscattering methods. The result also showed that the thickness of bed sediment varied from one location to another, whereby the thickness variation could reach up to 0.75 metre in some areas. This study could assist local authorities (AMDA) in identifying the rates and sources of accumulated sediment as well as quality and quantity of water in the study area in order to sustain distribution of good quality water to the farmers. (Author)

The quality of Metroxylon Sago sucker: morphology and uptake of manganese and iron

International Nuclear Information System (INIS)

Nashriyah Mat; Abdul Khalik Wood; Ramli Ishak

2001-01-01

Metroxylon sago or sagopalm is an important source of carbohydrate for the South East Asian countries, apart from rice. In Malaysia, wild sagopalm grows in Sarawak in its natural habitats, the coastal peat swamp. The quality of sucker growing vegetatively on sagopalm was studied at Sungai Talau experimental station, Dalat plantation and Oya/Mukah plantation in Sarawak. The coefficients of variability (C) and Index of similiarity (I) were calculated based on sucker morphology and uptake of manganese and iron, The matrix of hypothetical exact interpoint distances (Indices of Similarity and Dissimilarity) shows that sucker on matured sagopalm at Sungai Talam experimental station was a high quality, sucker on 5 years old sagopalm at Mukah sago plantation was approximately one-third as good, whereas sucker on 1.5 years old sagopalm at Oya/dalat sago plantation was of inferior quality. (Author)

THE STRUCTURE OF SOIL MESOFAUNA AND MACROFAUNA IN GRODA CAVE, GUNUNGKIDUL

Directory of Open Access Journals (Sweden)

Andri Prasetyo

2016-10-01

  The number of soil macrofauna and mesofauna in Groda Cave can be used as an indicator of bats abundance since bat droppings are food for macrofauna and mesofauna soils. The purpose of this study are to determine the community structure of Groda Cave soil macrofauna and mesofauna  and its correlation with the content of N, P, K. The method used is the observation, taking of macrofauna and mesofauna soils using pit fall traps and tool green technique. Testing the N, P, K of the soil was conducted in Balai Pengkajian Teknologi Pertanian (BPTP Yogyakarta. The analysis technique used Shannon diversity index-Wienner, Margaleff wealth index, frequency of attendance of  macrofauna and mesofauna soils and its correlation with N, P, K of the land in Groda Cave. The results obtained are that six families mesofauna and 20 families macrofauna soils with moderate diversity index, the highest wealth index was in the Margaleff lit zone, the frequency of the highest attendance in the light zone is Formicidae (0.12, ie dim zones Isotomidae and Diptera (a brown (0.04 and the dark zone is Gryllacididae (0.05. The correlation showed the more the content of N, P, K, the fewer mesofauna and macrofauna soils were found. The uniqueness found in this study is the discovery of one species of Isotomidae in Groda Cave, which has been considered spreading only in Sulawesi, Sumatera, Bali, Lombok, Ternate and Papua.   Keywords: community structure, mesofauna soil, macrofauna soil, Groda Cave

Drepanosticta adenani sp. nov., from the Lanjak Entimau Wildlife Sanctuary in Sarawak (Odonata: Zygoptera: Platystictidae).

Science.gov (United States)

Dow, Rory A; Reels, Graham T

2018-02-15

Drepanosticta adenani sp. nov. (holotype ♂, from a tributary of Sungai Jela, Nanga Segerak area, Lanjak Entimau Wildlife Sanctuary, Sri Aman Division, Sarawak, Malaysian Borneo, 18 vii 2016, deposited in the Natural History Museum, London) is described from both sexes.

Notes on the discovery of Rafflesia hasseltii Suringar (Rafflesiaceae) in Taman Negara (National Park), Malaysia

NARCIS (Netherlands)

Latiff, A.; Mat-Salleh, K.

2001-01-01

Rafflesia hasseltii Suringar was discovered in the vicinity of Sungai Pelenting in Taman Negara, Pahang, with a population of about 20 buds and a few flowers in full bloom. This is the first confirmed report of the species for the National Park, Malaysia.

Status Pencemaran Lingkungan Sungai Badung dan Sungai Mati di Provinsi Bali Berdasarkan Bioindikator Phylum Annelida

Directory of Open Access Journals (Sweden)

Mawardi Labbaik

2017-11-01

Full Text Available Water pollution is the entry or inclusion of substances, energy and other components into the water by human activities, so that water quality decrease to a certain level. This study a timed to monitor the pollution of aquatic environment in the Badung River and Mati River by using Annelida phylum as bioindicator, the study was conducted from February to March 2017. The data obtained were analyzed by the structure of the community, and also used ABC (Abudance-Biomass Comparison method. The result of the research showed that the most abundance of Annelida and dominant from all stations of Badung River and Mati River was Lumbriculus variegatus. Is showed that it contamination status was categorized as mild contamination because it was dominant by facultative organism. The structure of the Annelida community in the Badung River and Mati River with the value of the diversity index was categorized as low Annelida (H '<1.0. The uniformity index was categorized as depressed Annelida community (0.00

The influence of urban development and social mobility on socioeconomic level: The application of GIS on urban ecosystems

Science.gov (United States)

Suhaili Mansor, Nur; Zulhaidi Mohd Shafri, Helmi; Mansor, Shattri; Paradhan, Biswajeet

2014-06-01

Specifically, the integration between social sciences and natural science are fundamental in our understanding of the economic, social and technological transformations that have drastically changed the society. This study will be based on the municipality of Sungai Petani, Kedah as it has been most influenced by urbanization and urban development. Urban development in Sungai Petani is closely associated with a tremendous increase in demand for land, which is highly related to population growth, human movement and their social mobility. The qualitative case study taken will rely on the visual interpretation technique that would allow the researcher to develop a map of urban changes detection. The potential application of GIS information to estimate socioeconomic indicators and the modelling of socio-economic activities that are explored in this study is hoped to increase further our understanding of the impacts of development and urbanization on social life.

The influence of urban development and social mobility on socioeconomic level: The application of GIS on urban ecosystems

International Nuclear Information System (INIS)

Mansor, Nur Suhaili; Shafri, Helmi Zulhaidi Mohd; Mansor, Shattri; Paradhan, Biswajeet

2014-01-01

Specifically, the integration between social sciences and natural science are fundamental in our understanding of the economic, social and technological transformations that have drastically changed the society. This study will be based on the municipality of Sungai Petani, Kedah as it has been most influenced by urbanization and urban development. Urban development in Sungai Petani is closely associated with a tremendous increase in demand for land, which is highly related to population growth, human movement and their social mobility. The qualitative case study taken will rely on the visual interpretation technique that would allow the researcher to develop a map of urban changes detection. The potential application of GIS information to estimate socioeconomic indicators and the modelling of socio-economic activities that are explored in this study is hoped to increase further our understanding of the impacts of development and urbanization on social life

The Effects of Saltwater Intrusion to Flood Mitigation Project

Science.gov (United States)

Azida Abu Bakar, Azinoor; Khairudin Khalil, Muhammad

2018-03-01

The objective of this study is to determine the effects of saltwater intrusion to flood mitigation project located in the flood plains in the district of Muar, Johor. Based on the studies and designs carried out, one of the effective flood mitigation options identified is the Kampung Tanjung Olak bypass and Kampung Belemang bypass at the lower reaches of Sungai Muar. But, the construction of the Kampung Belemang and Tanjung Olak bypass, while speeding up flood discharges, may also increase saltwater intrusion during drought low flows. Establishing the dynamics of flooding, including replicating the existing situation and the performance with prospective flood mitigation interventions, is most effectively accomplished using computer-based modelling tools. The finding of this study shows that to overcome the problem, a barrage should be constructed at Sungai Muar to solve the saltwater intrusion and low yield problem of the river.

Sedimentation studies at MUDA catchment area, Kedah, Malaysia

International Nuclear Information System (INIS)

Kamarudin Samuding; Juhari Yusuf; Wan Abdul Aziz; Juhari Latiff

2000-01-01

A study on the sediment size distribution and determination of sediment density profile in the selected area of Muda dam catchment area, Kedah is presented. The objective of the study was to establish a base line data of the input sedimentation with regards to the effects of development within the catchment in the future. Three main sampling locations were identified namely at Sungai Teliang, Sungai Muda and Muda reservoir. Measurement of sediment thickness was performed by using nuclear gauges i.e. direct transmission and backscattering methods. Results showed that the grain size distribution of sediment ranges from gravel to clay sizes. In the reservoir and downstream of the river, most of the samples studied consisting of fine sediment i.e silt and clay sizes (<63,um). However, sediment distribution in the upstream section of Sungai Teliang mainly consist of fine to coarse sand. Sediment density profiles in the reservoir showed little changes, whereas bed sediment profiles in the river cross-sectional areas exhibit some changes. The results also showed that thickness of bedload sediment were different from one location to another, in which the thickness may achieve up to 0.75 metre in some areas. Based on the sediment distribution profile analysis, the study site could be divided into two parts comprising of dynamic area (region) covering selected locations along the river and deposited sediment in the reservoir. Basic information derived from this study may provide as one of the important inputs for the MADA reservoir management authority in monitoring, supervising y and identifying rate and source of sediment in the catchment area

75 FR 24742 - In the Matter of Certain Large Scale Integrated Circuit Semiconductor Chips and Products...

Science.gov (United States)

2010-05-05

... Semiconductor, Xiqing Integrated Semiconductor, Manufacturing Site, No. 15 Xinghua Road, Xiqing Economic... Malaysia Sdn. Bhd., NO. 2 Jalan SS 8/2, Free Industrial Zone, Sungai Way, 47300 Petaling Jaya, Selengor, Malaysia. Freescale Semiconductor Pte. Ltd., 7 Changi South Street 2, 03-00, Singapore 486415. Freescale...

AKUMULASI LOGAM BERAT Cr DAN Pb PADA TUMBUHAN MANGROVE AVICENNIA MARINA DI MUARA SUNGAI BABON PERBATASAN KOTA SEMARANG DAN KABUPATEN DEMAK JAWA TENGAH (Accumulation of Heavy Metals Cr and Pb in Mangrove Plant Avicennia marina On Babon River’s Estuari

Directory of Open Access Journals (Sweden)

Vita Kartikasari

2002-11-01

Full Text Available ABSTRAK Ekosistem mangrove cenderung dapat mengakumulasi unsur-unsur logam berat yang berada dalam perairan sekitar tumbuhan mengrove. Kajian ini dilakukan di muara sungai Babon, Semarang, Jawa Tengah. Tujuan penelitian untuk mengetahui kemampuan tumbuhan mangrove, Avicennia murina, dalam mengakumulasi unsur logam berat Cr dan Pb; mengetahui organ (akar, cabang, dan daun yang paling banyak mengakumulasi unsur logam berat dan mengetahui peran tumbuhan mangrove dalam mengurangi kandungan logam berat (Cr dan Pb yang ada di perairan muara sungai Babon. Penelitian ini dibagi menjadi dua tahap. Tahap observasi pendahuluan ditujukan untuk mengidentifikasi jenis-jenis tumbuhan yang hidup di ekosistem mangrove dan menentukan keberadaan unsur logam berat dalam organ tumbuhan mangrove. Setelah observasi pendahuluan dapat ditentukan lokasi sampling yang ada tumbuhan mangrove A. marina dan lokasi yang tidak ada tumbuhan tersebut. Penelitian utama ditujukan untuk memperoleh data primer konsentrasi Cr dan Pb dengan cara mencuplik dari organ tumbuhan (akar, cabang dan daun, sedimen dan air. Cuplikan dibawa ke laboratorium untuk dikeringkan dengan Microwave Digestion MLS-1200 MEGA dan ditentukan kadar Cr dan Pbnya. Data yang diperoleh kemudian dianalisis secara statistik Uji Non Parametric Kruskal Wallis dan Uji Two Test Kolmogorov Smimov. Hasil penelitian menampakkian Cr terakumulasi lebih banyak daripada Pb di tumbuhan mlangrove. Kecepatan faktor biokonsentrasi untuk Cr adalah 1052.66 dan Pb adalah 349.54. Tempat konsentrasi tertinggi Cr dan Pb dalam organ tumbuhan berturut-turut: akar, cabang dan dedaunan. Daun menyerap unsur Pb lebih besar daripada cabang. Hasil penelitian juga menunjukkan bahwa konsentrasi Cr dan Pb di sedimen yang perairannya ditumbuhi mangrove lebilr besar dari pada di sedimen yang perairannya tanpa ditumbuhi mangrove. Konsentrasi unsur logam berat dalam perairan yang ditumbuhi magrove.   ABSTRACT Mangrove have a tendency to accumulate

PERAN KELEMBAGAAN LOKAL ADAT DALAM PEMBANGUNAN DESA

Directory of Open Access Journals (Sweden)

Wedy Nasrul

2013-06-01

Full Text Available The role of public and institute in development of countryside is not only limited to beneficial owner, but actively involved direct in development programs. Condition of local institute of custom here and now will affect to the role in development of countryside. Purpose of fundamental of this research description the role of local institute of custom in development of countryside. This research applies qualitative method with case study in Nagari Sungai Pua Kecamatan Sungai Puar Kabupaten Agam. Data collecting is done qualitatively, that is direct observation or observation, in-depth interview and documentation. Research finding indicates that as result of governmental intervenes to government of nagari from time to time indirectly makes the role of local institute of custom on the wane in development of countryside. The role of local institute of custom in development of nagari still there is in each development step countryside, where a real role dominance is at planning stage and coordination.

Pemetaan Kelembagaan dalam Kajian Lingkungan Hidup Strategis DAS Bengawan Solo Hulu

Directory of Open Access Journals (Sweden)

Sri Rum Giyarsih

2015-10-01

Full Text Available Fakta empiris memberikan pembuktian terhadap pentingnya pengembangan kelembagaan dalam rangka mencapai keberhasilan suatu program pembangunan, bahkan seringkali program pembangunan yang mengabaikan pengembangan kelembagaan berakhir dengan kegagalan. Pengembangan kelembagaan telah menjadi bagian dari strategi pembangunan tak terkecuali dalam Kajian Lingkungan Hidup Strategis di DAS Bengawan Solo Hulu. Sasaran yang ingin dicapai dari kegiatan pengembangan kelembagaan adalah tumbuhnya kelembagaan yang tangguh, dinamis, dan berdaya saing serta mandiri dalam melakukan pengelolaan lingkungan. Untuk mencapai hal ini maka perlu dilakukan pemetaan kelembagaan di DAS tersebut. Dari pemetaan kelembagaan yang ada di wilayah ini terdapat tiga lembaga yang dapat melakukan kegiatan Koordinasi, Intergrasi, Sinergitas, Sinkronisasi (KISS yaitu BKPRD (Badan Koordinasi Penataan Ruang Daerah, BP DAS (Badan Pengelolaan Daerah Aliran Sungai/Forum DAS, dan TKPSDA WS Bengawan Solo (Tim Koordinasi Pengelolaan Sumberdaya Air Wilayah Sungai Bengawan Solo. Di antara ketiga lembaga tersebut maka TKPSDA adalah lembaga yang dipercaya untuk melakukan Koordinasi, Intergrasi, Sinergitas, Sinkronisasi (KISS dalam pengelolaan lingkungan DAS Bengawan Solo Hulu.

Kalimat Majemuk Bahasa Melayu Dialek Deli Medan : Suatu Kajian Transformasi Generatif

OpenAIRE

Rozanna Mulyani

2006-01-01

Bahasa Melayu Dialek Deli Medan (BMDDM) adalah salah satu bahasa daerah di Indonesia. Penutur BMDDM adalah suku Melayu yang tinggal di daerah Deli Serdang dan Medan, Sumatera Utara. Kawasan kawasan penutur BMDDM Deli Serdang meliputi kawasan Tanjung Morawa, Percut Sungai Tuan dan Lubuk pakam, oleh Rozanna Mulyani D0300043

Determination of borneol and other chemical compounds of ...

African Journals Online (AJOL)

1Department of Pre-Clinical Sciences, Faculty of Medicine and Health Sciences, Universiti Tunku Abdul Rahman, Lot PT. 21144, Jalan Sungai Long, .... due to geographical variation of plant species, which lead to difference in environmental and culture conditions. In summary, the compounds detected in this study such as ...

DESAIN SELF-PROPELLED CAR BARGE UNTUK DISTRIBUSI MOBIL BARU RUTE CIKARANG BEKASI LAUT (CBL – TANJUNG PERAK

Directory of Open Access Journals (Sweden)

Bintang Jiwa Jiwa

2017-01-01

Full Text Available Berbagai upaya telah dilakukan Pemerintah untuk dapat mengurangi kemacetan jalur Pantura. Mulai dari pemberian jalur alternatif, pelebaran jalan, hingga pembuatan jalan tol baru. Segala upaya tersebut tidak sebanding dengan jumlah kendaraan yang terus meningkat melewati jalur Pantura, khususnya kendaraan-kendaraan barang seperti truk dan kontainer. Hal ini tidak terlepas dari geliat perekonomian yang terus tumbuh. Kawasan industri otomotif di sekitar Cikarang dan Bekasi salah satu contohnya. Jumlah produksi mobil domestik dan permintaan yang terus meningkat ini membutuhkan sarana yang baik dan cepat dalam mendistribusikan mobil baru ke berbagai daerah. Dalam beberapa tahun ini, Jawa Timur merupakan provinsi dengan tingkat permintaan mobil yang cukup tinggi di Indonesia. Oleh karena itu, salah satu solusi yang ditawarkan untuk dapat mengurangi kemacetan di jalur darat adalah berupa pengalihan transportasi darat ke sungai atau laut. Berdasarkan solusi tersebut, maka dibutuhkan alat transportasi pengangkut barang, dalam hal ini mobil, yang dapat melewati sungai dan laut. Self-propelled car barge diharapkan mampu menjadi inovasi yang cukup baik dalam mendistribusikan barang melalui rute Sungai Cikarang Bekasi Laut (CBL menuju ke Pelabuhan Tanjung Perak. Untuk mendapatkan ukuran utama yang optimum digunakan metode optimation design approach dengan bantuan fitur solver pada program Microsoft Excel dengan menjadikan biaya pembangunan paling minimum sebagai fungsi objektif, serta adanya batasan-batasan dari persyaratan teknis dan regulasi yang ada. Dari proses optimisasi, didapatkan ukuran utama optimum Self-Propelled Car Barge adalah L=53.10 m, B=15.17 m, TFW=3.09 m, TSW=3.02 m, dan H=4.66 m, dengan estimasi biaya pembangunan sebesar $1.435.270,56 atau setara Rp.19.281.424.757,10.

Research Article Special Issue

African Journals Online (AJOL)

pc

2017-11-10

Nov 10, 2017 ... acial Cancer Research Group, Faculty of Dentistry, UniversitiTekn. MARA, Sungai Buloh ... pancreas, lung, colon, skin and prostate [6]. IC50 is used to indicate the concentration of inhibitor that require to inhibit a given biological ..... stress.International Journal of Molecular Sciences,2010, 11(5):2109–2117.

Research Article Special Issue

African Journals Online (AJOL)

Sungai Besi Camp, 57000 Kuala Lumpur, Malaysia. Published online: 10 September 2017 be quickly transmitted without any boundaries within the present m. From this, the Islamic State (IS) organization of Iraq and Syria is a ers in a faster and effective way. Malaysian police have identified mor counts that being used to ...

Perencanaan Check Dam Sungai Dawe Kudus

OpenAIRE

Mustaanah, Adibatul; Pinandoyo, Nur; Sugiyanto, Sugiyanto; Wahyuni, Sri Eko

2013-01-01

Juana river's located in two administrative regions Kudus and Pati had superficial. This is because the slope of the river is quite gentle and the level of environmental degradation in the watershed (DAS) Juana river's have increased. Based on these conditions, it is necessary to plan the construction of sediment control (check dams) to reduce sedimentation along the river and optimize the function of the Juana river's. Planning is performed on Dawe river's ,the branch of Juana river's. From ...

PENCIRIAN DEBIT ALIRAN SUNGAI CITARUM HULU

Directory of Open Access Journals (Sweden)

Yayat Hidayat

2013-08-01

Full Text Available Citarum is one of strategic rivers in West Java. In the upper part of this river, there are 3 large dams (Saguling, Cirata, and Jatiluhur which operates hydroelectric power that supply ± 20% electricity needs of Java-Bali area. Run off discharge of the river are fluctuating widely so greatly affect the performance of electricity production, supply of irrigation, and household water in the downstream area. The research aims to identify character of river discharge of Citarum Hulu and its relation with land use changes and farm management. River discharge were analyzed at the inlet of Saguling dam in Kampung Nanjung and some stream monitoring stations located in Ciwidey, Cisangkuy, and Cikapundung-Gandok. River discharge was highly fluctuating. In the peak of rainy season the flow rate can reach 578 m3/sec which caused flooding in several area such as Majalaya, Banjaran, and Dayeuhkolot. In contrary, in dry season the flow was very low, about 2.7 m3/sec, causing drought, failure of rice harvest, and reduced water supply to hydropower plant of Saguling. In addition to affecting rainfall patterns, the flow rate fluctuations was also influenced by pattern of land use and management. Land utilization that was not in accordance with the land capability was the main cause of land degradation which in turn would decrease hydrology function of watershed to control river discharge in rainy season.

Detection of heavy metals in water in Negeri Sembilan, Malaysia: From source to consumption

Science.gov (United States)

Khalaf, Baydaa; Abdullah, Md. Pauzi; Tahrim, Nurfaizah Abu

2018-04-01

Drinking water should be free from harmful levels of impurities, such as heavy metals. The aim of this study is to investigate the heavy metals concentrations in a water reticulation system of Negeri Sembilan. 25 stations were selected along Sungai Linggi (upstream of intake point) and through there reticulation system of Sungai Linggi Water Treatment Plant encompassing raw water through to the last point of use. Sampling activities were carried out in June and July 2016. The samples taken were analysed for heavymetals using an Inductively Coupled Plasma - Optical Emission Spectrometer (ICP-OES). In addition other water quality parameters were measured in situ (pH, water temperature, conductivity and dissolved oxygen) and analysed in the laboratory (BOD, COD, TSS, NH3-N, TOC and residual chlorine). The results showed a high level of Ca in the distribution system, while in the treatment plant it was normal, as well as Fe is decreased. Meanwhile Mn is decreased after treatment processes. The concentrations of DO and temperature in the tap water exceeded the standard concentrations.

Research Article Special Issue

African Journals Online (AJOL)

2017-09-10

Sep 10, 2017 ... h Associations category. ATURE ON WETTABILITY l Malaysia, Sungai Besi, 57000. Bangi, Selangor,. 87) on a copper substrate with red for the wettability of SAC g condition. Hand soldering of temperature of 60°C, 80°C and ed under an optical microscope of SAC 387 lead-free solder samples prepared at ...

PERFORMANSI SISTEM AGROFORESTRI TRADISIONAL DI DESA TELAGA LANGSAT, KABUPATEN BANJAR

Directory of Open Access Journals (Sweden)

Adistina Fitriani

2016-09-01

Full Text Available ABSTRACT. The study aims to learn: (1 study the system and process of formation of agroforestri, (2 study management system which includes the Division of labor, working time and work as well as the institusional system, and (3 figure out the composition and structure of plants with agroforestry system. The object of the research is the agroforestry system has been developed by the community in the Sungai Langsat village, Banjar Regency in which consists of a type and composition that forms a system. The results showed that the system agroforestry in the Sungai Langsat village consists of one system of agroforestry, agrisilvikultur system, with two sub system, i.e. the sub system agroforestri rubber garden and Orchard blend. The history of the development of the process of formation of agroforestry system in location research in the beginning was the natural forest or scrub. Then opened by the community for the annual crop of shifting cultivation. As time goes by, in addition to the annual planting crops, also grow fruits and plants producing wooden resin (rubber. In its development the plant fruits into orchards mixture that consists of a variety of fruit trees are scattered at random and irregular, while rubber plantations were planted in irregular and tend to even aged. Keywords: Performance, Traditional, Agroforestry System ABSTRAK.  Penelitan ini bertujuan untuk mempelajari : (1 mempelajari sistem dan proses terbentuknya agroforestri, (2 Mendiskripsikan sistem pengelolaan yang meliputi pembagian kerja, waktu kerja dan sistem kerja serta kelembagaannya, dan (3 mengetahui komposisi dan struktur tanaman dengan sistem agroforestri. Obyek penelitian ini adalah sistem agroforestry yang telah dikembangkan oleh masyarakat di desa Sungai Langsat Kabupaten Banjar yang di dalamnya terdiri atas jenis dan komposisinya yang membentuk suatu sistem. Hasil penelitian menunjukkan bahwa sistem agroforestri yang terdapat di desa Sungai Langsat terdiri dari

DISTRIBUSI HUTAN BAKAU DI LAGUNA PANTAI SELATAN YOGYAKARTA (Mangrove Distribution at the Lagoons in the Southern Coast of Yogyakarta

Directory of Open Access Journals (Sweden)

Tjut Sugandawaty Djohan

2007-03-01

Full Text Available ABSTRAK  Kehadiran sisa hutan bakau di laguna Bogowonto, pantai selatan Yogyakarta menunjukkan bahwa pada masa lalu laguna tersebut didominasi oleh hutan bakau, sehingga penelitian ini bertujuan mempelajari kehadiran vegetasi bakau di laguna-laguna dan muara sungai di pantai selatan tersebut. Ada empat laguna di pantai Selatan Yogyakarta, laguna Bogowonto, Serang, Progo, Opak, dan satu muara sungai, Kali Baron. Laguna tersebut merupakan laguna internitten, artinya pada musim kemarau, mulut sungainya tertutup gumuk pasir dan laguna didominasi oleh perairan tawar dan merupakan ekosistem tergenang. Sebaliknya di musim hujan mulut sungai terbuka, laguna bersifat sebagai ekosistem pasang surut. Data vegetasi dicuplik dengan menggunakan kuadrat plot berukuran 10m x 20m dengan ulangan dua kali. Kuadrat plot ditempatkan pada pusat distribusi mangrovenya, yang dipilih mulai dari rawa burit ke arah muara sungai. Tekstur tanah, hara tanah, salinitas air dan hara air juga dikaji. Kehadiran hutan bakau di laguna dibatasi oleh tekstur tanah. Tekstur pasir, 60-99 %, mendominasi laguna Serang, Progo, Opak dan muara kali Baron. Komunitas bakau hanya ditemukan di laguna Bogowonto, yang tersusun atas 5 jenis bakau, Sonneratia alba, Nypa fruticans, Acanthus ilicifolius, Acrosticum sp., dan Derris heterophylla, dan dua jenis spesies peralihan, Pandanus sp. dan Cynodon dactylon. Pola distribusi komunitasnya mengelompok (clump, mempunyai tipe riverine mangrove,dan tidak membentuk zonasi. Sonneratia hadir mulai dari muara sungai sampai di rawa burit. Ketika air surut salinitas berkisar antara 0-6,5 %. Nypa hanya ditemukan satu kelompok di kaki gumuk. Distribusi Sonneratia tidak ditentukan oleh tinggi genangan, akan tetapi tinggi pneumatophor mengikuti pola tinggi genangan air. Di laguna Bogowonto, spesies bakau tidak mempunyai zonasi dan beradaptasi pada sistem ekologinya.   ABSTRACT  The presence of mangrove remnant at the lagoon of Bogowonto River in the southern

Studi Umum Permasalahan dan Solusi DAS Citarum Serta Analisis Kebijakan Pemerintah

OpenAIRE

Imansyah, Muhammad Fadhil

2012-01-01

Sebagai komponen terpenting dalam kehidupan, keberadaan air sudah selayaknya dijaga dan dilestarikan. Kaidah-kaidah konservasi air harus dipatuhi dalam kehidupan sehari-hari agar kelestarian air dapat berlangsung hingga masa depan. Sungai Citarum sebagai salah satu potensi air terbesar di Jawa Barat menyimpan potensi yang besar bagi masyarakat, baik potensi menguntungkan maupun potensi merugikan. Sayangnya, masyarakat dan pemerintah cenderung terlena oleh potensi menguntungkan ...

Identification of Trihalomethanes (THMs Levels in Water Supply: A Case Study in Perlis, Malaysia

Directory of Open Access Journals (Sweden)

Ab Jalil Mohd Faizal

2018-01-01

Full Text Available In Malaysia, chlorination is used for drinking water disinfection at water treatment plants due to its cost-effectiveness and efficiency. However, the use of chlorine poses potential health risks due to the formation of disinfection by-products such as trihalomethanes (THMs. THMs are formed due to the reaction between chlorine and some natural organic matter. The objective of the study is to analyze the level of THMs in the water supply in Perlis, Malaysia. The water samples were collected from end-user tap water near the water treatment plant (WTP located in Perlis, including Timah Tasoh WTP, Kampung Sungai Baru WTP, Arau Phase I, II, III, and IV WTPs. The THMs were analyzed using a Gas Chromatography-Mass Spectrometry (GC/MS. The results showed that the water supply from Timah Tasoh WTP generates the most THMs, whereas Kuala Sungai Baru shows the fewest amounts of total THMs. In conclusion, the presence of THMs in tap water has caused great concern since these components can cause cancer in humans. Therefore, the identification of THM formation is crucial in order to make sure that the tap water quality remains at acceptable safety levels.

Identification of Trihalomethanes (THMs) Levels in Water Supply: A Case Study in Perlis, Malaysia

Science.gov (United States)

Jalil, Mohd Faizal Ab; Hamidin, Nasrul; Anas Nagoor Gunny, Ahmad; Nihla Kamarudzaman, Ain

2018-03-01

In Malaysia, chlorination is used for drinking water disinfection at water treatment plants due to its cost-effectiveness and efficiency. However, the use of chlorine poses potential health risks due to the formation of disinfection by-products such as trihalomethanes (THMs). THMs are formed due to the reaction between chlorine and some natural organic matter. The objective of the study is to analyze the level of THMs in the water supply in Perlis, Malaysia. The water samples were collected from end-user tap water near the water treatment plant (WTP) located in Perlis, including Timah Tasoh WTP, Kampung Sungai Baru WTP, Arau Phase I, II, III, and IV WTPs. The THMs were analyzed using a Gas Chromatography-Mass Spectrometry (GC/MS). The results showed that the water supply from Timah Tasoh WTP generates the most THMs, whereas Kuala Sungai Baru shows the fewest amounts of total THMs. In conclusion, the presence of THMs in tap water has caused great concern since these components can cause cancer in humans. Therefore, the identification of THM formation is crucial in order to make sure that the tap water quality remains at acceptable safety levels.

Kelayakan Ekonomi dan Lingkungan Kegiatan Pertambangan Rakyat di Kabupaten Sleman

Directory of Open Access Journals (Sweden)

Farida Afriani Astuti

2016-06-01

Full Text Available Kabupaten Sleman memiliki 19 titik lokasi penambangan rakyat yang belum memiliki ijin dari pemerintah. Kegiatan penambangan menghasilkan dampak positif dan negatif bagi lingkungan. Oleh karena itu perlu dilakukan penelitian mengenai kelayakan ekonomi dan lingkungan sebagai dasar untuk memberikan ijin bagi kegiatan pertambangan rakyat tersebut. Penentuan kelayakan ekonomi dan lingkungan menggunakan metode pengharkatan. Kelayakan ekonomi kegiatan penambangan menggunakan 3 parameter sebagai dasar evaluasi, baik untuk penambangan di bukit maupun di sungai. Parameter kegiatan penambangan di bukit adalah umur tambang, potensi pasar dan pemanfaatan bahan galian, dan benefit cost ratio (BCR. Sedangkan parameter kegiatan penambangan di sungai adalah perbandingan cadangan terhadap penggunaan bahan galian (PCPBG, potensi pasar dan pemanfaatan bahan galian, dan benefit cost ratio (BCR. Adapun parameter kelayakan lingkungan adalah jenis dampak yang dihasilkan dari kegiatan penambangan, yaitu Dampak Penting Hipotetik (DPH, Dampak Tidak Penting Hipotetik 1 (DTPH 1, dan Dampak Tidak Penting Hipotetik 2 (DTPH 2. Hasil penelitian menunjukkan bahwa dari aspek kelayakan ekonomi terdapat 10 titik lokasi tidak layak, 5 titik lokasi kurang layak, dan 4 titik lokasi layak. Sedangkan dari aspek kelayakan lingkungan terdapat 12 titik lokasi tidak layak, 4 titik lokasi kurang layak, dan 3 titik lokasi layak.

BIOAKUMULASI MERKURI DAN STRUKTUR HEPATOPANKREAS PADA TEREBRALIA SULCATA DAN NERITA ARGUS (MOLUSKA: GASTROPODA DI KAWASAN BEKAS PENGGELONDONGAN EMAS, MUARA SUNGAI LAMPON, BANYUWANGI, JAWA TIMUR(Bioaccumulation of mercury and the hepatopancreas structure

Directory of Open Access Journals (Sweden)

Susintowati Susintowati

2014-05-01

Full Text Available ABSTRAK Amalgamasi pada proses penggelondongan emas tradisional di muara sungai Lampon menggunakan Merkuri (Hg. Limbah dibuang langsung ke muara dan lingkungan sekitar. Walaupun aktivitas penggelondongan emas telah dihentikan, efek cemar Merkuri terhadap lingkungan termasuk biota terus berlangsung. Bioakumulasi Merkuri dapat ditelusuri menggunakan bioindikator anggota Gastropoda. Penelusuran bioakumulasi Merkuri menggunakan spesimen Terebralia sulcata yang hidup di hutan mangrove sekitar lokasi penggelondongan, dan Nerita argus yang hidup di muara pantai. Analisis Merkuri berdasar metode SNI 06-6992.2-2004 menggunakan perangkat Mercury Analyzer. Hepatopankreas sebagai organ detoksifikasi Merkuri digunakan sebagai parameter patologis. Hepatopankreas masing-masing spesimen dipreparasi dengan metode parafin, diwarnai dengan Hematoksilin Ehrlich’s-Eosin untuk pengamatan struktur mikroskopis. Bioakumulasi Merkuri dalam tubuh T. sulcata hingga 3,10 ppm, sedangkan dalam tubuh N. argus hingga 3,03 ppm. Tampak banyak vesikula residu diduga berisi inklusi pemadatan elektron dan metalotionin sebagai dampak detoksifikasi ion logam Merkuri dalam hepatopankreas. Tubulus hepatopankreas N. argus mengalami disintegrasi dan atropi cukup parah. Walaupun tambang emas di Lampon berskala kecil dan telah ditutup, efek patologis pencemaran Merkuri terhadap biota terutama Gastropoda sangat signifikan.   ABSTRACT Traditional gold mining at Lampon Banyuwangi district was used mercury amalgamation. Tailings are discharged to waters, that caused mercury pollution. Mercury accumulation can be trace in sediments and benthic organisms such as Gastropods. Although the gold mining has been ceased, the impact of mercury pollution can be traced. The purposes of this study are to know the mercury accumulation in sediments, to know mercury bioaccumulation in the soft body of Gastropod bioindicators, to know mercury pathological effect in hepatopancreas. Terebralia sulcata and

Menalar Dinamika Konflik Wisata Goa Pindul

Directory of Open Access Journals (Sweden)

Laode Machdani Afala

2017-09-01

Full Text Available This paper intends to provide an overview of how the drama of the conflict took place in the tourist area of Goa Pindul, Gunungkidul egency. Through the contentious politics approach, this paper oncludes that the dynamics of conflict that occurred in the cinde tour of Pindul have increased escalation of conflict along with the development of Goa Pindul tourism that increasingly famous and bring huge profits. This happens because of the conflictual relationship between the actors, namely the government, Pokdarwis, and local communities in the management of Goa Pindul tourist attraction. The conflict was mainly triggered by the presence of an open opportunity structure of economic structure and land ownership that emerged along with the presence of Goa Pindul tourist attraction. The conflict then expanded and involved many actors through the emergence of claims in their bid for rights over the management of the tourist area.

EVALUASI IMPLEMENTASI TQM PADA SDN KARANGREJEK II DAN SD MUHAMMADIYAH AL MUJAHIDIN WONOSARI GUNUNGKIDUL

Directory of Open Access Journals (Sweden)

Eko Pramono

2015-10-01

Full Text Available Penelitian ini bertujuan mengetahui: (1 seberapa besar tingkat implementasi TQM, (2 perbandingan implementasi, (3 aspek-aspek yang perlu mendapatkan perbaikan untuk ditingkatkan. Penelitian evaluasi dengan model descrepancy. Instrumen pengumpul data berupa angket jawaban skala 2 terdiri atas 69 butir. Teknik analisis data menggunakan teknik persentase. Hasil penelitian menunjukkan bahwa: (1 implementasi TQM di SD Negeri Karangrejek II rata-rata sebesar 87,73%, aspek-aspek yang mendekati standar: mutu pembelajaran, organisasi terbalik, perubahan kultur, kolega sebagai pelanggan, profesionalisme, dan pemasaran internal. Implementasi TQM di SD Muhammadiyah Al Mujahidin rata-rata sebesar 94,42%. Aspek-aspek yang mendekati standar: organisasi terbalik, mutu pembelajaran, perubahan kultur, profesionalisme, kaizen dan menjaga hubungan dengan pelanggan. (2 Perbandingan implementasi TQM sebagai berikut: aspek mutu pembelajaran, organisasi terbalik dan perubahan kultur merupakan aspek dengan rata-rata tertinggi di SD Karangrejek II, sedangkan di SD Muhammadiyah Al Mujahidin: aspek organisasi terbalik, mutu pembelajaran, dan perubahan kultur. (3 Aspek yang perlu mendapatkan perbaikan di kedua sekolah adalah perbaikan terus-menerus.

Komposisi Kimia, Kadar Albumin Dan Bioaktivitas Ekstrak Protein Ikan Gabus (Channa Striata) Alam Dan Hasil Budidaya

OpenAIRE

Ekowati Chasanah; Mala Nurilmala; Ayu Ratih Purnamasari; Diini Fithriani

2015-01-01

Khasiat kesehatan ikan gabus (C. striata) telah dikenal secara luas dan saat ini C. striata telah digunakan sebagai bahan baku industri produk suplemen. Tingginya permintaan akan produk suplemen tersebut menimbulkan masalah pada ketersediaan C. striata yang sebagian besar ditangkap dari sungai dan danau sebagai tempat hidupnya. Ikan gabus budidaya dipercaya memiliki kualitas tidak sebaik ikan gabus alam.Tujuan penelitian ini adalah untuk mendapatkan informasi mengenai komposisi kimia, termasu...

Diversity and distribution of Dorippid Crabs (Brachyura: Dorippidae) in East Coast of Lampung, Indonesia

Science.gov (United States)

Zairion; Hakim, AA; Mashar, A.; Fahrudin, A.; Adrianto, L.; Widigdo, B.; Wardiatno, Y.

2018-05-01

Dorippid crabs (Brachyura: Dorippidae) commonly live in sand or mud substrate at shallow coastal water. These crabs are a macro-benthos, mostly found in tropic, have no economic value, but have high abundance in blue swimming crab habitat and lack information in Indonesia. This study aims to determine diversity and species distribution of dorippid crabs in East Coast of Lampung, Indonesia. This study was conducted on March-April 2017 in seven locations along coastal area (i.e. Labuhan Maringgai, Kuala Penet, Sekopong, Wako, Seputih, Sungai Burung, and Kuala Teladas). The specimen was collected from the blue swimming crab gill-net fishery as by-catch. Each location found by this family was noted at coordinate point at satellite imagery map and processed using ArcGIS. Two species have been found, there are Dorippe quadridens and Dorippoides facchino. Both species were found at every location, except D. quadridens at Sungai Burung as well as D. facchino in Sekopong. There are 74% among the sample of fishermen caught D. quadridens in those areas with an average number of 36 individuals and weight of 959 grams. While, 40% of fishermen caught D. facchino with an average number of 17 individuals and weight 152 grams.

Seaweed temporal distribution in southeast coast of Peninsular Malaysia and isolation of endophytic fungi

Science.gov (United States)

Zainee, Nur Farah Ain; Ismail, Ahmad; Ibrahim, Nazlina; Ismail, Asmida

2018-04-01

Temporal study of seaweeds was carried out between on February 2015 and November 2015 at Kampung Jawa Darat and Kampung Sungai Buntu at Pengerang, Johor, Malaysia. The research objectives were to study the diversity of seaweed and to determine the presence of fungal endophyte in the seaweed. The diversity of seaweed in the sampling site was calculated by using quadrat with 25 meter line transect by 3 replication for each site. The specimen were identified and processed in laboratory and kept for reference in the Algae Herbarium, Universiti Kebangsaan Malaysia. The specimen for fungal endophyte isolation was collected randomly by choosing the complete thallus, transferred into sterile zip-lock plastic bag and kept in freezer until used. From this study, a total of 29 species have been successfully identified including 12 species of Chlorophyta, 2 species of Phaeophyta and 14 species of Rhodophyta. From February to November 2015, the number of species highly varied and a significant change in community structure was noted. Kampung Sungai Buntu shows the highest diversity throughout the study compared to Kampung Jawa Darat. Eighteen seaweed species were screened for the presence of fungal endophyte, Sargassum polycystum shows the highest number of fungal endophyte. This study documented the seaweed diversity in two sites at Pengerang, Johor that accommodates fungal endophytes.

The Increase of Arthropods Biodiversity in Paddy Field Ecosystem Managed by Using Integrated Pest Management at South Borneo

Directory of Open Access Journals (Sweden)

Samharinto

2012-12-01

Full Text Available We have studied the arthropods biodiversity in two paddy field ecosystems, namely, paddy field ecosystem using Integrated Pest Management (IPM system and non-IPM paddy field ecosystem. This study was conducted from April 2011 – November 2011 in three locations, that is, Pasar Kamis village and Sungai Rangas village in Banjar regency, and Guntung Payung village in Banjarbaru city, South Borneo Province. In this study, we used insect nets, yellow sticky traps, light trap and pitfall trap to get the sample or catch the arthropods in one period of planting season. The arthropods caught were then classified into some classes: pest (herbivore, natural enemy (parasitoid and predator, and other arthropods. After that, the Species Diversity Index was determined using its Shannon-Wiener Index (H’, Evenness (e, Species Richness (R, and Species Similarity Index (IS. The sum of arthropods which have the characteristic of pest and parasitoid were higher in the IPM paddy fields than in the non-IPM paddy fields, and the sum of other arthropods were the same. The highest H’ and e values were in the IPM paddy field in Pasar Kamis village. The IS value for each three locations were 77.5% in Pasar Kamis village, 93.42% in Guntung Payung village, and 78.76% in Sungai Rangas village.

Detection of Cryptosporidium and Cyclospora Oocysts from Environmental Water for Drinking and Recreational Activities in Sarawak, Malaysia.

Science.gov (United States)

Bilung, Lesley Maurice; Tahar, Ahmad Syatir; Yunos, Nur Emyliana; Apun, Kasing; Lim, Yvonne Ai-Lian; Nillian, Elexson; Hashim, Hashimatul Fatma

2017-01-01

Cryptosporidiosis and cyclosporiasis are caused by waterborne coccidian protozoan parasites of the genera Cryptosporidium and Cyclospora, respectively. This study was conducted to detect Cryptosporidium and Cyclospora oocysts from environmental water abstracted by drinking water treatment plants and recreational activities in Sarawak, Malaysia. Water samples (12 each) were collected from Sungai Sarawak Kanan in Bau and Sungai Sarawak Kiri in Batu Kitang, respectively. In addition, 6 water samples each were collected from Ranchan Recreational Park and UNIMAS Lake at Universiti Malaysia Sarawak, Kota Samarahan, respectively. Water physicochemical parameters were also recorded. All samples were concentrated by the iron sulfate flocculation method followed by the sucrose floatation technique. Cryptosporidium and Cyclospora were detected by modified Ziehl-Neelsen technique. Correlation of the parasites distribution with water physicochemical parameters was analysed using bivariate Pearson correlation. Based on the 24 total samples of environmental water abstracted by drinking water treatment plants, all the samples (24/24; 100%) were positive with Cryptosporidium , and only 2 samples (2/24; 8.33%) were positive with Cyclospora . Based on the 12 total samples of water for recreational activities, 4 samples (4/12; 33%) were positive with Cryptosporidium , while 2 samples (2/12; 17%) were positive with Cyclospora . Cryptosporidium oocysts were negatively correlated with dissolved oxygen (DO).

Flood Risk Assessment on Selected Critical Infrastructure in Kota Marudu Town, Sabah, Malaysia

Directory of Open Access Journals (Sweden)

Ayog Janice Lynn

2017-01-01

Full Text Available This study investigates the risk of flood on selected critical infrastructure in a flood-prone catchment in Sabah, Malaysia. Kota Marudu, located in the Bandau floodplain, one of the Sabah’s northern water catchments, was selected as the study site due to its frequent flood occurrence and large floodplain coverage. Two of its largest rivers, namely Sungai Bongon and Sungai Bandau, tends to flood during rainy season and cause temporary displacements of thousands of people living in the floodplain. A total of 362 respondents participated in the questionnaire survey in order to gather information on historical flood occurrence. Three flood depth groups were determined, which are 1 less than 0.3 meter, 2 0.3 – 0.6 meter and 3 more than 0.6 meter, while three categories of critical infrastructure were defined, namely transportation system, communication system and buildings. It is found that the transportation system encounters the most severe impact as flood inundation increases, where 92% of the respondents believe that the transportation access should be abandoned when flood depth is more than 0.6m. The findings of this study will be used for detailed risk assessment, specifically on the vulnerability of the critical infrastructures to flood in this floodplain.

Microbial keratitis in West and East Malaysia

OpenAIRE

Vanitha Ratnalingam; Thiageswari Umapathy; Kala Sumugam; Hanida Hanafi; Shamala Retnasabapathy

2017-01-01

AIM: To evaluate the epidemiological and etiological factors of microbial keratitis seen in tertiary hospitals in West and East Malaysia.METHODS: A total of 207 patients were enrolled. Patients referred for microbial keratitis to Sungai Buloh Hospital and Kuala Lumpur Hospital in West Malaysia and Queen Elizabeth Hospital and Kuching General Hospital in East Malaysia were recruited. Risk factors were documented. Corneal scrapings for microscopy and culture were performed.RESULTS: The most com...

Peran Pengurus Credit Union Canaga Antutn dalam Pemberdayaan Masyarakat Sektor Pendidikan di Desa Menyumbung

OpenAIRE

Marjuki, Firmus

2017-01-01

Minithesis title this the role of management credit union canaga antutn in the community empowerment of education sector in the village menyumbung district hulu sungai. Public problem is how role of management credit union canaga antutn in the community empowerment of education sector ? With sub problem how form the role management and aktivities empowerment of education sector be socialization ?. Purpose the minithesis to description how role management credit union canaga antutn in the comm...

Index insurance for pro-poor conservation of hornbills in Thailand

OpenAIRE

Chantarat, Sommarat; Barrett, Christopher B.; Janvilisri, Tavan; Mudsri, Sittichai; Niratisayakul, Chularat; Poonswad, Pilai

2011-01-01

This study explores the potential of index insurance as a mechanism to finance community-based biodiversity conservation in areas where a strong correlation exists between natural disaster risk, keystone species populations, and the well-being of the local population. We illustrate this potential using the case of hornbill conservation in the Budo-Sungai Padi rainforests of southern Thailand, using 16-y hornbill reproduction data and 5-y household expenditures data reflecting local economic w...

PROPORSI BAGIAN TUBUH DAN KADAR PROKSIMAT IKAN GABUS PADA BERBAGAI UKURAN

OpenAIRE

Ruddy - Suwandi; - - nurjanah; margaretha - winem

2014-01-01

Ikan gabus (Channa striata) merupakan jenis ikan air tawar yang sudah banyak dikenal oleh masyarakat Indonesia. Ikan gabus hidup di muara sungai, danau, rawa, dan dapat pula hidup di air kotor dengan kadar oksigen rendah. Ikan gabus belum banyak dibudidayakan secara luas dan belum banyak dimanfaatkan sebagai produk olahan ikan. Informasi mengenai proporsi tubuh ikan gabus masih kurang dan belum banyak dikaji. Penelitian ini bertujuan untuk menentukan proporsi bagian-bagian tubuh ikan dan komp...

Melioidosis in acute cholangitis of diabetic patient: a forgotten diagnosis

OpenAIRE

Mohamad, Nasir; Ponnusamy,Suresh; Devi,Sunita; Manikam,Rishya; Idrus,Ilya Irinaz; Hidayah Binti Abu Bakar,Nor

2012-01-01

Nasir Mohamad,1 Suresh Ponnusamy,2 Sunita Devi,3 Rishya Manikam,4 Ilya Irinaz Idrus,1 Nor Hidayah Abu Bakar51Department of Emergency Medicine, School of Medical Sciences, Universiti Sains Malaysia, Kubang Kerian, Malaysia; 2AIMST University, Bedong, Malaysia; 3Hospital Sultan Abdul Halim, Sungai Petani, Malaysia; 4University Malaya Medical Centre, Kuala Lumpur, Malaysia; 5Department of Pathology, Hospital Raja Perempuan Zainab II, Kota Bharu, MalaysiaAbstract: Melioidosis presents with a wide...

Konsep ABG (Academic-Business-Government dalam Rencana Sistem Industri Berbasis Potensi Daerah Kabupaten Sleman dan Gunung Kidul

Directory of Open Access Journals (Sweden)

Muhammad Prasanto Bimantio

2018-01-01

Full Text Available Daerah Istimewa Yogyakarta (DIY mempunyai potensi industri yang cukup tinggi, baik industri kecil, menengah, maupun besar. Namun daya saing produk industri pengolahan di DIY rendah karena beberapa faktor, yakni masih lemahnya keterkaitan antar industri, keterbatasan produksi barang setengah jadi dan komponen di dalam negeri, keterbatasan industri berteknologi tinggi, kesenjangan kemampuan ekonomi antardaerah, serta ketergantungan ekspor pada beberapa komoditas tertentu. Penelitian ini bertujuan untuk membuat rancangan konsep kawasan industri berbasis potensi daerah (Domestic Based Industry/ DBI menggunakan pendekatan sinergi Academic-Business-Government (ABG. Pendekatan ini dilakukan dengan fokus pada pemanfaatan bahan baku, sumber daya manusia, dan pemenuhan permintaan pasar lokal. Hasil kajian ini menghasilkan tiga konsep kawasan DBI yang diusulkan: (i pengolahan produk turunan salak pondoh di Turi Sleman, (ii pengolahan zeolit di Gedangsari Gunungkidul, dan (iii pengolahan limbah produk biogas di Cangkringan Sleman. Ketiga konsep kawasan industri pengolahan tersebut saling terkait dan akan membentuk jejaring yang terintegrasi mulai dari bahan baku hingga produk, baik dengan industri rancangan baru maupun dengan industri yang sudah ada.

STUDI KUALITAS AIR SUNGAI TELAGA WAJA KABUPATEN KARANGASEM

Directory of Open Access Journals (Sweden)

K.G. Darma Susila

2015-06-01

Full Text Available Telaga Waja River in Karangasem Regency has got water discharge from 2.500 to 3.500 litre per second. The use of fertilizer, farm and household cesspool disposal, and changes of land function can reduce the quality of the water. This research is done in order to know the quality of water and index of its pollution. This research is done in Telaga Waja river for along 10 kilometres from Besakih Village to Muncan Village from August until November 2011. The research of physic parachmeter, chemistry and microbiology by taking sample for insitu and eksitu examination are compared with the standard quality of Balinese Goverment Regulation No.8/2007. While the observation and interview are done in order to know beha,1our of the people in polluting the water. Result of the research shows that the concentration of Fecal coli and Total coliforms reach 240.000.000 MPN/100 ml It is more than standard quality of all classes.The analysis of COD is more than first class water quality, BOD and Fosfat are more than third class water quality and DO concentration is less than minimum first class water concentration. The evaluation of Pollution Index (Pl for first class water in all location is high polluted. Evaluations PI of third and fou1th class standard water quality in Menanga Village and Muncan Village are medium polluted and from Rendang Village until Muncan Village is high polluted in the delta of the river. Water condition indicate function ofTelaga Waja watershed for agriculture, living place, tourism ( rafting, restaurant, and villa, and mining pollute the water. Base on the evaluation of pollution index, all locations are medium and high polluted. That is why the goverment, entrepreneurs, and the society should save River Telaga Waja by keeping it clean. Observation of the water quality is also should be done regularly.

Characteristics Of Smoked Catfish (Hemibagrus Nemurus) Prepared Frompond Culture, Cage And Wild Fish

OpenAIRE

Maskilin, Jippo; Hasan, Bustari; Leksono, Tjipto

2017-01-01

This study was aimed to evaluate the sensory quality, proximate composition, amino acids and fatty acids profiles of smoked catfish prepared from pond, cage culture and wild fish. Catfish samples 300-350 grams in weight wastaken respectualy from wild (Kampar river), pond and cage culture in Sungai Paku, Kampar. The fish was smoked using hot smoking method, and the smoked fish was evaluated for smoking yield, sensory quality, proximate composition, amino acid and fatty acid profile.The smoking...

Modifikasi Jembatan Sembayat Baru II Menggunakan Sistem Jembatan Busur Rangka Baja

Directory of Open Access Journals (Sweden)

Rio Prasmoro

2017-03-01

Full Text Available Perencanaan struktur jembatan perlu mempertimbangkan desain yang tepat agar material yang digunakan menjadi efektif. Jembatan Sembayat Baru II di Kabupaten Gresik yang didesain menggunakan jembatan busur beton dengan bentang 93 m dimana terdapat pilar pada badan sungai, menjadi tidak efektif karena dapat mengurangi effective linear waterway sungai tersebut. Pertimbangan jembatan bentang panjang yang berupa busur merupakan keputusan yang tepat, hanya saja bentang yang didesain masih kurang maksimal. Dalam perencanaan ini, jembatan Sembayat Baru II didesain dengan tetap menggunakan jembatan busur namun material beton dirubah menjadi material baja, dimana dengan penggunaan material baja, bentang jembatan dapat lebih maksimal. Sehingga dari desain awal yang terdapat 5 bentang jembatan prategang dan 1 bentang jembatan busur, dirubah menjadi 4 bentang jembatan prategang dan 1 jembatan busur tipe a half through arch dengan bentang 144 m. Dasar perencanaan jembatan mengacu pada peraturan BMS 1992 dan SNI 1729-2015. Analisis perhitungan struktur utama dan sekunder menggunakan bantuan software MIDAS Civil 2011. Dari hasil perencanaan, didapat profil struktur busur utama yaitu menggunakan profil Box 800x500x38x38 dan batang tarik menggunakan profil Box 800x600x45x45. Perhitungan accidental load yang berupa 1 batang penggantung putus menghasilkan kesimpulan bahwa jembatan masih mampu menahan beban layan selama masa perbaikan. Metode pelaksanaan yang ditinjau menggunakan sistem Full Cantilever.

Slippery Violence in the REDD+ Forests of Central Kalimantan, Indonesia

Directory of Open Access Journals (Sweden)

Peter Howson

2018-01-01

Full Text Available Due to increasing global demand for palm oil, coal, and timber, Indonesia has become the largest contributor of greenhouse gases from primary forest loss in the world. Carbon market mechanisms, like Reducing Emissions from Deforestation and forest Degradation (REDD+, are being promoted by many elements of Indonesia's government as an effective policy response. The REDD+ programme is designed to enable the provision of financial compensations to protect and restore standing forests by making them more valuable than the timber they contain. However, the logic of REDD+ constructs people living in and around project sites as environmentally destructive and therefore in need of incentivisation to do otherwise. Local people are compensated for the 'opportunity costs' of not degrading forests. Within this frame ‘locals’—suffering from the malaise of dispossession—are Othered as illegal loggers, poachers, greedy miners or arsonists. In reality, REDD+ often facilitates the continuation of violence, legitimising an image of small-holders, rather than large international corporations, as the cause of forest degradation in Indonesia. Focusing on the Sungai Lamandau REDD+ project of Central Kalimantan, I discuss how, for some of Sungai Lamandau's landless farmers, REDD+ is accelerating the very violence and environmentally destructive behaviours it claims to discourage. Farmers are becoming embroiled in other ongoing processes, pushing them towards illicit livelihood strategies, sometimes with devastating outcomes.

Model Pengambilan Keputusan Untuk Mengembalikan Fungsi Hutan Pasca Reklamasi Lahan Bekas Timah dengan Analytical Hierarchy Process

Directory of Open Access Journals (Sweden)

Hilyah Magdalena

2017-07-01

Full Text Available Setelah masa kejayaan timah berlalu dari Pulau Bangka, maka saat ini Pulau Bangka harus berusaha membenahi peninggalan penambangan timah yang telah berlangsung lama. Masalah besarnya adalah rusaknya ekosistem baik itu di darat, sungai, maupun di pesisir pantai. Selain itu areal bekas tambang timah ternyata cukup luas dan seharusnya dapat dimanfaatkan kembali untuk kesejahteraan masyarakat Pulau Bangka. Direktorat Kehutanan mempunyai beberapa strategi untuk memanfaatkan kembali lahan bekas tambang timah tersebut. Penelitian ini menganalisa beberapa kriteria untuk meenentukan model pengambilan keputusan terbaik yang akan dilaksanakan di Pulau Bangka. Kriteria–kriteria yang dianalisa adalah lokasi tambang terdiri dari lokasi daratan, sungai, dan pesisir pantai. Kriteria lainnya adalah dampak lingkungan yang terdiri dari rusaknya ekosistem pesisir, cemarnya sumber air bersih, perubahan topografi garis pantai, limbah tailing, padang pasir, dan erosi. Kriteria terakhir yang dianalisa adalah teknologi perbaikan lahan yang terdiri dari, teknologi pertanian dengan amelioran pupuk organik dan menggunakan kompos untuk menurunkan kadar timbal dalam air kolong sebagai media budidaya ikan. Sedangkan alternatif – alternatif yang akan dipilih untuk mengembalikan fungsi hutan di Pulau Bangka adalah agroforestri, ekowisata, silvopastura, dan silvofishery. Penelitian ini menggunakan metodologi Analytical Hierarchy Process (AHP yang menyusun beberapa criteria untuk memilih beberapa alternatif dengan membandingkan tingkat kepentingannya. Hasil pengolahan data menunjukkan bahwa kriteria paling penting adalah teknologi perbaikan lahan dengan bobot mencapai 48,9% dan alternatif yang terpilih adalah agroforestri dengan bobot mencapai 33,1%.

STUDI HIDROLOGI BERDASARKAN CLIMATE CHANGES MENGGUNAKAN MODEL SWAT DI DAERAH TANGKAPAN AIR WADUK JATILUHUR

OpenAIRE

Supatmanto, Budi Darmawan; Yusuf, Sri Malahayati

2015-01-01

Daerah Tangkapan waduk Jatiluhur berada diantara 107011'36” - 107032'36" BT and 6029'50" - 6040'45" LS di Jawa Barat, Indonesia. Area dengan luas 380 km2 merupakan 8% dari seluruh total area Hulu Sungai Citarum seluas 4500 km2. Fungsi dari daerah ini untuk memenuhi kebutuhan air untuk pertanian di Karawang dan Bekasi dan memenuhi kebutuhan air di Jakarta. Tujuan dari penelitian ini untuk meneliti dampak dari perubahan ik (Climate Changes) terhadap hasil hidrologi di daerah tangkapan. Perubaha...

Hubungan Kecerdasan Emosional dan Kemampuan Menyelesaikan Masalah Matematika Siswa di SMP Bumi Khatulistiwa

OpenAIRE

Rospitasari, Murni

2017-01-01

This reseach aimed to know the correlation among emotional intelligence and the ability of mathematics problem solving of the ninth grade students of SMP Bumi Khatulistiwa Sungai Raya. The method that used un this reseach was a quatitative descriptive with Ex Post Facto form. The subject of this research were the ninth grade students class B that consist of 13 student. Data collection techniques in this research was a measurement technique in the form of essay and the scale of emotional inte...

Social innovation to promote sustainability and independence of small-scale palm oil farmers in the Province of Jambi, Indonesia

OpenAIRE

Firman, Anita Nathalia

2017-01-01

The aim of this thesis was to investigate the situation of the independent small-scale palm oil farmers in the Province of Jambi, Indonesia regarding the practices of palm oil production that cause deforestation in Sumatra. The goal of this thesis was to provide sustainable opportunities for the independent small-scale farmers in Jambi through social innovation. The field research took place at the village of Mekar Jaya and Sungai Rotan Village in the Provinces of Jambi, Indonesia. In the fra...

Validitas Media Gambar Dengan Aplikasi Movie Maker Pada Materi Sistem Pencernaan Manusia Untuk Tingkat SMP

OpenAIRE

Susanti, Diana

2016-01-01

The result of research interviews with biology teacher at SMPN 2 Sungai Limau, Padang- Pariaman district revealed that, when the teacher explains the material in human digestive system, teachers only explain lessons using media board. Though these materials, demanding to know the structure of the digestive organs and the digestive process. In addition, the average value of students for the material is still below 65, while KKM. The KKM is 77. So that the material presented by the teacher cann...

Evaluasi Mutu Sensoris dan Kimia Ikan Asap Baung (Mystus Nemurus) yang Dibuat dari Ikan Segar dan Beku

OpenAIRE

', Sahyudi; Hasan, Bustari; ', Desmelati

2015-01-01

This study was aimed to evaluate the sensory and chemical quality ofMystus smoked fish (Mystus nemurus) made from fresh and frozen fish. Mystusfish harvest size (200-300 grams) per head obtained from aquaculture cages inSungai Paku, Kampar. A total of 10 fish were frozen at -18 0C for 10 days beforesmoked and 10 other smoked in a fresh condition. Before the two fish groupssmoked, each cleaved form of butterfly like cut and filleted. Mystus fish thenwashed with clean water and smoked using mul...

Parental involvement in elementary school-aged child’s creativity

Science.gov (United States)

Suparmi; Suardiman, S. P.; Kumara, A.

2018-01-01

This study aims at describing the parental involvement in cultivating elementary school-aged child’s creativity. The qualitative research was designed with multidisciplinary study approach. Eight students and some parents from public elementary schools of Ngawen 4th of Gunungkidul, Yogyakarta, and 4 students from an elementary school in Sleman, Yogyakarta were involved in the process of collecting the data. In-depth interview, observation, and documentation were used simultaneously to collect the data. The results showed that: 1) the subject had a level of intelligence quotient; the intelligence of verbal creativity above the average level, and creative behaviour on average, 2) interaction of parents and child-related discussions, experiences, and plans, academic problems in school were needed to boost the students’ creativity, 3) interactions of parents and school-related participations in school were also encouraged to implant students’ social awareness, 4) interaction among parents communicated each other to have a better result of academic awareness, and 5) Parents should install family norms to cultivate children’s intelligence quotient.

