WorldWideScience

Sample records for subtilis trpedcfba operon

  1. GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

    NARCIS (Netherlands)

    KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  2. Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

    Science.gov (United States)

    de Oliveira, Rafael R; Nicholson, Wayne L

    2016-01-01

    To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

  3. Modular Organization of the NusA- and NusG-Stimulated RNA Polymerase Pause Signal That Participates in the Bacillus subtilis trp Operon Attenuation Mechanism.

    Science.gov (United States)

    Mondal, Smarajit; Yakhnin, Alexander V; Babitzke, Paul

    2017-07-15

    The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism in which tryptophan-activated TRAP binds to the nascent transcript and blocks the formation of an antiterminator structure such that the formation of an overlapping intrinsic terminator causes termination in the 5' untranslated region (5' UTR). In the absence of bound TRAP, the antiterminator forms and transcription continues into the trp genes. RNA polymerase pauses at positions U107 and U144 in the 5' UTR. The general transcription elongation factors NusA and NusG stimulate pausing at both positions. NusG-stimulated pausing at U144 requires sequence-specific contacts with a T tract in the nontemplate DNA (ntDNA) strand within the paused transcription bubble. Pausing at U144 participates in a trpE translation repression mechanism. Since U107 just precedes the critical overlap between the antiterminator and terminator structures, pausing at this position is thought to participate in attenuation. Here we carried out in vitro pausing and termination experiments to identify components of the U107 pause signal and to determine whether pausing affects the termination efficiency in the 5' UTR. We determined that the U107 and U144 pause signals are organized in a modular fashion containing distinct RNA hairpin, U-tract, and T-tract components. NusA-stimulated pausing was affected by hairpin strength and the U-tract sequence, whereas NusG-stimulated pausing was affected by hairpin strength and the T-tract sequence. We also determined that pausing at U107 results in increased TRAP-dependent termination in the 5' UTR, implying that NusA- and NusG-stimulated pausing participates in the trp operon attenuation mechanism by providing additional time for TRAP binding. IMPORTANCE The expression of several bacterial operons is controlled by regulated termination in the 5' untranslated region (5' UTR). Transcription attenuation is defined as situations in which the binding of a regulatory

  4. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  5. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  6. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

    Science.gov (United States)

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

    2016-10-15

    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  7. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Science.gov (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  8. SOS-like induction in Bacillus subtilis: induction of the RecA protein analog and a damage-inducible operon by DNA damage in Rec+ and DNA repair-deficient strains

    International Nuclear Information System (INIS)

    Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.

    1988-01-01

    We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation

  9. Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

    Science.gov (United States)

    Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

    2015-01-01

    Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

  10. Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

    Science.gov (United States)

    Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

    2015-08-18

    Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  12. Regulation of the rhaEWRBMA Operon Involved in l-Rhamnose Catabolism through Two Transcriptional Factors, RhaR and CcpA, in Bacillus subtilis.

    Science.gov (United States)

    Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro

    2015-12-28

    The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological

  13. Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL)

    DEFF Research Database (Denmark)

    Johansen, L.E.; Nygaard, P.; Lassen, C.

    2003-01-01

    In Bacillus subtilis expression of genes or operons encoding enzymes and other proteins involved in purine synthesis is affected by purine bases and nucleosides in the growth medium. The genes belonging to the PurR regulon (purR, purA, glyA, guaC, pbuO, pbuG, and the pur, yqhZ-folD, and xpt...

  14. Production, regulation and transportation of bacillibactin in bacillus subtilis

    International Nuclear Information System (INIS)

    Raza, W.; Hussain, Q.; Shen, Q.

    2012-01-01

    Bacillus subtilis produces a catecholate type siderophore 'Bacillibactin'. This review focuses on the non-ribosomal synthesis, transport and regulation of bacillibactin. Bacillibactin biosynthetic operon contains five genes (dhbACEBF). The uptake of bacillibactin requires the FeuABC transporter, inner-membrane permease, FepDG and YusV ATPase and an esterase encoding gene, besA and while export required YmfE major facilitator super-family (MFS)-type transporter. Fur is the major iron-controlled transcriptional regulator in B. subtilis, which acts as an iron-dependent repressor of the dhb operon in vivo while an iron-independent repressor in vitro. Knowledge of the Fur regulon will be useful in interpreting other global analysis of transcriptional responses. (author)

  15. Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis

    DEFF Research Database (Denmark)

    Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin

    1996-01-01

    Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...

  16. Menaquinone and iron are essential for complex colony development in Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Gidi Pelchovich

    Full Text Available Cells of undomesticated species of Bacillus subtilis frequently form complex colonies during spreading on agar surfaces. Given that menaquinone is involved in another form of coordinated behavior, namely, sporulation, we looked for a possible role for menaquinone in complex colony development (CCD in the B. subtilis strain NCIB 3610. Here we show that inhibition of menaquinone biosynthesis in B. subtilis indeed abolished its ability to develop complex colonies. Additionally some mutations of B. subtilis which confer defective CCD could be suppressed by menaquinone derivatives. Several such mutants mapped to the dhb operon encoding the genes responsible for the biosynthesis of the iron siderophore, bacillibactin. Our results demonstrate that both menaquinone and iron are essential for CCD in B. subtilis.

  17. Deregulation of purine pathway in Bacillus subtilis and its use in riboflavin biosynthesis

    Science.gov (United States)

    2014-01-01

    Background Purine nucleotides are essential metabolites for living organisms because they are involved in many important processes, such as nucleic acid synthesis, energy supply, and biosynthesis of several amino acids and riboflavin. Owing to the pivotal roles of purines in cell physiology, the pool of intracellular purine nucleotides must be maintained under strict control, and hence the de novo purine biosynthetic pathway is tightly regulated by transcription repression and inhibition mechanism. Deregulation of purine pathway is essential for this pathway engineering in Bacillus subtilis. Results Deregulation of purine pathway was attempted to improve purine nucleotides supply, based on a riboflavin producer B. subtilis strain with modification of its rib operon. To eliminate transcription repression, the pur operon repressor PurR and the 5’-UTR of pur operon containing a guanine-sensing riboswitch were disrupted. Quantitative RT-PCR analysis revealed that the relative transcription levels of purine genes were up-regulated about 380 times. Furthermore, site-directed mutagenesis was successfully introduced into PRPP amidotransferase (encoded by purF) to remove feedback inhibition by homologous alignment and analysis. Overexpression of the novel mutant PurF (D293V, K316Q and S400W) significantly increased PRPP amidotransferase activity and triggered a strong refractory effect on purine nucleotides mediated inhibition. Intracellular metabolite target analysis indicated that the purine nucleotides supply in engineered strains was facilitated by a stepwise gene-targeted deregulation. With these genetic manipulations, we managed to enhance the metabolic flow through purine pathway and consequently increased riboflavin production 3-fold (826.52 mg/L) in the purF-VQW mutant strain. Conclusions A sequential optimization strategy was applied to deregulate the rib operon and purine pathway of B. subtilis to create genetic diversities and to improve riboflavin production

  18. Bistability and Biofilm Formation in Bacillus subtilis

    Science.gov (United States)

    Chai, Yunrong; Chu, Frances; Kolter, Roberto; Losick, Richard

    2008-01-01

    Summary Biofilms of Bacillus subtilis consist of long chains of cells that are held together in bundles by an extracellular matrix of exopolysaccharide and the protein TasA. The exopolysaccharide is produced by enzymes encoded by the epsA-O operon and the gene encoding TasA is located in the yqxM-sipW-tasA operon. Both operons are under the control of the repressor SinR. Derepression is mediated by the antirepressor SinI, which binds to SinR with a 1:1 stoichiometry. Paradoxically, in medium promoting derepression of the matrix operons, the overall concentration of SinR in the culture greatly exceeded that of SinI. We show that under biofilm-promoting conditions sinI, which is under the control of the response regulator Spo0A, was expressed only in a small subpopulation of cells, whereas sinR was expressed in almost all cells. Activation of Spo0A is known to be subject to a bistable switch, and we infer that SinI reaches levels sufficient to trigger matrix production only in the subpopulation of cells in which Spo0A is active. Additionally, evidence suggests that sinI is expressed at intermediate, but not low or high, levels of Spo0A activity, which may explain why certain nutritional conditions are more effective in promoting biofilm formation than others. PMID:18047568

  19. Whole genome assembly of a natto production strain Bacillus subtilis natto from very short read data.

    Science.gov (United States)

    Nishito, Yukari; Osana, Yasunori; Hachiya, Tsuyoshi; Popendorf, Kris; Toyoda, Atsushi; Fujiyama, Asao; Itaya, Mitsuhiro; Sakakibara, Yasubumi

    2010-04-16

    Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and functions as a starter for the production of the traditional Japanese food "natto" made from soybeans. Although re-sequencing whole genomes of several laboratory domesticated B. subtilis 168 derivatives has already been attempted using short read sequencing data, the assembly of the whole genome sequence of a closely related strain, B. subtilis natto, from very short read data is more challenging, particularly with our aim to assemble one fully connected scaffold from short reads around 35 bp in length. We applied a comparative genome assembly method, which combines de novo assembly and reference guided assembly, to one of the B. subtilis natto strains. We successfully assembled 28 scaffolds and managed to avoid substantial fragmentation. Completion of the assembly through long PCR experiments resulted in one connected scaffold for B. subtilis natto. Based on the assembled genome sequence, our orthologous gene analysis between natto BEST195 and Marburg 168 revealed that 82.4% of 4375 predicted genes in BEST195 are one-to-one orthologous to genes in 168, with two genes in-paralog, 3.2% are deleted in 168, 14.3% are inserted in BEST195, and 5.9% of genes present in 168 are deleted in BEST195. The natto genome contains the same alleles in the promoter region of degQ and the coding region of swrAA as the wild strain, RO-FF-1. These are specific for gamma-PGA production ability, which is related to natto production. Further, the B. subtilis natto strain completely lacked a polyketide synthesis operon, disrupted the plipastatin production operon, and possesses previously unidentified transposases. The determination of the whole genome sequence of Bacillus subtilis natto provided detailed analyses of a set of genes related to natto production, demonstrating the number and locations of insertion sequences that B. subtilis natto harbors but B. subtilis 168 lacks

  20. Whole genome assembly of a natto production strain Bacillus subtilis natto from very short read data

    Directory of Open Access Journals (Sweden)

    Fujiyama Asao

    2010-04-01

    Full Text Available Abstract Background Bacillus subtilis natto is closely related to the laboratory standard strain B. subtilis Marburg 168, and functions as a starter for the production of the traditional Japanese food "natto" made from soybeans. Although re-sequencing whole genomes of several laboratory domesticated B. subtilis 168 derivatives has already been attempted using short read sequencing data, the assembly of the whole genome sequence of a closely related strain, B. subtilis natto, from very short read data is more challenging, particularly with our aim to assemble one fully connected scaffold from short reads around 35 bp in length. Results We applied a comparative genome assembly method, which combines de novo assembly and reference guided assembly, to one of the B. subtilis natto strains. We successfully assembled 28 scaffolds and managed to avoid substantial fragmentation. Completion of the assembly through long PCR experiments resulted in one connected scaffold for B. subtilis natto. Based on the assembled genome sequence, our orthologous gene analysis between natto BEST195 and Marburg 168 revealed that 82.4% of 4375 predicted genes in BEST195 are one-to-one orthologous to genes in 168, with two genes in-paralog, 3.2% are deleted in 168, 14.3% are inserted in BEST195, and 5.9% of genes present in 168 are deleted in BEST195. The natto genome contains the same alleles in the promoter region of degQ and the coding region of swrAA as the wild strain, RO-FF-1. These are specific for γ-PGA production ability, which is related to natto production. Further, the B. subtilis natto strain completely lacked a polyketide synthesis operon, disrupted the plipastatin production operon, and possesses previously unidentified transposases. Conclusions The determination of the whole genome sequence of Bacillus subtilis natto provided detailed analyses of a set of genes related to natto production, demonstrating the number and locations of insertion sequences that B

  1. Bacterial competition reveals differential regulation of the pks genes by Bacillus subtilis.

    Science.gov (United States)

    Vargas-Bautista, Carol; Rahlwes, Kathryn; Straight, Paul

    2014-02-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305-310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis.

  2. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    Science.gov (United States)

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  3. High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

    Science.gov (United States)

    Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.

    2016-01-01

    Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575

  4. The Bacillus subtilis GntR family repressor YtrA responds to cell wall antibiotics.

    Science.gov (United States)

    Salzberg, Letal I; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D

    2011-10-01

    The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σ(M). Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses.

  5. Molecular characterization of an unauthorized genetically modified Bacillus subtilis production strain identified in a vitamin B2 feed additive.

    Science.gov (United States)

    Paracchini, Valentina; Petrillo, Mauro; Reiting, Ralf; Angers-Loustau, Alexandre; Wahler, Daniela; Stolz, Andrea; Schönig, Birgit; Matthies, Anastasia; Bendiek, Joachim; Meinel, Dominik M; Pecoraro, Sven; Busch, Ulrich; Patak, Alex; Kreysa, Joachim; Grohmann, Lutz

    2017-09-01

    Many food and feed additives result from fermentation of genetically modified (GM) microorganisms. For vitamin B2 (riboflavin), GM Bacillus subtilis production strains have been developed and are often used. The presence of neither the GM strain nor its recombinant DNA is allowed for fermentation products placed on the EU market as food or feed additive. A vitamin B 2 product (80% feed grade) imported from China was analysed. Viable B. subtilis cells were identified and DNAs of two bacterial isolates (LHL and LGL) were subjected to three whole genome sequencing (WGS) runs with different devices (MiSeq, 454 or HiSeq system). WGS data revealed the integration of a chloramphenicol resistance gene, the deletion of the endogenous riboflavin (rib) operon and presence of four putative plasmids harbouring rib operons. Event- and construct-specific real-time PCR methods for detection of the GM strain and its putative plasmids in food and feed products have been developed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. The Bacillus subtilis GntR Family Repressor YtrA Responds to Cell Wall Antibiotics▿§

    Science.gov (United States)

    Salzberg, Letal I.; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D.

    2011-01-01

    The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σM. Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses. PMID:21856850

  7. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  8. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Directory of Open Access Journals (Sweden)

    Løvdal Irene S

    2012-03-01

    Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

  9. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Science.gov (United States)

    2012-01-01

    Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

  10. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  11. Spermidine promotes Bacillus subtilis biofilm formation by activating expression of the matrix regulator slrR.

    Science.gov (United States)

    Hobley, Laura; Li, Bin; Wood, Jennifer L; Kim, Sok Ho; Naidoo, Jacinth; Ferreira, Ana Sofia; Khomutov, Maxim; Khomutov, Alexey; Stanley-Wall, Nicola R; Michael, Anthony J

    2017-07-21

    Ubiquitous polyamine spermidine is not required for normal planktonic growth of Bacillus subtilis but is essential for robust biofilm formation. However, the structural features of spermidine required for B. subtilis biofilm formation are unknown and so are the molecular mechanisms of spermidine-stimulated biofilm development. We report here that in a spermidine-deficient B. subtilis mutant, the structural analogue norspermidine, but not homospermidine, restored biofilm formation. Intracellular biosynthesis of another spermidine analogue, aminopropylcadaverine, from exogenously supplied homoagmatine also restored biofilm formation. The differential ability of C-methylated spermidine analogues to functionally replace spermidine in biofilm formation indicated that the aminopropyl moiety of spermidine is more sensitive to C -methylation, which it is essential for biofilm formation, but that the length and symmetry of the molecule is not critical. Transcriptomic analysis of a spermidine-depleted B. subtilis speD mutant uncovered a nitrogen-, methionine-, and S -adenosylmethionine-sufficiency response, resulting in repression of gene expression related to purine catabolism, methionine and S -adenosylmethionine biosynthesis and methionine salvage, and signs of altered membrane status. Consistent with the spermidine requirement in biofilm formation, single-cell analysis of this mutant indicated reduced expression of the operons for production of the exopolysaccharide and TasA protein biofilm matrix components and SinR antagonist slrR Deletion of sinR or ectopic expression of slrR in the spermidine-deficient Δ speD background restored biofilm formation, indicating that spermidine is required for expression of the biofilm regulator slrR Our results indicate that spermidine functions in biofilm development by activating transcription of the biofilm matrix exopolysaccharide and TasA operons through the regulator slrR . © 2017 by The American Society for Biochemistry and

  12. Engineering genome-reduced Bacillus subtilis for acetoin production from xylose.

    Science.gov (United States)

    Yan, Panpan; Wu, Yuanqing; Yang, Li; Wang, Zhiwen; Chen, Tao

    2018-02-01

    To investigate the capacity of a genome-reduced Bacillus subtilis strain as chassis cell for acetoin production from xylose. To endow the genome-reduced Bacillus subtilis strain BSK814 with the ability to utilize xylose, we inserted a native xyl operon into its genome and deleted the araR gene. The resulting strain BSK814A2 produced 2.94 g acetoin/l from 10 g xylose/l, which was 39% higher than control strain BSK19A2. The deletion of the bdhA and acoA genes further improved xylose utilization efficiency and increased acetoin production to 3.71 g/l in BSK814A4. Finally, BSK814A4 produced up to 23.3 g acetoin/l from 50 g xylose/l, with a yield of 0.46 g/g xylose. Both the titer and yield were 39% higher than those of control strain BSK19A4. As a chassis cell, genome-reduced B. subtilis showed significantly improved capacity for the production of the overflow product acetoin from xylose compared with wild-type strain.

  13. Activation of pur Gene Expression by a Homologue of the Bacillus subtilis PurR repressor:

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Martinussen, Jan

    1998-01-01

    R encoded repressor from Bacillus subtilis. The wildtype purR gene complements the purine auxotrophy of a purR::Iss1mutant, and it was shown that the purR::Iss1 mutation lowers transcription from the purine regulated L. lactis purD promoter. In a parallel study on the regulation of purC and purD expression....... We have identified a PurBox sequence overlapping the -35 region of the L. lactis purR promoter and found, by studies of a purR-lacLM fusion plasmid, that purR is autoregulated. Because of the high similarity of the PurR proteins from B. subtilis and L. lactis, we looked for PurBox sequences...... in the promoter regions of the PurR regulated genes in B. subtilis, and identified a perfectly matching PurBox in the purA promoter region, and slightly degenerate PurBox like sequences in the promoter regions for the pur operon and the purR gene....

  14. Inhibition of biofilm formation in Bacillus subtilis by new halogenated furanones.

    Science.gov (United States)

    Kayumov, Airat R; Khakimullina, Elvina N; Sharafutdinov, Irshad S; Trizna, Elena Y; Latypova, Lilia Z; Thi Lien, Hoang; Margulis, Anna B; Bogachev, Mikhail I; Kurbangalieva, Almira R

    2015-05-01

    Gram-positive bacteria can cause various infections including hospital-acquired infections. While in the biofilm, the resistance of bacteria to both antibiotics and the human immune system is increased causing difficulties in the treatment. Bacillus subtilis, a non-pathogenic Gram-positive bacterium, is widely used as a model organism for studying biofilm formation. Here we investigated the effect of novel synthesized chloro- and bromo-containing 2(5H)-furanones on biofilm formation by B. subtilis. Mucobromic acid (3,4-dibromo-5-hydroxy-2(5H)-furanone) and the two derivatives of mucochloric acid (3,4-dichloro-5-hydroxy-2(5H)-furanone)-F8 and F12-were found to inhibit the growth and to efficiently prevent biofilm formation by B. subtilis. Along with the low production of polysaccharide matrix and repression of the eps operon, strong repression of biofilm-related yqxM also occurred in the presence of furanones. Therefore, our data confirm that furanones affect significantly the regulatory pathway(s) leading to biofilm formation. We propose that the global regulator, Spo0A, is one of the potential putative cellular targets for these compounds.

  15. Genome engineering using a synthetic gene circuit in Bacillus subtilis.

    Science.gov (United States)

    Jeong, Da-Eun; Park, Seung-Hwan; Pan, Jae-Gu; Kim, Eui-Joong; Choi, Soo-Keun

    2015-03-31

    Genome engineering without leaving foreign DNA behind requires an efficient counter-selectable marker system. Here, we developed a genome engineering method in Bacillus subtilis using a synthetic gene circuit as a counter-selectable marker system. The system contained two repressible promoters (B. subtilis xylA (Pxyl) and spac (Pspac)) and two repressor genes (lacI and xylR). Pxyl-lacI was integrated into the B. subtilis genome with a target gene containing a desired mutation. The xylR and Pspac-chloramphenicol resistant genes (cat) were located on a helper plasmid. In the presence of xylose, repression of XylR by xylose induced LacI expression, the LacIs repressed the Pspac promoter and the cells become chloramphenicol sensitive. Thus, to survive in the presence of chloramphenicol, the cell must delete Pxyl-lacI by recombination between the wild-type and mutated target genes. The recombination leads to mutation of the target gene. The remaining helper plasmid was removed easily under the chloramphenicol absent condition. In this study, we showed base insertion, deletion and point mutation of the B. subtilis genome without leaving any foreign DNA behind. Additionally, we successfully deleted a 2-kb gene (amyE) and a 38-kb operon (ppsABCDE). This method will be useful to construct designer Bacillus strains for various industrial applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Role of Ribonucleotide Reductase in Bacillus subtilis Stress-Associated Mutagenesis.