REVIEW ON WATER POLLUTION STUDIES IN INDONESIA

Directory of Open Access Journals (Sweden)

Bambang Hartono

2012-09-01

Full Text Available Tulisan ini merupakan tinjauan terhadap lebih dari 60 penelitian yang pernah dilakukan di Indonesia yang berkaitan dengan masalah pencemaran air. Dalam tinjauan ini terungkap bahwa hampir semua jenis sumber air, yaitu sungai, danau, tambak, laut maupun air tanah (misalnya sumur yang pernah diteliti, telah mengalami pencemaran. Pencemarnya terdiri dari semua jenis pencemar, baik bakteriologis, fisis maupun kimiawi. Pencemar bakteriologis terutama datang dari pembuangan tinja manusia. Bukan hanya karena letak sumber air yang berdekatan dengan pembuangan tinja yang menyebabkan pencemaian, melainkan juga karena perilaku masyarakat. Namun dicatat pula bahwa penelitian dalam bidang ini masih terlalu sedikit. Khususnya yang berkaitan dengan besarnya masalah. Pencemar fisis dan kimiawi terutama berasal dari pabrik-pabrik. Yang banyak mendapat perhatian tampaknya adalah logam-logam berat. Walaupun dijumpai kandungan beberapa logam berat dalam air ma­sih di bawah standar, tetapi beberapa yang lain cukup potensial atau telah melewati batas-batas standar dan bahkan telah menimbulkan dampak negatif terhadap kesehatan masyarakat. Hal ini terutama dikarena­kan banyaknya pabrik-pabrik yang membuang limbah industrinya langsung ke sungai dan badan-badan air lain tanpa pengolahan terlebih dulu atau dengan pengolahan yang tidak sempurna. Selain deterjen, sampah rumah tangga, pestisida dan pupuk sebagai pencemar, yang masih kurang mendapat perhatian peneliti, akhir-akhir ini muncul masalah baru yang tampaknya lebih menarik minat para peneliti, yaitu intrusi air laut. Dari beberapa penelitian yang telah dilakukan terungkap bahwa masalah ini pun sudah cukup serius, khususnya di daerah dekat pantai.

The use of Moringa oleifera seed as a natural coagulant for wastewater treatment and heavy metals removal

Science.gov (United States)

Shan, Tan Chu; Matar, Manaf Al; Makky, Essam A.; Ali, Eman N.

2017-06-01

Moringa oleifera (MO) is a multipurpose tree with considerable potential and its cultivation is currently being actively promoted in many developing countries. Seeds of this tropical tree contain water-soluble, positively charged proteins that act as an effective coagulant for water and wastewater treatment. Based on this, water quality of "Sungai baluk" river was examined before and after the treatment using MO seed. MO seed exhibited high efficiency in the reduction and prevention of the bacterial growth in both wastewater and "Sungai baluk" river samples. The turbidity was removed up to 85-94% and dissolved oxygen (DO) was improved from 2.58 ± 0.01 to 4.00 ± 0.00 mg/L. The chemical oxygen demand (COD) and biological oxygen demand (BOD) were increased after the treatment from 99.5 ± 0.71 to 164.0 ± 2.83 mg/L for COD and from 48.00 ± 0.42 to 76.65 ± 2.33 mg/L for BOD, respectively. Nevertheless, there was no significant alteration of pH, conductivity, salinity and total dissolved solid after the treatment. Heavy metals such as Fe were fully eliminated, whereas Cu and Cd were successfully removed by up to 98%. The reduction of Pb was also achieved by up to 78.1%. Overall, 1% of MO seed cake was enough to remove heavy metals from the water samples. This preliminary laboratory result confirms the great potential of MO seed in wastewater treatment applications.

Financial assessment of oil palm cultivation on peatland in Selangor, Malaysia

Directory of Open Access Journals (Sweden)

M.N. Noormahayu

2009-02-01

Full Text Available Oil palm plantations on peat soils are generally believed to have greater environmental impacts than those on other soil types. Nonetheless, Malaysia operates substantial incentives to maximise palm oil production, which in practice encourage the establishment of plantations on peatland. This paper explores the social and economic basis of oil palm cultivation on one peatland estate at Sungai Panjang in the state of Selangor, peninsular Malaysia. Data were obtained by conducting a questionnaire survey of 200 farmers who cultivate oil palm on peat soil. Some of the data were cross-tabulated against farmers’ ages in order to identify any age-related trends in education level, the area of land farmed, annual income and knowledge about oil palm cultivation. The Cobb-Douglas production function was used to model the financial output from oil palm in terms of the costs of chemical inputs and labour. The results indicated that cultivation of this crop gives decreasing returns to scale on peatland in Sungai Panjang, and that chemical inputs are more important than labour cost in determining the level of financial output. Finally, the financial viability of oil palm cultivation for farmers was assessed by calculating three financial indicators (NPV, BCR and IRR. This can be a profitable investment so long as growth conditions, costs, selling price and interest rate do not fluctuate substantially. Greater annual returns can be achieved over 20–25 years than over shorter periods, especially of less than 10 years.

Persepsi Masyarakat Kampung Cieunteung, Kabupaten Bandung tentang Rencana Relokasi Akibat Bencana Banjir

Directory of Open Access Journals (Sweden)

Fanni Harliani

2015-04-01

Full Text Available Abstrak: Salah satu upaya yang dilakukan pemerintah untuk memperkecil dampak banjir di Daerah Aliran Sungai (DAS Citarum khususnya di Kabupaten Bandung adalah dengan rencana memindahkan penduduk ke tempat lain. Penelitian ini bertujuan untuk mengidentifikasi faktor-faktor yang mempengaruhi persepsi masyarakat terhadap rencana relokasi permukiman di Kampung Cieunteung. Metodologi penelitian dilakukan dengan cara menyebarkan kuesioner dan dengan mewawancarai berbagai stakeholder terkait seperti tokoh masyarakat dan beberapa instansi pemerintahan. Berdasarkan hasil analisis dapat disimpulkan bahwa sebagian besar masyarakat di Kampung Cieunteung, Kabupaten Bandung menolak adanya rencana relokasi sebagai upaya menanggulangi bencana banjir. Faktor-faktor yang mempengaruhi penolakan masyarakat ini meliputi proses penyebaran informasi, komunikasi antar stakeholder, serta keterlibatan masyarakat dalam proses perencanaan, tingkat pendidikan, hubungan sosial masyarakat yang terjalin, serta cara menyampaikan aspirasi kepada pemerintah.Kata kunci: Pengelolaan risiko banjir, relokasi, Daerah Aliran Sungai (DAS, persepsi masyarakatAbstract: One of the efforts made by government to minimize the impact of flooding in the Citarum River Basin, particularly Bandung District, is through relocation. This study aims to identify factors influencing inhabitants’ perceptions on the relocation plan in Cieunteung. The research methods inlcude distributing questionnaire and conducting interviews with related stakeholders. The analysis shows that most of the people in Cieunteung rejected the relocation plan. Factors influencing this community rejection consist of information dissemination process, inter-stakeholders communication, community involvement in the planning process, level of education, social relations, and aspiration chanelling to the government.Keywords: Flood risk management, relocation, river basin, community perception

Prevalence of Helicobacter pylori infection among patients referred for endoscopy: Gender and ethnic differences in Kedah, Malaysia

Directory of Open Access Journals (Sweden)

Sreenivasan Sasidharan

2012-02-01

Full Text Available Objective: To study the prevalence of Helicobacter pylori (H. pylori infection, according to ethnicity and gender among the people of Sungai Petani, Kedah, Malaysia who undergo endoscopy. Methods: To study the epidemiology of H. pylori infection in Kedah, Malaysia population, we assessed the database of hospital admissions of the patients referred to the Endoscopy Unit at Sungai Petani Hospital for oesophagogastro-duodenoscopy (OGD between January 2000 and December 2007. For statistical analysis, the Fisher’s exact test (2- tailed test was used. H. pylori infection rate was determined in 1 965 consecutive patients. Results: Out of 1 965 patients, 597 (30.4% were positive and 1368 (69.6% were negative for H. pylori infections. Generally, the prevalence rate among males (51.9%; 398/767 was significantly higher (P<0.05 than for females (33.1%; 199/601. In terms of ethnics, the overall prevalence showed H. pylori infection was commonly found among Indians and Chinese with prevalence rate of 35.6% (194/545 and 28.6% (100/350 respectively. These figures are significantly higher (P< 0.05 than the 28.5% (300/1051 for Malays. The prevalence rates for Malay males was lower (P<0.05 than those of Chinese and Indians. Conclusions: In conclusion, there is a significant difference in H. pylori infection prevalence rates among ethnic groups (highest in Indians, then Chinese and unusually low in Malays and gender groups (highest in males in Kedah, Malaysia.

Sistem Informasi Geografis Pemetaan Daerah Aliran Sungai Berbasis Web

Directory of Open Access Journals (Sweden)

Sitta Rahayu

2016-08-01

Full Text Available Watershed management becomes very important because the more maintained its watershed, the risk for disasters caused by the overflowing river became smaller. Watershed management could be done if the information on that watershed could be complete, but untill this day, the available information was lacking. This condition caused the difficulty of data collected, so required a system that could be used to perform watershed data processing. A system that to be used is Geographic Information Systems Watershed Mapping. This system  is a Web-based system that can be used for collected data and mapping the watershed using a map from Google Maps. Features polyline which was owned by Google Maps can be used to describe a network of rivers and long inundation, library geometry was used to calculate the length of polylines, feature marker was used to describe the location of the dam and the point was prone to flooding of a river and features a polygon used to describe the watershed. This system can collected data watershed in two ways, namely digitization and input the coordinates that can be done by the admin. Results from watershed data can provide information to the user about the location of the dam along with its description, the river network in the watershed, a point prone to flooding, inundation and limit the length of the watershed and its description.

KARAKTERISTIK SUSU KERBAU SUNGAI DAN RAWA DI SUMATERA UTARA

Directory of Open Access Journals (Sweden)

Evy Damayanthi

2014-08-01

Full Text Available The objective of this research was to investigate the characteristics and differences in quality milk of Water andSwamp buffalo milk in North Sumatera. This research was conducted used complete random design used 30buffalo from three breeding farm in North Sumatera. Buffalo milk were collecting from lactating buffaloes on threetraditional farms located at Patumbak, Lubuk Pakam, and Siborong-borong with extensive farming system. Theresult of this research shown milk production per day for Swamp buffalo is 1 1.5 l and Water buffalo is 6 8 l withquality of Swamp and Water buffalo sequentially are for protein 5.14 ± 0.37% and 4.68 ± 0.41%, fat content 7.52 ±0.98% and 4.13 ± 0.73%, non-fat dry matter (NFDM 10.61 ± 0.78% and 11.5 ± 0.86%, moisture 81.87 ± 2.26% and80.33 ± 2.33%, milk density 1.030 and 1.036, and then Total Plate Count (TPC 3.79 x 106 and 5.08 x 105, shownindicated that there ware significant difference in protein, fat content and NFDM (P<0.01. But there is nodifferences in moisture and milk density. TPC shown that Swamp buffalo milk has above the maximum microbespresent in milk. The conclusion of this research is milk production of Swamp buffalo less than River buffalo but hashigher in chemical quality of milk than River buffalo such as protein, NFDM and fat content. Amino acids in Swampbuffalo milk were higher than River buffalo milk. Althought buffalo has less milk production than cow but buffalomilk were higher in all quality tested parameters and have more potential than dairy cow to be developed becausemaintenance of buffalo in North Sumatera is still use traditional method and not yet leading to efforts to obtainmaximum production performance.

Perencanaan Check Dam Sungai Glugu Kabupaten Grobogan, Jawa Tengah

OpenAIRE

Kusuma, Abhibawa Tegar; Wijayanti, Deny; Atmojo, Pranoto Sapto; Edhisono, Sutarto

2015-01-01

Glugu River is a tributary of the Lusi River under the authority of the Central River Region Pemali - Juana, precisely located in the administrative area of the Grobogan Regency. Location of Glugu River located upstream, gave effect to the degradation of the river channel, so as to stabilize the river flow necessary to design coservation structure on Glugu River, that is check dam.The data used for design check dam are the primary data (geotechnical, geometry Glugu River, and water when the f...

PERENCANAAN KAPASITAS PEMBANGKIT PLTM SUNGAI LOGUNG KARANGTALUN KABUPATEN TEMANGGUNG

Directory of Open Access Journals (Sweden)

Agung Nugroho

2013-12-01

Full Text Available Central Java Province intends to improve the use of renewable energy (EBT such as water resources. Logung river at Ngaliyan subdistrict, Temanggung district has potential energy for micro power plan. The first step to use the water resource is determining the capacity of a mini hydro power plan in accordance with the conditions of the river Logung. Based on the the technical study, the elvation height between the prospective weir with potential power house is 110 m and the effetive height at 105 m. Logung maximum river flow is 11.06 m3/dt, with average flow is 4,77 m3/dt., The minimum flow is 0,75 m3/dt. This electricity power is 10253.12 KW with maximum flow, it will be produced 4848.44 KW at maximum flow 60 %. The minimum flow can deliver 695,28 KW. The suitable capacity for the generator of micro power plants of Logung is 3220 KVA when it is according to manufacture. Key words : power, flow, power

Penentuan Konsentrasi Tanah dalam Air Sungai Berdasarkan Perbedaan Warna

Directory of Open Access Journals (Sweden)

Imam Sofi'i

2008-08-01

Full Text Available Information of soil erosion is very useful related with prevention action and planning in the future. The objective of this research is to determine soil concentration in water river based on colour differences using image processing and artificial neural network (ANN. Soil and water mixture image was taken using a digital camera then was processed by an image processing program. Two ANN Models were developed. The first model had 3 input parameters while the second model had 6 input parameters. Both models had altogether one output parameters of the soil concentration. The accuracy of the first model was 38% while the second one was 36%.

PERANSERTA MASYARAKAT DALAM PENGELOLAAN LINGKUNGAN PERMUKIMAN DI KELURAHAN 5 ULU PALEMBANG (The Community Participation in Settlement Environment Management at Kelurahan 5 Ulu Palembang, Indonesia

Directory of Open Access Journals (Sweden)

Korlena Korlena

2003-07-01

Full Text Available ABSTRAK Kebutuhan untuk permukiman yang baik dan memaciai merupakan salah satu masalah perkotaan yang harus diatasi oleh pemerintah. Kampung lrnprovement Progran (KIP yang berisikan pengembangan infrastruktur pemukiman merupakan jawaban untuk masalah tersebut. Kegunaan KIP adalah untuk memotivasi masyarakat agar dapat menolong dirinya sendiri dalam bentuk partisipasi dalam mengelola lingkungan sekitarnya. Penelitian ini berfokus pada partisipasi masyarakat di Kelurahan 5 Ulu Palembang. Penelitian ini bertujuan untuk mengkaji tingkat partisipasi masyarakat dalam KIP di sepanjang sungai, dan mengidentifikasi faktor determinan yang mempengaruhi partisipasi. Penelitian ini menggunakan pendekatan eksplanasi, dengan menggunakan proporsional random sampling dengan unit analisis rumah tangga di 2 wilayah yaitu daerah KIP dan sepanjang sungai. Data dikurnpulkan rnenggunakan kuesioner, interview pengamatan lapangan dan data sekunder. Metode statistik multiple regression digunakan untuk mengetahui pengaruh faktor sosial-demografi dan sosio-ekonomik terhadap tingkat partisipasi, Uji T-test independent sample dan Mann-Withey-test digunakan untuk membedakan partisipasi di 2 wilayah. Hasil penelitian menunjukkan bahwa : (1 partisipasi di daerah KIP untuk jalan dan drainase cenderung berupa kontribusi tenaga dan uang, sedangkan pengelolaan sampah padat cenderung dalam bentuk uang, sementara di daerah sepanjang sungai hal tersebut cenderung tenaga saja; (2 tingkat partisipasi masyarakat yang tinggal di daerah KIP lebih tinggi dari pada yang ada di sepanjang sungai; (3 faktor sosial-demografi dan sosio-ekonomi menentukan tingkat partisipasi dalam pengelolaan jalan dan drainase, sedangkan faktor kepemilikan rumah dan faktor pendapatan menentukan tingkat partisipasi dalam pengelolaan limbah padat; (4 faktor determinan yang mempengaruhi tingkat partisipasi adalah kepemimpinan formal dan informal, kondisi geografis, infrastruktur KIP, rasa keterasingan, kebutuhan

Kandungan logam berat dalam sedimen di Perairan Teluk Wawobatu, Kendari, Sulawesi Tenggara

Directory of Open Access Journals (Sweden)

Edward

2014-08-01

Full Text Available Pengamatan kandungan logam berat dalam sedimen di Perairan Teluk Wawobatu, Kendari telah dilakukan pada bulan Juni 2011. Contoh sedimen diambil dengan menggunakan gravity core pada 5 stasiun penelitian. Kandungan logam berat diukur dengan menggunakan Spektrofotometer Serapan Atom (SSA. Tujuan penelitian ini adalah untuk mengetahui kandungan logam berat dalam sedimen serta memprediksi kualitas sedimen berdasarkan pendekatan analisis indeks (Indeks geoakumulasi dan Indeks Beban Pencemaran. Hasilnya menunjukkan, kandungan Pb berkisar 3,704-21,892 ppm, Cd 0,784-1,385 ppm, Cu 3,451-12,193 ppm, Zn 24,838-69,973 ppm, dan Ni 37,289-72,329 ppm. Kandungan ke lima logam tersebut masih lebih rendah dari nilai ambang batas yang ditetapkan oleh Kantor Menteri Negara Lingkungan Hidup 2010 dan baku mutu sedimen Ontario (Ontario Sediment Guideline 2008. Kandungan logam berat dalam sedimen di Stasiun 4 lebih tinggi dibandingkan dengan Stasiun lainnya. Hal ini disebabkan oleh perbedaan tekstur sedimen di masing-masing stasiun. Stasiun 4 berada di muara sungai dan mempunyai sedimen dengan tekstur berupa lumpur berwarna hitam. Kandungan logam Ni lebih tinggi dibandingkan dengan yang lain, hal ini menunjukkan adanya masukan sedimen dari Teluk Kendari dan Teluk Lasolo yang terbawa oleh arus, disamping yang berasal dari darat yang masuk melalui aliran sungai. Berdasarkan nilai indeks geoakumulasi (I-geo sedimen di perairan ini termasuk kategori tidak tercemar oleh Pb, Cu, Zn, dan Ni (I_geo<0, dan tercemar sedang oleh Cd (1

STRATEGI PENGEMBANGAN PERTANIAN DAN KONSERVASI LAHAN DI KAWASAN SEGARA ANAKAN, JAWA TENGAH (Agriculture and Land Conservation Development Strategy in Segara Anakan Region, Central Java, Indonesia

Directory of Open Access Journals (Sweden)

Suratman Suratman

2015-01-01

Full Text Available ABSTRAK Segara Anakan merupakan suatu kesatuan kawasan laguna yang mempunyai keunikan, tidak sebagaimana umumnya lahan pantai pasang surut di Indonesia. Beberapa keadaan dan proses yang khas terjadi di kawasan ini, antara lain adanya pasang surut yang bergantian secara musiman antara air asin dan tawar, sedimentasi sungai sangat cepat sehingga terbentuk “tanah timbul”, penyempitan kawasan perairan, pembentukan dan perubahan alur sungai, serta penciutan hutan mangrove. Keadaan ini menyebabkan perubahan yang drastis terhadap mata pencaharian penduduk yang tadinya nelayan menjadi petambak dan petani. Untuk itu diperlukan masukan strategi pengembangan pertanian yang sesuai dengan karakteristik lahan yang khas tersebut. Sesuai dengan karakteristik lahannya, daerah ini dapat dikelompokkan menjadi zona pengembangan tambak, pengembangan lahan basah, lahan kering, tanaman tahunan, dan areal konservasi. Dari segi konservasi diperlukan tindakan pengendalian sedimen dan mempertahankan keberadaan areal sempadan pantai dan hutan mangrove.   ABSTRACT Segara Anakan is a lagoon which has unique characteristics different from other swamp lands in Indonesia. Its characteristics include seasonal fluctuation of fresh water river and sea water, rapid river sedimentation, narrowing water area, forming and changing river channels, and decreasing forest area. These phenomena have drastically changed people occupation. They, who were previously fishermen, have changed to be farmers. These conditions require an agriculture development strategy suitable for that area. Based on its characteristics, the area can be categorized into development zones for fishpond, wetland, dry land, annual crop, and conservation. This area requires actions to control the sedimentation process for maintaining its coastal belt and mangrove forest.

Effects of Physiochemical Factors on Prokaryotic Biodiversity in Malaysian Circumneutral Hot Springs

Directory of Open Access Journals (Sweden)

Chia S. Chan

2017-07-01

Full Text Available Malaysia has a great number of hot springs, especially along the flank of the Banjaran Titiwangsa mountain range. Biological studies of the Malaysian hot springs are rare because of the lack of comprehensive information on their microbial communities. In this study, we report a cultivation-independent census to describe microbial communities in six hot springs. The Ulu Slim (US, Sungai Klah (SK, Dusun Tua (DT, Sungai Serai (SS, Semenyih (SE, and Ayer Hangat (AH hot springs exhibit circumneutral pH with temperatures ranging from 43°C to 90°C. Genomic DNA was extracted from environmental samples and the V3–V4 hypervariable regions of 16S rRNA genes were amplified, sequenced, and analyzed. High-throughput sequencing analysis showed that microbial richness was high in all samples as indicated by the detection of 6,334–26,244 operational taxonomy units. In total, 59, 61, 72, 73, 65, and 52 bacterial phyla were identified in the US, SK, DT, SS, SE, and AH hot springs, respectively. Generally, Firmicutes and Proteobacteria dominated the bacterial communities in all hot springs. Archaeal communities mainly consisted of Crenarchaeota, Euryarchaeota, and Parvarchaeota. In beta diversity analysis, the hot spring microbial memberships were clustered primarily on the basis of temperature and salinity. Canonical correlation analysis to assess the relationship between the microbial communities and physicochemical variables revealed that diversity patterns were best explained by a combination of physicochemical variables, rather than by individual abiotic variables such as temperature and salinity.

Studi Komparasi Jenis Makanan Ikan Keperas (Puntius binotatus) Di Sungai Aek Pahu Tombak, Aek Pahu Hutamosu Dan Sungai Parbotikan Kecamatan Batang Toru Tapanuli Selatan

OpenAIRE

Situmorang, Toberni Santika

2013-01-01

Research about study of comparative types food in fish Keperas (Puntius binotatus) in the river of Aek Pahu Tombak, Aek Pahu Hutamosu and Parbotikan, District Batang Toru that have aim to determine the types of food in the gut of fish and food habit of Puntius binotatus. The research was occured in the river of Aek Pahu Tombak, Aek Pahu Hutamosu and Parbotikan District Batang Toru in January-Maret 2013.The method of fishing is used by elektrofising with capacity 12 volt. The analysis of d...

Model validation and error estimation of tsunami runup using high resolution data in Sadeng Port, Gunungkidul, Yogyakarta

Science.gov (United States)

Basith, Abdul; Prakoso, Yudhono; Kongko, Widjo

2017-07-01

A tsunami model using high resolution geometric data is indispensable in efforts to tsunami mitigation, especially in tsunami prone areas. It is one of the factors that affect the accuracy results of numerical modeling of tsunami. Sadeng Port is a new infrastructure in the Southern Coast of Java which could potentially hit by massive tsunami from seismic gap. This paper discusses validation and error estimation of tsunami model created using high resolution geometric data in Sadeng Port. Tsunami model validation uses the height wave of Tsunami Pangandaran 2006 recorded by Tide Gauge of Sadeng. Tsunami model will be used to accommodate the tsunami numerical modeling involves the parameters of earthquake-tsunami which is derived from the seismic gap. The validation results using t-test (student) shows that the height of the tsunami modeling results and observation in Tide Gauge of Sadeng are considered statistically equal at 95% confidence level and the value of the RMSE and NRMSE are 0.428 m and 22.12%, while the differences of tsunami wave travel time is 12 minutes.

Efektifitas Riverbank Filtration Trhadap Parameter Fisik (TDS di Sungai Cihideung

Directory of Open Access Journals (Sweden)

Roh Santoso Budi Waspodo

2013-01-01

Full Text Available Water is a natural resource that is necessary for the livelihood of many people, even by all living things. Data Ministry of Public Works in 2006 mentions the availability of water in Indonesia amounted to 15,500 cubic meters per capita per year, far higher than the global availability averaged only 600 m3. If drawn, the amount of water covers 21% of Indonesia Pacific Ocean. However, the overflow Indonesia does not necessarily solve the problem of water crisis which is also predicted to fall on two major islands in 2015. The general objective of this research is to develop and implement technological innovations RBF (Riverbank Filtration to support the needs of irrigation water Watershed Cisadane, making RBF (Riverbank Filtration as a natural water treatment in Cisadane River area, and water quality data information through RBF (Riverbank Filtration Cisadane Watershed.

Sistem Akuifer dan Potensi Airtanah Daerah Aliran Sungai (DAS Opak

Directory of Open Access Journals (Sweden)

Setyawan Purnama

2016-08-01

Full Text Available Opak River Basin is an area with high concentration of settlement. Generally, the settlement use groundwater as a water source. Variation of groundwater condition cause differentiation of water usage in some regions. There are two objectives of this research. First, to determine aquifer system in the research area and second, to calculate the groundwater potential in each aquifer system. To achieve these objectives, aquifer system is determined base on its geology and geomorphology, whereas groundwater potency is calculated by static and dynamic approach. As a result, show that the aquifer system in Opak River Basin can be distinguished into seven aquifer system. There are The Upper Merapi Aquifer System, The Middle Merapi Aquifer System, The Lower Merapi Aquifer System, Baturagung Range Aquifer System, The Aquifer System of Baturagung Range Foot Slope, Sentolo Hill Aquifer System and Sanddune Aquifer System. Among the seventh aquifer system, The Middle Merapi Aquifer System, The Lower Merapi Aquifer System and The Sanddune Aquifer System have high productivity. Sentolo Hill Aquifer System and The Aquifer System of Baturagung Range Foot Slope Aquifer have low productivity, whereas The Baturagung Range is categorized as non akuifer.

PENGGUNAAN MAKROZOOBENTOS SEBAGAI INDIKATOR STATUS PERAIRAN HULU SUNGAI CISADANE, BOGOR

OpenAIRE

Dyah Muji Rahayu; Gunawan Pratama Yoga; Hefni Effendi; Yusli Wardiatno

2015-01-01

Anthropogenic pollution (organic matter and Hg) around Cisadane River upstream can affect the abundances of macrozoobenthos. The aim of this research was to identify the abundances of macrozoobenthos and feeding groups, and also to identify the status of waters based on macrozoobenthos community. The research was conducted on January to March in four locations in the upstream of Cisadane River, covering Cikuluwung (ST 1), Cisarua (ST 2), Curug Bitung (ST 3), and Lukut (ST 4). Samples were col...

Impak Pembangunan Tebingan Sungai Ke Atas Persekitaran Fizikal dan Manusia

Directory of Open Access Journals (Sweden)

Zaini Sakawi

2011-10-01

Full Text Available Development and environment are two phenomena which very synonym in recent development. Generally, development demands will bring positive or negative impact to the environment. Therefore, this paper work will discuss the study of the impact of Malacca River bank development at Bandar Hilir, Malacca to the environment, especially to human environment. The finding of this study shows that the impact of Malacca River bank construction and beautify can be classified into four main impacts. The impacts are restructuring of layout, tourists attraction, infrastructure development and environmental quality. The finding of this study also shows that river bank development and environmental changes give new shift to local society benefits to generate higher quality and dynamic life. In effort to attain the prosperous and equipoise in this river bank development, it is not involved only the administration, but also need the involvement of all parties such as the NGOs, mass media and society.

PENGGUNAAN MAKROZOOBENTOS SEBAGAI INDIKATOR STATUS PERAIRAN HULU SUNGAI CISADANE, BOGOR

Directory of Open Access Journals (Sweden)

Dyah Muji Rahayu

2015-04-01

Full Text Available Anthropogenic pollution (organic matter and Hg around Cisadane River upstream can affect the abundances of macrozoobenthos. The aim of this research was to identify the abundances of macrozoobenthos and feeding groups, and also to identify the status of waters based on macrozoobenthos community. The research was conducted on January to March in four locations in the upstream of Cisadane River, covering Cikuluwung (ST 1, Cisarua (ST 2, Curug Bitung (ST 3, and Lukut (ST 4. Samples were collected with kick net and Eckman Grab. The dominance macrozoobenthos are Bungona (171 ind/m2, Simulium (101 ind/m2, Cheumatopsyche (50 ind/m2, and Polypedilum (28 ind/m2. Based on feeding groups, the dominance are filtering collector and gatherer collector. Based on the Pollution Index and Heavy Metal Pollution Index (Hg on sediment, the upstream of Cisadane River is low polluted whereas EPT Index and Signal showed that upstream of Cisadane River is moderate polluted.

Peningkatan Kemampuan Memecahkan Masalah melalui Media Komputer dalam Pembelajaran Matematika pada Siswa SMKN 1 Ngawen

Directory of Open Access Journals (Sweden)

Urip Haryanto

2016-01-01

Full Text Available This study aims at improving the students’ problem solving ability of Mathematics through computer-based learning, particularly in the space figures competency at SMK Negeri 1 Ngawen Gunungkidul. This study is categorized as classroom action research. The subjects of the study were the grade XI OC students of SMK Negeri 1 Ngawen Gunung Kidul. The study consisted of repetitious cycles. Every cycle consisted of problem identification, planning, action, observation, and reflection. The results of the study showed that: (1 the application of computer-based learning could improve the students’ problem solving ability of Mathematics and affected positively on the students’ achievement. The improvement was resulted from the conducive learning atmosphere (2 the students were highly interested in computer-based learning. They were more enthusiastic because they were able to confirm the answers directly; (3 to deal with the texts’ low legibility due to the mismatch between the background and the font size, the narration orally explained by the researcher was employed (4 the application of quizzes could motivate the students. They get involved actively in answering questions. The learning activities were more varied.

Procedures for determining stream flowrate using radioisotope method in Pesanggrahan River, Indonesia. Prosedur untuk mengukur kadar-alir sungai menggunakan kaedah radioisotop di Sungai Pesanggrahan, Indonesia

Energy Technology Data Exchange (ETDEWEB)

1983-08-01

River flow measurements either by a current meter or a tracer dilution are established elsewhere. This report describes the experimental method, calibrations of NaI detector, preparation of radioisotopes and equipment, and safety aspect considerations as well as results interpretation in determining stream flowrate of Pesanggrahan River, Indonesia in which radioisotopes /sup 82/Br and /sup 51/Cr complexed with EDTA were used as tracers. The total count technique of stream flow D=AF/N, developed by Hull, was simplified for the ease of field work purposes and adopted in this study. Discharge results at different water levels during low flows gauged using both radioisotope tracers are comparable. The relationship between water level and discharge value is also plotted although the available data is insufficient.

JENIS HERPETOFAUNA DI CAGAR ALAM DAN TAMAN WISATA ALAM PENGANDARAN JAWA BARAT

Directory of Open Access Journals (Sweden)

Syafa'at Ariful Huda

2017-06-01

Full Text Available This study aims to determine the type of Herpetofauna that often appear in the area Cikamal and Cirengganis. This research was conducted in West Java precisely in Nature Tourism and Pangandaran Nature Reserve. The method used in this research is descriptive qualitative with field research approach (VES. Visual Encounter Survey (VES along the river and river body. The data obtained is analyzed first with the calculation of the number and calculation of the percentage of research results. From the results of this study get 2 types of herpetofauna consisting of amphibians and reptiles. Amphibians consist of a type of frog and type of bangkong. While only the type of lizard reptile found in the two locations. Amphibians and reptiles are found: Type of frog (Fajervarya limnocharis, Rana chalconata, Microdiscus sp, Hylidae, type of bangkong (Microhyla achatina, Bufonidae and Lizard Type (Spenomorphus sp.Penelitian ini bertujuan untuk mengetahui jenis Herpetofauna yang sering muncul di daerah Cikamal dan Cirengganis. Penelitian ini dilakukan di Jawa Barat tepatnya di Wisata Alam dan Cagar Alam Pangandaran. Metode yang digunakan dalam penelitian adalah deskriptif kualitatif dengan pendekatan riset lapangan (VES. Visual Encounter Survey (VES dengan menyusuri Sungai dan badan Sungai. Data yang diperoleh dianalisis terlebih dahulu dengan perhitungan jumlah dan perhitungan persentase hasil penelitian. Dari hasil penelitian kali ini mendapatkan 2 jenis herpetofauna yang terdiri dari amfibi dan reptil. Amfibi terdiri dari jenis katak dan jenis bangkong. Sedangkan reptil hanya jenis kadal yang di temukan di dua lokasi tersebut. Amfibi dan reptil yang ditemukan yaitu: Jenis katak (Fajervarya limnocharis, Rana chalconata, Microdiscus sp, Hylidae, jenis bangkong (Microhyla achatina, Bufonidae dan Jenis Kadal (Spenomorphus sp.

Pengaruh Komposisi dan Seleksi Pakan terhadap Performans Rusa Jawa (Cervus timorensis di Stasiun Flora Fauna Bunder, Kabupaten Gunungkidul.

Directory of Open Access Journals (Sweden)

Subeno (Subeno

2012-06-01

Full Text Available The objectives of this research are to determine food composition preferred feeds and performance of Java deer. Survey of research was conducted from August to September 2007. Data collected by selecting the group of java deer, then monitoring was done on the compositionof offered feed.

BIOAKUMULASI KADMIUM PADA IKAN BANDENG DI TAMBAK DUKUH TAPAK SEMARANG

Directory of Open Access Journals (Sweden)

NKT Martuti

2017-03-01

Full Text Available Dukuh Tapak merupakan muara dari Sungai Tapak yang sebagian besar wilayahnya berupa pertambakan ikan bandeng. Berkembangnya industri di daerah aliran sungai (DAS Tapak, mengakibatkan terjadinya penurunan kualitas perairan Tapak akibat adanya pencemaran limbah yang mengandung logam berat. Penurunan kualitas perairan tersebut akan mempengaruhi kualitas ikan bandeng yang dipelihara pada tambak-tambak di Dukuh Tapak. Penelitian ini bertujuan untuk mengetahui kandungan Cd dalam air dan ikan bandeng di tambak Dukuh Tapak Semarang. Penelitian bersifat observasional analitik menggunakan analisis komparatif. Analisis kadar Cd menggunakan AAS. Kandungan Cd pada air Sungai Tapak 0,004mg/l, nilai tersebut masih berada di bawah ambang batas yang ditetapkan PPRI No.82 Tahun 2001 yaitu sebesar 0,01mg/l. Rerata kandungan Cd pada air tambak Tapak 0,0045mg/l, melebihi ambang batas yang ditetapkan KepMen LH No.51 Tahun 2004 yaitu sebesar 0,001mg/l. Rerata kandungan Cd pada daging ikan bandeng di ketiga stasiun adalah 0,01mg/l, masih berada di bawah ambang batas yang ditetapkan SNI 7287:2009 yakni sebesar 0,1 mg/kg. Simpulan dari penelitian ini adalah kandungan Cd pada air tambak Tapak melebihi ambang batas yang sudah ditentukan, namun kandungan Cd pada ikan bandeng masih berada di bawah ambang batas. Meskipun demikian, perlu diwaspadai keberadaan logam berat Cd karena logam berat bersifat toksik dan akumulatif.District Tapak is an estuary of Tapak river which most of the area is formed of milk fish aqua farming region. Tapak watershed industry growth has affected in Tapak water degradation quality. Due to waste contamination containing heavy metals. It affects the quality of breeding milk fish. This research aims to discover Cadmium (Cd content both in watershed and milk fish in district Tapak, Semarang. This observational analytic research using comparative analysis, purposive random sampling method. Data analysis method using AAS. Cadmium (Cd content in Tapak

PENDUGAANPARAMETERPERTUMBUHAN,MORTALITAS DANUKURAN PERTAMAMATANGGONAD IKAN GABUS (Channa striata DI RAWABANJIRAN SUNGAIMUSI

Directory of Open Access Journals (Sweden)

Syarifah Nurdawati

2015-12-01

Full Text Available Ikan gabus merupakan salah satu jenis ikan ekonomis penting yang banyak dimanfaatkan sebagai bahan baku produk olahan. Habitat ikan gabus di SungaiMusi yaitu banyak dijumpai di rawa banjiran seperti lebak-lebak di SungaiMeriak, Sungai Semuntul dan hutan rawa Danau Cala. Penelitian dilakukan dari bulan Februari–Desember 2010 dengan tujuan untukmengetahui pertumbuhan, mortalitas, laju pertumbuhan dan ukuran pertama matang gonad. Hasil penelitian menunjukkan bahwa selama 11 bulan penelitian didapatkan sampel ikan gabus sebanyak 2.303 ekor dengan kisaran nilai tengah panjang antara 20 - 500 mm, Ikan gabus betina pertama matang gonad berukuran panjang 210 mm sedangkan ikan gabus jantan pada ukuran 185 mm. Dari analisa Ford-Walford diperoleh nilai parameter pertumbuhan dengan panjang asimtotik ikan gabus (L sebesar 575,9 mm, koefisien pertumbuhan (K sebesar 0,173 per tahun dan umur teorits (t0 sebesar - 0,07 per tahun sehingga diperoleh persamaan pertumbuhan Von Bertalanffy untuk ikan gabus adalah Lt = 575,9 (1-e-0,173(t +0,07. Dugaan laju kematian alami (M sebesar 0,25 per tahun dan laju kematian karena penangkapan (F sebesar 0,51 per tahun. Laju eksploitasi (E ikan gabus sebesar 0,67 per tahun atau sudah melebihi nilai eksploitasi optimumyaitu 0,50. The snakehead fishis considered to be an important food fish.The fishes arewidely used asraw material refined products. Habitat of Channa striata in floodplain of Musi River, there are in Meriak River, Semuntul River and in plood plain of Cala lake. Estimation of population parameters and size at the firstmaturity of female and male snakehead (Channa striata has been conducted from February 2010 to December 2010. The purpose is to estimate fish population parameters quantitatively including growth of snakehead. The first sexual maturity and natural mortality (M, fishing mortality (Z and exploitation rates (E of snakehead.The results of this study showed that 11 month study period we

Sociodemographic profile and predictors of outpatient clinic attendance among HIV-positive patients initiating antiretroviral therapy in Selangor, Malaysia

Directory of Open Access Journals (Sweden)

Abdulrahman SA

2017-07-01

Full Text Available Surajudeen Abiola Abdulrahman,1,2 Lekhraj Rampal,1 Norlijah Othman,3 Faisal Ibrahim,1 Kadir Shahar Hayati,1 Anuradha P Radhakrishnan4 1Department of Community Health, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Selangor, 2Department of Public Health Medicine, Penang Medical College, George Town, Penang, 3Department of Paediatrics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Selangor, 4Infectious Disease Clinic, Hospital Sungai Buloh, Sungai Buloh, Selangor, MalaysiaBackground: Inconsistent literature evidence suggests that sociodemographic, economic, and system- and patient-related factors are associated with clinic attendance among the HIV-positive population receiving antiretroviral therapy (ART around the world. We examined the factors that predict outpatient clinic attendance among a cohort of HIV-positive patients initiating ART in Selangor, Malaysia.Patients and methods: This cross-sectional study analyzed secondary data on outpatient clinic attendance and sociodemographic, economic, psychosocial, and patient-related factors among 242 adult Malaysian patients initiating ART in Selangor, Malaysia. Study cohort was enrolled in a parent randomized controlled trial (RCT in Hospital Sungai Buloh Malaysia between January and December 2014, during which peer counseling, medication, and clinic appointment reminders were provided to the intervention group through short message service (SMS and telephone calls for 24 consecutive weeks. Data on outpatient clinic attendance were extracted from the hospital electronic medical records system, while other patient-level data were extracted from pre-validated Adult AIDS Clinical Trial Group (AACTG adherence questionnaires in which primary data were collected. Outpatient clinic attendance was categorized into binary outcome – regular attendee and defaulter categories – based on the number of missed scheduled outpatient clinic appointments within a 6-month

FAUNA DAN TEMPAT PERKEMBANGBIAKAN POTENSIAL NYAMUK Anopheles spp DI KECAMATAN MAYONG, KABUPATEN JEPARA, JAWA TENGAH

Directory of Open Access Journals (Sweden)

Mardiana Mardiana

2012-10-01

Full Text Available Malaria masih merupakan masalah kesehatan masyarakat di beberapa daerah pedesaan di Jawa Tengah. Usaha pemberantasan malaria telah dilakukan oleh program baik secara kimiawi maupun hayati, guna memutuskan rantai penularan. Penelitian fauna dan tempat perindukan potensial nyamuk Anopheles telah dilakukan di Desa Buaran, Kecamatan Mayong I, Kabupaten Jepara, Jawa Tengah. Penangkapan nyamuk dengan umpan orang dilakukan di dalam dan di luar rumah pada malam hari dari pukul 18.00-24.00 yang masing-masing dilakukan oleh dua orang kolektor. Penangkapan nyamuk yang istirahat di dalam dan luar rumah (vegetasi pada pagi hari dilakukan pukul 06.00-08.00, yang dilakukan satu bulan 4 kali penangkapan selama 6 bulan. Pengambilan larva dan pupa dilakukan dari pukul 06.00-08.00 pagi di tempat genangan air dan sawah serta tempat yang potensial diduga sebagai perindukan Anopheles. Hasil penangkapan selama 6 bulan, diperoleh 1248 ekor nyamuk Anopheles yang terdiri dari 6 spesies yaitu: An. aconitus 442 ekor (35,42%, An. annularis 69 ekor (5,53% , An. barbirostris 30 ekor (2,4%, An. maculatus 2 ekor (0,16%, An. tesselatus 5 ekor (0,40% dan An. vagus 700 ekor (56,09%. Populasi aconitus ditemukan dari penangkapan di luar rumah, pada bulan Juli (56,40%, Agustus (42,80% dan Oktober (39,50% sedangkan pada bulan Mei (52,9%, Juni (44% dan September (50,40% dari penangkapan di kandang sapi. Pengambilan larva dan pupa Anopheles dilakukan di tempat habitat seperti sawah yang pada bulan Aguslus terbanyak ditemukan sebesar 85 (1.70, di sungai ditemukan hanya 4 (0.08 serta di genangan air bekas telapak kaki/kobokan ditemukan sebesar 6 (0.12. Ternyata tempat perindukan yang potensial larva Anopheles pada musim kemarau, ditemukan pada sungai yang ditanami kangkung oleh masyarakat selempat. Kata kunci: Fauna, tempat perindukan, Anopheles, vector

ASOSIASI AKAR KUNING (Fibraurea tinctoria Lour. DENGAN TUMBUHAN BERPOTENSI OBAT DI SAMBOJA, KALIMANTAN TIMUR

Directory of Open Access Journals (Sweden)

Noorcahyati Noorcahyati

2017-06-01

Full Text Available Akar kuning (Fibraurea tinctoria Lour. Is a medicinal plant at Kalimantan that has the potential of development and require conservation efforts. This research was aimed to observe the ecology, association and other plants that have the potential as medicinal plants in the community garden in Sungai Merdeka, Samboja East Kalimantan. Data collection were using purposive sampling plot of 20 x 20 m. Found 28 species of 21 families among the sites of various stages of growth. The highest IVI value at every growth is Fibraurea tinctoria with an IVI of 78.24 (seedlings, Archidendron jiringa with IVI 35.20 (saplings, Glochidion sp. IVI 109.94 (poles and Artocarpus integer IVIs 109.94 (trees. The strongest associations at the level of the tree is Artocarpus integer. At the root of the akar kuning habitat obtained 19 species of plants that also have potential as a drug that can be developed with agroforestry system. Akar kuning (Fibraurea tinctoria merupakan biofarmaka Kalimantan yang perlu mendapat perhatian untuk dikembangkan dan dilestarikan. Penelitian bertujuan untuk mendapatkan informasi ekologi, asosiasi dan tumbuhan lain yang berpotensi sebagai obat pada habitat akar kuning di kebun masyarakat di Desa Sungai Merdeka, Samboja Kalimantan Timur. Pengumpulan data dilakukan secara sengaja dengan teknik sampling kuadrat ukuran petak 20 x 20 m. Ditemukan 28 jenis dari 21 famili pada lokasi penelitian dari berbagai tingkat pertumbuhan. Nilai INP tertinggi pada setiap pertumbuhan adalah Fibraurea tinctoria dengan INP sebesar 78,24 (tingkat semai, jenis Archidendron jiringa dengan INP 35,20 (tingkat pancang, Glochidion sp. INP 109,94 (tingkat tiang dan Artocarpus integer memiliki INP 109,94 (tingkat pohon. Asosiasi terkuat pada tingkat pohon adalah Artocarpus integer. Pada habitat akar kuning diperoleh 19 jenis tumbuhan yang juga memiliki potensi sebagai obat yang dapat dikembangkan secara bersama-sama.

GEO-ARKEOLOGI TERAS PURBA BENGAWAN SOLO DI SEKITAR KABUPATEN BOJONEGORO, JAWA TIMUR The Geo-archaeology of Ancient Terrace of Bengawan Solo in Bojonegoro Surrounding Regency, East Java

Directory of Open Access Journals (Sweden)

Johan Arif

2016-07-01

Abstrak Pemetaan teras purba Bengawan Solo merupakan kajian geo-arkeologi tahap awal yang dilakukan di beberapa lokasi di wilayah kabupaten Bojonegoro, Jawa Timur. Permasalahannya adalah ditemukannya indikasi keberadaan peralatan batu paleolitik dan fosil-fosil vertebrata di beberapa teras purba di wilayah ini. Oleh karena itu, tujuan dari kegiatan ini adalah mendapatkan gambaran sebaran teras purba Bengawan Solo berumur Kuarter serta memberikan usulan kepada para ahli arkeologi dalam merancang kegiatan pencarian sisa-sisa budaya manusia antara lain peralatan batu paleolitik maupun sisa-sisa fosil rangka manusia dan hewan pada suatu teras purba. Metode yang dipakai di dalam penelitian ini adalah metode pemetaan geologi, deskripsi profil sedimen, pengambilan contoh-contoh sedimen (termasuk fosil hewan untuk keperluan analisa sedimentologi dan analisa kimia. Di daerah penelitian yang terletak di kabupaten Bojonegoro dijumpai tiga teras yaitu Teras Menden (berumur sub-Resen, Jipangulu (berumur Holosen Awal dan Ngandong (berumur Plestosen Atas. Teras Menden dijumpai di Payaman, Teras Jipangulu di Prangi dan Wotangare dan Teras Ngandong dijumpai di Prangi dan di desa Kedung. Berdasarkan bukti stratigrafinya ketiga teras tersebut disusun oleh lapisan pasir ukuran kasar hingga kerikilan di bagian bawah dan berubah menjadi pasir lempungan dan lempung pasiran di bagian atas. Fenomena ini menunjukkan bahwa ketiga teras tersebut dibentuk oleh sungai yang berkelok-kelok yaitu Bengawan Solo purba. Kedudukan masing-masing teras purba di daerah penelitian yang diukur dari Bengawan Solo adalah 2-3 m (Teras Menden, 5-7 m (Teras Jipangulu dan >8 m (Teras Ngandong. Berdasarkan hasil kajian teras purba ini diusulkan agar para ahli arkeologi lebih memfokuskan kepada perlapisan sedimen yang berukuran kasar dalam sistem endapan sungai purba berumur Kuarter untuk mencari sisa-sisa budaya manusia paleolitikum seperti peralatan batu maupun sisa-sisa fosil rangka manusia dan hewan.   Kata

Analisis Debit Sungai Dengan Menggunakan Model SWAT pada DAS Cipasauran, Banten

Directory of Open Access Journals (Sweden)

Maulana Ibrahim Rau

2015-10-01

Full Text Available Total water demand at non industrial and industrial region in Cilegon is increasing. With its water production capacity of 2,000 l/s, PT Krakatau Tirta Industri cannot fulfill the amount number of demand from the industrial and domestic sectors at Cilegon. To cover the shortage of water supply of ±600 l/s, PT KTI requires taking water from Cipasauran Watershed. The objective of this study was to analyze river discharge of Cipasauran Watershed using SWAT model. Input data such as soil characteristics, climate data, landuse, and hydrology data at the area of the watershed were gathered and put at the data input file. In SWAT simulation, 4 processes were done, i.e. watershed delineation, hydrological response unit (HRU forming, data process and SWAT simulation, and visualization process. The result showed that the daily and monthly calibration process crossed 84% and 83% with the 95PPU area, with daily and monthly p-factor value of 0.84 and 0.83. Thus, calibrated model result was valid, though R2 and NS value were not satisfied. Using the validated SWAT model, the daily discharge in Cipasauran Watershed was about 0 - 3.309 m3/s, whereas the monthly discharge was 0.648 - 3.266m3/s. This showed that daily and monthly PT KTI’s water demand of 0.6 m3/s were fulfilled about 98.22% and 100%. Within the future time, the SWAT model could be potentially used as an assessment for predictive scenarios. However, to gain optimum results, well-observed and precise data is highly required, especially for such calibrations and validations.

ADSORPSI LOGAM BESI (FE SUNGAI BARITO MENGGUNAKAN ADSORBEN DARI BATANG PISANG

Directory of Open Access Journals (Sweden)

Nur Hidayah

2012-10-01

Full Text Available Grounded on BLHD’s report of South Borneo on 2009, Fe contents in Barito river achieve 2,5455 mg/L. This level pass by KEPMENKES on 2002 which only permit Fe contents in water as many 0,3 mg/L. The goals of this research are to study ability of banana stem to decrease Fe contents in water sample of Barito river. Knowing the best adsorbent condition to decrease Fe contents in Barito river based on variations of activation process, kind of activator, adsorbent diameter size, stirring of velocity and adsorption duration as well as to find water of Barito river which appropriate with clean or drink water standart based on KEPMENKES on 2002.This research started with adsorption process and finishing with filtration process. Banana stem is washed until clean and then cut to small slice to abridge vaporization of water contents when is hoted under the sun. The dried banana stem be broken with blender. Banana stem is screned to find diameter size as big as 20, 30 and 40 mesh. Then, banana stem is activated using KMnO4 ­0,1 M dan ZnCl2 0,1 M solution during 24 hours. Whereas in physics activation, banana stem is pyrolysed during 30 minute at 500oC. Activated carbon is used to adsorption with some variation. The result will test use spectofotometry.Result of this research indicate that banana stem can decrease Fe content in water of Barito river. Activated carbon with size 40 mesh which use physic-chemical activation with KMnO40,1 M solution as well as 150 rpm strring velocity and ahour adsorption duration give the best result.

Bioprospektif Perairan Berdasarkan Produktivitas : Studi Kasus Estuari Sungai Serayu Cilacap, Indonesia

Directory of Open Access Journals (Sweden)

Nur Laila Rahayu

2017-08-01

Full Text Available The high changes of Serayu River land use is resulting the high of load particle sedimentation into the body of water. Turbidity will accumulate in the downstream or estuaries which would have an impact on biota, especially plankton as primary productivity and secondary productivity. This research is conducted with a survey method and purposive sampling technique. Estuary Serayu River is divided into 5 stations, starts from the nearest to the sea (1 with 26 ‰ salinity and the furthest stations from the sea (5 with 8 ‰ salinity. Samples of water and plankton are taken at the time of high tide and low tide every month, for 4 months (August, September, October, and November 2016. The obtained data is analyzed by PCA to study the environmental factors towards primary productivity and secondary productivity. Based on the research result environmental factors has relation waters estuary productivity of Serayu river on the highest and lowest tide those are lightness, level TSS and pH.

Studi Kapasitas Sungai Riam Kiwa Menggunakan Hec-ras 4.1.0

OpenAIRE

Noor, M. Azhari; Utomo, Budi

2013-01-01

South Kalimantan is not spared by the flood. One of the rivers that floods are the river Riam Kiwa. The area being flooded each year is the District Astambul. This research will discuss about the capacity of the river Riam Kiwa Astambul Ruas assisted by HEC-RAS software 4.1.0.The method used is a field research conducted along the river Riam Kiwa Astambul segment, so we get the river Riam Kiwa geometry data were reviewed. The data is then combined with hydrological data so it can do the analy...

DINAMIKA SPASIAL PEMANFAATAN LAHAN OLEH MASYARAKAT DAERAH ALIRAN SUNGAI (DAS KREO

Directory of Open Access Journals (Sweden)

Dewi Liesnoor Setyowati

2011-12-01

Full Text Available Landuse dynamics of Kreo watershed from the result of interpretation of satellite image landsat (the year 1994 and image SPOT-5 (the year 2006 in the form of degradation of open farm wide of 67,07%, coppice 9,61%, forest 6,69%, and rice feld 4,64%; improvement of plantation wide 24,42%, setlement 21,68%, and mixture garden with a width of 1,05%. Forest wide and plantation of DAS Kreo only with a width of 17,19% had not pursuant to ideal wide of minimum forest of 30% at one particular in watershed (PP number 33  the year 1970. Wide area of setlement  in Kreo watershed with a width of 12,21%  is including category has exceeded ideal boundary of setlement area at one particular in watershed, maximum boundary (threshold in the form of area of waterproof equal to 6%-10% in  watershed.Keywords: Landuse spatial dynamic, landuse trend.

Umur glas eel (Anguilla spp. yang masuk muara Sungai Progo Yogyakarta

Directory of Open Access Journals (Sweden)

Agung Budiharjo

2017-03-01

Full Text Available The leptocephalus drift with sea currents and moving from spawning area into coastal area near mouth of Progo River. In thecoastal area, leptocephalus metamorfosed into glass eel, after that glass eel migrated to river. The aims of this research were to estimate glass eels age and predict hatching dates. Glass eels sampled on new moon during Februari 2007-Mei 2009 at mouth of Progo River.Glass eel ages estimated using their otolith micro structure. Hatching dates predicted with back calculation of glass eels age. We collected 1.082 glass eels. The ages of glass eel at recruit ranged from 58 to 190 days, and divided into 5 age groups. Glass eels are migrated to river hatched on a "new moon" from July to January. Glass eels are migrated to river during October-January hatched during July-October. Glass eels are migrated to river during February-Juny hatched during November-January.

Analisis Fluktuasi Hujan dan Morfologi Sungai terhadap Konsentrasi Banjir Daerah Surakarta

Directory of Open Access Journals (Sweden)

Alif Noor Anna

2011-07-01

Full Text Available This research aims to analyse rain fluctuation and river morphology to flood concentration in Bengawan Solo River, Surakarta. The method of this research is field survey supported by secondary data analysis. The survey was conducted using GPS (Global Positioning System. The result indicates that high intensity rainfall in the research area happened during October till April. River flow in dry season generally decreased in accordance with the distribution of low rainfall (dry month. Whereas, river flow rates seen to increase along with the rainfall that occurs in the rainy season. Other result show that point 11-18 (location in Tanjung village district of Sukoharjo till Semanggi village district of Pasar Kliwon very superficial which became impact of the river. The point represent floods concentration, therefore if there is rain with high quantity, the water will rise and overflow to surface, especially point 11, 13, and 16 (Tanjung, Kedunggudel, and Telukan village district of Sukoharjo. The processes that occurred at these sites are sedimentation, and lateral erosion (horizontal erosion.

Status kualitas Sungai Musi bagian hilir ditinjau dari kom unitas fitoplankton

Directory of Open Access Journals (Sweden)

Hilda Zulkifli

2012-02-01

Full Text Available Musi river is the main source of water for society and industry on the downstream area, and also becomes the waste disposal area for domestic/industry. The objective of this study was to evaluate the status of Musi river on the downstream area based on phytoplankton community (from the Pulokerto district to downstream of musi river on Tanjung Buyut Village. The sample of water surface and plankton were taken compositely on 18 stations. The water quality analysis is held on LIPI Bogor, while the identification of microscopic community of phytoplankton is held on BRPPU Mariana. The result of research showed that phytoplankton community on observed locations comprises of Chlorophyta with 18 genus (45.34%, followed by Cyanophyta with 7 genus (26.09%, Baccillariophyta with 14 genus (25.81% and Euglenophyta with 2 genus (2.17%. The Oscillatoria (Cyanophyta is found on most of observed locations. Based on the examination of saprobic status, Pulokerto station is categorized as “moderate polluted” or (ά/ß –mesosaprobik dan ß/ά –mesosaprobik, while closer to downstream of Musi river is categorized as “low polluted” or (oligo/ß –mesosaprobic.

FENOMENA PLASTISITAS FENOTIPIK IKAN BELIDA (Chitala lopis DI SUNGAI KAMPAR, RIAU

Directory of Open Access Journals (Sweden)

Arif Wibowo

2016-03-01

Phenotypic variation in morphological characters such as body shape and meristic count has long been used to delineate stocks of fish and continue to be used today. Variation in such characters was assumed to be purely genetic in early studies, however, spectacular differences can occur in the extent of genetic and morphological differentiation between groups of fish. This is due to morphological characters undergo a phenotypic plasticity. In order to reveal phenotypic plasticity phenomenon on giant featherback (Chitala lopis, the morphology and genetic analysis were conducted. Morphology analysis was observed on 22 characters on giant featherback from five stations sampling in Kampar River and as a comparison, samples from Musi River (South Sumatra and Barito River (South Kalimantan are also subject to analyze. Genetic analysis by using D-Loop mtDNA sequences from GenBank data base. The research shows that there is a different between stocks using morphological and genetic analysis. The morphological characters exhibit pattern of heterogeneity base on geography location, phenotypic plasticity. Genetic analysis reveals the existence two stock of giant featherback in Kampar River, the upper and down stream stock.

Geographical information system (GIS) application for flood prediction at Sungai Sembrong

Science.gov (United States)

Kamin, Masiri; Ahmad, Nor Farah Atiqah; Razali, Siti Nooraiin Mohd; Hilaham, Mashuda Mohamad; Rahman, Mohamad Abdul; Ngadiman, Norhayati; Sahat, Suhaila

2017-10-01

The occurrence of flood is one of natural disaster that often beset Malaysia. The latest incident that happened in 2007 was the worst occurrence of floods ever be set in Johor. Reporting floods mainly focused on rising water rising levels, so about once a focus on the area of flood delineation. A study focused on the effectiveness of using Geographic Information System (GIS) to predict the flood by taking Sg. Sembrong, Batu Pahat, Johor as study area. This study combined hydrological model and water balance model in the display to show the expected flood area for future reference. The minimum, maximum and average rainfall data for January 2007 at Sg Sembrong were used in this study. The data shows that flood does not occurs at the minimum and average rainfall of 17.2mm and 2mm respectively. At maximum rainfall, 203mm, shows the flood area was 9983 hectares with the highest level of the water depth was 2m. The result showed that the combination of hydrological models and water balance model in GIS is very suitable to be used as a tool to obtain preliminary information on flood immediately. Besides that, GIS system is a very powerful tool used in hydrology engineering to help the engineer and planner to imagine the real situation of flood events, doing flood analysis, problem solving and provide a rational, accurate and efficient decision making.

EVALUASI JEMBATAN DI SUNGAI BOYONG YOGYAKARTA PASCA ERUPSI GUNUNG MERAPI 2010

Directory of Open Access Journals (Sweden)

Mega Ayundya Widiastuti

2015-08-01

Full Text Available Mount Merapi is one of 129 active volcanoes in Indonesia with high frequent of eruptions. The 2010 Mount Merapi eruption on October 26th was the biggest disaster compare to similar disasters in the five previous period before. Cold lava flow as the continous impact of the eruption potentially could damaging the bridges along the rivers that disgorge at Mount Merapi, one of them is Boyong river. The Boyong river downstream was crossing the center of Yogyakarta city. The fears of after eruption damage againts bridges along the Boyong River channel and limited government funds on restoring the bridges function and condition encourage the preparation of priorities scale to determine which bridge should be addressed first. Both primary and secondary data were collected and a comprehensive damage assessment refers to the Bridge Management System standard was conducted in order to compile further evaluation and bridges priorities formulation. The impact of Mt. Merapi eruption in 2010 against the bridges along Boyong river resulted in the highly increasement of riverbed sediment and cause damage againts the Ngentak, Plemburan, Boyong and Gemawang bridge’s retaining wall. In terms of safety on structure, all bridges along the Boyong river still can be passed safely except Wonosobo bridge and Kemiri bridge. The order of bridge jandling priority on A class bridges, ie the bridges of Tungkak, Boyong, Sudirman, and Code; while on B class bridges, ie the bridges of Ngentak, Guava, Sayidan, Wirosaban, Juminahan, Sardjito I, Wirosaban, Kewek, Wreksodiningrat and Krikilan Pulowatu; On C class bridges, ie the bridges of Pecan, Wonosobo, Plemburan, Gemawang and Rejodani

ANALISIS WILAYAH KONSERVASI DAERAH ALIRAN SUNGAI (DAS KURANJI DENGAN APLIKASI SWAT

Directory of Open Access Journals (Sweden)

Fadli Irsyad

2015-12-01

Full Text Available Degradasi lahan merupakan penyebab utama tingginya runoff dibandingkan dengan faktor lainnya. Perubahan tata guna lahan yang terjadi pada suatu kawasan menyebabkan terjadinya perubahan kondisi catchment area dan dapat menyebabkan perubahan aliran permukaan (runoff.  Jika limpasan yang terjadi saat hujan kecil dan infiltrasi air ke dalam tanah besar, maka air terlebih dahulu disimpan di dalam tanah sehingga akan meningkatkan ketersediaan air tanah. DAS Kuanji merupakan salah satu DAS di Kota Padang yang memiliki luas 202,7 km2 dan terdiri dari 5 sub-DAS. Penelitian ini dilakukan pada kawasan DAS Kuranji yang secara geografis terletak pada 100o20’31,20” – 100o33’50.40” BT dan 00o55’59.88” - 00o47’24” LS. Penelitian ini dilaksanakan pada bulan Maret – Juni 2013. Penelitian ini menggunakan aplikasi open sources software MapWindows GIS 4.8 RC1 (4.8.1 dari www.mapwindow.org.  Tahapan awal dalam penelitian ini yakni pengumpuan data, analisis SWAT di DAS Kuranji, dan penentuan wilayah konservasi DAS Kuranji. Hasil peneltian yang menggunakan MWSWAT untuk DAS Kuranji didapatkan HRU DAS sebanyak 2.034 HRU. Limpasan terbesar yang terjadi yakni 84 mm dengan luasan 75,195 ha, dan tersebar di empat kecamatan (Pauh, Padang Utara, Nanggalo, dan Kototengah. Wilayah konservasi yang direkomendasikan yakni  Limau Manih (81,56 ha, Lambung Bukit (42,27 ha, Gunung Sarik (86,32 ha, Kuranji (60,20 ha, dan Lubuk Minturun (64,45 ha. Kata kunci: Alih Fungsi Lahan,  DAS Kuranji, Konservasi, Limpasan, MWSWAT.

KEANEKARAGAMAN JENIS IKAN DI SUNGAI BATANG GADIS MANDAILING NATAL SUMATERA UTARA

Directory of Open Access Journals (Sweden)

Yusni Atifah

2017-12-01

Full Text Available Batang Gadis River, located in Mandailing Natal, faces a severe threat by the increase of human activities along the river. The fish community, as well as other biotas, is exposed to reducing environmental condition. Therefore, the study of fish community in this river is essential to get the most recent condition as a baseline data. The purpose of this research was to determine the species diversity of fish in Batang Gadis River of Mandailing Natal. This research used a descriptive exploratory method by surveying with purposive sampling method to collect samples at four specified stations. This study used a fishing net with a zig-zag pattern of sampling covered the river bank for about 200–300m at each observation station. The collected fish samples were identified at the Biology Laboratory of the University of Muhammadiyah Tapanuli Selatan. This study found ten species of fish from five families. The family with the most significant members was Cyprinidae (6 species, and the other families, Bagridae, Clariidae, Nemachelidae, and Loricariidae, were found with only one species. The species diversity comprised of Rasbora lateristriata, Nemacheilus fasciatus, Mystacoleucus marginatus, Tor tambra, Cyprinus carpio, Clarias bathracus, Rasbora argyrotaenia , Barbonymus gonionotus, Puntius binotatus, Bagrus nemurus, and Pterygoplichthys pardalis. The fish population of Batang Gadis River has diversity index (H’ of 1.77 and similarity index (E of 0.77.