    Science.gov (United States)

    Castro-Cerritos, Karla Viridiana; Yasbin, Ronald E; Robleto, Eduardo A; Pedraza-Reyes, Mario

    2017-02-15

    The Gram-positive microorganism Bacillus subtilis relies on a single class Ib ribonucleotide reductase (RNR) to generate 2'-deoxyribonucleotides (dNDPs) for DNA replication and repair. In this work, we investigated the influence of RNR levels on B. subtilis stationary-phase-associated mutagenesis (SPM). Since RNR is essential in this bacterium, we engineered a conditional mutant of strain B. subtilis YB955 (hisC952 metB5 leu427) in which expression of the nrdEF operon was modulated by isopropyl-β-d-thiogalactopyranoside (IPTG). Moreover, genetic inactivation of ytcG, predicted to encode a repressor (NrdR) of nrdEF in this strain, dramatically increased the expression levels of a transcriptional nrdE-lacZ fusion. The frequencies of mutations conferring amino acid prototrophy in three genes were measured in cultures under conditions that repressed or induced RNR-encoding genes. The results revealed that RNR was necessary for SPM and overexpression of nrdEF promoted growth-dependent mutagenesis and SPM. We also found that nrdEF expression was induced by H 2 O 2 and such induction was dependent on the master regulator PerR. These observations strongly suggest that the metabolic conditions operating in starved B. subtilis cells increase the levels of RNR, which have a direct impact on SPM. Results presented in this study support the concept that the adverse metabolic conditions prevailing in nutritionally stressed bacteria activate an oxidative stress response that disturbs ribonucleotide reductase (RNR) levels. Such an alteration of RNR levels promotes mutagenic events that allow Bacillus subtilis to escape from growth-limited conditions. Copyright © 2017 American Society for Microbiology.

  17. Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant.

    Science.gov (United States)

    Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M

    2017-06-01

    Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  18. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  19. Extra-chromosomal DNA maintenance in Bacillus subtilis, dependence on flagellation factor FliF and moonlighting mediator EdmS.

    Science.gov (United States)

    Hakumai, Yuichi; Shimomoto, Kouko; Ashiuchi, Makoto

    2015-05-15

    Extra-chromosomal DNA maintenance (EDM) as an important process in the propagation and genetic engineering of microbes. Bacillus subtilis EdmS (formerly PgsE), a protein comprising 55 amino acids, is a mediator of the EDM process. In this study, the effect of mutation of global regulators on B. subtilis EDM was examined. Mutation of the swrA gene abolished EdmS-mediated EDM. It is known that swrA predominantly regulates expression of the fla/che operon in B. subtilis. We therefore performed EDM analysis using fla/che-deletion mutants and identified an EDM-mediated EDM cooperator in the flgB-fliL region. Further genetic investigation identified the flagellation factor FliF is a crucial EDM cooperator. To our knowledge, this is the first observation of the moonlighting function of FliF in DNA maintenance. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. ThrR, a DNA-binding transcription factor involved in controlling threonine biosynthesis in Bacillus subtilis.

    Science.gov (United States)

    Rosenberg, Jonathan; Müller, Peter; Lentes, Sabine; Thiele, Martin J; Zeigler, Daniel R; Tödter, Dominik; Paulus, Henry; Brantl, Sabine; Stülke, Jörg; Commichau, Fabian M

    2016-09-01

    The threonine dehydratase IlvA is part of the isoleucine biosynthesis pathway in the Gram-positive model bacterium Bacillus subtilis. Consequently, deletion of ilvA causes isoleucine auxotrophy. It has been reported that ilvA pseudo-revertants having a derepressed hom-thrCB operon appear in the presence of threonine. Here we have characterized two classes of ilvA pseudo-revertants. In the first class the hom-thrCB operon was derepressed unmasking the threonine dehydratase activity of the threonine synthase ThrC. In the second class of mutants, threonine biosynthesis was more broadly affected. The first class of ilvA pseudo-revertants had a mutation in the Phom promoter (P*hom ), resulting in constitutive expression of the hom-thrCB operon. In the second class of ilvA pseudo-revertants, the thrR gene encoding a putative DNA-binding protein was inactivated, also resulting in constitutive expression of the hom-thrCB operon. Here we demonstrate that ThrR is indeed a DNA-binding transcription factor that regulates the hom-thrCB operon and the thrD aspartokinase gene. DNA binding assays uncovered the DNA-binding site of ThrR and revealed that the repressor competes with the RNA polymerase for DNA binding. This study also revealed that ThrR orthologs are ubiquitous in genomes from the Gram-positive phylum Firmicutes and in some Gram-negative bacteria. © 2016 John Wiley & Sons Ltd.

  1. Subtilomycin: A New Lantibiotic from Bacillus subtilis Strain MMA7 Isolated from the Marine Sponge Haliclona simulans

    Directory of Open Access Journals (Sweden)

    Teresa M. Barbosa

    2013-06-01

    Full Text Available Bacteriocins are attracting increased attention as an alternative to classic antibiotics in the fight against infectious disease and multidrug resistant pathogens. Bacillus subtilis strain MMA7 isolated from the marine sponge Haliclona simulans displays a broad spectrum antimicrobial activity, which includes Gram-positive and Gram-negative pathogens, as well as several pathogenic Candida species. This activity is in part associated with a newly identified lantibiotic, herein named as subtilomycin. The proposed biosynthetic cluster is composed of six genes, including protein-coding genes for LanB-like dehydratase and LanC-like cyclase modification enzymes, characteristic of the class I lantibiotics. The subtilomycin biosynthetic cluster in B. subtilis strain MMA7 is found in place of the sporulation killing factor (skf operon, reported in many B. subtilis isolates and involved in a bacterial cannibalistic behaviour intended to delay sporulation. The presence of the subtilomycin biosynthetic cluster appears to be widespread amongst B. subtilis strains isolated from different shallow and deep water marine sponges. Subtilomycin possesses several desirable industrial and pharmaceutical physicochemical properties, including activity over a wide pH range, thermal resistance and water solubility. Additionally, the production of the lantibiotic subtilomycin could be a desirable property should B. subtilis strain MMA7 be employed as a probiotic in aquaculture applications.

  2. Subtilomycin: A New Lantibiotic from Bacillus subtilis Strain MMA7 Isolated from the Marine Sponge Haliclona simulans

    Science.gov (United States)

    Phelan, Robert W.; Barret, Matthieu; Cotter, Paul D.; O’Connor, Paula M.; Chen, Rui; Morrissey, John P.; Dobson, Alan D. W.; O’Gara, Fergal; Barbosa, Teresa M.

    2013-01-01

    Bacteriocins are attracting increased attention as an alternative to classic antibiotics in the fight against infectious disease and multidrug resistant pathogens. Bacillus subtilis strain MMA7 isolated from the marine sponge Haliclona simulans displays a broad spectrum antimicrobial activity, which includes Gram-positive and Gram-negative pathogens, as well as several pathogenic Candida species. This activity is in part associated with a newly identified lantibiotic, herein named as subtilomycin. The proposed biosynthetic cluster is composed of six genes, including protein-coding genes for LanB-like dehydratase and LanC-like cyclase modification enzymes, characteristic of the class I lantibiotics. The subtilomycin biosynthetic cluster in B. subtilis strain MMA7 is found in place of the sporulation killing factor (skf) operon, reported in many B. subtilis isolates and involved in a bacterial cannibalistic behaviour intended to delay sporulation. The presence of the subtilomycin biosynthetic cluster appears to be widespread amongst B. subtilis strains isolated from different shallow and deep water marine sponges. Subtilomycin possesses several desirable industrial and pharmaceutical physicochemical properties, including activity over a wide pH range, thermal resistance and water solubility. Additionally, the production of the lantibiotic subtilomycin could be a desirable property should B. subtilis strain MMA7 be employed as a probiotic in aquaculture applications. PMID:23736764

  3. PamR, a new MarR-like regulator affecting prophages and metabolic genes expression in Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Alba De San Eustaquio-Campillo

    Full Text Available B. subtilis adapts to changing environments by reprogramming its genetic expression through a variety of transcriptional regulators from the global transition state regulators that allow a complete resetting of the cell genetic expression, to stress specific regulators controlling only a limited number of key genes required for optimal adaptation. Among them, MarR-type transcriptional regulators are known to respond to a variety of stresses including antibiotics or oxidative stress, and to control catabolic or virulence gene expression. Here we report the characterization of the ydcFGH operon of B. subtilis, containing a putative MarR-type transcriptional regulator. Using a combination of molecular genetics and high-throughput approaches, we show that this regulator, renamed PamR, controls directly its own expression and influence the expression of large sets of prophage-related and metabolic genes. The extent of the regulon impacted by PamR suggests that this regulator reprograms the metabolic landscape of B. subtilis in response to a yet unknown signal.

  4. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  5. Whole-Genome Sequencing and Comparative Genome Analysis of Bacillus subtilis Strains Isolated from Non-Salted Fermented Soybean Foods.

    Directory of Open Access Journals (Sweden)

    Mayumi Kamada

    Full Text Available Bacillus subtilis is the main component in the fermentation of soybeans. To investigate the genetics of the soybean-fermenting B. subtilis strains and its relationship with the productivity of extracellular poly-γ-glutamic acid (γPGA, we sequenced the whole genome of eight B. subtilis stains isolated from non-salted fermented soybean foods in Southeast Asia. Assembled nucleotide sequences were compared with those of a natto (fermented soybean food starter strain B. subtilis BEST195 and the laboratory standard strain B. subtilis 168 that is incapable of γPGA production. Detected variants were investigated in terms of insertion sequences, biotin synthesis, production of subtilisin NAT, and regulatory genes for γPGA synthesis, which were related to fermentation process. Comparing genome sequences, we found that the strains that produce γPGA have a deletion in a protein that constitutes the flagellar basal body, and this deletion was not found in the non-producing strains. We further identified diversity in variants of the bio operon, which is responsible for the biotin auxotrophism of the natto starter strains. Phylogenetic analysis using multilocus sequencing typing revealed that the B. subtilis strains isolated from the non-salted fermented soybeans were not clustered together, while the natto-fermenting strains were tightly clustered; this analysis also suggested that the strain isolated from "Tua Nao" of Thailand traces a different evolutionary process from other strains.

  6. Evidence against the selfish operon theory.

    Science.gov (United States)

    Pál, Csaba; Hurst, Laurence D

    2004-06-01

    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  7. DNA-damage-inducible (din) loci are transcriptionally activated in competent Bacillus subtilis

    International Nuclear Information System (INIS)

    Love, P.E.; Lyle, M.J.; Yasbin, R.E.

    1985-01-01

    DNA damage-inducible (din) operon fusions were generated in Bacillus subtilis by transpositional mutagenesis. These YB886(din::Tn917-lacZ) fusion isolates produced increased β-galactosidase when exposed to mitomycin C, UV radiation, or ethyl methanesulfonate, indicating that the lacZ structural gene had inserted into host transcriptional units that are induced by a variety of DNA-damaging agents. One of the fusion strains was DNA-repair deficient and phenotypically resembled a UV-sensitive mutant of B. subtilis. Induction of β-galactosidase also occurred in the competent subpopulation of each of the din fusion strains, independent of exposure to DNA-damaging agents. Both the DNA-damage-inducible and competence-inducible components of β-galactosidase expression were abolished by the recE4 mutation, which inhibits SOS-like (SOB) induction but does not interfere with the development of the component state. The results indicate that gene expression is stimulated at specific loci within the B. subtilis chromosome both by DNA-damaging agents and by the development of competence and that this response is under the control of the SOB regulatory system. Furthermore, they demonstrate that at the molecular level SOB induction and the development of competence are interrelated cellular events

  8. REMap: Operon Map of M. tuberculosis

    Science.gov (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  9. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  10. Spore Heat Activation Requirements and Germination Responses Correlate with Sequences of Germinant Receptors and with the Presence of a Specific spoVA2mob Operon in Foodborne Strains of Bacillus subtilis.

    Science.gov (United States)

    Krawczyk, Antonina O; de Jong, Anne; Omony, Jimmy; Holsappel, Siger; Wells-Bennik, Marjon H J; Kuipers, Oscar P; Eijlander, Robyn T

    2017-04-01

    Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA 2mob operon carried on the Tn 1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA 2mob required higher HA temperatures for efficient germination than spores lacking spoVA 2mob The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K + (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers. IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that increases

  11. The relative value of operon predictions

    NARCIS (Netherlands)

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  12. Comparative transcriptional analysis of Bacillus subtilis cells overproducing either secreted proteins, lipoproteins or membrane proteins

    Directory of Open Access Journals (Sweden)

    Marciniak Bogumiła C

    2012-05-01

    Full Text Available Abstract Background Bacillus subtilis is a favorable host for the production of industrially relevant proteins because of its capacity of secreting proteins into the medium to high levels, its GRAS (Generally Recognized As Safe status, its genetic accessibility and its capacity to grow in large fermentations. However, production of heterologous proteins still faces limitations. Results This study aimed at the identification of bottlenecks in secretory protein production by analyzing the response of B. subtilis at the transcriptome level to overproduction of eight secretory proteins of endogenous and heterologous origin and with different subcellular or extracellular destination: secreted proteins (NprE and XynA of B. subtilis, Usp45 of Lactococcus lactis, TEM-1 β-lactamase of Escherichia coli, membrane proteins (LmrA of L. lactis and XylP of Lactobacillus pentosus and lipoproteins (MntA and YcdH of B. subtilis. Responses specific for proteins with a common localization as well as more general stress responses were observed. The latter include upregulation of genes encoding intracellular stress proteins (groES/EL, CtsR regulated genes. Specific responses include upregulation of the liaIHGFSR operon under Usp45 and TEM-1 β-lactamase overproduction; cssRS, htrA and htrB under all secreted proteins overproduction; sigW and SigW-regulated genes mainly under membrane proteins overproduction; and ykrL (encoding an HtpX homologue specifically under membrane proteins overproduction. Conclusions The results give better insights into B. subtilis responses to protein overproduction stress and provide potential targets for genetic engineering in order to further improve B. subtilis as a protein production host.

  13. Engineering of a Bacillus subtilis strain with adjustable levels of intracellular biotin for secretory production of functional streptavidin.

    Science.gov (United States)

    Wu, Sau-Ching; Wong, Sui-Lam

    2002-03-01

    Streptavidin is a biotin-binding protein which has been widely used in many in vitro and in vivo applications. Because of the ease of protein recovery and availability of protease-deficient strains, the Bacillus subtilis expression-secretion system is an attractive system for streptavidin production. However, attempts to produce streptavidin using B. subtilis face the problem that cells overproducing large amounts of streptavidin suffer poor growth, presumably because of biotin deficiency. This problem cannot be solved by supplementing biotin to the culture medium, as this will saturate the biotin binding sites in streptavidin. We addressed this dilemma by engineering a B. subtilis strain (WB800BIO) which overproduces intracellular biotin. The strategy involves replacing the natural regulatory region of the B. subtilis chromosomal biotin biosynthetic operon (bioWAFDBIorf2) with an engineered one consisting of the B. subtilis groE promoter and gluconate operator. Biotin production in WB800BIO is induced by gluconate, and the level of biotin produced can be adjusted by varying the gluconate dosage. A level of gluconate was selected to allow enhanced intracellular production of biotin without getting it released into the culture medium. WB800BIO, when used as a host for streptavidin production, grows healthily in a biotin-limited medium and produces large amounts (35 to 50 mg/liter) of streptavidin, with over 80% of its biotin binding sites available for future applications.

  14. Transcriptome dynamics-based operon prediction in prokaryotes.

    Science.gov (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  15. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    International Nuclear Information System (INIS)

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

    1993-01-01

    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  16. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  17. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Science.gov (United States)

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  18. Role of the Fur regulon in iron transport in Bacillus subtilis.

    Science.gov (United States)

    Ollinger, Juliane; Song, Kyung-Bok; Antelmann, Haike; Hecker, Michael; Helmann, John D

    2006-05-01

    The Bacillus subtilis ferric uptake regulator (Fur) protein mediates the iron-dependent repression of at least 20 operons encoding approximately 40 genes. We investigated the physiological roles of Fur-regulated genes by the construction of null mutations in 14 transcription units known or predicted to function in siderophore biosynthesis or iron uptake. We demonstrate that ywbLMN, encoding an elemental iron uptake system orthologous to the copper oxidase-dependent Fe(III) uptake system of Saccharomyces cerevisiae, is essential for growth in low iron minimal medium lacking citric acid. 2,3-Dihydroxybenzoyl-glycine (Itoic acid), the siderophore precursor produced by laboratory strains of B. subtilis, is of secondary importance. In the presence of citrate, the YfmCDEF ABC transporter is required for optimal growth. B. subtilis is unable to grow in minimal medium containing the iron chelator EDDHA unless the ability to synthesize the intact bacillibactin siderophore is restored (by the introduction of a functional sfp gene) or exogenous siderophores are provided. Utilization of the catecholate siderophores bacillibactin and enterobactin requires the FeuABC importer and the YusV ATPase. Utilization of hydroxamate siderophores requires the FhuBGC ABC transporter together with the FhuD (ferrichrome) or YxeB (ferrioxamine) substrate-binding proteins. Growth with schizokinen or arthrobactin is at least partially dependent on the YfhA YfiYZ importer and the YusV ATPase. We have also investigated the effects of a fur mutation on the proteome and documented the derepression of 11 Fur-regulated proteins, including a newly identified thioredoxin reductase homolog, YcgT.

  19. Stochastic simulations of the tetracycline operon

    Science.gov (United States)

    2011-01-01

    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  20. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  1. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  2. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  3. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

    Science.gov (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

    2015-05-25

    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  4. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  5. Bacillus subtilis NhaC, an Na+/H+ antiporter, influences expression of the phoPR operon and production of alkaline phosphatases

    NARCIS (Netherlands)

    Pragai, Z; Eschevins, C; Bron, S; Harwood, CR

    When Bacillus subtilis is subjected to phosphate starvation, genes of the Pho regulon are either induced or repressed. Among those induced are genes encoding alkaline phosphatases (APases). A set of isogenic mutants, with a beta -galactosidase gene transcriptionally fused to the inactivated target

  6. Molecular and Physiological Logics of the Pyruvate-Induced Response of a Novel Transporter in Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Teddy Charbonnier

    2017-10-01

    Full Text Available At the heart of central carbon metabolism, pyruvate is a pivotal metabolite in all living cells. Bacillus subtilis is able to excrete pyruvate as well as to use it as the sole carbon source. We herein reveal that ysbAB (renamed pftAB, the only operon specifically induced in pyruvate-grown B. subtilis cells, encodes a hetero-oligomeric membrane complex which operates as a facilitated transport system specific for pyruvate, thereby defining a novel class of transporter. We demonstrate that the LytST two-component system is responsible for the induction of pftAB in the presence of pyruvate by binding of the LytT response regulator to a palindromic region upstream of pftAB. We show that both glucose and malate, the preferred carbon sources for B. subtilis, trigger the binding of CcpA upstream of pftAB, which results in its catabolite repression. However, an additional CcpA-independent mechanism represses pftAB in the presence of malate. Screening a genome-wide transposon mutant library, we find that an active malic enzyme replenishing the pyruvate pool is required for this repression. We next reveal that the higher the influx of pyruvate, the stronger the CcpA-independent repression of pftAB, which suggests that intracellular pyruvate retroinhibits pftAB induction via LytST. Such a retroinhibition challenges the rational design of novel nature-inspired sensors and synthetic switches but undoubtedly offers new possibilities for the development of integrated sensor/controller circuitry. Overall, we provide evidence for a complete system of sensors, feed-forward and feedback controllers that play a major role in environmental growth of B. subtilis.

  7. Teaching the Big Ideas of Biology with Operon Models

    Science.gov (United States)

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  8. Definition of the Bacillus subtilis PurR operator using genetic and bioinformatic tools and expansion of the PurR regulon with glyA, guaC, pbuG, xpt-pbuX, yqhZ-folD, and pbuO

    DEFF Research Database (Denmark)

    Saxild, Hans Henrik; Brunstedt, K.; Nielsen, K.I.

    2001-01-01

    The expression of the pur operon, which encodes enzymes of the purine biosynthetic pathway in Bacillus subtilis, is subject to control by the purR gene product (PurR) and phosphoribosylpyrophosphate. This control is also exerted on the purA and purR genes. A consensus sequence for the binding...... of PurR, named the PurBox, has been suggested (M. Kilstrup, S.G. Jessing, S.B. Wichmand-Jorgensen, M. Madsen, and D. Nilsson, J. Bacteriol. 180:3900-3906, 1998). To determine whether the expression of other genes might be regulated by PurR, we performed a search for PurBox sequences in the B. subtilis...

  9. Phosphorylated DegU Manipulates Cell Fate Differentiation in the Bacillus subtilis Biofilm

    Science.gov (United States)

    Marlow, Victoria L.; Porter, Michael; Hobley, Laura; Kiley, Taryn B.; Swedlow, Jason R.; Davidson, Fordyce A.