Menggali Potensi Lokal Mewujudkan Kemandirian Desa

Directory of Open Access Journals (Sweden)

Fajar Sidik

2015-12-01

Full Text Available Artikel ini menganalisis pelaksanaan desa wisata di Desa Bleberan, Kecamatan Playen, Kabupaten Gunungkidul. Sebelum ada Badan Usaha Milik Desa (BUMDes, Desa Bleberan dikenal sebagai desa pelosok, terisolir, dan kekurangan air. Tingginya angka kemiskinan menjadi masalah utama yang dihadapi masyarakat setempat. Namun, setelah Pemerintah Desa bersama warga setempat berhasil membentuk BUMDes, kini Desa Bleberan berkembang dan menjadi desa wisata terbaik di Provinsi Daerah Istimewa Yogyakarta (DIY. Kajian ini menggunakan metode penelitian kualitatif deskriptif. Pengumpulan data menggunakan teknik observasi, wawancara, dan dokumentasi. Sementara, analisis data dilakukan melalui tahapan sebagai berikut; (1 reduksi data, (2 penyajian data, dan (3 kesimpulan/verifikasi. Agar hasil kajian dapat kredibel, maka teknik triangulasi data digunakan saat validasi. Hasil penelitian menunjukkan bahwa dalam pelaksanaan Desa Wisata di Bleberan (2010-2014, pendapatan asli desa secara signifikan meningkat. Hal tersebut tidak lepas dari peran modal sosial yang dimiliki warga yang telah berkembang dengan baik seperti Organisasi Desa, Kepercayaan, Norma, dan Jaringan. Namun, pengelolaan BUMDes dinilai kurang efektif karena belum dikelola secara transparan dan akuntabel. Kemudian, upaya mewujudkan desa mandiri juga menghadapi tantangan sosial yaitu adanya kecemburuan antar dukuh terkait dengan dana bantuan yang diberikan serta munculnya pelaku ekonomi di sekitar area wisata yang berasal dari keluarga berekonomi mapan.

SOIL PROPERTIES OF EIGHT FOREST STANDS RESULTED FROM REHABILITATION OF DEGRADED LAND ON THE TROPICAL AREA FOR ALMOST A HALF CENTURY (Sifat-sifat Tanah Delapan Tegakan Hutan Hasil Rehabilitasi Lahan Terdegradasi pada Daerah Tropika Selama Setengah Abad

Directory of Open Access Journals (Sweden)

Haryono Supriyo

2013-11-01

Full Text Available ABSTRACT Physical, chemical and biological properties of soil are influenced by vegetation types which grow above it. Different tree species of stands will produce difference litter quantity, litter quality and also plants’ root system. Therefore quantifying physical and chemical soil properties in several stands after rehabilitation of degraded land will increase the understanding of forest soil characteristics. The research was conducted in 8 forest stands in Wanagama I, Gunungkidul, Yogyakarta. Collection of soil samples was done at the depth of 0-10, 10-30 and 30-50 cm by making soil profile. The result showed that the textural classes were from sandy clay loam to clay. The content of clay increased with increasing soil depth. Bulk density did not differ much among the profiles and soil depth, ranging from 0.90 to 1.28 g/cm3, and so were particle density ranged from 2.19 to 2.55 g/cm3 and pore space ranged from 47.89 to 58.08 %. pH H2O ranging from 5.81 to 7.49 (slightly acid to neutral, meanwhile  pH KCl ranging from 4.44 to 6.37. C-organic content varied widely among the vegetations and soil depth ranged between 0.11 and 5.17 %. Available P and total P varied widely from 1 to 104 ppm and from 20 to 390 ppm, respectively. CEC were not much different among the profiles and soil depths, ranging from 19.80 to 38.06 cmol (+/kg and base saturation in all samples were very high i.e. > 100 %.   ABSTRAK Sifat-sifat fisik, kimia dan biologi tanah dipengaruhi oleh tipe vegetasi yang tumbuh di atasnya. Perbedaan spesies pohon suatu tegakan akan menghasilkan perbedaan jumlah seresah, kualitas seresah dan juga sistem perakaran. Kuantifikasi sifat-sifat fisik dan kimia tanah pada beberapa tegakan hutan pada lahan terdegradasi setelah direhabilitasi akan meningkatkan pemahaman mengenai sifat-sifat tanah hutan. Penelitian dilakukan pada I jenis tegakan hutan di Hutan Pendidikan Wanagama, Gunungkidul, Yogyakarta. Pengambilan sampel tanah dilakukan pada

OPTIMALISASI PENGGUNAAN LAHAN UNTUKAGROFORESTRI DI DAERAH ALIRAN SUNGAI CIMANUK PROPINSI JAWA BARAT

Directory of Open Access Journals (Sweden)

Caya, Totok Gunawan, Suratman Woro Suprodjo, dan Lutfi Muta’ali

2015-11-01

Full Text Available Watershed-based management in areas at the boundary of water sheds until now has not been realized. Basicadministrative process is still practiced in management, and sectoral ego is still high. Though watershed area is asystem, when an error occurs in the upper management, it will have an impact on down stream are as. Watershedmanagement is still focused on the economic benefits compared to environmental aspects. This research aims todevelop land evaluation models and economic evaluation to support the optimization of the use of land-based agroforestry. This study uses the physicall and evaluation with Ver.1.0 SPKL land evaluation model, which aims todetermine the level of suitability of the land for agro forestry crops and the economic valuation of environmentalservices approach. The results of this study are in the form of land use optimization appropriate tothe physicaland economic aspects of the approach, for the development of sustainable agriculture(agro forestry. The resultsobtained from this research can bring an idea about the amount(dollars that can be produced by a plant agroforestry.

MODEL INTERPOLASI GEOSTATISTIK LOGAM BERAT DAN BIOTA DI PERAIRAN MUARA SUNGAI KUIN

Directory of Open Access Journals (Sweden)

Abdur Rahman

2016-10-01

Full Text Available This study aimed to model the spatial content of heavy metals in water bodies and biota in the waters of the River Estuary Kuin. Data analysis methods are used to determine water quality status with spatial interpolation models Semivariogram (kriging and Inverse Distance weighting (IDW is integrated with  Geographic Information System (GIS. Based on calculations using the Ordinary Kriging method with Semivariogram/covariance modeling to model the heavy metals in water bodies Average Standard Error values average of 0.01641 (RMS = 0.01430 at the station Kuin River Estuary. Results of calculations using the Inverse Distance weighting method (IDW for models of heavy metals in biota obtained Root Mean Square value (RMS-error average of 0.29787 on Kuin River Estuary, and the mean value of the average station of 0.0138.

DESAIN INSTALASI PENGOLAH LIMBAH WC KOMUNAL MASYARAKAT PINGGIR SUNGAI DESA LINGKAR KAMPUS

Directory of Open Access Journals (Sweden)

Asep Sapei

2011-08-01

Full Text Available Cangkurawok Village is located in the outer of the Bogor Agricultural University area and does not have good sanitation facilities. Disposal of domestic wastewater directly discharges into drainage channels to river. Wastewater treatment plant design from toilets communal divides into three stages. The first stage is determining the location of toilets communal and excreta treatment plant. Location provided by the public is around 5 meters above the surface of the river water. The second stage is the determination of service areas. In this village consists of 70 heads of households as the basic criteria for determining the volume of septic tanks. The last step is determining the design of toilets communal and wastewater treatment unit. This stage requires the unit options that fits on the selected sites, based on ease of maintenance and no need employ trained operators. Waste treatment facility consists septic tank and infiltration well planning. Septic tank volume is 26.5 m3 with the long dimension of 2.75 m, width of 5.5 m and height of 1.5 m plus 0.3 meters for free board. Septic tank serving four toilets communal is built above it, with the division of space for two men and two spaces for women. infiltration well constructed to absorb the waste liquid vertically through the soil pores. Layers of sand and gravel is spread throughout the wells to assist the flow pattern. Depth and diameter of infiltration well are 3 m and 1 m. This wells should be placed lower than the drinking water sources and wells, with a minimum distance of 15 m

Evaluasi Perubahan Penggunaan Lahan Kecamatan di Daerah Aliran Sungai Cisadane Kabupaten Bogor

Directory of Open Access Journals (Sweden)

Tessie Krisnaningtyas Endang Trimarmanti

2014-04-01

Full Text Available Bogor Regency is part of the National Strategic Area Jabodetabekpunjur, serves as the buffer area. However, it is not denied, accessibility making the Bogor Regency as one of the development center urban settlement and other economic activities. There are two Nature Conservation Area and seven Watershed, the greatest area is Cisadane Watershed, rich biodiversity, daily needs, but susceptible of land use change, especially high population area. The purpose study is to find out land use change and its influence factors on sub-district located in Cisadane Watershed, Bogor Regency. This study used mixed methodes research with series/multiply research, the first is spatial approach and quantitative analysis and the second is qualitative approach. Based on the discussion and findings research, the expansion development settlement in the suburban areas and productive lands convertion (Rustiadi et.al, 2003 happens in Cisadane watershed, urban activities have an impact transformation land use, agricultural into housing/settlement land was truly indeed. It had been occured before the provision of wetland agricultural area. Economic-social factors trigger developers the function of agricultural into housing with value added, no exception resident with the right ownership. Another factor is institutional factors, lack of commitment service from government to presence infrastructure and sustainability irrigation flow. The application of space utilization control has been conducted by sub- district and district officials through supervision and control accordance with the provisions of RTRW/IMB regulation, but this has offset by socialization to the public so a lot of society and officials government have yet know and understand the rules, so tendency land use change is quite high.

Identifikasi Lapisan Geologi Bawah Permukaan Berdasarkan Data Geomagnetik di Sungai Logawa Banyumas

Directory of Open Access Journals (Sweden)

Sukmaji Anom Raharjo

2014-02-01

Full Text Available Identification of geological resources can be done either using surface mapping and cross sectional stratigraphy measurement or geophysical approximation beneath the earth surface. Geomagnetic exploration related to the existing of gold mineral begins with the total magnetic field intensity measurements at 173 locations was scattered in 109.196970 - 109.207580E and 7.448830 - 7.454110S. Interpretation from processing of data obtained four anomalous object, which is defined as fine-medium sandstone (χ= 0.0015 cgs units, coarse sandstone and compact (χ= 0.0035 cgs units, igneous basalt-andesite old Slamet (χ= 0.0085 cgs units, and the complex bedrock (χ= 0.0145 cgs units. The presence of gold mineralization in the rock throughout geomagnetic surveys used to identification of subsurface geological which is interpreted from the processing data that indicated the presence of gold in association with sedimentary (sandstone is often referred to as sediment-hosted.

STUDI KUALITAS UDARA DI SEKITAR SUNGAI TELAGAWAJA, DESA MUNCAN, KABUPATEN KARANGASEM BALI

Directory of Open Access Journals (Sweden)

I WAYAN ARTHANA

2012-11-01

Full Text Available The research was done in surrounding Telagawaja River at Muncan Village, Karangasem Regency, Bali at October2008. The aim of the research was to know the air quality condition in that area. There were six air quality parametersmeasured at three different sites. The content of NO2 at the air varied 24,29-31,87 ?g/m3 was higher than that in GunaksaBeach where there are no activities at all but it was lower than that in Sawangan Nusa Dua where full of tourismactivities. The level of SO2 at the range of 34,44-44,97 ?g/m3 was lower than that in Padangbai Harbour where full ofhuman activities and transportations. The content of dust at the range of 105,82 ?g/m3, CO at the range of 497,78-568,89?g/m3, Pb at the range of 0,250-0,792 ?g/m3. The level of noise at the range of 40,33-53,79 dB(A was lower than that invillage community at Kubu, Karangasem Regency and also lower than that in Sawangan Beach of Nusa Dua. All the airquality parameters are not yet over than standard of safe air quality level.

Pembangunan Berbasis Waterfront dan Transformasi Konflik di Bantaran Sungai: Sebuah Pemikiran Awal

Directory of Open Access Journals (Sweden)

Cahyo Seftyono

2012-12-01

Full Text Available Water resources development at this time led to the front view policy known as waterfront term. This policy is to make water resources as the main area for regional development. The concept of ‘front view’ was developed originally to give understanding to people of the water resources as not only functional but also interesting to look at. On the other side, front view-based development has become the means of developing active interaction among people aroung the site. With regard to the construction of waterfront along the river, the social interaction of community members has become more meaningful, because apparently this is the cause of the unity of the community in the development of their area. As the most communities along the river are lower middle class people who are prone to conflict, this idea of front view-based river bank construction has united the people on one side of the river with another.

ANALISIS DINAMIKA SEBARAN SPASIAL SEDIMENTASI MUARA SUNGAI CANTUNG MENGGUNAKAN CITRA LANDSAT MULTITEMPORAL

Directory of Open Access Journals (Sweden)

Zulaiha Zulaiha

2017-01-01

Full Text Available ABSTRACT: Given the pivotal role played by the Cantung River for the supervision and management of the public good becomes important. Incoming sediment load can damage the uncontrolled flow conditions of the Cantung river and estuary. Observations of suspended sediment can take advantage of multitemporal Landsat imagery. This study uses Landsat satellite image data corrected 5TM March 5, 1992 data acquisition path/row 117/62, Landsat data acquisition 5TM 22 May 1997 path/row 117/62, Landsat data acquisition 5TM March 27, 2000 the path/row 117/62. Several stages in processing the image, that is the conversion of DN to reflectance values, cropping, water-not water secession, and the class divide sediment concentration by density slicing technique. Spatial distribution of suspended sediment in the estuary of the Cantung River Landsat image processing results 5TM March 5, 1992, Landsat 5TM May 22, 1997, and March 27, 2000 Landsat 5TM show distribution patterns of suspended sediment from the River Cantung the same direction, that is northeast. Sediment concentrations were detected in the Landsat image processing 5TM March 5, 1992 the largest-value 27,564096 mg/l and the smallest 14,886048 mg/l. Sediment concentrations were detected in the Landsat image processing 5TM May 22, 1997 the largest-value 121,476776 mg/l and the smallest 12,647415 mg/l. Sediment concentrations were detected in the Landsat image processing 5TM March 27, 2000 most valuable 159,256704 mg/l and the smallest 10,584161 mg/l. Getting away from the effect Cantung River estuary sediment concentration of river flow Cantung tends to get smaller. Changes in the distribution area of the sediments of March 5, 1992 until March 27, 2000 amounted to 450 m2/year.   Keywords: Remote Sensing, Sedimentation, Landsat, Cantung River

Peningkatan Kualitas Permukiman Dengan Pendekatan Disain Pada Bantaran Sungai di Kelurahan Kebonsari

Directory of Open Access Journals (Sweden)

Oktavi Elok Hapsari

2017-03-01

Full Text Available Housing and settlement are basic human needs and welfare in the merits of life. Other than serves as a residence, house has a strategic function in its role as the center of family education, cultural conformity and improving the future generations quality. Settlement as a life supported environment to do the activities and livelihood has a close connection with the setting of human behaviour varieties and social environment prevailing. Housing and residential development is not only based on phsyical development but should be linked to the social, economic and cultural life that supporting sustainable community. Settlement should provide the needs for its society that consists of five elements such as nature, man, society, shells, and network. Kebonsari Village which located on the south border of Malang became the object of this study. This is a qualitative descriptive research with participatory observational techniques. Kebonsari has a quite interesting topography because it is traversed by two streams, Mergan River and the Sukun River, flowing from north to south and located in the eastern region of Kebonsari. Existing problem that occurred in Kebonsari is related to the uncleanliness of Mergan river. In addition, supporting public facility in the settlement needs improvement, such as unkempt and barren footpath along the riverside, as well as the lack of communal space for the society. The result of this study is a concept design for the river-side area arrangement including footpath and communal space for the society in order to improving the quality of the settlement in Kebonsari.

Decolorization and Degradation of Batik Dye Effluent using Ganoderma lucidum

Science.gov (United States)

Pratiwi, Diah; Indrianingsih, A. W.; Darsih, Cici; Hernawan

2017-12-01

Batik is product of traditional Indonesia culture that developed into a large textile industry. Synthetic dyes which widely used in textile industries including batik. Colour can be removed from wastewater effluent by chemical, physical, and biology methods. Bioremediation is one of the methods that used for processing colored effluent. Isolated White-rot fungi Ganoderma lucidum was used for bioremediation process for batik effluent. G. lucidum was developed by G. lucidum cultivation on centers of mushroom farmer Media Agro Merapi Kaliurang, Yogyakarta. The batik effluent was collected from a private small and medium Batik enterprises located at Petir, Rongkop, Gunungkidul Regency. The aim of the study were to optimize decolorization of Naphtol Black (NB) using G. lucidum. The effect of process parameters like incubation time and dye concentration on dye decolorization and COD degradation was studied. G. lucidum were growth at pH 5-6 and temperature 25°C at various Naphtol Black dye with concentration 20 ppm, 50 ppm, and 100 ppm for 30 day incubation time. The result from this study increased decolorization in line with the increasing of COD degradation. Increasing percentage of decolorization and COD degradation gradually increased with incubation time and dye concentration. The maximum decolorization and COD reduction were found to be 60,53% and 81,03%. G. lucidum had potential to decolorized and degraded COD for NB dye effluent on higher concentration.

Characteristics and environmental carrying capacities of coastal area in Yogyakarta Special Region for aquaculture

Science.gov (United States)

Triyatmo, B.; Rustadi; Priyono, S. B.

2018-03-01

The purpose of this study were to determine characteristics and environmental carrying capacities of coastal area in Yogyakarta Special Region for aquaculture. This study was conducted in 2015 by characterizing land and water dynamics, land use, and the suitability of coastal environments for aquaculture. Evaluation on the coastal environments suitability for aquaculture ponds was based on the landforms, soil properties, water quality and land. Selection of coastal locations for aquaculture development was based on the level of suitability of coastal environment. The results showed that the coastal in Kulon Progo and Bantul Regencies were characterized by sand dune and beach ridge with sandy soil texture, while in Gunungkidul Regency was characterized by limestone hill with rocky texture. Water sources of the coastal area were the sea, river, and ground water with the salinity of 31–37, 7–11, 7–31 ppt and pH of 7.4–8.4 7.0–8.2 and 7.4–9.9, respectively. The coastal lands were used for seasonal/annual planting, ponds, fish landing sites, tourism areas and conservation areas. The coastal carrying capacity was rather suitable for aquaculture, especially in the sandy soil area. Aquaculture in that area can be done intensively for shrimp (Litopenaeus vannamei), using biocrete (biological material) or plastic sheet.

Occurrence of Blastocystis sp. in water catchments at Malay villages and Aboriginal settlement during wet and dry seasons in Peninsular Malaysia

Directory of Open Access Journals (Sweden)

Samseh Abdullah Noradilah

2016-10-01

Full Text Available In the tropics, there are too few studies on isolation of Blastocystis sp. subtypes from water sources; in addition, there is also an absence of reported studies on the occurrence of Blastocystis sp. subtypes in water during different seasons. Therefore, this study was aimed to determine the occurrence of Blastocystis sp. subtypes in river water and other water sources that drained aboriginal vicinity of highly endemic intestinal parasitic infections during wet and dry seasons. Water samples were collected from six sampling points of Sungai Krau (K1–K6 and a point at Sungai Lompat (K7 and other water sources around the aboriginal villages. The water samples were collected during both seasons, wet and dry seasons. Filtration of the water samples were carried out using a flatbed membrane filtration system. The extracted DNA from concentrated water sediment was subjected to single round polymerase chain reaction and positive PCR products were subjected to sequencing. All samples were also subjected to filtration and cultured on membrane lactose glucuronide agar for the detection of faecal coliforms. During wet season, Blastocystis sp. ST1, ST2 and ST3 were detected in river water samples. Blastocystis sp. ST3 occurrence was sustained in the river water samples during dry season. However Blastocystis sp. ST1 and ST2 were absent during dry season. Water samples collected from various water sources showed contaminations of Blastocystis sp. ST1, ST2, ST3 and ST4, during wet season and Blastocystis sp. ST1, ST3, ST8 and ST10 during dry season. Water collected from all river sampling points during both seasons showed growth of Escherichia coli and Enterobacter aerogenes, indicating faecal contamination. In this study, Blastocystis sp. ST3 is suggested as the most robust and resistant subtype able to survive in any adverse environmental condition. Restriction and control of human and animal faecal contaminations to the river and other water sources

DAN IDENTIFIKASI PATOGEN POTENSIAL YANG MENGINFEKSI IKAN RAINBOW (Melanotaenia sp.

Directory of Open Access Journals (Sweden)

Lili Sholichah

2014-03-01

Full Text Available Pemeliharaan ikan rainbow (Melanotaenia sp. di Balai Penelitian dan Pengembangan Budidaya Ikan Hias selalu terjadi kematian secara bertahap mulai calon induk hingga proses pemijahan. Hal ini terjadi berulang kali sehingga ketersediaan induk Melanotaenia sp. sangat terancam. Ikan ini berasal dari Papua yang diperoleh mengandalkan penangkapan di alam. Tujuan dari penelitian ini adalah untuk menginventarisir dan mengidentifikasi berbagai patogen (parasit, jamur, bakteri potensial yang menginfeksi ikan rainbow yang dipelihara di dalam akuarium berukuran 50 cm x 50 cm x 50 cm dengan sistem aliran air stagnan. Tiga jenis rainbow yang dipelihara yaitu: rainbow Sungai Salawati, asal Sungai Sawiat, dan asal Danau Kurumoi. Setiap ikan masing-masing berjumlah 100 ekor dipelihara di akuarium dengan penambahan batu karang dan tanpa penambahan karang (kontrol ke dalam akuarium. Ikan diberi pakan sekenyangnya berupa jentik nyamuk dan cacing rambut beku setiap pagi dan sore hari. Sampling dilakukan secara random sebulan sekali dan secara unrandom setiap ada kejadian ikan sakit. Gejala klinis ikan yang sakit sebagai berikut: ikan berenang di permukaan dan menggosok-gosokkan badan di dinding akuarium, nafsu makan berkurang, gerakan berputar-putar, warna memudar menjadi putih, penekanan warna hitam pada sirip punggung dan perut meningkat, pendarahan pada perut, lendir berlebihan dan sangat berbau, serta sisik berdiri/terbuka. Diagnosa dan deteksi penyakit awal berupa pengamatan parasit baik ektoparasit maupun endoparasit, pengamatan dan isolasi jamur pada media selektif jamur, dan isolasi bakteri dilakukan untuk mengetahui jenis-jenis patogen yang menginfeksi ketiga jenis ikan rainbow. Selanjutnya dilakukan uji histologi dan analisa DNA beberapa patogen. Hasil pengamatan diperoleh patogen berupa parasit (Ichthyophthirius sp., Dactylogyrus sp., Gyrodactylus sp., dan Trichodina sp. dan bakteri (Aeromonas hydrophila, Acinetobacter sp

POTENSI “IKAN MURAI AIR TAWAR” (Gymnothorax polyuranodon SEBAGAI IKAN HIAS

Directory of Open Access Journals (Sweden)

Ahmad Musa

2011-12-01

Full Text Available Indonesia merupakan negara yang kaya akan potensi sumberdaya alam hayati termasuk di dalamnya ikan-ikan air tawar, payau, dan laut yang prospeknya dikembangkan sebagai komoditas yang bernilai ekonomi tinggi. Ikan murai air tawar (Gymnothorax polyuranodon merupakan salah satu spesies ikan yang sebarannya cukup luas di Indonesia. Dalam siklus hidupnya ikan murai ini hidup di air tawar, payau dan laut. Corak warna coklat kekuningan dengan bintik hitam bulat yang tidak teratur pada kepala seperti pita-pita yang warnanya memanjang yang lengkap serta bentuknya yang mirip ular menyebabkan ikan murai ini juga dijadikan ikan hias. Tiga kali koleksi ikan murai di alam telah dilakukan di Sungai Lasusua, Sulawesi Tenggara pada September 2008, Oktober, dan November 2009.

PENCEMARAN KADMIUM DI SEDIMEN WADUK SAGULING PROVINSI JAWA BARAT (Cadmium Pollution in Saguling DAM Sediment West Java Province

Directory of Open Access Journals (Sweden)

Eka Wardhani

2016-09-01

Full Text Available ABSTRAK Sungai Citarum Hulu merupakan sumber air utama Waduk Saguling. Kualitas air sungai ini telah mengalami penurunan bahkan terpantau beberapa logam berat terkandung dalam air Sungai Citarum. Penelitian ini bertujuan untuk melihat pencemaran Cd di sedimen Waduk Saguling pada dua musim yang berbeda. Lokasi penelitian dilakukan di 10 titik di Waduk Saguling. Penelitian mengkaji perbedaan konsentrasi Cd pada Bulan Juli 2015 mewakili musim kemarau dan Bulan November 2015 mewakili musim hujan. Sedimen yang diperiksa merupakan sedimen permukaan pada kedalaman 0-10 cm pada dasar waduk. Konsentrasi Cd di sedimen dianalisis menggunakan ICP-MS. Tingkat pencemaran sedimen akibat Cd dinilai dengan menggunakan dua metode yaitu: faktor contaminasi/contamination factor, CF dan indeks pencemaran logam/Metal Pollution Index, MPI. Berdasarkan hasil penelitian konsentrasi Cd dalam air selama satu dekade mulai tahun 2008-2014 cenderung mengalami peningkatan, dengan konsentrasi berkisar antara 0 mg/L-0,14 mg/L. Konsentrasi rata-rata Cd di sedimen Waduk Saguling pada Bulan Juli 2015 mewakili musim kemarau sebesar 13,54 mg/kg, sedangkan pada Bulan November 2015 mewakili musim hujan sebesar 21,08 mg/kg. Konsentrasi Cd di sedimen Waduk Saguling tidak memenuhi baku mutu kualitas sedimen berdasarkan baku mutu yang berlaku di Australian dan New Zaeland mengingat Indonesia belum memiliki baku mutu kualitas sedimen yaitu sebesar 1,5 mg/kg. Hasil penilaian kualitas sedimen dengan menggunakan metode CF di semua titik penelitian di Waduk Saguling termasuk kategori terkontaminasi sangat tinggi sedangkan berdasarkan hasil penilaian dengan MPI kualitas sedimen Waduk Saguling termasuk kategori tercemar oleh logam berat Cd. Hasil penelitian ini dapat dijadikan bahan pertimbangan bagi pengelolaan Waduk Saguling mengenai kondisi pencemaran logam berat yang telah terjadi di waduk tersebut. ABSTRACT Citarum river is the main water source for Saguling Dam. The river waters quality

Teknologi Pesawat Tanpa Awak untuk Pemetaan Skala Detail Rencana Jaringan Pipa Sanitasi Komunal bagi Masyarakat Dusun Kepek 1, Kepek, Wonosari, Gunungkidul

Directory of Open Access Journals (Sweden)

Suharyadi Suharyadi

2017-02-01

Full Text Available Human settlements can not be separated from the emergence of waste generated by human activity. Waste will give a negative efect on health and the environment if not handled and managed properly. Hamlet Kepek 1, Kepek, Wonosari have realized the impact that arises when household waste is not managed properly. For that, some residents have initiated a communal waste management and manufacture of communal sanitation pipelines. Conventionally, communal sanitary pipe network planning and data requires a huge cost, for it takes breakthrough of utilization of appropriate technology to facilitate the planning process and reduce the cost incurred.Utilization of small format aerial photographs resulting from the unmanned aircraf vehicle (UAV used as an alternative technology in the planning communal sanitation pipelines. Analytical methods to create a map of the communal sanitation pipelines through least cost path analysis. Utilization of UAV technology is expected to make the planning of communal sanitary pipelines with good results and at afordable costs. Te result of small format aerial photography from unmanned aircraf vehicle (UAV can be used to produce the spatial data with high resolution. Small format aerial photographs produced is then processed to obtain the orthophoto image and the image of Digital Surface Model (DSM. Both kinds of remote sensing image are then used as the main data to create maps of the communal sanitation pipelines. Te result of processing in the form of a map of communal sanitation pipelines in t Kepek 1 at low cost and appropriate technology.

Pengaruh Holding Time Terhadap Kekeruhan Pada Sampel Air Sungai Babura Dengan Metode Turbidimetri

OpenAIRE

Ashari, Dian

2010-01-01

Turbidity define the water optic determined based on amount of lihgts absorbed by materials in water. Turbidity caused by organic and inorganic materials which suspended and solved (such as mud and smooth sand), also organic and inorganic materials which in form of plankton and other microorganism. In this case, I study about holding time influence to turbidity, on trial this show very influencing a period of holding time to turbidity. Where a period of holding time at maximum turbidity sampl...

Pemanfaatan Limbah Cangkang Kerang Hijau (Perna Viridis Menjadi Kitin Sebagai Biokoagulan Air Sungai

Directory of Open Access Journals (Sweden)

Syamsidar HS

2017-06-01

Full Text Available This study aims to determine the optimum weight of chitin that used as biocoagulant of river water. The water sample is taken from Kajenjeng river and the chitin used for research are isolated from green mussels (Perna viridis shell powder through three steps such as deproteination by NaOH 3%, demineralization by HCl 1,25 N and depigmentation by NaOCl 4%. Then, the obtained chitin are contacted into water with variation of 0,25 gram; 0,5 gram; 0,75 gram and 1 gram in an hour. The result showed that optimum weight of chitin for COD determination, total hardness, calcium and turbidity is 0,75 gram, while optimum weight of chitin for magnesium determination is 0,5 gram.

ANALISIS KADAR LOGAM BERAT AIR SUNGAI SEKONYER DI KABUPATEN KOTAWARINGIN BARAT KALIMANTAN TENGAH.

Directory of Open Access Journals (Sweden)

Maria T. Indarwati

2012-11-01

Full Text Available Sekonyer river as west border of Tanjung Puting National Park, is the main flora and fauna preservation areasespecially for orangutan conservation. Part of Sekonyer river upper course around year 1990 to 2002, there was anillegal gold mining (IGM activity, and in 2002 this IGM was forbidden to be operated because of the use of mercuryfor extracting the gold. In former IGM location, up to this research has been done, the location is still used for silikapuya (sand mining that is extracted from the sands by using water from the river, as a result, the waste water wasinundated in the mining area and flows into Sekonyer river. The objectives of this research are first of all, to identifythe heavy metal degree of the water, such as mercury, copper, cadmium, zinc, lead, arsenic, and chrome. The secondone is to identify the source of pollution, and the last one is to identify the potential heavy metal that pollute the water.Composite method was used in collecting the water samples, i.e. in Sekonyer river and the mining location.Water and puya samples were analyzed in Analytical Laboratory of University of Udayana, and then its pollutionindexes were counted, and the quality of the water was fixed based on Third Degree of quality standardized criteria,Government Rule Number 82 Year 2001.The results of the research show that along the Sekonyer river, from upper to lower courses of the river sideswith the following conditions: from the lower course of mining area it was found light pollution with pollution index of 2,51, after puya mine it was found heavy pollution with pollution index of 17,84, up to mid of Rimba Orangutan Eco-Lodge with Sekonyer river estuary there were found light pollution with pollution indexes of 3,71; 4,59; and 2,88respectively, but in the junction of Sekonyer river and Ulin river it was found moderate pollution with pollution indexof 5,13, and in Sekonyer river estuary it was found heavy pollution with pollution index of 16,35.It was also found heavy pollution with pollution index of 16,26 in the inundated water in the puya mininglocation . It was also happened to puya in the mining location that was contaminated by heavy metal of mercury in0,1168 ppm and zinc in 0,195 ppm degrees, whilst in Kumai river, upper side of Kumai quay it was found heavypollution with pollution index of 17,42.From the results of the analysis, it can be concluded that the heavy metals was derived from mining area(Aspai, from the sea and also from upper course of Kumai river. The potential metals as the pollutant were cadmium,zinc, lead, and mercury.

Pengaruh kualitas air limbah sentra industri penyamakan kulit sitimulyo terhadap karakteristik air sungai

Directory of Open Access Journals (Sweden)

R. Jaka Susila

2005-07-01

Full Text Available The characteristic of waste discaharged in tanning industry depends on variety and describe of processing and technology are used. Liquid effluent is high-grade category. Waste water comes from beam house process and tanning process, and the dangerous of waste is trivalent and hexavalent of chrome from tanning chrome process. The management of waste in the tanning industry is holding and handling start at raw material, auxiliaries, processing, finishing the last product and the end of pipe treatment. The objective of the research was to know the influence of waste water quality in tanning industry centre Sitimulyo for water river characteristic. The sample was examine in 5 months and the eight parameters were limited by SK Gunernur No : 281/KPTS/1998: Waste water analysis in tanning industry was BOD 31,80mg/l, COD 660,84 mg/l, TSS 221,60 mg/l, Chrom 0,07 mg/l, N-Amonia 13,36 mg/l, Sulfide 13,56 mg/l, Oil/fat 4,80 mg/l, and pH 7,53. Characteristic water river befor received pollutant was BOD 0,75 mg/l, COD 12,18 mg/l, TSS 10,00 mg/l, Chrom 0,01 mg/l, N-Amonia 2,07 mg/l, Sulfide 0,17 mg/l, oil/fat 4,00 mg/l, and pH 7,48. Characteristic water river after received polutan was BOD 8,17 mg/l, COD 38,42 mg/l, TSS 14,00 mg/l, Chrom 0,06 mg/l, N-Amonia 0,47 mg/l, Sulfide 0,002 mg/l, Oil/fat 4,21 mg/l and pH 7,33. Stated that there is a correlation between waste water quality in tanning industry centre Sitimulyo with the river. Although water river characteristic to be change, but still full fill the requiremnts.

Studi Kelayakan terhadap Proyek Lembah Sungai Musi Banyuasin Bagian 1: Studi Umum Sedimentasi

Directory of Open Access Journals (Sweden)

Sohei Matsuno

2007-09-01

Full Text Available This is an extract of a feasibility-study report on the two projects, 'Consolidation of Infrastructure of Biofuel Industry,in Musi- Banyuasin regency and ditto in Banyuasin regency. PART 1 is of general studies on sediment in the Musi-Banyuasin River system where the project sites are located. The primary objective of this report is to forward solution to the sediment-origin problems, which is a compulsory subject for any projects in the Musf-Banyuasin River system. To attain this objective, it clears the following secondary objectives, viz. (a identifying every problem hindering human lives and activities, (b drawing a hypothesis about causality, (e determining basic data by field surveys, lab tests and data analyses and (d authenticating the hypothesis to be a theory. To achieve these objectives, the studies have gone forward with four represenfative objects, viz. (i the Muba River system as a wholee, (ii the lower reaches of the main stream, (iii the biggest tributary ,and (iv the biggest dis-tributary. It concludes that sediment is the sole cause of major problems, forwards measures to solve the problems, and suggests do's and don’ts. PART 2, 'Particular Studies on a Certain Project,' explains how the results of PART 1 are applied to the project. PART 1 leaves the verification of the suggested technical systems to full-scale/ in­-situ model tests that are elaborated in PART 2 and to baexecuted in the first step of each project.

Biologi reproduksi ikan juaro (Pangasius polyuranodon di daerah aliran Sungai Musi Sumatra Selatan

Directory of Open Access Journals (Sweden)

Yunizar Ernawati

2012-02-01

Full Text Available Study on biology reproduction was expected to give basic information for management, such as for aquaculture, capture fisheriesand conservation of P. polyuranodon in Musi river. Sampling were conducted on June 2006, August 2006, January 2007, and July 2007in Musi river by using gillnet. Data analysis included length-weight relationship, sex ratio, condition factor, gonad maturity stage,Gonadosomatic Index (GSI, fecundity, and spawning type. Total number of collected P. polyuranodon was 51, consisted of 23 maleand 28 female. Total length of fish was ranged in 85–511 mm. Length-weight relationship of male and female was W = 0.00002L2.8062and W = 0.0002L2.8215 respectively. The result from t-test analysis showed that both of sexes have allometric negative growth. Sex ratiothoroughly was balance (1:1. Mean of factor condition relatively increased by the increasing of gonad maturity stage. At that timeP. polyuranodon was entering spawning time. June and August was predicted as the spawning time of this species. Gonadosomaticindex of female was much higher than the male. Fecundity of female was ranged between 616 and 7,059. Based on distribution of eggdiameter, this species was total spawner.Key words: juaro fish, IKG, spawning pattern, TKG.

PEMBANGUNAN HUKUM SUMBER DAYA AIR SUNGAI YANG BERBASIS KEARIFAN LOKAL: PELUANG DAN TANTANGANNYA

Directory of Open Access Journals (Sweden)

Mr. Sulastriyono

2008-10-01

Full Text Available This article aims to discuss the opportunity and challenge in the development of river water resources law as a consequence of population growth, development, and technology advancement. Fast growth on water needs induces the growth of economic value of water, rather than its social values. This condition potentially causes of conflict interests among sectors, among regions and among various stakeholder related to water resources management. The management of river water resources can be perceived as an opportunity as well as a challenge. The quantity and the potential of water which is abundant in Indonesia to use water resources optimally. However, the development of river water resources law still faces some challenges, namely institutional obstacle, legal system and culture. Globalization in the free market economic order must be faced by Indonesia in its efforts to develop law on the management of river water resources. Privatization in the management of river water resources led to the increase of the role of private sector in pursuing economic benefits. It is feared that privatization will limit the community access to water resources and will make the price of water is more expensive. An integrated law development of river water resources based on local wisdom is an alternative guarantee the community access and the sustainability of the availability way to river water resources.

Use of Space and the Need for Planning in the Disaster-Prone Area of Code River, Yogyakarta, Indonesia

Directory of Open Access Journals (Sweden)

Rini Rachmawati

2017-01-01

  Abstrak Tepi Sungai Code merupakan daerah rawan terhadap banjir lahar yang disebabkan oleh erupsi Gunungapi Merapi. Penelitian ini menfokuskan pada daerah terdampak di Danurejan, Kota Yogyakarta, Indonesia. Tujuan dari penelitian ini adalah 1 untuk mengidentifikasi dan menganalisa fungsi ruang setelah bencana, dan 2 untuk menganalisa tindakan perencanaan ruang yang dibutuhkan setelah bencana. Data dikumpulkan dari data sekunder dan primer. Data primer diperoleh melalui observasi, interview mendalam, dan diskusi kelompok terfokus. Hasil menunjukkan bahwa pemanfaatan ruang dalam antisipasi dari bencana banjir lahar masih terbatas  untuk pembangunan peninggian tanggul. Temuan penelitian menyarankan perlunya perhatian terhadap pemanfaatan ruang untuk kelompok yang rentan. Selain itu juga perlunya partisipasi publik dalam pemanfaatan ruang, penyiapan design ekowisata dan kegiatan bernilai ekonomi. Selan itu juga perlu adanya integrasi analisis risiko dan distribusi spasial dari risiko yang  dituangkan dalam  rencana rinci tata ruang.

Freescale Sdn Bhd: Monitoring Radiofrequency Assessment

International Nuclear Information System (INIS)

Wan Saffiey Wan Abdullah; Noor Ezati Shuib; Rozaimah Abdul Rahim; Pasupathy, E.; Muhammad Yusri Yahaya

2015-01-01

Freescale Semiconductor (M) Sdn Bhd, requested the assistance of Malaysian Nuclear Agency (Nuclear Malaysia) to conduct an electromagnetic radiation (Radiofrequency Radiation) measurements around its facilities at Freescale Semiconductor (M) Sdn Bhd, 2, Jalan SS8/2, Sungai Wai Free Industrial Zone, 47300 Petaling Jaya, Selangor. Nuclear Agency Non-Ionising Radiation (NIR) Group carried out the measurement on 30th July 2012. In carrying out the work, the Group was assisted by Mr Daniel. The main objectives of the measurement were to assess the presence of electromagnetic radiation (RF field) in an accessible work places within and around the facilities and to advise the company on outcomes of the assessment and measurement based on international recommendations of standard guidelines issued by Malaysian Communication and Multimedia Commission (MCMC) and International Commission on Non-Ionising Radiation Protection (ICNIRP). (author)

Instrumental neutron activation analysis of soil sample

International Nuclear Information System (INIS)

Abdul Khalik Haji Wood.

1983-01-01

This paper describes the analysis of soil samples collected from 5 different location around Sungai Lui, Kajang, Selangor, Malaysia. These sample were taken at 22-24 cm from the top of the ground and were analysed using the techniques of Instrumental Neutron Activation Analysis (INAA). The analysis on soil sample taken above 22-24 cm level were done in order to determine if there is any variation in elemental contents at different sampling levels. The results indicate a wide variation in the contents of the samples. About 30 elements have been analysed. The major ones are Na, I, Cl, Mg, Al, K, Ti, Ca and Fe. Trace elements analysed were Ba, Sc, V, Cr, Mn, Ga, As, Zn, Br, Rb, Co, Hf, Zr, Th, U, Sb, Cs, Ce, Sm, Eu, Tb, Dy, Yb, Lu and La. (author)

Stability Test For Sorghum Mutant Lines Derived From Induced Mutations with Gamma-Ray Irradiation

Directory of Open Access Journals (Sweden)

S. Human

2011-12-01

Full Text Available Sorghum breeding program had been conducted at the Center for the Application of Isotopes and Radiation Technology, BATAN. Plant genetic variability was increased through induced mutations using gamma-ray irradiation. Through selection process in successive generations, some promising mutant lines had been identified to have good agronomic characteristics with high grain yield. These breeding lines were tested in multi location trials and information of the genotypic stability was obtained to meet the requirements for officially varietal release by the Ministry of Agriculture. A total of 11 sorghum lines and varieties consisting of 8 mutant lines derived from induced mutations (B-100, B-95, B-92, B-83, B-76, B-75, B-69 and Zh-30 and 3 control varieties (Durra, UPCA-S1 and Mandau were included in the experiment. All materials were grown in 10 agro-ecologically different locations namely Gunungkidul, Bantul, Citayam, Garut, Lampung, Bogor, Anyer, Karawaci, Cianjur and Subang. In each location, the local adaptability test was conducted by randomized block design with 3 replications. Data of grain yield was used for evaluating genotypic stability using AMMI approach. Results revealed that sorghum mutation breeding had generated 3 mutant lines (B-100, B-76 and Zh-30 exhibiting grain yield significantly higher than the control varieties. These mutant lines were genetically stable in all locations so that they would be recommended for official release as new sorghum varieties to the Ministry of Agriculture

The Effect Feed Supplement of Medicated Block (SPMB) of the Daily Weight Gain on Cows after Calving

International Nuclear Information System (INIS)

Suharyono; Andini, L.S; WT Sasongko

2004-01-01

The purpose of the experiment was to develop feed supplement for sustain ability of technology and improving the performance of cows after calving. This feed supplement is derived from modification of UMMB-bungkil kedelai composition. In vitro study to measure ratio bacteria and protozoa using 32 P method was carried out. Cows after calving were treated 3 with treatments, namely I = control (basal diet + concentrate), II = I + UMMB, III = I + SPMB-temu ireng. Ratio bacteria and protozoa of UMMB-soy bean powder and soy bean meal was 19:1 and 14:1 respectively. Nutrient content of crude protein was 30.02 and 26.47%. SPMB-temu ireng and UMMB increased daily weight gain of cows 0.02 and 0.01 kg/h/d compared control (0.08 kg/h/d). The daily weight gain decreased, however, it was slower than control. The daily weight gain was - 0.04 and - 0.03 kg/h/d compared to - 0.3 kg/h/d. Basal diet and concentrate offered in Gunungkidul was between 5.4 - 6.84 forages/DM and 1.7 - 3.3 kg, while in Sleman it was 5.2 - 5.81 kg/forages/DM and 2.5 - 3.2 kg. The overall conclusion is the SPMB and UMMB has positive responds on the performance of cows after calving, however, the cows have to be fulfilled with the requirement of basal diet. (author)

The learning continuum based on student's level of competence and specific pedagogical learning material on physiological aspects from teachers's opinions

Science.gov (United States)

Hadi, Ria Fitriyani; Subali, Bambang

2017-08-01

The scope of learning continuum at the conceptual knowledge is formulated based on the student's level of competence and specific pedagogical learning material. The purpose of this study is to develop a learning continuum of specific pedagogical material aspects of physiology targeted for students in primary and secondary education. This research was conducted in Province of Yogyakarta Special Region from October 2016 to January 2017. The method used in this study was survey method. The data were collected using questionnaire that had been validated from the aspects of construct validity and experts judgements. Respondents in this study consist of 281 Science/Biology teachers at Public Junior and Senior High Schools in the Province of Yogyakarta Special Region which spread in Yogyakarta city and 4 regencies namely Sleman, Bantul, Kulonprogo, and Gunungkidul. The data were taken using a census. Data were analyzed using a descriptive analysis technique. The results show the learning continuum of physiology based on teachers's opinion from grade VII, VIII, and IX are taught in grade VII, VIII, IX and X on level of C2 (understanding) and the learning continuum of physiology based on teachers's opinion from grade X, XI and XII are taught in grade X and XI on level of C2 (understanding), C3 (applying), and C4 (analyzing) based on teachers's opinions. The conclusion is that many teachers refer to the existing curriculum rather than their own original idea for developing learning continuum.

The Effectiveness of Collaborative Writing Strategy (CWS in Writing Lesson Regarded to The Students’ Creativity

Directory of Open Access Journals (Sweden)

Kiky Soraya

2016-11-01

Full Text Available This study is aimed at finding out what appropriate methods to be usedin writing lesson seen from the students’ creativity especially for studentswho have high creativityand low creativity. This study used quasi experimental research. The population of the research was the eighth grade of a Junior High School in Wonosari in the academic year of 2013/2014. The sampling technique used was cluster random sampling. The sample in this study was 64 students covering 32 students of E as experimental class and 32 students of C as control class. The data or the students’ writing scores were analyzed in terms of their frequency distribution, normality, homogeneity, then ANOVA and Tuckey tests to test the research hypotheses. Based on the result, the research findings are: CWS is more effective than MWS in writing lesson; the high creativity students produced better writing rather than the low creativity student; and the interaction of teaching methods and the students’ creativity is existing in this writing lesson. In short, Collaborative Writing Strategy (CWS is effective to teach writing for the eighth grade of a Junior High School in Wonosari, Gunungkidul. Then, the research result implies that it is better for the teachers to apply CWS in teaching and learning process of writing, to improve the students’ writing achievement, CWS needs to be used in the classroom activities, then future research can conduct the similar research with different sample and different students’ condition.

STUDI BIO-EPIDEMIOLOGI DAN ANALISIS SPASIAL KASUS MALARIA DAERAH LINTAS BATAS INDONESIA – MALAYSIA (PULAU SEBATIK KABUPATEN NUNUKAN, PROVINSI KALIMANTAN TIMUR

Directory of Open Access Journals (Sweden)

Damar Tri Boewono

2013-02-01

Dinas Kesehatan. Walaupun demikian, kasus malaria masih banyak ditemukan beberapa tahun lalu. Penelitian komprehensif telah dilakukan untuk mengetahui distribusi spasial kasus malaria dengan pemetaan menggunakaan geographical information system (GIS sehubungan dengan distribusi breeding habitat positip jentik nyamuk vektor. Tujuan penelitian adalah untuk menentukan strategi pengendalian vektor malaria spesifik, berdasarkan beberapa faktor bionomik, distribusi spasial kasus malaria dan breeding habitat positip jentik nyamuk vektor  dengan pemetaan GIS dan analisis indek jarak (distance index analyses dan status kerentanan vektor malaria terhadap insektisida.  Hasil penelitian ditemukan bahwa tiga spesies nyamuk dicurigai sebagai vektor malaria seperti: Anopheles balabacensis dan Anopheles maculatus (daerah pegunungan di pedalaman, seperti Desa Sungai Limau and Lapio, sebagai breeding habitat adalah air sumur/perigi, kolam dan parit. Daerah pantai, Desa Sungai Nyamuk dan Liang Bunyu, kolam dan lagoon/goba air payau ditemukan sebagai breeding habitat nyamuk Anopheles sundaicus (dicurigai sebagai vektor malaria. Vektor malaria (An. balabacensis and An. maculatus, ditemukan sudah resisten terhadap insektisida Permetrin dan Lambdacyhalotrin tetapi masih toleran terhadap Malation. Insektisida alternatif perlu dipertimbangkan dalam pengendalian vektor malaria.  Analisis spasial diketahui bahwa kasus malaria tersebar mengelompok clumped/cluster, buffer zones terhadap breeding habitat (< 400 meter sebagai indikasi penularan lokal/setempat (indigenous sehubungan dengan perilaku vektor  dan kurang disebabkan  mobititas manusia.  Pengendalian vektor malaria di Desa Sungai Limau (daerah endemis perlu diperhatikan secara khusus,  Manajemen vektor secara terpadu baik aplikasi dalam rumah  (indoors treatment seperti indoor residual spraying/IRS (penyemprotan insektisida pada dinding rumah, atau distribusi kelambu berinsektisida (LLIN dan aplikasi breeding habitat jentik nyamuk

In vivo antitumor and antimetastatic effects of flavokawain B in 4T1 breast cancer cell-challenged mice

Directory of Open Access Journals (Sweden)

Abu N

2015-03-01

Full Text Available Nadiah Abu,1,2 Nurul Elyani Mohamed,2 Swee Keong Yeap,3 Kian Lam Lim,4 M Nadeem Akhtar,5 Aimi Jamil Zulfadli,3 Beh Boon Kee,2 Mohd Puad Abdullah,2 Abdul Rahman Omar,3 Noorjahan Banu Alitheen2 1Bright Sparks Unit, Universiti Malaya, Kuala Lumpur, Malaysia; 2Department of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular Sciences, 3Institute of Bioscience, Universiti Putra Malaysia, Serdang, Selangor Darul Ehsan, Malaysia; 4Faculty of Medicine and Health Sciences, Universiti Tunku Abdul Rahman, Lot PT, Jalan Sungai Long, Bandar Sungai Long, Cheras, Selangor, Malaysia; 5Faculty of Industrial Sciences and Technology, Universiti Malaysia Pahang, Lebuhraya Tun Razak, Kuantan Pahang, Malaysia Abstract: Flavokawain B (FKB is a naturally occurring chalcone that can be isolated through the root extracts of the kava-kava plant (Piper methysticum. It can also be synthesized chemically to increase the yield. This compound is a promising candidate as a biological agent, as it is reported to be involved in a wide range of biological activities. Furthermore, FKB was reported to have antitumorigenic effects in several cancer cell lines in vitro. However, the in vivo antitumor effects of FKB have not been reported on yet. Breast cancer is one of the major causes of cancer-related deaths in the world today. Any potential treatment should not only impede the growth of the tumor, but also modulate the immune system efficiently and inhibit the formation of secondary tumors. As presented in our study, FKB induced apoptosis in 4T1 tumors in vivo, as evidenced by the terminal deoxynucleotidyl transferase dUTP nick end labeling and hematoxylin and eosin staining of the tumor. FKB also regulated the immune system by increasing both helper and cytolytic T-cell and natural killer cell populations. In addition, FKB also enhanced the levels of interleukin 2 and interferon gamma but suppressed interleukin 1B. Apart from that, FKB was also found to inhibit

STRATEGI PEGELOLAAN SUAKA PERIKANAN RAWA BANJIRAN DI SUMATERA DAN KALIMANTAN

Directory of Open Access Journals (Sweden)

Agus Djoko Utomo

2016-10-01

“Danau lindung Empangau “ (124 ha di Kapuas Hulu Kalimantan Barat terdapat stok ikan 5.700 ekor/ha didominansi oleh ikan Haruan (Channa striata, Entukan (Thynnichthys thynnoides, Biawan (Helostoma temmenckii, Tengadak (Barbonymus schwanenfeldii. Suaka perikanan tipe sungai “Kapak Hulu” (segmen sungai panjang 1 km, lebar 30 m di Lubuk Lamam Sumatera selatan terdapatstok ikan 4 ton didominansi oleh ikan Lais (Kryptopterus kryptopterus, Baung (Hemibagrus nemurus, Palau (Osteochilus hasselti, Lampam (Barbonymus schwanenfeldii. Suaka perikanan “Lubuk Gunung Isam” di Lubuk Lamam Sumatera selatan terdapat stok ikan 2 ton didominansi oleh ikan Tapa (Wallago leeri, Bulu Tulang (Kryptopterus apagon, Baung (Hemibagrus nemurus, Lais (Kryptopterus kryptopterus. Agar supaya suaka perikanan dapat berfungsi dengan baik sehingga mempunyai dampak terhadap masyarakat sekitarnya maka suaka tersebut harus dikelola dengan tepat mulai dari penentuan lokasi yang tepat, sarana prasarana yang diperlukan, serta kelembagaan dan pengawasan. Floodplain waters are strongly influenced by season, drought during dry season and floods in rainy season. There are two groups of fish in the swamp namely the swamp fishgroup (black fish and river fish group (white fish. Based on the type of habitat in the swamp flood, there are several types of fish reserves namely floodplain pool reserve, swamp lake reserve, river segment reserve, and deep pool of the riverreserve. Floodplain pool reserve type:” Suak Buaya Reserve”(0.5 ha in southern Sumatra contained 2 tons of fish stocks dominated by snakehead, kissing gourami, Snakeskin gourami, climbing perches. Swamp lake reserve type: Empangau Lake Reserve (124 ha in West Kalimantan with5.700 fish/ha dominated by Snakehead fish, minnows or carp,kissing gourami, Tinfoil barb. River segment reserve type: “Kapak Hulu Reserve “ (river segment, length =1 km and width =30 m in southern Sumatra contained 4 tons of fish dominated by Sheatfishes, Catfish

ANALISA PERBANDINGAN ANOMALI GRAVITASI DENGAN PERSEBARAN INTRUSI AIR ASIN (STUDI KASUS JAKARTA 2006-2007

Directory of Open Access Journals (Sweden)

Litanya Octonovrilna

2009-07-01

Full Text Available Aplikasi pada bidang geofisika, berupa pengukuran gravitasi dilakukan di lapangan dalam jangka waktu tertentu, dengan tujuan untuk mendeteksi perubahan kondisi bawah permukaan bumi. Dalam hal ini dilakukan pengukuran gravitasi di wilayah Jakarta untuk mendeteksi perubahan kondisi hidrologi Jakarta dalam kaitannya dengan fenomena intrusi air asin. Secara geografis daerah penelitian berada pada -6.35158 s.d -6.08655 LS dan 106.689 s.d. 106.955 BT. Pengolahan data gravitasi wilayah Jakarta dilakukan dalam 2 periode, yaitu periode I (September 2006 dan periode II (November–Desember 2007. Anomali gravitasi  tertinggi terdapat pada bagian pusat dan barat Jakarta ini mengindikasikan terjadinya fenomena subsidensi dan kekosongan massa akibat eksploitasi air tanah serta tekanan dari sejumlah gedung tinggi yang berpusat pada daerah tersebut. Anomali gravitasi terendah terdapat di bagian barat laut Jakarta yang bersesuaian konsentrasi nilai kepayauan tertinggi, mengindikasikan adanya intrusi air asin yang diakibatkan oleh adanya fenomena Conate Water yang menyusup  pada aquifer air tanah akibat eksplotasi air tanah berlebih. Hubungan pola aliran sungai dengan nilai kepayauan air, membuktikan adanya pengaruh sungai aquifer air tanah, namun dampaknya tidak terlalu berpengaruh terlebih pada aquifer dalam.   Gravity measurements are conducted in the field within a certain period in order to detect changes in the earth's surface conditions. We conducted gravity measurements in Jakarta to detect changes in hydrologic conditions in connection to salt water intrusion phenomena. The data processing performed in the two periods, the first period is September 2006 and the second one is November-December 2007. The highest gravity anomalies are in central and western parts of Jakarta. This implies the occurrence of mass subsidence and void due to the exploitation of ground water and the pressure from a number of high buildings based on the area. The lowest gravity

PENGOLAHAN GULA AREN (Arrenga Pinnata Merr DI DESA BANUA HANYAR KABUPATEN HULU SUNGAI TENGAH

Directory of Open Access Journals (Sweden)

Rosidah R Radam

2016-11-01

Full Text Available Gula aren salah satu pemanis yang telah diproduksi oleh bangsa Indonesia sejak lama. Gula aren sebagai alternatif bahan pemanis makanan dan merupakan mata pencaharian sampingan bagi kebanyakan masyarakat di Desa Banua Hanyar. Tujuan penelitian ini untuk mengetahui produktivitas dan kontribusi terhadap pendapatan masyarakat. Objek penelitian ini adalah pembuat gula aren. Data yang dikumpulkan terdiri dari  karakteristik responden, proses pembuatan gula aren, perhitungan produktivitas dan kontribusinya terhadap pendapatan masyarakat. Produktivitas gula aren (Arenga pinnata Merr berkisar antara 0,465 Kg/hari hingga 1,137 kg/hari. Kontribusi dari pengolahan gula aren sebesar 60,48% dari pendapatan masyarakat. Tingkat kesejahteraan masyarakat termasuk dalam golongan termiskin dengan pendapatan tahunan per kapita Rp.962 919,- atau setara dengan 148 kg beras. Disarankan perlu pembentukan kelompok tani dengan tujuan keseragaman dalam harga pasar gula aren. Peningkatan kualitas dengan peningkatan bentuk cetakan, kemasan dan aneka  rasa. Sehingga produk gula aren dapat dijual di pasar modern. Palm sugar is a sweetener that has been produced by the nation of Indonesia since long ago.  Palm sugar as an alternative sweetener foodstuffs as well as an second job for most people in the Banua Hanyar village.  The purpose of this research to know the productivity and contribution to community income. The object of this research is the maker of palm sugar. Data collected as data characteristics, the process of making palm sugar, calculation of productivity and its contribution to household income. Productivity sugar palm (Arenga pinnata Merr ranged from 0.465 Kg / day up to 1,137 kg / day. Contributions from processing palm sugar by 60.48% of household income. The level of welfare including in the poorest of the poor with annual income  per capita of IDR 962 919, - or the equivalent of 148 kg of rice.  Need formation of farmer groups with the goal of uniformity in the market price of palm sugar. Improved quality with improved shape of the mold, packaging and various flavors. So that the products of palm sugar can be sold on the modern markets.

Kajian Kualitas Air Sungai Condong yang terkena Buangan Limbah Cair Industri Batik Trusmi Cirebon

Directory of Open Access Journals (Sweden)

Pipin Supenah

2015-05-01

Full Text Available The aims of this study were to assess the water quality of the River Condong and Condong River Quality Statebased on physical, chemical and biological parameters. Sampling was carried out in seven stations with 3 repetitions at intervals of one month. Water quality were analyzed descriptively by reference raw Water Quality Standard.  Determination of the stateof water quality using methods Storet. Results of laboratory tests showed that the water quality of the River Condong exceed the Water Quality Standard Group II based on Government Regulation No. 82 of 2001 and in particular textile waste quality standard TSS, DO, BOD5, COD, NH3, sulfide, Cr (VI, phenols, oils and fats, Biological parameters using makrobentos diversity index (H ' obtained a low value that is from 0 to 1.7077.  Quality state based Storet method, the value of  > -31. It can be concluded that the condition of physical, chemical and biological parameters, Condong River water showed waters not appropriate the Quality Standard for agricultural irrigation, freshwater fish breeding and infrastructure or water recreation facilities before and after the discharge of liquid waste of batik. Condong River quality state before and after the liquid waste of batik is heavily polluted.

Hubungan Kualitas Air Sumur dengan Kejadian Diare di Daerah Aliran Sungai (DAS Bengawan Solo

Directory of Open Access Journals (Sweden)

Saudin Yuniarno

2015-12-01

Full Text Available ABSTRACT Background: Water has a role as media of many infectious diseases. One of disease whisch is often transmitted through water is diarrhea. The quality of water consumed by the community must be fillfull for health. So, It becomes the important thing in preventing the incidence of diarrhea.  The aim of this research was to determine the relationship between the quality of well water and the incidence of diarrhea on the community living along the riverside area of Bengawan Solo. Method: This was an observational research using cross sectional design. The subjects of this research were 66 persons staying for each upstream and downstream of Bengawan Solo.The quality of well water was assessed based on the parameters for temperature, pH, Biochemical Oxygen Demand (BOD, total dissolved solid (TDS, and E. coli.  The occurrence of diarrhea was determined by interviewing. Data would be analyzed using chi-square test at 0,05 level of significance. Result: The result of this research showed that variables which had relationship (p-value<0,05 to the incidence of diarrhea were: education, income, distance of well to septictank and to river,  knowledge, attitude, practice, pH, BOD, TDS, and E. coli content.  Well water located on upstream area of Bengawan Solo containing E. coli. Person who had well water containing  E. coli  over standard had 0,17 of probability to suffer diarrhea.  The other one, well water located on downstream area of Bengawan Solo containing total dissolved solid.  Person who had well water containing E. coli and TDS over standard had 0,13 of probability to suffer diarrhea. Conclusion: well water containing E. coli is the main variable associated to the occurrence of diarrhea on upstream area of Bengawan. The content of E. coli and TDS are two variables associated to the occurrence of diarrhea on downstream area of Bengawan. Key words :   Quality of well water, Diarrhea  Incidence, community living on the riverside of Bengawan Solo.

Metode Tracer Test untuk Mencari Hubungan Antar Sistem Sungai Bawah Tanah Di Akuifer Karst

Directory of Open Access Journals (Sweden)

Harjito Harjito

2015-08-01

Full Text Available Problem yang umum dijumpai di kawasan karst adalah mengenai ketersediaan air, mengingat kondisi hidrologi kawasan karst yang berbeda dengan kawasan lain. Ditinjau dari sisi lain, masyarakat di sekitar kawasan rencana perluasan eksploitasi masih memanfaatkan mata air yang daerah tangkapannya berasal dari perbukitan batu gamping untuk memenuhi kebutuhan air domestik dan irigasi pertanian. Dengan demikian, perlu adanya penelitian hidrologi karst lebih lanjut terutama mengenai keberadaan sistem jaringan yang saling terhubung di dalam kawasan rencana perluasan eksploitasi dan sekitarnya. Studi ini diharapkan dapat menjadi pertimbangan terhadap kebijakan yang akan diambil sebagai upaya untuk dapat melakukan pengelolaan potensi tersebut sebaik-baiknya. Tracer test dilakukan sebagai bentuk follow-up dari survei gua dan sinkhole yang ada di sekitar area tambang. Tracer test dilakukan untuk mengetahui konektivitas aliran pada sistem gua berair dan mata air Cipintu. Berdasarkan hasil penelitian potensi debit air di Mata air Cipintu sebesar 18,55 liter/s dan mengindikasikan adanya konektivitas antara gua berair dengan Mata air Cipintu. Kata kunci : karst, hidrologi, tracer test, eksploitasi

Indonesian Traditional Migrant Worker Profile Cross-border Kelurahan Sungai Raya Kecamatan Meral Kabupaten Karimun

OpenAIRE

Razif, M.; ", Jumiati

2014-01-01

Indonesia is a developing country that is characterized by the development of cities in a fast tempo, this supported with high population growth and labor force. It also increases the demands of various jobs and so on. As experienced by the Karimun lack of jobs and the low level of wages / salary earned make them choose to work as Indonesian workers. Various types of job in other state including construction workers, farm workers, etc. Therefore, the problems in this research are: 1. How Tanj...

Kajian Kualitas Air Sungai Bedog Akibat Pembuangan Limbah Cair Sentra Industri Batik Desa Wijirejo

Directory of Open Access Journals (Sweden)

Widayati Indarsih

2016-10-01

ABSTRACT Bedog River that flows along Wijirejo Village, Pandak, in Bantul has been indicated to be polluted by varieties of liquid waste including batik industry. The objectives of this research are : to determine the quality of batik liquid waste; the quality of Bedog River water from physical aspects (temperature, TDS, TSS; chemical aspects (pH, COD, BOD, Cu, Cr+6; and biological aspect (plankton; to measure participation of stakeholder and also to develop a management strategy to manage batik liquid waste so that it does not pollute the environment.This research use survey method, data collected by purposive sampling. Water sample is directly taken from batik liquid waste and from the Bedog River with six observation station : S1 is the location before the waste disposal point, located around Pedak Bridge; S2 (+ 350 m next to S1,  S3 (+ 750 m next to S2, located at Pijenan Bridge, S4 (+ 400 m next to S3 and S5 (+ 250 m next to S4 is location that has been polluted by batik liquid waste, and S6 (+ 400 m next to S5 is an area that is no longer able to contain more additonal batik waste. Chemical, physical and biological data is carried on in direct measurement in the field and at laboratory. Participation data of stakeholder data is carried on interview method using questionare . Result analysis used in this research is qualitative descriptive.The result of this research shows that the quality of batik liquid waste has surpassed from the quality standard. The water quality at location S4 has been polluted shown by the COD point 28 mg/L (quality standard 25 mg/L and BOD point 4,8 mg/L (quality standard 3 mg/L. S4 is the location of which has highest density of batik industry. Both organic and inorganic materials inside batik liquid waste have increased COD and BOD of Bedog River. According to the plankton diversity index, the water of Bedog River has been polluted at S2, S3, S4 and S5 locations. S1 and S6 locations are not classified into the polluted area. Batik liquid waste gives accumulatively effects to chemical and physical river ecosystem character, thus it decreases plankton diversity index which live in it. The grade of local government stakeholder participation generally (57,14% at middle category. The environment management strategy can be done by : improving participation of batik crafter both  individually (by applying clean production and minimalizing waste and collectively (by building IPAL in cluster; improving participation of stakeholder; and choosing properly  technology of waste water treatment (IPAL.

PREDIKSI KEMUNGKINAN BPREDIKSI BANJIR SUNGAI CITARUM DENGAN LOGIKA FUZZY HASIL ALGORITMA PARTICLE SWARM OPTIMIZATION

Directory of Open Access Journals (Sweden)

Phitsa Mauliana

2016-09-01

Full Text Available Abstract The purpose of this paper is the prediction of the possibility of flooding using fuzzy logic results of data processing algorithms using particle swarm optimization (PSO. Flooding is the water level exceeds the normal stream. Usually on the face of water and erratic rainfall cause people cannot predict the occurrence of floods. It required an effort to predict the flood in order to minimize losses resulting from flooding. Particle swarm optimization algorithm can solve a system of nonlinear equations for predicting flooding is a non-linear data processing. Particle swarm optimization algorithm and sample used was rainfall and water level, the result is a flood prediction accuracy of 73% based on the resulting confusion matrix calculations. Implementation of fuzzy logic can help predict the likelihood of flooding around the Citarum River. Keywords: Prediction, Flood, Particle Swarm Optimization, Fuzzy Logic.

Pencirian Karbon Organik Air Sungai Citarum Hulu Dari Masukan Air Limbah Penduduk Dan Industri

OpenAIRE

Harsono, Eko; Nomosatryo, Sulung

2010-01-01

Characterisation of Organic Carbon of Up Stream Citarum River Water from Domestic andIndustrial Waste Effluent. The local government of Citarum upstream area has conducted theriver cleaning program to increase Disolved Oxygen since 1991 until now. The program hasimpacted to installments of to wastewater treatment for 80% industrials in the Upper Citarumdrainage area declining the load of BOD5 wastewater. However most of waste water comingfrom Banung population have been treated in the collect...

Flood inundation modeling and hazard mapping under uncertainty in the Sungai Johor basin, Malaysia

NARCIS (Netherlands)

Md. Ali, A.

2018-01-01

Flooding can have devastating impacts on people’s livelihood, economy and the environment. An important instrument in flood management is floodplain maps, which assist land planners and local authorities in identifying flood-prone areas, and provide useful information for rescue and relief agencies

Geology and Slope Stability Analysis using Markland Method on Road Segment of Piyungan – Patuk, Sleman and Gunungkidul Regencies, Yogyakarta Special Region, Indonesia

Directory of Open Access Journals (Sweden)

B. N. Kresna Citrabhuwana

2016-06-01

Full Text Available Road segment of Piyungan - Patuk is a part of Yogyakarta - Wonosari highway, fairly dense traversed by vehicles, from bicycles to buses and trucks. This road crosses hilly topography, causing its sides bounded by quite steep slopes or cliffs. Steep slopes and cliffs are potential to create mass movement. Geologic condition of the surrounding area is built of various volcanic lithology such as breccia, siltstone, sandstone and tuff. There are also geologic structures of joints and faults that affect the stability of the slopes around this road. Slope stability analysis for road segment of Piyungan – Patuk was conducted by applying Markland method. Laboratory testings were done to determine the mechanical and physical properties of rocks that influence the slope strength. Results of the testings show that cohesion and friction angle of volcanic breccia are c = 20.0441 kg/cm2 and  = 56.38˚; cohesion and friction angle of sandstone are cr = 0.6862 kg/cm2, cp = 4.6037 kg/cm2, r = 26.37˚, and p = 32.79˚; cohesion and friction angle of tuff is cr = 1.677 kg/cm2, cp = 7.5553 kg/cm2, r = 17.85˚, and p = 24.19˚. Based on the analysis, some slopes in the study area are potential to move. The movements can be classified into rock fall, debris fall, and rock slides with the sliding plane categorized as planar and wedge. On the other hand, landslide prone zones in the study area can be divided into: Areas with high vulnerability, Areas with moderate vulnerability, and Areas with low vulnerability. Areas prone to landslide should be managed by a series of measures, among others understand natural phenomena, recognizing symptoms of avalanche, attempting to reduce the risk, and land use regulation. The management activities should involve all stakeholders in an integrated manner of implementation.

Activity concentrations of 239+240 Pu in sediment at Sabah and Sarawak coastal areas

International Nuclear Information System (INIS)

Jalal Sharib; Zaharudin Ahmad; Yii Mei Wo; Hidayah Shahar

2009-01-01

The coastal sediment sampling was carried out in July 2004 as part of the Marine Radioactivity Database Development Project for Malaysia. The determination of plutonium, 239+240 Pu activity concentration and their distributions along the coastal areas of Sabah and Sarawak was by the alpha spectrometry counting system. Prior to counting, the radionuclides were isolated from the samples using radiochemical separation technique and mounted on a stainless steel disc by using electro-deposition. The results show that the distribution of 239+240 Pu activity concentration in coastal sediment is consistent, ranging from BDL - 1.83 Bq/kg and 0.11 - 0.84 Bq/kg dry weight, respectively. Lubok Sabanan, SB 15, in Sabah and Sungai Similajau, SR 13, in Sarawak were sampling stations that gave highest 239+240 Pu activity concentration. Overall, the 239+240 Pu activity concentration of Sabah and Sarawak are slightly higher in comparison the West Coast coastal stations of Peninsular Malaysia, and can be used as database. (Author)

Validity of Learning Module Natural Sciences Oriented Constructivism with the Contain of Character Education for Students of Class VIII at Yunior Hight School

Science.gov (United States)

Oktarina, K.; Lufri, L.; Chatri, M.

2018-04-01

Referring to primary data collected through observation and interview to natural science teachers and some students, it is found that there is no natural science teaching materials in the form of learning modules that can make learners learn independently, build their own knowledge, and construct good character in themselves. In order to address this problem, then it is developed natural science learning module oriented to constructivism with the contain of character education. The purpose of this study is to reconstruct valid module of natural science learning materials. This type of research is a development research using the Plomp model. The development phase of the Plomp model consists of 3 stages, namely 1) preliminary research phase, 2) development or prototyping phase, and 3) assessment phase. The result of the study shows that natural science learning module oriented to constructivism with the contain of character education for students class VIII of Yunior High School 11 Sungai Penuh is valid. In future work, practicality and effectiveness will be investigated.

Activities concentration of 239+240Pu in sediment in Sabah and Sarawak coastal area

International Nuclear Information System (INIS)

Jalal Sharib; Zaharudin Ahmad; Yii Mei Wo; Ahmad Sanadi Abu Bakar; Norfaizal Mohamed; Kamarozaman Ishak; Zulkifli Daud

2008-08-01

The determination of plutonium, 239+240 Pu activity concentration and their distributions along the coastal area of the Sabah and Sarawak have been performed using alpha spectrometry counting system. The sampling coastal sediment for this study was carried out in July 2004 as part of the Marine Radioactivity Database Development Project for Malaysia. This results show that the distribution of Plutonium, 239+240 Pu radionuclides in coastal sediment is consistent, their activities are depending on the sampling locations. Generally, the 239+240 Pu activities measured in Sabah and Sarawak coastal sediment are in the range of BDL - 1.83 Bq/kg and 0.11 - 0.841 Bq/kg dry weights, respectively. The sampling stations, Persisiran Lubok Sabanan, SB 15 and Sungai Similajau, SR 13 showed the highest plutonium, 239+240 Pu radionuclides isotopes activity in Sabah and Sarawak. Meanwhile, these two stations shows higher activity compare to West Coast of Peninsular of Malaysia station for the Marine Radioactivity Database Development Project for Malaysia. (Author)

Isolation of Acetyl Aleuritolic Acid from Pimeleodendron Griffithianum (Euphorbiaceae)

International Nuclear Information System (INIS)

Rosmawati Abdul Aziz; Norizan Ahmat; Rosmawati Abdul Aziz; Norizan Ahmat

2016-01-01

Pimeleodendron griffithianum, locally known as Perah ikan is available in Thailand, Peninsular Malaysia and Sumatra. The plant can be found in wet forest, secondary forest, pole forest, semi-swamps, and along logging roads or on hill slopes. In Malaysia, the stem of P. griffithianum being used as commercial timber. So far, no chemical constituents have been reported from P. griffithianum. In this study, a phytochemical study was conducted on the stem bark of P. griffithianum. The stem bark was obtained from Sungai Siput, Perak. The cleaned, chopped and dried stem-bark was extracted using acetone for several times. The separation of the components was carried out using vacuum liquid chromatography (VLC) followed by recrystallization method. The structure of the pure compound was elucidated by spectroscopic methods including nuclear magnetic resonance (NMR), ultraviolate - visible (UV-Vis) and comparison with literature. One compound (1) was isolated and identified as acetyl aleuritolic acid. This compound was reported for the first time from this plant. (author)

PENGGUNAAN BIOCATALYS ELECTROLYSIS DALAM PENURUNAN KONSENTRASI TOTAL SUSPENDED SOLID (TSS DAN CHEMICAL OXYGEN DEMAND (COD LIMBAH DOMESTIK

Directory of Open Access Journals (Sweden)

Wiharyanto Oktiawan

2016-09-01

Full Text Available Secara umum air limbah kegiatan rumah tangga (domestik dibuang langsung menuju badan air seperti sungai dan danau. Pengolahan limbah cair secara biologis (aerob sering menghasilkan lumpur dalam jumlah besar. Jumlah lumpur dapat dikurangi dengan pengolahan anaerob. Sistem bioelektrokimia merupakan salah satu terobosan teknologi yang memungkinkan untuk mengolah limbah sekaligus menghasilkan energi berupa gas metana. Penggunaan biocatalys electrolysis dapat mengatasi kelemahan proses anaerob secara konvensional dalam penurunan konsentrasi TSS dan COD limbah domestik salah satunya mampu menghasilkan gas H2 dari proses elektrolisis. Penambahan daya ekternal sebesar 6 volt mampu menyisihkan TSS sampai kadar 82 mg/l dari kadar semula 157 mg/l. Tegangan 12 volt mampu menurunkan kadar COD sampai 47,46 mg/l dari kadar awal 223 mg/l. Penyisihan TSS paling rendah pada waktu elektrolisis 15 menit dengan kadar 87 mg/l. Penambahan waktu elektrolisis sebanding dengan penurunan konsentrasi COD limbah domestik. Pada penelitian ini kualitas maupun kuantitas gas metana tidak diketahui secara jelas. Selain gas metan, produk fermentasi juga belum diketahui.

First report of the toxigenic Nitzschia navis-varingica (Bacillariophyceae) isolated from Tebrau Straits, Johor, Malaysia.

Science.gov (United States)

Suriyanti, S N P; Usup, Gires

2015-12-15

Screening of the occurrence of potentially toxic diatoms was carried out at two sites of cage cultures in Tebrau Straits, Johor. Phytoplankton samples from Sungai Pendas and Teluk Sengat were collected using a 20 μm mesh plankton net and salinity was recorded in-situ. Nitzschia and Pseudo-nitzschia cells were isolated and established into clonal cultures. All cultures were tested for domoic acid using HPLC-UV analysis and verified by LC-MS analysis. Three Nitzschia spp. and one Pseudo-nitzschia sp. were identified from these locations. Toxic and non-toxic strains of Nitzschia navis-varingica are found at the cage culture areas. Cellular toxin content in the toxic strain of N. navis-varingica is 1.8 pg cell(-1). This is a new record from Malaysia and this species was isolated from estuarine water with salinity 28 PSU. The discovery of toxic Nitzschia species in Tebrau Straits indicates the potential for domoic acid accumulation in seafood. Copyright © 2015 Elsevier Ltd. All rights reserved.

Analisis Laju Sedimen DAS Serayu Hulu dengan Menggunakan Model SWAT

Directory of Open Access Journals (Sweden)

Nugroho Christanto

2018-03-01

Full Text Available Wilayah DAS Serayu Hulu merupakan DAS prioritas yang memerlukan langkah pengelolaan yang komprehensif. Aplikasi model Soil and Water Assessment Tool (SWAT dapat digunakan sebagai media untuk  perencanaan konservasi ataupun evaluasi respon DAS (debit aliran permukaan, sedimen dan pencemaran sungai. Tujuan utama dari penelitian ini adalah menjalankan model SWAT di DAS Serayu Hulu untuk mengetahui laju sedimen di wilayah ini. Pemodelan SWAT membutuhkan sejumlah input parameter berupa relief, tanah, tutupan lahan dan pengelolaan lahan. Pedogeomorfologi digunakan sebagai batas satuan tanah karena tidak tersedianya peta tanah di wilayah penelitian. Hasil Penerapan model SWAT di DAS Serayu Hulu menghasilkan nilai yang cukup memuaskan, hal ini ditunjukkan nilai R2 mencapai 0,94. Hasil pemodelan SWAT dengan menggunakan data selama 10 tahun (2004-2013 menunjukkan bahwa DAS Serayu Hulu memiliki rerata hasil sedimen sebesar 1.926.900 ton/tahun. Sub DAS 8,9 11, 17, 18, dan 19 merupakan penghasil sedimen tertinggi di DAS Serayu Hulu dengan hasil sedimen 43.931– 121.434 ton/ha/tahun.

Carbon stores from a tropical seagrass meadow in the midst of anthropogenic disturbance.

Science.gov (United States)

Rozaimi, Mohammad; Fairoz, Mohammad; Hakimi, Tuan Mohamad; Hamdan, Nur Hidayah; Omar, Ramlan; Ali, Masni Mohd; Tahirin, Siti Aishah

2017-06-30

Seagrass meadows provide important carbon sequestration services but anthropogenic activities modify the natural ecosystem and inevitably lower carbon storage capacity. The tropical mixed-species meadows in the Sungai Pulai Estuary (Johor, Malaysia) are impacted by such activities. In this study, we provide baseline estimates for carbon stores analysed from sediment cores. In sediment depths up to 100cm, organic (OC) and inorganic carbon (IC) stores were 43-101MgCha -1 and 46-83MgCha -1 , respectively, and are in the lower end of global average values. The bulk of OC (53-98%) originated from seston suggesting that the meadows had low capacity to retain seagrass-derived organic matter. The species factor resulted in some variability in OC stores but did not appear to influence IC values. The low carbon stores in the meadow may be a direct result of sediment disturbances but natural biogeochemical processes are not discounted as possible causal factors. Copyright © 2017 Elsevier Ltd. All rights reserved.

PENDUGAAN EROSI DAN PERENCANAAN KONSERVASI TANAH DAN AIR PADA DAERAH ALIRAN SUNGAI OTAN KABUPATEN TABANAN

Directory of Open Access Journals (Sweden)

TATIEK KUSMAWATI

2012-11-01

Full Text Available Erosion Prediction and Planning of Soil Water Conservation at Otan Watershed, Tabanan Regency The aims of this research was to predict the erosion and planning of soil and water conservation when the erosion is more than tolerable erosion. The USLE (Universal Soil Loss Equation was used to predict erosion and planning of soil and water conservation. The result showed that the erosion level in this area was varied from very slight to very severe. The lowest erosion was on land unit 11 and 12 which were on the forest land. Slight erosion occurred on land units 2, 3, 4, 5, 10, 13, 18, 20, 22, 23, 25, 26, 28, 31, 32, 33, 34, 36, 37, 40, 41, and 43 on the use of forest land, irrigated fields, and mix crop land. Moderate erosion can be found at cocoa plantations, coffee plantations, scrub and dry land (land unit 1, 8, 16, 30, 38, dan 45. Severe and very severe erosion occurs at mixed crop land, coffee plantations, mixed crop and dry land (land unit 35 and 6, 7, 9, 14, 15, 17, 19, 21, 24, 27, 29, 39, 42, and 44 . The planning of soil and water conservation was focused on the very severe erosion by doing for some plant growing storied canopies, very high density, and constructed terrace for land unit of 6, 7, 14, 15 ,19, 21, 27, and, 29. While at land unit, 9, 17, 24, and 35 was purposed mixed estate crop with high density, it was combinated with mulch of 1 ton/ha and in land unit 39 were for traditional terrace with gogo rice and corn plant in rotation plantation.

PENDEKATAN EKOSISTEM UNTUK PENGELOLAAN SUMBERDAYA IKAN ARWANA IRIAN, Scleropages jardinii DI SUNGAI MARO, MERAUKE–PAPUA

Directory of Open Access Journals (Sweden)

Endi Setiadi Kartamihardja

2013-11-01

Resources Conservation, and Agent of Change (Researcher of the Agency for Fisheries and Marine Research. Management measures which should be implemented are: quota of Saratoga juvenile of Maro River was 112,000 individuals per spawning season; establishment of conservation area for spawning and nursery of Saratoga by allocated a part of center exploited area and there closed for fishing at Saratoga spawning season; collected and reported of the number of Saratoga fry by the fishers and whole sellers; development of co-management and ecosystem approach to Saratoga fisheries which should be based on environmental, biological, social and economic indicators.

Pencemaran air raksa (Hg sebagai dampak pengolahan bijih emas di Sungai Ciliunggunung, Waluran, Kabupaten Sukabumi

Directory of Open Access Journals (Sweden)

Widodo Widodo

2014-06-01

Full Text Available http://dx.doi.org/10.17014/ijog.vol3no3.20083Gold ore mining at Waluran Subregency, Sukabumi Regency was carried out by an underground mining method, and only rock that contains high enough gold ore would be taken (selective mining. The gold ore from the mining was processed with a direct amalgamation method, so it produced low gold concentrate, but the concentrate of mercury discarded to the river was high enough. Monitoring result of water and sedimentation in Ciliunggunung River in 2004, showed that the river was contamined by mercury (Hg, and the contamination was above the value limit. This happened especially in August 2005 where the Hg content was about 0.218 mg/l on the Ciliunggunung River in CLG.07. The chemical analysis result of heavy metals for the water of the Ciliunggunung River in CLG.07 was known to contain Fe above the standard drinking water criteria, meanwhile Mn, Cu, Pb, and As were still under the maximum drinking water criteria value. To decrease the mercury contamination, it is suggested the process of gold ore from the amalgamation direct method to be changed to the amalgamation indirect method. The indirect gold ore amalgamation process consists of: removing fine particles by washing, grinding ore, and the amalgamation phase. The total impact of the indirect amalgamation method will increase the tying of gold by mercury, so the losing of mercury will be decreased and the gain of gold will be optimum.  

POROSITAS DAN PERMEABILITAS KOMPOSIT BERPORI DENGAN BAHAN DASAR LIMBAH KACA (CULT

Directory of Open Access Journals (Sweden)

MI Savitri

2014-11-01

Full Text Available Komposit berpori dengan bahan dasar limbah kaca dan Polyethylen Glycol  (PEG telah dihasilkan dengan metode pencampuran sederhana. Pori pada komposit terbentuk akibat PEG yang menguap ketika dipanaskan pada temperature 700oC selama 2,5 jam. Variasi pori dihasilkan dengan mengatur komposisi PEG yaitu 2%, 3%, 4%, 5%, 6%, 7%, 8%, dan 9%. Komposit berpori memiliki nilai porositas yang bertambah dengan kenaikan komposisi PEG. Komposit berpori memiliki porositas pada rentang 1% hingga 5% dan nilai permeabilitas komposit berpori yaitu (0.3-25x10-15 m2. Potensi komposit berpori sebagai filter air diujicobakan dengan mengalirkan limbah air sungai. Hasil pengujian diperoleh air dengan sifat fisis air bening dan tidak berbau, sehingga komposit berpori dari limbah kaca dapat menyaring air limbah.  {0>Komposit berpori dengan bahan dasar limbah kaca dan Polyethylen Glicol (PEG telah dihasilkan dengan metode pencampuran sederhana.<}0{>Porous composites from waste glass and Polyethylene Glycol (PEG have been synthesized by a simple mixing method.<0} {0>Pori pada komposit terbentuk akibat PEG yang menguap ketika dipanaskan pada temperature 700oC selama 2,5 jam.Variasi pori dihasilkan dengan mengatur komposisi PEG yaitu 2%, 3%, 4%, 5%, 6%, 7%, 8%, dan 9%.Komposit berpori memiliki nilai porositas yang bertambah dengan kenaikan komposisi PEG.<}0{>The pores of the composite were formed due to the evaporation of PEG when heated at temperature of 700oC for 2.5 hours. The pore variation may be obtained by adjusting the PEG composition, i.e. 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, and 9%. The porous composites have higher porosity because of the PEG composition.<0} {0>Komposit berpori memiliki porositas pada rentang 1% hingga 5% dan nilai permeabilitas komposit berpori yaitu (0.3-25x10-15m2.Potensi komposit berpori sebagai filter air diujicobakan dengan mengalirkan limbah air sungai.<}0{>Mesoporous composites have porosity ranging from 1% to 5% and the permeability has value

Swamp Buffalo in South Kalimantan : Problem, Disease and Control

Directory of Open Access Journals (Sweden)

Lily Natalia

2006-12-01

Full Text Available In recent years, several studies have been carried out to evaluate and investigate the important diseases of swamp buffaloes (Bubalus carabanensis in Kalimantan . More attention has been focused on the case of acute infectious diseases and sudden death in the buffaloes . Fasciolosis black disease, acute enteritis, especially fatal enterotoxaemia haemorrhagic septicaemia . and trypanosomiasis (Surra, are some of the important diseases found in these animals . Black disease caused by toxigenic Clostridium novyi occurs in the presence of the organism in the liver and the degree of liver fluke Fasciola gigantica infestation . In regions where black disease is enzootic, Cl. novvi can be isolated from livers of normal healthy animals . In Hulu Sungai Utara district, South Kalimantan, the prevalence of fasciolosis caused by Fasciola gigantica in swamp buffalo was 77% in 1991 . A gross sudden change in diet due to seasonal changes could induce rumen and intestinal stasis, which provide a favourable environment for the rapid proliferation of commensal toxigenic Clostridium perfringens in the small intestine . Subsequent absorption of the toxin produced through the gut wall and its generalized dissemination culminated in a fatal enterotoxaemia . Haemorrhagic septicaemia (HS is an acute, fatal disease affecting swamp buffalo, and caused by Pasteurella multocida B : 2 . The swamp buffalo is particularly susceptible for HS, and the reported greatest losses of swamp buffalo in Kalimantan due to HS is recorded in 1980s. The clinical signs of Surra in swamp buffalo were also found in certain areas in Danau Panggang area . Hulu Sungai Utara district . Vaccination is the accepted method for controlling Black disease, enterotoxaemia and HS. Multi component vaccine, alum adjuvant containing at least 5 types of clostridial toxoids and P. multocida B2 bacterin have been used and provide good protection to the animals . Control and treatment of liver fluke infestation

APLIKASI DATA CITRA SATELIT LANDSAT UNTUK PEMANTAUAN DINAMIKA PESISIR MUARA DAS BARITO DAN SEKITARNYA

Directory of Open Access Journals (Sweden)

Abdur Rahman

2016-06-01

Full Text Available Telah terjadi terjadi kerusakan habitat lingkungan mangrove, abrasi dan akresi yang menyebabkan semakin tingginya muka air  di sepanjang DAS Sungai Barito (DAS Martapura, DAS Alalak dan DAS Kuin, sebab erjadinya proses abrasi dan akresi  yang terjadi di sepanjang garis pantai, terutama DAS Martapura, DAS Alalak dan DAS Kuin. Klasifikasi pemanfaatan lahan dan konversinya serta perubahan pesisir berupa akresi dan abrasi di sepanjang pantai area penelitian di analisis dengan memanfaatkan informasi dari data citra satelit Landsat multi temporal yang di peroleh pada tanggal 29 Juni tahun 1985, dan 03 September 2006. Dominasi pemanfaatan lahan berupa HPH, pertambangan dan pemukiman dengan konversi lahan pada hutan untuk pemanfaatan lain memberikan dampak erosi yang cukup besar dengan ditunjukannya wilayah pesisir yang mengalami peningkatan akresi terutama pada bagian muara sungai (delta. Tren perubahan yang terlihat pada kawasan pesisir di area penelitian selama 21 tahun adalah abrasi sebesar 294,55 m2 di daerah Muara S. Martapura, 75,53 m2 di sekitar muara S. Alalak. Dan perubahan Abrasi sebesar 177,42 m2 , dan akresi sebesar 610,86 m2 di sekitar Muara S. Barito/Kuin. Have happened happened damage of environmental habitat of mangrove, and abrasi of akresi causing its excelsior of face irrigate alongside DAS River of Barito (DAS Martapura, DAS Alalak and of DAS Kuin, because the happening of process of abrasi and of akresi that happened alongside coastline, especially DAS Martapura, DAS Alalak and  DAS Kuin. Classification exploiting of farm and its conversion and also change of coastal area in the form of and akresi of abrasi alongside research area coast in analysis by exploiting information of satellite image data of Landsat temporal multi which in obtaining on 29 June year 1985, and 03 September 2006. Domination exploiting of farm in the form of HPH, settlement and mining with farm conversion at forest for other exploiting give big enough

Potensi Kayu Perkakas dan Kayu Bakar Jenis Jati (Tectona grandis di Hutan Rakyat Desa Natah, Gunung Kidul

Directory of Open Access Journals (Sweden)

Ris Hadi Purwanto

2009-07-01

Full Text Available Potentials  of Merchantable Timber and Firewod of Teak (Tectona grandis in Natah Village Community Forest , Gunungkidul The potential of merchantable timber and firewod of teak (Tectona grandis in Desa Natah community forest was estimated by developing allometric equations method. To establish the allometric equation 350 sample trees were measured to determine the relationships between tree height (H and diameter breast height (D. Thirty trees of various sizes were cut to measure the merchantable timber and firewood volume. The raw merchantable timber volume of teak in the community forest was defined as the ligneous material contained in the bole and branches which both with a diameter of at least 10cm. The result showed that D (taken at about 1.3m above the ground was a good predictor of H with r2 over 0.9672. When D was combined with H, r2 was improved somewhat for the merchantable timber volume, suggesting the growth patterns of tree dimensions were colesy interdependent. A standing stock of the merchantable timber and firewood volume of teak in the community forest was then estimated based on the allometric relations. Proportions of the merchantable timber and firewood volume were 66.91% and 33.09% of total wood volume per tree, respectively. The potential of merchantable timber and firewood volume in these community forest were 13.501 m3/ha and 8.686 m3/ha, respectively, with a basal area of 1.887 m2/ha. Based on the basal area, Desa Natah community forests of teak could be classified into extremely sparse of stands category.

PENGEMBANGAN SUBJECT SPESIFIC PEDAGOGY TEMATIK UNTUK MENINGKATKAN KEJUJURAN DAN KEDISIPLINAN SISWA KELAS I SD

Directory of Open Access Journals (Sweden)

Paimun Paimun

2014-07-01

_________________________________________________________________________________________________________________________________________________________________________________________________________________________________ DEVELOPING THEMATIC SUBJECT-SPECIFIC PEDAGOGY TO IMPROVE GRADE I STUDENTS’ HONESTY AND DISCIPLINE ABSTRACT This study aims to produce integrated learning kits in the form of thematic Subject-Specific Pedagogy (SSP capable of improving the characters of Grade I students of the elementary school, especially those of honesty and discipline. This was a research and development (R & D study consisting of nine stages, namely: (1 preliminary study and data collection, (2 planning, (3 product draft development, (4 preliminary field tryout, (5 revision of the tryout result, (6 field tryout, (7 product finalization based the field tryout result, (8 field implementation testing, and (9 final product finalization. The tryout subjects were Grade I students of SDN Wonosari I Gunungkidul, Yogyakarta. The one-to-one tryout subjects consisted of three students. The small-group tryout subjects consisted of ten students who were not involved in the one-to-one tryout. The field tryout subjects consisted of 47 students from Grade I B and Grade I C.The result of the study is in the form of SSP consisting of a syllabus, lesson plans, student worksheets, and assessment instruments. The results of the evaluation show that the developed syllabus is good. The developed lesson plans are very good, the developed student worksheets are very good, the developed assessment instruments are very good, and the developed learning media are good. Therefore, it can be concluded that the developed SSP is in the good and very good categories to improve students’ characters. The students’ average affective learning outcomes are 99.50 for honesty and 98.66 for discipline. Keywords: development, SSP, thematic, characters

PERENCANAAN PENGGUNAAN LAHAN KOMODITAS UNGGULAN PERKEBUNAN DI KABUPATEN TANAH DATAR

Directory of Open Access Journals (Sweden)

Astriana Rahmi Setiawati

2016-08-01

Full Text Available Tanah Datar is one of regency in West Sumatera that has a great potential in agriculture, which is more than 70% of  its population are farmers. Unfortunately, the economic income of this regency is lowest than another regency in West Sumatera. This research aimed: (1 to identify superior estate comodities of Tanah Datar Regency; (2 to identify present land use of Tanah Datar Regency; (3 to analyze land availability and to evaluate land suitability of superior estate commodities; (4 to arrange the direction of superior estate commodities development. Land  suitability  evaluation was  done  by  using the matching method  between land characteristics and crops requirement. The study showed that the available land for development of  superior comodities is about 38.210 ha which is suitable for robusta coffee (X koto; nutmeg (Batipuh; cocoa (Batipuh selatan, Rambatan, Limo kaum, Tanjung emas, and Lintau buo utara; rubber (Padang gantiang; cassievera (Pariangan and Salimpauang; vanilla (Sungai tarap; and arabica coffee (Salimpauang, respectively.

Tape seagrass (Enhalus acoroides) as a bioindicator of trace metal contamination in Merambong shoal, Johor Strait, Malaysia.

Science.gov (United States)

Sidi, Nordiani; Aris, Ahmad Zaharin; Mohamat Yusuff, Ferdaus; Looi, Ley Juen; Mokhtar, Nor Farhanna

2018-01-01

Revealing the potential of seagrass as a bioindicator for metal pollution is important for assessing marine ecosystem health. Trace metal ( 111 Cd, 63 Cu, 60 Ni, 208 Pb, 66 Zn) concentrations in the various parts (root, rhizome, and blade) of tape seagrass (Enhalus acoroides) collected from Merambong shoal of Sungai Pulai estuary, Johor Strait, Malaysia were acid-extracted using a microwave digester and analysed via inductively coupled plasma-mass spectrometry (ICP-MS). The ranges of trace metal concentrations (in μgg -1 dry weight) were as follows: Cd (0.05-0.81), Cu (1.62-27.85), Ni (1.89-9.35), Pb (0.69-4.16), and Zn (3.44-35.98). The translocation factor revealed that E. acoroides is a hyperaccumulator plant, as its blades can accumulate high concentrations of Cd, Cu, Ni, and Zn, but not Pb. The plant limits Pb mobility to minimize Pb's toxic impact. Thus, E. acoroides is a potential bioindicator of metal pollution by Cd, Cu, Ni, and Zn in estuarine environments. Copyright © 2017 Elsevier Ltd. All rights reserved.

IMPROVING LISTENING SKILL TO FAIRYTALES USING A HAND PUPPETS MEDIA

Directory of Open Access Journals (Sweden)

Desy Sugianto

2017-05-01

Full Text Available The purpose of this research was to describe the increase the ability of listening to fairy tales using hand puppets media in grade III State Elementary School 16 Sungai Ringin Sintang year 2016/2017. The approach of this study was a qualitative descriptive form of classroom action research. The result showed that (1 the puppets media enhanced students’ listening skills very well, seen from students’ active and enthusiastic participation; (2 the listening skill in the first cycle gained the average of 63.78 and reached 72.42 in cycle two. This showed an increase of learning outcome from the first to the second cycle of 8.64 points. The general completeness level in the first cycle was 60.71% with satisfactory categories and in the second cycle reached 85.71% in both categories; (3 The response of students to the application of a hand puppet media was very good. This shows that the use of hand puppets media while listening to fairy tales is a way that can attract students’ attention.

ANALISIS USAHA MIKRO, KECIL DAN MENENGAH PENGOLAHAN KERUPUK IKAN GABUS DI KABUPATEN BANJAR

Directory of Open Access Journals (Sweden)

Yarna Hasiani

2017-05-01

Full Text Available This study aims to (1 analyze the performance of technology processing business cracker cork fish in Banjar district; and (2 analyze the factors that affect  revenue processing business cracker cork fish in Banjar district. The research was conducted in the village of Sungai Alang, Karang Intan Subdistrict, Banjar District, as one of the villages located Groups Processors and Marketers (poklahsar fish crackers cork in Banjar Regency, with the object of research the processing of fish cracker cork incorporated in poklahsar fish cracker cork. The results showed that the performance of technology,  processing business  cork fish crackers develops well, after the processors belonging to the group processors and marketers (poklahsar, which is characterized by increasing the quantity and quality of production. Operating revenues fish cracker processing real cork influenced by the volume of fish that is processed, the amount of the loan capital and business scale, where the regression coefficient of each variable with the probability of positive-value <0.01 or valid at test level of 99%.

Subsurface Investigation using 2D Resistivity and Ground Penetrating Radar at Teluk Kumbar, Penang

Science.gov (United States)

Teoh, YJ; Bruka, MA; Idris, NM; Ismail, NA; Muztaza, NM

2018-04-01

The objective of this study is to determine the structure and condition of the subsurface by using 2D resistivity and Ground Penetrating Radar (GPR) methods. The study was conducted at SK Sungai Batu, Teluk Kumbar, Penang Island. For 2D resistivity method, Wenner-Schlumberger array was used while for GPR, 250 MHz antenna was used at the site. The survey consists of 200m length survey line. GPR result shows that there is high intensity of EM. 2D resistivity result shows that the low resistivity region (200 Ωm to 340 Ωm) appears to be at the centre of the survey line from depth 7 m to 13 m. Meanwhile, the higher resistivity region (4000 Ωm to 6000 Ωm) may indicate the bedrock structure of the subsurface, which is the granitic rock. This region is bedrock which rested at depth 14 m and below. In conclusion, data obtained from GPR and 2D resistivity methods can be easily correlated to determine the features of the subsurface.

LINGKUNGAN KELUARGA SEBAGAI SUMBER STIMULASI UTAMA UNTUK PERKEMBANGAN KOGNITIF ANAK USIA PRASEKOLAH

Directory of Open Access Journals (Sweden)

Elmanora .

2017-08-01

Full Text Available This study aimed to analyze the influence of child characteristic, family characteristics, quality of home environment, and quality of preschool education on child's cognitive development in Sungai Penuh City, Jambi Province. The samples were 120 children who are attending formal (formal group and nonformal (nonformal group preschool education and her/his mother that were selected by stratified random sampling. The samples chose from eightpreschool education (four formal and four nonformal. Data collected by interview and observation. Data analysis used descriptive analysis, independent samples t-test, and path analysis.Formal group families had higher mother’s education, family income, and the quality of home environment than nonformal group families. The quality of formal preschool education also better than the quality of nonformal preschool education. The preschool children’s cognitive development was influenced by the child's age, maternal education, family income, quality of home environment, the type of preschool education, and quality of preschool education. Stimulation from family environment had stronger effect on child's cognitive development than stimulation from school environment

Evaluation of stream discharges measurement using radioisotope and conventional method at Sungai Weng catchment area, Kedah

International Nuclear Information System (INIS)

Nazrul Hizam Yusoff and Wan Zakaria Wan MuhdTahir

2006-01-01

A number of discharge measurements using radioisotope and current metering techniques at selected streams in Sg. Weng Experimental Catchment were conducted by MINT and JPS gauging teams starting from 2003-2005. This study aims to prepare stage-discharge relationships or rating curves of the selected streams during variable flow conditions. The rating curve of the stream is one of the important parameters and usually appraised in certain routine operations of hydrological studies. It may be used in the planning of water resources management and flood control scheme. The radioisotope method employed in this study involved the injection of short-lived radioisotope tracer, that is, technetium-99m ( 99m Tc having its half-life ∼ 6.023 hrs) which was supplied from a high activity technetium generator (55.5 Gbq). Measurement of stream discharges were concurrently undertaken by JPS staff using a current meter type 0TT-C2 mounted on a wading rod at selected gauging stations for comparison purposes. Methodologies from the two methods of discharge measurements, comparison of results and identifying the uncertainties (errors) in performing the measurement during low, medium and high turbulent flows were explained in this paper. Generally, the entire results of streamflow data (2003-2005) measured by both methods during low flows (Q 3 /s) exhibit almost comparable values to each other. However, for moderate flows (1.0 m 3 /s 3 /s), the different in gauging results are slightly higher using radioisotope method ( i.e. Q isotope > Q current meter and may goes up to 40%) , and during high turbulent flows (Q>6.0 m 3 /s) the radioisotope method presented more than 40% higher discharge values as compared to the measurement made by the conventional current-meter. Observation made on site anticipated that inaccurate gauging data measured by conventional means during high flow and turbulent conditions are expected. The average estimated measurement error associated with isotope method is within ± 2 % of the discharge value. In conclusion, streamflow measurement by radioisotope method is considered capable in providing meaningful data or supplementary and complementary to the conventional means as normally measured by the routine gauging team, and should be incorporated in the DID future planning programme of the basin water resources studies. Despite having certain advantages over conventional means which can be offered by the radioisotope method, this technique is not yet ready to replace conventional current-meter for routine use in stream gauging work. (Author)

ANALISIS KUALITAS PERAIRAN SUNGAI RAMAN DESA PUJODADI TRIMURJO SEBAGAI SUMBER BELAJAR BIOLOGI SMA PADA MATERI EKOSISTEM

Directory of Open Access Journals (Sweden)

Agus Sutanto

2015-06-01

Full Text Available River is one of fresh water ecosystem which is very important in human life since it is the most practical and economical source in fulfilling domestic and industrial needs. Therefore, it should meet the quality standards. The research objectives were: 1 knowing the quality of waterway in Raman River, Pujodadi, Trimurjo, based on the physical, chemical and biological aspects; 2 turning the information intoa Biology learning source on Ecosystem subject. The data were directly observed in the river by measuring the physical factors (temperature, stream, turbidity; chemical factors (pH, DO; and biological factor (macro invertebrates. The results were: temperature 24-29oC ; stream 0.3 – 0.6 mm/s; turbidity 33.5-3.7 NTU; pH 4.1-5.2; and DO 2.07-2.35 ml/I. Furthermore, micro vertebrates found were; a Plecoptra; b Tricoptra; c Mollusca, d Ephemeroptra; and e Hemiptra. In each station, they were classified as insects and non-insects. The insects found were: 1 Odonata; 2 Tricoptra; 3 Ephemeroptra; 4 Plecoptra. Based on those parameters, the waterway quality was qualified as light wasted. The results can be turned into student worksheet as a Biology learning source, especially on Ecosystem subject.

Evaluasi Ekonomi Kawasan Tambak dan Mangrove Pasca Bencana Lumpur di Muara Sungai Porongkabupaten Sidoarjo Jawa Timur

Directory of Open Access Journals (Sweden)

Taufik Hidayatullah

2016-11-01

  ABSTRACT Mangrove ecosystem and aquaculture in estuaries Delta Porong Jabon sub-district are at risk for experiencing pollution brought by the flooding caused by the disposal Sidoarjo Mud-vulcano. This study aim to identify coastal flooding of  contaminated Sidoarjo Mud-vulcano around the mouth of the River Porong and estimate the economic value of fish-ponds and mangrove areas in the district of Sidoarjo regency Jabon. The method used to identify the inundation flooding using flood models using elevation data RBI converted into DEM data and information obtained from the highest tides in the community to apply in the flood inundation model. Land cover information was extracted from Landsat and Geoeye image through on-screen digitizing. Estimated farm economy is based on the business value of aquaculture, especially shrimp and milkfish, while the economic value of mangrove based on benefit transfer method. The results based on the model showed a decrease of productive fish-pond from 5,010.49 Ha to 4,473.05 Ha (60 cm inundation scenario and 1,630.82 Ha (80 cm inundation scenario. The effect will decrease the estimated economic value of the fish pond, from Rp 299,126,432,100,- to Rp 126,139,981,800 and Rp 45,989,124,000,-. Meanwhile the mangrove forests area have increased from 374,58 ha to 571.30 Ha based on the interpretation of land cover and it will increase the estimated economic value of mangrove from Rp 35,769,530,456.28,- to Rp 54,554,597,711.07,-

Pencemaran merkuri di perairan dan karakteristiknya: suatu kajian kepustakaan ringkas

Directory of Open Access Journals (Sweden)

M. Adlim

2016-05-01

Full Text Available Abstract. The issue of mercury pollution in Aceh waters, Indonesiadue to gold mining activities hasbeen a polemic in local media and Aceh Local Government and the communities have much concern on this case. The impact of mercury pollution in the Teunom and Tangse (Acehrivers was often assumed that it has similarity with Minamatapollution in Japan. This article intends to enlighten the characteristic mercury either as elements or compounds including methyl mercury which is highly toxic. Gold mining using elemental mercury is poorly soluble in water, the solubility is only 0.06 g per ton of mercury but the solubility can increase indark the sea-bed and ina lot of dissolved oxygen. Based on the properties of solubility, it is understood that the mercury levels in the Teunom and Tangse rivers still below the tolerance limit, but the gold mining activities still bringsthe risk of environmental damage especially inadequate supervision. Many researchers were trying to prove the natural conversionfrom mercury into methyl mercury (biomethylation but they usedthe salt instead of the elemental mercury in their experiments. Methyl mercury is found in nature, but the process mercury conversion into methyl mercury compound is still controversial and it has not obtained adequate evidence for the natural alteration,therefore gold pollution which is due to releasing elemental mercury into environment might not be analogue to Minamata case. Keywords: Aceh; Methyl-mercury; Minamata; Mining; Gold   Abstrak. Informasi pencemaran merkuri di perairan Aceh dan kaitannya dengan aktivitas pertambangan emas telah menjadi polemik sehingga menjadi perhatian Pemda Aceh dan Masyarakat. Dampak pencemaran merkuri di Sungai Teunom dan Tangse sering dianalogikan dengan kasus pencemaran merkuri di teluk Minamata, Jepang. Artikel ini bermaksud memberi pencerahan kharakteristik merkuri baik sebagai unsur maupun sebagai senyawa seperti metil merkuri yang sangat beracun. Penambangan

Kinerja Pembangunan Daerah Kabupaten/Kota di Provinsi Jambi

Directory of Open Access Journals (Sweden)

Raina Damarsari

2015-03-01

Full Text Available Abstrak Penelitian ini bertujuan untuk: (1 menganalisis peringkat kinerja pembangunan antar kabupaten/kota di Provinsi Jambi, dan (2 mengkategorikan kabupaten/kota di Provinsi Jambi berdasarkan kinerja pembangunan ekonomi, sumber daya manusia, dan infrastruktur. Data yang digunakan dalam penelitian ini adalah data sekunder dari 2009-2012 dari Badan Pusat Statistik, terdiri dari delapan indikator untuk menilai kinerja pembangunan ekonomi, lima indikator untuk menilai kinerja pembangunan sumber daya manusia, dan delapan indikator untuk menilai kinerja pembangunan infrastruktur. Metode analisis untuk mencapai tujuan pertama adalah analisis komponen utama (PCA dan analisis faktor serta untuk tujuan ketiga adalah analisis kluster. Hasil penelitian menunjukkan bahwa (1 Kota Jambi menempati peringkat pertama dalam kinerja pembangunan secara keseluruhan, diikuti oleh dari Tanjab Barat dan Kabupaten Batang Hari, (2 Empat kelompok kabupaten/kota di Provinsi Jambi terbentuk berdasarkan kinerja pembangunan, yaitu: cluster I (Kerinci, Merangin, dan Tebo memiliki kinerja yang pembangunan daerah paling rendah, klaster II (Tanjab Timur memiliki kinerja pembangunan di atas rata-rata, klaster III (Sarolangun, Batang Hari, Muaro Jambi, Tanjab Barat, Bungo Kabupaten, dan Kota Sungai Penuh memiliki kinerja pembangunan rata-rata (menengah, dan kelompok IV ( Kota Jambi memiliki kinerja pembangunan paling tinggi. Kata kunci : Analisis Faktor, Analisis Klaster, Pembangunan Ekonomi, Sumberdaya Manusia, Infrastruktur.   Abstract This study aims (1 to analyze the performances among regencies/ cities in Jambi Province, and (2 to categorize the regencies/ cities in Jambi Province based on economic, human resources, and infrastructure development performances. Datas used in this study are secondary data of 2009-2012 from Statistics Indonesia, consists of eight component indicators to assess the performance of economic development, the five component indicators to assess the

Studi Kasus; “Koreksi terhadap Pengukuran Polutan di Udara Unit Perajin Logam dan Dampaknya terhadap Kesehatan”

Directory of Open Access Journals (Sweden)

Husaini Husaini

2016-09-01

Full Text Available AbstractUnderstanding on the reaction of various air pollutants until today continues to grow, even it is hard to find information about the results of the reaction of various air pollutants standard. The aim of the research was to analyze and to correct of the the various air pollutants as well as to determine the health impact of blacksmith in 2014. The samples consisted of 38 blacksmith from 38 working units in Hulu Sungai Selatan of South Kalimantan. Analytical approach of the examination of air pollutants, blood samples and pulmonary functions of selected workers was applied in this study. The results showed a decrease in lung function and abnormalization workers immune response, as a result of exposure to various air pollutants. It is very difficult to determine and predict the causality of air pollution and health impact since there must be various factors contributing to the the health impact. because it is caused by pollutants singly or may be caused from the various reactions of these pollutants, for that, the correction need on the measurement and analysis of air pollutants that made so far, including its impact on the human body. The benefit of this research as a form of correction to use the Threshold Limit Value (TLV and measurement of air pollutants, including the impact of the target organ in the human body.Keywords : Measurements correction, pollutants, lung function, immune response.AbstrakPemahaman reaksi berbagai polutan di udara sampai saat ini terus berkembang, bahkan hampir tidak ditemukan informasi tentang standar hasil reaksi berbagai polutan di udara. Tujuan penelitian untuk menganalisis dan koreksi pengukuran berbagai polutan di udara serta dampaknya terhadap kesehatan perajin logam. Studi kasus dilakukan pada 38 perajin logam serta 38 unit kerjanya di Kabupaten Hulu Sungai Selatan Kalimantan Selatan tahun 2013 dengan pendekatan observational analitik beserta pengambilan contoh polutan di udara dan pengambilan sampel

Accretion rate in mangroves sediment at Sungai Miang, Pahang, Malaysia: 230Thexcess versus artificial horizon marker method

International Nuclear Information System (INIS)

Kamaruzzaman Yunus; Jamil Tajam; Hasrizal Shaari; Noor Azhar Mohd Shazili; Misbahul Mohd Amin

2008-01-01

Mangroves have enormous ecological value and one of their important role is to act as an efficient sediment trappers which dominantly supplied by rivers and the atmosphere to the oceans. Applying the 230 Th excess method, an average accretion rate of 0.54 cm yr -1 was obtained. this is comparable to that of an artificial horizon marker method giving an average of 0.54 cm yr -1 . The 230 Th excess method provides a rapid and simple method of evaluating 230 Th excess accumulation histories in sediment cores. Sample preparation is also significantly simplified, thus providing a relatively quick and easy method for the determination of the accretion rate in mangrove area. (author)

Application of environmental Cs-137 techniques to problems of sediment redistribution Sungai Lui Representative Basin, Selangor, Malaysia

International Nuclear Information System (INIS)

Daud bin Mohamad; Moo Siew Pheng.

1980-10-01

Secondary standard dosimetry laboratory (UPDK), Nuclear Energy Unit, is well equipped with all necessary irradiation facilities and radiation measuring devices. The establishment of the Laboratory is partly aimed at giving calibration services for all kinds of dosemeters, personnel radiation monitoring by using film badges and TLD etc. In running the above services, safe and correct handling procedures of the mentioned facilities and devices are necessary. Furthermore, the accuracy of measurements is of great importance. This report outlined the procedures of handling the equipment, of performing experimental works as well as of getting the mentioned services from UPDK. This report is referred as a guide containing all the standard procedures aiming at a safety operation of radiation and electrical devices and finally to achieve a high degree of dosimetric accuracies. (author)

Studi Aspek Reproduksi Ikan Baung (Mystus nemurus Cuvier Vallenciennes) Di Sungai Bingai Kota Binjai Provinsi Sumatera Utara

OpenAIRE

Manurung, Vindy Rilani

2014-01-01

VINDY RILANI MANURUNG: The Studied of Fish Reproduction Baung (Mystus nemurus Cuvier Vallenciennes) in Bigai’s River Binjai City North Sumatera Province. Under direction of YUNASFI and DESRITA. The researcher was conducted in the Bingai’s river at Binjai North Sumatera which was held in March to May 2013 at the three different locations points and using sensus metode. The total of baung’s fish (Mystus nemurus C.V) obtained was 29 tails consist of 26 females and 3 males with unbalanced sex ...

TRMM Satellite Algorithm Estimates to Represent the Spatial Distribution of Rainstorms

Directory of Open Access Journals (Sweden)

Patrick Marina

2017-01-01

Full Text Available On-site measurements from rain gauge provide important information for the design, construction, and operation of water resources engineering projects, groundwater potentials, and the water supply and irrigation systems. A dense gauging network is needed to accurately characterize the variation of rainfall over a region, unfitting for conditions with limited networks, such as in Sarawak, Malaysia. Hence, satellite-based algorithm estimates are introduced as an innovative solution to these challenges. With accessibility to dataset retrievals from public domain websites, it has become a useful source to measure rainfall for a wider coverage area at finer temporal resolution. This paper aims to investigate the rainfall estimates prepared by Tropical Rainfall Measuring Mission (TRMM to explain whether it is suitable to represent the distribution of extreme rainfall in Sungai Sarawak Basin. Based on the findings, more uniform correlations for the investigated storms can be observed for low to medium altitude (>40 MASL. It is found for the investigated events of Jan 05-11, 2009: the normalized root mean square error (NRMSE = 36.7 %; and good correlation (CC = 0.9. These findings suggest that satellite algorithm estimations from TRMM are suitable to represent the spatial distribution of extreme rainfall.

Physico-Chemical Properties of Personal Care Products Containing Guava Scrub Granules as Exfoliating Agent

International Nuclear Information System (INIS)

Zahariah Ismail; Mohd Fadlly Jumadi; Nurdiyana Mohamed Johari

2015-01-01

Treated guava scrub granules (GSG) as an exfoliating agent were obtained from the decanter waste at Sime Darby Food and Beverages, Sungai Wangi, Perak (SDFB). The treated GSG and tocotrienol were the main active ingredients incorporated in a basic formulation containing 87 % palm-based derivatives. Guava body scrub (GBS) and guava facial scrub (GFS) lotions were developed at skin pH 5.5 and pH 5.6 respectively. Both products were found to be stable for three years due to the liquid crystalline structure in the emulsion system , having small particle size (490 nm and 880 nm) and high zeta potential values (-54 mv and -39 mv). The rheological properties showed that the GBS lotion had a viscosity at 900 Pas and a yield value at 98 Pa, whereas the GFS lotion 60 Pas and 6 Pa viscosity and yield values respectively. The formulations were designed to be soft and flowable, with the firmness force indicated at 111 g and 66 g for GBS lotion and GFS lotion respectively. Efficacy testing on 20 healthy subjects showed a significant decrease of 21 % and 22 % in skin sebum removal for GBS lotion and GFS lotion respectively. (author)

Faktor Risiko Perilaku dan Lingkungan dalam Penularan Malaria di Pulau Sebatik, Kabupaten Nunukan, Kalimantan Timur

Directory of Open Access Journals (Sweden)

Wiwik Trapsilowati

2016-12-01

Full Text Available Malaria transmission is influenced by several factors, including parasites, human, mosquito and environment. In 2009, slide positive rate (SPR in Puskesmas Aji Kuning, Sungai Nyamuk and Setabu in Sebatik Island were identified as amount 63,61%, 28,04% and 30,12% respectively, while the target malaria pre-elimination SPR < 5%. The aim of this study was to determine the behavioral and environmental risk factors of malaria transmission. This is a cross sectional study and the number of sample were 101 respondents. The results showed that there was significant association between the habit of using mosquito nets, the habit of using mosquito coils, repellent and others, the respondent's house near breeding mosquitoes habitats and the respondent’s house near the cocoa/coffee plantation with the occurrence of malaria cases. Relative risk (RR value were 2,0, 2,3, 2,9 and 1,7, respectively. Behavioral risk factors of malaria transmission were the habit of using a mosquito nets and habit of using mosquito coils, repellent and others. Environmental risk of malaria transmission were the house near mosquito breeding habitats, and the house near the cocoa and coffee plantation.

Mini hydro power in Peninsular Malaysia - the past, present and future

International Nuclear Information System (INIS)

Bhaskar Kannan

2006-01-01

The early development of mini hydro development in Peninsular Malaysia was carried out by the National Electricity Board (NEB) and the projects developed in the 50s and 60s were Ulu Langat (Selangor), Sempam, Kg. Raja , Kuala Terla, and Robinson Falls (all in Pahang). In the 70s the main effort of hydropower development was concentrated on developing major hydropower projects not only to cater to the country increasing demand for electricity but also to the country needs for flood control. This development was feverishly carried out on the Perak River and the prohects built were Temenggor (384 MW), Bersia (72 MW), Kenering (20 MW), Sg Piah (70 MW) and the Kenyir (400 MW) project in Sungai Terengganu. In late 1970s, the government was keen to electrify the rural areas of Peninsular Malaysia and mini hydro power development was thought of as an option to provide electricity to these areas. The Mini Hydro Department of National Electricity Board (MHD) was then formed to undertake the task of planning, developing and implementing mini hydro projects to meet this government aspiration. Table 1 shows the list of projects identified and implemented and its status

Adsorption and desorption study of 14C-Chloropyrifos in two Malaysian agricultural soils

International Nuclear Information System (INIS)

Halimah Muhammad; Nashriyah Mat; Tan Yew Ai; Ismail, B.S.

2004-01-01

The adsorption equilibrium time and effects of pH and concentration of 14 C-labeled chloropyrifos 0,0-diethyl 0-(3, 5, 6 tricloro-2-pyridyl)-phosphorothiote in soil were investigated. Two types of Malaysian soil under oil palm were used in this study; namely clay loam and clay soil obtained from the Sungai Sedu and Kuala Lumpur International Airport (KLIA) Estates, respectively. Equilibrium studies of chloropyrifos between the agricultural soil and the pesticide solution were conducted. Adsorption equilibrium time was achieved within 6 and 24 hours for clay loam and clay soil, respectively. It was found that chloropyrifos adsorbed by the soil samples was characterized by an initial rapid adsorption after which adsorption remained approximately constant. The percentage of 14 C-labeled chloropyrifos adsorption on soil was found to be higher in clay loam than in clay soils. Results of the study demonstrated that pH affected the adsorption of chloropyrifos on both clay loam and clay soils. The adsorption of chloropyrifos on both types of soil was higher at low pH with the adsorption reduced as the pH increased. Results also suggest that chloropyrifos sorption by soil is concentration dependent. (Author)

Effects of Alachlor and Metolachlor on Microbial Populations in the Soil

Directory of Open Access Journals (Sweden)

Ismail, B. S.

2005-01-01

Full Text Available A study of the impact of two acetanilide herbicides, viz. alachlor and metolachlor on bacterial and fungal populations and biomass in the Sungai Buluh soil series samples was carried out under laboratory conditions. The effects of the two herbicides were monitored for 70 days under ambient conditions. Metolachlor caused greater reduction in bacterial counts than on fungal populations. There was approximately 75% reduction in bacterial counts 14 days after treatment (DAT with 2 µg/g metolachlor. Alachlor however was less toxic to bacterial and fungal populations. Alachlor caused a reduction in bacterial counts at 7 and 14 DAT with 2µg/g or above. Fungal population decreased significantly in the presence of 20 µg/g alachlor at 7 DAT but no further effects were observed as the incubation period was prolonged. The study showed that the microbial biomass immediately decreased significantly in the presence of 2 µg/g or more of metolachlor at 0 and 28 DAT. Alachlor, on the other hands, at the lowest experimental dose of 2 µg/g reduced the microbial biomass almost immediately upon incubation, but had no further effects when the incubation period was prolonged.

Penurunan Logam Timbal (Pb pada Limbah Cair TPA Piyungan Yogyakarta dengan Constructed Wetlands Menggunakan Tumbuhan Eceng Gondok (Eichornia Crassipes

Directory of Open Access Journals (Sweden)

Eko Siswoyo

2015-10-01

Full Text Available Salah satu permasalahan lingkungan yang ditimbulkan dari adanya lindi di TPA Piyungan yaitu pencemaran pada badan air, sungai dan air tanah. Untuk mengatasi permasalahan ini salah satunya dengan sistem Constructed Wetlands dengan menggunakan tumbuhah eceng gondok. Tujuan dari penelitian ini adalah untuk mengetahui tingkat penurunan konsentrasi Timbal (Pb yang terdapat dalam limbah cair TPA Piyungan dengan Constructed Wetlands menggunakan tumbuhan eceng gondok dan untuk mengetahui seberapa besar kapasitas serapan tumbuhan eceng gondok terhadap kandungan Timbal (Pb dalam limbah cair TPA Piyungan.Dalam penelitian ini digunakan reaktor yang terbuat dari kayu yang dilapisi plastik dengan ukuran 0,5 m x 1,0 m. Setiap reaktor diberi media tanah 5 cm, dan diberi tumbuhan sebanyak 14 buah. Reaktor tersebut diberi perlakuan dengan konsentrasi limbah yang bervariasi (100%, 75%, 50%, 25%, dan 0%, dan waktu pengambilan sampel (0, 3, 6, 9, 12 hari. Dengan menggunakan metode SSA (Spektrofotometri Serapan Atom.Berdasarkan pengujian diperoleh bahwa penurunan logam Pb pada limbah cair TPA Piyungan hari ke- 12, yaitu sebesar 0.0501mg/L pada konsentrasi 100%, 0.0295mg/L pada konsentrasi 75%, 0.0267mg/L pada konsentrasi 50% dan 0.0041 mg/L pada konsentrasi 25%.

Assessment of Selected Heavy Metals in Seawater and Sediment at Klang Coastal Area Malaysia

International Nuclear Information System (INIS)

Noor Aziatul Aini Hamzan; Farah Fardiana Mohamad Zaini; Mohd Ismail Ibrahim; Nik Azlin Nik Ariffin

2015-01-01

Sediments are capable of transporting loads of adsorbed nutrients, pesticides, heavy metals, and other toxins. In this study, the samples of sediment were collected from four sampling points (Kapar, Sungai Puloh, Sementa and North Port) using sediment core sampler. The cores then was sub-sampled by slicing into 1 cm slices and dried at 60 degree Celsius until mass become constant and the weight recorded. The samples were pulverized and sieved through 220 μm stainless steel sieves. Each sub-sample digested using aqua regia acids. For seawater, the samples were evaporated using the hotplate at 60 degree Celsius. The concentration of heavy metals was determined by inductively coupled plasma optical emission spectrometry (ICP-OES). The highest concentration of copper, zinc, iron and lead was observed from seawater samples obtained from Sementa while highest concentration of cadmium was found from Kapar samples). Most of the bottom seawater gives high concentration of the heavy metal compare to the surface. For sediment, the overall concentration of heavy metal in each layer was fluctuated. From the analysis, there is a significant correlation for overall selected heavy metals and the samples (seawater and sediment) that study in this area. (author)

The Improvement of the Ventilation System in the Existing Terraced Houses in Malaysia

Directory of Open Access Journals (Sweden)

Arab Yasser

2016-01-01

Full Text Available This study aims to find a sustainable solution in order to reduce the indoor temperature in hot and humid climate such as Malaysia. The focus of this study is to create a new device (Air Tube which is considered to be a remedial device for the indoor spaces, and can be installed for the existed houses. The method of this study is to design the Air Tube device and install is in the rooms of second floor in semi-detached and terrace house in order to reduce the temperature few degrees. The study will depend on taking manual measurements in the site and making simulation using computer software Ecotect on 14th of February (which considered to be the hottest day in the year and trying to find the best solution to reduce the temperature in such hot and humid weather, the case study is a semi-detach house with post-modern architectural style, which is located in Sungai Petani, Kedah, Malaysia. The research finds that AirTubeis a good solution for the existed houses to decrease the temperature and reach the thermal comfortable atmosphere.

Studi Pengembangan Pulau Lumpur Sarinah Kabupaten Sidoarjo Sebagai Geo-Ecotourism

Directory of Open Access Journals (Sweden)

Siti Chamdalah

2017-01-01

Full Text Available Daratan dengan total luas 94 hektar di kawasan muara Sungai Porong Kabupaten Sidoarjo yang dibentuk dari endapan buangan lumpur Sidoarjo disebut pulau lumpur buatan atau Pulau Sarinah. Secara administratif Pulau Sarinah masuk dalam wilayah Kecamatan Jabon, Kabupaten Sidoarjo, Provinsi Jawa Timur. Daratan buatan yang dibentuk sejak tahun 2011 ini ditumbuhi oleh tanaman bakau mayoritas jenis Api–api (Avicennia Officinalis. Terdapat pula sebuah kolam pendukung aktivitas penelitian dan kolam tempat pembudidayaan beberapa hewan air seperti udang, kepiting dan bandeng. Rencana pengembangan pulau menjadi kawasan ekowisata yang berkelanjutan mendapatkan beberapa kendala yaitu minimnya sarana prasarana pendukung ekowisata, ketidakjelasan status kawasan dan kepengurusan pulau sehingga pengembangan pulau tidak optimal. Maka dari itu, penelitian dengan metode Analisa Hirarki Proses (AHP yaitu dengan menyatukan persepsi beberapa pihak terkait (pemerintah daerah dan pusat, masyarakat, BPLS serta akademisi untuk mencapai rumusan pengembangan pulau berdasarkan prioritas kepentingan. Terdapat lima faktor yang diperhitungkan (lingkungan, ekonomi, sosial, hukum dan infrastruktur dalam proses analisa dan dibantu dengan pengaplikasian software Expert Choice menunjukkan urutan prioritas pengembangan yang harus dilakukan yakni pengembangan destinasi (30,6%, pengembangan kelembagaan (28,3%, pengembangan pemasaran (24,8% dan pengembangan industri (16,3% dengan nilai rasio inkonsistensi sebesar 0.04.