    2014-01-01

    Cell differentiation is ubiquitous and facilitates division of labor and development. Bacteria are capable of multicellular behaviors that benefit the bacterial community as a whole. A striking example of bacterial differentiation occurs throughout the formation of a biofilm. During Bacillus subtilis biofilm formation, a subpopulation of cells differentiates into a specialized population that synthesizes the exopolysaccharide and the TasA amyloid components of the extracellular matrix. The differentiation process is indirectly controlled by the transcription factor Spo0A that facilitates transcription of the eps and tapA (tasA) operons. DegU is a transcription factor involved in regulating biofilm formation. Here, using a combination of genetics and live single-cell cytological techniques, we define the mechanism of biofilm inhibition at high levels of phosphorylated DegU (DegU∼P) by showing that transcription from the eps and tapA promoter regions is inhibited. Data demonstrating that this is not a direct regulatory event are presented. We demonstrate that DegU∼P controls the frequency with which cells activate transcription from the operons needed for matrix biosynthesis in favor of an off state. Subsequent experimental analysis led us to conclude that DegU∼P functions to increase the level of Spo0A∼P, driving cell fate differentiation toward the terminal developmental process of sporulation. PMID:24123822

  10. Characterization of Bacillus subtilis YfkE (ChaA): a calcium-specific Ca2+/H+ antiporter of the CaCA family.

    Science.gov (United States)

    Fujisawa, Makoto; Wada, Yuko; Tsuchiya, Takahiro; Ito, Masahiro

    2009-08-01

    YfkE, a protein from Bacillus subtilis, exhibits homology to the Ca(2+):Cation Antiporter (CaCA) Family. In a fluorescence-based assay of everted membrane vesicles prepared from Na(+)(Ca(2+))/H(+) antiporter-defective mutant Escherichia coli KNabc, YfkE exhibited robust Ca(2+)/H(+) antiport activity, with a K (m) for Ca(2+) estimated at 12.5 muM at pH 8.5 and 113 muM at pH 7.5. Neither Na(+) nor K(+) served as a substrate. Mg(2+) also did not serve as a substrate, but inhibited the Ca(2+)/H(+) antiporter activity. The Ca(2+) transport capability of YfkE was also observed directly by transport assays in everted membrane vesicles using radiolabeled (45)Ca(2+). Transcriptional analysis from the putative yfkED operon using beta-garactosidase activity as a reporter revealed that both of the yfkE and yfkD genes are regulated by forespore-specific sigma factor, SigG, and the general stress response regulator, SigB. These results suggest that YfkE may be needed for Ca(2+) signaling in the sporulation or germination process in B. subtilis. ChaA is proposed as the designation for YfkE of B. subtilis.

  11. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  12. Critical Minireview: The Fate of tRNACys during Oxidative Stress in Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Juan Campos Guillen

    2017-01-01

    Full Text Available Oxidative stress occurs when cells are exposed to elevated levels of reactive oxygen species that can damage biological molecules. One bacterial response to oxidative stress involves disulfide bond formation either between protein thiols or between protein thiols and low-molecular-weight (LMW thiols. Bacillithiol was recently identified as a major low-molecular-weight thiol in Bacillus subtilis and related Firmicutes. Four genes (bshA, bshB1, bshB2, and bshC are involved in bacillithiol biosynthesis. The bshA and bshB1 genes are part of a seven-gene operon (ypjD, which includes the essential gene cca, encoding CCA-tRNA nucleotidyltransferase. The inclusion of cca in the operon containing bacillithiol biosynthetic genes suggests that the integrity of the 3′ terminus of tRNAs may also be important in oxidative stress. The addition of the 3′ terminal CCA sequence by CCA-tRNA nucleotidyltransferase to give rise to a mature tRNA and functional molecules ready for aminoacylation plays an essential role during translation and expression of the genetic code. Any defects in these processes, such as the accumulation of shorter and defective tRNAs under oxidative stress, might exert a deleterious effect on cells. This review summarizes the physiological link between tRNACys regulation and oxidative stress in Bacillus.

  13. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

    Science.gov (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  14. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

    Science.gov (United States)

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

    2011-11-01

    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  15. Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

    Science.gov (United States)

    Crawford, I P; Han, C Y; Silverman, M

    1991-01-01

    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  16. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    Science.gov (United States)

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  17. Evolution and Biophysics of the Escherichia coli lac Operon

    Science.gov (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  18. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    NARCIS (Netherlands)

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

    2013-01-01

    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  19. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  20. Lysinibacillus fusiformis M5 Induces Increased Complexity in Bacillus subtilis 168 Colony Biofilms via Hypoxanthine.

    Science.gov (United States)

    Gallegos-Monterrosa, Ramses; Kankel, Stefanie; Götze, Sebastian; Barnett, Robert; Stallforth, Pierre; Kovács, Ákos T

    2017-11-15

    In recent years, biofilms have become a central subject of research in the fields of microbiology, medicine, agriculture, and systems biology, among others. The sociomicrobiology of multispecies biofilms, however, is still poorly understood. Here, we report a screening system that allowed us to identify soil bacteria which induce architectural changes in biofilm colonies when cocultured with Bacillus subtilis We identified the soil bacterium Lysinibacillus fusiformis M5 as an inducer of wrinkle formation in B. subtilis colonies mediated by a diffusible signaling molecule. This compound was isolated by bioassay-guided chromatographic fractionation. The elicitor was identified to be the purine hypoxanthine using mass spectrometry and nuclear magnetic resonance (NMR) spectroscopy. We show that the induction of wrinkle formation by hypoxanthine is not dependent on signal recognition by the histidine kinases KinA, KinB, KinC, and KinD, which are generally involved in phosphorylation of the master regulator Spo0A. Likewise, we show that hypoxanthine signaling does not induce the expression of biofilm matrix-related operons epsABCDEFGHIJKLMNO and tasA-sipW-tapA Finally, we demonstrate that the purine permease PbuO, but not PbuG, is necessary for hypoxanthine to induce an increase in wrinkle formation of B. subtilis biofilm colonies. Our results suggest that hypoxanthine-stimulated wrinkle development is not due to a direct induction of biofilm-related gene expression but rather is caused by the excess of hypoxanthine within B. subtilis cells, which may lead to cell stress and death. IMPORTANCE Biofilms are a bacterial lifestyle with high relevance regarding diverse human activities. Biofilms can be beneficial, for instance, in crop protection. In nature, biofilms are commonly found as multispecies communities displaying complex social behaviors and characteristics. The study of interspecies interactions will thus lead to a better understanding and use of biofilms as they

  1. Construction and development of an auto-regulatory gene expression system in Bacillus subtilis.

    Science.gov (United States)

    Guan, Chengran; Cui, Wenjing; Cheng, Jintao; Zhou, Li; Guo, Junling; Hu, Xu; Xiao, Guoping; Zhou, Zhemin

    2015-09-21

    Bacillus subtilis is an all-important Gram-positive bacterium of valuable biotechnological utility that has been widely used to over-produce industrially and pharmaceutically relevant proteins. There are a variety of expression systems in terms of types of transcriptional patterns, among which the auto-inducible and growth-phase-dependent promoters are gaining increasing favor due to their inducer-independent feature, allowing for the potential to industrially scale-up. To expand the applicability of the auto-inducible expression system, a novel auto-regulatory expression system coupled with cell density was constructed and developed in B. subtilis using the quorum-sensing related promoter srfA (PsrfA). The promoter of the srf operon was used to construct an expression plasmid with the green fluorescent protein (GFP) downstream of PsrfA. The expression displayed a cell-density-dependent pattern in that GFP had a fairly low expression level at the early exponential stage and was highly expressed at the late exponential as well as the stationary stages. Moreover, the recombinant system had a similar expression pattern in wild-type B. subtilis 168, WB600, and WB800, as well as in B. subtilis 168 derivative strain 1681, with the complete deletion of PsrfA, indicating the excellent compatibility of this system. Noticeably, the expression strength of PsrfA was enhanced by optimizing the -10 and -35 core sequence by substituting both sequences with consensus sequences. Importantly, the expression pattern was successfully developed in an auto-regulatory cell-density coupling system by the simple addition of glucose in which GFP could not be strongly expressed until glucose was depleted, resulting in a greater amount of the GFP product and increased cell density. The expression system was eventually tested by the successful over-production of aminopeptidase to a desired level. The auto-regulatory cell density coupling system that is mediated by PsrfA is a novel expression

  2. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  3. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Science.gov (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  4. Dynamic expression of the translational machinery during Bacillus subtilis life cycle at a single cell level.

    Directory of Open Access Journals (Sweden)

    Alex Rosenberg

    Full Text Available The ability of bacteria to responsively regulate the expression of translation components is crucial for rapid adaptation to fluctuating environments. Utilizing Bacillus subtilis (B. subtilis as a model organism, we followed the dynamics of the translational machinery at a single cell resolution during growth and differentiation. By comprehensive monitoring the activity of the major rrn promoters and ribosomal protein production, we revealed diverse dynamics between cells grown in rich and poor medium, with the most prominent dissimilarities exhibited during deep stationary phase. Further, the variability pattern of translational activity varied among the cells, being affected by nutrient availability. We have monitored for the first time translational dynamics during the developmental process of sporulation within the two distinct cellular compartments of forespore and mother-cell. Our study uncovers a transient forespore specific increase in expression of translational components. Finally, the contribution of each rrn promoter throughout the bacterium life cycle was found to be relatively constant, implying that differential expression is not the main purpose for the existence of multiple rrn genes. Instead, we propose that coordination of the rrn operons serves as a strategy to rapidly fine tune translational activities in a synchronized fashion to achieve an optimal translation level for a given condition.

  5. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Science.gov (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Science.gov (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  7. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

    Science.gov (United States)

    Ray, J. Christian J; Igoshin, Oleg A.

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  8. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  9. Solving a discrete model of the lac operon using Z3

    Science.gov (United States)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  10. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

    2003-01-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  11. Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

    2003-09-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  12. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

    Science.gov (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

    2017-09-01

    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Science.gov (United States)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  14. Rapid customised operon assembly by yeast recombinational cloning.

    Science.gov (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  15. Subcellular localization, interactions and dynamics of the phage-shock protein-like Lia response in Bacillus subtilis.

    Science.gov (United States)

    Domínguez-Escobar, Julia; Wolf, Diana; Fritz, Georg; Höfler, Carolin; Wedlich-Söldner, Roland; Mascher, Thorsten

    2014-05-01

    The liaIH operon of Bacillus subtilis is the main target of the envelope stress-inducible two-component system LiaRS. Here, we studied the localization, interaction and cellular dynamics of Lia proteins to gain insights into the physiological role of the Lia response. We demonstrate that LiaI serves as the membrane anchor for the phage-shock protein A homologue LiaH. Under non-inducing conditions, LiaI locates in highly motile membrane-associated foci, while LiaH is dispersed throughout the cytoplasm. Under stress conditions, both proteins are strongly induced and colocalize in numerous distinct static spots at the cytoplasmic membrane. This behaviour is independent of MreB and does also not correlate with the stalling of the cell wall biosynthesis machinery upon antibiotic inhibition. It can be induced by antibiotics that interfere with the membrane-anchored steps of cell wall biosynthesis, while compounds that inhibit the cytoplasmic or extracytoplasmic steps do not trigger this response. Taken together, our data are consistent with a model in which the Lia system scans the cytoplasmic membrane for envelope perturbations. Upon their detection, LiaS activates the cognate response regulator LiaR, which in turn strongly induces the liaIH operon. Simultaneously, LiaI recruits LiaH to the membrane, presumably to protect the envelope and counteract the antibiotic-induced damage. © 2014 John Wiley & Sons Ltd.

  16. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Science.gov (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  17. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

    Science.gov (United States)

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

    2013-07-01

    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Host organisms: Bacillus subtilis

    NARCIS (Netherlands)

    Hohman, Hans-Peter; van Dijl, Jan; Krishnappa, Laxmi; Pragai, Zoltan

    2016-01-01

    Bacillus subtilis and its close Bacillus relatives are important bacterial platforms for industrial production of enzymes and fine chemicals such as vitamin B2 and nucleotides. B. subtilis is an attractive bacterial organism for industrial use mainly because of its straightforward genetic

  19. CONDOP: an R package for CONdition-Dependent Operon Predictions.

    Science.gov (United States)

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

    2016-10-15

    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

    Science.gov (United States)

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

    2012-01-01

    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  1. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  2. Ecology and genomics of Bacillus subtilis.

    Science.gov (United States)

    Earl, Ashlee M; Losick, Richard; Kolter, Roberto

    2008-06-01

    Bacillus subtilis is a remarkably diverse bacterial species that is capable of growth within many environments. Recent microarray-based comparative genomic analyses have revealed that members of this species also exhibit considerable genomic diversity. The identification of strain-specific genes might explain how B. subtilis has become so broadly adapted. The goal of identifying ecologically adaptive genes could soon be realized with the imminent release of several new B. subtilis genome sequences. As we embark upon this exciting new era of B. subtilis comparative genomics we review what is currently known about the ecology and evolution of this species.

  3. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  4. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  5. Pirated Siderophores Promote Sporulation in Bacillus subtilis.

    Science.gov (United States)

    Grandchamp, Gabrielle M; Caro, Lews; Shank, Elizabeth A

    2017-05-15

    In microbial communities, bacteria chemically and physically interact with one another. Some of these interactions are mediated by secreted specialized metabolites that act as either intraspecies or interspecies signals to alter gene expression and to change cell physiology. Bacillus subtilis is a well-characterized soil microbe that can differentiate into multiple cell types, including metabolically dormant endospores. We were interested in identifying microbial interactions that affected sporulation in B. subtilis Using a fluorescent transcriptional reporter, we observed that coculturing B. subtilis with Escherichia coli promoted sporulation gene expression via a secreted metabolite. To identify the active compound, we screened the E. coli Keio Collection and identified the sporulation-accelerating cue as the siderophore enterobactin. B. subtilis has multiple iron acquisition systems that are used to take up the B. subtilis- produced siderophore bacillibactin, as well as to pirate exogenous siderophores such as enterobactin. While B. subtilis uses a single substrate binding protein (FeuA) to take up both bacillibactin and enterobactin, we discovered that it requires two distinct genes to sporulate in response to these siderophores (the esterase gene besA for bacillibactin and a putative esterase gene, ybbA , for enterobactin). In addition, we found that siderophores from a variety of other microbial species also promote sporulation in B. subtilis Our results thus demonstrate that siderophores can act not only as bacterial iron acquisition systems but also as interspecies cues that alter cellular development and accelerate sporulation in B. subtilis IMPORTANCE While much is known about the genetic regulation of Bacillus subtilis sporulation, little is understood about how other bacteria influence this process. This work describes an interaction between Escherichia coli and B. subtilis that accelerates sporulation in B. subtilis The interaction is mediated by the E

  6. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Science.gov (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  7. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  8. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  9. Contributions of the σ(W) , σ(M) and σ(X) regulons to the lantibiotic resistome of Bacillus subtilis.

    Science.gov (United States)

    Kingston, Anthony W; Liao, Xiaojie; Helmann, John D

    2013-11-01

    In Bacillus subtilis, the extracytoplasmic function (ECF) σ factors σ(M) , σ(W) and σ(X) all contribute to resistance against lantibiotics. Nisin, a model lantibiotic, has a dual mode of action: it inhibits cell wall synthesis by binding lipid II, and this complex also forms pores in the cytoplasmic membrane. These activities can be separated in a nisin hinge-region variant (N20P M21P) that binds lipid II, but no longer permeabilizes membranes. The major contribution of σ(M) to nisin resistance is expression of ltaSa, encoding a stress-activated lipoteichoic acid synthase, and σ(X) functions primarily by activation of the dlt operon controlling d-alanylation of teichoic acids. Together, σ(M) and σ(X) regulate cell envelope structure to decrease access of nisin to its lipid II target. In contrast, σ(W) is principally involved in protection against membrane permeabilization as it provides little protection against the nisin hinge region variant. σ(W) contributes to nisin resistance by regulation of a signal peptide peptidase (SppA), phage shock proteins (PspA and YvlC, a PspC homologue) and tellurite resistance related proteins (YceGHI). These defensive mechanisms are also effective against other lantibiotics such as mersacidin, gallidermin and subtilin and comprise an important subset of the intrinsic antibiotic resistome of B. subtilis. © 2013 John Wiley & Sons Ltd.

  10. Contributions of the σW, σM, and σX Regulons to the Lantibiotic Resistome of Bacillus subtilis

    Science.gov (United States)

    Kingston, Anthony W.; Liao, Xiaojie; Helmann, John D.

    2014-01-01

    Summary In Bacillus subtilis, the extracytoplasmic function (ECF) σ factors σM, σW, and σX all contribute to resistance against lantibiotics. Nisin, a model lantibiotic, has a dual mode of action: it inhibits cell wall synthesis by binding lipid II, and this complex also forms pores in the cytoplasmic membrane. These activities can be separated in a nisin hinge-region variant (N20P M21P) that binds lipid II, but no longer permeabilizes membranes. The major contribution of σM to nisin resistance is expression of ltaSa, encoding a stress-activated lipoteichoic acid synthase, and σX functions primarily by activation of the dlt operon controlling D-alanylation of teichoic acids. Together, σM and σX regulate cell envelope structure to decrease access of nisin to its lipid II target. In contrast, σW is principally involved in protection against membrane permeabilization as it provides little protection against the nisin hinge region variant. σW contributes to nisin resistance by regulation of a signal peptide peptidase (SppA), phage shock proteins (PspA and YvlC, a PspC homolog), and tellurite resistance related proteins (YceGHI). These defensive mechanisms are also effective against other lantibiotics such as mersacidin, gallidermin, and subtilin and comprise an important subset of the intrinsic antibiotic resistome of B. subtilis. PMID:23980836

  11. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

    OpenAIRE

    Stewart, V; Yanofsky, C

    1986-01-01

    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  12. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  13. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  14. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

    Science.gov (United States)

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  15. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

    Science.gov (United States)

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

    2016-01-01

    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  16. Molecular and Physiological Logics of the Pyruvate-Induced Response of a Novel Transporter in Bacillus subtilis.

    Science.gov (United States)

    Charbonnier, Teddy; Le Coq, Dominique; McGovern, Stephen; Calabre, Magali; Delumeau, Olivier; Aymerich, Stéphane; Jules, Matthieu

    2017-10-03

    At the heart of central carbon metabolism, pyruvate is a pivotal metabolite in all living cells. Bacillus subtilis is able to excrete pyruvate as well as to use it as the sole carbon source. We herein reveal that ysbAB (renamed pftAB ), the only operon specifically induced in pyruvate-grown B. subtilis cells, encodes a hetero-oligomeric membrane complex which operates as a facilitated transport system specific for pyruvate, thereby defining a novel class of transporter. We demonstrate that the LytST two-component system is responsible for the induction of pftAB in the presence of pyruvate by binding of the LytT response regulator to a palindromic region upstream of pftAB We show that both glucose and malate, the preferred carbon sources for B. subtilis , trigger the binding of CcpA upstream of pftAB , which results in its catabolite repression. However, an additional CcpA-independent mechanism represses pftAB in the presence of malate. Screening a genome-wide transposon mutant library, we find that an active malic enzyme replenishing the pyruvate pool is required for this repression. We next reveal that the higher the influx of pyruvate, the stronger the CcpA-independent repression of pftAB , which suggests that intracellular pyruvate retroinhibits pftAB induction via LytST. Such a retroinhibition challenges the rational design of novel nature-inspired sensors and synthetic switches but undoubtedly offers new possibilities for the development of integrated sensor/controller circuitry. Overall, we provide evidence for a complete system of sensors, feed-forward and feedback controllers that play a major role in environmental growth of B. subtilis IMPORTANCE Pyruvate is a small-molecule metabolite ubiquitous in living cells. Several species also use it as a carbon source as well as excrete it into the environment. The bacterial systems for pyruvate import/export have yet to be discovered. Here, we identified in the model bacterium Bacillus subtilis the first import

  17. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  18. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  19. Crystallization and preliminary X-ray diffraction analysis of YisP protein from Bacillus subtilis subsp. subtilis strain 168

    International Nuclear Information System (INIS)

    Hu, Yumei; Jia, Shiru; Ren, Feifei; Huang, Chun-Hsiang; Ko, Tzu-Ping; Mitchell, Douglas A.; Guo, Rey-Ting; Zheng, Yingying

    2012-01-01

    A bacteria biofilm formation involved enzyme, BsYisP, from Bacillus subtilis subsp. subtilis strain 168, was crystallized and diffracted to 1.92 Å. YisP is an enzyme involved in the pathway of biofilm formation in bacteria and is predicted to possess squalene synthase activity. A BlastP search using the YisP protein sequence from Bacillus subtilis subsp. subtilis strain 168 shows that it shares 23% identity with the dehydrosqualene synthase from Staphylococcus aureus. The YisP from B. subtilis 168 was expressed in Escherichia coli and the recombinant protein was purified and crystallized. The crystals, which belong to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 43.966, b = 77.576, c = 91.378 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.92 Å resolution. Structure determination using MAD and MIR methods is in progress

  20. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  1. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    International Nuclear Information System (INIS)

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

    1994-01-01

    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  2. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  3. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  4. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  5. Glutamate dehydrogenase affects resistance to cell wall antibiotics in Bacillus subtilis.

    Science.gov (United States)

    Lee, Yong Heon; Kingston, Anthony W; Helmann, John D

    2012-03-01

    The glutamate dehydrogenase RocG of Bacillus subtilis is a bifunctional protein with both enzymatic and regulatory functions. Here we show that the rocG null mutant is sensitive to β-lactams, including cefuroxime (CEF), and to fosfomycin but that resistant mutants arise due to gain-of-function mutations in gudB, which encodes an otherwise inactive glutamate dehydrogenase. In the presence of CEF, ΔrocG ΔgudB mutant cells exhibit growth arrest when they reach mid-exponential phase. Using microarray-based transcriptional profiling, we found that the σ(W) regulon was downregulated in the ΔrocG ΔgudB null mutant. A survey of σ(W)-controlled genes for effects on CEF resistance identified both the NfeD protein YuaF and the flotillin homologue YuaG (FloT). Notably, overexpression of yuaFG in the rocG null mutant prevents the growth arrest induced by CEF. The YuaG flotillin has been shown previously to localize to defined lipid microdomains, and we show here that the yuaFGI operon contributes to a σ(W)-dependent decrease in membrane fluidity. We conclude that glutamate dehydrogenase activity affects the expression of the σ(W) regulon, by pathways that are yet unclear, and thereby influences resistance to CEF and other antibiotics.

  6. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

    Science.gov (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

    2014-01-01

    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  7. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Science.gov (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  8. Tricistronic operon expression of the genes gcaD (tms), which encodes N-acetylglucosamine 1-phosphate uridyltransferase, prs, which encodes phosphoribosyl diphosphate synthetase, and ctc in vegetative cells of Bacillus subtilis

    DEFF Research Database (Denmark)

    Hilden, Ida; Krath, Britta N.; Hove-Jensen, Bjarne

    1995-01-01

    The gcaD, prs, and ctc genes were shown to be organized as a tricistronic operon. The transcription of the prs gene, measured as phosphoribosyl diphosphate synthetase activity, and of the ctc gene, measured as β-galactosidase activity specified by a ctc-lacZ protein fusion, were dependent...

  9. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  10. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  11. High-level expression and characterization of the Bacillus subtilis subsp. subtilis str. BSP1 YwaD aminopeptidase in Pichia pastoris.

    Science.gov (United States)

    Tang, Wei; Li, Zhezhe; Li, Chunhua; Yu, Xianhong; Wang, Fei; Wan, Xin; Wang, Yaping; Ma, Lixin

    2016-06-01

    Aminopeptidases are widely used for creating protein hydrolysates and peptide sequencing. The ywaD gene from a new Bacillus isolate, named Bacillus subtilis subsp. subtilis str. BSP1, was cloned into the yeast expression vector pHBM905A and expressed and secreted by Pichia pastoris strain GS115. The deduced amino acid sequence of the aminopeptidase encoded by the ywaD gene shared up to 98% identity with aminopeptidases from B. subtilis strains 168 and zj016. The yield (3.81 g/l) and specific activity (788 U/mg) of recombinant YwaD in high-density fermentation were extremely high. And 829.83 mg of the purified enzyme (4089.72 U/mg) were harvested. YwaD was glycosylated, and its activity decreased after deglycosylation, which was similar to that of the aminopeptidase from B. subtilis strain zj016. YwaD was most active toward l-arginine-4-nitroanilide. Moreover, it exhibited high resistance to carbamide, which was not true for aminopeptidases from B. subtilis strains 168 and zj016, which could simplify the purification of YwaD. Moreover, the expression and parts of characterization of the aminopeptidase from B. subtilis strain 168 in Pichia pastoris were added as supplementary material. The sequence and other characteristics of YwaD were compared with those of aminopeptidases from B. subtilis strains 168 and zj016, and they will provide a solid foundation for further research on the influence of amino acid mutations on the function of aminopeptidases. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Science.gov (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  13. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Science.gov (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  14. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  15. clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

    Science.gov (United States)

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

    2015-03-01

    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Engineering of Bacillus subtilis 168 for increased nisin resistance

    DEFF Research Database (Denmark)

    Hansen, Mette; Wangari, Romilda; Hansen, Egon Bech

    2009-01-01

    . Bacillus subtilis had been suggested as a potential host for the biosynthesis of nisin but was discarded due to its sensitivity to the lethal action of nisin. In this study, we have reevaluated the potential of B. subtilis as a host organism for the heterologous production of nisin. We applied...... transcriptome and proteome analyses of B. subtilis and identified eight genes upregulated in the presence of nisin. We demonstrated that the overexpression of some of these genes boosts the natural defenses of B. subtilis, which allows it to sustain higher levels of nisin in the medium. We also attempted...... to overcome the nisin sensitivity of B. subtilis by introducing the nisin resistance genes nisFEG and nisI from L. lactis under the control of a synthetic promoter library....

  17. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  18. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  19. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Science.gov (United States)

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  20. Type I signal peptidases of Bacillus subtilis

    NARCIS (Netherlands)

    Tjalsma, Harold; Bolhuis, Albert; Bron, Sierd; Jongbloed, Jan; Meijer, Wilfried J.J.; Noback, Michiel; van Roosmalen, Maarten; Venema, Gerhardus; van Dijl, Jan Maarten; Hopsu Havu, VK; Jarvinen, M; Kirschke, H

    1997-01-01

    Bacillus subtilis contains at least three chromosomally-encoded type I signal peptidases (SPases; SipS, SipT, and SipU), which remove signal peptides from secretory proteins. In addition, certain B. subtilis (natto) strains contain plasmid-encoded type I SPases (SipP). The known type I SPases from

  1. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    DEFF Research Database (Denmark)

    Danielsen, S; Kilstrup, M; Barilla, K

    1992-01-01

    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  2. Bacillus subtilis strain specificity affects performance improvement in broilers.

    Science.gov (United States)

    Rhayat, L; Jacquier, V; Brinch, K S; Nielsen, P; Nelson, A; Geraert, P-A; Devillard, E

    2017-07-01

    The study reports the effects on broiler performance of a newly isolated Bacillus subtilis strain, which is phylogenetically not closely related to already well-described strains of B. subtilis. In the first experiment, birds were reared in battery cages and exposed to C. perfringens. An increase in growth performance was observed with the strain when compared to the challenged animals. Three additional growth trials were conducted to 35 d of age, in different rearing conditions (genetic breeds, corn-soybean meal-based diet with or without animal proteins, in presence or absence of phytase, on fresh or used litter) to investigate the efficacy and the specificity of this new B. subtilis strain on the improvement of BWG and FCR of broilers in comparison with a B. subtilis-based DFM already used in the field. Whatever the rearing conditions tested, the new B. subtilis strain led to an average 3.2% improvement in feed conversion ratio or bodyweight. Comparatively, the commercial Bacillus strain significantly improved broiler performance in only one trial out of 3 with an average improvement reaching 2%. All these results indicate that this new B. subtilis strain consistently improves broiler performances. © 2017 Poultry Science Association Inc.

  3. Intracellular Biosynthesis of Fluorescent CdSe Quantum Dots in Bacillus subtilis: A Strategy to Construct Signaling Bacterial Probes for Visually Detecting Interaction Between Bacillus subtilis and Staphylococcus aureus.

    Science.gov (United States)

    Yan, Zheng-Yu; Ai, Xiao-Xia; Su, Yi-Long; Liu, Xin-Ying; Shan, Xiao-Hui; Wu, Sheng-Mei

    2016-02-01

    In this work, fluorescent Bacillus subtilis (B. subtilis) cells were developed as probes for imaging applications and to explore behaviorial interaction between B. subtilis and Staphylococcus aureus (S. aureus). A novel biological strategy of coupling intracellular biochemical reactions for controllable biosynthesis of CdSe quantum dots by living B. subtilis cells was demonstrated, through which highly luminant and photostable fluorescent B. subtilis cells were achieved with good uniformity. With the help of the obtained fluorescent B. subtilis cells probes, S. aureus cells responded to co-cultured B. subtilis and to aggregate. The degree of aggregation was calculated and nonlinearly fitted to a polynomial model. Systematic investigations of their interactions implied that B. subtilis cells inhibit the growth of neighboring S. aureus cells, and this inhibition was affected by both the growth stage and the amount of surrounding B. subtilis cells. Compared to traditional methods of studying bacterial interaction between two species, such as solid culture medium colony observation and imaging mass spectrometry detection, the procedures were more simple, vivid, and photostable due to the efficient fluorescence intralabeling with less influence on the cells' surface, which might provide a new paradigm for future visualization of microbial behavior.

  4. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

    Science.gov (United States)

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

    2013-10-01

    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  5. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  6. PRODUKSI ANTIBIOTIKA OLEH Bacillus subtilis M10 DALAM MEDIA UREA-SORBITOL

    Directory of Open Access Journals (Sweden)

    Supartono Supartono

    2012-04-01

    Full Text Available PRODUCTION OF ANTIBIOTICS BY Bacillus subtilis M10 IN UREA-SORBITOL MEDIUM. Infection diseases still become the main health problems that suffered by people in Indonesia. Besides, there were many pathogen bacteria found to be resistant to the some antibiotics. Therefore, the efforts to get a new antibiotic require to be done continuously. A new local strain of Bacillus subtilis BAC4 has been known producing an antibiotic that inhibit Serratia marcescens ATCC 27117 growth. To make efficient the local strain, mutation on Bacillus subtilis BAC4 was done by using acridine orange and a mutant cell of Bacillus subtilis M10 that overproduction for producing antibiotic was obtained. Nevertheless, the production kinetics of antibiotic by this mutant has not been reported. The objective of this research was to study the production kinetics of antibiotic by Bacillus subtilis M10 mutant. The production of antibiotic was conducted using batch fermentation and antibiotic assay was performed with agar absorption method using Serratia marcescens ATCC 27117 as bacteria assay. Research result provided that Bacillus subtilis M10 mutant with overproduction of antibiotic produced an antibiotic since 8th hour’s fermentation and optimum of it production was at 14th hours after inoculation.  Penyakit infeksi masih menjadi masalah yang utama diderita oleh masyarakat Indonesia. Di samping itu, banyak bakteri patogen yang ditemukan resisten terhadap beberapa antibiotika. Oleh karena itu, upaya-upaya untuk mendapatkan antibiotika baru perlu dilakukan secara terus-menerus. Suatu galur lokal baru Bacillus subtilis BAC4 teridentifikasi memproduksi senyawa antibiotika yang menghambat pertumbuhan Serratia marcescens ATCC27117. Untuk memberdayakan galur tersebut, terhadap Bacillus subtilis BAC4 dilakukan mutasi dengan larutan akridin oranye dan diperoleh mutan Bacillus subtilis M10 yang memproduksi antibiotika berlebihan. Namun, kinetika produksi antibiotika oleh Bacillus

  7. Biodegradation of naphthalene and phenanthren by Bacillus subtilis 3KP

    Science.gov (United States)

    Ni'matuzahroh, Trikurniadewi, N.; Pramadita, A. R. A.; Pratiwi, I. A.; Salamun, Fatimah, Sumarsih, Sri

    2017-06-01

    The purposes of this research were to know growth response, degradation ability, and uptake mechanism of naphthalene and phenanthrene by Bacillus subtilis 3KP. Bacillus subtilis 3KP was grown on Mineral Synthetic (MS) medium with addition of 1% yeast extract and naphthalene and phenanthrene respectively 200 ppm in different cultures. Bacillus subtilis 3KP growth response was monitored by Total Plate Count (TPC) method, the degradation ability was monitored by UV-Vis spectrophotometer, and the uptake mechanism of hydrocarbon was monitored by emulsification activity, decrease of surface tension, and activity of Bacterial Adherence to Hydrocarbon (BATH). Bacillus subtilis 3KP was able to grow and show biphasic growth pattern on both of substrates. Naphthalene and phenanthrene were used as a carbon source for Bacillus subtilis 3KP growth that indicated by the reduction of substrate concomitant with the growth. At room temperature conditions (± 30°C) and 90 rpm of agitation for 7 days, Bacillus subtilis 3KP could degrade naphthalene in the amount of 70.5% and phenanthrene in the amount of 24.8%. Based on the analysis of UV-Vis spectrophotometer, three metabolites, 1-hydroxy-2-naphthoic acid, salicylic acid, and pyrocatechol were found in both cultures. The metabolite identification became basis of propose degradation pathway of naphthalene and phenanthrene by Bacillus subtilis 3KP. The results of hydrocarbon uptake mechanism test show that Bacillus subtilis 3KP used all of the mechanism to degrade naphthalene and phenanthrene.

  8. Bacillus subtilis biofilm induction by plant polysaccharides.

    Science.gov (United States)

    Beauregard, Pascale B; Chai, Yunrong; Vlamakis, Hera; Losick, Richard; Kolter, Roberto

    2013-04-23

    Bacillus subtilis is a plant-beneficial Gram-positive bacterium widely used as a biofertilizer. However, relatively little is known regarding the molecular processes underlying this bacterium's ability to colonize roots. In contrast, much is known about how this bacterium forms matrix-enclosed multicellular communities (biofilms) in vitro. Here, we show that, when B. subtilis colonizes Arabidopsis thaliana roots it forms biofilms that depend on the same matrix genes required in vitro. B. subtilis biofilm formation was triggered by certain plant polysaccharides. These polysaccharides served as a signal for biofilm formation transduced via the kinases controlling the phosphorylation state of the master regulator Spo0A. In addition, plant polysaccharides are used as a source of sugars for the synthesis of the matrix exopolysaccharide. The bacterium's response to plant polysaccharides was observed across several different strains of the species, some of which are known to have beneficial effects on plants. These observations provide evidence that biofilm genes are crucial for Arabidopsis root colonization by B. subtilis and provide insights into how matrix synthesis may be triggered by this plant.

  9. Structural characterization of the Salmonella typhimurium LT2 umu operon

    International Nuclear Information System (INIS)

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

    1990-01-01

    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  10. Antibiotic Stimulation of a Bacillus subtilis Migratory Response

    Science.gov (United States)

    Liu, Yongjin; Kyle, Steven

    2018-01-01

    ABSTRACT Competitive interactions between bacteria reveal physiological adaptations that benefit fitness. Bacillus subtilis is a Gram-positive species with several adaptive mechanisms for competition and environmental stress. Biofilm formation, sporulation, and motility are the outcomes of widespread changes in a population of B. subtilis. These changes emerge from complex, regulated pathways for adapting to external stresses, including competition from other species. To identify competition-specific functions, we cultured B. subtilis with multiple species of Streptomyces and observed altered patterns of growth for each organism. In particular, when plated on agar medium near Streptomyces venezuelae, B. subtilis initiates a robust and reproducible mobile response. To investigate the mechanistic basis for the interaction, we determined the type of motility used by B. subtilis and isolated inducing metabolites produced by S. venezuelae. Bacillus subtilis has three defined forms of motility: swimming, swarming, and sliding. Streptomyces venezuelae induced sliding motility specifically in our experiments. The inducing agents produced by S. venezuelae were identified as chloramphenicol and a brominated derivative at subinhibitory concentrations. Upon further characterization of the mobile response, our results demonstrated that subinhibitory concentrations of chloramphenicol, erythromycin, tetracycline, and spectinomycin all activate a sliding motility response by B. subtilis. Our data are consistent with sliding motility initiating under conditions of protein translation stress. This report underscores the importance of hormesis as an early warning system for potential bacterial competitors and antibiotic exposure. IMPORTANCE Antibiotic resistance is a major challenge for the effective treatment of infectious diseases. Identifying adaptive mechanisms that bacteria use to survive low levels of antibiotic stress is important for understanding pathways to

  11. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  12. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Sun Yuan

    2006-02-01

    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  13. Homolactic fermentation from glucose and cellobiose using Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Martinez Alfredo

    2009-04-01

    Full Text Available Abstract Backgroung Biodegradable plastics can be made from polylactate, which is a polymer made from lactic acid. This compound can be produced from renewable resources as substrates using microorganisms. Bacillus subtilis is a Gram-positive bacterium recognized as a GRAS microorganism (generally regarded as safe by the FDA. B. subtilis produces and secretes different kind of enzymes, such as proteases, cellulases, xylanases and amylases to utilize carbon sources more complex than the monosaccharides present in the environment. Thus, B. subtilis could be potentially used to hydrolyze carbohydrate polymers contained in lignocellulosic biomass to produce chemical commodities. Enzymatic hydrolysis of the cellulosic fraction of agroindustrial wastes produces cellobiose and a lower amount of glucose. Under aerobic conditions, B. subtilis grows using cellobiose as substrate. Results In this study, we proved that under non-aerated conditions, B. subtilis ferments cellobiose to produce L-lactate with 82% of the theoretical yield, and with a specific rate of L-lactate production similar to that one obtained fermenting glucose. Under fermentative conditions in a complex media supplemented with glucose, B. subtilis produces L-lactate and a low amount of 2,3-butanediol. To increase the L-lactate production of this organism, we generated the B subtilis CH1 alsS- strain that lacks the ability to synthesize 2,3-butanediol. Inactivation of this pathway, that competed for pyruvate availability, let a 15% increase in L-lactate yield from glucose compared with the parental strain. CH1 alsS- fermented 5 and 10% of glucose to completion in mineral medium supplemented with yeast extract in four and nine days, respectively. CH1 alsS- produced 105 g/L of L-lactate in this last medium supplemented with 10% of glucose. The L-lactate yield was up to 95% using mineral media, and the optical purity of L-lactate was of 99.5% since B. subtilis has only one gene (lctE that

  14. Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus species

    Science.gov (United States)

    Rey, Michael W; Ramaiya, Preethi; Nelson, Beth A; Brody-Karpin, Shari D; Zaretsky, Elizabeth J; Tang, Maria; de Leon, Alfredo Lopez; Xiang, Henry; Gusti, Veronica; Clausen, Ib Groth; Olsen, Peter B; Rasmussen, Michael D; Andersen, Jens T; Jørgensen, Per L; Larsen, Thomas S; Sorokin, Alexei; Bolotin, Alexander; Lapidus, Alla; Galleron, Nathalie; Ehrlich, S Dusko; Berka, Randy M

    2004-01-01

    Background Bacillus licheniformis is a Gram-positive, spore-forming soil bacterium that is used in the biotechnology industry to manufacture enzymes, antibiotics, biochemicals and consumer products. This species is closely related to the well studied model organism Bacillus subtilis, and produces an assortment of extracellular enzymes that may contribute to nutrient cycling in nature. Results We determined the complete nucleotide sequence of the B. licheniformis ATCC 14580 genome which comprises a circular chromosome of 4,222,336 base-pairs (bp) containing 4,208 predicted protein-coding genes with an average size of 873 bp, seven rRNA operons, and 72 tRNA genes. The B. licheniformis chromosome contains large regions that are colinear with the genomes of B. subtilis and Bacillus halodurans, and approximately 80% of the predicted B. licheniformis coding sequences have B. subtilis orthologs. Conclusions Despite the unmistakable organizational similarities between the B. licheniformis and B. subtilis genomes, there are notable differences in the numbers and locations of prophages, transposable elements and a number of extracellular enzymes and secondary metabolic pathway operons that distinguish these species. Differences include a region of more than 80 kilobases (kb) that comprises a cluster of polyketide synthase genes and a second operon of 38 kb encoding plipastatin synthase enzymes that are absent in the B. licheniformis genome. The availability of a completed genome sequence for B. licheniformis should facilitate the design and construction of improved industrial strains and allow for comparative genomics and evolutionary studies within this group of Bacillaceae. PMID:15461803

  15. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

    Science.gov (United States)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2015-01-01

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  16. A Generic Protocol for Intracellular Expression of Recombinant Proteins in Bacillus subtilis.

    Science.gov (United States)

    Phan, Trang; Huynh, Phuong; Truong, Tuom; Nguyen, Hoang

    2017-01-01

    Bacillus subtilis (B. subtilis) is a potential and attractive host for the production of recombinant proteins. Different expression systems for B. subtilis have been developed recently, and various target proteins have been recombinantly synthesized and purified using this host. In this chapter, we introduce a generic protocol to express a recombinant protein in B. subtilis. It includes protocols for (1) using our typical expression vector (plasmid pHT254) to introduce a target gene, (2) transformation of the target vector into B. subtilis, and (3) evaluation of the actual expression of a recombinant protein.

  17. Removing Bacillus subtilis from fermentation broth using alumina nanoparticles.

    Science.gov (United States)

    Mu, Dashuai; Mu, Xin; Xu, Zhenxing; Du, Zongjun; Chen, Guanjun

    2015-12-01

    In this study, an efficient separation technology using Al2O3 nanoparticles (NPs) was developed for removing Bacillus subtilis from fermentation broth. The dosage of alumina nanoparticles used for separating B. subtilis increased during the culture process and remained stable in the stationary phase of the culture process. The pH of the culture-broth was also investigated for its effects on flocculation efficiency, and showed an acidic pH could enhance the flocculation efficiency. The attachment mechanisms of Al2O3 NPs to the B. subtilis surface were investigated, and the zeta potential analysis showed that Al2O3 NPs could attach to B. subtilis via electrostatic attachment. Finally, the metabolite content and the antibacterial effect of the fermentation supernatants were detected and did not significantly differ between alumina nanoparticle separation and centrifugation separation. Together, these results indicate a great potential for a highly efficient and economical method for removing B. subtilis from fermentation broth using alumina nanoparticles. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Plant methyl salicylate induces defense responses in the rhizobacterium Bacillus subtilis.