KESEJAHTERAAN KELUARGA DAN KUALITAS LINGKUNGAN PENGASUHAN PADA ANAK USIA PRASEKOLAH

Directory of Open Access Journals (Sweden)

Elmanora Elmanora

2015-05-01

Full Text Available The aim of the research was to analyze the influence of child characteristics, family characteristics, and family welfare on quality of home environment on preschool aged children. The samples involved 120 formal and nonformal preschool age children in Sungai Penuh District, Jambi Province that were chosen by stratified random sampling. Data was collected by interview and observation, and also was analyzed by descriptive analysis, correlation test, and multiple linear regression test. Based on poverty line indicator, families were divided into welfare families and nonwelfare families. The results showed that 45,8% families was welfare and 54,2% families was nonwelfare. The quality of home environment was measured by scale of Home Observation for Measurement of the Environment (HOME and was divided into good and less. Parent provided language stimulation, responsivisity, and modeling into good quality, while the availability of learning materials, physical environment; academic stimulation, variety of stimulation, and acceptance into less quality. The quality of home environment was influenced by child’s age and sex, family size, maternal education, and family welfare.

Pemetaan Potensi Kekeringan Lahan se-pulau Batam menggunakan Teknik Sistem Informasi Geografis (SIG dan Penginderaan Jauh

Directory of Open Access Journals (Sweden)

Titi Aprilliyanti

2017-04-01

Full Text Available Kekeringan merupakan hubungan antara ketersediaan air yang jauh dibawah kebutuhan baik untuk kebutuhan hidup, pertanian, kegiatan ekonomi dan lingkungan. Informasi mengenai potensi kekeringan sangat diperlukan untuk pencegahan ataupun penanggulangan untuk mengurangi dampak negatif yang ditimbulkan. Adapun tujuan dari penelitian ini adalah menghasilkan peta potensi kekeringan lahan di Batam yang berbasis web. Dalam penelitian ini memanfaatkan teknik penginderaan jauh dan SIG. Penggunaan citra landsat 8 untuk menentukan nilai LST (Land Surface Temperature dan penggunaan lahan kemudian di overlay dan dilakukan scoring. Tahap akhir penelitian yaitu melakukan validasi terhadap parameter-parameter yang mempengaruhi dengan mengambil beberapa sampel. Adapun hasil akhir dari penelitian ini adalah peta potensi kekeringan se-pulau Batam yang memiliki 5 kelas potensi kekeringan. Kelas potensi kekeringan sangat rendah dengan  luas area 2629.45 ha yang dominan terletak pada Kecamatan Sungai Beduk, Sekupang dan Batu Aji. Kelas potensi kekeringan rendah dengan luas area 9585.521 ha yang dominan terletak pada Kecamatan Sekupang. Kelas potensi kekeringan sedang dengan  luas area 9507.12 ha yang dominan terletak pada Kecamatan Sekupang. Kelas potensi kekeringan tinggi dengan  luas area 7081.392 ha yang dominan terletak pada Kecamatan Sekupang, Sagulung dan Nongsa. Kelas potensi kekeringan sangat tinggi dengan luas area 15600.12 ha yang dominan terletak pada Kecamatan Batam Kota dan Nongsa.   Drought is the relationship between the availability of water is far below the need both for the necessities of life, agriculture, economic activities and the environment. Information about potential droughts is indispensable for the prevention or mitigation to reduce the negative impact caused. As for the purpose of this research is to produce a map of potential drought land in the Batam-based web. In this research utilising remote sensing and GIS techniques. The use of

PERANAN MANGROVE SEBAGAI BIOFILTER PENCEMARAN AIR WILAYAH TAMBAK BANDENG TAPAK, SEMARANG (Role of Mangrove as Water Pollution Biofilter in Milkfish Pond, Tapak, Semarang

Directory of Open Access Journals (Sweden)

Nana T.M. Kariada

2014-10-01

Full Text Available ABSTRAK Mangrove yang tumbuh di ujung sungai besar berperan sebagai penampung terakhir bagi limbah dari industri di perkotaan dan perkampungan hulu yang terbawa aliran sungai. Area hutan mangrove mempunyai kemampuan mengakumulasi logam berat yang terdapat dalam ekosistem tempat tumbuhnya. Tujuan yang hendak dicapai dari  penelitian ini adalah mengkaji peranan mangrove sebagai biofilter pencemaran air dan  mengetahui jenis mangrove yang terbaik berperan sebagai biofilter pencemaran air di di lingkungan tambak bandeng Tapak Kota Semarang. Desain yang digunakan dalam penelitian ini adalah deskriptif eksploratif. Berdasarkan hasil penelitian tentang akumulasi logam berat Cu antara air dan sedimen tambak, diperoleh hasil telah terjadi akumulasi Cu dengan Faktor Konsentrasi antara 43-400.  Pada stasiun 3 dan 4 terdapat akumulasi Cu dengan nilai Faktor Konsentrasi 3 dan 0,3. Hal ini menunjukkan akumulasi Cu dari sedimen ke akar mangrove relatif masih kecil. Perbedaan akumulasi dari tiap stasiun penelitian yang diamati menunjukkan adanya perbedaan jenis mangrove yang tumbuh pada masing-masing stasiun penelitian. Mangrove yang berada di lingkungan tambak bandeng wilayah Tapak Kota Semarang disimpulkan dapat berperan sebagai biofilter pencemaran air yang ada di perairan tersebut. Mangrove dari jenis Avicennia marina mempunyai peranan yang lebih baik dari jenis Rhizophora sp sebagai biofilter pencemaran air di lingkungan tambak bandeng Tapak Kota Semarang.   ABSTRACT Mangroves,  that is growing at the end of a great river, has a role as the last place for the waste water from urban and domestic industry at the upstream that were carried by the flow of river. Mangrove area  has  ability to accumulate a heavy metals  which is contained in it. The  goals  from this research is to assess role of mangrove as biofilter of water pollution and to find out the best species of mangrove as biofilter of water pollution in milkifish pond in Tapak, Semarang

DISTRIBUSI SEDIMEN DASAR SEBAGAI IDENTIFIKASI EROSI PANTAI DI KECAMATAN BREBES MENGGUNAKAN ANALISIS GRANULOMETRI

Directory of Open Access Journals (Sweden)

Wisnu Arya Gemilang

2017-05-01

Full Text Available Dinamika kawasan pesisir Kecamatan Brebes berupa bencana abrasi dan akresi yang terjadi memiliki dampak besar terhadap kerusakan kawasan mangrove dan pesisir. Fenomena abrasi dan akresi yang terjadi dipengaruhi oleh parameter oseanografi yang dapat mempengaruhi sebaran sedimen di pesisir. Penelitian ini bertujuan untuk mengetahui karakteristik pembangkit fenomena abrasi dan akresi di pesisir Kecamatan Brebes serta bentuk mitigasi yang tepat untuk mengurangi bencana abrasi. Metode yang digunakan adalah descriptive kuantitatif dan analisis yang dilakukan adalah pengukuran arus, pengukuran pasang surut, pemetaan batimetri, analisis ukuran butir sedimen dan pemodelan hidrodinamika 2 dimensi. Sedimen berupa pasir, lanau, dan pasir lanauan dengan nilai rerata ukuran butir 5.00 phi – 8.00 phi. Kecepatan arus sepanjang pantai hasil model pada kondisi purnama berkisar 0-0,12 m.s-1 dan pada saat perbani berkisar antara 0-0,08 m.s-1, dengan dominasi arah arus menuju ke Timur dan Timur laut. Perlu dilakukan penataan ulang terhadap kawasan mangrove dan bangunan pelindung pantai serta melakukan pencodetan terhadap sungai – sungai utama yang merupakan sumber pembawa material sedimen sehingga dapat memberikan suplay endapan sedimen di bagian pesisir.Kata Kunci: Brebes, erosi, arus sepanjang pantai, mitigasi, sedimenBED SEDIMENT DISTRIBUTION FOR IDENTIFICATION OF THE COASTAL EROSION IN BREBES SUBDISTRICT USING GRANULOMETRI ANALYSISThe dynamics of erosion and accretion in the coastal area of Brebes Subdistrict have many impacts on mangrove destruction and coastal region. The erosion and accretion are influenced by oceanography parameters that can affect the distribution of coastal sediments. The aims of this research were to determine the characteristics of the phenomenon of erosion and accretion in coastal Brebes Subdistrict and shape appropriate mitigation to reduce the erosion. This research is done with the bed sediment sampling using grab sampler for 26

PAPARAN SENG DI PERAIRAN KALIGARANG TERHADAP EKSPRESI Zn-THIONEIN DAN KONSENTRASI SENG PADA HATI IKAN MAS

Directory of Open Access Journals (Sweden)

NK Dewi

2013-07-01

Full Text Available Penelitian bertujuan mengetahui paparan seng (Zn di perairan Kaligarang terhadap ekspresi Zn-thionein dan konsentrasi seng pada hati ikan mas (Cyprinus carpio L. Sebanyak 200 ekor ikan dibagi menjadi dua kelompok, masing-masing kelompok 100 ekor. Kelompok kontrol dipelihara di kolam ikan di Balai Benih Ikan Kabupaten Semarang, sedangkan kelompok perlakuan dipelihara pada karamba jaring apung di bagian hilir sungai Kaligarang. Setiap minggu sampel ikan diambil masing-masing lima ekor dari kedua kelompok secara acak untuk diambil organ hatinya dan dianalisis konsentrasi seng dan Zn-thionein. Ikan pada kedua kelompok dipelihara hingga Zn-thionein muncul pada hati ikan. Metallothionein diisolasi dari hati ikan dan dianalisis menggunakan metode High-Performance Liquid Chromatography, dengan larutan standar seng. Setiap satu minggu sekali, konsentrasi seng terlarut pada sampel air dari kedua kelompok diukur dengan metode Atomic Absorption Spectroscopy hingga Zn-thionein muncul. Hasil penelitian menunjukkan bahwa konsentrasi seng yang terlarut dalam air sungai Kaligarang adalah 0,078 mg/l, lebih tinggi dari nilai baku mutu air kelas I (0,05 mg/l. Rata-rata konsentrasi seng yang terabsorbi oleh hati ikan mas pada minggu ke-6 adalah 0,025868 mg/l, lebih rendah dari batas maksimum cemaran seng (100 mg/kg. Rata-rata konsentrasi seng pada hati ikan sebesar 0,025868 µg/g dapat menginduksi munculnya Zn-thionein pada hati ikan mas yang hidup di perairan Kaligarang pada minggu ke-6 perlakuan. The research aims to find concentration of dissolved zinc in the water of Kaligarang River and absorbed zinc concentration inside the liver of carp, also to analyze zinc exposure in Kaligarang River toward Zn-thionein induction inside the liver of carp. The concentration of dissolved zinc was measured using Atomic Absorption Spectroscopy method until Zn-thionein emerges. Metallothionein was isolated from the liver of carp and analyzed using High-Performance Liquid

Rancang Bangun Sistem Scada (Supervisory Control And Data Acquisition pada Instalasi Pengolahan Air Sungai Cihideung Institut Pertanian Bogor

Directory of Open Access Journals (Sweden)

Agus Eko Handoko

2017-08-01

Full Text Available Abstract SCADA is a combination of telemetry and data acquisition. SCADA proceeding by means of accumulating some information and return back to center controlling, it is also implementing every analysis and necessary control through PID control system as a control parameter to SCADA input data system in this research. In designing PID control system it is needed the arrangement of P, I and D parameter in order to acquire output signal system to particular input system which has adjusted to necessity. The research was implemented on Water Treatment Plant in Bogor Agricultural University at Cihideung's area region. The NTU score as a starting operational data is necessary as a bench mark in PAC dose application which is obtained from the samples of morning and afternoon raw water and dose proportion is 75% for 14kgs PAC mixed with 200 Litre water within 30 NTU as the maximal treatment. 75% dose application can be imposed for 7 hours PAC usage. The result of research indicated that the variety of percentages value in PAC dose application delivered the advantage in operating of clean water processing installation particularly for PAC needed. Design Of SCADA System SCADA indicated the outcome of unit data acquirement on certain period to determine the PAC necessity in operating Water Treatment Plant.

Kebijakan Penataan Sempadan Sungai Cisadane Di Kota Tangerang (Penanganan Penyalah Gunaan Lahan Di Kelurahan Babakan Dan Kelurahan Mekarsari)

OpenAIRE

Irawan, Ryan Fadhillah; Widayati, Wiwik; Turtiantoro

2014-01-01

As an Industrial based city and have been decided to be the National Strategic Area, The City of Tangerang has become the one of favorite place to seek a job. With the job seekers from all over Indonesia and the people who already lives in Tangerang as a local society, are escalating with the demands of land for residence. In the end, some of the people are illegally using the government property (land(s),river,etc.) such as Cisadane river in sempadan. Its problem are spreading to the other a...

PROSPEK PUBLIC SPACE PADA KAMPUNG SUSUN SEBAGAI RUANG INTERAKSI SOSIAL, EKONOMI DAN PENGEMBANGAN ILMU DI AREA BANTARAN SUNGAI

Directory of Open Access Journals (Sweden)

Hestin Mulyandari

2015-07-01

Full Text Available Commercial buildings in the city of Yogyakarta is growing rapidly and removing settlements outside the city of Yogyakarta. Some settlements reject commercial buildings, besides there is a plan of Ministry of public housing about the proposed location of settlements in the city of Yogyakarta to serve flats to maintain residential land and provide homes for low-income people. This study aims to explore the needs of the needs of the public space for children, adults, and the elderly. This study uses research methods - explorative search were the findings of the survey location, land use policy along the riverbank, and the use of public spaces in the building. RW 07 Jetis Harjo has become one of the targeted land for flats. Components of flats should enter "public space" that is used for public facilities together, and has designed the research team include: corridors, workshops, parking areas (motorcycles, bicycles, tricycles and angkringan, banquet facilities, warehouses, open space, post of Code information that comes with this famous hawker centers and entertainment stage, children's playground (out door, where gardening and farming, planting space, business space, drying rooms, creative space including space of music (band. The expectations of the public space of flats can strengthen the social structure of society, by institutional structures and solidarity in society, and understanding the values of a new life in solving the problems of life.

IDENTIFIKASI SUMBER PENCEMAR DAN KUALITAS AIR SUNGAI DI DESA CANGGU DAN DESA DALUNG KECAMATAN KUTA UTARA KABUPATEN BADUNG

Directory of Open Access Journals (Sweden)

Anggi Suprabawati

2012-11-01

Full Text Available The Identification of source pollution was done with sum up the data of the activity which have potency toreleasing liquid waste with the method of spreading questioner. Quality research water river was done at 15 pointsampel (PS in Tukad Umalas, Tukad Pangi and Tukad Canggu. Activity of human being representing source ofpolution in Countryside Dalung is consist of : settlement 90.84%, restaurant 6.55%, laundry 0.841%, motor workshop0.474%, car workshop 0.604%, motor wash 0.604%, car wash 0.086%. Activity of human being representing sourcepolution in Countryside Canggu is settlement 63.97%, restaurant 17.23%, lodging 17.68%, laundry 0.393%, motorworkshop 0.393%, motor wash 0.136%, car wash 0.112%. car workshop 0.112%. Volume of Liquid waste from eachactivity of human being per day in Countryside Dalung is consist of : settlement 5056.8 m3, motor wash 35.26 m3,restaurant 33.63 m3, laundry 8.934m 3, car wash 5.94 m3, car workshop 2.22 m3 and motor workshop 2.04 m3. Volumeliquid waste from each of activity of human being per day in Countryside Canggu is settlement 1368 m3, restaurant173.22 m, hotel 34.17 m3, car wash 14.48 m3, motor workshop 1.86 m3, motor wash 0.72 m3, laundry 0.4297 m3 andcar workshop 0.3 m3.Analysis of water with value of pollution index (IP based on water quality class 2,TS-6 is middle polluted,and fourteenth of TS is slightly polluted. Based on water quality class 3, TS-1 to TS-7 and TS-14 is fill water qualitycriteria And TS-8 to TS-15 is slightly polluted. Based on water quality class 4, TS-3 still fill the quality criteria andfourteenth of TS is slightly polluted

Keanekaragaman, Dominasi, Persebaran Spesies Penggerek Batang Padi dan Serangannya pada Berbagai Tipologi Lahan di Provinsi Jambi

Directory of Open Access Journals (Sweden)

. Wilyus

2014-03-01

Full Text Available Diversity, domination, and distribution of rice stem borer species and its damage in various land typologies in Jambi Province.  The research was conducted to analyze the diversity, domination, species distribution of rice stem borers (RSB and its damage on various land typologies in Jambi Province.  The research was carried out using survey method, from December 2010 until June 2011.  Samples of RSB were collected from tidal swamp in Tanjung Jabung Timur District, swampy area in Muaro Jambi District, rainfed lowland in Sarolangun District, irrigated lowland in Merangin District, and irrigated upland in Kerinci District and Sungai Penuh District.  The results showed that there were five spesies of  RSB found in Jambi Province.  Scirpophaga  incertulas Walker (yellow stem borer was the most dominant of RSB, followed by Sesamia inferens Walker (pink stem borer, Chilo suppressalis Walker (striped stem borer, Chilo polychrysus Meyrick (dark-headed stem borer, and Scirpophaga innotata Walker (white stem borer.  The distribution of S. incertulas, S. inferens, C. suppressalis and C. polychrysus were in all of rice field in Jambi Province, but that of S. innotata was limited over tidal swamp and  rainfield  lowland area. The RSB damage rate was lower than economic thereshold.

Index insurance for pro-poor conservation of hornbills in Thailand.

Science.gov (United States)

Chantarat, Sommarat; Barrett, Christopher B; Janvilisri, Tavan; Mudsri, Sittichai; Niratisayakul, Chularat; Poonswad, Pilai

2011-08-23

This study explores the potential of index insurance as a mechanism to finance community-based biodiversity conservation in areas where a strong correlation exists between natural disaster risk, keystone species populations, and the well-being of the local population. We illustrate this potential using the case of hornbill conservation in the Budo-Sungai Padi rainforests of southern Thailand, using 16-y hornbill reproduction data and 5-y household expenditures data reflecting local economic well-being. We show that severe windstorms cause both lower household expenditures and critical nest tree losses that directly constrain nesting capacity and so reduce the number of hornbill chicks recruited in the following breeding season. Forest residents' coping strategies further disturb hornbills and their forest habitats, compounding windstorms' adverse effects on hornbills' recruitment in the following year. The strong statistical relationship between wind speed and both hornbill nest tree losses and household expenditures opens up an opportunity to design wind-based index insurance contracts that could both enhance hornbill conservation and support disaster-affected households in the region. We demonstrate how such contracts could be written and operationalized and then use simulations to show the significant promise of unique insurance-based approaches to address weather-related risk that threatens both biodiversity and poor populations.

Habitat Perkembangbiakan Spesifik Anopheles sp Di Tambang Emas Kura-Kura Banian (Perubahan Perilaku Anopheles sp

Directory of Open Access Journals (Sweden)

Liestiana Indriyati, SKM

2016-12-01

Full Text Available The results of Health Research 2010, showed that malaria was an infectious disease that the sixth cause of death cause of the sixth of death in Indonesia. Kotabaru is a malaria endemic district, especially in Puskesmas Banian, Annual Parasite Incidence 241.19 in 2014 where the cases of malaria with occurring in illegal gold mines on the slopes of Banian Mountain. It’s needed to know the factors that affect the existence of malaria in these locations. This research was observational study doing by cross-sectional study and analyzed by descriptively. Research conducted at the Gold Mine Banian Buluh Kuning village, Sungai Durian subdistric, Kotabaru district, South Kalimantan Province in February and March, 2015. The activities were catching larva and adult mosquitoes, environmental and mosquito breeding habitats observation and Mass Blood Survey. It was found Anopheles maculatus and Anopheles leucosphyrus with very low densities in area with the number of malaria cases by 22.99%. It was found divers breeding habitats of Anopheles sp on a former gold wash, former drum and former plastic containers. This indicated a behavioral change of Anopheles breeding places because previous to this the Anopheles breed in puddles on the ground or direct contact with the ground.

Pengaruh Pembelajaran Project Based Learning (PjBL pada Materi Ekosistem terhadap Sikap dan Hasil Belajar Siswa SMAN 2 Malang

Directory of Open Access Journals (Sweden)

Susriyati Mahanal

2010-05-01

Full Text Available The objective of this research was to know the effect of Project Based Learning (PjBL to the attitude and student cognitive achievement in SMAN 2 Malang. This research applied quasy experimental with non-equivalent control group design. The populations of this research is all student of class X SMAN 2 Malang on academic year 2008/2009. The samples of this research were class X7 as experimental (PjBL and class X8 as control (conventional. The instrument of this research namely cognitive achievement test and attitude scale questionnaire to river ecosystem. This research data are quantitative data consisted by score cognitive achievement and attitude scale questionnaire to river ecosystem, collected on 14 Maret until 31 May 2009. Data were analysed by bilinear covariant statistical analysis (Ancova, continued with LSD test. The result of this research indicated that there were PjBL toward the cognitive achievement and student attitude to river ecosystem. Students with PjBl having attitude higher 11,65% from conventional students. Beside, students with PjBl having cognitive achievement higher 81,05% from conventional students. Based on this research, the researcher suggest to the teacher that this strategy can be implemented in biology learning.   Kata kunci: Project Based Learning, sikap terhadap ekosistem sungai, hasil belajar

Comparison of catching efficiency of two Indonesian traditional traps, Ayunan and Tamba

Directory of Open Access Journals (Sweden)

Ahmadi

2014-08-01

Full Text Available The catching efficiency of traditional traps: Ayunan and Tamba were tested in Sungai Batang River, South Kalimantan of Indonesia. Trials consisted of 320-trap hauls/type using 1-day submersion time of 24 hr. The baited traps sampling accounted for 82 specimens assigned to 5 species of 5 families. There was a large variability in number of catch between prawns and fish species collected (T=2.318, P<0.05. The prawns catch was represented by only the species Macrobrachium rossenbergii with total of 53 and 1,015 g weight. The prawns weight of Tamba was significantly higher than that of Ayunan (T=3.453, P<0.01.The fish catch composed of Mystus gulio 79%, Osteochilus hasselti 10%, Hypostomus plecostomus 7%, and Macrognathus aculeatus 3%, with total weight ranged from 35 to 560 g. A clear difference was found in catching efficiency. Comparative fishing trials showed that Tamba collected specimens were 1.8 times higher than Ayunan (T=2.223, P<0.05. Catch per unit effort for Tamba ranged from 58.13 to 80.00, and for Ayunan ranged from 5.31 to 7.19. The gear modifications and various treatments (e.g. bait odor, light are necessary to be taken to increase their relative catching efficiency.

Challenges in managing freshwater fishery resource through Lebak Lebung Auction approach: a case study in Pangkalan Lampam District Ogan Komering Ilir Regency

Science.gov (United States)

Muslimin, B.; Suadi

2018-03-01

Responsible management of fishery resources has been a tradition of Ogan Komering Ilir (OKI) of South Sumatera for generations. It was recorded that since 1630 the Dutch Government had made auction policy for managing water territory in OKI Regency as an effort to preserve nature and to avoid the conflict of inland water ownership. Currently, the community-based management model has been adopted by local governments into formal regulations, known as Regional Regulation on Auction of Flood Water Swamp and Rivers (Lelang Lebak Lebung dan Sungai or L3S). This paper describes the success factors and the threats for the failure of the L3S management model in OKI Regency, based on a case study in Pangkalan Lampam District. The study showed that the management mechanism through the L3S system had been well instituted and become a well-established management practice. The management model is in line with the principle of co-management and the approach has become critical success factor in L3S management. However, ecological, economic and social aspects influence the sustainability of such fishery management model. Besides, L3S management model faces limited data and information related to fish stocks, which result in difficulties in determining the total allowable catch.

THE PERCEPTION OF COMMUNITY TOWARDS THE DISTURBANCE OF SUMATERAN ELEPHANT (ELEPHAS MAXIMUS SUMATRANUS IN OGAN KOMERING ILIR REGENCY

Directory of Open Access Journals (Sweden)

Anita Rianti

2017-08-01

Full Text Available Research of elephant conflict with community have been conducted in Sungai Menang District, Ogan Komering Ilir Regency, South Sumatera Province. This study was conducted in three villages in September through December 2015. This study aimed to identify the perception and socio-economic characteristics of the community related to the conflict towards elephant conservation value. Data was collected through structured interview, while respondents were selected intentionally (purposive sampling. The results are shown that the level of community education in the village of Gajah Mati dan Gajah Mulya are low, 51% and 47% respectively, which are elementary school graduates, while the level of education in the village of Gajah Mukti is 58% of high school graduates. The majority of respondents are in productive age classes and worked as a farmer. The average income per month of people in the village of Gajah Mati is Rp1,814,583, while in Gajah Mukti and Gajah Mulya Village are Rp1,158,750 and Rp1,060,833 respectively. Elephants disturbance occur in all respondent villages and has an impact on the community perception of the elephant conservation becomes negative. Most respondents want that the elephants are relocated to Padang Sugihan Wildlife Sanctuary which is suitable for the habitat of the elephants.

PROPORSI BAGIAN TUBUH DAN KADAR PROKSIMAT IKAN GABUS PADA BERBAGAI UKURAN

Directory of Open Access Journals (Sweden)

Ruddy - Suwandi

2014-07-01

Full Text Available Ikan gabus (Channa striata merupakan jenis ikan air tawar yang sudah banyak dikenal oleh masyarakat Indonesia. Ikan gabus hidup di muara sungai, danau, rawa, dan dapat pula hidup di air kotor dengan kadar oksigen rendah. Ikan gabus belum banyak dibudidayakan secara luas dan belum banyak dimanfaatkan sebagai produk olahan ikan. Informasi mengenai proporsi tubuh ikan gabus masih kurang dan belum banyak dikaji. Penelitian ini bertujuan untuk menentukan proporsi bagian-bagian tubuh ikan dan komposisi kimia daging ikan gabus pada berbagai ukuran (0,5 kg; 1 kg; dan 2 kg dan jenis kelamin. Prosedur yang dilakukan pada penelitian ini yaitu pengukuran proporsi tubuh ikan dan analisis proksimat. Ikan gabus betina memiliki rendemen daging yang lebih tinggi dibanding ikan gabus jantan. Rendemen terbesar terdapat pada daging dengan bobot tubuh ikan 2 kg. Kadar air dan kadar abu tertinggi terdapat pada ikan gabus jantan 0,5 kg yaitu 80,41% dan 1,47%. Kadar protein tertinggi yaitu 20,14% terdapat pada ikan gabus betina 1 kg. Kadar lemak tertinggi terdapat pada ikan gabus jantan 2 kg yaitu sebesar 1,69%. Kadar karbohidrat tertinggi terdapat pada ikan gabus betina 2 kg yaitu 2,71%.Kata kunci: ikan gabus, proksimat, proporsi tubuh

IDENTIFIKASI DAN EVALUASI AKSES PUBLIK DAN OPEN SPACE DI KAWASAN SENG HIE PONTIANAK

Directory of Open Access Journals (Sweden)

Bontor Jumaylinda Br. Gultom

2016-09-01

Seng Hie area has a unique character that gives the image of the city of Pontianak. This area has the potential to be developed. This area already has the appeal of the inherent function, namely trade. This makes this area very easily become a magnet to invite more people to visit. REFERENCES Breen, Ann dan Dick Rigby. (1994. Waterfront, Cities Reclaim Their Edge. Mc.Graw Hill. New York Breen, Ann dan Dick Rigby. (1996. The New Waterfront: A Worldwide Urban Success Story. Mc.Graw Hill. New York Department of City Planning, Waterfront Urban Design Technical Advisory Committee. (1997. The Port of San Francisco Waterfront Design & Access: An Element of the Waterfront Land Use Plan, Port of San Francisco. San Francisco. Garnham, Harry Launce. (1985 Maintaining the Spirit of Place: a Process for the preservation of Town Character. PDA Publisher Corp. Madison Garnham. H. L. (1976. Maintaining the Spirit of Place: A Guidebook for Citizen/professional Participation in the Preservation and Enhancement of Small Texas Towns.  A & M University Printing. Texas. Jumaylinda. (2007. Kualitas Visual Fasad Bangunan Komersil Seng Hie. Thesis. UGM. Yogyakarta Maryono, Agus; Parikesit, Danang. (2003. Transportasi Sungai Mulai Ditinggalkan. Kompas, 01 Mei 2003 Wrenn, Douglas M, dkk. (1983. Urban Waterfront Development. Urban Land Institute. Michigan

Seismic performance for vertical geometric irregularity frame structures

Science.gov (United States)

Ismail, R.; Mahmud, N. A.; Ishak, I. S.

2018-04-01

This research highlights the result of vertical geometric irregularity frame structures. The aid of finite element analysis software, LUSAS was used to analyse seismic performance by focusing particularly on type of irregular frame on the differences in height floors and continued in the middle of the building. Malaysia’s building structures were affected once the earthquake took place in the neighbouring country such as Indonesia (Sumatera Island). In Malaysia, concrete is widely used in building construction and limited tension resistance to prevent it. Analysing structural behavior with horizontal and vertical static load is commonly analyses by using the Plane Frame Analysis. The case study of this research is to determine the stress and displacement in the seismic response under this type of irregular frame structures. This study is based on seven-storey building of Clinical Training Centre located in Sungai Buloh, Selayang, Selangor. Since the largest earthquake occurs in Acheh, Indonesia on December 26, 2004, the data was recorded and used in conducting this research. The result of stress and displacement using IMPlus seismic analysis in LUSAS Modeller Software under the seismic response of a formwork frame system states that the building is safe to withstand the ground and in good condition under the variation of seismic performance.

Faecal coliform simulation on sewage discharge for an environmentally sustainable township in Medini Iskandar Johor Malaysia

Science.gov (United States)

Teh, Su Yean; Koh, Hock Lye; Lee, Elizabeth; Woo, Wing Thye; Tan, Wai Kiat

2017-11-01

The Medini Iskandar Development is a 2300-acre multi-purpose urban development comprising residential, commercial, educational, business and recreational areas. The developer applied to the Department of Environment (DOE) Johor in July 2008 for approval of the environmental impact assessment (EIA) report for the overall Medini development. A conditional approval of the EIA report was granted by the DOE subject to some conditions, one of which stipulated that sewage effluent from the centralized sewage treatment plant (STP) is not permitted to be discharged into Sungai Pendas. A suitable location for the discharge of sewage into the Selat Johor is to be identified, based on a hydraulic and water quality modelling investigation. This modelling investigation aims to assess the impact of the discharge of treated sewage effluent on the marine water quality and on aquatic life in the Selat Johor. The supplementary EIA report was submitted to the DOE. Approval was granted in December 2011 for the construction of the marine sewage outfall and its operations. This paper presents the sampling and simulation results for key hydraulic and environmental parameters suitable for sustaining acceptable faecal coliform criteria in Selat Johor. Simulation models used include WASP7 developed by USEPA and AQUASEA developed by Vatnaskil Consulting Engineers.

POTENSI LILIN LEBAH HUTAN THE POTENTIAL BEES WAXS FROM WILD BEE

Directory of Open Access Journals (Sweden)

Muhammad Junus

2017-11-01

Full Text Available This research was carried out to examine the ability of forest resources in producing total (amount nest, hive comb lowering and beeswax of giant honey bee. The method used in this research was survey method. This research was conducted in July 2015 in Sialang Honey Community Cooperative (KOPMAS located in Sungai Pagar village, Riau province. The result indicated that a. The research location was suitable for giant honey bee (Apis dorsata development, b. The number of hive combs lowering from 15 trees was 411 combs with 67 times lowering, c. The average of hive comb weight in every lowering was around 40.6 kg. d. Beeswax production at every harvest time was 273.6 kg. The conclusions from this research were: 1. The number of giant honey bee hive combs from various trees and the weight of hive combs were not the same. 2. The amount of beeswax was equivalent to the production of bee hive comb. It is suggested that: 1. The utilization of giant honey bees wax should be designed so it can be used as a commodity to increase people’s incomes. 2. Certain policies are needed to develop giant honey bee activity around forest areas in order to produce more hive comb and beeswax.

A review of the design, construction and development of the PUSPATI project

International Nuclear Information System (INIS)

Ahmad Tajuddin Ali.

1983-01-01

The setting up of the Tun Ismail Atomic Research Centre (PUSPATI) was decided upon in September 1972 and soon after, plans were underway for the purchase of a research reactor and the construction of a research centre to house it. The centre was originally planned to be located at Sungai Buloh about 20 km to the north-west of Kuala Lumpur. However, in September 1978, a decision was made to locate the centre at Bangi, about 32 km to south of Kuala Lumpur. Earth work was started in January 1979 with clearing of the forest at the proposed site. Building construction started in February 1980. By September 1981, the reactor building was practically completed and enable reactor construction to begin. This was finished on July 15, 1982 when the reactor was officially handed over to PUSPATI. Work on the rest of the complex fell behind schedule and was only completed in July 1983 when PUSPATI moved in to occupy the research laboratories. The implementation of the PUSPATI project has been completed not without its share of problems. Its completion also marks the beginning of a new era for the development of nuclear science and technology in this country. This paper reviews the design, construction and development of the entire project. (author)

MORFOLOGI KOTA SOLO (TAHUN 1500-2000

Directory of Open Access Journals (Sweden)

Budi Prayitno

2007-01-01

installations. In 2000s, the city of Solo acquired the city problems like the other cities in Indonesia. The city problems were divided into three aspects as follows: the built environment; the natural environment; and the social environment. The accumulation of those problems made the city grow in decline direction that needs to be fixed by a-sustainable-city design. Abstract in Bahasa Indonesia : Paper ini berusaha mengupas tentang perubahan struktur dan bentuk Kota Solo setelah mengalami perkembangan dari masa ke masa. Metode penelitian dilakukan dengan studi pendekatan kearsipan, baik arsip primer, arsip sekunder maupun arsip fisik. Untuk arsip primer bersumber pada naskah-naskah dokumenter Jawa, seperti parintah, undang-undang, pranatan, piyagem, kakancingan, serat, gugat, penget dan babad. Untuk arsip sekunder bersumber pada buku-buku dari para ahli sejarah (Ricklefs, Lombard, Vorstensteden, Muljana, Notosusanto, Kartodirdjo dll dan hasil riset dari para ahli sejarah arsitektur Jawa (Ronald, Ikaputra, Adishakti dll. Untuk arsip fisik bersumber dari artefak, elemen alam dan tradisi masyarakat yang diperoleh dari survey lapangan. Temuan utama dari studi morfologi Kota Solo pada tahun 1500-2000 adalah, elemen 'tulang' telah tumbuh membentuk berbagai formasi, yaitu memusat, mengelompok dan organik. Elemen 'daging' telah tumbuh secara horisontal, vertikal dan interestisial. Sementara elemen 'darah' telah berkembang dari orang-orang pribumi (Jawa, Madura, Banjar bertambah dengan orang-orang pendatang (Cina, Arab, India, Belanda, dengan mata pencaharian dari agricultural ke non-agricultural. Temuan penting lainnya adalah, Kota Solo tersusun oleh tiga konsep yang berlainan, yang saling tumpang tindih, yaitu konsep organik oleh masyarakat pribumi, konsep kolonial oleh masyarakat Belanda dan konsep kosmologi oleh masyarakat Keraton Jawa. Kota Solo pada tahun 1500-1750 masih berupa kota tepian sungai di Bengawan Solo, kemudian pada tahun 1750-1850 berkembang menjadi kota campuran

Kajian Ketersediaan Air Permukaan pada Beberapa Daerah Aliran Sungai (Studi Kasus di Sub DAS Temon, Wuryantoro, Alang, dan Keduang

Directory of Open Access Journals (Sweden)

Ugro Hari Murtiono

2009-07-01

Full Text Available The study was conducted at some watersheds (Temon, Wuryantoro, Alang, and Keduang sub Watersheds, in Wonogiri District. These four sub Watersheds are Main River whose outlets go into Wonogiri Dam. The study will calculate of water availability and the need of water for various uses at four sub Watersheds. The Thornwaite and Mather method was used to calculate the of water availability. The results indicate that : (1 The water availability at Temon Sub Watershed 35.435.875 m³ and the need of water per year sebesar 51.053.247 m³, the water minus 30,59% per year; (2 The water availability per year Wuryantoro sub Watershed 17.788.417 m³ and the need of water per year 22.413.430 m³, the water minus 20,64% per year; (3 The water availability per year at Alang sub Watershed 31.372.317 m³ per year and the need of water per year 69.566.500 m³, the water minus 54,90% per year; (4 The water availability per year geological at Keduang sub Watershed 438.527.889 m³ and the need of water per year 452.611.219 m³, the water minus 3,11% per year; (5. Watershed having condition needs improvement especially an effective water resourcesplan, allocating, and distributing of water according to priority establishment, e.g., water pond, revegetation with low evapotranspiration potential, developing infiltration well, protecting water spring from disconcerting, and construction of water reservoir.

Morfological Variation of Endemic Fish Rainbow Celebensis (Telmatherina celebensis Boulenger in Lake Towuti, South Sulawesi

Directory of Open Access Journals (Sweden)

S.H. Nasution

2007-08-01

morfologi ikan rainbow Selebensis berdasarkan karakter morfometrik baku pada beberapa stasiun. Penelitian dilakukan di perairan Danau Towuti, Sulawesi Selatan dari bulan Maret 2002 hingga April 2003 pada empat stasiun, yaitu I: Tanjung Bakara, II: inlet Danau Towuti yang berasal dari Sungai Tominanga, III: Pulau Loeha, dan IV: outlet Danau Towuti yang mengalir ke Sungai Hola-hola. Sampel ikan diperoleh dengan menggunakan jaring insang eksperimen (experimental gillnet terdiri dari empat ukuran mata jaring yaitu 3A , 1, VA . dan VA inci. Pengukuran karakter morfometrik ikan menggunakan metode baku yang mengacu pada Kottelat et al. (1993 yang dimodifikasi yang meliputi 14 karakter. Berdasarkan hasil analisis univariat dan multivariat terhadap karakter morfometrik baku di setiap stasiun, dapat dikatakan bahwa ikan jantan dan betina pada stasiun I, II, III, dan IV cenderung sama atau berasal dari satu kelompok populasi ikan. Karakter yang paling berpengaruh pada ikan jantan dicirikan oleh tinggi badan dan panjang dari mulut ke sirip punggung pertama, sedangkan pada ikan betina dicirikan oleh karakter panjang forskal, panjang total, dan panjang dasar sirip punggung kedua. Kata kunci: Variasi morfologis. Telmatherina celebensis, Danau Towuti

Coal fires in Indonesia

Energy Technology Data Exchange (ETDEWEB)

Whitehouse, Alfred E.; Mulyana, Asep A.S. [Office of Surface Mining/Ministry of Energy and Mineral Resources Coal Fire Project, Ministry of Energy and Mineral Resources, Agency for Training and Education, Jl. Gatot Subroto, Kav. 49, Jakarta 12950 (Indonesia)

2004-07-12

Indonesia's fire and haze problem is increasingly being ascribed to large-scale forest conversion and land clearing activities making way for pulpwood, rubber and oil palm plantations. Fire is the cheapest tool available to small holders and plantation owners to reduce vegetation cover and prepare and fertilize extremely poor soils. Fires that escaped from agricultural burns have ravaged East Kalimantan forests on the island of Borneo during extreme drought periods in 1982-1983, 1987, 1991, 1994 and 1997-1998. Estimates based on satellite data and ground observations are that more than five million hectares were burned in East Kalimantan during the 1997/1998 dry season. Not only were the economic losses and ecological damage from these surface fires enormous, they ignited coal seams exposed at the ground surface along their outcrops.Coal fires now threaten Indonesia's shrinking ecological resources in Kutai National Park and Sungai Wain Nature Reserve. Sungai Wain has one of the last areas of unburned primary rainforest in the Balikpapan-Samarinda area with an extremely rich biodiversity. Although fires in 1997/1998 damaged nearly 50% of this Reserve and ignited 76 coal fires, it remains the most valuable water catchment area in the region and it has been used as a reintroduction site for the endangered orangutan. The Office of Surface Mining provided Indonesia with the capability to take quick action on coal fires that presented threats to public health and safety, infrastructure or the environment. The US Department of State's Southeast Asia Environmental Protection Initiative through the US Agency for International Development funded the project. Technical assistance and training transferred skills in coal fire management through the Ministry of Energy and Mineral Resource's Training Agency to the regional offices; giving the regions the long-term capability to manage coal fires. Funding was also included to extinguish coal fires as

ZONASI POTENSI PENCEMARAN AIR TANAH PADA TERAS SUNGAI CODE YOGYAKARTA (Zoning The Potential Groundwater Pollution at Code River Terrace, Yogyakarta

Directory of Open Access Journals (Sweden)

Frista Yorhanita

2001-08-01

Full Text Available ABSTRAK Tujuan penelitian ini ialah untuk membuktikan bahwa biomassa Fusarium sp dapat mereduksi Cr(VI, dan biomassa Aspergillus niger dapat digunakan untuk mengambil ion krom dari larutan. Fusarium.sp ditumbuhkan pada media cair kentang dekftosa cair, ditambah K2Cr2O7 atau sludge limbah penyamakan kulit. Selanjutnya diamati perubahan warnanya, bila terjadi perubahan warna dan oranye ke ungu atau tak berwarna maka telah terjadi reduksi krom valensi VI menjadi krom valensi Ill. Aspergillus niger ditumbuhkan pada media Potato dectrose agar (PDA padat, dipindahkan ke media cair yang bensi bakto pepton, bakto dektrose dan srukronutrien. Produksi biomassa dilakukan pada labu erlenmeyer; setelah 5 hari dipanen dan dibuat bubuk. Bubuk ini digunakan untuk mengambil krom dari larutan. Hasil penelitian menunjukkan bahwa biomassa Fusarium sp dapat digunakan untuk mengambil krom dan larutan yang.mengandung KrCrrO, atau sludge limbah penyamakan kulit. Waktu inkubasi yang lebih lama meningkatkan absorbsi krom oleh biomassa Fascrium sp. Fusarium sp mampu mereduksi Cr(VI menjadi Cr(Iii. Biomassa Aspergillus niger dapat digunakan untuk mengambil krom dari larutan. Hasil terbaik diperoleh pada konsentrasi awal 100 mg/I, pada pH 2,0, berat biomassa 0,1 g, dan waktu kontak 12 jam, yaitu 96,23% untuk Cr(II| dan96,3 % untuk Cr(VI. Fusarium sp. dan A. niger dapat digunakan sebagai bioremediator dalam penanganan limbah penyamakan kulit secara biologi.   ABSTRACT The study area of this research was parts of the code river terraces, Yogyakarta. The aims of this research were as follows: (1 to determine the part of the code river terrace which has potential groundwater pollution; (2 to assess the natural physical factors (aquifer materials, depth of groundwater table, and the groundwater flow distance and the non-natural physical factors of environmental sanitation (houses density, population density, horizontal distance between pollution source and well, and the number of water consumers that influence groundwater pollution; and (3 to estimate the total amount of economical loss that caused by groundwater pollution. The determination of groundwater pollution potential area was done by overlaying aquifer material map, groundwater table depth map, groundwater table gradient map, and soil texture map. The result of the overlay was the potential groundwater pollution map. In order to find out the actual groundwater pollution, a quality test of the groundwater samples was conducted. The parameters of the water quality tested were temperature, electric conductivity, turbidity, CaCO3, NO2 NO3, Fe, Na, Cl, pH, and coli bacteria. Te result of the NO3 test was drawn in an actual groundwater pollution map. The actual groundwater map and the potential groundwater map were compared to know the difference between them. The result of this research showed that the area which had the potential groundwater pollution were those density populated and high houses density. Statistical analysis showed that a non-natural physical factors which has the most significant influence on the groundwater pollution was the groundwater flow distance. Population density and the number of water consumers significantly influence the groundwater pollution. The estimation of economical loss by PDA substitution costs indicated that area which suffered the most financial los was Kotabaru regionan (Rp.18.125.00/month/house.  The estimation of the economical loaa by health substitution costs showed that area suffered the most was Gowongan region (Rp.849.000/year.

ANALISIS PENYEDIAAN DAN PENGGUNAAN AIR SUNGAI PADA RUMAH TANGGA DI PEKON ULU KRUI DAN DI PEKON LAAY KABUPATEN LAMPUNG BARAT

Directory of Open Access Journals (Sweden)

Onnie Violetta Saragi

2012-03-01

Full Text Available 800x600 Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Calibri","sans-serif"; mso-bidi-font-family:"Times New Roman";} The objectives of this research were: 1 to analyze household characteristics in Village Ulu Krui and Village Laay; 2 to analyze knowledge, attitude and pratices of household in water using; 3 to analyze the chemical charactistic of water; and 4 to analyze relation between knowledge and river water usage. The research design is cross sectional. Data was collected by interviewing respondents. Data was analyzed using descriptive and inference statistics. Twenty nine housewife in Village Ulu Krui and twenty housewife in Village Laay were participated as respondents. Results of this research found that the average of family member was four people. Husband age was ranged from twentyfive to seventy three years old. The average of the husband age was fourty four years old. The wife age were range from twenty one to seventy three years old. The average of the wife age was fourty years old. The modus of education of husband was elementry school. The modus of occupation of husband was farmer and farmworker. The level of knowledge in river water usage was low, the level of attitude was moderate, the level of pratices using the river water was good. Keywords: knowledge, attitude, practice, river water

Kandungan Nitrat dan Fosfat Sedimen serta Keterkaitannya dengan Kerapatan Mangrove di Kawasan Mertasari di Aliran Sungai TPA Suwung Denpasar, Bali

Directory of Open Access Journals (Sweden)

Ni Nyoman Desi Kusuma Dewi

2017-06-01

Full Text Available Mangrove is a green plants tolerant of salt water, which grows mainly along the sheltered coastal areas, especially along the bay or in estuaries. Final Disposal (TPA Rubbish Suwung which located in the village Pedungan South Denpasar District is the rubbish dumps originating from the city of Denpasar and Badung. There is a natural mangrove vegetation in the river TPA. Mertsari area which located in the village of Sanur, West Denpasar District is a mangrove planting area and tourism destination on the Mertasari Beach. The purpose of this research are as follows: (1 To identify the content of nitrate and phosphate in mangrove sediments, (2 To determine the density of mangrove in Region Mertasari and TPA Suwung River Flow and (3 To describe the mangrove density is linkage with nitrate and phosphate mangrove sediments. The method used on this research is linear regression. Nitrate and phosphate sediments of mangroves in TPA Suwung River Flow and Region Mertasari range of 0.04 ppm - 79.034 ppm. The average density results of the mangrove tree level, saplings and seedlings in different locations ranged 0.01 ind / m2 - 0.32 ind / m2. The river's flow TPA Suwung produce a simple linear regression calculation of nitrate mangrove sediments density y = -0,002x + 0,288 (R2 10,1 %, and the calculation of the density sedimentary  phosphate mangrove produce y = 0,007x + 0,125  (R2 6,1 %. The results of simple linear regression calculation of nitrate sediments density Mertasari mangrove area is y = -0,002x+ 0,537  R2 = 4,7%, and the calculation of the density sedimentary  phosphate mangrove produce y = -0,038x + 0,777 (R2 63,7 %.

Kinerja Pembangunan Daerah Kabupaten/Kota di Provinsi Jambi

Directory of Open Access Journals (Sweden)

Raina Damarsari

2015-03-01

Full Text Available This study aims (1 to analyze the performances among regencies/ cities in Jambi Province, and (2 to categorize the regencies/ cities in Jambi Province based on economic, human resources, and infrastructure development performances. Datas used in this study are secondary data of 2009-2012 from Statistics Indonesia, consists of eight component indicators to assess the performance of economic development, the five component indicators to assess the performance of the components of human resources development, and eight component indicators to assess the performance of infrastructure development. The analytical method used to achieve the objectives of the first research purposes is principal component analysis (PCA which followed by factor analysis and to achieve the third purpose is cluster analysis. The results showed that (1 Jambi City is ranked first in the overall development performance, followed by of Tanjab Barat and Batang Hari Regencies, (2 four clusters of regencies/ cities in Jambi Province are formed based on the performance of development, namely: cluster I (Kerinci, Merangin, and Tebo Regencies have lower performance of regional development, cluster II (Tanjab Timur Regency has average to high performance of regional development, cluster III (Sarolangun, Batang Hari, Muaro Jambi, Tanjab Barat, Bungo Regencies, and Sungai Penuh City have average performance of regional development, and cluster IV (Jambi City has high performance of regional development.

Land Exploration Study and Water Quality Changes in Tanah Tinggi Lojing, Kelantan, Malaysia

International Nuclear Information System (INIS)

Wan Adi Yusoff; Mokhtar Jaafar; Mohd Khairul Amri Kamarudin; Mohd Khairul Amri Kamarudin; Mohd Ekhwan Toriman; Mohd Ekhwan Toriman

2015-01-01

Land exploration activities in the highlands areas without mitigation can give more impact on the environment health in the river basin. Tanah Tinggi Lojing Gua Musang is one of the commercial areas developed for agricultural activities. Sungai Belatop is one of the affected river at Tanah Tinggi Lojing. This article was conducted to investigate the relationship of land development and water quality changes in the Belatop river basin.The study was conducted by analyzing data from the Department of Environment starts from February to October 2012. The results indicated the development of land exploration activities in the Tanah Tinggi Lojing area has affected on water quality parameters in the area. Where, the suspended sediment (SS) is high with 1161 mg/L, turbidity value is 991 (NTU) and this parameters is increasing on the rainy season impacted from surface erosion and surface runoff at land is not covered. Magnisium content also has increased from 0.66 mg/L to 1.38 mg/L. The high content magnesium result is from fertilizers used in agricultural activities in the study area. Chemical fertilizers content excessive causes the contents of calcium (Ca) high (3.18 mg/L). Ferum content in the water has also exceeded (0.3 mg/L), in Class IIA/B and Class III by WQI. Therefore, some recommendations is proposed to reduce and solving this problem. (author)

Removal of iron and manganese using granular activated carbon and zeolite in artificial barrier of riverbank filtration

Science.gov (United States)

Ismail, Abustan; Harmuni, Halim; Mohd, Remy Rozainy M. A. Z.

2017-04-01

Iron and Manganese was examined from riverbank filtration (RBF) and river water in Sungai Kerian, Lubok Buntar, Serdang Kedah. Water from the RBF was influenced by geochemical and hydro chemical processes in the aquifer that made concentrations of iron (Fe), and manganese (Mn) high, and exceeded the standard values set by the Malaysia Ministry of Health. Therefore, in order to overcome the problem, the artificial barrier was proposed to improve the performance of the RBF. In this study, the capability and performance of granular activated carbon, zeolite and sand were investigated in this research. The effects of dosage, shaking speed, pH and contact time on removal of iron and manganese were studied to determine the best performance. For the removal of iron using granular activated carbon (GAC) and zeolite, the optimum contact time was at 2 hours with 200rpm shaking speed with 5g and 10g at pH 5 with percentage removal of iron was 87.81% and 83.20% respectively. The removal of manganese and zeolite arose sharply in 75 minutes with 90.21% removal, with 100rpm shaking speed. The GAC gave the best performance with 99.39% removal of manganese. The highest removal of manganese was achieved when the adsorbent dosage increased to 10g with shaking speed of 200rpm.

Melioidosis in acute cholangitis of diabetic patient: a forgotten diagnosis

Directory of Open Access Journals (Sweden)

Mohamad N

2012-08-01

Full Text Available Nasir Mohamad,1 Suresh Ponnusamy,2 Sunita Devi,3 Rishya Manikam,4 Ilya Irinaz Idrus,1 Nor Hidayah Abu Bakar51Department of Emergency Medicine, School of Medical Sciences, Universiti Sains Malaysia, Kubang Kerian, Malaysia; 2AIMST University, Bedong, Malaysia; 3Hospital Sultan Abdul Halim, Sungai Petani, Malaysia; 4University Malaya Medical Centre, Kuala Lumpur, Malaysia; 5Department of Pathology, Hospital Raja Perempuan Zainab II, Kota Bharu, MalaysiaAbstract: Melioidosis presents with a wide range of clinical presentations, which include severe community-acquired pneumonia, septicemia, central nervous system infection, and less severe soft tissue infection. Hence, its diagnosis depends heavily on the clinical microbiology laboratory for culture. In this case report, we describe an atypical presentation of melioidosis in a 52-year-old man who had fever, right upper-abdominal pain, and jaundice for 15 days. Melioidosis caused by Burkholderia pseudomallei was subsequently diagnosed from blood culture. As a primary care physician, high suspicion index is of great importance. High suspicion index of melioidosis in a high-risk group patient, such as the patient with diabetes mellitus and diabetic foot, is crucial in view of atypical presentations of pseudomonas sepsis. A correct combination of antibiotic administration in the early phase of therapy will determine its successful outcome.Keywords: Burkholderia pseudomallei, atypical, high suspicion, primary care

Ekonomi Politik Penyelesaian Konflik Batas Daerah Antara Kota Cirebon dan Kabupaten Cirebon

Directory of Open Access Journals (Sweden)

Agung Firmansyah

2014-05-01

Full Text Available Batas daerah menjadi isu yang sangat penting sejak era otonomi daerah berlangsung di Indonesia. Pemerintah daerah menjadi terdorong untuk mengetahui secara pasti batas-batas wilayah kewenangannya terutama yang memiliki potensi sumber daya yang mendukung pendapatan asli daerah dalam menjalankan otonomi daerah. Konflik batas daerah mengacu pada konflik yang terjadi antara pemerintah daerah pada tingkatan yang sama dalam rangka perebutan batas daerah. Konflik batas daerah antara Kabupaten Cirebon dan Kota Cirebon sudah berlangsung sejak tahun 1988. Berlarut-larutnya penyelesaian konflik batas daerah ini berkaitan dengan ekonomi politik yang ada di tujuh titik batas yang masih disengketakan. Permasalahan yang diteliti adalah asal mula/titik pangkal terjadinya konflik batas daerah dan perkembangan penyelesaian konflik batas daerah. Penelitian ini menggunakan metode deskriptif dengan pendekatan kualitatif dan analisis data yang yang digunakan adalah model interaktif. Hasil penelitian menunjukkan bahwa lamanya penyelesaian konflik antara Kota Cirebon dan Kabupaten Cirebon disebabkan oleh faktor sumber daya khususnya aspek ekonomi di tujuh titik batas daerah yang disengketakan. Pada dasarnya asal mula/titik pangkal terjadinya konflik batas daerah ini disebabkan oleh perbedaan penafsiran pembentukan kota/kabupaten, undang-undang pembentukan kota/kabupaten yang tidak mencantumkan batas-batas daerahnya, kebijakan pelurusan sungai, perbedaan peta dasar acuan, tidak ada koordinasi antardaerah, ketiadaan regenerasi kepemimpinan yang baik, dan pengaruh pembangunan DKI Jakarta. Konflik menjadi rumit karena dipengaruhi beberapa faktor yaitu kepentingan, kebijakan, dan kelembagaan.

The invasion of leptochloa chinensis (L.) nees in the MUDA area

International Nuclear Information System (INIS)

Hamdan Pane; Mashhor Mansor; Ho Nai Kin

2002-01-01

In 1981, red sprangletop (Leptochloa chinensis (L.) Nees] was first observed at site 2 (Sungai Udang) in the southern part of the Muda area. In the first cropping season of 1984, the populations of L. chinensis expanded to three sampling sites. Consequently, the populations gradually spread to other parts of the Muda area. In 1986, the infestations were recorded at sampling site 6 (Kubang Pangas) which is about 50 km from the original infestation sites. In 1988, most of the southern parts of Muda area were colonized by this weed. In 1990, the populations reached the northern part of Muda area. The whole Muda area was finally covered with L. chinensis by 1992. From 1981 until 1994, the increase of area infested per unit time was estimated at about 4% of the area based on the previous year's record. The intensive survey conducted in 1994 from the 20 sampling sites showed that in addition to L. chinensis, twelve dominant weed species were also recorded. However, by far the single most dominant weed species was L. chinensis. Based on the spatial quantitative vegetative analysis, L. chinensis populations were predominantly recorded in 75% of the sampling sites. The L. chinensis populations were also observed to thrive well on slightly acidic rice fields with pH values ranging from 4.0 to 6.8. (Author)

Detergent Disposal into Our Environmentand Its Impact on Marine Microbes

Science.gov (United States)

Effendi, I.; Nedi, S.; Ellizal; Nursyirwani; Feliatra; Fikar; Tanjung; Pakpahan, R.; Pratama

2017-12-01

Detergents figure in an extensive array of industrial and home cleaning applications, released into the flow of wastewater coming from the home, can far-reaching environmental impacts. Microorganisms are crucial to nutrient recycling in ecosystems as they act as decomposers, pathogen, antibiotic producer, biodegradation of pollutants etc. The research is aimed to examine effect detergent disposal to bacterial population growth in marine environment both in vitro and in situ condition. Seawater samples were collected from Sungai Kayu Ara Village, and Dumai River estuary, Siak Regency and Dumai City, Riau Province. Experimental method with complete randomized design (RAL) 2 (two) factors; a detergent brand (a1: ATTACK, a2; RINSO and a3; SURF) and b concentration of detergent concentration with 5 (five) concentration level, b1 (0%) as control, b2 (0.3%), b3 (0.6%), b4 (0.9%) and b5 (1.2%) wass applied. The study showed that there was an effect of detergent addition, periode of exposure, and doses to the growth of bacterial population both in vitro and in situ conditions. The higher levels of detergent in the water column and the longer contamination duration, causing more and more depressed bacterial populations. It is suggested to run a further research on identification, and growth optimatioan of the species capable of degrading detergent.

DINAMIKA KOMUNITAS PLANKTON DI PERAIRAN EKOSISTEM HUTAN BAKAU SEGARA ANAKAN YANG SEDANG BERUBAH (Plankton Dynamic in the Changing Mangrove Ecosystem of Segara Anakan Central Java

Directory of Open Access Journals (Sweden)

Tjut Sugandawaty Djohan

2010-11-01

Full Text Available ABSTRAK Perairan hutan bakau Segara Anakan merupakan ekosistem yang sedang berubah karena sedimentasi yang tinggi sejak tahun 1980, dan telah mengakibatkan pendangkalan perainan dan mengganggu proses pasang surut. Perubahan ekosistem ini direspon oleh komunitas plankton. pada musim hujan tabun 2002 salinitas perairannya adalah 0 0/00' dan musim kemarau 20 – 32%. Perubahan komunitas plankton tersebut dicirikan hadimya komunitas baik phyto maupun zooplankton dominan sungai pada musim hujan, dan sebaliknya komunitas laut pada musim kemarau. Pada tahun 2004, karena pendangkalan di perairan Bondan, mudflat dan perairannya dikeruk. Penelitian ini bertujuan untuk mempelajari respon komunitas phyto dan zooplankton terhadap pernbanan ekosistem pada musim kemarau Agustus 2005 di daerah tangkapan ikan nelayan perairan Segara Anakan. Hasil menunjukkan bahwa ada peledakan kemelimpahan phytoplankton yang didommasi olehl populasi Chaetoceros di perairan Bondan dan Klaces sebanyak 206890 dan 397273 individu per 100 liter, dan populasi  Asterione/lajaponica meningkat sebanyak 69778 per 100 liter di perairan Cigatal. Peledakan kedua genus tersebut adalah merupakan respon phytoplankton terhadap meningkatnya kandungan PO4 di perairan oleh pengerukan sedimen di perairan Bondan. Kenaikan P04 di perairan berturut-berturut dari Bondan ke Cigatal sebesar 4,95 ppm, 5,88 ppm, dan 4,62 ppm. Pada musim kemarau, perairan Segara Anakan juga dicirikan dengan hadimya komunitas plankton sungai yaitu sebanyak 19 species phytoplankton, dan 9 spesies zooplankton. Peledakan populasi Chaetoceros tidak direspon oleh peledakan populasi zooplankton. Keadaan ini mencerminkan bahwa kualitas perairan Segara Anakan telah menurun.   ABSTRACT The mangrove ecosystem of Segara Anakan is in the process of changing to the freshwater-wetland due to the heavy sedimentation. This change was responded by the plankton communities. In the 2002 during the rainy season, the salinity

Hydrological Analysis for Inflow Forecasting into Temengor Dam

Science.gov (United States)

Najid, MI; Sidek, LM; Hidayah, B.; Roseli, ZA

2016-03-01

These days, natural disaster such as flood is the main concern for hydrologists. One of solutions in understanding the reason of flood is by prediction of the event sooner than normal occurrence. One of the criteria is lead time or travel time that is important in the study of fresh waters and flood events. Therefore, estimation of lead or travel time for flood event can be beneficial primary information. The objective of this study is to estimate the lead time or travel time for outlet of Temengor dam in Malaysia. Tenaga Nasional Berhad (TNB) Sungai Perak dam operation has the main contribution on decision support for early water released and flood warning to authorities and locals resident for in the down streams area. For this study, hydrological analysis carried out will help to determine which years that give more rainfall contribution into the reservoir. Rainfall contribution of reservoir help to understanding rainfall distribution and peak discharge on that period. It also help for calibration of forecasting model system for better accuracy of flood hydrograph. There may be various methods to determine the rainfall contribution of catchment. The result has shown that, the rainfall contribution for Temengor catchment, is more on November in each year which is the monsoon season in Malaysia. TNB dam operational decision support systems can prepare and be more aware at this time for flood control and flood mitigation.

Malnutrition risk and its association with appetite, functional and psychosocial status among elderly Malays in an agricultural settlement.

Science.gov (United States)

Suzana, S; Boon, P C; Chan, P P; Normah, C D

2013-04-01

Malnutrition is a common phenomenon among the elderly and quite often related to psychosocial problems. The objective of this study was to determine malnutrition risk and its association with appetite, functional and psychosocial status among elderly Malays in an agricultural settlement, i.e. FELDA Sungai Tengi, Selangor. A cross-sectional study was conducted among 160 subjects (men = 36.2%), with a mean age of 65.0 +/- 3.9 years, who were interviewed to obtain information on malnutrition risk and appetite using Mini Nutritional Assessment Short Form and Simplified Nutritional Appetite Questionnaire, respectively. Functional status was determined using Instrumental Activities of Daily Living (IADL), Elderly Mobility Scale (EMS) and handgrip strength. Mini Mental Status Examination (MMSE), Geriatric Depression Scale and De Jong Gierveld Loneliness Scale were used to identify cognitive impairment, depressive symptoms and loneliness status of subjects respectively. A total of 42.5% of subjects were at risk of malnutrition and 61.2% had poor appetite. The mean scores of IADL and EMS were lower in subjects at risk of malnutrition, compared to those who were not at high risk (p risk was predicted by poor appetite, decreased functional status (IADL) and depression. Malnutrition risk was prevalent and associated with poor appetite, functional status and psychosocial problems among the elderly subjects. The psychosocial aspect should also be incorporated in nutrition intervention programmes in order to improve mental well-being and functional independancy.