    Science.gov (United States)

    Kobayashi, Kazuo

    2015-04-01

    Bacillus subtilis is a rhizobacterium that promotes plant growth and health. Cultivation of B. subtilis with an uprooted weed on solid medium produced pleat-like architectures on colonies near the plant. To test whether plants emit signals that affect B. subtilis colony morphology, we examined the effect of plant-related compounds on colony morphology. Bacillus subtilis formed mucoid colonies specifically in response to methyl salicylate, which is a plant-defense signal released in response to pathogen infection. Methyl salicylate induced mucoid colony formation by stimulating poly-γ-glutamic acid biosynthesis, which formed enclosing capsules that protected the cells from exposure to antimicrobial compounds. Poly-γ-glutamic acid synthesis depended on the DegS-DegU two-component regulatory system, which activated DegSU-dependent gene transcription in response to methyl salicylate. Bacillus subtilis did not induce plant methyl salicylate production, indicating that the most probable source of methyl salicylate in the rhizosphere is pathogen-infected plants. Methyl salicylate induced B. subtilis biosynthesis of the antibiotics bacilysin and fengycin, the latter of which exhibited inhibitory activity against the plant pathogenic fungus Fusarium oxysporum. We propose that B. subtilis may sense plants under pathogen attack via methyl salicylate, and express defense responses that protect both B. subtilis and host plants in the rhizosphere. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  19. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  20. Effect of Bacillus subtilis on Granite Weathering: A Laboratory Experiment

    Science.gov (United States)

    Song, W.; Ogawa, N.; Oguchi, C. T.; Hatta, T.; Matsukura, Y.

    2006-12-01

    We performed a comparative experiment to investigate how the ubiquitous soil bacterium Bacillus subtilis weathers granite and which granite-forming minerals weather more rapidly via biological processes. Batch type experiments (granite specimen in a 500 ml solution including NaCl, glucose, yeast extract and bacteria Bacillus subtilis at 27°E C) were carried out for 30 days. Granite surfaces were observed by SEM before and after the experiment. Bacillus subtilis had a strong influence on granite weathering by forming pits. There were 2.4 times as many pits and micropores were 2.3 times wider in granite exposed to Bacillus subtilis when compared with bacteria-free samples. Bacillus subtilis appear to preferentially select an optimum place to adhere to the mineral and dissolve essential elements from the mineral to live. Plagioclase was more vulnerable to bacterial weathering than biotite among the granite composing minerals.

  1. Association of RNAs with Bacillus subtilis Hfq.

    Directory of Open Access Journals (Sweden)

    Michael Dambach

    Full Text Available The prevalence and characteristics of small regulatory RNAs (sRNAs have not been well characterized for Bacillus subtilis, an important model system for Gram-positive bacteria. However, B. subtilis was recently found to synthesize many candidate sRNAs during stationary phase. In the current study, we performed deep sequencing on Hfq-associated RNAs and found that a small subset of sRNAs associates with Hfq, an enigmatic RNA-binding protein that stabilizes sRNAs in Gram-negatives, but whose role is largely unknown in Gram-positive bacteria. We also found that Hfq associated with antisense RNAs, antitoxin transcripts, and many mRNA leaders. Several new candidate sRNAs and mRNA leader regions were also discovered by this analysis. Additionally, mRNA fragments overlapping with start or stop codons associated with Hfq, while, in contrast, relatively few full-length mRNAs were recovered. Deletion of hfq reduced the intracellular abundance of several representative sRNAs, suggesting that B. subtilis Hfq-sRNA interactions may be functionally significant in vivo. In general, we anticipate this catalog of Hfq-associated RNAs to serve as a resource in the functional characterization of Hfq in B. subtilis.

  2. Development of Bacillus subtilis mutants to produce tryptophan in pigs

    DEFF Research Database (Denmark)

    Bjerre, Karin; Cantor, Mette D.; Nørgaard, Jan Værum

    2017-01-01

    Objectives To generate tryptophan-overproducing Bacillus subtilis strains for in situ use in pigs, to reduce the feed cost for farmers and nitrogen pollution. Results A novel concept has been investigated—to generate B. subtilis strains able to produce tryptophan (Trp) in situ in pigs. Mutagenesis......-excreting B. subtilis strains were obtained with UV-mutagenesis and analogue selection and can be used in animal feed applications....

  3. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

    OpenAIRE

    Riyanti, Eny Ida; Rogers, Peter L

    2009-01-01

    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  4. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

    Science.gov (United States)

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

    2014-10-01

    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  5. Effect of Bacillus subtilis natto on growth performance in Muscovy ducks

    Directory of Open Access Journals (Sweden)

    T Sheng-Qiu

    2013-09-01

    Full Text Available The aim of the present study was to determine whether dietary Bacillus subtilis natto could affect growth performance of Muscovy ducks. A total of 120 hundred Muscovy ducks at the age of 1 day were randomly assigned to four groups (30 Muscovy ducks/group, and fed with diets supplemented with 0% (control group, 0.1%, 0.2%, and 0.4% Bacillus subtilis natto, respectively during the 6-week feeding period. Weight gain, feed intake and feed conversion efficiency of Muscovy ducks were significantly improved by the dietary addition of Bacillus subtilis natto, and the results were more significant in 0.4% dietary Bacillus subtilis natto treatment group; Also, Bacillus subtilis natto reduced Escherichia coli and Salmonella colonies, and increased lactobacilli population in the ileum and the cecum. Biochemical parameters, including total protein, GOT (glutamic oxaloacetic transaminase, GPT (glutamic pyruvic transaminase, AKP (alkaline phosphatase, triiodothyronine (T3 and tetraiodothyronine (T4 contents (pBacillus subtilis natto was added to the diets (p0.05. The results of the present study indicate that diets with 0.4% Bacillus subtilis natto improved the growth performance of Muscovy ducks by increasing the absorption of protein, simulating hormone secretion, suppressing harmful microflora, and improving the duodenal structure and immune functions of Muscovy ducks. It is suggested that Bacillus subtilis natto is a potential candidate to be used use as a probiotic to improve the growth performance of Muscovy ducks.

  6. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  7. Complete Genome Sequence of Bacillus subtilis subsp. subtilis Strain ∆6

    NARCIS (Netherlands)

    Reuß, Daniel R; Thürmer, Andrea; Daniel, Rolf; Quax, Wim J; Stülke, Jörg

    2016-01-01

    Bacillus subtilis ∆6 is a genome-reduced strain that was cured from six prophages and AT-rich islands. This strain is of great interest for biotechnological applications. Here, we announce the full-genome sequence of this strain. Interestingly, the conjugative element ICEBs1 has most likely

  8. Protein-Tyrosine Phosphorylation in Bacillus subtilis

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Bottini, N.

    2005-01-01

    phosphorylation, indicating that this post-translational modifi cation could regulate physiological processes ranging from stress response and exopolysaccharide synthesis to DNA metabolism. Some interesting work in this fi eld was done in Bacillus subtilis , and we here present the current state of knowledge...... on protein-tyrosine phosphorylation in this gram-positive model organism. With its two kinases, two kinase modulators, three phosphatases and at least four different tyrosine-phosphorylated substrates, B. subtilis is the bacterium with the highest number of presently known participants in the global network...

  9. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

    Science.gov (United States)

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

    2014-12-01

    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  10. Global transcriptional responses of Bacillus subtilis to xenocoumacin 1.

    Science.gov (United States)

    Zhou, T; Zeng, H; Qiu, D; Yang, X; Wang, B; Chen, M; Guo, L; Wang, S

    2011-09-01

    To determine the global transcriptional response of Bacillus subtilis to an antimicrobial agent, xenocoumacin 1 (Xcn1). Subinhibitory concentration of Xcn1 applied to B. subtilis was measured according to Hutter's method for determining optimal concentrations. cDNA microarray technology was used to study the global transcriptional response of B. subtilis to Xcn1. Real-time RT-PCR was employed to verify alterations in the transcript levels of six genes. The subinhibitory concentration was determined to be 1 μg ml(-1). The microarray data demonstrated that Xcn1 treatment of B. subtilis led to more than a 2.0-fold up-regulation of 480 genes and more than a 2.0-fold down-regulation of 479 genes (q ≤ 0.05). The transcriptional responses of B. subtilis to Xcn1 were determined, and several processes were affected by Xcn1. Additionally, cluster analysis of gene expression profiles after treatment with Xcn1 or 37 previously studied antibiotics indicated that Xcn1 has similar mechanisms of action to protein synthesis inhibitors. These microarray data showed alterations of gene expression in B. subtilis after exposure to Xcn1. From the results, we identified various processes affected by Xcn1. This study provides a whole-genome perspective to elucidate the action of Xcn1 as a potential antimicrobial agent. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  11. A DegU-P and DegQ-Dependent Regulatory Pathway for the K-state in Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Mathieu Miras

    2016-11-01

    Full Text Available The K-state in the model bacterium Bacillus subtilis is associated with transformability (competence as well as with growth arrest and tolerance for antibiotics. Entry into the K-state is determined by the stochastic activation of the transcription factor ComK and occurs in about ~15% of the population in domesticated strains. Although the upstream mechanisms that regulate the K-state have been intensively studied and are well understood, it has remained unexplained why undomesticated isolates of B. subtilis are poorly transformable compared to their domesticated counterparts. We show here that this is because fewer cells enter the K-state, suggesting that a regulatory pathway limiting entry to the K-state is missing in domesticated strains. We find that loss of this limitation is largely due to an inactivating point mutation in the promoter of degQ. The resulting low level of DegQ decreases the concentration of phosphorylated DegU, which leads to the de-repression of the srfA operon and ultimately to the stabilization of ComK. As a result, more cells reach the threshold concentration of ComK needed to activate the auto-regulatory loop at the comK promoter. In addition, we demonstrate that the activation of srfA transcription in undomesticated strains is transient, turning off abruptly as cells enter the stationary phase. Thus, the K-state and transformability are more transient and less frequently expressed in the undomesticated strains. This limitation is more extreme than appreciated from studies of domesticated strains. Selection has apparently limited both the frequency and the duration of the bistably expressed K-state in wild strains, likely because of the high cost of growth arrest associated with the K-state. Future modeling of K-state regulation and of the fitness advantages and costs of the K-state must take these features into account.

  12. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk

    2004-01-01

    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  13. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

    Science.gov (United States)

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

    2013-02-01

    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

  14. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Sticking together: building a biofilm the Bacillus subtilis way.

    Science.gov (United States)

    Vlamakis, Hera; Chai, Yunrong; Beauregard, Pascale; Losick, Richard; Kolter, Roberto

    2013-03-01

    Biofilms are ubiquitous communities of tightly associated bacteria encased in an extracellular matrix. Bacillus subtilis has long served as a robust model organism to examine the molecular mechanisms of biofilm formation, and a number of studies have revealed that this process is regulated by several integrated pathways. In this Review, we focus on the molecular mechanisms that control B. subtilis biofilm assembly, and then briefly summarize the current state of knowledge regarding biofilm disassembly. We also discuss recent progress that has expanded our understanding of B. subtilis biofilm formation on plant roots, which are a natural habitat for this soil bacterium.

  16. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Directory of Open Access Journals (Sweden)

    Qinna Cui

    Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  17. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  18. stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

    Science.gov (United States)

    Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

    2015-07-07

    Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

  19. Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

    Science.gov (United States)

    Kim, Moonjeong; Kim, Kwang-Sun

    2017-07-06

    The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Tryptophan provision by dietary supplementation of a Bacillus subtilis mutant strain in piglets

    DEFF Research Database (Denmark)

    Torres-Pitarch, A; Nielsen, B.; Canibe, Nuria

    2015-01-01

    Supplementing Bacillus (B.) subtilis mutants selected to overproduce a specific amino acid (AA) may be an alternative method to provide essential AA in pig diets. Two experiments on a B. subtilis strain selected to overproduce Trp were conducted using 8-kg pigs fed Trp-deficient diets for 20 d. B....... subtilis were supplied in a low or high dose in Experiments 1 and 2, respectively. The Trp-deficient diet (0.15 SID Trp:Lys) reduced (p subtilis strain was not able...... to counterbalance the Trp deficiency in any of the two experiments. No effect of B. subtilis supplementation to piglet diets was observed on the plasma AA profile. In conclusion, this mutant strain of B. subtilis was not able to compensate a Trp deficiency in the tested doses....

  1. Production of milk-clotting enzyme by Bacillus subtilis B1 from wheat ...

    African Journals Online (AJOL)

    Three strains, Bacillus subtilis B1, B. subtilis B18 and Bacillus thuringiensis B12, were screened from wheat bran to produce milk-clotting enzyme. Among them, B. subtilis B1 exhibited considerable milkclotting activity with low proteolytic activity. After response surface methodology optimization, milkclotting activity was ...

  2. Extracellular signaling and multicellularity in Bacillus subtilis.

    Science.gov (United States)

    Shank, Elizabeth Anne; Kolter, Roberto

    2011-12-01

    Bacillus subtilis regulates its ability to differentiate into distinct, co-existing cell types in response to extracellular signaling molecules produced either by itself, or present in its environment. The production of molecules by B. subtilis cells, as well as their response to these signals, is not uniform across the population. There is specificity and heterogeneity both within genetically identical populations as well as at the strain-level and species-level. This review will discuss how extracellular signaling compounds influence B. subtilis multicellularity with regard to matrix-producing cannibal differentiation, germination, and swarming behavior, as well as the specificity of the quorum-sensing peptides ComX and CSF. It will also highlight how imaging mass spectrometry can aid in identifying signaling compounds and contribute to our understanding of the functional relationship between such compounds and multicellular behavior. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. PRODIGIOSIN INDUCES AUTOLYSINS IN ACTIVELY GROWN Bacillus subtilis CELLS

    Directory of Open Access Journals (Sweden)

    Tjasa eDanevcic

    2016-01-01

    Full Text Available Prodigiosin produced by marine bacterium Vibrio ruber DSM 14379 exhibits a potent antimicrobial activity against a broad range of Gram positive and Gram negative bacteria. The mechanism of prodigiosin antimicrobial action, however, is not known. In this work, the effect of prodigiosin on B. subtilis growth, cell membrane leakage, and induction of autolysins was studied. Treating B. subtilis with prodigiosin resulted in rapid decline of optical density and increased cell membrane leakage measured by β-galactosidase activity. Cell lysis was initiated immediately after treatment with prodigiosin in the middle exponential phase and was completed within two hours. Lytic activity of prodigiosin in mutant strains with impaired autolysin genes lytABCD decreased for 80 % compared to the wild-type strain, while in lytABCDEF mutant strain prodigiosin had no bacteriolytic but only bacteriostatic effect. Fast prodigiosin lytic activity on individual B. subtilis cells was confirmed by a modified comet assay. The results indicate that prodigiosin autolysin induction in B. subtilis is growth phase dependent.

  4. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

    OpenAIRE

    Chung, T; Resnik, E; Stueland, C; LaPorte, D C

    1993-01-01

    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  5. Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

    Science.gov (United States)

    Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

    2016-01-01

    The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

  6. Bacillus subtilis Early Colonization of Arabidopsis thaliana Roots Involves Multiple Chemotaxis Receptors.

    Science.gov (United States)

    Allard-Massicotte, Rosalie; Tessier, Laurence; Lécuyer, Frédéric; Lakshmanan, Venkatachalam; Lucier, Jean-François; Garneau, Daniel; Caudwell, Larissa; Vlamakis, Hera; Bais, Harsh P; Beauregard, Pascale B

    2016-11-29

    Colonization of plant roots by Bacillus subtilis is mutually beneficial to plants and bacteria. Plants can secrete up to 30% of their fixed carbon via root exudates, thereby feeding the bacteria, and in return the associated B. subtilis bacteria provide the plant with many growth-promoting traits. Formation of a biofilm on the root by matrix-producing B. subtilis is a well-established requirement for long-term colonization. However, we observed that cells start forming a biofilm only several hours after motile cells first settle on the plant. We also found that intact chemotaxis machinery is required for early root colonization by B. subtilis and for plant protection. Arabidopsis thaliana root exudates attract B. subtilis in vitro, an activity mediated by the two characterized chemoreceptors, McpB and McpC, as well as by the orphan receptor TlpC. Nonetheless, bacteria lacking these chemoreceptors are still able to colonize the root, suggesting that other chemoreceptors might also play a role in this process. These observations suggest that A. thaliana actively recruits B. subtilis through root-secreted molecules, and our results stress the important roles of B. subtilis chemoreceptors for efficient colonization of plants in natural environments. These results demonstrate a remarkable strategy adapted by beneficial rhizobacteria to utilize carbon-rich root exudates, which may facilitate rhizobacterial colonization and a mutualistic association with the host. Bacillus subtilis is a plant growth-promoting rhizobacterium that establishes robust interactions with roots. Many studies have now demonstrated that biofilm formation is required for long-term colonization. However, we observed that motile B. subtilis mediates the first contact with the roots. These cells differentiate into biofilm-producing cells only several hours after the bacteria first contact the root. Our study reveals that intact chemotaxis machinery is required for the bacteria to reach the

  7. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  8. Genetic Competence Drives Genome Diversity in Bacillus subtilis

    Science.gov (United States)

    Chevreux, Bastien; Serra, Cláudia R; Schyns, Ghislain; Henriques, Adriano O

    2018-01-01

    Abstract Prokaryote genomes are the result of a dynamic flux of genes, with increases achieved via horizontal gene transfer and reductions occurring through gene loss. The ecological and selective forces that drive this genomic flexibility vary across species. Bacillus subtilis is a naturally competent bacterium that occupies various environments, including plant-associated, soil, and marine niches, and the gut of both invertebrates and vertebrates. Here, we quantify the genomic diversity of B. subtilis and infer the genome dynamics that explain the high genetic and phenotypic diversity observed. Phylogenomic and comparative genomic analyses of 42 B. subtilis genomes uncover a remarkable genome diversity that translates into a core genome of 1,659 genes and an asymptotic pangenome growth rate of 57 new genes per new genome added. This diversity is due to a large proportion of low-frequency genes that are acquired from closely related species. We find no gene-loss bias among wild isolates, which explains why the cloud genome, 43% of the species pangenome, represents only a small proportion of each genome. We show that B. subtilis can acquire xenologous copies of core genes that propagate laterally among strains within a niche. While not excluding the contributions of other mechanisms, our results strongly suggest a process of gene acquisition that is largely driven by competence, where the long-term maintenance of acquired genes depends on local and global fitness effects. This competence-driven genomic diversity provides B. subtilis with its generalist character, enabling it to occupy a wide range of ecological niches and cycle through them. PMID:29272410

  9. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  10. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

    Science.gov (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

    2013-07-01

    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  11. Logarithmic sensing in Bacillus subtilis aerotaxis.

    Science.gov (United States)

    Menolascina, Filippo; Rusconi, Roberto; Fernandez, Vicente I; Smriga, Steven; Aminzare, Zahra; Sontag, Eduardo D; Stocker, Roman

    2017-01-01

    Aerotaxis, the directed migration along oxygen gradients, allows many microorganisms to locate favorable oxygen concentrations. Despite oxygen's fundamental role for life, even key aspects of aerotaxis remain poorly understood. In Bacillus subtilis, for example, there is conflicting evidence of whether migration occurs to the maximal oxygen concentration available or to an optimal intermediate one, and how aerotaxis can be maintained over a broad range of conditions. Using precisely controlled oxygen gradients in a microfluidic device, spanning the full spectrum of conditions from quasi-anoxic to oxic (60 n mol/l-1 m mol/l), we resolved B. subtilis' 'oxygen preference conundrum' by demonstrating consistent migration towards maximum oxygen concentrations ('monotonic aerotaxis'). Surprisingly, the strength of aerotaxis was largely unchanged over three decades in oxygen concentration (131 n mol/l-196 μ mol/l). We discovered that in this range B. subtilis responds to the logarithm of the oxygen concentration gradient, a rescaling strategy called 'log-sensing' that affords organisms high sensitivity over a wide range of conditions. In these experiments, high-throughput single-cell imaging yielded the best signal-to-noise ratio of any microbial taxis study to date, enabling the robust identification of the first mathematical model for aerotaxis among a broad class of alternative models. The model passed the stringent test of predicting the transient aerotactic response despite being developed on steady-state data, and quantitatively captures both monotonic aerotaxis and log-sensing. Taken together, these results shed new light on the oxygen-seeking capabilities of B. subtilis and provide a blueprint for the quantitative investigation of the many other forms of microbial taxis.

  12. The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

    Science.gov (United States)

    Boyd, D A; Mulvey, M R

    2013-02-01

    To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

  13. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie

    1991-01-01

    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  14. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Elasri, Mohamed O

    2014-06-11

    Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

  15. Cloning of the Bacillus subtilis recE+ gene and functional expression of recE+ in B. subtilis

    International Nuclear Information System (INIS)

    Marrero, R.; Yasbin, R.E.

    1988-01-01

    By use of the Bacillus subtilis bacteriophage cloning vehicle Phi 105J23, B. subtilis chromosomal MboI fragments have been cloned that alleviate the pleiotropic effects of the recE4 mutation. The recombinant bacteriophages Phi 105Rec Phi1 (3.85-kilobase insert) and Phi 105Rec Phi4 (3.3-kilobase insert) both conferred on the recE4 strain YB1015 resistance to ethylmethane sulfonate, methylmethane sulfonate, mitomycin C, and UV irradiation comparable with the resistance observed in recE + strains. While strain YB1015 (recE4) and its derivatives lysogenized with bacteriophage Phi105J23 were not transformed to prototrophy by B. subtilis chromosomal DNA, strain YB1015 lysogenized with either Phi 105Rec Phi 1 or Phi 105RecPhi 4 was susceptible to transformation with homologous B. subtilis chromosomal DNA. The heteroimmune prophages Phi 105 and SPO2 were essentially uninducible in strain YB1015. Significantly, both recombinant prophages Phi 105RecPhi 1 and Phi 105Rec Phi 4 were fully inducible and allowed the spontaneous and mitomycin C-dependent induction of a coresident SPO2 prophage in a recE4 host. The presence of the recombinant prophages also restored the ability of din genes to be induced in strains carrying the recE4 mutation. Finally, both recombinant bacteriophages elaborated a mitomycin C-inducible, 45-kilodalton protein that was immunoreactive with Escherichia coli recA + gene product antibodies. Collectively, these data demonstrate that the recE + gene has been cloned and that this gene elaborates the 45-kilodalton protein that is involved in SOB induction and homologous recombination

  16. The methionine salvage pathway in Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Danchin Antoine

    2002-04-01

    Full Text Available Abstract Background Polyamine synthesis produces methylthioadenosine, which has to be disposed of. The cell recycles it into methionine through methylthioribose (MTR. Very little was known about MTR recycling for methionine salvage in Bacillus subtilis. Results Using in silico genome analysis and transposon mutagenesis in B. subtilis we have experimentally uncovered the major steps of the dioxygen-dependent methionine salvage pathway, which, although similar to that found in Klebsiella pneumoniae, recruited for its implementation some entirely different proteins. The promoters of the genes have been identified by primer extension, and gene expression was analyzed by Northern blotting and lacZ reporter gene expression. Among the most remarkable discoveries in this pathway is the role of an analog of ribulose diphosphate carboxylase (Rubisco, the plant enzyme used in the Calvin cycle which recovers carbon dioxide from the atmosphere as a major step in MTR recycling. Conclusions A complete methionine salvage pathway exists in B. subtilis. This pathway is chemically similar to that in K. pneumoniae, but recruited different proteins to this purpose. In particular, a paralogue or Rubisco, MtnW, is used at one of the steps in the pathway. A major observation is that in the absence of MtnW, MTR becomes extremely toxic to the cell, opening an unexpected target for new antimicrobial drugs. In addition to methionine salvage, this pathway protects B. subtilis against dioxygen produced by its natural biotope, the surface of leaves (phylloplane.

  17. Bacillus subtilis Hfq: A role in chemotaxis and motility

    Indian Academy of Sciences (India)

    2016-07-16

    Jul 16, 2016 ... motility, thus assigning a new function for Hfq in B. subtilis. 1. Introduction. Hfq in ... to play a role in pathogenecity in mice, tolerance to osmotic and ethanol stress ...... in B. subtilis is characterized by events like surfactin pro- duction .... SM Cutting (New York: John Wiley and Sons Inc) pp 442–444. Nicolas P ...

  18. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Unknown

    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  19. LODO INDUSTRIAL COMO ALTERNATIVA DE MEIO DE CULTURA PARA Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Fábio Fernando de Araújo

    2006-06-01

    Full Text Available The objective of this study was to demonstrate that industrial wastewater sludge, class II, originary of alimenticeous industry, could be used as a sole raw material to sustain growth of Bacillus subtilis. The growth of one strain of Bacillus subtilis (AP-3, antagonist of phytopathogens, was evaluated in culture media based in diluitions with differents concentrations of sludge obtained in biologicals treatments of wastewater. The sludge showed concentration of organic components in 76,5% that contributed for growth and survival of B. subtilis. The dose of sludge (20% p/v evaluated was satisfactory para growth of bacteria. Nutrient enrichement did not increased growth of B. subtilis in media with sludge. Culture media based in industrial sludge evaluated would be indicated with of big potential for use large scale.

  20. Antioxidation, angiotensin converting enzyme inhibition activity, nattokinase, and antihypertension of Bacillus subtilis (natto)-fermented pigeon pea

    OpenAIRE

    Bao-Hong Lee; Yi-Syuan Lai; She-Ching Wu

    2015-01-01

    Because of the high incidence of cardiovascular diseases in Asian countries, traditional fermented foods from Asia have been increasingly investigated for antiatherosclerotic effects. This study investigated the production of nattokinase, a serine fibrinolytic enzyme, in pigeon pea by Bacillus subtilis fermentation. B. subtilis 14714, B. subtilis 14715, B. subtilis 14716, and B. subtilis 14718 were employed to produce nattokinase. The highest nattokinase activity in pigeon pea was obtained us...

  1. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  2. The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

    2014-01-01

    Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

  3. Evaluation of in situ valine production by Bacillus subtilis in young pigs.

    Science.gov (United States)

    Nørgaard, J V; Canibe, N; Soumeh, E A; Jensen, B B; Nielsen, B; Derkx, P; Cantor, M D; Blaabjerg, K; Poulsen, H D

    2016-11-01

    Mutants of Bacillus subtilis can be developed to overproduce Val in vitro. It was hypothesized that addition of Bacillus subtilis mutants to pig diets can be a strategy to supply the animal with Val. The objective was to investigate the effect of Bacillus subtilis mutants on growth performance and blood amino acid (AA) concentrations when fed to piglets. Experiment 1 included 18 pigs (15.0±1.1 kg) fed one of three diets containing either 0.63 or 0.69 standardized ileal digestible (SID) Val : Lys, or 0.63 SID Val : Lys supplemented with a Bacillus subtilis mutant (mutant 1). Blood samples were obtained 0.5 h before feeding and at 1, 2, 3, 4, 5 and 6 h after feeding and analyzed for AAs. In Experiment 2, 80 piglets (9.1±1.1 kg) were fed one of four diets containing 0.63 or 0.67 SID Val : Lys, or 0.63 SID Val : Lys supplemented with another Bacillus subtilis mutant (mutant 2) or its parent wild type. Average daily feed intake, daily weight gain and feed conversion ratio were measured on days 7, 14 and 21. On day 17, blood samples were taken and analyzed for AAs. On days 24 to 26, six pigs from each dietary treatment were fitted with a permanent jugular vein catheter, and blood samples were taken for AA analysis 0.5 h before feeding and at 1, 2, 3, 4, 5 and 6 h after feeding. In experiment 1, Bacillus subtilis mutant 1 tended (PBacillus subtilis mutant 2 and the wild type did not result in a growth performance different from the negative and positive controls. In conclusion, results obtained with the mutant strains of Bacillus subtilis were not better than results obtained with the wild-type strain, and for both strains, the results were not different than the negative control.

  4. The Global Regulator Spx Functions in the Control of Organosulfur Metabolism in Bacillus subtilis†

    Science.gov (United States)

    Choi, Soon-Yong; Reyes, Dindo; Leelakriangsak, Montira; Zuber, Peter

    2006-01-01

    Spx is a global transcriptional regulator of the oxidative stress response in Bacillus subtilis. Its target is RNA polymerase, where it contacts the α subunit C-terminal domain. Recently, evidence was presented that Spx participates in sulfate-dependent control of organosulfur utilization operons, including the ytmI, yxeI, ssu, and yrrT operons. The yrrT operon includes the genes that function in cysteine synthesis from S-adenosylmethionine through intermediates S-adenosylhomocysteine, ribosylhomocysteine, homocysteine, and cystathionine. These operons are also negatively controlled by CymR, the repressor of cysteine biosynthesis operons. All of the operons are repressed in media containing cysteine or sulfate but are derepressed in medium containing the alternative sulfur source, methionine. Spx was found to negatively control the expression of these operons in sulfate medium, in part, by stimulating the expression of the cymR gene. In addition, microarray analysis, monitoring of yrrT-lacZ fusion expression, and in vitro transcription studies indicate that Spx directly activates yrrT operon expression during growth in medium containing methionine as sole sulfur source. These experiments have uncovered additional roles for Spx in the control of gene expression during unperturbed, steady-state growth. PMID:16885442

  5. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  6. Advances and prospects of Bacillus subtilis cellular factories: From rational design to industrial applications.

    Science.gov (United States)

    Gu, Yang; Xu, Xianhao; Wu, Yaokang; Niu, Tengfei; Liu, Yanfeng; Li, Jianghua; Du, Guocheng; Liu, Long

    2018-05-15

    Bacillus subtilis is the most characterized gram-positive bacterium that has significant attributes, such as growing well on cheap carbon sources, possessing clear inherited backgrounds, having mature genetic manipulation methods, and exhibiting robustness in large-scale fermentations. Till date, B. subtilis has been identified as attractive hosts for the production of recombinant proteins and chemicals. By applying various systems and synthetic biology tools, the productivity features of B. subtilis can be thoroughly analyzed and further optimized via metabolic engineering. In the present review, we discussed why B. subtilis is the primary organisms used for metabolic engineering and industrial applications. Additionally, we summarized the recent advances in systems and synthetic biology, engineering strategies for improving cellular performances, and metabolic engineering applications of B. subtilis. In particular, we proposed emerging opportunities and essential strategies to enable the successful development of B. subtilis as microbial cell factories. Copyright © 2018. Published by Elsevier Inc.

  7. ZnO Nanoparticles Affect Bacillus subtilis Cell Growth and Biofilm Formation.

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    Full Text Available Zinc oxide nanoparticles (ZnO NPs are an important antimicrobial additive in many industrial applications. However, mass-produced ZnO NPs are ultimately disposed of in the environment, which can threaten soil-dwelling microorganisms that play important roles in biodegradation, nutrient recycling, plant protection, and ecological balance. This study sought to understand how ZnO NPs affect Bacillus subtilis, a plant-beneficial bacterium ubiquitously found in soil. The impact of ZnO NPs on B. subtilis growth, FtsZ ring formation, cytosolic protein activity, and biofilm formation were assessed, and our results show that B. subtilis growth is inhibited by high concentrations of ZnO NPs (≥ 50 ppm, with cells exhibiting a prolonged lag phase and delayed medial FtsZ ring formation. RedoxSensor and Phag-GFP fluorescence data further show that at ZnO-NP concentrations above 50 ppm, B. subtilis reductase activity, membrane stability, and protein expression all decrease. SDS-PAGE Stains-All staining results and FT-IR data further demonstrate that ZnO NPs negatively affect exopolysaccharide production. Moreover, it was found that B. subtilis biofilm surface structures became smooth under ZnO-NP concentrations of only 5-10 ppm, with concentrations ≤ 25 ppm significantly reducing biofilm formation activity. XANES and EXAFS spectra analysis further confirmed the presence of ZnO in co-cultured B. subtilis cells, which suggests penetration of cell membranes by either ZnO NPs or toxic Zn+ ions from ionized ZnO NPs, the latter of which may be deionized to ZnO within bacterial cells. Together, these results demonstrate that ZnO NPs can affect B. subtilis viability through the inhibition of cell growth, cytosolic protein expression, and biofilm formation, and suggest that future ZnO-NP waste management strategies would do well to mitigate the potential environmental impact engendered by the disposal of these nanoparticles.

  8. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  9. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

    Science.gov (United States)

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V

    1999-09-01

    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  10. Antagonistic action of Bacillus subtilis strain SG6 on Fusarium graminearum.

    Science.gov (United States)

    Zhao, Yueju; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhou, Lu; Wang, Yan; Song, Huimin; Tan, Xinxin; Sun, Lichao; Sangare, Lancine; Folly, Yawa Minnie Elodie; Liu, Yang

    2014-01-01

    Fusarium graminearum causes Fusarium head blight (FHB), a devastating disease that leads to extensive yield and quality loss of wheat and barley. Bacteria isolated from wheat kernels and plant anthers were screened for antagonistic activity against F. graminearum. Based on its in vitro effectiveness, strain SG6 was selected for characterization and identified as Bacillus subtilis. B. subtilis SG6 exhibited a high antifungal effect on the mycelium growth, sporulation and DON production of F. graminearum with the inhibition rate of 87.9%, 95.6% and 100%, respectively. In order to gain insight into biological control effect in situ, we applied B. subtilis SG6 at anthesis through the soft dough stage of kernel development in field test. It was revealed that B. subtilis SG6 significantly reduced disease incidence (DI), FHB index and DON (P ≤ 0.05). Further, ultrastructural examination shows that B. subtilis SG6 strain induced stripping of F. graminearum hyphal surface by destroying the cellular structure. When hypha cell wall was damaged, the organelles and cytoplasm inside cell would exude, leading to cell death. The antifungal activity of SG6 could be associated with the coproduction of chitinase, fengycins and surfactins.

  11. Antagonistic action of Bacillus subtilis strain SG6 on Fusarium graminearum.

    Directory of Open Access Journals (Sweden)

    Yueju Zhao

    Full Text Available Fusarium graminearum causes Fusarium head blight (FHB, a devastating disease that leads to extensive yield and quality loss of wheat and barley. Bacteria isolated from wheat kernels and plant anthers were screened for antagonistic activity against F. graminearum. Based on its in vitro effectiveness, strain SG6 was selected for characterization and identified as Bacillus subtilis. B. subtilis SG6 exhibited a high antifungal effect on the mycelium growth, sporulation and DON production of F. graminearum with the inhibition rate of 87.9%, 95.6% and 100%, respectively. In order to gain insight into biological control effect in situ, we applied B. subtilis SG6 at anthesis through the soft dough stage of kernel development in field test. It was revealed that B. subtilis SG6 significantly reduced disease incidence (DI, FHB index and DON (P ≤ 0.05. Further, ultrastructural examination shows that B. subtilis SG6 strain induced stripping of F. graminearum hyphal surface by destroying the cellular structure. When hypha cell wall was damaged, the organelles and cytoplasm inside cell would exude, leading to cell death. The antifungal activity of SG6 could be associated with the coproduction of chitinase, fengycins and surfactins.

  12. Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

    Science.gov (United States)

    Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

    2016-01-01

    An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

  13. Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

    Science.gov (United States)

    Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

    2014-01-01

    Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

  14. Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

    Science.gov (United States)

    Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

    2014-01-01

    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  15. Molecular mechanisms involved in Bacillus subtilis biofilm formation

    Science.gov (United States)

    Mielich-Süss, Benjamin; Lopez, Daniel

    2014-01-01

    Summary Biofilms are the predominant lifestyle of bacteria in natural environments, and they severely impact our societies in many different fashions. Therefore, biofilm formation is a topic of growing interest in microbiology, and different bacterial models are currently studied to better understand the molecular strategies that bacteria undergo to build biofilms. Among those, biofilms of the soil-dwelling bacterium Bacillus subtilis are commonly used for this purpose. Bacillus subtilis biofilms show remarkable architectural features that are a consequence of sophisticated programs of cellular specialization and cell-cell communication within the community. Many laboratories are trying to unravel the biological role of the morphological features of biofilms, as well as exploring the molecular basis underlying cellular differentiation. In this review, we present a general perspective of the current state of knowledge of biofilm formation in B. subtilis. In particular, a special emphasis is placed on summarizing the most recent discoveries in the field and integrating them into the general view of these truly sophisticated microbial communities. PMID:24909922

  16. Construction of acetoin high-producing Bacillus subtilis strain

    Directory of Open Access Journals (Sweden)

    Yanjun Tian

    2016-07-01

    Full Text Available This paper describes the construction and selection of a high-producing mutant, Bacillus subtilis HB-32, with enhanced acetoin yield and productivity. The mutant was obtained by the protoplast fusion of a Bacillus subtilis mutant TH-49 (Val− producing acetoin and Bacillus licheniformis AD-30 producing α-acetolactate decarboxylase, with the fusogen polyethylene glycol and after the regeneration and selection, etc. of the fusant. The acetoin production reached 49.64 g/L, which is an increase of 61.8% compared to that of B. subtilis strain TH-49. Random amplified polymorphic DNA analysis was performed to determine the mutagenic and protoplast fusion effects and the genomic changes in the acetoin high-producing strain compared to the parent strains at the molecular level. The constructed strain was shown to be promising for large-scale acetoin production. Future studies should focus on the application of the mutant strain in practice.

  17. Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

    Science.gov (United States)

    Ray, Sujay; Banerjee, Arundhati

    2015-10-01

    Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

  18. A magnesium-dependent mreB null mutant: implications for the role of mreB in Bacillus subtilis.

    Science.gov (United States)

    Formstone, Alex; Errington, Jeffery

    2005-03-01

    MreB shares a common prokaryotic ancestor with actin and is present in almost all rod-shaped bacteria. MreB proteins have been implicated in a range of important cell processes, including cell morphogenesis, chromosome segregation and cell polarity. The mreB gene frequently lies at the beginning of a cluster of genes, immediately upstream of the conserved mreC and mreD genes. RNA analysis showed that in Bacillus subtilis mreB is co-transcribed with mreC and that these genes form part of an operon under the control of a promoter(s) upstream of mreB. Construction of an in-frame deletion of mreB and its complementation by mreB(+) only, in trans, established that the gene is important for maintenance of cell width and cell viability under normal growth conditions, independent of polar effects on downstream genes. Remarkably, virtually normal growth was restored to the mreB null mutant in the presence of high concentrations of magnesium, especially when high concentrations of the osmoprotectant, sucrose were also present. Under these conditions, cells could be maintained in the complete absence of an mreB gene, with almost normal morphology. No detectable effect on chromosome segregation was evident in the mutant, nor was there an effect on the topology of nascent peptidoglycan insertion. A GFP-MreB fusion was used to look at the localization of MreB in live cells. The pattern of localization was similar to that previously described, but no tight linkage to nucleoid positioning was evident. Propagation of the mreB null mutant in the absence of magnesium and sucrose led to a progressive increase in cell width, culminating in cell lysis. Cell division was also perturbed but this effect may be secondary to the disturbance in cell width. These results suggest that the major role of MreB in B. subtilis lies in the control of cell diameter.

  19. Evaluation of in situ valine production by Bacillus subtilis in young pigs

    DEFF Research Database (Denmark)

    Nørgaard, Jan Værum; Canibe, Nuria; Assadi Soumeh, Elham

    2016-01-01

    Mutants of Bacillus subtilis can be developed to overproduce Val in vitro. It was hypothesized that addition of Bacillus subtilis mutants to pig diets can be a strategy to supply the animal with Val. The objective was to investigate the effect of Bacillus subtilis mutants on growth performance...... and blood amino acid (AA) concentrations when fed to piglets. Experiment 1 included 18 pigs (15.0±1.1 kg) fed one of three diets containing either 0.63 or 0.69 standardized ileal digestible (SID) Val : Lys, or 0.63 SID Val : Lys supplemented with a Bacillus subtilis mutant (mutant 1). Blood samples were...... obtained 0.5 h before feeding and at 1, 2, 3, 4, 5 and 6 h after feeding and analyzed for AAs. In Experiment 2, 80 piglets (9.1±1.1 kg) were fed one of four diets containing 0.63 or 0.67 SID Val : Lys, or 0.63 SID Val : Lys supplemented with another Bacillus subtilis mutant (mutant 2) or its parent wild...

  20. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Science.gov (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  1. Inducible error-prone repair in B. subtilis. Progress report, September 1, 1979-February 28, 1981

    International Nuclear Information System (INIS)

    Yasbin, R.E.

    1980-10-01

    The mechanism of activation and the mode of action of the SOS system in Bacillus subtilis are being investigated. Interesting aspects of the SOS system in B. subtilis include: (1) the differences between the SOS functions in this bacterium and in the enteric bacteria; (2) the spontaneous activation of SOS functions in competent cells; and (3) the difficulty in establishing the presence of error-prone repair in this bacterium. In order to characterize the SOS system of B. subtilis, attempts will be made to: (1) isolate bacteria mutated in genes controlling various repair functions; (2) investigate inducible repair; (3) determine the role of endogenous prophages in DNA repair phenomena; and (4) utilize competent B. subtilis as a tester system for the detection of potential carcinogens. Data obtained during the past 18 months demonstrate: (1) the ability of the B. subtilis Comptest to detect potential environmental carcinogens; (2) the importance of DNA polymerase III in W-reactivation in B. subtilis; and (3) the control the bacteriophage SPβ has over the inducible DNA modification system in B. subtilis. Furthermore, the data also suggests the lack of error-prone repair in B. subtilis, and the differences which exist between the Bacilli and the enteric bacteria with regards to SOS phenomena. In order to further characterize inducible repair functions in B. subtilis, results will also be presented on attempts to mobilize error-prone repair systems of other bacterial species

  2. Inducible error-prone repair in B. subtilis. Progress report, September 1, 1978-August 31, 1979

    International Nuclear Information System (INIS)

    Yasbin, R.E.