Validasi Algoritma Estimasi konsentrasi Klorofil-a dan Padatan Tersuspensi Menggunakan Citra Terra dan Aqua Modis dengan Data In situ (Studi Kasus : Perairan Selat Makassar

Directory of Open Access Journals (Sweden)

Endang Prinina

2017-01-01

Full Text Available Klorofil-a dan Padatan Tersuspensi (TSS merupakan parameter fisik kualitas perairan. Pigmen klorofil-a memiliki daya serap yang tinggi pada gelombang tampak biru dan merah. TSS merupakan zat padatan sedimentasi dari aliran sungai yang membawa material-material organik maupun anorganik. Kandungan TSS yang tinggi sangat mengganggu proses fotosintesis pada fitoplankton yang merupakan produsen penghasil zat klorofil-a. Sehingga TSS juga mampu menyerap gelombang tampak. Kemampuan klorofil-a dan TSS dalam menyerap gelombang tampak dapat di amati dengan menggunakan teknologi penginderaan jauh. Pemanfaatan teknologi ini membutuhkan algoritma dalam menentukan nilai estimasi konsentrasi klorofil-a dan TSS. Penelitian ini menggunakan citra Terra dan Aqua MODIS. Penelitian ini bertujuan untuk memvalidasi hasil algoritma klorofil-a dan TSS yang telah ada dalam perangkat lunak SeaDAS 7.3.1. Dari hasil penelitian ini didapatkan koreksi atmosfer terbaik dalam pendugaan klorofil-a dan TSS yaitu koreksi atmosfer MUMM. Dari hasil pemetaan klorofil-a dan TSS menghasilkan nilai NMAE sebesar 158,34% dan 65,28%. Hal ini menunjukkan bahwa algoritma empiris ini tidak dapat diterapkan pada Selat Makassar. Sebaran klorofil-a terendah sebesar 0,105 µg/l dan tertinggi sebesar 0,783 µg/l pada citra Terra MODIS. Sedangkan sebaran TSS terendah 0,02 mg/l dan tertinggi 6,88 mg/l pada citra Terra MODIS. Citra Terra MODIS lebih baik dalam pendugaan klorofil-a dan TSS dengan menggunakan algoritma empiris di SeaDAS 7.3.1 daripada menggunakan citra Aqua MODIS.

Determination of carbon and nitrogen in litter fall of mangrove ecosystem in peninsular Malaysia

International Nuclear Information System (INIS)

Hemati, Z.; Hossain, M.

2017-01-01

Mangroves in Peninsular Malaysia are typical of tropical forest setting. Nevertheless, the state of the mangrove forests has led to various classifications; natural and degraded mangroves. The study aimed to utilize litter fall (production and standing crop) potential as a means of evaluating the degree of productivity of the mangrove types across seasons, in addition to determining the abundance of carbon and nitrogen in the Peninsular mangrove forest. Leaf litter accounted for more than 70% of the total litter production in both natural and degraded mangroves, and the peak month for such production was December; 82.7% and 82.2%, for Sungai Haji Dorani and Kuala Selangor Nature Park, respectively. The degraded mangrove recorded higher concentration of total N (6.16 mg/g) than the natural mangrove forest (5.60 mg/g) at significant level. However, the organic carbon (CO) content across the litter parts varied with the three seasons. The CO of leaf litter was at the peak during the dry season, however, analysis on the branch and fruit revealed that during the intermediate and wet seasons CO level could be higher than the concentration observed at dry season. Though, the study concluded that both mangrove types in Peninsular Malaysia showed high similarity in the degree of litter production, yet the identified differences suggest that counter measures need to be adopted in order to protect mangroves from degradation and possible productivity loss. (author)

Risk Assessment of Aluminum in Drinking Water between Two Residential Areas

Directory of Open Access Journals (Sweden)

Aizat I. Syazwan

2011-09-01

Full Text Available A cross-sectional study was conducted at Sungai Lembing (SL and Bukit Ubi (BU, Kuantan, Malaysia. The main objectives of this epidemiological study were to determine the aluminum concentration in drinking water, to compare with the government standard and to perform health risk assessment prediction among respondents from these two residential areas. A total of 100 respondents were selected from the study areas based on a few inclusive and exclusive criteria. Two duplicates of treated water samples were taken from each respondent's house using a 200 mL high-density polyethylene (HDPE bottle and 0.4 mL (69% pure concentrated nitric acid added as preservative. Aluminum concentrations were analyzed using Lambda 25 UV/V spectrophotometer. The result showed that the mean concentration of aluminum in drinking water from SL was 0.11 ± 0.0634 mg/L and 0.12 ± 0.0462 mg/L for BU. The mean value of Chronic Daily Intake (CDI in SL (0.0035 ± 0.0028 mg/kg/day was lower compared to BU (0.0037 ± 0.0021 mg/kg/day. The Hazard Index (HI calculation showed all respondents had HI less than 1. In conclusion, there was unlikely potential for adverse health effects from aluminum intake in drinking water. However, it was necessary for some action to be taken in order to reduce aluminum levels found in drinking water in both locations.

Measurement of radioactivity and heavy metal levels in edible vegetables and their impact on Kuala Selangor communities of Peninsular Malaysia

International Nuclear Information System (INIS)

Asaduzzaman, Kh.; Khandaker, M.U.; Amin, Y.M.; Zainuddin, Z.; Farook, M.S.; Bradley, D.A.

2015-01-01

Vegetable is an essential daily diet item for the people of Malaysia. This work addressed the radiation and heavy metal exposure scenarios through the consumption of vegetables. Kuala Selangor is located in Sungai Selangor estuary in the west coast of Peninsular Malaysia, which is susceptible to pollution load due to the presence of large-scale industrial and human activities. Radioactivity and heavy metals level in human diet is of particular concern for the assessment of possible radiological and chemical hazards to human health. Therefore, a comprehensive study was carried out to determine the radioactivity levels ( 226 Ra, 228 Ra and 40 K) and heavy metal concentrations (Cr, As, Cd, Mn, Mg, Al, Sr, Rb, Sb, Ba, Hg, Fe, Ni, Zn, Cu, Bi and Pb) in 10 varieties of vegetable collected from different farmlands in Kuala Selangor region. The committed doses for 226 Ra, 228 Ra and 40 K due to consumption of vegetables were found 16.6±1.3, 23.6±1.7 and 58±5 μSv y -1 , respectively, with a total of 98±8 μSv y -1 . This dose imposes no significant threat to human health. The estimated cancer risk shows that probability of increase in cancer risk from daily intake of vegetables is only a minor fraction of International Commission on Radiological Protection values. The concentrations of heavy metal were below the daily intake recommended by the international organisations. (authors)

Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing.

Science.gov (United States)

Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

2015-01-01

The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0-9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community.

Penerapan Enterprise Resource Planning (ERP pada Sistem Pembelian, Penjualan dan Inventory Barang di Mini Market 7 Putra

Directory of Open Access Journals (Sweden)

Andre Nofriandi

2015-10-01

Full Text Available 7 Putra is one of the mini market located on the Pasar Sungai Sariak. Purchasing, sales, and inventory of goods on this market mini is done without using a computer. It can be seen from the process of buying new goods, the receipt of goods, payment to suppliers, inventories in storage, movement of goods, sales of goods and payments from customers. ll of the above processes suffer from the financial constraints and poorly controlled. Application development Enterprise Resource Planning (ERP in a mini-market 7 Putra to assist and facilitate the process of purchase, sales and inventory items. Implementation of ERP in 7 Putra done through several stages of the business process analysis, analysis of ERP selection, ERP implementation and ERP testing. In filming the analysis of business processes, use BPMN (Business Process Modeling Notation. The module used in this research is the main module purchase, sales, as well as items and inventory. Before the implementation of ERP. ERP selection was done according to the 7th Round. The results of the election analysis showed FrontAccounting application is an application that is suitable for 7 Putra. ERP implementation is done by using the application FrontAccounting. System testing is done to check and make sure it is appropriate and ERP applications can run as expected. The test is based on existing business processes in 7 Putra. Results of testing ERP accordance with existing reporting and business processes in the 7th Round

Birds communities of fragmented forest within highly urbanized landscape in Kuala Lumpur, Malaysia

Science.gov (United States)

Mohd-Taib, F. S.; Rabiatul-Adawiyah, S.; Md-Nor, S.

2014-09-01

Urbanization is one form of forest modification for development purposes. It produces forest fragments scattered in the landscape with different intensity of disturbance. We want to determine the effect of forest fragmentation towards bird community in urbanized landscapes in Kuala Lumpur, namely Sungai Besi Forest Reserve (FR), Bukit Nenas FR and Bukit Sungei Puteh FR. We used mist-netting and direct observation method along established trails. These forests differ in size, vegetation composition and land use history. Results show that these forests show relatively low number of species compared to other secondary forest with only 39 bird species recorded. The largest fragment, Sg. Besi encompassed the highest species richness and abundance with 69% species but lower in diversity. Bukit Nenas, the next smallest fragment besides being the only remaining primary forest has the highest diversity index with 1.866. Bkt. Sg. Puteh the smallest fragment has the lowest species richness and diversity with Shanon diversity index of 1.332. The presence of introduced species such as Corvus splendens (House crow) in all study areas suggest high disturbance encountered by these forests. Nonetheless, these patches comprised of considerably high proportion of native species. In conclusion, different intensity of disturbance due to logging activities and urbanization surrounding the forest directly influenced bird species richness and diversity. These effects however can be compensated by maintaining habitat complexity including high vegetation composition and habitat structure at the landscape level.

Field studies of hydrodynamic conditions and fine-sediment suspension in the Kapar coastal region, Malaysia

International Nuclear Information System (INIS)

Abdul Kadir Ishak

2006-01-01

Field studies to determine the hydrodynamics and fine-sediment transport were carried out at the Kapar coastal region, on the west coast of the Malaysian Peninsula. Several observation stations were established to measure near-bed tidal currents, suspended sediment concentration (SSC), water temperature, salinity and tidal elevation. It was found that resuspension (erosion) and deposition of fine sediment occurred during every tidal cycle, with greater transport occurred during the ebb than the flood. This become the major source of fine sediment that contribute to the siltation problem in this region. The high resuspension and entrainment of sediment into the flow column was due to a high near-bed current velocity which was at its peak at 1.3 m/s (during spring tides) and easily-eroded fine particles recently settled during previous tidal cycles. Significant erosion (and deposition) took place during the spring tides but little erosion was observed during the neap. The secondary source of fine sediment is from Sungai Kelang transported to the area by ebb currents in particular during spring tides. The measurement data also showed that the current flows around an industrial construction, the Kapar power station, had been modified and greatly reduced, which had resulted in a significant siltation problem in this region. This study contributes to a better understanding of the influence of hydrodynamics on the physical processes relating to the resuspension, transport and deposition of the fine-sediment in this region. (Author)

KERUGIAN FINANSIAL AKIBAT KECACINGAN: STUDI DI KABUPATEN NUNUKAN

Directory of Open Access Journals (Sweden)

Liestiana Indriyati

2015-04-01

Full Text Available ABSTRACTHelminthiasis is one cause of nutritional anemia that impairs cognitive function, productivity and physical growth and development of children. This paper discuss the nutritional and financial losses caused by the helminthiasis. This study was observational research using cross-sectional design. The population were all primary school children in Nunukan, the number of sample were 1126 school age children enrolled in nine primary health centers working area (Nunukan, Sedadap, Setabu, Sungai Nyamuk, Aji Kuning, Sembakung, Pembeliangan, Mansalong and Sanur during March to December 2010. Ascaris lumbricoides consume carbohydrates as much as 0.14 g/worm/day and 0.035 g protein/day. While Trichuris trichiura fed on blood as much as 0,005 cc/ worm/day and Hookworm as much as 0.2 cc/worm/day. The price of carbohydrates assumed to be the rice price Rp.7.199,49/kg, the price of protein assumed to be beef price Rp.30.000/kg and blood Rp.250.000/pack 250cc (Rp.1000/cc. The results showed that prevalence of ascariasis was 10.3 percent, trichuriasis 8.97 percent and hookworm 2.93 percent . Based on the calculation of nutrients and financial losses, during 2010 Nunukan suffered loss of carbohydrate of 2068.9 kg/year worth Rp. 14.895.075,- , protein loss of 517.23 kg/year worth Rp.32.530.588,- , and blood loss amounted to 1,220,241.17 cc/year worth Rp.1.220.241.100,- the total financial losses due to helminthiasis amounted to Rp.1.276.666.763,-.Keywords : helminthiasis,nutrition, financial disadvantageABSTRAKKecacingan disebabkan oleh infestasi cacing parasit merupakan salah satu penyebab anemia gizi, dapat mempengaruhi tingkat kecerdasan, produktivitas, pertumbuhan serta perkembangan fisik dan mental anak-anak. Kecacingan juga menyebabkan gangguan kemampuan belajar, dan dalam jangka panjang akan berakibat menurunnya kualitas Sumber Daya Manusia (SDM. Tulisan ini membahas tentang perhitungan kerugian nutrisi dan finansial yang diakibatkan oleh penyakit

Sistem Perdagangan Risiko Bencana dalam Pengelolaan Banjir Antar-Wilayah

Directory of Open Access Journals (Sweden)

Sakinah Fathrunnadi Shalihati

2016-10-01

Full Text Available ABSTRAK Tujuan diteliti ini adalah: 1 Untuk mengidentifikasi dan menganalisis perbedaan mutlak antara daerah menurut kabupaten / kota di Bengawan Solo DAS tahun 2007, (2 Untuk mengidentifikasi dan menganalisis risiko banjir pada tahun 2007 di wilayah dalam administratif di Bengawan Solo Daerah Aliran Sungai , 3 Untuk mengidentifikasi dan menganalisis keseimbangan risiko perdagangan bencana spasial dalam pengelolaan banjir antar-wilayah di Bengawan Solo DAS. Penelitian ini menggunakan metode analisis deskriptif. Data dianalisis secara kualitatif dan kuantitatif. Aspek perbedaan mutlak antar-daerah dan ketinggian wilayah diambil sebagai data. Data berdasarkan perbedaan mutlak aspek antar-daerah (nilai positif adalah pertumbuhan ekonomi dan produk domestik regional bruto per kapita. Data yang didasarkan pada daerah ketinggian (nilai negatif yang Images SRTM, frekuensi banjir dan hasil dari kerugian banjir. Untuk menganalisis neraca perdagangan dari risiko banjir dengan menganalisis hasil nilai-nilai positif dan negatif. Hasil penelitian menunjukkan bahwa perbedaan mutlak di antar-wilayah administratif dalam Bengawan Solo Daerah Aliran Sungai tahun 2007 menjadi yang parameter dilakukan dengan menganalisis hasil penilaian kemampuan daerah berdasarkan pertumbuhan ekonomi dan produk daerah gros domestik nilai kapita per dalam manajemen sumber daya, sedangkan analisis risiko banjir Tahun 2007 menjadi adalah parameter dilakukan dengan menganalisis hasil dari kemampuan daerah yang memiliki potensi banjir berisiko tinggi atau tidak memiliki potensi banjir berisiko tinggi. Perbedaan mutlak di daerah antar analisis risiko banjir administrasi dan wilayah menghasilkan risiko wilayah banjir shceme dari perdagangan memisahkan menjadi dua shemes; subsidi penerima dan pemasok hulu / hilir, di mana hulu dan hilir dapat complet tanpa batas topografi pertimbangkan.   ABTRACT The objectives of this researched are: 1 To identify and to analyze absolute difference

THE DIFFERENCE IN PEOPLE’S RESPONSE TOWARD NATURAL LANDSCAPE BETWEEN UNIVERSITY STUDENTS OF JAPAN AND INDONESIA (Perbedaan dalam Respon Manusia terhadap Lanskap Alami antara Pelajar Jepang dan Indonesia

Directory of Open Access Journals (Sweden)

Prita Indah Pratiwi

2014-10-01

, but differences had been found in landscape recognition based on the way of seeing landscape.   ABSTRAK Manusia dalam budaya yang berbeda membedakan respon mereka terhadap lingkungan, khususnya dalam interpretasi dan pemahaman lanskap yang dilihat atau dirasakan. Dalam rangka merencanakan dan mengelola lingkungan untuk pemilihan lanskap dengan tujuan perawatan khusus, perlindungan, dan kenyamanan, sangat penting bahwa manusia berpartisipasi secara efektif dan mengukur nilai-nilai eksisting yang alam berikan bagi penduduk lokal. Preferensi lanskap alami penting dalam perencanaan lanskap dari sudut pandang wisata. Tujuan dari penelitian ini adalah untuk mengklarifikasi perbedaan dalam pengenalan lanskap di Jepang dan Indonesia dan menemukans elemen lanskap yang dinilai tinggi. Penelitian ini dilaksanakan dengan enam tahapan, yaitu pengumpulan foto, pengelompokkan foto, evaluasi preferensi, evaluasi eksotisme, analisis dan rekomendasi. Analisis klaster (metode Ward, jarak Euclidian kuadrat digunakan untuk analisis kelompok foto dan uji Mann-Whitney U digunakan untuk menguji perbedaan nyata. Dalam pengelompokan foto, tujuh foto lanskap alami di Jepang dan Indonesia dikelompokkan ke dalam grup yang berbeda. Foto hutan dikelompokkan sebagai lahan basah oleh pelajar Jepang. Dua foto sungai, danau, dan hutan dikelompokkan oleh pelajar Indonesia, tetapi pelajar Jepang mengelompokkannya sebagai hutan dan gunung pada jarak jauh. Pelajar Jepang juga membedakan lahan basah sebagai lahan basah pada jarak jauh dan lahan basah pada jarak dekat. Hasil evaluasi preferensi menunjukkan bahwa perbedaan nyata ditemukan pada 25 foto dari 68 foto. Evaluasi eksotisme menemukan perbedaan nyata dalam 48 foto dari 68 foto. Pelajar Jepang dan Indonesia tidak memilih hutan dan lahan basah. Namun, keduanya lebih memilih air terjun dan pesisir daripada jenis lanskap lainnya. Berdasarkan evaluasi eksotisme, sungai dan lahan basah tidak dipilih, sedangkan pesisir dan air terjun lebih dipilih oleh

STRUKTUR KOMUNITAS MAKROZOOBENTOS PADA TIGA MUARA SUNGAI SEBAGAI BIOINDIKATOR KUALITAS PERAIRAN DI PESISIR PANTAI AMPENAN DAN PANTAI TANJUNG KARANG KOTA MATARAM LOMBOK

Directory of Open Access Journals (Sweden)

HUSNAYATI HARTINI

2015-06-01

Full Text Available Increasing the human activity may lead to decrease utilization of river waters quality. The purpose of this study were to find out structure of macrozoobenthos community as bioindicator of waters quality in three estuaries of Ampenan district; find out the chemical and physical conditions of waters; determine the relationship of physical chemical of waters and macrozoobenthos diversity indices. The study was conducted by dividing of each estuary into 10 stations. Community structure and physical chemical waters parameters was analyzed descriptively. The relationship of physical and chemical waters quality parameters with macrozoobenthos diversity indices was analyzed by regression. The results showed that 8 species found in the estuary of Berenyok, 11 species in the estuary of Ancar and 12 species in the estuary of Jangkok. Conditions of community structure in three estuaries balanced enough up to unstable. Physical and chemistry waters quality in three estuaries are still below the quality standard except for Hg. In Berenyok and J angkok estuaries Hg values obtained in excess of standard quality. Pollution levels in the three estuaries ranging from moderate to heavily polluted. There is a linear correlation between macrozoobenthos diversity indices and DO parameter in each estuary.

STRATEGI ADAPTASI NELAYAN LANJUT USIA DAN HUBUNGANNYA DENGAN KETAHANAN SOSIAL. STUDI KASUS DI NAGARI AIR BANGIS, KECAMATAN SUNGAI BEREMAS, KABUPATEN PASAMAN BARAT

Directory of Open Access Journals (Sweden)

Ermayanti .

2014-09-01

Full Text Available Human existence as living beings will keep trying to make ends meet, despite his advanced age. Reality that they are not engaged by the employer group requiring them to implement various strategies in order to fulfill the necessities of life for yourself and family is maintained. This is possible as an option strategy adaptation in the elderly fishermen anticipate the changes that occur in the life of the fishing community. This study aims to describe the fishing community adaptation strategies in the face of the elderly. Future elderly fishing communities are determined based on the socio-cultural level of productivity that is generated, are still actively searching for fish on the high seas or just along the coast. Productive age limit directly affects the revenue lost fishermen. This fact led to the emergence of a variety of problems experienced by elderly fishermen, both from the economic, psychological, social and cultural. The families of elderly fisherman as the unit of analysis in this study have similar characteristics with elderly fishermen in general. A qualitative approach is emphasized in the process of collecting and analyzing the data. For that, although using the analysis in several families of elderly fishermen, but the problems are representative of elderly fisherman can span the 'hierarchy. The results showed that the main strategy applied elderly fisherman is still maintaining fishermen job, considering the social and cultural environment sulir fishing communities offer alternatives for another job. In addition, elderly family strategy in fulfilling its economy is the income earned, usually in debt to the tauke or indebted to anyone who would give him a loan debt. Aside from the elderly fisherman fishermen borrow another boat and look for alternative livelihoods outside between fishermen, such as gathering firewood to be sold to people in need. In addition, the results showed that elderly fisherman efforts to realize social security is to improve safety in these villages with mutual respect, tolerance and collaboration, because the villagers' Air Bangis already feel safe. In Nagari Air Bangis rarely finds conflicts between fishermen here, even if there was only a small problem, which can be directly solved maslaah. Usually the elderly fisherman to keep track of security among citizens just always maintain good relations between people, mutual help for anyone who needs and mutually saluted each other. Not distinguish economic status or the status of their fishermen. The main problem in this village is still the economic problems of society, because there are many people here who are in the poverty level.

Ambit determination method in estimating rice plant population density

Directory of Open Access Journals (Sweden)

Abu Bakar, B.,

2017-11-01

Full Text Available Rice plant population density is a key indicator in determining the crop setting and fertilizer application rate. It is therefore essential that the population density is monitored to ensure that a correct crop management decision is taken. The conventional method of determining plant population is by manually counting the total number of rice plant tillers in a 25 cm x 25 cm square frame. Sampling is done by randomly choosing several different locations within a plot to perform tiller counting. This sampling method is time consuming, labour intensive and costly. An alternative fast estimating method was developed to overcome this issue. The method relies on measuring the outer circumference or ambit of the contained rice plants in a 25 cm x 25 cm square frame to determine the number of tillers within that square frame. Data samples of rice variety MR219 were collected from rice plots in the Muda granary area, Sungai Limau Dalam, Kedah. The data were taken at 50 days and 70 days after seeding (DAS. A total of 100 data samples were collected for each sampling day. A good correlation was obtained for the variety of 50 DAS and 70 DAS. The model was then verified by taking 100 samples with the latching strap for 50 DAS and 70 DAS. As a result, this technique can be used as a fast, economical and practical alternative to manual tiller counting. The technique can potentially be used in the development of an electronic sensing system to estimate paddy plant population density.

Measurement of radioactivity and heavy metal levels in edible vegetables and their impact on Kuala Selangor communities of Peninsular Malaysia.

Science.gov (United States)

Asaduzzaman, Kh; Khandaker, M U; Amin, Y M; Zainuddin, Z; Farook, M S; Bradley, D A

2015-11-01

Vegetable is an essential daily diet item for the people of Malaysia. This work addressed the radiation and heavy metal exposure scenarios through the consumption of vegetables. Kuala Selangor is located in Sungai Selangor estuary in the west coast of Peninsular Malaysia, which is susceptible to pollution load due to the presence of large-scale industrial and human activities. Radioactivity and heavy metals level in human diet is of particular concern for the assessment of possible radiological and chemical hazards to human health. Therefore, a comprehensive study was carried out to determine the radioactivity levels ((226)Ra, (228)Ra and (40)K) and heavy metal concentrations (Cr, As, Cd, Mn, Mg, Al, Sr, Rb, Sb, Ba, Hg, Fe, Ni, Zn, Cu, Bi and Pb) in 10 varieties of vegetable collected from different farmlands in Kuala Selangor region. The committed doses for (226)Ra, (228)Ra and (40)K due to consumption of vegetables were found 16.6±1.3, 23.6±1.7 and 58±5 µSv y(-1), respectively, with a total of 98±8 µSv y(-1). This dose imposes no significant threat to human health. The estimated cancer risk shows that probability of increase in cancer risk from daily intake of vegetables is only a minor fraction of International Commission on Radiological Protection values. The concentrations of heavy metal were below the daily intake recommended by the international organisations. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

KEMUNCULAN DAN TINGKAH LAKU PESUT (Orcaella brevirostris (Owen in Gray 1866 SEBAGAIMAMALIATERANCAMLANGKA DI PERAIRANKUBU RAYADANKAYONGUTARAKALIMANTAN BARAT

Directory of Open Access Journals (Sweden)

Regi Fiji Anggawangsa

2015-12-01

2013. Selama pengamatan hanya diketahui terdapat satu kelompok pesut sebanyak 4-6 individu yang terdiri dari pesut muda dan dewasa. Kelompokan itu dijumpai di muara Sungai Bumbun pada kedalamanan perairan 11 meter. Tingkah laku yang teramati menunjukkan gerombolan pesut umumnya memburu kelompokan ikan dan sesekali menyemburkan air dari blowhole nya. Berdasarkan ciri-ciri morfologi dan tingkah laku yang teramati serta kondisi lingkungan perairan setempat maka perairan di Kabupaten Kubu Raya dan Kabupaten Kayong Utara yang terletak di Provinsi Kalimantan Barat diduga merupakan perairan yang potensial sebagai habitat pesut (Orcaella brevirostris. Irrawaddy dolphins (Orcaella brevirostris (Owen in Gray 1866 is one of aquatic mammals species who populations are increasingly threatened. The lack information about population of Irrawaddy dolphins in West Kalimantan waters makes the conservation of this species and its management were still not optimized yet. This research aims to identify the characteristics and behavior of dolphins found in Kubu Raya and Kayong Utara waters of West Kalimantan. The observation was held on April 2013, exploring coastal waters and estuaries which are expected to be the habitats of Irrawaddy dolphins using binoculars. There are 4-6 individuals of Irrawaddy dolphin found at the mouth of Bumbun River. A group consist of young and adults dolphins at the depth of 11 meters. The observed behavior is chasing schooling fish and occasionally spitting water from his blowhole. Based on morphological character and fish behavior observed, and environmental condition parameters, indicated that the water surrounding of Kubu Raya and Kayong Utara District were potential habitat for Irrawaddy dolphins.

Relationships between social support and depression, and quality of life of the elderly in a rural community in Malaysia.

Science.gov (United States)

Ibrahim, Norhayati; Din, Normah Che; Ahmad, Mahadir; Ghazali, Shazli Ezzat; Said, Zaini; Shahar, Suzana; Ghazali, Ahmad Rohi; Razali, Rosdinom

2013-04-01

This study aimed to examine the role of social support and depression in predicting the quality of life among the elderly living in a rural Federal Land Development Authority (FELDA) community in Malaysia. A total of 162 elderly settlers of FELDA Sungai Tengi, aged 60 years and above, were selected by universal sampling method in this cross-sectional study. Three standardized instruments - the 12-item Short Form (SF-12), 15-item Geriatric Depression Scale (GDS-15) and Medical Outcome Study Social Support (MOS-Social Support) - were used to assess for quality of life, depression and social support. Quality of life of the elderly people in this community was high, especially in terms of physical components as compared to mental components. The mean scores for emotional role in the SF-12 was relatively the highest (90.74 ± 21.59) with social functioning being the lowest (30.35 ± 22.29). The results also showed that the mean value was higher for physical component summary (74.40) as compared to mental component summary (51.51). Approximately 23.5% suffered mild depression and only 2.5% had severe depression. This study showed that the elderly FELDA settlers have a high quality of life, mainly on the physical components of life and low rate of severe depression, a positive indicator of their psychological well-being. Social support in the form of emotional/informational support, and depression were significant factors related to their good quality of life. Copyright © 2013 Wiley Publishing Asia Pty Ltd.

Evaluation and assessment of baseline metal contamination in surface sediments from the Bernam River, Malaysia.

Science.gov (United States)

Kadhum, Safaa A; Ishak, Mohd Yusoff; Zulkifli, Syaizwan Zahmir

2016-04-01

The Bernam River is one of the most important rivers in Malaysia in that it provides water for industries and agriculture located along its banks. The present study was conducted to assess the level of contamination of heavy metals (Cd, Ni, Cr, Sn, and Fe) in surface sediments in the Bernam River. Nine surface sediment samples were collected from the lower, middle, and upper courses of the river. The results indicated that the concentrations of the metals decreased in the order of Sn > Cr > Ni > Fe > Cd (56.35, 14.90, 5.3, 4.6, and 0.62 μg/g(1) dry weight). Bernam River sediments have moderate to severe enrichment for Sn, moderate for Cd, and no enrichment for Cr, Ni, and Fe. The contamination factor (CF) results demonstrated that Cd and Sn are responsible for the high contamination. The pollution load index (PLI), for all the sampling sites, suggests that the sampling stations were generally unpolluted with the exception of the Bagan Tepi Sungai, Sabak Bernam, and Tanjom Malim stations. Multivariate techniques including Pearson's correlation and hierarchical cluster analysis were used to apportion the various sources of the metals. The results suggested that the sediment samples collected from the upper course of the river had lower metal concentrations, while sediments in the middle and lower courses of the river had higher metal concentrations. Therefore, our results can be useful as a baseline data for government bodies to adopt corrective measure on the issues related to heavy metal pollution in the Bernam River in the future.

Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

Directory of Open Access Journals (Sweden)

Chia Sing eChan

2015-03-01

Full Text Available The Sungai Klah (SK hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-meter-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0 to 9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC. In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3−V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream and geochemical parameters (broad temperature and pH range. It is speculated that symbiotic relationships occur between the members of the community.

EFFECTIVENESS OF HUANGLONGBING VECTOR (DIAPHORINA CITRI KUWAYAMA CONTROL IN CITRUS GROWER GROUP BASED IN SAMBAS REGENCY OF WEST KALIMANTAN, INDONESIA

Directory of Open Access Journals (Sweden)

Supriyanto A.

2017-12-01

Full Text Available The purpose of this study was to determine the effectiveness of Huanglongbing vector control based on Citrus Grower Group recommendation. Studies have been carried out in 2010 in Tebas Sungai village, Sambas district, with 11 tangerine groves owned by growers in the Citrus grower Association of Sambas district. The tangerine grove that been used are, one grower's orchard as a demonstration plot in a particular citrus grower group (orchard I; five other citrus orchards with different ownership at the same citrus grower Group (orchard II, as well as five other citrus orchard with different ownership which each of them spreads over five different citrus grower groups outside the farm demonstration plots (orchard III. The recommendation technology for controlling Huanglongbing vector which applied in this experiment, included bark painting by systemic insecticide of imidacloprid for two each 1.5-month and spray using contact insecticide with dimethoate to the plant crown which application time been alternated after bark painting application. The effectiveness of technology implementation is measured by a decrease psyllid populations found in citrus samples in adult stage, nymphs and eggs that were observed at regular intervals every two weeks during the flushing to the 14th week after the first treatment. The results showed that recommended treatment technology were absolutely proven to reduce Huanglongbing vector population in significant, namely in the orchard I, II, and III respectively at 95.3%, 84.7%, and 72% for stage adult; 97.3 %, 80%, and 100% for stage nymphs; and 98.5%, 100% and 100% for the egg stage.

Pembuatan Alur Pelayaran dalam Rencana Pelabuhan Marina Pantai Boom, Banyuwangi

Directory of Open Access Journals (Sweden)

Muhammad Didi Darmawan

2017-01-01

Full Text Available Pantai Boom merupakan pantai yang ada di Kabupaten Banyuwangi. Pantai ini terletak di Kelurahan Kampung Mandar, Kecamatan Banyuwangi, Banyuwangi, Jawa Timur. Pantai tersebut rencananya akan dibangun pelabuhan marina. Pelabuhan harus dilengkapi dengan beberapa fasilitas untuk mendukung rencana tersebut seperti salah satunya adalah alur pelayaran. Untuk membuat alur pelayaran diperlukan penelitian mengenai pasang surut, topografi dasar laut, serta jenis kapal yang melintas untuk memastikan kapal yang berlayar aman dari kemungkinan kecelakaan. Penelitian ini menggunakan data hasil pemeruman, data pasang surut yang diperoleh dari pengamatan langsung, serta berbagai jenis kapal yacht. Hasil dari penelitian ini didapatkan bahwa rencana dermaga sebaiknya dibangun 60 meter menjorok ke arah laut dengan panjang dermaga 25 meter. Dalam keadaan air rendah terendah (LLWL, ketiga jenis kapal yang ditentukan dapat merapat ke rencana Dermaga Pelabuhan Marina Pantai Boom, Banyuwangi. Daerah yang tidak bisa dilewati pada saat LLWL, pada saat MSL daerah tersebut sudah dapat dilewati oleh ketiga jenis kapal tersebut. Pada keadaan muka air tinggi tertinggi (HHWL, Kapal Yacht Class 8 dan 6 dapat melewati sebagian perairan sungai Pantai Boom.         Waktu yang tidak tepat untuk melakukan pelayaran pada saat LLWL dari alur pelayaran yang telah dibuat yaitu antara pukul 04:00 – 06:00 WIB pada saat bulan November 2015-Februari 2016 dan pukul 16:00-18:00 pada saat bulan Juni-Agustus 2016. Sedangkan Waktu yang tepat untuk melakukan pelayaran pada saat HHWL yaitu antara pukul 20:00–23:00 WIB pada saat bulan Desember 2015- Maret 2016 dan pukul 8:00-11:00 pada saat bulan Juni-September 2016.

ANALISIS PERAN SERTA MASYARAKAT DALAM PENGELOLAAN AIR BERSIH (The Analysis of Community Roles in Potable Water Management

Directory of Open Access Journals (Sweden)

Syahrani Syahrani

2004-07-01

Full Text Available ABSTRAK Kondisi air sungai yang terpolusi karena penebangan hutan, penambangan, dan limbah domestik menyebabkan rendahnya kualitas air yang dikonsumsi masyarakat. Pada tahun l996 telah dibentuk Unit Pengelola Air (UPS-AB oleh komunitas di Kumpai Batu untuk membantu pengadaan air bagi masyarakat. Studi ini dilakukan untuk mengkaji kinerja UPS-AB melalui survai lapangan terhadap 160 rumah tangga. Variabel yang dikaji meliputi aktivitas UPS-AB. cara pengelolaannya dan keterlibatan masyarakat dalam pengelolaan air. Data ini kemudian diproses dengan analisa deskriptif dan analisis regresi. Hasil analisis menunjukkan bahwa tingkat partisipasi masyarakat cukup tinggi. Tingginya tingkat partisipasi ini disebabkan karena kebutuhan komunitas yang tinggi akan pelayanan air. Meskipun demikian masyarakat merasakan pentingnya peningkatan pengelolaaut air oleh UPS-AB khususnya dalam hal: peningkatan kualitas air. kontinuitas suplai. sistim pembayaran dan sistim pencatatan.   ABSTRACT Polluted river water due to destructed forest, mining and population settlement have created lower quality of up-stream water that households generally consume. Considering the scarcity of water, in 1996, Potable Water Management Unit (UPS-AB of Kumpai Batu was founded as community association to participate in the potable water preparation, development and maintenance. This study was conducted through a field survey on 160 households selected using random sampling method. The variable studied were the availability of UPS-AB, involvement indecision making, involvement in activity, involvement in evaluation and social economic condition of village community. Data were processed using descriptive an regression analysis. The result showed that availability of UPS-AB involvement in decision making, involvement in activities, involvement in evaluation and social-economic condition of village community positively affected community participation in potable water management.

Perencanaan Sistem Drainase Kebon Agung Kota Surabaya, Jawa Timur

Directory of Open Access Journals (Sweden)

Made Gita Pitaloka

2017-03-01

Full Text Available Saluran Kebon Agung terletakdi Surabaya bagian selatan di Kecamatan Jambangan dan bermuara di sisi laut Surabaya bagian Timur di Kecamatan Rungkut. Saluran ini memiliki panjang 11 kilometer dan lebar berkisar antara 7 – 12 meter. Pada saluran Kebon Agung terdapat 2 rumah pompa, yaitu Pompa Kutisari dan Pompa Kebon Agung. Rumah pompa ini sudah berfungsi untuk mengurangi banjir di Surabaya, namun masih kurang maksimal, sehingga masih terjadi genangan di beberapa lokasi. Berdasarkan Peta Kawasan Rawan Banjir Kota Surabaya tahun 2014, terdapat kawasan rawan banjir di pemukiman kampung wilayah kecamatan Jambangan akibat luapan sungai Kali Surabaya. Selain itu, menurut BAPPEKO (Badan Perencanaan Pembangunan Kota Surabaya tahun 2015, terjadi pula genangan setinggi 10-40 cm di Kecamatan Wonocolo dan setinggi 10-50 cm di Kecamatan Gununganyar.Perencanaan sistem drainase Kebon Agung dilakukan dengan mengevaluasi kondisi saluran eksisting, kemudian melakukan analisis hidrologi dengan menggunakan program bantu HEC-HMS untuk mendapatkan debit banjir rencana. Sedangkan, analisis hidrolika menggunakan program bantu HEC-RAS dengan dua kali simulasi unsteady flow, yaitu simulasi kondisi saluran eksisting dan hasil perencanaan. Berdasarkan hasil analisis kondisi eksisting diperoleh bahwa genangan air terjadi karena kapasitas kapasitas saluran Kebon Agung saat ini tidak dapat mengalirkan debit banjir rencana, sehingga dibutuhkan perencanaan baru. Lebar saluran primer yang diperlukan berkisar antara 8 sampai 15 meter dengan kedalaman 3 meter, lebar saluran sekunder yang diperlukan berkisar antara 5 sampai 8 meter dengan kedalaman 2,5 meter, dan untuk lebar saluran tersier antara 1,2 sampai 2 meter dengan kedalaman 1 meter sampai 2 meter. Jumlah pompa yang dibutuhkan adalah 5 buah pompa dengan kapasitas 5 m3/detik dan 3 buah pompa dengan kapasitas 1,5 m3/detik.

Komposisi Kimia, Kadar Albumin Dan Bioaktivitas Ekstrak Protein Ikan Gabus (Channa Striata Alam Dan Hasil Budidaya

Directory of Open Access Journals (Sweden)

Ekowati Chasanah

2015-12-01

Full Text Available Khasiat kesehatan ikan gabus (C. striata telah dikenal secara luas dan saat ini C. striata telah digunakan sebagai bahan baku industri produk suplemen. Tingginya permintaan akan produk suplemen tersebut menimbulkan masalah pada ketersediaan C. striata yang sebagian besar ditangkap dari sungai dan danau sebagai tempat hidupnya. Ikan gabus budidaya dipercaya memiliki kualitas tidak sebaik ikan gabus alam.Tujuan penelitian ini adalah untuk mendapatkan informasi mengenai komposisi kimia, termasuk albumin dan potensi ekstrak protein kasar ikan gabus alam dan hasil budidaya sebagai antioksidan dan anti hipertensi. Hasil analisis menunjukkan bahwa ikan gabus alam dan hasil budidaya memiliki kadar protein yang tidak berbeda secara nyata, tetapi berbeda pada kadar air, abu, dan lemak. Ikan gabus alam memiliki kadar lemak dan abu lebih rendah tetapi kadar air lebih tinggi dibanding ikan gabus budidaya. Ikan dari kedua sumber memiliki bagian yang dapat dimakan atau edible portion (EP sebesar 36%,dengan kadar mineral makro (Na, K, Ca dan mikro (Zn, Fe pada ikan hasil budidaya lebih tinggi dibanding kedua kelompok mineral pada ikan gabus alam. Kadar albumin ikan gabus alam lebih tinggi daripada kadar albumin ikan gabus budidaya. Namun demikian, hasil analisis asam amino menunjukkan bahwa ikan gabus hasil budidaya memiliki kuantitas asam amino yang lebih tinggi daripada ikan gabus alam. Asam amino non essensial dominan adalah alanin, asam aspartat, glisin, alloisoleusin, prolin, dan glutamin, sedangkan asam amino esensial didominasi oleh leusin, lisin, dan fenilalanin. Kedua ikan gabus yang diperoleh dari tempat yang berbeda tersebut memiliki bioaktivitas sebagai antioksidan yang lemah, namun berpotensi sebagai antihipertensi (penghambat Angiotensin Converting Enzyme (ACE dengan kekuatan 1/10 kekuatan kontrol obat hipertensi captopril.

Komposisi Kimia, Kadar Albumin dan Bioaktivitas Ekstrak Protein Ikan Gabus (Channa striata Alam dan Hasil Budidaya

Directory of Open Access Journals (Sweden)

Ekowati Chasanah

2015-12-01

Full Text Available Khasiat kesehatan ikan gabus (C. striata telah dikenal secara luas dan saat ini C. striata telah digunakan sebagai bahan baku industri produk suplemen. Tingginya permintaan akan produk suplemen tersebut menimbulkan masalah pada ketersediaan C. striata yang sebagian besar ditangkap dari sungai dan danau sebagai tempat hidupnya. Ikan gabus budidaya dipercaya memiliki kualitas tidak sebaik ikan gabus alam.Tujuan penelitian ini adalah untuk mendapatkan informasi mengenai komposisi kimia, termasuk albumin dan potensi ekstrak protein kasar ikan gabus alam dan hasil budidaya sebagai antioksidan dan anti hipertensi. Hasil analisis menunjukkan bahwa ikan gabus alam dan hasil budidaya memiliki kadar protein yang tidak berbeda secara nyata, tetapi berbeda pada kadar air, abu, dan lemak. Ikan gabus alam memiliki kadar lemak dan abu lebih rendah tetapi kadar air lebih tinggi dibanding ikan gabus budidaya. Ikan dari kedua sumber memiliki bagian yang dapat dimakan atau edible portion (EP sebesar 36%,dengan kadar mineral makro (Na, K, Ca dan mikro (Zn, Fe pada ikan hasil budidaya lebih tinggi dibanding kedua kelompok mineral pada ikan gabus alam. Kadar albumin ikan gabus alam lebih tinggi daripada kadar albumin ikan gabus budidaya. Namun demikian, hasil analisis asam amino menunjukkan bahwa ikan gabus hasil budidaya memiliki kuantitas asam amino yang lebih tinggi daripada ikan gabus alam. Asam amino non essensial dominan adalah alanin, asam aspartat, glisin, alloisoleusin, prolin, dan glutamin, sedangkan asam amino esensial didominasi oleh leusin, lisin, dan fenilalanin. Kedua ikan gabus yang diperoleh dari tempat yang berbeda tersebut memiliki bioaktivitas sebagai antioksidan yang lemah, namun berpotensi sebagai antihipertensi (penghambat Angiotensin Converting Enzyme (ACE dengan kekuatan 1/10 kekuatan kontrol obat hipertensi captopril.

Dampak Perubahan Penggunaan Lahan terhadap Tingkat Kekritisan Air Sub-DAS Citarum Hulu

Directory of Open Access Journals (Sweden)

Tito Latif Indra

2016-10-01

Full Text Available ABSTRAK Sehubungan dengan pertumbuhan penduduk yang membutuhkan ruang untuk hidup telah mengubah pola penggunaan tanah khususnya di DAS Citarum Hulu yang juga merupakan salah satu DAS kritis di Indonesia. Perubahan penggunaan tanah tersebut akan berakibat pada berkurangnya sumberdaya air sehingga menjadikan tingkat kekritisan air semakin tinggi. Data yang digunakan dalam penelitian ini meliputi peta jaringan sungai, peta penggunaan lahan yang diperoleh dari Badan Pertanahan Nasional (BPN, data curah hujandan suhu Tahun 1975-2005, peta tanah, peta kemiringan lereng, tutupan vegetasi dan data kebutuhan air primer. Melalui metode GIS yang dipadukan pendekatan hidrologis telah menghasilkan wilayah-wilayah sub DAS yang mengalami kekurangan air dalam hal ini kekritisan air. ABSTRACT The population growth and the need for living space have changeq the patterns of land use especially in Upper Sub Citarum Watershed as one of the critical watersheds in Indonesia. The changes in land use will result in the reduction of water resources and make the higher level of water criticality. Data used in this research including river network map, landuse map obtained from Indonesian National Land Agency (BPN, precipitation and temperature data of 1975-2005, soil map, slope map, vegetation cover and primary water demand data. The critical level of watershed is deterimined based on the comparison of primary water demand and water availability in Upper Citarum Sub Watershed. Through GIS method combined with hydrological approach, the areas of sub watershed experiencing water shortage, in this case is water critical level can be determined. The combination of GIS method and a hydrological approach has resulted in sub-catchment areas experiencing water shortages in this case the critical water level.

Use of red palm oil in local snacks can increase intake of provitamin A carotenoids in young aborigines children: a Malaysian experience.

Science.gov (United States)

Ng, T K W; Low, C X; Kong, J P; Cho, Y L

2012-12-01

Carotenoid-rich red palm oil (RPO)-based snacks have been provided to children in impoverished communities to improve their vitamin A status. The non-availabilty of information on the acceptability of RPO-based snacks by Malaysian aborigines (Orang Asli) children forms the basis of this study. Twenty-one Orang Asli children, majority of whom had normal body mass index for age (BMI-for-age) and aged 4.73 +/- 0.92 years in Sungai Tekir, Negeri Sembilan were provided with three freshly-prepared snacks (springroll, curry puff or doughnut) each containing one teaspoon or 5 ml of RPO per serving, on separate mornings. On the fourth morning, one serving each of all 3 different snacks was provided together on a plate to every child for consumption and preference for the snacks recorded. The children's habitual vitamin A intakes were assessed by a semi-quantitative food frequency questionnaire (FFQ) and carotenoid retention tests for the prepared snacks were performed by column chromatography. Fifty-four percent of the children did not meet their RNI for vitamin A. Based on acceptance criterion of consuming at least one-half serving of the snacks provided, springroll and curry puff recorded 100% acceptability while doughnut had 82% acceptability. Preference of snack was in the order, springroll (47%) > doughtnut (35%) > curry puff (18%), but a Z-test test for proportions showed no statistical significance. Carotenoid retention tests showed great variation between snacks namely, doughnut (100%) > springroll (84%) > curry puff (45%). The overall findings indicate that the RPO-based snacks are highly acceptable and can be used to improve the dietary intake of provitamin A carotenoids of Malaysian Orang Asli children.

Bola Pakka: Rumah Tradisional Suku ToBalo di Kabupaten Barru

Directory of Open Access Journals (Sweden)

Zulkarnain AS

2016-12-01

Full Text Available Abstrak— Perkembangan fungsi kegunaan bangunan khususnya bangunan tradisional itu bereneka ragam, sesuai dengan struktur masyarakat dan kebudayaan penduduk yang bersangkutan. Akan tetapi pada umumnya sebagai bangunan tradisional maupun bangunan modern mempunyai kegunaan dan fungsi yang sama. Penelitian dilakukan di Kabupaten Barru, Kecamatan Pujanannting, Desa Bulo-Bulo, Dusun Labaka. Metode yang digunakan adalah deskriptif kualitatif dengan pendekatan rasionalistik. Secara makro dapat merujuk pada penggunaan batas kawasan berupa batu, kayu maupun vegetasi sebagai bentuk pembagian teritori, orientasi pembangunan rumah mengarah pada jalan, sungai dan mata perncaharian. Bola Pakka yang merupakan rumah milik Suku To Balo secara umummemiliki kesamaan bentuk pada rumah Bugis pada umumnya, hanya saja penggunaan serta cara merakit material (proses yang sedikit berbeda. Bola Pakka terbagi atas tiga tipe yakni Bola Sussa, Bola Sicandring dan Bola Amang. Kata kunci: To Balo, Bola Pakka, Tradisional Abstract — The development of utility functions of the building, especially the traditional building is various according to its societies structure and its population’s culture. Generally whether in traditional buildings and modern buildings have, it has utility and similar functions. The research is conducted in Barru, District Pujanannting, village of Bulo-Bulo, Hamlet Labaka. The method of the research is descriptive qualitative with rationalistic approach. In macro, it refers to the use of area boundaries such as stone, wood and vegetation as a form of division of territory, the house development orientation which leads to the roads, rivers and ricefield Bola, only the function and the way in assembling material (process that make them different. Pakka ball is divided into three types namely Bola Sussa, Bola Sicandaring dan Bola Amang. Key words ; To Balo, Bola Pakka, Architecture Local

Peningkatan Pengetahuan dan Sikap Kepala Keluarga tentang Pengelolaan Sampah Melalui Pemberdayaan Keluarga di Kelurahan Tamansari Kota Bandung

Directory of Open Access Journals (Sweden)

Tati Ruhmawati

2017-03-01

Full Text Available Judul: Peningkatan Pengetahuan dan Sikap Kepala Keluarga tentang Pengelolaan Sampah Melalui Pemberdayaan Keluarga di Kelurahan Tamansari Kota Bandung Latar belakang: Sungai Cikapundung merupakan tempat dimana masyarakat banyak membuang sampah ke dalamnya. Pemberdayaan keluarga merupakan alternatif model yang diharapkan merubah pengetahuan dan sikap menuju keluarga yang lebih baik. Penelitian ini bertujuan untuk menganalisis pengetahuan dan sikap keluarga sebelum dan sesudah pemberdayaan pengelolaan sampah. Materi dan Metode: Penelitian ini merupakan penelitian eksperimen semu dengan rancangan “pre and post design.” Intervensi yang dilakukan adalam pemberdayaan model keluarga mencakup konseling, pelatihan, dan pendampingan. Populasi penelitian ini adalah seluruh kepala keluarga atau wakilnya yang tinggal di sekitar aliran sungai Cikapundung di Rw 06 Kelurahan Tamansari Bandung Wetan. Pengambilan sampel diambil secara non random. Pengumpulan data dilakukan melalui wawancara dan observasi. Analisis ststistik untuk uji beda digunakan indepnden T test pada taraf signifikasi 5%. Hasil: Hasil penelitian ini menunjukkan bahwa sebanyak 82,6% responden berumur tidak produktif; 56,5% berpendidikan Sekolah Menengah Atas; 87% tidak bekerja; 56,5% berpenghasilan di bawah UMR; 100% muslim, telah tinggal lebih dari satu tahun, sebagian besar mempunyai 4 anggota keluarga. Fasilitas pendukung pengelolaan sampah yang ada di lingkungan mereka adalah tempat pembuangan sampah sementara (TPS, motor angkut sampah, dan ada lembaga bank sampah. Setelah intervensi pemberdayaan, pengetahuan dan sikap mereka sangat baik masing-masing 78,3% dan 82,6%. Hasil analisis statistik menunjukkan ada perbedaan pengetahuan dan sikap secara signifikan antara sebelum dan sesudah intervensi pemberdayaan keluarga  (p=0,001 dan p=0,005. Simpulan: Intervensi pemberdayaan mampu meningkatkan secara signifikan pengetahuan dan sikap keluarga dalam pengelolaan sampah. Abstact Title: The

Dampak Pencemaran Air terhadap Kesehatan Lingkungan dalam Perspektif Hukum Lingkungan (Studi Kasus Sungai Code di Kelurahan Wirogunan Kecamatan Mergangsan dan Kelurahan Prawirodirjan Kecamatan Gondomanan Yogyakarta

Directory of Open Access Journals (Sweden)

Dinarjati Eka Puspitasari

2012-02-01

Full Text Available This research is aimed to know the contribution government and societies in Yogyakarta for maintaining the water pollution on Code River. Code River is a river in Yogyakarta which has crowded area on its river flow region. The research location is in Code’s river flow region, especially in Kelurahan Prawirodirjan Kecamatan Gondomanan dan Kelurahan Wirogunan Kecamatan Mergangsan Yogyakarta.Data in this research were obtained through field research and library research. The field research was carried out by using interview guidance and sample waste data testing from Balai Besar Teknik Lingkungan (BBTKL Yogyakarta, whereas the library research was done by documentary study by collecting and analyzing selected laws and regulation which were relevant to the research.The result showed that the environmental data to maintain environment health and social condition in the field research has not been served. Beside that, the result of laboratory testing BBTKL showed that water condition on field research has contained pollutant. However, the government and societies just give less contribution to decrease the effect of water pollution on Code River. In this case, the contribution of laws and regulation has been needed to decrease the water pollution.

SEBARAN ASPEK KERUANGAN TIPE LONGSORAN DI DAERAH ALIRAN SUNGAI ALO PROVINSI GORONTALO (Spread of Spatial Aspect of Landslide Types at Alo Watershed in Gorontalo Province

Directory of Open Access Journals (Sweden)

Fitryane Lihawa

2015-01-01

Full Text Available ABSTRAK Sebaran aspek keruangan tipe longsoran di DAS Alo Provinsi Gorontalo telah dikaji dan dievaluasi menggunakan bentuk Peta Sebaran Tipe Longsoran Skala 1 : 50.000. Lokasi penelitian ini meliputi seluruh wilayah DAS Alo Provinsi Gorontalo dengan luas 7.588 Ha. Penentuan sampel penelitian dilakukan secara Accidental Sampling yaitu dengan melakukan penelusuran di seluruh wilayah yang rawan longsor di DAS Alo untuk menemukan titik-titik kejadian longsoran. Dalam pengkajian tipe dan sebaran longsoran, dilakukan pengamatan dan pengukuran terhadap kejadian longsoran yang terjadi pada seluruh wilayah DAS Alo yaitu sejumlah 15 (lima belas titik kejadian longsoran.  Tipe longsoran ditentukan melalui pengukuran dan pengamatan morfometri longsoran untuk menentukan indeks klasifikasi longsoran dan hasil analisis tersebut di plot ke dalam Peta Lokasi Sebaran Tipe Longsoran Skala 1 : 50.000 untuk mengetahui sebaran keruangan dari kejadian longsoran di DAS Alo Provinsi Gorontalo. Berdasarkan analisis morfometri dan indeks klasifikasi longsoran menunjukkan bahwa tipe longsoran yang terjadi adalah rotational slide, planar slide, slide flow dan rock block slide. Kejadian longsoran yang terjadi di DAS Alo Provinsi Gorontalo tersebar pada wilayah dengan kemiringan lereng curam dan sangat curam dengan bentuk permukaan lereng cembung dan cenderung lurus. Kejadian longsoran juga terjadi pada wilayah dengan tekstur tanah lempung dan lempung berlanau, serta jenis batuan vulkanik dan batuan beku yang mengandung silika tinggi dan telah mengalami pelapukan. Berdasarkan wilayah  administrasi, kejadian longsoran tersebar di wilayah Kecamatan Tibawa, Kecamatan Pulubala dan Kecamatan Isimu Utara.    ABSTRACT Distribution of spatial aspect of landslide at ALO Watershed of Gorontalo Province has been studied by providing it through form of spread landslide maps at scale of 1 : 50.000. Research site involved all areas of ALO Watershed in Gorontalo Province as having an area of 7,588 Ha. Research sampling was conducted through accidental sampling as exploring all areas across the region prone to landslides at ALO Watershed in order to invent potential spot of landslide occurence. Regarding to the discussion and spread landslide, it was conducted an observation and measurement toward landslide which was occured to all areas of  ALO Watershed  15 number spots of landslide occurance. Type of landslide was determined by the measurement and observation of landslide morphometry toward classification index and analysis result. Then it was distributed into the map of spread landslide at scale of 1 : 50.000 in order to acknowledge the spatial spread of landslide occurence at ALO Watershed in Gorontalo Province. Based on the morphometry analysis and classification index of landslide, they showed that landslide types are rotational slide, planar slide, slide flow, and rock block slide. Landslide occurence of  ALO Watershed in Gorontalo Province has been spread  in areas with steep slope and very steep slopes by having convex surface shape and tend to be straight. It also occures to the area of clay texture and silted loam, and types of volcanic and igneous rocks which contained high silica and encountering weathering. Regarding to the administration area, landslide occurence is spread to the subdistrict of Tibawa, Pulubala, and Isimu Utara subdistricts.

Reintroduction of Orangutans: A New Approach. A Study on the Behaviour and Ecology of Reintroduced Orangutans in the Sungai Wain Nature Reserve, East Kalimantan Indonesia

NARCIS (Netherlands)

Fredriksson, Gabriella

1995-01-01

The reintroduction of ex-captive orangutans Pongo pygmaeus) is part of a comprehensive conservation program to preserve this species and it’s habitat. During the last decades the orangutan has been under severe threat throughout it’s range- Northern Sumatra, Kalimantan and East Malaysia- due to

Toxicity of Pandanus amaryllifolius L. chloroform extract against diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae)

Science.gov (United States)

Imtithal I., J.; Mustapha, Wan Aida Wan; Idris A., B.

2018-04-01

The potential of using plant and plant-derived products as deterrent against pest of crops in the field and during postharvest period, is gaining increasing attention, due to rapid development of resistance to the synthetic insecticides and couple with the fact that natural insecticides constitute a rich source of bioactive compounds that are safe and biodegradable into non-toxic products. The aim of the present study was to evaluate the insecticidal effects of chloroform extract of Pandanus amaryllifolius L. leaves against diamondback moth, Plutella xylostella under laboratory conditions. The medicinal plants were collected around Kampong Sungai Siput, Lubok China, Malacca, Malaysia. The leaf disc immersion method was used to assess the insecticidal effects of Pandanus amaryllifolius L. leaves extract on the larvae as well as duration of the larval phase following feeding of the second instar larvae of diamondback on the treated leaf discs for 24 h at various concentrations (0.5, 1, 2, 4 and 8 mg/ml). Larval mortality was evaluated every 24 hours for a period of three days. Highest larval percent was observed at 72hrs post exposure with 86.67 % mortality at 8mg/ml concentration LC50 and LC90 value was calculated against different concentrations. It was recorded that lowest LC50 and LC90 values were observed after 72 h of exposure followed by 48 h at 2.84 mg/ml and 17.59 mg/ml respectively and 3.36 mg/ml and 28.59 mg/ml respectively at 48 h of exposure time. Both larvae mortality and duration of exposure were found to be directly related to the concentration of Pandan amaryllifolius L. leaves extract and inversely related to fecundity. The present study indicates that phytochemicals derived from Pandanus amaryllifolius L. leaf extracts are effective DBM control agent and the plant extracts may be useful for further IPM program.

ANTIBIOTICS RESISTANCE AND PUTATIVE VIRULENCE FACTORS OF AEROMONAS HYDROPHILA ISOLATED FROM ESTUARY

Directory of Open Access Journals (Sweden)

Olumide Adedokun Odeyemi

2012-06-01

Full Text Available This study aim to investigate antibiotics resistance profile and putative virulence factors of Aeromonas hydrophila isolated from estuary. Bacteria used for this study were isolated from water and sediment samples obtained from Sungai Melayu, Johor, Malaysia. Serially diluted 100 µL water and 1g sediment were inoculated on modified Rimler - Shott (mRS agar. Colonies with distinct cultural characteristics were picked for further studies. Isolates were tested for biofilm productions, protease enzyme and antibiotics resistance profile using agar well diffusion method against 10 commercial antibiotics. Congo Red Agar (CRA, Microplate and Standard Tube (ST methods were used for assessment of biofilm formation among the isolates while Skim Milk Agar was used for protease production. Sw.KMJ 3 and Sw.KMJ 9 produced black crystalline colonies on CRA. Six of the isolates were biofilm producers in ST method. Result of Microplate method, helped in grouping the isolates into weak (n = 8, moderate (n = 3 and strong producers (n = 4 at 540 nm wavelength. All the isolates were classified as weak ODc  ODi 0.1, moderate ODi = 0.1  0.12 and strong producers ODi  0.12 respectively at 540 nm wavelength. Antibiotics susceptibility test also revealed that all the isolates were resistant to between 6 and 10 antibiotics. Two isolates each were resistant to 6 (60 %, 7 (70 % and 9 (90 % antibiotics respectively. Eight of the isolates showed resistance to 8 (80 % antibiotics while only isolate Sw.KMJ-7 showed resistance to all the tested antibiotics. Sw.KMJ-3, Sw.KMJ-8 and Sw.KMJ-9 produced protease enzyme on SMA. The isolates were also found to be resistant to both antibiotics and heavy metals.

Assessing dengue outbreak areas using vector surveillance in north east district, Penang Island, Malaysia

Directory of Open Access Journals (Sweden)

Ahmad Mohiddin

2015-11-01

Full Text Available Objective: To understand the efficacy of ovitrap surveillance and its implementation on monitoring reflection upon case occurrence in relation to climate variables. Methods: We used routinely setup ovitrap surveillance to monitor the mosquito populations in previous outbreak areas. Ovitraps were installed weekly at three localities that experienced high number of dengue cases (Flat Hamna, Kampung Sungai Gelugor and Kampung Tanjung Tokong from January 2010 to February 2011. Ovitraps and paddles were brought back to the laboratory and all of the water contents were poured into an enamel pan. Aged tap water was added into the enamel pan and eggs were allowed to hatch. The hatching larvae were counted after 3 days. The hatched larvae were identified at the 3rd instar larval stage. The ovitrap indices and mean number of larvae were analyzed using student t-test and One-way ANOVA. Spearmen’s rank correlation coefficient was used to determine the relation between meteorology variables and dengue fever cases. Results: Aedes albopictus was found as dominant species followed by Aedes aegypti recorded in all three study areas. Aedes aegypti preferred to breed outdoor with larvae collection, which was higher than indoor (72.37%. There was a positive correlation between the ovitrap index with the rainfall and humidity except in Kampung Tanjung Tokong. Our result also showed negative correlation between temperature and ovitrap index in all localities. Conclusions: This study provides useful data to be adapted in dengue vector management. It is very important to understand the fluctuation of vector population according to the seasonal activity, which can help us to improve our control programs. However, other factors might also contribute to the increment of dengue outbreak such as the number of available breeding sites, behavior of the vector against environmental factors and the cleanliness of the environment.

Feasibility Study of NMR Based Serum Metabolomic Profiling to Animal Health Monitoring: A Case Study on Iron Storage Disease in Captive Sumatran Rhinoceros (Dicerorhinus sumatrensis).

Science.gov (United States)

Watanabe, Miki; Roth, Terri L; Bauer, Stuart J; Lane, Adam; Romick-Rosendale, Lindsey E

2016-01-01

A variety of wildlife species maintained in captivity are susceptible to iron storage disease (ISD), or hemochromatosis, a disease resulting from the deposition of excess iron into insoluble iron clusters in soft tissue. Sumatran rhinoceros (Dicerorhinus sumatrensis) is one of the rhinoceros species that has evolutionarily adapted to a low-iron diet and is susceptible to iron overload. Hemosiderosis is reported at necropsy in many African black and Sumatran rhinoceroses but only a small number of animals reportedly die from hemochromatosis. The underlying cause and reasons for differences in susceptibility to hemochromatosis within the taxon remains unclear. Although serum ferritin concentrations have been useful in monitoring the progression of ISD in many species, there is some question regarding their value in diagnosing hemochromatosis in the Sumatran rhino. To investigate the metabolic changes during the development of hemochromatosis and possibly increase our understanding of its progression and individual susceptibility differences, the serum metabolome from a Sumatran rhinoceros was investigated by nuclear magnetic resonance (NMR)-based metabolomics. The study involved samples from female rhinoceros at the Cincinnati Zoo (n = 3), including two animals that died from liver failure caused by ISD, and the Sungai Dusun Rhinoceros Conservation Centre in Peninsular Malaysia (n = 4). Principal component analysis was performed to visually and statistically compare the metabolic profiles of the healthy animals. The results indicated that significant differences were present between the animals at the zoo and the animals in the conservation center. A comparison of the 43 serum metabolomes of three zoo rhinoceros showed two distinct groupings, healthy (n = 30) and unhealthy (n = 13). A total of eighteen altered metabolites were identified in healthy versus unhealthy samples. Results strongly suggest that NMR-based metabolomics is a valuable tool for animal health

Feasibility Study of NMR Based Serum Metabolomic Profiling to Animal Health Monitoring: A Case Study on Iron Storage Disease in Captive Sumatran Rhinoceros (Dicerorhinus sumatrensis.