    1979-01-01

    The mechanism of activation and the mode of action of the SOS system in the bacterium Bacillus subtilis is under study. Interesting aspects of the SOS system in B. subtilis are: (1) the differences between SOS functions in this bacterium and in the enteric bacteria; (2) the spontaneous activation of SOS functions in component cells; and (3) the difficulty in obtaining consistent results for mutation studies in this bacterium. In order to characterize the SOS system of B. subtilis, it was proposed to: (1) isolate bacteria mutated in genes controlling various repair function; (2) investigate inducible repair; (3) determine the role of endogeneous Bacillus prophages in SOS functions; and (4) develop a tester system for potential carcinogens from competent Bacillus subtilis cells. Research has been able to: (1) isolate strains of B. subtilis in which the endogeneous prophages have been removed or neutralized; (2) demonstrate the association of one SOS function with prophage SPB; (3) demonstrate that the survival of uv-irradiated B. subtilis is not significantly altered by the removal and neutralization of the endogeneous prophages; (4) develop competant B. subtilis into a tester system; and (5) show that DNA polymerase III is absolutely necessary for W reactivation. In addition, uv and mitomycin C resistant mutants have been isolated and inducible postreplication repair in excision-repair deficient mutants of B. subtilis has been studied. The last two results are somewaht confusing but highly exciting in regards to DNA repair mechanisms in B. subtilis

  3. Fast neutron radiation inactivation of Bacillus subtilis: Absorbed dose determination

    International Nuclear Information System (INIS)

    Song Lingli; Zheng Chun; Ai Zihui; Li Junjie; Dai Shaofeng

    2011-01-01

    In this paper, fast neutron inactivation effects of Bacillus subtilis were investigated with fission fast neutrons from CFBR-II reactor of INPC (Institute of Nuclear Physics and Chemistry) and mono-energetic neutrons from the Van de Graaff accelerator at Peking University. The method for determining the absorbed dose in the Bacillus subtilis suspension contained in test tubes is introduced. The absorbed dose, on account of its dependence on the volume and the form of confined state, was determined by combined experiments and Monte Carlo method. Using the calculation results of absorbed dose, the fast neutron inactivation effects on Bacillus subtilis were studied. The survival rates and absorbed dose curve was constructed. (authors)

  4. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

    Science.gov (United States)

    Pérez-Oseguera, Angeles; Cevallos, Miguel A

    2013-11-01

    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

    Directory of Open Access Journals (Sweden)

    Terezinha Knöbl

    2006-06-01

    Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

  6. Co-production of surfactin and a novel bacteriocin by Bacillus subtilis subsp. subtilis H4 isolated from bikalga, an African alkaline Hibiscus sabdariffa seed fermented condiment

    DEFF Research Database (Denmark)

    Compaore, C. S.; Nielsen, Dennis S.; Ouoba, L. I. I.

    2013-01-01

    inhibited in the agar spot assay while only Gram-positive pathogens were inhibited in the agar well diffusion assay. Cell free supernatants (CFS) of pure cultures of 3 B. subtilis subsp. subtilis (G2, H4 and F1) strains inhibited growth of Listeria monocytogenes, Micrococcus luteus, Staphylococcus aureus...

  7. Genetic transformation of Bacillus strains close to bacillus subtilis and isolated from the soil

    International Nuclear Information System (INIS)

    Van, C.K.; Kuzin, Yu.Yu.; Kozlovskii, Yu.E.; Prozorov, A.A.

    1986-01-01

    Chromosomal and plasmid transformation was found in five out of 118 Bacillus strains, close or identical to Bacillus subtilis, and isolated from soil in Moscow or in the Moscow district. The efficiency of transformation in these strains was lower than that in derivatives of Bac. subtilis strain 168. In these strains the ability to undergo transformation was dependent on the rate of sporulation and the presence of restrictases. As in the case of Bac. subtilis 168 the strains isolated may be used as models in genetic transformation studies on Bac. subtilis

  8. Inhibition of Cell Differentiation in Bacillus subtilis by Pseudomonas protegens

    Science.gov (United States)

    Powers, Matthew J.; Sanabria-Valentín, Edgardo; Bowers, Albert A.

    2015-01-01

    ABSTRACT Interspecies interactions have been described for numerous bacterial systems, leading to the identification of chemical compounds that impact bacterial physiology and differentiation for processes such as biofilm formation. Here, we identified soil microbes that inhibit biofilm formation and sporulation in the common soil bacterium Bacillus subtilis. We did so by creating a reporter strain that fluoresces when the transcription of a biofilm-specific gene is repressed. Using this reporter in a coculture screen, we identified Pseudomonas putida and Pseudomonas protegens as bacteria that secrete compounds that inhibit biofilm gene expression in B. subtilis. The active compound produced by P. protegens was identified as the antibiotic and antifungal molecule 2,4-diacetylphloroglucinol (DAPG). Colonies of B. subtilis grown adjacent to a DAPG-producing P. protegens strain had altered colony morphologies relative to B. subtilis colonies grown next to a DAPG-null P. protegens strain (phlD strain). Using a subinhibitory concentration of purified DAPG in a pellicle assay, we saw that biofilm-specific gene transcription was delayed relative to transcription in untreated samples. These transcriptional changes also corresponded to phenotypic alterations: both biofilm biomass and spore formation were reduced in B. subtilis liquid cultures treated with subinhibitory concentrations of DAPG. Our results add DAPG to the growing list of antibiotics that impact bacterial development and physiology at subinhibitory concentrations. These findings also demonstrate the utility of using coculture as a means to uncover chemically mediated interspecies interactions between bacteria. IMPORTANCE Biofilms are communities of bacteria adhered to surfaces by an extracellular matrix; such biofilms can have important effects in both clinical and agricultural settings. To identify chemical compounds that inhibited biofilm formation, we used a fluorescent reporter to screen for bacteria that

  9. Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

    International Nuclear Information System (INIS)

    Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

    1988-01-01

    The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

  10. Bacillus subtilis generates a major specific deletion in pAM beta 1.

    OpenAIRE

    van der Lelie, D; Venema, G

    1987-01-01

    pAM beta 1, a 26.5-kilobase plasmid originally isolated from Streptococcus faecalis, was conjugally transferred from Streptococcus lactis to Bacillus subtilis. No conjugal transfer of pAM beta 1 from B. subtilis to S. lactis was observed. In addition, pAM beta 1 which had been reintroduced in S. lactis after cycling through B. subtilis had lost its conjugal transferability to Streptococcus cremoris, although under the same conditions noncycled pAM beta 1 was transferred at high efficiency. Re...

  11. Assembly properties of the Bacillus subtilis actin, MreB.

    Science.gov (United States)

    Mayer, Joshua A; Amann, Kurt J

    2009-02-01

    The bacterial actin MreB has been implicated in a variety of cellular roles including cell shape determination, cell wall synthesis, chromosome condensation and segregation, and the establishment and maintenance of cell polarity. Toward elucidating a clearer understanding of how MreB functions inside the bacterial cell, we investigated biochemically the polymerization of MreB from Bacillus subtilis. Light scattering and sedimentation assays revealed pH-, ionic-, cationic-, and temperature-dependent behavior. B. subtilis MreB polymerizes in the presence of millimolar divalent cations in a protein concentration-dependent manner. Polymerization is favored by decreasing pH and inhibited by monovalent salts and low temperatures. Although B. subtilis MreB binds and hydrolyzes both ATP and GTP, it does not require a bound nucleotide for assembly and polymerizes indistinguishably regardless of the nucleotide species bound, with a critical concentration of approximately 900 nM. A number of the presently reported properties of B. subtilis MreB differ significantly from those of T. maritima MreB1 (Bean and Amann [2008]: Biochemistry 47: 826-835), including the nucleotide requirements and temperature and ionic effects on polymerization state. These observations collectively suggest that additional factors interact with MreB to account for its complex dynamic behavior in cells.

  12. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

    Science.gov (United States)

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

  13. Production of Bioactive Compounds by Bacillus subtilis against Sclerotium rolfsii

    Directory of Open Access Journals (Sweden)

    Nalisha, I.

    2006-01-01

    Full Text Available This study aims to investigate the characteristic of bioactive compound produced by Bacillus subtilis against Sclerotium rolfsii and the influence of additive supplements on the antagonistic activity of B. subtilis. The fact that B. subtilis produced an antifungal substance which has inhibitory effect on wide range of fungi, including S. rolfsii, is well known. To learn the effect of pH, temperature and light condition on the production of antifungal compound, B. subtilis was inoculated in Potato Dextrose Broth at various initial pH, temperatures and light conditions, respectively. This antagonist was found to produce antifungal compound that stable at 80C with 58.3 % inhibition on S. rolfsii. The activity was constant within a wide range of pH (3–11. However, treatment with pH11 lead to higher antifungal activity (31.57 % inhibition and it was also found to produce substance that can endure dark condition (46.24 % inhibition with fungicidal effect on S. rolfsii. A series of experiments also been carried out to enhance the antifungal production by supplementing different carbon source preparation into bacterial liquid culture. B. subtilis were grown in minimal medium containing 1 % of oil palm root, Ganoderma lucidum or chitin, respectively prior to bioassay. Crude culture from oil palm root supplemented culture shown significantly reduction in S. rolfsii growth compared to other carbon source crude culture or the antagonism alone, suggesting that this approach may provide improved biocontrol efficiency.

  14. Study of UV-mutagenesis in Bacillus subtilis

    International Nuclear Information System (INIS)

    Lotareva, O.V.; Filippov, V.D.

    1974-01-01

    The sensitivity of Bac. subtilis to the inactivating and mutagenic effects of UV-mutants has been determined: uvr, which does not extract pyrimidine dimers from damaged DNA; recsub(x), which exhibits a reduced activity of ATP-dependent DNAase; poll, which is devoid of DNA polymerase, and wild strains (DT). The sensitivity of these strains to the inactivating effects of UV rays increases in the order: DT<= recsub(x) << uvr < poll, and UV mutability in the order: DT = rec(sub(x) < poll<< uvr. A comparison of UV mutagenesis in Bac. subtilis and E. coli suggests the hypothesis that the mechanisms of UV mutation formation are similar in these two organisms. (author)

  15. Cloning of the Bacillus subtilis recE/sup +/ gene and functional expression of recE/sup +/ in B. subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Marrero, R.; Yasbin, R.E.

    1988-01-01

    By use of the Bacillus subtilis bacteriophage cloning vehicle Phi 105J23, B. subtilis chromosomal MboI fragments have been cloned that alleviate the pleiotropic effects of the recE4 mutation. The recombinant bacteriophages Phi 105Rec Phi1 (3.85-kilobase insert) and Phi 105Rec Phi4 (3.3-kilobase insert) both conferred on the recE4 strain YB1015 resistance to ethylmethane sulfonate, methylmethane sulfonate, mitomycin C, and UV irradiation comparable with the resistance observed in recE/sup +/ strains. While strain YB1015 (recE4) and its derivatives lysogenized with bacteriophage Phi105J23 were not transformed to prototrophy by B. subtilis chromosomal DNA, strain YB1015 lysogenized with either Phi 105Rec Phi 1 or Phi 105RecPhi 4 was susceptible to transformation with homologous B. subtilis chromosomal DNA. The heteroimmune prophages Phi 105 and SPO2 were essentially uninducible in strain YB1015. Significantly, both recombinant prophages Phi 105RecPhi 1 and Phi 105Rec Phi 4 were fully inducible and allowed the spontaneous and mitomycin C-dependent induction of a coresident SPO2 prophage in a recE4 host. The presence of the recombinant prophages also restored the ability of din genes to be induced in strains carrying the recE4 mutation. Finally, both recombinant bacteriophages elaborated a mitomycin C-inducible, 45-kilodalton protein that was immunoreactive with Escherichia coli recA/sup +/ gene product antibodies. Collectively, these data demonstrate that the recE/sup +/ gene has been cloned and that this gene elaborates the 45-kilodalton protein that is involved in SOB induction and homologous recombination.

  16. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  17. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

    Science.gov (United States)

    Chowdhury, Nilkanta; Bagchi, Angshuman

    2017-07-01

    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  18. Fitness Trade-Offs in Competence Differentiation of Bacillus subtilis

    OpenAIRE

    Yüksel, Melih; Power, Jeffrey J.; Ribbe, Jan; Volkmann, Thorsten; Maier, Berenike

    2016-01-01

    In the stationary phase, Bacillus subtilis differentiates stochastically and transiently into the state of competence for transformation (K-state). The latter is associated with growth arrest, and it is unclear how the ability to develop competence is stably maintained, despite its cost. To quantify the effect differentiation has on the competitive fitness of B. subtilis, we characterized the competition dynamics between strains with different probabilities of entering the K-state. The relati...

  19. Effect of decoyinine on the regulation of alpha-amylase synthesis in Bacillus subtilis.

    OpenAIRE

    Nicholson, W L; Chambliss, G H

    1987-01-01

    Decoyinine, an inhibitor of GMP synthetase, allows sporulation in Bacillus subtilis to initiate and proceed under otherwise catabolite-repressing conditions. The effect of decoyinine on alpha-amylase synthesis in B. subtilis, an event which exhibits regulatory features resembling sporulation initiation, was examined. Decoyinine did not overcome catabolite repression of alpha-amylase synthesis in a wild-type strain of B. subtilis but did cause premature and enhanced synthesis in a mutant strai...

  20. Effect of Bacillus subtilis mutants on growth performance of piglets fed tryptophan- and valine-deficient diets

    DEFF Research Database (Denmark)

    Nørgaard, Jan Værum; Canibe, Nuria; Assadi Soumeh, Elham

    2016-01-01

    The objective was to determine the concentration of l-Trp and l-Val to be substituted by feeding piglets Bacillus subtilis strains developed to overproduce Trp (B. subtilis Trp mutant [BsTrp]) and Val (B. subtilis Val mutant [BsVal]) and by using equations obtained in 3 dose–response studies......-Val per kilogram feed using curvilinear plateau and broken-line equations obtained by modeling the 6 AA levels. Bacillus subtilis Val mutant increased animal performance corresponding to 0.88 and 0.39 g l-Leu and 0.17 and 0.44 g l-Val per kilogram feed for 10x and 100x doses, respectively. Bacillus...... subtilis Trp mutant was equivalent to 0.02 and 0.11 g l-Trp/kg feed for 10x and 100x doses, respectively. Bacillus subtilis Val mutant (10x dose) increased (P Bacillus subtilis Trp mutant tended (P = 0.06) to increase Trp plasma concentrations...

  1. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

    Science.gov (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

    2018-01-01

    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  2. Antioxidation, angiotensin converting enzyme inhibition activity, nattokinase, and antihypertension of Bacillus subtilis (natto)-fermented pigeon pea.

    Science.gov (United States)

    Lee, Bao-Hong; Lai, Yi-Syuan; Wu, She-Ching

    2015-12-01

    Because of the high incidence of cardiovascular diseases in Asian countries, traditional fermented foods from Asia have been increasingly investigated for antiatherosclerotic effects. This study investigated the production of nattokinase, a serine fibrinolytic enzyme, in pigeon pea by Bacillus subtilis fermentation. B. subtilis 14714, B. subtilis 14715, B. subtilis 14716, and B. subtilis 14718 were employed to produce nattokinase. The highest nattokinase activity in pigeon pea was obtained using B. subtilis 14715 fermentation for 32 hours. In addition, the levels of antioxidants (phenolics and flavonoids) and angiotensin converting enzyme inhibitory activity were increased in B. subtilis 14715-fermented pigeon pea, compared with those in nonfermented pigeon pea. In an animal model, we found that both water extracts of pigeon pea (100 mg/kg body weight) and water extracts of B. subtilis-fermented pigeon pea (100 mg/kg body weight) significantly improved systolic blood pressure (21 mmHg) and diastolic blood pressure (30 mmHg) in spontaneously hypertensive rats. These results suggest that Bacillus-fermented pigeon pea has benefits for cardiovascular health and can be developed as a new dietary supplement or functional food that prevents hypertension. Copyright © 2015. Published by Elsevier B.V.

  3. Antioxidation, angiotensin converting enzyme inhibition activity, nattokinase, and antihypertension of Bacillus subtilis (natto-fermented pigeon pea

    Directory of Open Access Journals (Sweden)

    Bao-Hong Lee

    2015-12-01

    Full Text Available Because of the high incidence of cardiovascular diseases in Asian countries, traditional fermented foods from Asia have been increasingly investigated for antiatherosclerotic effects. This study investigated the production of nattokinase, a serine fibrinolytic enzyme, in pigeon pea by Bacillus subtilis fermentation. B. subtilis 14714, B. subtilis 14715, B. subtilis 14716, and B. subtilis 14718 were employed to produce nattokinase. The highest nattokinase activity in pigeon pea was obtained using B. subtilis 14715 fermentation for 32 hours. In addition, the levels of antioxidants (phenolics and flavonoids and angiotensin converting enzyme inhibitory activity were increased in B. subtilis 14715-fermented pigeon pea, compared with those in nonfermented pigeon pea. In an animal model, we found that both water extracts of pigeon pea (100 mg/kg body weight and water extracts of B. subtilis-fermented pigeon pea (100 mg/kg body weight significantly improved systolic blood pressure (21 mmHg and diastolic blood pressure (30 mmHg in spontaneously hypertensive rats. These results suggest that Bacillus-fermented pigeon pea has benefits for cardiovascular health and can be developed as a new dietary supplement or functional food that prevents hypertension.

  4. Fungal Competitors Affect Production of Antimicrobial Lipopeptides in Bacillus subtilis Strain B9-5.

    Science.gov (United States)

    DeFilippi, Stefanie; Groulx, Emma; Megalla, Merna; Mohamed, Rowida; Avis, Tyler J

    2018-04-01

    Bacillus subtilis has shown success in antagonizing plant pathogens where strains of the bacterium produce antimicrobial cyclic lipopeptides (CLPs) in response to microbial competitors in their ecological niche. To gain insight into the inhibitory role of these CLPs, B. subtilis strain B9-5 was co-cultured with three pathogenic fungi. Inhibition of mycelial growth and spore germination was assessed and CLPs produced by B. subtilis B9-5 were quantified over the entire period of microbial interaction. B. subtilis B9-5 significantly inhibited mycelial growth and spore germination of Fusarium sambucinum and Verticillium dahliae, but not Rhizopus stolonifer. LC-MS analysis revealed that B. subtilis differentially produced fengycin and surfactin homologs depending on the competitor. CLP quantification suggested that the presence of Verticillium dahliae, a fungus highly sensitive to the compounds, caused an increase followed by a decrease in CLP production by the bacterium. In co-cultures with Fusarium sambucinum, a moderately sensitive fungus, CLP production increased more gradually, possibly because of its slower rate of spore germination. With co-cultures of the tolerant fungus Rhizopus stolonifer, B. subtilis produced high amounts of CLPs (per bacterial cell) for the duration of the interaction. Variations in CLP production could be explained, in part, by the pathogens' overall sensitivities to the bacterial lipopeptides and/or the relative growth rates between the plant pathogen and B. subtilis. CLP production varied substantially temporally depending on the targeted fungus, which provides valuable insight concerning the effectiveness of B. subtilis B9-5 protecting its ecological niche against the ingress of these pathogens.

  5. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

    Science.gov (United States)

    Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

    2014-12-01

    The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

  6. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Phosphatases modulate the bistable sporulation gene expression pattern in Bacillus subtilis

    NARCIS (Netherlands)

    Veening, JW; Hamoen, LW; Kuipers, OP

    Spore formation in the Gram- positive bacterium Bacillus subtilis is a last resort adaptive response to starvation. To initiate sporulation, the key regulator in this process, Spo0A, needs to be activated by the so-called phosphorelay. Within a sporulating culture of B. subtilis, some cells initiate

  8. An Exogenous Surfactant-Producing Bacillus subtilis Facilitates Indigenous Microbial Enhanced Oil Recovery.

    Science.gov (United States)

    Gao, Peike; Li, Guoqiang; Li, Yanshu; Li, Yan; Tian, Huimei; Wang, Yansen; Zhou, Jiefang; Ma, Ting

    2016-01-01

    This study used an exogenous lipopeptide-producing Bacillus subtilis to strengthen the indigenous microbial enhanced oil recovery (IMEOR) process in a water-flooded reservoir in the laboratory. The microbial processes and driving mechanisms were investigated in terms of the changes in oil properties and the interplay between the exogenous B. subtilis and indigenous microbial populations. The exogenous B. subtilis is a lipopeptide producer, with a short growth cycle and no oil-degrading ability. The B. subtilis facilitates the IMEOR process through improving oil emulsification and accelerating microbial growth with oil as the carbon source. Microbial community studies using quantitative PCR and high-throughput sequencing revealed that the exogenous B. subtilis could live together with reservoir microbial populations, and did not exert an observable inhibitory effect on the indigenous microbial populations during nutrient stimulation. Core-flooding tests showed that the combined exogenous and indigenous microbial flooding increased oil displacement efficiency by 16.71%, compared with 7.59% in the control where only nutrients were added, demonstrating the application potential in enhanced oil recovery in water-flooded reservoirs, in particular, for reservoirs where IMEOR treatment cannot effectively improve oil recovery.