Directory of Open Access Journals (Sweden)

Miki Watanabe

Full Text Available A variety of wildlife species maintained in captivity are susceptible to iron storage disease (ISD, or hemochromatosis, a disease resulting from the deposition of excess iron into insoluble iron clusters in soft tissue. Sumatran rhinoceros (Dicerorhinus sumatrensis is one of the rhinoceros species that has evolutionarily adapted to a low-iron diet and is susceptible to iron overload. Hemosiderosis is reported at necropsy in many African black and Sumatran rhinoceroses but only a small number of animals reportedly die from hemochromatosis. The underlying cause and reasons for differences in susceptibility to hemochromatosis within the taxon remains unclear. Although serum ferritin concentrations have been useful in monitoring the progression of ISD in many species, there is some question regarding their value in diagnosing hemochromatosis in the Sumatran rhino. To investigate the metabolic changes during the development of hemochromatosis and possibly increase our understanding of its progression and individual susceptibility differences, the serum metabolome from a Sumatran rhinoceros was investigated by nuclear magnetic resonance (NMR-based metabolomics. The study involved samples from female rhinoceros at the Cincinnati Zoo (n = 3, including two animals that died from liver failure caused by ISD, and the Sungai Dusun Rhinoceros Conservation Centre in Peninsular Malaysia (n = 4. Principal component analysis was performed to visually and statistically compare the metabolic profiles of the healthy animals. The results indicated that significant differences were present between the animals at the zoo and the animals in the conservation center. A comparison of the 43 serum metabolomes of three zoo rhinoceros showed two distinct groupings, healthy (n = 30 and unhealthy (n = 13. A total of eighteen altered metabolites were identified in healthy versus unhealthy samples. Results strongly suggest that NMR-based metabolomics is a valuable tool for

Food selection of the Malayan tapir (Tapirus indicus) under semi-wild conditions

Science.gov (United States)

Simpson, Boyd K.; Shukor, M. N.; Magintan, David

2013-11-01

A study on the selection of food plants by captive Malayan tapirs (Tapirus indicus) was undertaken in a 30 hectare natural forest enclosure at the Sungai Dusun Wildlife Reserve, Malaysia. Tapirs browsed on 217 species of plants (from 99 genera and 49 families) from a total of the 1142 specimens collected and identified. Food plants were heavily dominated by sapling trees and shrubs which comprised 93% of all plants taken, with the remainder comprising woody lianas, vines and herbaceous plants. Although tapirs browsed on a wide variety of plant species, the top 30 species consumed represented more than 60% of all the plants selected, whilst the vast majority of species were rarely eaten. More than 80 species of trees and shrubs were available, but not eaten at all. The most readily consumed species were the sub-canopy and understorey trees Xerospermum noronhianum, Aporosa prainiana and Baccaurea parviflora, while Aporosa, Knema and Xerospermum were the dominant plant genera. The Phyllanthaceae (leaf flowers), Myristicaceae (nutmegs) and Sapindaceae (rambutans) were the most commonly selected families comprising 45% of the diet. Tapirs fed on saplings trees up to 8.3 m in height, while plants taller than about 1.6 m were bent, broken or pushed to the ground to gain access to the foliage. Sapling stems up to 4.2 cm in diameter could be snapped by biting, while larger trees to 7 cm diameter could be pushed down. Tapirs typically fed on the newer leaves and shoots, however, often only consuming half of the available foliage on a plant. This study documents 160 new plant species suitable as Malayan tapir food, and is consistent with the generalist, but selective browsing nature of the Tapirus species in general.

The floating houses of Sintang City: space, resources and political nexus

Science.gov (United States)

Lubis, M. S.; Harjoko, T. Y.; Susanto, D.

2018-03-01

Sintang is a city in the interior of West Kalimantan, located at the confluence of two large rivers, Kapuas River and Melawi River. Growing from the river’s edge, the present Sintang still maintains its riverine culture in the form of floating houses (‘rumah lanting’), as its legacy of the past, when rivers played important role as main transportation routes for political and economic activities. This paper explores several concepts related to power, space, and resources, to examine the complexity of life of lanting dwellers, conducted at two locations of lanting houses that spread around Sintang urban area: Pasar Sungai Durian and Pasar Inpres. The results show that there are two main factors affecting the life as well as the spatiality of lanting dwellers: First, the relationship with river’s ecology and river’s behavior, and second, the linkages with the activities on the mainland, where both of them are strongly influenced by political and economic considerations. The impact of changes in the river’s ecology and behavior on the lanting dwellers has shown how government policies affected the rivers and thus, the lanting communities. The key contribution of this study is a clear depiction of the political and power relations in the context of spatiality and resources on the riverine culture, especially the lanting communities along Kapuas and Melawi River in Sintang City, which tends to reveal the marginalization of the lanting community among the other urban community. So far, there has been no serious and detailed studies about the politics of space in relation to nature and resources and local livelihoods in the area. This paper wishes to explore the challenges to strive for a livable and just place for river community in the future.

Kerangka Aset Rumah Tangga Miskin dalam Peristiwa Banjir Pasang Surut di Kecamatan Pekalongan Utara Kota Pekalongan

Directory of Open Access Journals (Sweden)

Novi Maulida Ni’mah

2016-09-01

Full Text Available ABSTRAK Penelitian ini membahas tentang penghidupan rumah tangga miskin dalam konteks bencana banjir pasang surut di Kota Pekalongan. Tujuan dari penelitian ini adalah (1 mengetahui aset dan (2 dampak banjir pasang surut terhadap aset. Penelitian ini menggunakan pendekatan descriptive exploratory dan field research yang dibahas secara deskriptif kualitatif dengan menguraikan aset rumah tangga miskin dan dampak banjir pasang surut terhadap aset. Pemanfaatan aset oleh rumah tangga miskin di Kecamatan Pekalongan Utara dilakukan sesuai mata pencaharian yang dimiliki yaitu sektor pertanian dan perikanan serta sektor industri, perdagangan, dan jasa. Sektor pertanian dan perikanan bergantung pada natural asset yaitu laut, sungai, dan lahan, sedangkan sektor industri, perdagangan, dan jasa bergantung pada physical asset yaitu rumah, alat transportasi, dan alat bekerja. Kerusakan kedua aset tersebut akibat bencana banjir pasang surut telah menghambat peningkatan kesejahteraan hidup.   ABSTRACT This study discusses the livelihoods of poor households in the context of tidal flood in Pekalongan City. The purpose of this study was (1 to know the assets and (2 to determine the impact of tidal flood to assets. This study used descriptive exploratory and field research approach which discussed in qualitative descriptive with outline of assets of poor households and the impact of tidal flood to assets. Utilization of assets by poor households in the Pekalongan Utara District done according owned livelihood that is agriculture and fisheries sectors as well as industry, trade, and services. Agriculture and fisheries rely on the natural assets of the sea, river and land, while the industrial sector, trade, and services depend on the physical asset of a house, transportation, and work tools. Damages to the two assets caused by flood tides have prevented an increase in welfare.

HUTAN DAN PERILAKU ALIRAN AIR: KLARIFIKASI KEBERADAAN HUTAN DAN PENGARUHNYA TERHADAP BANJIR DAN KEKURANGAN AIR (Forest and Stream Flow Behaviour: Clarification on Forest Relation With Flood and Drought Issues

Directory of Open Access Journals (Sweden)

Chay Asdak

2002-03-01

Full Text Available ABSTRAK Banjir bandang di wilayah hilir Daerah Aliran Sungai (DAS seringkali dihubungkan dengan penebangan hutan di wilayah hulu DAS. Hal ini terkait dengan dua hal: (1 perhatian masyarakat terhadap tingginya laju degradasi sumberdaya hutan di banyak tempat di Indonesia, dan (2 adanya kesenjangan pemahaman tentang keterkaitan antara vegetasi, air, dan tanah. kedua hal ini mendorong terbentuknya pemahaman bersama (masyarakat luas termasuk akademisi yang cenderung bersifat simplistik bahwa banjir bandang tersebut terjadi karena mengingkatnya penebangan hutan. Apakah pemahaman tersebut di atas didukung oleh bukti-bukti ilmiah? Atau karena didorong oleh emosi bahwa kerusakan hutan makin meningkat. Tulisan ini mencoba untuk menunjukkan hasil penelitian bahwa, pada banyak kasus, banjir bandang lebih disebabkan oleh tingginya intensitas curah hujan.   ABSTRACT Big floods found in downstream areas that occurred in the wettest months of rainy season are often said to be associated with forest cutting in the upper parts of a watershed. This is partly caused by an increasing strong concerned from many people on high rate of forest destruction in many parts of Indonesia. Partly by false perception on forest-water-soil interaction. In the mean time, there is a common perception among the people including some scientific communities that large floods with severe economic impact are closely linked with the increasing forest cutting. Does this allegation have scientific justification? Or is it just a public emotion driven by the fact that many forest stands are becoming degraded overtime. This article is trying to bring up some scientific findings that, in many cases, big floods were often associated with extreme rainfall. Some illustrations used in this article are mainly from research findings in the temperate climates, with small protions from tropical regions.

The Vulnerability of Community Capitals as a Threat to Orang Kuala Community Development in Malaysia

Directory of Open Access Journals (Sweden)

W. A. Amir Zal

2014-05-01

Full Text Available Community development emphasizes the utilization of community resources, also known as community capitals. However, it is often difficult for the community to access these resources; this difficulty retards development. Such is the predicament faced by the Orang Kuala, for whom coastal changes have resulted in greater difficulty in accessing their community resources. Nor is that the only threat that they face. For affirmation of these threats, this article lists two objectives, that is, to identify the accessibility of marine resources and to explain the types of threats faced by the Orang Kuala. To achieve these objectives, a study was conducted involving 51 household heads and 5 Orang Kuala informants, all of whom are residents of Sungai Layau village in Johor, Malaysia. This study uses a mixed-method approach, the concurrent embedded design, and also interview-based questionnaires and in-depth interviews simultaneously. For the first objective, the results show that the Orang Kuala can still attain community resources in the form of marine products. However, the Orang Kuala faced three types of threats: trends, shocks, and seasonal changes. The most significant threat to the Orang Kuala is the trend, that is, cost of living and social problems. These threats can reduce their chances of acquiring benefits from these community resources. This condition is called “vulnerability of community capitals.” The objective of this article is to put forth proposals on how to increase the capacity of community resources for the Orang Kuala so that their community can attain sustainable development. This proposal is based on the reality that the threats facing the Orang Kuala are at a critical level and that they are ready to accept changes.

Pengembangan Sistem Informasi Bahaya Erupsi untuk Pengelolaan Kebencanaan di Lereng Selatan Gunungapi Merapi

Directory of Open Access Journals (Sweden)

Sriadi Setyowati

2016-10-01

Full Text Available ABSTRAK Pengembangan sistem informasi bencana ini dilakukan di Lereng Selatan Gunungapi Merapi sebagai salah satu upaya mitigasi bencana. Penelitian ini bertujuan: 1 menyusun peta tingkat bahaya dan sebaran bahaya pasca erupsi 2010, dan 2 menyusun informasi spasial untuk pengurangan risiko bencana. Pengambilan sampel dilakukan secara purposif pada setiap satuan medan. Analisis spasial dilakukan dengan bantuan SIG, yang terlebih dulu dilakukan pengharkatan terhadap atribut datanya. Hasil penelitiannya adalah, pertama, terdapat tiga kelas bahaya erupsi di lereng selatan Gunungapi Merapi yaitu rendah, sedang, dan tinggi. Tingkat bahaya erupsi sedang meliputi 73% wilayah, sedangkan tingkat bahaya rendah dan tinggi meliputi 27% wilayah. Faktor yang mempengaruhi tingkat bahaya adalah jarak dari kepundan, jarak dari alur sungai utama, kemiringan lereng, dan relief. Kedua, terdapat empat jalur evakuasi yang disarankan untuk digunakan dalam pengelolaan bencana dengan memperhatikan tingkat bahaya, penduduk, aksesibilitas, serta keberadaan fasilitas pendukung.   ABSTRACT This research aims to: (1 map the hazard level and distribution after 2010 eruption, based on new morphological database at southern flank of Merapi Volcano. (2 make spatial information for disaster risk reduction according to renovated hazard level information. This research employs explorative survey methods. Population sampling is done through purposive sampling methods. Samplings are taken in terrain units. The analysis technique employs in this research are GIS, scoring, and descriptive spatial analysis. Result shows: (1 there are three level of eruption hazard in southern flank of Merapi Volcano, namely: low, middle, and high. Middle eruption hazard level to includes 73% area, low and high hazard level to includes 27% area. The factors that influence hazard level are distance from crater, distance from main river channel, slope, and relief. (2 there are four routes suggested to

Sample Size Calculations for Population Size Estimation Studies Using Multiplier Methods With Respondent-Driven Sampling Surveys.

Science.gov (United States)

Fearon, Elizabeth; Chabata, Sungai T; Thompson, Jennifer A; Cowan, Frances M; Hargreaves, James R

2017-09-14

While guidance exists for obtaining population size estimates using multiplier methods with respondent-driven sampling surveys, we lack specific guidance for making sample size decisions. To guide the design of multiplier method population size estimation studies using respondent-driven sampling surveys to reduce the random error around the estimate obtained. The population size estimate is obtained by dividing the number of individuals receiving a service or the number of unique objects distributed (M) by the proportion of individuals in a representative survey who report receipt of the service or object (P). We have developed an approach to sample size calculation, interpreting methods to estimate the variance around estimates obtained using multiplier methods in conjunction with research into design effects and respondent-driven sampling. We describe an application to estimate the number of female sex workers in Harare, Zimbabwe. There is high variance in estimates. Random error around the size estimate reflects uncertainty from M and P, particularly when the estimate of P in the respondent-driven sampling survey is low. As expected, sample size requirements are higher when the design effect of the survey is assumed to be greater. We suggest a method for investigating the effects of sample size on the precision of a population size estimate obtained using multipler methods and respondent-driven sampling. Uncertainty in the size estimate is high, particularly when P is small, so balancing against other potential sources of bias, we advise researchers to consider longer service attendance reference periods and to distribute more unique objects, which is likely to result in a higher estimate of P in the respondent-driven sampling survey. ©Elizabeth Fearon, Sungai T Chabata, Jennifer A Thompson, Frances M Cowan, James R Hargreaves. Originally published in JMIR Public Health and Surveillance (http://publichealth.jmir.org), 14.09.2017.

Kaitan antara karakteristik pantai Provinsi Sumatera Barat dengan potensi kerawanan tsunami

Directory of Open Access Journals (Sweden)

Yudhicara Yudhicara

2014-06-01

Full Text Available http://dx.doi.org/10.17014/ijog.vol3no2.20084The coast of West Sumatera Province has two types of beaches: low lying sandy beach and steep rocky beach. Straight shoreline beaches at Padang beach until Air Bangis at the north and between Pasir Ganting and Salido beach at the south will have a potential tsunami height lower than bay shape beaches like at Kasai Bay, Kabung Bay, Batung Bay and Nibung Bay. A tsunami inundation will be further at a low lying area (low lying sandy beaches compared with a coastal area which has steep slope and high relief (steep rocky beaches. Gosong beach at Pariaman which has a steep angle of beach slope will have lower tsunami height compared with a low angle beach slope like at Sungai Beramas, Kasai, Kabung, Batung and Nibung bays which have a beach slope about 3° to 5°. The maximum tsunami inundation is assumed to be located at Pasaman and Pasir Pariaman Sub-regencies, while the maximum tsunami height is assumed to be located at the middle of mapped area which has a bay shape. Tsunami is assumed to be arrived early at the southern most of mapped area or close to Muko-muko (Bengkulu. The maximum height difference from sea level was found at Tabai - Pariaman about 5.394 m, while the minimum height difference was found at Carocok Anau about 1.821 m. The horizontal distance measured from the nearest building from the shoreline is about 119 to 173 m. The worst case of tsunami modeling assumed that the maximum tsunami height will be about 32 m and used for reference to make tsunami prone zonation, such as high, moderate and low prone area.    

TINJAUAN ULANG MATERI AJAR GERAK LURUS BERATURAN MELALUI PERCOBAAN GRAVITY CURRENT DALAM SKALA LABORATORIUM

Directory of Open Access Journals (Sweden)

A. K. Wardani

2013-07-01

Full Text Available ABSTRAKDalam konteks problem-based learning, salah satu masalah belajar fisika di sekolah dan di universitas adalah keterkaitan antara materi ajar dan fenomena alam dalam kehidupan sehari-hari masih minimum. Siswa, mahasiswa, guru, dan dosen masih mengalami kesulitan dalam memberikan contoh nyata GLB. Penelitian ini meninjau ulang materi ajar gerak lurus beraturan melalui percobaan gravity current sebagai sistem dua fluida dengan beda kerapatan di laboratorium dalam upaya mencari contoh nyata sistem fisis yang bergerak sepanjang garis lurus dengan kecepatan tetap. Penelitian ini dapat dipandang sebagai model proses intrusi air laut di estuari, tempat pertukaran massa air laut dan air sungai. Fokus penelitian adalah membuktikan bahwa gravity current bergerak dengan kecepatan tetap dan menentukan faktor-faktor dinamik kecepatan. Pengukuran akurat waktu tempuh dan tinggi permukaan air dalam tangki percobaan memberikan kecepatan tak-berdimensi gravity current sebesar 0,45 ± 0,03 dengan beda kerapatan massa dan tinggi awal permukaan air merupakan dua faktor dinamik penentu kecepatan. ABSTRACTIn the context of problem-based learning, one of learning difficulties in physics at schools and universities is theminimum relevance of learning materials to natural phenomena. School and university students still have difficulties in giving real examples of uniform motion. This research examines uniform motion by performing laboratory experiments on gravity current as a system of two fluids with different densities. The experiments were designed to provide a factual case of a moving system with constant speed and to model salt intrusion in an estuary, where sea water and river stream meets. The research focused on the dynamics of gravity currents and determines factors affecting the speed. Based on measurements of travel time and initial height of water surface in all experiments, the results showed that the non-dimensional speed was found to be 0.45 ± 0

Diversitas Dan Hilangnya Jenis-jenis Ikan Disungai Ciliwung Dan Sungai Cisadane [Study of Fish Diversity and the Lost of Fish Species of River Ciliwung and R. Cisadane

OpenAIRE

Hadiaty, Renny Kurnia

2011-01-01

The fish research in Indonesian waters has been begun since 16 century ago. Most of the research collected fish around Batavia.Many new species was described and the type specimens deposited at the museums in Europe or America.The study of fish diversity and the lost of fish species was conducted at River Ciliwung and R. Cisadane in 2009. The aim of this study is to describe the recent fish diversity in both river drainages, then make a comparison with the number of species recorded based on ...

Penyuluhan dan Pengetahuan Tentang Pernikahan Usia Muda

Directory of Open Access Journals (Sweden)

Rufaida Nurjanah

2013-09-01

Full Text Available Pada tahun 2010-2012, di Kabupaten Gunungkidul, terjadi kenaikan dua kali lipat kasus pernikahan di bawah umur. Kasus tertinggi terdapat di Kecamatan Patuk, yaitu sebanyak 18 kasus. Kehamilan di usia muda berkorelasi dengan angka kematian ibu. Peningkatan pengetahuan kesehatan reproduksi dapat dilakukan dengan penyuluhan. Tujuan penelitian ini untuk mengetahui pengaruh penyuluhan terhadap peningkatan pengetahuan tentang pernikahan usia muda. Jenis penelitian yang digunakan adalah kuasi eksperimen dengan pretest-posttest terhadap kelompok kontrol. Penelitian dilakukan di SMPN 1 Patuk. Subjek penelitian adalah siswa kelas VIII. Jumlah sampel sebanyak 25 responden, baik pada kelompok eksperimen maupun kontrol. Instrumen penelitian adalah kuesioner. Hasil pretest menunjukkan nilai rata-rata kelompok eksperimen adalah 70,40 dan kelompok kontrol adalah 71,20. Hasil posttest menunjukkan nilai rata-rata kelompok eksperimen adalah 90,88 dan kelompok kontrol adalah 78,40. Terdapat perbedaan yang signifikan antara nilai pretest dengan posttest. Peningkatan pengetahuan pada kelompok eksperimen sebesar 20,48, sedangkan kelompok kontrol sebesar 7,20. Hasil uji independen sampel uji t menghasilkan nilai p 0,000 (< 0,05. Penelitian ini menyimpulkan bahwa ada pengaruh penyuluhan terhadap peningkatan pengetahuan tentang pernikahan usia muda pada siswa kelas VIII di SMPN 1 Patuk tahun 2013. In 2010-2012, the amount of underage marriage had doubled in Gunung Kidul. Moreover, the highest case was in Patuk which had 18 cases. However, there was correlation between early pregnancy and maternal mortality. Improving the knowledge of reproductive health can be done by counseling. The research was aimed to find out about the effect of counseling on the improvement of the knowledge of young age marriage. The research was categorized into quasi experimental research which has pre-posttest with control group design. The research was conducted at SMPN 1 Patuk. The subject of

IDENTIFIKASI PERTAMBAHAN PERSEBARAN LIMBAH TEMPAT PEMBUANGAN AKHIR (TPA JATIBARANG TAHUN 2015 MENGGUNAKAN METODE GEOLISTRIK

Directory of Open Access Journals (Sweden)

R S Wulandari

2016-04-01

Full Text Available Pada tahun 2000 timbunan sampah pada TPA Jatibarang yang berlokasi di Kelurahan Kedungpane Kecamatan Mijen Kota Semarang, sudah melebihi daya tampung yaitu sekitar 1,6 juta m3. Kondisi tersebut sangat berpotensi menimbulkan pencemaran lingkungan terutama pencemaran leacheat (air lindi. Oleh karena itu, dilakukan penelitian untuk mengetahui tingkat pencemaran limbah di daerah sekitar TPA Jatibarang pada tahun  2015 dengan menggunakan metode geolistrik konfigurasi schlumberger. Pengambilan data dilakukan pada tiga titik penelitian, dua berada didalam TPA dan satu berada di daerah perumahan sekitar TPA dengan panjang lintasan masing-masing 75 m. Pengolahan data hasil penelitian dilakukan dengan menggunakan softwareres2dinv. Hasil yang didapatkan berupa kondisi topografi serta nilai resistivitas lindi sebesar 0,044-0,70 Ωm. Persebaran lindi pada tahun 2015 menuju ke daerah dengan elevasi rendah yang mengarah ke Sungai Kreo. Sedangkan persebaran lindi pada lokasi penelitian di Perumahan Bambankerep Kecamatan Ngaliyan Kota Semarang juga telah diidentifikasikan tercemar oleh air lindi yang diduga berasal TPA Jatibarang.In 2000, piles of garbage in the landfill is located in the Village Jatibarang Kedungpane Mijen District of Semarang, has exceeded the capacity of around 1.6 million m3. The condition is potentially causing environmental pollution, especially pollution leacheat (leachate. Therefore, to investigate the pollution level of waste in the area around the landfill Jatibarang 2015 using geoelectric method Schlumberger configuration. Data were collected at three points research, two are in the landfill and one is located in a residential area around the landfill with a path length of each- each 75 m. Data processing results of research conducted by using softwareres2dinv. Results obtained in the form of topography and leachate resistivity value of 0.044 Ωm- 0.70 Ωm. Distribution of leachate in 2015 heading to areas with low elevation that

Influence of Amang (Tin Tailing) on Geotechnical Properties of Clay Soil

International Nuclear Information System (INIS)

Zulfahmi, A.R.; Zuhairi, W.Y.W.; Raihan, M.T.; Sahibin, A.R.; Razi, I.W.M.; Tukimat, L.; Syakireen, Z.S.N.; Noorulakma, A.

2012-01-01

Amang or tin tailing is commonly found in the vicinity of disused mining area and responsible in downgrading the water quality, landscape and mechanical behaviour of soils. It was generated from extraction process of separating valuable metal from particular ore. This paper presents the geotechnical characteristics of amang-contaminated clay soil. The geotechnical properties of uncontaminated soils were studied in order to compare to that of amang contaminated soils. The base soil used in this study represents completely weathered horizon of meta sedimentary rock. Meanwhile, tin tailing sample was taken from the disused mine at Sungai Lembing, Pahang. The geotechnical characterisations of base soil and contaminated soils were determined based on consistency index, compaction behaviour, hydraulic conductivity and undrained shear strength (UU tests). Contaminated soil samples were prepared by adding 5, 10 and 20 % of tailing, based on dry weigh of the studied base soil. The results from the particle size distribution analysis showed that residual soil from meta sedimentary rock comprised 42.6 % clay, 32.2 % silt and 25.2 % sand whilst tailing was dominated by 98 % of sand fraction. XRD analysis indicated the presence of quartz, kaolinite and muscovite minerals in the studied soil. The specific gravity of soil used is 2.67 and the pH is 3.88. Tailing found to have higher specific gravity of 3.37. The consistency index of contaminated soils showed that liquid limit, wL and plastic limit, wP decreased with the increase in the percentage of tailing added to the soil samples. The value of maximum dry density, ρ dry max increased while optimum moisture content decreased due to the increase in tailing content in soil sample. The permeability of contaminated soil also increased with the increase in tailing contents ranged from 19.8 cm/ hr to 23.8 cm/ hr. The undrained shear strength, Cu, of contaminated soil decreased from 646 kPa (5 % of tailing) to 312 kPa (20 % of

PERENCANAAN TATA GUNA LAHAN DAS WAY SEPUTIH HULU LAMPUNG TENGAH MENGGUNAKAN MODEL TATA AIR (Landuse Planning for Way Seputih Watershed at Central Lampung by Water Management Model

Directory of Open Access Journals (Sweden)

Mohammad Amin

2008-11-01

Full Text Available ABSTRAK Das Way Seputih Hulu merupakan sungai yang terletak di Kabupaten Larnpung Tengah, merniliki luas 175,28 km2. Kejadian banjir di Desa Segalarninder hilir Way Seputih Hulu terjadi setiap datang musim penghujan. Hasil penelitian bempa software program tata-air.exe, konsep dasar rnodel menggunakan neraca air (waterbalance yang dibuat dengart program delphi versi 7. Hasil uji t-tes antara tebal aliran model simulasi dengan pengukuran lapangan menunjukkan nilai t-hitung (0,14 lebih besar dari t-tabel (2,51, sehingga dikatakan model dapat digunakan untuk melakukan simulasi berbagai alternatif penggunaan lahan. Hasil simulasi program tata-air.exe menunjukkan bahwa keseluruhan alternatif untuk eksperimentasi model menghasilkan nilai rasio tebal aliran di bawah angka 30. Kondisi rasio tebal aliran air Way Seputih Hulu memiliki nilai berkisar antara 2,84 sanrpai 3,40, sehingga dapat dikatakan dalam kondisi masih wajar bahkan dapat dikatakan mempunvai nilai yang cukup bagus. Alternatif penggunaan lahan yang mengarah kepada bentuk lahan kebun campuran akan memberikan nilai rasio paling kecil dan menghasilkan produksi air yang kecil pula.   ABSTRACT  Watersheed of Way Seputih Upstream represent river which located in Kabupaten Lampung Tengah, oing wide of 175,28 km2. Occurence of floods in Countryside of Segalaminder go downstream Way Seputih Upstream happened in every coming rain season. Result of the research namely tata-air.exe, base concept of modeling uses water balance was made by using Delphi 7th version. Result of t-test value between modeled discharge flow and field measurement result shows t-counting value (0.14 higher than t-table (2.51, hence the model is can be used for simulating various landuse alternative. The simulation result using tata-air.exe shows that entire alternatives for model experimentation resulted discharge ratio value was under 30. Condition of Way Seputih Hulu River discharge was in the range between 2.84 until 3

GROUND WATER ASSESSMENT IN AGRICULTURAL AREA, CASE STUDY FROM MACHANG-MALAYSIA (Penilaian Air Tanah di Daerah Pertanian, Studi Kasus di Machang Malaysia

Directory of Open Access Journals (Sweden)

Nur Islami

2010-11-01

Full Text Available ABSTRACT The study area is located in Machang, North Kelantan - Malaysia. The North Kelantan plain is covered with Quaternary sediments overlying granite bedrock. The drainage system is dendritic with the main river flowing into the South China Sea. Hydrogeochemical method was used to study groundwater of shallow aquifer characters within the area. Based on water samples analysis collected from the study area, it can be deduced that the cations and anions concentration are good for domestic use except in the southern region which the nitrate concentration is higher (more than 20 mg/l compared to the northern region (relatively zero. The areas that possibly possess nitrate-contaminated groundwater have been mapped along with groundwater flow patterns. The southern and middle part of the study area has an east to west groundwater flow pattern, making it impossible for contaminated water from the southern region to enter the northern area, despite in the northern area has lower elevation. ABSTRAK Lokasi area studi adalah berada di Machang, Kelantan Utara – Malaysia. Dataran tanah wilayah Kelantan Utara dilapisi oleh batuan Sedimen Kuarter yang mana batuan granit sebagai batuan dasar. Sistem pengairan adalah berbentuk jaringan dendritik dengan sungai utama mengalir ke Laut Cina Selatan. Metoda hydrogeochemical digunakan untuk mempelajari karakter air tanah dari akuifer dangkal untuk keseluruhan area studi. Berdasarkan pada analisa air yang diperoleh dari area studi, dapat disimpulkan bahwa konsentrasi kation dan anion baik digunakan untuk kehidupan sehari hari kecuali air tanah di area sebelah selatan yang mana kandungan nitratnya tinggi (lebih dari 20 mg/l dibandingkan di area sebelah utara (hampir tidak ada kandungan nitrat. Area yang memungkinkan memiliki konsentrasi nitrat pada air tanah dipetakan dengan kombinasi pola aliran air tanah. Pola aliran air tanah di area belahan selatan dan bagian tengah adalah dari timur ke barat yang mana tidak

NOTES ON THE PALM FLORA OF CENTRAL SUMATRA

Directory of Open Access Journals (Sweden)

John Dransfield

2014-01-01

Full Text Available In July and August 1972, I spent five weeks on an expedition to study rattans and other palms in the provinces of Jambi and West Sumatra. This central area of Sumatra was chosen because expeditions have already been made to South Sumatra in February 1971 and March 1972 and to North Sumatra and Aceh with the Kyoto University Expedition in August 1971, and therefore collections made in this central area would link up collections from the south and north and would hence add considerably to our knowledge of the palm flora of this rich island. After advice from the Department of Nature Conservation in Jambi and from Dr. M. Jacobs in Rijksherbarium (Leiden had been considered, it was decided to work westwards from Berbak Nature Reserve on the east coast near Nipah Panjang, to the Bukit Barisan, the main range of Sumatra, to Gunung Kerinci Nature Reserve and G. Tujuh near Sungai Penuh and from there, across the western part of the Bukit Barisan to Padang and Bukittinggi. From Bukittinggi it was planned to visit the Kafflesia arnoldii Nature Reserve at Batang Palupuh, and then return to Jambi by way of Muara Tebo and Muara Tembesi, where reputedly there still exists lowland forest. By more or less confining our collecting activities to the normally neglected Palmae it was hoped that within the time available a large area could be covered reasonably, and a palm transect for central Sumatra made. Two assistants from Bogor accompanied me to help in the difficult task of collecting rattans: Dedy Darnaedi (Herbarium Bogoriense and Abdul Hanan (Kebun Raya. These assistants were also given individual collecting assignments as part of a scheme for training assistants in field botany. Dedy was to collect Pteridophyta and Hanan to collect material for growing in the Kebun Raya. Soetrisno Soewoko, head of Nature Conservation in Jambi accompanied us throughout tha expedition.

PENINGKATAN KETERAMPILAN MEMBACA PERMULAAN MELALUI MEDIA FLASHCARD PADA SISWA KELAS I SDN BAJAYAU TENGAH 2

Directory of Open Access Journals (Sweden)

Budi Rahman

2014-07-01

Full Text Available Penelitian ini bertujuan untuk meningkatkan keterampilan membaca siswa kelas I SDN Bajayau Tengah 2 Kecamatan Daha Barat Kabupaten Hulu Sungau Selatan. Penelitian ini merupakan penelitian tindakan kelas yang menggunakan desain model Kemmis & Taggart. Subjek penelitian adalah 18 siswa kelas I SDN Bajayau Tengah 2 tahun pelajaran 2013/2014. Teknik pengumpulan data yang digunakan adalah observasi, tes unjuk kerja. Instrumen yang digunakan adalah lembar pengamatan, soal tes unjuk kerja, dan lembar penilaian membaca. Data yang terkumpul dianalisis dengan teknik deskriptif. Hasil penelitian menunjukkan bahwa media flashcard dapat meningkatkan keterampilan membaca permulaan siswa kelas I SDN Bajayau Tengah 2. Peningkatan keterampilan membaca permulaan dapat dilihat dari nilai rata-rata sebelum diberi tindakan sebesar 59,7%, yang termasuk dalam kategori cukup; kemudian meningkat pada siklus I menjadi 71,3%, yang termasuk dalam kategori baik; kemudian meningkat lagi pada siklus II menjadi 90,7%, yang termasuk dalam kategori baik sekali. _______________________________________________________________________________________________________________________________________________________________________________________________________ IMPROVING EARLY READING SKILL THROUGH FLASHCARD MEDIA IN 1STGRADE STUDENTS OF STATE ELEMENTARY SCHOOL (SDN BAJAYAU TENGAH 2 ABSTRACT This study aims to improve the early reading skill of 1st grade students of State Elementary School (SDN Bajayau Tengah 2, Daha Barat District, Hulu Sungai Selatan Regency. This study was classroom action research using  Kemmis & Taggart model design. The subject was 18  1st grade students of SDN Bajayau Tengah 2 in 2013/2014. The data collection technique used was observation, performance test. The instrument used was observation sheets, performance test exercises, and reading assessment sheets. The data were analyzed using the descriptive technique. The result shows that flashcard media

Antibody and immune memory persistence post infant hepatitis B vaccination

Directory of Open Access Journals (Sweden)

Hudu SA

2013-09-01

Full Text Available Shuaibu A Hudu,1,2 Yasmin A Malik,3 Mohd Taib Niazlin,1 Nabil S Harmal,1,4 Ariza Adnan,5 Ahmed S Alshrari,1 Zamberi Sekawi1 1Department of Medical Microbiology and Parasitology, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Selangor, Malaysia; 2Department of Pathology and Medical Microbiology, College of Health Sciences, Usmanu Danfodiyo University Sokoto, Sokoto State, Nigeria; 3Department of Clinical Science, Faculty of Medicine and Health Sciences, Universiti Tunku Abdul Rahman, Selangor, Malaysia; 4Department of Medical Microbiology, Faculty of Medicine and Health Sciences, Sana'a University, Sana'a, Yemen; 5Cluster of Laboratory Medical Sciences, Faculty of Medicine Universiti Teknologi MARA, Sungai Buloh, Selangor, Malaysia Objectives: This study aimed to evaluate the level of hepatitis B immunity among undergraduate students 23 years after commencement of the nationwide hepatitis B childhood immunization program in Malaysia. Methods: A total of 402 serum samples obtained from volunteer undergraduate students were screened for the presence of hepatitis B surface antibodies using qualitative ELISA. Results: Results showed that 62.7% of volunteers had protective anti-hepatitis B surface antigens (≥10 IU/L, of whom 67.9% received three doses of the vaccine. The estimated post-vaccination immunity was found to be at least 20 years, indicating persistent immunity against hepatitis B and a significant association (P < 0.05 with duration of vaccination. Anamnestic response 1 month post-hepatitis B booster was 94.0% and highly significant (P < 0.01. Isolated anti-hepatitis B core antigen (anti-HBc prevalence was found to be 5.0%, all having had a positive anamnestic response. Conclusion: Immunity after primary vaccination with hepatitis B recombinant vaccine persists for at least 20 years post-vaccination, with significant association with the number of vaccinations. Furthermore, the presence of anamnestic response to

Terrestrial gamma radiation dose study to determine the baseline for environmental radiological health practices in Melaka state, Malaysia

International Nuclear Information System (INIS)

Ramli, Ahmad Termizi; Sahrone, Sallehudin; Wagiran, Husin

2005-01-01

Environmental terrestrial gamma radiation dose rates were measured throughout Melaka, Malaysia, over a period of two years, with the objective of establishing baseline data on the background radiation level. Results obtained are shown in tabular, graphic and cartographic form. The values of terrestrial gamma radiation dose rate vary significantly over different soil types and for different underlying geological characteristics present in the study area. The values ranged from 54 ± 5 to 378 ± 38 nGy h -1 . The highest terrestrial gamma dose rates were measured over soil types of granitic origin and in areas with underlying geological characteristics of an acid intrusive (undifferentiated) type. An isodose map of terrestrial gamma dose rate in Melaka was drawn by using the GIS application 'Arc View'. This was based on data collected using a NaI(Tl) scintillation detector survey meter. The measurements were taken at 542 locations. Three small 'hot spots' were found where the dose rates were more than 350 nGy h -1 . The mean dose rates in the main population areas in the mukims (parishes) of Bukit Katil, Sungai Udang, Batu Berendam, Bukit Baru and Bandar Melaka were 154 ± 15, 161 ± 16, 160 ± 16, 175 ± 18 and 176 ± 18 nGy h -1 , respectively. The population-weighted mean dose rate throughout Melaka state is 172 ± 17 nGy h -1 . This is lower than the geographical mean dose rate of 183 ± 54 nGy h -1 . The lower value arises from the fact that most of the population lives in the central area of the state where the lithology is dominated by sedimentary rocks consisting of shale, mudstone, phyllite, slate, hornfels, sandstone and schist of Devonian origin which have lower associated dose rates. The mean annual effective dose to the population from outdoor terrestrial gamma radiation was estimated to be 0.21 mSv. This value is higher than the world average of 0.07 mSv

Heavy Metal Concentration in Soil at Sg. Kembong Landfill, Bangi, Selangor

International Nuclear Information System (INIS)

Natrah Mohamed; Umar Hamzah; Sahibin Abd Rahim

2009-01-01

The distribution of heavy metals in soils, physico-chemical properties of soils and 2D geo electrical resistivity survey at Sungai Kembong sanitary landfill were analyzed in order to investigate the effect of heavy metals in the leachate around the dumping site. A total of 30 soil samples were collected for physico-chemical and heavy metals analysis by hand auger from a depth of about 60 cm in the ground within the covered inactive landfill. Geo electrical resistivity survey was carried out using Wenner electrode array and 2-D imaging technique. Electrode spacing used was 5 m along 300 m line. The soil samples contained about 25 - 75 % of sand, 4 - 40 % of clay and 19 - 67 % of silt. Results of heavy metals analysis showed that the concentrations of Cu, Pb and Cr were higher than the background level while other metals such as Ni, Co, Cd, Zn and Fe were lower than the background values. The range of Cu concentrations is 2-326 μg/ g while Pb and Cr are 3-78 μg/ g and 4-76 μg/ g, respectively. The range of resistivity based on 2D inverse model along the survey line is from 5 Ωm to 105 Ωm. Resistivity values of 3 to 5 Ωm were interpreted as representing leachate plume. The width of leachate plumes was between 20 to 100 m. The average value of CEC is from 1.7 to 3.8 meq/ 100 and the pH value ranged from 4 to 7. The electrical conductivity is in between 1910 to 5525 μS/cm. The organic matter in the soil is ranged from 0.3 to 5.6 %. Muscovite, quartz, kaolinite and orthoclase minerals were found dominant in the XRD patterns of the samples. These minerals were interpreted as coming from the covering metasediments soil taken from the surrounding areas. These results showed that the soil cover used in the dumping site managed to control the heavy metals from infiltrating into the surrounding areas. (author)

Monitoring and mapping leaf area index of rubber and oil palm in small watershed area

International Nuclear Information System (INIS)

Rusli, N; Majid, M R

2014-01-01

Existing conventional methods to determine LAI are tedious and time consuming for implementation in small or large areas. Thus, raster LAI data which are available free were downloaded for 4697.60 km 2 of Sungai Muar watershed area in Johor. The aim of this study is to monitor and map LAI changes of rubber and oil palm throughout the years from 2002 to 2008. Raster datasets of LAI value were obtained from the National Aeronautics and Space Administration (NASA) website of available years from 2002 to year 2008. These data, were mosaicked and subset utilizing ERDAS Imagine 9.2. Next, the LAI raster dataset was multiplied by a scale factor of 0.1 to derive the final LAI value. Afterwards, to determine LAI values of rubber and oil palms, the boundaries of each crop from land cover data of the years 2002, 2006 and 2008 were exploited to overlay with LAI raster dataset. A total of 5000 sample points were generated utilizing the Hawths Tool (extension in ARcGIS 9.2) within these boundaries area and utilized for extracting LAI value of oil palm and rubber. In integration, a wide range of literature review was conducted as a guideline to derive LAI value of oil palm and rubber which range from 0 to 6. The results show, an overall mean LAI value from year 2002 to 2008 as decremented from 4.12 to 2.5 due to land cover transition within these years. In 2002, the mean LAI value of rubber and oil palm is 2.65 and 2.53 respectively. Meanwhile in 2006, the mean LAI value for rubber and oil palm is 2.54 and 2.82 respectively. In 2008, the mean LAI value for both crops is 0.85 for rubber and 1.04 for oil palm. In conclusion, apart from the original function of LAI which is related to the growth and metabolism of vegetation, the changes of LAI values from year 2002 to 2008 also capable to explain the process of land cover changes in a watershed area

Kemiskinan Pada Keluarga Penambang Pasir Di Tiga Desa Daerah Aliran Sungai Tajum Kabupaten Banyumas Poverty of Sand Miner Family in Three Villages at Tajum River Flowing Area, Banyumas Regency

OpenAIRE

Sudjarwanto; Sugito

2007-01-01

The aim of this research was to know poverty of sand miner family at Tajum river flowing area, Banyumas and their received advocacy. Data were collected from 60 respondents chosen by cluster sampling method. Result of the research showed that respondents worked daily as sand miner in average of 7.25 hours and received their income of Rp10,131.00 or Rp303,979.00 per month. Their low income and high number of family member (average of 4.75 persons) pushed they and their family member to work fo...

Model Penilaian Risiko Kebakaran Perkotaan dengan Sistem Pakar berbasis GIS Grid-Based

Directory of Open Access Journals (Sweden)

Sabrillah Taridala

2017-12-01

Full Text Available Abstrak Kota Kendari merupakan suatu kawasan perkotaan dengan luas wilayah terkecil dan jumlah penduduk terpadat di Provinsi Sulawesi Tenggara. Bencana kebakaran di Kota Kendari sering terjadi dan telah menimbulkan kerugian yang cukup banyak, hingga menelan korban jiwa. Penelitian ini bertujuan untuk melakukan penilaian terhadap tingkat risiko bencana kebakaran di Kota Kendari dengan menggunakan pendekatan Sistem Pakar (Expert System berbasis Sistem Informasi Geografis (SIG. Hasil penelitian menujukkan bahwa tingkat risiko kebakaran di Kota Kendari terklasifikasi dalam empat kelas, yaitu tingkat risiko kebakaran sangat tinggi sebanyak 206 grid, tingkat risiko kebakaran tinggi sebanyak 6.815 grid, tingkat risiko kebakaran rendah sebanyak 46.175 grid, dan tingkat risiko kebakaran sangat rendah sebanyak 54.640 grid. Tingkat risiko kebakaran sangat tinggi di Kota Kendari merupakan kawasan terbangun yang berpenduduk padat dengan dominasi jenis material bangunan kayu dan campuran, terletak pada daerah dengan morfologi berbukit, dan aksesibilitas hanya dilalui oleh jalan umum yang memiliki lebar jalur lalu lintas <4 meter. Wilayah dengan tingkat risiko sangat rendah merupakan kawasan non-terbangun yang didominasi oleh badan air (sungai dan rawa, hutan dan sebagian kawasan pertanian (kebun. Kawasan tersebut bermorfologi datar, berbukit dan bergunung. Abstract Kendari city is an urban area with the smallest area and the densest population in Southeast Sulawesi Province. Fire disaster in the city of Kendari often occurs and has caused considerable losses, to claim casualties. This study aims to assess the risk degree of fire disaster in Kendari City using Expert System Approach based on Geographic Information System (GIS. The results showed that the degrees of fire risk in Kendari City were classified into four classes, ie very high fire risk degree, 206 grid, high fire risk degree, 6,815 grid, low fire risk degree, 46.175 grid, and very low fire risk, as

Benthic infaunal community structuring in an acidified tropical estuarine system.

Science.gov (United States)

Hossain, M Belal; Marshall, David J

2014-01-01

Recent studies suggest that increasing ocean acidification (OA) should have strong direct and indirect influences on marine invertebrates. While most theory and application for OA is based on relatively physically-stable oceanic ecological systems, less is known about the effects of acidification on nearshore and estuarine systems. Here, we investigated the structuring of a benthic infaunal community in a tropical estuarine system, along a steep salinity and pH gradient, arising largely from acid-sulphate groundwater inflows (Sungai Brunei Estuary, Borneo, July 2011- June 2012). Preliminary data indicate that sediment pore-water salinity (range: 8.07 - 29.6 psu) declined towards the mainland in correspondence with the above-sediment estuarine water salinity (range: 3.58 - 31.2 psu), whereas the pore-water pH (range: 6.47- 7.72) was generally lower and less variable than the estuarine water pH (range: 5.78- 8.3), along the estuary. Of the thirty six species (taxa) recorded, the polychaetes Neanthes sp., Onuphis conchylega, Nereididae sp. and the amphipod Corophiidae sp., were numerically dominant. Calcified microcrustaceans (e.g., Cyclopoida sp. and Corophiidae sp.) were abundant at all stations and there was no clear distinction in distribution pattern along the estuarine between calcified and non-calcified groups. Species richness increased seawards, though abundance (density) showed no distinct directional trend. Diversity indices were generally positively correlated (Spearman's rank correlation) with salinity and pH (p 0.05). Three faunistic assemblages were distinguished: (1) nereid-cyclopoid-sabellid, (2) corophiid-capitellid and (3) onuphid- nereid-capitellid. These respectively associated with lower salinity/pH and a muddy bottom, low salinity/pH and a sandy bottom, and high salinity/pH and a sandy bottom. However, CCA suggested that species distribution and community structuring is more strongly influenced by sediment particle characteristics than by the

KONFLIK LINGKUNGAN DI KAMPUNG AGAS, TANJUNG UMA, BATAM (Environmental Conflict in Kampung Agas, Tanjung Uma, Batam

Directory of Open Access Journals (Sweden)

Saprial Saprial

2004-11-01

Full Text Available ABSTRAK Perkembangan kota Batam sebagai kawasan industri, perdagangan, pelabuhan, dan pariwisata, membawa tidak saja dampak positip, melainkan juga dampak negatif. Salah satu dampak negatif yang muncul adalah konffik lingkungan dalam bentuk pencemaran air di sungai Jodoh yang menganggu pemukiman liar di Kampung Agas, Tanjung Uma. Penelitian ini bertujuan untuk mengkaji akar masalah konflik dan resolusinya. Penelitian ini merupakan studi deskriptif-kualitatip, dengan data yang dikumpulkan melalui wawancara mendalam dengan pihak-pihak yang terlibat dalam konflik. Penelitian ini menemukan bahwa akar masalah konffik adalah konflik spasial antara permukiman liar dan pembangunan ruko yang menimbulkan limbah di sekitar permukiman liar. Tidak dibangunnya IPAL memicu protes warga di permukiman liar dan terjadilah konflik. Penelitian ini melihat bahwa penyelesaian konflik dalam bentuk kompensasi atau “sagu hati" tidak menyelesaikan akar masalah konflik. Walaupun begitu, penyelesaian ini dipandang oleh pihak-pihak yang berkonflik sebagai hasil mufakat yang dimungkinkan untuk menghindari konflik sosial yang lebih besar. Penelitian ini juga menemukan bahwa bentuk penyelesaian konflik melalui musyawarah dan mufakat dapat dilakukan secara efektif sejauh ada mediator yang dipercaya oleh pihak-pihak yang bersengketa.   ABSTRACT The development of Batam City as an area for industry, trade, ship transit, and tourism activities brings not only positive impacts, but negative impact as well. One of the negative impacts is environmental conflict in the form of water pollution in Sei Jodoh downstream which affected informal settlement in Kampung Agas, Tanjung Uma. This research aimed to study the roots of the conflict and evaluated the resolution. It adopted a descriptive, qualitative research method. Data were collected through in-depth interviews with parties involved in the conflict. The research founded that the root causes of the environmental conflict was the

Seroprevalence of dengue among healthy adults in a rural community in Southern Malaysia: a pilot study.

Science.gov (United States)

Dhanoa, Amreeta; Hassan, Sharifah Syed; Jahan, Nowrozy Kamar; Reidpath, Daniel D; Fatt, Quek Kia; Ahmad, Mohtar Pungut; Meng, Cheong Yuet; Ming, Lau Wee; Zain, Anuar Zaini; Phipps, Maude Elvira; Othman, Iekhsan; Rabu, Aman Bin; Sirajudeen, Rowther; Fatan, Ahmad Abdul Basitz Ahmad; Ghafar, Faidzal Adlee; Ahmad, Hamdan Bin; Allotey, Pascale

2018-01-16

The frequency and magnitude of dengue epidemics continue to increase exponentially in Malaysia, with a shift in the age range predominance toward adults and an expansion to rural areas. Despite this, information pertaining to the extent of transmission of dengue virus (DENV) in the rural community is lacking. This community-based pilot study was conducted to establish DENV seroprevalence amongst healthy adults in a rural district in Southern Malaysia, and to identify influencing factors. In this study undertaken between April and May 2015, a total of 277 adult participants were recruited from households across three localities in the Sungai Segamat subdistrict in Segamat district. Sera were tested for immunoglobulin G (IgG) (Panbio® Dengue Indirect IgG ELISA/high-titer capture) and immunoglobulin M (IgM) (Panbio®) antibodies. The plaque reduction neutralization test (PRNT) was conducted on random samples of IgG-positive sera for further confirmation. Medical history and a recall of previous history of dengue were collected through interviews, whereas sociodemographic information was obtained from an existing database. The overall seroprevalence for DENV infection was 86.6% (240/277) (95% CI: 83-91%). Serological evidence of recent infection (IgM/high-titer capture IgG) was noted in 11.2% (31/277) of participants, whereas there was evidence of past infection in 75.5% (209/277) of participants (indirect IgG minus recent infections). The PRNT assay showed that the detected antibodies were indeed specific to DENV. The multivariate analysis showed that the older age group was significantly associated with past DENV infections. Seropositivity increased with age; 48.5% in the age group of 45 years (P people. The majority of infections did not give rise to recognizable disease (either asymptomatic or nonspecific symptoms) as only 12.9% of participants (31/240) recalled having dengue in the past. The predominantly rural community under study had a very high previous

Mobile phone reminders and peer counseling improve adherence and treatment outcomes of patients on ART in Malaysia: A randomized clinical trial.

Science.gov (United States)

Abdulrahman, Surajudeen Abiola; Rampal, Lekhraj; Ibrahim, Faisal; Radhakrishnan, Anuradha P; Kadir Shahar, Hayati; Othman, Norlijah

2017-01-01

Adherence to treatment remains the cornerstone of long term viral suppression and successful treatment outcomes among patients receiving Antiretroviral Therapy (ART). Evaluate the effectiveness of mobile phone reminders and peer counseling in improving adherence and treatment outcomes among HIV positive patients on ART in Malaysia. A single-blind, parallel group RCT conducted in Hospital Sungai Buloh, Malaysia in which 242 adult Malaysian patients were randomized to intervention or control groups. Intervention consisted of a reminder module delivered through SMS and telephone call reminders by trained research assistants for 24 consecutive weeks (starting from date of ART initiation), in addition to adherence counseling at every clinic visit. The length of intended follow up for each patient was 6 months. Data on adherence behavior of patients was collected using specialized, pre-validated Adult AIDS Clinical Trial Group (AACTG) adherence questionnaires. Data on weight, clinical symptoms, CD4 count and viral load tests were also collected. Data was analyzed using SPSS version 22 and R software. Repeated measures ANOVA, Friedman's ANOVA and Multivariate regression models were used to evaluate efficacy of the intervention. The response rate after 6 months follow up was 93%. There were no significant differences at baseline in gender, employment status, income distribution and residential location of respondents between the intervention and control group. After 6 months follow up, the mean adherence was significantly higher in the intervention group (95.7; 95% CI: 94.39-96.97) as compared to the control group (87.5; 95% CI: 86.14-88.81). The proportion of respondents who had Good (>95%) adherence was significantly higher in the intervention group (92.2%) compared to the control group (54.6%). A significantly lower frequency in missed appointments (14.0% vs 35.5%) (p = 0.001), lower viral load (p = 0.001), higher rise in CD4 count (p = 0.017), lower incidence of

Eksplorasi dan Karakterisasi Tanaman Genjer (Limnocharis flava (L. Buch di Kabupaten Pangandaran Berdasarkan Karakter Morfologi dan Agronomi

Directory of Open Access Journals (Sweden)

Liberty Chaidir

2016-12-01

Full Text Available Genjer merupakan tanaman yang tumbuh liar di area persawahan, rawa, atau sungai yang keberadaannya sering dianggap sebagai gulma. Tanaman genjer memiliki banyak manfaat, diantaranya sebagai bahan penyerap logam berat dalam tanah dan sebagai obat yang memiliki banyak kandungan gizi. Penelitian ini bertujuan untuk mengetahui variasi karakter morfologi dan karakter agronomi untuk mengetahui hubungan kekerabatan tanaman genjer antar daerah di Kabupaten Pangandaran. Penelitian dilaksanakan di Kabupaten Pangandaran pada Mei sampai Oktober 2015. Metode yang digunakan adalah metode eksplorasi purposive sampling pada 77 aksesi genjer yang diambil dari Kabupaten Pangandaran. Hasil penelitian menunjukkan terdapat keragaman fenotipik yang luas pada karakter morfologi ujung daun, warna batang, tekstur daun, warna daun, panjang lekukan bawah daun, warna kelopak bunga dan warna bunga. Karakter agronomi yang mempunyai keragaman yang luas ialah tinggi tanaman, jumlah batang per rumpun, panjang daun, lebar daun, jumlah daun, jumlah bunga dan diameter batang. Tanaman genjer di Kabupaten Pangandaran memiliki kekerabatan yang jauh dengan rentang jarak Euclidian 0,48 sampai 10,17. Aksesi yang memiliki hubungan kekerabatan paling jauh yaitu Ciakar (001 dengan jarak Euclidian 10,17, sedangkan yang memiliki hubungan kekerabatan paling dekat yaitu Cikalong (003 dan Cikalong (004 dengan jarak Euclidian 0,48. Genjer or Yellow velvetleaf is a plant that grows wild in lowland area, swamp or river which existence is considered as a weed. Genjer has a lot of benefits, such as material absorbent for heavy metals in the soil and medicine that has a lot of nutrition. This study aimed to determine the variety of morphological and agronomic characters of Genjer in Pangandaran Regency and to determine the genetic relationship of genjer between regions in Pangandaran. The research was conducted in the Pangandaran Regency on May to October 2015. The method used purposive sampling

KATALOG SEBAGAI MEDIA PROMOSI BAGI UMKM KOELON KALIE KROBOKAN SEMARANG

Directory of Open Access Journals (Sweden)

Dimas Irawan Ihya' Ulumuddin

2016-12-01

Full Text Available Abstrak Sampah merupakan zat yang bersifat organik maupun anorganik yang dihasilkan dari setiap aktifitas manusia, seperti rumah tangga, industri, maupun komersil. Persoalan sampah di Indonesia, terutama di perkotaan merupakan masalah serius. Dinas Kebersihan Kota Semarang mencatat bahwa sampah perkotaan dari tahun ke tahun semakin meningkat seiring laju pertumbuhan jumlah penduduk. Sampah mengakibatkan permasalahan yang komplek, antara lain pembuangan sampah liar yang dapat menimbulkan berbagai penyakit, kota kotor, bau tidak sedap, mengurangi daya tampung sungai dan lain-lain. Tahun 2012, berdiri UMKM “Koelon Kalie” yang bertujuan meningkatkan pendapatan masyarakat dengan mengelola sampah plastik menjadi produk yang mempunyai nilai jual. Permasalahannya adalah belum adanya kegiatan promosi yang dilakukan dan hanya melalui mulut ke mulut konsumen dalam memasarkan produk. Media katalog merupakan media yang terjangkau dan efektif. Di dalam media katalog berisi informasi mengenai produk. Informasi yang dicantumkan yaitu nama, spesifikasi, dan harga produk tersebut. Gambaran produk dapat dilihat dengan jelas melalui informasi foto produk yang ditampilkan di media katalog. Berkebalikan dengan media mulut ke mulut yang hanya bisa didengarkan tanpa adanya gambaran produk dengan jelas. Melalui media katalog, konsumen mendapat informasi lebih jelas mengenai gambaran produk olahan sampah plastik. Kata Kunci: katalog, media promosi, UMKM Abstract Trash are an organic and inorganic substance that generated from any human activity, such as household, industrial, and commercial. Trash issues in Indonesia, especially in urban area is a serius problem. Department of Semarang City Sanitation noted that urban trash from year to year increases along with population growth rate. The trash resulting complex problems, such as illegal waste disposal, appear various diseases, dirty city, odor, reduce the capacity of river and others. In 2012, arise MSMEs �

KONSEP WATERFRONT PADA PERMUKIMAN ETNIS KALI SEMARANG

Directory of Open Access Journals (Sweden)

Ajeng Sarinastiti

2015-12-01

Full Text Available Kali Semarang sebagai sungai bersejarah di Semarang, dahulu memiliki fungsi transportasi yang membelah perekonomian dan pertahanan kota. Bermacam etnis pedagang tinggal di sekitarnya hingga daerah tersebut menjadi permukiman etnis. Contohnya Kampung Melayu, etnis Tionghoa pada Kampung Pecinan, etnis Arab pada Kampung Kauman, serta Kampung Sekayu. Dan juga Kawasan Kota Lama sebagai daerah bersejarah dalam masa pemerintahan Kota Semarang. Kali Semarang memberi pengaruh fungsi waterfront pada permukiman tersebut.Penelitian ini bertujuan untuk mengetahui konsep waterfront pada permukiman etnis Kali Semarang, yaitu Kampung Melayu, Kawasan Kota Lama, Kampung Pecinan, Kampung Kauman, dan Kampung Melayu. Diperlukan eksplorasi dan deskripsi keadaan yang mendalam untuk mengidentifikasikan informasi baru pada lokasi penelitian dengan konsep atau teori yang menjelaskan fenomena yang akan terjadi. Metode kualitatif rasionalistik digunakan dengan landasan teori mengenai waterfront dan permukiman etnis disertai dengan pengumpulan data melalui studi literatur dari berbagai sumber, observasi lapangan langsung, dan pertanyaan mendalam kepada key person. Hasil penelitian ini menunjukkan bahwa hanya Kampung Melayu dan Kawasan Kota Lama yang pada awal mulanya menggunakan konsep waterfront karena lokasinya merupakan kawasan pelabuhan, pergudangan, dan perdagangan. Kampung Pecinan sebagai kawasan perdagangan, serta Kampung Kauman dan Kampung Sekayu sebagai permukiman tidak menggunakan konsep waterfront.[Title: Waterfront Concept on Ethnic Settlement in Kali Semarang] Kali Semarang, as a historical river in Semarang, has function as transportation to support the economy and city. Many ethnic traders settled around, so that area becomes ethnic settlement, such as Kampung Melayu, Chinese ethnic in Kampung Pecinan, Arabian ethnic in Kampung Kauman, and Kampung Sekayu, and Kota Lama areas as historical area in Semarang’s government era. The Kali Semarang giving influence

Keanekaragaman Jenis Kupu-Kupu Superfamili Papilionoidae di Banyuwindu, Limbangan Kendal

Directory of Open Access Journals (Sweden)

Ratna Oqtafiana

2013-03-01

Full Text Available Kupu-kupu turut memberi andil dalam mempertahankan keseimbangan ekosistem dan memperkaya keanekaragaman hayati. Tujuan dari penelitian ini adalah untuk mengetahui keanekaragaman jenis kupu-kupu superfamili Papilionoidae di Dukuh Banyuwindu Desa Limbangan Kecamatan Limbangan Kabupaten Kendal khususnya di habitat hutan sekunder, permukiman, Daerah Aliran Sungai (DAS dan persawahan.Populasi dalam penelitian ini adalah semua jenis kupu-kupu superfamili Papilionoidae yang ada di Banyuwindu, Limbangan Kendal. Sampel penelitian ini adalah jenis kupu-kupu superfamili Papilionoidae yang teramati di Banyuwindu Limbangan Kendal khususnya di habitat hutan sekunder, permukiman, DAS dan persawahan. Penelitian dilakukan dengan metode Indeks Point Abudance (IPA atau metode titik hitung.Hasil penelitian ditemukan sebanyak 62 jenis kupu-kupu superfamili Papilionoidae yang terdiri dari 737 individu yang tergolong kedalam empat famili yaitu Papilionidae, Pieridae, Lycaenidae dan Nymphalidae. Hasil analisis indeks keanekaragaman jenis berkisar antara 2,74-3,09, indeks kemerataan jenis berkisar antara 0,86-0,87 dan memiliki dominansi berkisar antara 0,07-0,09. Indeks keanekaragaman jenis dan indeks kemerataan jenis tertinggi tercatat pada habitat permukiman yaitu 3,09 dan 0,87 dan memiliki dominansi 0,07 sedangkan terendah tercatat pada habitat persawahan yaitu 2,74 dan 0,86 dan memiliki dominansi 0,07.Butterfly also contribute in maintaining the ecological balance and enrich biodiversity. The aim of this research was to determine the diversity of butterflies’ superfamily Papilionoidae in Banyuwindu Hamlet Limbangan Sub district Kendal Regency, especially in the secondary forest habitat, settlements, river flow area (RFA and rice field. The population in this research were all kinds of butterflies’ Papilionoidae superfamily in Banyuwindu, Limbangan Kendal. The sample was kind of butterfly superfamily Papilionoidae that observed in Banyuwindu Limbangan Kendal

Identification of Water Quality Significant Parameter with Two Transformation/Standardization Methods on Principal Component Analysis and Scilab Software

Directory of Open Access Journals (Sweden)

Jovan Putranda

2016-09-01

Full Text Available Water quality monitoring is prone to encounter error on its recording or measuring process. The monitoring on river water quality not only aims to recognize the water quality dynamic, but also to evaluate the data to create river management policy and water pollution in order to maintain the continuity of human health or sanitation requirement, and biodiversity preservation. Evaluation on water quality monitoring needs to be started by identifying the important water quality parameter. This research objected to identify the significant parameters by using two transformation or standardization methods on water quality data, which are the river Water Quality Index, WQI (Indeks Kualitas Air, Sungai, IKAs transformation or standardization method and transformation or standardization method with mean 0 and variance 1; so that the variability of water quality parameters could be aggregated with one another. Both of the methods were applied on the water quality monitoring data which its validity and reliability have been tested. The PCA, Principal Component Analysis (Analisa Komponen Utama, AKU, with the help of Scilab software, has been used to process the secondary data on water quality parameters of Gadjah Wong river in 2004-2013, with its validity and reliability has been tested. The Scilab result was cross examined with the result from the Excel-based Biplot Add In software. The research result showed that only 18 from total 35 water quality parameters that have passable data quality. The two transformation or standardization data methods gave different significant parameter type and amount result. On the transformation or standardization mean 0 variances 1, there were water quality significant parameter dynamic to mean concentration of each water quality parameters, which are TDS, SO4, EC, TSS, NO3N, COD, BOD5, Grease Oil and NH3N. On the river WQI transformation or standardization, the water quality significant parameter showed the level of

Distribusi mikroplastik pada sedimen di Muara Badak, Kabupaten Kutai Kartanegara

Directory of Open Access Journals (Sweden)

Intan Sari Dewi

2015-11-01

Full Text Available Abstract. The distribution of microplastic was studied in the Muara Badak districts Kutai Kartanegara regency in May 2015. Sediment samples were taken from four stations that represent residential, in mangrove, near the beach and away from residential areas. Sediment samples were taken using the pipe at a depth of 0-10 cm - 10-20 cm, then the observed and calculated abundance of microplastic. The results showed that the type microplastic found is a fragment, film and fiber. At Station 1 found fragments about 100.2-201.3 particle/kg, the film about 69.6-79.9 particles/kg and fiber  about 43.1-50.9 particles/kg, the stations 2 found of fragments about 146.5-238.8 particle/kg, the film about 53.2-81.9 particles/kg and fiber about 48.8-75.5 particles/kg, stations 3 found of fragments about 204.2-207.9 particles/kg, the film about 107.7-126.5 particle/kg and fiber about 26.1-39.9 particles/kg, station 4 found of fragments about 167.6-220 particle/kg, the film about 59.7-69.5 particle/ kg and fiber about 47.5-55.3 particles/kg. Keywords: Depth; Microplastic; Muara Badak; Sediment   Abstrak. Distribusi mikroplastik diteliti di Kecamatan Muara Badak Kabupaten Kutai Kartanegara pada bulan Mei 2015. Sampel sedimen diambil dari 4 stasiun yang mewakili pemukiman penduduk, dekat sungai, dekat pantai dan jauh dari pemukiman penduduk. Sampel sedimen diambil menggunakan pipa paralon pada kedalaman 0-10 cm – 10-20 cm, kemudian diamati dan dihitung kelimpahan mikroplastik. Hasil penelitian menunjukan bahwa jenis mikroplastik yang ditemukan adalah fragmen, film dan fiber. Pada stasiun 1 ditemukan fragmen berkisar 100,2-201,3 partikel/kg, film berkisar 69,6-79,9 partikel/kg dan fiber berkisar 43,1-50,9 partikel/kg, stasiun 2 ditemukan fragmen berkisar 146,5-238,8 partikel/kg, film berkisar 53,2-81,9 partikel/kg dan fiber berkisar 48,8-75,2 partikel/kg, stasiun 3 ditemukan fragmen berkisar 204,2-207,9 partikel/kg, film berkisar 107,7-126,5 partikel/kg dan fiber

KAJIAN ASPEK FISIKA, KIMIA, DAN BIOLOGI PERAIRAN SITU RAWABEBEK, KARAWANG, DALAM RANGKA PENGELOLAAN PERIKANAN BERBASIS BUDI DAYA

Directory of Open Access Journals (Sweden)

Bambang Gunadi

2016-11-01

Full Text Available Penelitian tentang aspek-aspek fisika, kimia, dan biologi perairan bekas galian pasir telah dilakukan di Situ Rawabebek Kabupaten Karawang. Tujuan penelitian adalah untuk mendapatkan data dasar bagi penyusunan model pengelolaan perikanan di perairan bekas galian pasir berdasarkan prinsip perikanan berbasis budi daya (culture-based fisheries, CBF. Hasil pengamatan menunjukkan bahwa fluktuasi air di Situ Rawabebek mencapai hingga 1,90 m dan sangat dipengaruhi oleh ketinggian air Sungai Citarum. Nilai semua parameter kualitas air berada dalam kisaran yang layak untuk mendukung kehidupan ikan sementara kadar logam berat berada dalam ambang aman untuk kehidupan organisme akuatik termasuk ikan dan kesehatan manusia. Indeks keragaman plankton (Indeks Shanon-Wiener pada setiap stasiun dan musim pengamatan berkisar antara 3,95—4,52 yang berarti bahwa komunitas plankton di Situ Rawabebek stabil dan perairannya dalam kondisi belum tercemar. Jenis ikan yang teramati untuk mengetahui pola reproduksinya di Situ Rawabebek antara lain lalawak (Puntius bramoides, paray (Rasbora argyrotaenia, dan seren (Cyclocheilichthys apogon dengan tingkat Indeks Kematangan Gonad (IKG masing-masing 3,43%; 12,82%; dan 3,95%. Dari analisis terhadap kondisi fisika, kimia, dan biologinya disimpulkan bahwa perairan bekas galian pasir Situ Rawabebek cukup layak untuk pengembangan perikanan berbasis budi daya. A study on the physical, chemical, and biological aspects of the abandoned sand mining reservoir was conducted in Rawabebek Reservoir (Karawang Regency, West Java. This study aimed to develop a model of fisheries management in the reservoir based on the culture based fisheries (CBF system. The study showed that the fluctuation of water level in the Rawabebek Reservoir was monitored up to 1.90 m and highly influenced by the water level of Citarum River. The average value of all water quality parameters and heavy metals were in the suitable range for aquatic organism, fish and

REVIEW OF COASTAL CHARACTERISTICS OF IRON SAND DEPOSITS IN CILACAP CENTRAL JAVA

Directory of Open Access Journals (Sweden)

Hananto Kurnio

2017-07-01

Tua” yang kaya akan mineral magnetit dan ilmenit pada pedalaman Cilacap dengan kondisi elevasi curam dan batuan sangat terlapukkan. Muatan sedimen yang tinggi dari Cekungan Serayu di pedalaman tersebut (3.500-4.500 ton/km2/tahun; cekungan Sungai Citarum hanya 800-1.200 ton/km2/tahun menyebabkan pengendapan yang sangat luas pasir besi di wilayah pantai. Kata kunci: pantai, karakteristik, pasir besi, Cilacap

Karakteristik Habitat Perkembangbiakan Vektor Filariasis di Kecamatan Kodi Balaghar Kabupaten Sumba Barat Daya

Directory of Open Access Journals (Sweden)

Mefi Mariana Tallan

2016-12-01

dan biologi sebagai habitat perkembangbiakan nyamuk yang mempengaruhi penyebaran filariasis. Penelitian dilakukan di Kecamatan Kodi Balaghar Kabupaten Sumba Barat Daya selama delapan bulan dari bulan April – November 2014. Ditemukan habitat yang berpotensial sebagi tempat perkembangbiakan nyamuk dimana habitat yang dominan yaitu genangan air, mata air, saluran air dan sungai kecil dengan suhu berkisar 21-350C, pencahayaan 0,22-795 lux, PH berkisar antara 7,2-7,7, salinitas 0-0,1 ‰ dengan ketinggian tempat berkisar antara 25-117m/dpl. Dimana spesies yang ditemukan pada habitat perkembangbiakan adalahAn.vagus, An. barbirostris, An.annularis, Cx.vishnui, Cx bitaeniorhynchus, Cx quinquefasciatus, Ar. Kuchingensis.Kata Kunci : Filariasis, Lingkungan, Habitat perkembangbiakan

KEMAMPUAN GENTENG PLASTIK BERGELOMBANG (CORRUGATED PLASTIC SEBAGAI BIOFILTER PARTIKEL AMONIAK DAN BAHAN ORGANIK DI MEDIA BUDIDAYA DAN LIMBAH CAIR BUDIDAYA IKAN (Performance of Corrugated Plastic as Biofilter of Ammonia Particle and Organic Material

Directory of Open Access Journals (Sweden)

Muslim Muslim

2010-07-01

Full Text Available ABSTRAK Pertumbuhan budidaya ikan dalam beberapa dekade ini berkembang sangat pesat, hal ini karena permintaan akan ikan meningkat. Meningkatnya kegiatan budidaya ikan selalu diiringi dengan meningkatnya limbah yang dihasilkan. Hal ini akan sangat cepat berpengaruh bila sistem budidaya yang dipakai adalah semi intesif atau intensif. Limbah tersebut harus segera dihilangkan atau dikurangi, karena akan berdampak pada ikan yang dibudidaya dan lingkungan seperti sungai dan laut. Tujuan penelitian ini adalah ingin mengetahui kemampuan genteng plastik bergelombang mengurangi limbah yang dihasilkan budidaya ikan yaitu Total Suspended Sediment (TSS, Suspended Sediment (SS, amoniak dan bahan organik (COD. Dari hasil penelitian diperoleh bahwa air limbah budidaya ikan yang mengandung TSS, SS, amoniak dan bahan organik setelah dilewatkan dengan genteng plastik bergelombang konsentrasinya menurun dengan tingkat efisiensi pengurangan yang terjadi di dalam kolam ikan dan di luar kolam ikan adalah sebagai berikut: 74,51% dan 54,42% (TSS; 39,20% dan 49,12% (SS; 19,82% dan 14,2% (amoniak; dan 24,82% dan 22,47% (COD. Ternyata genteng plastik bergelombang mempunyai tingkat pengurangan (g/m3/hr dan tingkat pengurangan spesifik (mg/m2/hr terhadap kandungan amoniak lebih efektif bila dibandingkan dengan material lain seperti plastic rolls, scrub pads, pipa PVC dan lain sebagainya.   ABSTRACT Aquaculture has been developing rapidly during the last few decades; it is due to the increase of fish demand. Increasing aquaculture activities especially with semi-intensive and intensive system have significant effect on waste production, which has to be removed or to be reduced quickly because will effect on fish in rearing tank and environment when through away to environment such as river and sea. The objectives of this study were to know the capability of corrugated plastic to remove or to reduce wastes content produced by aquaculture activities, i.e, Total Suspended

Mobile phone reminders and peer counseling improve adherence and treatment outcomes of patients on ART in Malaysia: A randomized clinical trial.

Directory of Open Access Journals (Sweden)

Surajudeen Abiola Abdulrahman

Full Text Available Adherence to treatment remains the cornerstone of long term viral suppression and successful treatment outcomes among patients receiving Antiretroviral Therapy (ART.Evaluate the effectiveness of mobile phone reminders and peer counseling in improving adherence and treatment outcomes among HIV positive patients on ART in Malaysia.A single-blind, parallel group RCT conducted in Hospital Sungai Buloh, Malaysia in which 242 adult Malaysian patients were randomized to intervention or control groups. Intervention consisted of a reminder module delivered through SMS and telephone call reminders by trained research assistants for 24 consecutive weeks (starting from date of ART initiation, in addition to adherence counseling at every clinic visit. The length of intended follow up for each patient was 6 months. Data on adherence behavior of patients was collected using specialized, pre-validated Adult AIDS Clinical Trial Group (AACTG adherence questionnaires. Data on weight, clinical symptoms, CD4 count and viral load tests were also collected. Data was analyzed using SPSS version 22 and R software. Repeated measures ANOVA, Friedman's ANOVA and Multivariate regression models were used to evaluate efficacy of the intervention.The response rate after 6 months follow up was 93%. There were no significant differences at baseline in gender, employment status, income distribution and residential location of respondents between the intervention and control group. After 6 months follow up, the mean adherence was significantly higher in the intervention group (95.7; 95% CI: 94.39-96.97 as compared to the control group (87.5; 95% CI: 86.14-88.81. The proportion of respondents who had Good (>95% adherence was significantly higher in the intervention group (92.2% compared to the control group (54.6%. A significantly lower frequency in missed appointments (14.0% vs 35.5% (p = 0.001, lower viral load (p = 0.001, higher rise in CD4 count (p = 0.017, lower incidence of

DESAIN VEGETASI BERNILAI KONSERVASI DAN EKONOMI PADA KAWASAN PENYANGGA SISTEM TATA AIR DAS BOLANGO (Designing of Vegetation which Conservation and Economic Values in the Buffer Area of Water System at the Bolango Watershed

Directory of Open Access Journals (Sweden)

Danang Wahyu Purnomo

2016-02-01

Full Text Available ABSTRAK Perencanaan pembangunan arboretum di DAS Bolango dengan konsep konservasi dan ekonomi perlu dilakukan karena DAS ini memiliki peranan yang penting dalam kehidupan masyarakat sekitar. Tujuan penelitian ini adalah memberikan rekomendasi tentang komposisi dan struktur vegetasi penyusun hutan pada kawasan arboretum sebagai pemelihara mata air Sungai Bolango. Penelitian dimulai dengan mengidentifikasi sumber mata air, tanah, dan kondisi vegetasi eksisting. Metode wawancara kepada masyarakat setempat dilakukan untuk mendukung data etnobotani. Kajian lahan dilakukan antara lain tata guna, kelas kemampuan, konsep pengelolaan, kesesuaian lahan, dan penentuan vegetasinya. Hasil identifikasi sumber mata air menunjukkan bahwa terdapat 3 lokasi yang potensial dibangun arboretum, yaitu Desa Meranti Kecamatan Tapa Kabupaten Bone Bolango, Desa Dulamayo Selatan Kecamatan Telaga Kabupaten Gorontalo, dan Desa Mongiilo Kecamatan Bolango Ulu Kabupaten Bone Bolango. Berdasarkan data kualitas tanah, ketiga lokasi memiliki media perakaran yang cukup baik untuk tanaman budi daya. Secara umum, semua jenis tanaman budi daya sesuai untuk ditanam di ketiga lokasi arboretum. Perlu dilakukan pembuatan teras dan penerapan pola tanam konservasi yang mengaplikasikan tanaman penutup tanah (cover crop, tanaman budi daya, dan pohon penyusun hutan. Selain itu, perlu pemberian pupuk organik berupa kompos dan pupuk kandang.   ABSTRACT Arboretum development planning in Bolango Watershed using concept of conservation and economy is conducted because the watershed has an important role in people's lives around. This study aims to provide recommendations about composition and structure of forest vegetation in the arboretum area for conserving of Bolango River’s water springs. The study began by identifying the source of the springs, soil, and the existing vegetation. Interview to local communities was conducted to support the data of ethnobotany. Land observation was studied

Greenhouse gas efflux from an impacted Malaysian tropical peat swamp (Invited)

Science.gov (United States)

Waldron, S.; Vihermaa, L. E.; Evers, S.; Garnett, M.; Newton, J.; Padfield, R.

2013-12-01

Tropical peatlands constitute ~11% of global peatland area and ~12% of the global peat C pool. Malaysia alone contains 10% of tropical peats. Due to rising global demands for food and biofuels, SE-Asia peat swamp forest ecosystems are threatened by increasing amounts of drainage, fire and conversion to plantation. These processes can change the GHG emissions and thus net ecosystem C balance. However, in comparison to temperate and boreal peatlands, there is a lack of data on terrestrial-aquatic-atmospheric carbon transfer from tropical peatlands, both those that are little disturbed and those facing anthropogenic pressures. Lateral transport of soil-respired carbon, and fluvial respiration or UV-oxidation of terrestrial DOC primes atmospheric carbon dioxide efflux. We now know that DOC lost from disturbed tropical peat swamp forests can be centuries to millennia old and originates deep within the peat column - this carbon may fuel efflux of old carbon dioxide and so anthropogenic land-use change renders the older, slower carbon cycles shorter and faster. Currently we have no knowledge of how significant ';older-slower' terrestrial-aquatic-atmospheric cycles are in disturbed tropical peatlands. Further, in some areas for commercial reasons, or by conservation bodies trying to minimise peat habitat loss, logged peats have been left to regenerate. Consequently, unpicking the legacy of multiple land uses on magnitude, age and source of GHG emissions is challenging but required to support land management decisions and projections of response to a changing climate. Here, we present the results of our first field campaign in July 2013 to the Raja Musa and Sungai Karang Peat Swamp Forest Reserves in North Selangor, Malaysia. This is one of Malaysia's largest oceanic peat swamps, and has been selectively logged and drained for 80 years, but is now subject to a 30 year logging ban to aid forest regeneration and build up wood stocks. From sites subject to different land use

KERAGAMAN PERTUMBUHAN BIBIT GEMPOL(Nauclea orientalis L. DARI BEBERAPA POHON INDUK

Directory of Open Access Journals (Sweden)

Kurniawati Purwaka Putri

2017-02-01

Full Text Available Gempol (Nauclea orientalis L. is one of the fast growing species that potential to be developed in agroforestry system. These species used as wood production and also Jabon, which is the alternative for sengon wood. Gempol adapted growth at wet and drylands such as at riverbanks, rice fields and yards. The constrained of the development of community forests of gempol for high productivity is the availability of good quality seed sources. Seeds and seedlings are largely determined by the quality of the parent tree, hence the diversity of the mother plant will affect the seeds it produces. The purpose of this study was to determine the diversity of the growth of seedlings in the nursery gempol of 64 parent trees from Majalengka and Banten. The study design used was completely randomized design consisting of 64 trees parent gempol, with three replications and each replication consisted of six seedlings. The variables measured were the diameter and height of seedlings. The results showed that significantly affected the parent tree diameter and height of seedlings gempol. Growth in diameter is the best demonstrated by the parent tree 16 at 5.4 cm. The high growth (32.88 cm produced by seeds from the parent tree 10. Gempol (Nauclea orientalis L. merupakan salah satu tanaman cepat tumbuh yang potensial untuk dikembangkan dengan pola agroforestry.. Jenis tanaman ini dimanfaatkan khususnya masyarakat Jawa Barat sebagai pohon penghasil kayu pertukangan selain sengon dan jabon.Gempol mampu beradaptasi pada lahan basah maupun kering seperti di bantaran sungai, pematang sawah, tegalan dan pekarangan.  Pengembangan hutan rakyat gempol yang produktifitas tinggi terkendala ketersediaan sumber benih yang berkualitas. Benih dan bibit yang berkualitas sangat ditentukan oleh pohon induknya, oleh karena itu keragaman pada pohon induk akan berpengaruh terhadap bibit yang dihasilkannya. Tujuan penelitian ini adalah mengetahui keragaman pertumbuhan bibit gempol di

HYDRO-METEOROLOGICAL CHARACTERISTICS FOR SUSTAINABLE LAND MANAGEMENT IN THE SINGKARAK BASIN, WEST SUMATRA

Directory of Open Access Journals (Sweden)

Kasdi Subagyono

2008-11-01

Full Text Available Studi tentang karakteristik hidro-meteorologi telah dilakukan di wilayah danau Singkarak pada 2006-2007 dengan melibatkan partisipasi masyarakat. Stasiun iklim otomatis dan pengukur tinggi muka air otomatis dipasang untuk memonitor data hidrologi dan meteorologi di wilayah cekungan Singkarak. Data meteorologi dianalisa untuk mengetahui karakteristik iklim di wilayah sekitar danau. Model hidrologi GR4J dan H2U diaplikasikan untuk simulasi discharge dan untuk mengkarakterisasi proses hidrologi di wilayah danau. Simulasi model aliran divalidasi pada musim hujan. Alternatif pengelolaan lahan diformulasikan berdasarkan karakteristik hidrologi daerah aliran sungai di sekitar cekungan Singkarak. Hasil penelitian menunjukkan bahwa daerah tangkapan di sekitar danau Singkarak memiliki respon yang tinggi terhadap jumlah dan intensitas hujan. Hidrograp menunjukkan peningkatan yang tajam dari discharge segera setelah curah hujan mulai dan menurun relative lamban ketika curah hujan berhenti. Untuk pengelolaan lahan secara berkelanjutan di wilayah danau Singkarak, konservasi lahan dan air harus menjadi prioritas utama. Wanatani dapat diimplementasikan sebagai alternatif sistem pertanaman oleh penduduk lokal. Karena potensi kelangkaan air bisa terjadi pada periode kering, panen air dan konservasi air dapat diterapkan sebagai opsi yang dapat dikombinasikan dalam sistem pengelolaan lahan.   Hydro-meteorological processes of the Singkarak basin has been studied involving participatory of local community in 2006-2007. Automatic weather station (AWS and automatic water level recorder (AWLR were installed to record meteorological and hydrological data within the Singkarak Basin. Meteorological data was analyzed to understand the meteorological characteristic surrounding the Basin area. Model of GR4J and H2U were used to simulated discharge and to understand the hydrological processes within the basin. The validation of simulated discharge was done in the wet season

Integrasi Model SWAT dan SIG dalam Upaya Menekan Laju Erosi DAD Deli, Sumatera Utara

Directory of Open Access Journals (Sweden)

Riki Rahmad

2017-04-01

Full Text Available Penelitian ini bertujuan untuk melakukan simulasi model SWAT dalam menghitung besarnya laju erosi DAS, menguji kesesuaian model dalam memprediksi erosi, serta menentukan skenario penggunaan lahan yang paling optimal menurunkan laju erosi. Penelitian ini dilakukan di DAS Deli, Sumatera Utara. Pada penelitian ini analisis SWAT dilakukan dengan bantuan Sistem Informasi Geografi (SIG melalui 4 proses yaitu delineasi, pembentukan Hydrological Response Unit (HRU, pengolahan data dan simulasi, serta proses visualisasi. Hasil penelitian menunjukkan besarnya erosi rata-rata DAS Deli adalah 410,72 ton/ha/tahun. Hasil ini menunjukkan DAS Deli termasuk kedalam Tingkat Bahaya Erosi (TBE kategori Berat dengan kriteria sangat berat 37,04%, berat 17,07%, sedang 21,46%, ringan 17,38%, dan sangat ringan 7,04%. Uji validasi model menunjukkan bahwa ada hubungan positif antara debit model dan observasi dimana persentase perbedaan nilainya sangat kecil yang artinya besarnya debit model hampir sangat mendekati besarnya debit observasi, serta model dikategorikan sangat baik dalam melakukan simulasi debit aliran harian pada Sungai Deli. Metode skenario adalah berdasarkan analisis TBE. Hasil skenario penggunaan lahan berhasil menurunkan laju erosi DAS Deli 34,78% menjadi 267,88 ton/ha/tahun. This study aims to conduct SWAT model simulation calculation of the rate of erosion of the watershed, testing the suitability of the model in predicting erosion, land use scenarios and determine the most optimal decrease the rate of erosion. This research was conducted in the watershed Deli, North Sumatra. In this study, SWAT analysis performed with the help of Geographical Information Systems (GIS through 4 delineation process, namely, the establishment of Hydrological Response Unit (HRU, data processing and simulation, as well as the visualization process. The results show the average amount of erosion DAS Deli is 410.72 ton/ha/year. These results indicate DAS Deli included into

Komposisi dan Kelimpahan Ikan di Ekosistem Mangrove di Kedungmalang, Jepara (Fish Community Structure in Mangrove Ecosystem at Kedung Malang, Jepara Regency

Directory of Open Access Journals (Sweden)

Sri Redjeki

2014-06-01

Full Text Available Ekosistem mangrove di Kedungmalang, Kabupaten Jepara dilaporkan telah mengalami kerusakan ekologis. Kondisi ini mempengaruhi biota termasuk ikan yang hidup di kawasan tersebut. Penelitian ini dilakukan untuk mengetahui komposisi dan kelimpahan ikan di ekosistem mangrove di Desa Kedungmalang, Kecamatan Kedung, Kabupaten Jepara. Penelitian dilaksanakan bulan Mei sampai Agustus 2011. Pengambilan sampel ikan dilakukan di 3 lokasi perairan bervegetasi mangrove sejati (true mangrove Rhizophora sp. dan mangrove asosiasi (associate mangrove rumput Cyperus sp. Hasil penelitian menunjukkan terdapat 10 famili ikan, yaitu Mugilidae, Ariidae, Eleotridae, Pristigasteridae, Gobiidae, Drepanidae, Belonidae, Adrianichtyidae, Aplocheilidae, dan Haemulidae. Ikan paling banyak ditemui adalah famili Mugilidae, sedangkan ikan yang jarang ditemui adalah Famili Belonidae. Ikan Mugilidae hidup pada kisaran salinitas luas, sering masuk estuari dan sungai serta bersifat katadromous, biasanya membentuk kelompok besar di daerah dengan dasar pasir atau lumpur. Ikan famili Mugilidae yang paling banyak tertangkap adalah fase anakan dan juvenil. Jenis ikan Belanak ini merupakan ikan  yang berasosiasi dengan hutan mangrove selama periode anakan, tetapi saat dewasa cenderung menggerombol di sepanjang pantai berdekatan dengan hutan mangrove. Secara umum kelimpahan ikan pada saat surut selalu lebih tinggi dibandingkan saat pasang. Kelimpahan ikan di Rhizophora sp. lebih tinggi dibandingkan Cyperus sp. baik pada saat surut maupun pasang. Kata kunci: ekosistem mangrove, ikan, komposisi, Mugillidae Mangrove ecosystem at Kedungmalang has been reported experiencing  an ecological damage. This condition directly or indirectly affect the organisms, including fish that live around the area ecosystem. The purpose of this study was to identify and determine the abundance the fish communities in mangrove ecosystem in the Kedungmalang Village, Kedung District, Jepara Regency. The research

Heavy metals content in acid mine drainage at abandoned and active mining area

Science.gov (United States)

Hatar, Hazirah; Rahim, Sahibin Abd; Razi, Wan Mohd; Sahrani, Fathul Karim

2013-11-01

This study was conducted at former Barite Mine, Tasik Chini and former iron mine Sungai Lembing in Pahang, and also active gold mine at Lubuk Mandi, Terengganu. This study was conducted to determine heavy metals content in acid mine drainage (AMD) at the study areas. Fourteen water sampling stations within the study area were chosen for this purpose. In situ water characteristic determinations were carried out for pH, electrical conductivity (EC), redox potential (ORP) and total dissolved solid (TDS) using multi parameter YSI 556. Water samples were collected and analysed in the laboratory for sulfate, total acidity and heavy metals which follow the standard methods of APHA (1999) and HACH (2003). Heavy metals in the water samples were determined directly using Inductive Coupled Plasma Mass Spectrometry (ICP-MS). Data obtained showed a highly acidic mean of pH values with pH ranged from 2.6 ± 0.3 to 3.2 ± 0.2. Mean of electrical conductivity ranged from 0.57 ± 0.25 to 1.01 ± 0.70 mS/cm. Redox potential mean ranged from 487.40 ± 13.68 to 579.9 ± 80.46 mV. Mean of total dissolved solids (TDS) in AMD ranged from 306.50 ± 125.16 to 608.14 ± 411.64 mg/L. Mean of sulfate concentration in AMD ranged from 32.33 ± 1.41 to 207.08 ± 85.06 mg/L, whereas the mean of total acidity ranged from 69.17 ± 5.89 to 205.12 ± 170.83 mgCaCO3/L. Heavy metals content in AMD is dominated by Fe, Cu, Mn and Zn with mean concentrations range from 2.16 ± 1.61 to 36.31 ± 41.02 mg/L, 0.17 ± 0.13 to 11.06 ± 2.85 mg/L, 1.12 ± 0.65 to 7.17 ± 6.05 mg/L and 0.62 ± 0.21 to 6.56 ± 4.11 mg/L, respectively. Mean concentrations of Ni, Co, As, Cd and Pb were less than 0.21, 0.51, 0.24, 0.05 and 0.45 mg/L, respectively. Significant correlation occurred between Fe and Mn, Cu, Zn, Co and Cd. Water pH correlated negatively with all the heavy metals, whereas total acidity, sulfate, total dissolved solid, and redox potential correlated positively. The concentration of heavy metals in the AMD

PEMODELAN FAKTOR K BERBASIS RASTER SEBAGAI MASUKAN PEMODELAN EROSI DI DAS MERAWU, BANJARNEGARA, PROVINSI JAWA TENGAH (Modeling of Raster-Based of K Factor as Input for Erosion Modeling at Merawu Catchment, Banjarnegara, Central Java Province

Directory of Open Access Journals (Sweden)

Bambang Sulistyo

2015-07-01

Full Text Available ABSTRAK Penelitian ini bertujuan untuk mengkaji ketelitian absolut pemodelan faktor K berbasis raster sebagai masukan dalam pemodelan erosi Universal Soil Loss Equation (USLE di Daerah Aliran Sungai (DAS Merawu, Banjarnegara, Provinsi Jawa Tengah.Metode yang digunakan adalah dengan mengambil 30 sampel tanah secara stratified random sampling berdasarkan bentuklahan DAS Merawu. Sampel tanah tersebut kemudian dianalisis di laboratorium sehingga diperoleh tekstur, permeabilitas, bahan organik, dan struktur yang diperlukan untuk menghitung faktor K menggunakan rumus yang sudah ada. Dari 30 sampel yang diambil, 24 sampel digunakan untuk menghitung faktor K dalam pemodelan, sedangkan 6 sampel lainnya digunakan sebagai uji model. Pengeplotan nilai K pada sampel di atas peta dilakukan sesuai dengan lokasi sampel, kemudian dilakukan digitasi dan rasterisasi dan dilakukan interpolasi spasial untuk memperoleh Peta K untuk setiap piksel dengan metode Kriging. Hasil pemodelan K tersebut (Kmodel kemudian diuji pada 6 lokasi (Kaktual untuk mengetahui ketelitian pemodelan. Kmodel dikatakan teliti jika memiliki nilai ≥ 80% terhadap Kaktual.Hasil penelitian menunjukkan bahwa pemodelan faktor K berbasis raster di DAS Merawu mempunyai ketelitian melebihi nilai ambang yang ditetapkan, yaitu sebesar 89,068%, yang menunjukkan bahwa peta hasil pemodelan menggunakan analisis Kriging dapat digunakan untuk analisis lebih lanjut dalam menghitung erosi. ABSTRACT The research was aimed at knowing the absolute accuracy of modeling of raster-based K factor as input for Universal Soil Loss Equation (USLE erosion modeling at Merawu Catchment, Banjarnegara, Central Java Province. Methodology applied was by taking 30 soil samples of stratified random sampling based on landform of Merawu Catchment. Those 30 soil samples then were analised in a laboratory to get their texture, permeability, organic matter, and structure for K factor computation using the existing formula. From 30

Collective phenomena in the early stages of relativistic heavy-ion collisions

Science.gov (United States)

Ryblewski, Radoslaw

Geophysical signatures of volcano-hosted geothermal systems in Indonesia are compiled and synthesized. Parameters include electrical resistivity, seismicity, downhole logging, and pressure/temperature data; temperature and pressure states of systems are simulated through numerical models. The systems are Sungai Penuh, Hululais, Lumutbalai, Ulubelu, Kamojang, Kotamobagu, Tompaso, and Lahendong. The general resistivity structure of the systems comprises a vertical conductor under the volcano peak (70 ohm.m. The vertical conductor is the expression of either an active or inactive volcanic neck / magmatic chimney. The lateral conductor is the claycap of the geothermal system containing an argillic alteration zone that keeps the hot fluids and the heat inside the reservoir. The topography of the volcano dictates the hydrology and shapes the extent of the lateral conductor. The hydrothermal fluids themselves are kept within the intermediate resistivity region, 10--60 ohm.m for a liquid-dominated system, and up to 100 ohm.m for a vapor-dominated system, preferably with the temperature of 200--300 ° C. On the margins, the reservoir may have either sharp or diffuse contact with the background or the claycap; vapor-dominated systems have a sharp contact. A diffuse contact is usually associated with a gradational change in temperature, with temperature reversal at depth. The caprock of a geothermal system has an aseismic character possibly due to its ductile behavior from the clay and from its low permeability structure. The low permeability property impedes liquid movement and flashing that could induce seismicity. The propylitic reservoir is seismogenic due to less clay content and its high permeability that promotes liquid movement and flashing into steam which induces seismicity. Modeling studies suggest that the most favorable permeability configuration for a vapor-dominated reservoir similar to Kamojang contains a caprock with the permeability of 3 x 10 -16 m2

AKAD JUAL BELI DALAM TRADISI PASAR TERAPUNG MASYARAKAT BANJAR

Directory of Open Access Journals (Sweden)

HM Hanafiah

2015-08-01

�لإيجاب والقبول. ويمكن أن يكون عقد البيع والشراء عن طريق اللسان والفعل. أما العقد عن طريق اللسان فيقول البائع  صيغة " الإيجاب " ويكون " القبول " من المشتري. أما عن طريق " الفعل " فيكون " بالمعاطاة " أي سلّم كل من الطرفين المبيع دون أن يتلفّظ كل منهما أو واحد منها لفظ الإيجاب والقبول.   Abstrak: Tradisi jual beli masyarakat Banjar di Pasar Terapung memiliki keunikan tersendiri karena dilakukan di pasar yang terletak di tengah-tengah sungai. Dalam transaksi di Pasar Terapung tersebut, penjual dan pembeli tetap melakukan akad jual beli (ijab qabul sesuai dengan ketentuan hukum Islam, padahal sebenarnya situasi dan kondisi ketika itu tidak memungkinkan untuk transaksi jual beli biasa karena sampan yang mereka gunakan sebagai alat transportasi tersebut digoncang oleh ombak sungai. Menurut ulama syafi’iyah, “Tidak sah akad jual beli kecuali dengan shighat (ijab qabul yang diucapkan”. Sedangkan menurut Imam Malik, “Jual beli itu telah sah dan dapat dilakukan secara dipahami saja (tanpa diucapkan”. Akad jual-beli dapat dilakukan dengan metode ucapan lisan dan metode perbuatan. Metode ucapan lisan yaitu dengan adanya ucapan ijab dari penjual dan qabul dari pembeli. Sedangkan metode perbuatan (yang diistilahkan dengan al-mu'athah yaitu dengan saling menyerahkan barang yang dimaksudkan oleh masing-masing dari pelaku akad jual beli, tanpa adanya ucapan ijab atau qabul dari keduanya, atau dari salah satunya.Keywords: akad jual beli, tradisi, masyarakat Banjar, pasar terapung

Professionalism perspectives among medical students of a novel medical graduate school in Malaysia

Directory of Open Access Journals (Sweden)

Haque M

2016-07-01

Full Text Available Mainul Haque,1 Zainal Zulkifli,2 Seraj Zohurul Haque,3 Zubair M Kamal,4 Abdus Salam,5 Vidya Bhagat,2 Ahmed Ghazi Alattraqchi,2 Nor Iza A Rahman2 1Unit of Pharmacology, Faculty of Medicine and Defense Health, National Defense University of Malaysia, Kem Sungai Besi, Kuala Lumpur, Malaysia; 2Faculty of Medicine, Universiti Sultan Zainal Abidin, Jalan Sultan Mahmud, Kuala Terengganu, Terengganu, Malaysia; 3School of Medicine, University of Dundee, Ninewells Hospital & Medical School, Dundee, UK; 4Sleep Research Unit, Toronto Western Hospital, University Health Network, Toronto, ON, Canada; 5Department of Medical Education, Universiti Kebangsaan Malaysia Medical Centre, Cheras, Kuala Lumpur, Malaysia Abstract: Defining professionalism in this constantly evolving world is not easy. How do you measure degrees of benevolence and compassion? If it is so obvious to our profession, what professionalism is, then why is it so difficult to teach it to medical students and residents? Today’s definition of medical professionalism is evolving – from autonomy to accountability, from expert opinion to evidence-based medicine, and from self-interest to teamwork and shared responsibility. However, medical professionalism is defined as the basis for the trust in the patient–physician relationship, caring and compassion, insight, openness, respect for patient dignity, confidentiality, autonomy, presence, altruism, and those qualities that lead to trust-competence, integrity, honesty, morality, and ethical conduct. The purpose of this study is to explore professionalism in terms of its fundamental elements among medical students of Universiti Sultan Zainal Abidin (UniSZA. This was a cross-sectional study carried out on medical students of UniSZA. The study population included preclinical and clinical medical students of UniSZA from Year I to Year V of academic session 2014/2015. The simple random sampling technique was used to select the sample. Data were

PERKIRAAN PADAT PENEBARAN IKAN KERAPU MACAN (Epinephelus fuscoguttatus YANG OPTIMUM BERDASARKAN PADA KEBUTUHAN OKSIGEN TERLARUT

Directory of Open Access Journals (Sweden)

Arif Dwi Santoso

2016-11-01

Full Text Available Studi tentang perkiraan padat penebaran optimum pada ikan kerapu macan (Epinephelus fuscoguttatus berdasarkan pada kebutuhan oksigen terlarut telah dilakukan pada areal Teluk Hurun, Lampung pada bulan Juli 2003. Rata-rata hasil pengukuran kualitas lingkungan keramba jaring apung 13,5 m3 yang berisi ikan kerapu macan meliputi oksigen terlarut 3,68—6,76 (5,35 ± 0,25 mg/L suhu air 28,64—29,72 (29,09 ± 0,09 oC. Salinitas 32,69—33,0 (32,94 ± 0,13 psu and turbiditas 0,27—13,62 (1,15 ± 0,41 NTU. Data tambahan meliputi laju pemasukan air sungai sekitar 0,02 m3/detik dan kecepatan arus 2,3—5,1 cm/detik. Dari analisis data laju respirasi ikan kerapu macan yang diukur dengan mengunakan fish chamber menghasilkan fungsi korelasi terhadap bobot badan ikan yaitu Y= 0,0038 + 0,6108 dengan R2= 0,7437 dan fungsi padat penebaran yang optimum yaitu Y= 1505,6 X -0.632; R2= 0,7419. Dari kedua fungsi tersebut didapatkan rekomendasi penentuan padat penebaran yang optimum berdasarkan kebutuhan oksigen terlarut dengan batasan sebagai berikut: stok ikan berukuran kurang dari 50 g disarankan ditebar dengan kepadatan 175 ekor/m3, ikan ukuran 100--200 g sekitar 63 ekor/m3 dan ikan ukuran lebih dari 1.200 g sekitar 17 ekor/m3. Study on the optimum stocking rate estimation on tiger grouper (Epinephelus fuscoguttatus base on dissolved oxygen budged was held in aquaculture area Hurun Bay Lampung in July 2003. Environmental parameters of Hurun Bay estuary were monitored at the site of 13.5 m3 floating net cages for E. fuscoguttatus in July 2003. Average dissolved oxygen inside cages was 3.68—6.76 (5.35 ± 0.25 mg/L with water temperature 28.64—29.72 (29.09 ± 0.09 oC. Salinity 32.69—33.0 (32.94 ± 0.13 psu and turbidity 0.27—13.62 (1.15 ± 0.41 NTU. Inflow rate of cages was 0.02 m3/sec with current velocity 2.3—5.1 cm/s. Results showed that the functions of respiration rate for correlation between respiration of E. fucoguttatus and their weight was Y= 0

TIMBULAN SAMPAH B3 RUMAHTANGGA DAN POTENSI DAMPAK KESEHATAN LINGKUNGAN DI KABUPATEN SLEMAN, YOGYAKARTA (Generation of Household Hazardous Solid Waste and Potential Impacts on Environmental Health in Sleman Regency, Yogyakarta

Directory of Open Access Journals (Sweden)

Iswanto Iswanto

2016-07-01

Full Text Available ABSTRAK Sampah rumahtangga yang mengandung Bahan Berbahaya dan Beracun (B3 seperti baterai, lampu listrik, elektronik, kemasan pestisida, pemutih pakaian, pembersih lantai, cat, kaleng bertekanan (aerosol, sisa obat-obatan, termometer dan jarum suntik berpotensi mengancam kesehatan manusia dan lingkungan. Meskipun kuantitas sampah B3 rumahtangga (SB3-RT di Kabupaten Sleman hanya 2,44 g/orang/hari atau sekitar 0,488% dari sampah domestik, tetapi karena memiliki karakteristik mudah meledak, mudah terbakar, reaktif, beracun, infeksius dan/atau korosif maka sangat membahayakan bagi kesehatan dan lingkungan (air, tanah, udara. Sampai saat ini, SB3-RT di Kabupaten Sleman masih ditangani seperti layaknya sampah domestik, yaitu dibakar, dibuang ke sungai, ditimbun di pekarangan, dibuang ke tempat pembuangan sampah ilegal atau dibuang ke Tempat Pemrosesan Akhir (TPA Piyungan. Jenis SB3-RT yang banyak ditemukan adalah sampah elektronik (24,91%, lampu listrik bekas (18,08% dan baterai bekas (16,71%. Ketiga jenis sampah tersebut mengandung berbagai unsur logam berat seperti Cd, Pb, Hg, Cr, As, Ni, Co, Zn, Cu, Al, Mn, Li, Sb dan Fe yang umumnya bersifat toksik, karsinogenik dan akumulatif yang dapat masuk ke dalam tubuh manusia secara langsung atau melalui rantai makanan. Pemaparan bahan berbahaya beracun (B3 dapat menyebabkan kerusakan pada berbagai jaringan/organ tubuh pada masyarakat sekitar tempat pembuangan, petugas sampah, pemulung, pengepul, pemanfaat dan pelaku daur ulang SB3-RT. Oleh karena itu SB3-RT perlu dikelola sebagaimana mestinya sesuai dengan sifat dan karakteristiknya.   ABSTRACT Household solid waste containing hazardous and toxic materials such as batteries, electric light, electronics, pesticides, bleach, cleaner, paint, pressurized cans (aerosol, unused medicines, thermometers and syringes can threaten human and environment. Although the quantity of Household Hazardous Solid Waste (HHSW in Sleman Regency only 2.44 g/person/day or

ANALISIS PERUBAHAN PENGGUNAAN LAHAN DAN DAMPAKNYA TERHADAP HASIL AIR DI DAS CISADANE HULU

Directory of Open Access Journals (Sweden)

Nilda Nilda

2015-08-01

Full Text Available Air merupakan salah satu kebutuhan dasar yang sangat penting bagi manusia. Terdapat beberapa faktor utama penyebab perubahan sumber daya air, diantaranya adalah perubahan penutupandan pengelolaan lahan yang meningkatkan kekedapan lahan.Salah satu tujuan pengelolaan DAS adalah mencapai kondisi tata air optimal yang dapat dikenali dari sifat aliran sungai. Penelitian ini bertujuan untuk: (1 mengetahui distribusi perubahan penggunaan lahan yang terjadi di wilayah DAS Cisadane Hulu dari tahun 2003 sampai 2010; (2 mengetahui perubahan hasil air akibat distribusi perubahan penggunaan lahan. Daerah kajian penelitian adalah DAS Cisadane Hulu dengan luasan sekitar 22.288,01 ha. Penelitian dilakukan melalui dua tahap yaitu analisis perubahan penggnaan lahan dan prediksi aliran dengan model HEC-HMS. Dalam penelitian ini digunakan peta pengunaan lahan dari BIG (Badan Informasi Geospasial tahun 2003 dan Peta Penggunaan Lahan tahun 2010 hasil interpretasi Citra ALOS. Selanjutnya kedua peta tersebut dianalisis dengan metoda tabel silang (cross tabel untuk memperoleh data perubahan penggunaan lahan dari setiap kelas penggunaannya. Kedua data series penggunaan lahan ini digunakan sebagai input pada model prediksi debit aliran HEC-HMS. Selanjutnya dibangun juga skenario-skenario untuk melihat dampak perubahan lahan terhadap debit aliran di DAS Cisadane Hulu. Metode bilangan kurva (SCS-CN dipilih untuk menghitung besar curah hujan efektif, yaitu dari pengurangan curah hujan bruto dengan berbagai bentuk kehilangan air (loss. Transformasi dari curah hujan efektif menjadi hidrograf aliran langsung (direct runoff diperoleh dengan menggunakan metode hidrograf satuan SCS Curve Number. Selama kurun waktu 2003 – 2010 terjadi perubahan penggunaan lahan di DAS Cisadane Hulu. Luas Hutan bertambah 223,78 ha, pemukiman 214,78 ha, rumput/tanah kosong 85, 73 ha, dan gedung 12, 64 ha. Terjadi penguarangan luas semak belukar 225,64 ha, tegalan/ladang 145,92 ha, sawah irigasi 124

PEMETAAN POTENSI PENGEMBANGAN LAHAN TAMBAK GARAM DI PESISIR UTARA KABUPATEN PAMEKASAN

Directory of Open Access Journals (Sweden)

Mahfud Efendy

2014-04-01

Full Text Available Pamekasan sebagai salah satu sentra produksi garam nasional masih memungkinkan untuk meningkatkan produksi garamnya melalui program ekstensifikasi di wilayah pesisir utara. Penelitian ini bertujuan untuk memetakan potensi pengembangan lahan tambak garam baru di pesisir utara Kabupaten Pamekasan sebagai dasar program ekstensifikasitersebut. Penelitian ini memanfaatkan teknologi penginderaan jauh dan system informasi geografis dengan tahapan analisis: pemrosesan citra satelit, interpolasi peta rupa bumi Indonesia, digitasi peta tanah, interpolasi data curah hujan, dan interpretasi deskriptif. Kegiatan pemetaan ini menghasilkan informasi potensi ketersediaan lahan tambak garam baru di pesisir utara seluas 15.822,91 Ha. Potensi ketersediaan lahan baru ini secara topografi dengan klasifikasi lereng datar untuk produksi garam (0-8% tersedia seluas 10.084,55 Ha. Lahan baru ini didominasi mediteran rodik 12018 Ha dan kompleks mediteran, grumosol, regosol dan litosol 5662,4Ha. Potensi teknis lainnya yang mendukung kegiatan ekstensifikasi wilayah pesisir utara adalah curah hujan yang lebih rendah dibandingkan dengan daerah pedalaman dan daerah pesisir selatan yakni seluas 15.281,5 Ha. Dasar kesesuaian lainnya adalah jumlah sungai yang bermuara ke laut pesisir utara lebih sedikit dan lebih pendek dibandingkan dengan pesisir selatan yakni sepanjang 102,97 Km. Seperti halnya pesisir selatan, di pesisir utara juga tersedia jalur transportasi baik darat maupun laut berupa jalan kolektor sepanjang 17,6 Km yang melintasi Kecamatan Pasean dan Kecamatan Batumarmar.Kata Kunci: pemetaan, potensi pengembangan, tambak garam MAPPING THE POTENTIAL FOR LAND DEVELOPMENT IN COASTAL NORTH SALT POND PAMEKASANABSTRACTPamekasan as one of national salt producers still enables to improve its production through extension program in the north coastal area.  This study aim to mapping the potention of salt embankment development in Nort costal area of Pamekasan Regency as the

Studi Pemanfaatan Catu Daya Hibrida PLTS 3,7 kWp Dan PLN Pada Instalasi Pengolahan Air Limbah Desa Pemecutan Kaja Denpasar Bali

Directory of Open Access Journals (Sweden)

Aries Arimbawa

2016-11-01

Full Text Available Abstract—Pemecutan Kaja waste treatment plant (WTP was a community treatment plant located in one of Denpasar city ward to process sewerage produced by community members. The WTP uses radial flow anaerobic system which mainly consists of rabic pro and up flow tanks. The water produced by the WTP was released to nearby river as it already met envinronmental quality standard. The WTP was driven by an electric pump to circulate sewer material within the process flow. The pump was fed by hybrid power supply combining 3.7 kW solar PV and power from utility grid. The WTP was operated by village council of Pemecutan Kaja. The study presented here was result of firstly, evaluation on the utilization and performance of solar PV plant, and secondly, to propose managerial model that can manage the plant effectively and sustainably. The study found that daily average energy produced bythe PVplant was 23.59 kWh yielding cost of energy at IDR 7,766/kWh. Experiment to clean filters of the plant reduced daily energy consumption from 8.84 kWh to 3.05 kWh or 65%. Household that connected to the plant pay monthly subscription currently at IDR 10,000.  However, for sustainable operation of the plant, the household need to pay IDR 51,654. Keywords: Renewable Energy, Solar PV, Hybrid Power Supply, Waste Treatment, Managerial Model Abstrak—Instalasi Pengolahan Air Limbah (IPAL Desa Pemecutan Kaja adalah IPAL yang terletak di salah satu lingkungan kota Denpasar yang berfungi untuk mengolah air limbah yang dihasilkan oleh anggota masyarakat. IPAL ini meggunakan sistem radial flow anaerobic yang terdiri tangki rabic pro dan tangki up flow filter. Air hasil pengolahan limbah dapat langsung disalurkan ke sungai karena sudah memenuhi baku mutu limbah cair. IPAL ini menggunakan pompa listrik untuk mengalirkan limbah menuju tangki penyaringan. Pompa ini mengunakan catu daya hibrida PLTS 3,7 kW dan PLN. IPAL ini dikelola langsung oleh masyarakat desa Pemecutan Kaja. Hasil

Karakterisasi Kincir Air Sudu Melengkung pada Variasi Sudut Air Masuk (?1 dan Sudut Kelengkungan Sudu (?

Directory of Open Access Journals (Sweden)

Anak Agung Adhi Suryawan

2018-04-01

Full Text Available Bali memiliki banyak sumber energi aliran air  sungai atau saluran irigasi yang mempunyai debit aliran relatif kecil pada head yang rendah, dengan demikian Hydropower dapat memberikan solusi praktis terhadap masalah konservasi energi dan masalah lingkungan. Pada penelitian ini didesain model kincir sudu melengkung ke belakang (back curve vanes skala laboratorium, mengikuti kaidah-kaidah desain turbin air, dengan metode satu busur lingkaran, sehingga pengusaha bengkel nanti dapat membuat sudu kincir air dari potongan pipa besi. Data-data yang  diamati adalah : kapasitas aliran (Qa, head  (Ha, putaran kincir (n,  pada setiap variasi beban, sudut  aliran air masuk sudu,  dan sudut kelengkungan sudu dengan demikian menjadi jelas karakteristik dari kincir air. Empat sudu yang diuji memiliki sudut kelengkungan sudu (? yang berbeda yaitu 10o, 20o, 30o dan 40o, sudut air masuk (?1 yaitu 2/5 ?, 3/5 ?, 4/5 ? dan 5/5 ?. Hasil penelitian menunjukkan bahwa unjuk kerja sudu lengkung ke belakang dengan besarnya sudut aliran air masuk sudu (?1 yang sesuai/sama dengan sudut kelengkungan sudu (? akan menghasilkan unjuk kerja yang paling baik. Empat sudu yang diuji pada konstan dan variasi kapasitas maka   sudut kelengkungan sudu (? = 20o menunjukkan hasil terbaik. Semakin kecil sudut kelengkungan sudu maka unjuk kerja akan semakin baik dalam batas toleransi atas meningkatnya kerugian gesekan/hidrolis dari fluida kerja yang terjadi. Bali has many sources of river water streams or irrigation channels that have relatively small flow discharge at low head, thus Hydropower can provide practical solutions to energy conservation and environmental issues. In this research, the model is designed for the back curve vanes of laboratory scale, following the rules of water turbine design, with the method of one circular arc, so that the workshop entrepreneur can make the waterwheel from the iron pipe binder. The observed data are: flow capacity (Qa, head (Ha, rotation

Pemodelan Spasial untuk Pembuatan Peta Rawan Banjir dan Peta Tingkat Risiko Banjir Bengawan Solo di Kota Surakarta

Directory of Open Access Journals (Sweden)

Toto Cahyono

2016-09-01

Full Text Available ABSTRAK Penelitian ini bertujuan untuk melakukan pemodelan spasial untuk menyusun Peta Bahaya Banjir dan Peta Tingkat Risiko Banjir akibat luapan Bengawan Solo di Kota Surakarta. Lokasi penelitian meliputi penggal alur Bengawan Solo di wilayah Kota Surakarta. Metode penelitian yaitu dengan analisis hidrograf, pemodelan banjir, analisis potensi bahaya banjir, analisis kerentanan banjir, dan analisis tingkat risiko banjir. Analisis hidrograf dilakukan dengan menghitung debit puncak rancangan, analisis geometrik sungai, dan analisis karakteristik banjir. Pemodelan spasial banjir menggunakan perangkat lunak ArcView dengan ekstensi HEC-GeoRAS dan perangkat lunak hidrologi HEC-RAS. Analisis potensi bahaya banjir dari peta genangan hasil pemodelan spasial dengan input debit puncak rancangan banjir periode ulang 60. Analisis kerentanan dengan identifikasi elemen yang berisiko pada peta penggunaan lahan daerah bahaya. Analisis tingkat risiko dilakukan dengan cara overlay peta bahaya dan peta kerentanan banjir. Perangkat lunak ArcView 3.3 dengan ekstensi HEC-GeoRAS mampu untuk melakukan pemodelan banjir dengan tingkat validasi yang tinggi. Validasi dilakukan dengan membandingkan kedalaman maksimum hasil pemodelan dengan hasil perhitungan debit puncak rancangan. Nilai  perbedaan antara 0,68% - 4,54%. Meskipun secara kuantitatif peta model bahaya banjir rancangan sesudah pelurusan lebih luas daripada sebelum pelurusan, tetapi berdasarkan uji statistik penambahan luas tersebut tidak berbeda signifikan. Dari peta tingkat risiko banjir diketahui Kelurahan Sewu, Semanggi, Sangkrah dan Gandekan mempunyai potensi risiko banjir tertinggi di Kota Surakarta.   ABSTRACT This research is intended to perform flood modelling in Bengawan Solo River in order to develop flood hazard map, flood vulnerability map, and flood risk map as a result of overflow of such river in Surakarta City. The research area covers cut-off channel of Bengawan Solo in Surakarta City. The

KOMPOSISI IKAN HASIL TANGKAPAN JARING INSANG DI KAWASAN SUAKA PERIKANAN TELUK RASAU, SUMATERA SELATAN

Directory of Open Access Journals (Sweden)

Melfa Marini

2016-05-01

Full Text Available Teluk Rasau merupakan salah satu kawasan suaka perikanan rawa banjiran yang berfungsi untuk menjaga atau meningkatkan produksi perikanan di daerah aliran Sungai Lempuing. Sampai saat ini informasi mengenai efektivitas suaka perikanan terhadap sumber daya ikan belum banyak diketahui. Penelitian ini dilakukan dengan tujuan untuk mengetahui komposisi jenis ikan dengan menganalisis ikan hasil tangkapan jaring insang dari berbagai ukuran mata jaring di kawasan suaka perikanan Teluk Rasau. Analisis komposisi jenis ikan ini digunakan untuk menilai efektivitas suaka perikanan Teluk Rasau. Survei lapangan dilakukan sebanyak 3 kali yaitu Agustus, Oktober dan November 2009. Sampel jenis-jenis ikan didapatkan dari koleksi enumerator dan hasil tangkapan nelayan serta hasil tangkapan percobaan. Hasil penelitian menunjukkan bahwa terdapat sekitar 31 spesies ikan yang tergolong dalam 15 familia. Cyprinidae merupakan familia yang paling dominan, dengan komposisi hasil tangkapan terbesar diperoleh pada jaring insang ukuran 0,75 inci baik pada Agustus yaitu musim kemarau, maupun pada musim hujan yaitu pada Oktober-November dengan nilai komposisi hasil tangkapan sebesar 93,1%, 92,8% dan 78,3%. Komposisi hasil tangkapan terkecil pada musim kemarau (Agustus diperoleh pada alat tangkap jaring insang ukuran 2,25 inci yaitu sebesar 0,86% sedangkan pada musim hujan (Oktober-November diperoleh pada jaring insang ukuran 3 inci masing-masing sebesar 0,63% dan 2,23%. Hasil analisis jumlah jenis ikan yang tertangkap dan beberapa parameter ekologis perairan serta populasi ikan menunjukkan bahwa suaka Teluk Rasau kurang berfungsi dan kurang efektif sebagai kawasan suaka perikanan. Teluk Rasau, one of the floodplain fisheries reserves in Lempuing Rivers, has a function to increase fisheries production in that area. However, the effectiveness of this reserve to conserve and increase fish resources in that area has not been evaluated yet. Therefore, a study on

ANALISIS SPASIAL PADA KEJADIAN LUAR BIASA (KLB MALARIA DI DESA PANUSUPAN KECAMATAN REMBANG DAN DESA SIDAREJA KECAMATAN KALIGONDANG KABUPATEN PURBALINGGA

Directory of Open Access Journals (Sweden)

Widiarti Widiarti

2015-01-01

Full Text Available AbstrakMalaria seringkali muncul pada kejadian luar biasa (KLB maupun peningkatan kasus baik di Jawa maupun di luar Jawa. Dilaporkannya peningkatan kasus atau KLB malaria di Kabupaten Purbalingga menimbulkan pemikiran faktor-faktor apa yang mempengaruhi terjadinya KLB malaria. Tujuan penelitian adalah analisis spasial kasus malaria, konfirmasi vektor yang berperan dalam penularan malaria dan bioekologi nyamuk tersangka vektor. Lokasi penelitian di Desa Panusupan Kecamatan Rembang dan Desa Sidareja Kecamatan Kaligondang Kabupaten Purbalingga Jawa Tengah. Konfirmasi vektor dilakukan dengan elisa sporozoit dari semua nyamuk Anopheles sp yang diperoleh. Analisis kasus malaria digunakan metoda GIS dan dilanjutkan uji spatially weighted regression (spatial error model dengan GeoDa. Survei entomologi dilakukan sesuai standart penangkapan nyamuk oleh WHO. Hasil penelitian diperoleh informasi bahwa berdasarkan  elisa  sporozoit,  vektor  yang  berperan  di  Desa  Panusupan  Kecamatan  Rembang  adalah Anopheles maculatus hasil penangkapan hinggap pada manusia diluar rumah pada jam 18.00. Kejadian luar biasa malaria di Kabupaten Purbalingga, semula kasus import namun karena keberadaan vektor (daerah reseptif, sehingga terjadi penularan lokal. Analisis spasial kasus malaria di kedua desa mengelompok dan berdekatan dengan habitat perkembangbiakan An. maculatus yaitu ditepi aliran sungai. Mencermati vektor yang berperan di daerah KLB adalah An. maculatus dengan aktivitas sore sampai malam hari, maka perlu diinformasikan kepada masyarakat agar menjaga tidak kontak dengan nyamuk dan melindungi masyarakat dengan kelambu berinsektisida yang mempunyai daya lindung lama (LLIN sehingga dapat mengurangi terjadinya penularan.Kata Kunci : analisis spasial, KLB, Anopheles maculatus dan malariaAbstractMalaria outbreak or increase cases has came up very often inside or outside of Java Island. The increase malaria cases from Purbalingga Regency is reported

APLIKASI SIG UNTUK PEMETAAN INDEKS KEPEKAAN LINGKUNGAN: STUDI KASUS DI PESISIR CILACAP DAN SEGARA ANAKAN (GIS Application for Environmental Sensitivity Index Mapping Case Study in Cilacap Coastal Area and Segara Anakan

Directory of Open Access Journals (Sweden)

Utantyo Utantyo

2015-01-01

Full Text Available ABSTRAK Sumberdaya pesisir dapat menerima dampak dari kecelakaan tumpahan minyak. Polusi minyak dapat terjadi dalam berbagai situasi lingkungan. Dalam hal ini, inventarisasi pesisir secara detil dikombinasikan dengan indeks sensitivitas memungkinkan ketersediaan informasi pada tingkat yang lebih baik bagi perencana pengelolaan tumpahan minyak. Sistem Informasi Geografis (SIG=Geographic Information System dapat meningkatkan penggunaan data yang dibutuhkan dalam menanggapi adanya tumpahan minyak tersebut serta perencanaan darurat. Studi ini dilakukan untuk mempelajari sensitivitas lingkungan dan mengkombinasikannya untuk membentuk prototipe sistem informasi sensitivitas lingkungan. Dengan menggunakan SIG di daerah pesisir Segara Anakan dan Cilacap. Salah satu strategi yang penting di dalam perencanaan darurat adanya tumpahan minyak adalah memprioritaskan respons tumpahan. Lingkungan pesisir dapat dikuantitatifkan dengan menetapkan skema klasifikasi indeks sensitivitas lingkungan (ISE=Environmemntal Sensitivity Index: ESI. Sensitivitas lingkungan mencerminkan derajad reaksi dari wilayah pesisir untuk bertatran dan pulih ketika terjadi bencana tumpahan minyak. Metode untuk menetapkan ISE adalah dengan mengkombinasikan factor-faktor yang terkait dari suatu sensitivitas lingkungan, antara lain (a paparan terhadap energi gelombang dan pasut, (b pelerengan garis pantai, (c jenis substrata, dan (d produktivitas biologi. Studi ini menekankan kemampuan SIG untuk memvisualisasikan dan memodernkan faktor-faktor sensitivitas lingkungan secara spasial. Hasil penelitian menunjukkan bahwa aplikasi SIG untuk mengelola memanipulasi dan menayangkan data pesisir yang relevan dapat dilaksanakan dan dapat dicatat keunggulannya di dalam upaya pemetaan sensitivitas lingkungan. Dalam penelitian ini wilayah pesisir Cilacap memiliki sensitivitas medium, karena daerah tersebut dibatasi oleh garis pantai ESI 5 (dengan panjang 11,6 km, dan dengan ESI 6 Sungai Donan (12,3 km

ASPEK BIOLOGI REPRODUKSI DAN POLA PERTUMBUHAN IKAN UCENG (Nemacheilus fasciatus DALAM PEMELIHARAAN DI AKUARIUM

Directory of Open Access Journals (Sweden)

Vitas Atmadi Prakoso

2017-12-01

Full Text Available Ikan uceng (Nemacheilus fasciatus merupakan salah satu spesies ikan air tawar di Indonesia dengan nilai ekonomi cukup tinggi yang ketersediaannya masih mengandalkan penangkapan di alam, sehingga diperlukan upaya domestikasi untuk menjaga kelestariannya. Tujuan dari kegiatan ini adalah untuk mengamati biologi reproduksi dan pola pertumbuhan ikan uceng di lingkungan buatan (akuarium. Ikan uceng hasil tangkapan alam dari Sungai Progo, Temanggung, Jawa Tengah (panjang total 5,55 ± 0,53 cm; bobot 2,49 ± 0,24 g diadaptasikan selama 12 bulan di akuarium (40 cm × 30 cm × 30 cm dengan sistem air mengalir yang dilengkapi dengan aerator. Ikan uceng diberi Tubifex, hingga sampai akhirnya dapat beradaptasi dengan pakan komersial. Pakan komersial yang diberikan yaitu sebesar 3% per hari dari biomassa tubuh dengan frekuensi dua kali sehari. Data biologi reproduksi diperoleh melalui koleksi data panjang total, bobot badan, bobot gonad, fekunditas, diameter telur, dan indeks kematangan gonad. Data pola pertumbuhan diperoleh dengan koleksi data panjang, bobot, dan sintasannya. Hasil penelitian menunjukkan bahwa induk betina yang gonadnya berkembang mempunyai warna bintik hitam yang jelas, sebaliknya induk jantan warna bintik hitam memudar. Indeks kematangan gonad (IKG yang diamati pada ikan uceng setelah 12 bulan pemeliharaan yaitu berkisar antara 0,007-0,027 pada jantan dan 0,13-0,25 pada betina. Kisaran diameter telur yang diamati yaitu berkisar antara 0,61-0,68 mm, dengan fekunditas 680-4.198 butir. Sedangkan pola pertumbuhannya menunjukkan bahwa ikan uceng betina dan jantan memiliki pola pertumbuhan allometrik negatif (b= 2,739 pada betina; b= 2,895 pada jantan. Nilai faktor kondisi Fulton (K pada ikan uceng yang diamati yaitu 0,44-1,07 (rata-rata ± SD: 0,70 ± 0,11 pada betina dan 0,37-0,72 (rata-rata ± SD: 0,60 ± 0,06 pada jantan. Dari pengamatan ini ditemukan bahwa proses perkembangan kematangan gonad ikan uceng di akuarium lebih lambat dibandingkan

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.