  9. Dynamics and bistability in a reduced model of the lac operon

    Science.gov (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

    2004-06-01

    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  10. Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

    Science.gov (United States)

    Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

    2014-09-01

    Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  11. The Bacillus subtilis Acyl Lipid Desaturase Is a Δ5 Desaturase

    Science.gov (United States)

    Altabe, Silvia G.; Aguilar, Pablo; Caballero, Gerardo M.; de Mendoza, Diego

    2003-01-01

    Bacillus subtilis was recently reported to synthesize unsaturated fatty acids (UFAs) with a double bond at positions Δ5, Δ7, and Δ9 (M. H. Weber, W. Klein, L. Muller, U. M. Niess, and M. A. Marahiel, Mol. Microbiol. 39:1321-1329, 2001). Since this finding would have considerable importance in the double-bond positional specificity displayed by the B. subtilis acyl lipid desaturase, we have attempted to confirm this observation. We report that the double bond of UFAs synthesized by B. subtilis is located exclusively at the Δ5 position, regardless of the growth temperature and the length chain of the fatty acids. PMID:12730185

  12. Heterologous expression of antigenic peptides in Bacillus subtilis biofilms.

    Science.gov (United States)

    Vogt, Cédric M; Schraner, Elisabeth M; Aguilar, Claudio; Eichwald, Catherine

    2016-08-11

    Numerous strategies have been developed for the display of heterologous proteins in the surface of live bacterial carriers, which can be used as vaccines, immune-modulators, cancer therapy or bioremediation. Bacterial biofilms have emerged as an interesting approach for the expression of proteins of interest. Bacillus subtilis is a well-described, endospore-forming organism that is able to form biofilms and also used as a probiotic, thus making it a suitable candidate for the display of heterologous proteins within the biofilm. Here, we describe the use of TasA, an important structural component of the biofilms formed by B. subtilis, as a genetic tool for the display of heterologous proteins. We first engineered the fusion protein TasA-mCherry and showed that was widely deployed within the B. subtilis biofilms. A significant enhancement of the expression of TasA-mCherry within the biofilm was obtained when depleting both tasA and sinR genes. We subsequently engineered fusion proteins of TasA to antigenic peptides of the E. granulosus parasite, paramyosin and tropomyosin. Our results show that the antigens were well expressed within the biofilm as denoted by macrostructure complementation and by the detection of the fusion protein in both immunoblot and immunohistochemistry. In addition, we show that the recombinant endospores of B. subtilis preserve their biophysical and morphological properties. In this work we provide strong evidence pointing that TasA is a suitable candidate for the display of heterologous peptides, such as antigens, cytokines, enzymes or antibodies, in the B. subtilis biofilms. Finally, our data portray that the recombinant endospores preserve their morphological and biophysical properties and could be an excellent tool to facilitate the transport and the administration.

  13. Mechanisms of Action of Probiotics based on Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    A.V. Savustyanenko

    2016-04-01

    Full Text Available The bacterium B.subtilis is one of the most promi­sing probiotics studied in recent decades. Mechanisms of its probiotic action are associated with the synthesis of antimicrobial agents, increasing of non-specific and specific immunity, stimulation of growth of normal microflora of the intestine and the releasing of digestive enzymes. B.subtilis releases ribosomally synthesized peptides, non-ribosomally synthesized peptides and non-peptide substances with a broad spectrum of antimicrobial activity covering Gram-positive, Gram-negative bacteria, viruses and fungi. Resistance to these antimicrobial agents is rare. Enhancement of non-specific immunity is associated with macrophage activation and the release of pro-inflammatory cytokines from them, increasing of barrier function of the intestinal mucosa, releasing of vitamins and amino acids (including essential ones. Enhancement of specific immunity manifests by activation of T- and B-lymphocytes and the release from the latter of immunoglobulins — IgG and IgA. B.subtilis stimulates the growth of normal intestinal flora, in particular, bacteria of the genus Lactobacillus and Bifidobacterium. Furthermore, probiotic increases the diversity of intestinal microflora. Probiotic secretes all major digestive enzymes to the intestinal lumen: amylases, lipases, proteases, pectinases and cellulases. In addition to digestion, these enzymes destroy antinutritional factors and allergenic substances contained in the food. These mechanisms of action make reasonable the use of B.subtilis in the combination therapy to treat intestinal infections; prevention of respiratory infections during the cold season; prevention of antibiotic-associated diarrhea; for the correction of food digestion and movement impairments of various origin (errors in the diet, changes in the diet, diseases of the gastrointestinal tract, disorders of the autonomic nervous system, etc.. B.subtilis does not usually cause side effects. This

  14. 40 CFR 180.1128 - Bacillus subtilis MBI 600; exemption from the requirement of a tolerance.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis MBI 600; exemption... FOOD Exemptions From Tolerances § 180.1128 Bacillus subtilis MBI 600; exemption from the requirement of... biofungicide Bacillus subtilis MBI 600 in or on all food commodities, including residues resulting from post...

  15. BIOMASS PRODUCTION AND FORMULATION OF Bacillus subtilis FOR BIOLOGICAL CONTROL

    Directory of Open Access Journals (Sweden)

    Amran Muis

    2016-10-01

    Full Text Available Bacillus subtilis is a widespread bacterium found in soil, water, and air. It controls the growth of certain harmful bacteria and fungi, presumably by competing for nutrients, growth sites on plants, and by directly colonizing and attaching to fungal pathogens. When applied to seeds, it colonizes the developing root system of the plants and continues to live on the root system and provides protection throughout the growing season. The study on biomass production and formulation of B. subtilis for biological control was conducted in the laboratory of Department of Plant Pathology, College of Agriculture, University of the Philippines Los Baños (UPLB-CA, College, Laguna from May to July 2005. The objective of the study was to determine the optimum pH and a good carbon source for biomass production of B. subtilis and to develop a seed treatment formulation of B. subtilis as biological control agent. Results showed that the optimum pH for growth of B. subtilis was pH 6 (1.85 x 109 cfu/ml. In laboratory tests for biomass production using cassava flour, corn flour, rice flour, and brown sugar as carbon sources, it grew best in brown sugar plus yeast extract medium (6.8 x 108 cfu ml-1 in sterile distilled water and 7.8 x 108 cfu ml-1 in coconut water. In test for bacterial biomass carriers, talc proved to be the best in terms of number of bacteria recovered from the seeds (3.98 x 105 cfu seed-1.

  16. Bacillus subtilis IolQ (DegA) is a transcriptional repressor of iolX encoding NAD+-dependent scyllo-inositol dehydrogenase.

    Science.gov (United States)

    Kang, Dong-Min; Michon, Christophe; Morinaga, Tetsuro; Tanaka, Kosei; Takenaka, Shinji; Ishikawa, Shu; Yoshida, Ken-Ichi

    2017-07-11

    Bacillus subtilis is able to utilize at least three inositol stereoisomers as carbon sources, myo-, scyllo-, and D-chiro-inositol (MI, SI, and DCI, respectively). NAD + -dependent SI dehydrogenase responsible for SI catabolism is encoded by iolX. Even in the absence of functional iolX, the presence of SI or MI in the growth medium was found to induce the transcription of iolX through an unknown mechanism. Immediately upstream of iolX, there is an operon that encodes two genes, yisR and iolQ (formerly known as degA), each of which could encode a transcriptional regulator. Here we performed an inactivation analysis of yisR and iolQ and found that iolQ encodes a repressor of the iolX transcription. The coding sequence of iolQ was expressed in Escherichia coli and the gene product was purified as a His-tagged fusion protein, which bound to two sites within the iolX promoter region in vitro. IolQ is a transcriptional repressor of iolX. Genetic evidences allowed us to speculate that SI and MI might possibly be the intracellular inducers, however they failed to antagonize DNA binding of IolQ in in vitro experiments.

  17. Bacillus subtilis as a tool for vaccine development: from antigen factories to delivery vectors

    Directory of Open Access Journals (Sweden)

    Luís C.S. Ferreira

    2005-03-01

    Full Text Available Bacillus subtilis and some of its close relatives have a long history of industrial and biotechnological applications. Search for antigen expression systems based on recombinant B. subtilis strains sounds attractive both by the extensive genetic knowledge and the lack of an outer membrane, which simplify the secretion and purification of heterologous proteins. More recently, genetically modified B. subtilis spores have been described as indestructible delivery vehicles for vaccine antigens. Nonetheless both production and delivery of antigens by B. subtilis strains face some inherent obstacles, as unstable gene expression and reduced immunogenicity that, otherwise, can be overcome by already available gene technology approaches. In the present review we present the status of B. subtilis-based vaccine research, either as protein factories or delivery vectors, and discuss some alternatives for a better use of genetically modified strains.Bacillus subtilis e alguns de seus parentes mais próximos possuem uma longa história de aplicações industriais e biotecnológicas. A busca de sistemas de expressão de antígenos baseados em linhagens recombinants de B. subtilis mostra-se atrativa em função do conhecimento genético disponível e ausência de uma membrana externa, o que simplifica a secreção e a purificação de proteínas heterólogas. Mais recentemente, esporos geneticamente modificados de B. subtilis foram descritos com veículos indestrutíveis para o transporte de antígenos vacinais. Todavia a produção e o transporte de antígenos por linhagens de B. subtilis encontra obstáculos, como a expressão gênica instável e imunogenicidade reduzida, que podem ser superados com o auxílio de tecnologias genéticas atualmente disponíveis. Apresentamos nesta revisão o estado atual da pesquisa em vacinas baseadas em B. subtilis, empregado tanto como fábrica de proteínas ou veículos, e discute algumas alternativas para o uso mais

  18. Cloning and enhancing production of a detergent- and organic-solvent-resistant nattokinase from Bacillus subtilis VTCC-DVN-12-01 by using an eight-protease-gene-deficient Bacillus subtilis WB800.

    Science.gov (United States)

    Nguyen, Thao Thi; Quyen, Thi Dinh; Le, Hoang Thanh

    2013-09-10

    Nattokinases/Subtilisins (EC 3.4.21.62) belong to the second large family of serine proteases, which gain significant attention and play important role in many biotechnology processes. Thus, a number of nattokinases/subtilisins from various Bacillus species, especially from B. subtilis strains, extensively have been investigated to understand their biochemical and physical properties as well as to improve the production for industrial application. The purpose of this study was to clone a nattokinase gene from Bacillus subtilis strain VTCC-DVN-12-01, enhance its production in B. subtilis WB800, which is deficient in eight extracellular proteases and characterize its physicochemical properties for potential application in organic synthesis and detergent production. A gene coding for the nattokinase (Nk) from B. subtilis strain VTCC-DVN-12-01 consisted of an ORF of 1146 nucleotides, encoding a pre-pro-protein enzyme (30-aa pre-signal peptide, 76-aa pro-peptide and 275-aa mature protein with a predicted molecular mass of 27.7 kDa and pI 6.6). The nattokinase showed 98-99% identity with other nattokinases/subtilisins from B. subtilis strains in GenBank. Nk was expressed in B. subtilis WB800 under the control of acoA promoter at a high level of 600 mg protein per liter culture medium which is highest yield of proteins expressed in any extracellular-protease-deficient B. subtilis system till date. Nk was purified to homogeneity with 3.25 fold purification, a specific activity of 12.7 U/mg, and a recovery of 54.17%. The purified Nk was identified by MALDI-TOF mass spectrometry through three peptides, which showed 100% identity to corresponding peptides of the B. subtilis nattokinase (CAC41625). An optimal activity for Nk was observed at 65 °C and pH 9. The nattokinase was stable at temperature up to 50 °C and in pH range of 5-11 and retained more than 85% of its initial activity after incubation for 1 h. Mg2+ activated Nk up to 162% of its activity. The addition of

  19. Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Atlung, Tove

    1996-01-01

    The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

  20. Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

    Science.gov (United States)

    Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

    2015-05-01

    Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  1. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  2. Enhancement of extracellular expression of Bacillus naganoensis pullulanase from recombinant Bacillus subtilis: Effects of promoter and host.

    Science.gov (United States)

    Song, Wan; Nie, Yao; Mu, Xiao Qing; Xu, Yan

    2016-08-01

    Pullulanase plays an important role in industrial applications of starch processing. However, extracellular production of pullulanase from recombinant Bacillus subtilis is yet limited due to the issues on regulatory elements of B. subtilis expression system. In this study, the gene encoding B. naganoensis pullulanase (PUL) was expressed in B. subtilis WB800 under the promoter PHpaII in the shuttle vector pMA0911. The extracellular activity of expressed pullulanase was 3.9 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-PHpaII-pul. To further enhance the yield of PUL, the promoter PHpaII in pMA0911 was replaced by a stronger constitutive promoter P43. Then the activity was increased to 8.7 U ml(-1) from the recombinant B. subtilis WB800/pMA0911-P43-pul. Effect of host on pullulanase expression was further investigated by comparison between B. subtilis WB600 and B. subtilis WB800. In addition to the available B. subtilis WB800 recombinants, the constructed plasmids pMA0911-PHpaII-pul and pMA0911-P43-pul were transformed into B. subtilis WB600, respectively. Consequently, the extracellular production of PUL was significantly enhanced by B. subtilis WB600/pMA0911-P43-pul, resulting in the extracellular pullulanase activity of 24.5 U ml(-1). Therefore, promoter and host had an impact on pullulanase expression and their optimization would be useful to improve heterologous protein expression in B. subtilis. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Inducible error-prone repair in B. subtilis. Progress report, May 1, 1983-April 30, 1984

    International Nuclear Information System (INIS)

    Yasbin, R.E.

    1983-12-01

    DNA repair mechanisms in Bacillus subtilis were investigated following mutagenesis via ultraviolet radiation or by chemical mutagens. A bioassay is described whereby the efficiency of repair mechanisms can be measured. DNA cloning studies to transfer the photoreactivation gene from E. coli to B. subtilis are reported. The mutation, which induces the SOS-like system in B. subtilis when grown at 45 0 C, was characterized in order to begin delineation of the genes controlling this system, efforts directed at isolation and cloning of a DNA Polymerase III gene of B. subtilis are related. (DT)

  4. Endospores of B subtilis are pyrogenic and activate Mono Mac 6 cells

    DEFF Research Database (Denmark)

    Moesby, Lise; Hansen, Erik W; Christensen, Jens D

    2003-01-01

    interleukin-6. Lipopolysaccharides (LPS) dose-dependently induce interleukin-6 release, but the curve differs from that of LTA both in shape and offset. The interleukin-6 secretion induced by LPS, LTA and B. subtilis bacteria can be blocked by 73-85% by an antibody directed against CD14, whereas the antibody......The monocytic cell line Mono Mac 6 is sensitive to pyrogens and interleukin-6 secretion is induced after exposure to pyrogens. The aim of this study is to examine the pyrogenic activity and the interleukin-6-inducing capacity of the Gram-positive B. subtilis bacteria, endospores and isolated cell...... in a sandwich immunoassay. B. subtilis bacteria and endospores induce interleukin-6 in a dose-dependent manner. Endospores are less potent than bacteria. Lipoteichoic acid (LTA) isolated from B. subtilis induces interleukin-6 in a dose-dependent manner, whereas muramyl dipeptide (MDP) is unable to induce...

  5. 40 CFR 180.1111 - Bacillus subtilis GB03; exemption from the requirement of a tolerance.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis GB03; exemption from... FOOD Exemptions From Tolerances § 180.1111 Bacillus subtilis GB03; exemption from the requirement of a tolerance. The biofungicide Bacillus subtilis GB03 is exempted from the requirement of a tolerance in or on...

  6. HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

    Science.gov (United States)

    Roy, Ajit; Ranjan, Akash

    2016-02-23

    Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

  7. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    International Nuclear Information System (INIS)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

    2007-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  8. Transfer of Eu (III) associated with polymaleic acid to Bacillus subtilis

    International Nuclear Information System (INIS)

    Markai, S.; Montavon, G.; Andres, Y.; Grambow, B.

    2003-01-01

    The aim of this study is to contribute to the understanding of the distribution of Eu(III) between dissolved organic matter and microorganisms, and to investigate the effect of competitive ions such as Ca +2 on adsorption properties. Polymaleic acid (PMA), is used as synthetic organic matter, having similar properties as natural fulvic acid, and Bacillus subtilis is chosen as microorganism. A double labeling method was used: [ 14 C]MPA and 152 Eu to quantify the behavior of the various components. Preliminary experiments showed that the adsorption of polymaleic acid onto Bacillus subtilis was negligible at pH=5 in 0.15 mol/l of NaCl. In the absence of Ca +2 , the transfer of Eu(III) from PMA to B. subtilis could be described by a simple empirical model based on data obtained from sorption isotherms on the reference systems Eu(III)/PMA and Eu(III)/B. subtilis. In the presence of Ca +2 , the transfer was increased. The hypothesis that Ca +2 ions acted as a bridging agent between PMA and the bacteria was proposed

  9. Inhibition of quorum sensing-mediated virulence in Serratia marcescens by Bacillus subtilis R-18.

    Science.gov (United States)

    Devi, Kannan Rama; Srinivasan, Subramaniyan; Ravi, Arumugam Veera

    2018-04-13

    Serratia marcescens is an opportunistic human pathogen causing various nosocomial infections, most importantly urinary tract infections (UTIs). It exhibits increased resistance towards the conventional antibiotics. This study was aimed to evaluate the anti-virulence effect of a rhizosphere soil bacterium Bacillus subtilis strain R-18 against the uropathogen S. marcescens. First, the bacterial cell-free culture supernatant (CFCS) of B. subtilis strain R-18 was evaluated for its quorum sensing inhibitory (QSI) potential against biomarker strain Chromobacterium violaceum and the test pathogen S. marcescens. The B. subtilis R-18 CFCS effectively inhibited the quorum sensing (QS)-mediated violacein pigment production in C. violaceum and prodigiosin pigment production in S. marcescens. Furthermore, B. subtilis R-18 CFCS was successively extracted with different solvent systems. Of these solvents, B. subtilis R-18 petroleum ether (PE) extract showed inhibition in biofilm formation, protease, lipase, and hemolysin productions in S. marcescens. Fourier transform infrared spectroscopic (FT-IR) analysis revealed the alterations in the cellular components of bacterial cell pellets obtained from B. subtilis R-18 PE extract treated and untreated S. marcescens. The differential gene expression study further validated the downregulation of virulence-associated genes. Characterization of the active principle in B. subtilis R-18 PE extract by gas chromatography-mass spectrometry (GC-MS) analysis showed the presence of multiple compounds with therapeutic values, which could possibly reduce the QS-dependent phenotypes in S. marcescens. Copyright © 2018. Published by Elsevier Ltd.

  10. Bacillus subtilis biofilm extends Caenorhabditis elegans longevity through downregulation of the insulin-like signalling pathway

    Science.gov (United States)

    Donato, Verónica; Ayala, Facundo Rodríguez; Cogliati, Sebastián; Bauman, Carlos; Costa, Juan Gabriel; Leñini, Cecilia; Grau, Roberto

    2017-01-01

    Beneficial bacteria have been shown to affect host longevity, but the molecular mechanisms mediating such effects remain largely unclear. Here we show that formation of Bacillus subtilis biofilms increases Caenorhabditis elegans lifespan. Biofilm-proficient B. subtilis colonizes the C. elegans gut and extends worm lifespan more than biofilm-deficient isogenic strains. Two molecules produced by B. subtilis — the quorum-sensing pentapeptide CSF and nitric oxide (NO) — are sufficient to extend C. elegans longevity. When B. subtilis is cultured under biofilm-supporting conditions, the synthesis of NO and CSF is increased in comparison with their production under planktonic growth conditions. We further show that the prolongevity effect of B. subtilis biofilms depends on the DAF-2/DAF-16/HSF-1 signalling axis and the downregulation of the insulin-like signalling (ILS) pathway. PMID:28134244

  11. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  12. 75 FR 862 - Bacillus subtilis; Registration Review Proposed Decision; Notice of Availability

    Science.gov (United States)

    2010-01-06

    ...: Bacillus subtilis strain GB03 is used to prevent, control and suppress plant disease on barley, berries, bulb vegetables, cole crops, cotton, cucurbits, fruiting vegetables, herbs, leafy crops, legumes... subtilis strain MBI 600 is used to suppress disease organisms such as Botrytis, Alternaria, Rhizoctonia...

  13. Cell Physiology and Protein Secretion of Bacillus licheniformis Compared to Bacillus subtilis

    NARCIS (Netherlands)

    Voigt, Birgit; Antelmann, Haike; Albrecht, Dirk; Ehrenreich, Armin; Maurer, Karl-Heinz; Evers, Stefan; Gottschalk, Gerhard; van Dijl, Jan Maarten; Schweder, Thomas; Hecker, Michael

    2009-01-01

    The genome sequence of Bacillus subtilis was published in 1997 and since then many other bacterial genomes have been sequenced, among them Bacillus licheniformis in 2004. B. subtilis and B. licheniformis are closely related and feature similar saprophytic lifestyles in the soil. Both species can

  14. 77 FR 73934 - Bacillus subtilis Strain QST 713 Variant Soil; Amendment to an Exemption From the Requirement of...

    Science.gov (United States)

    2012-12-12

    ... Bacillus subtilis Strain QST 713 To Include Residues of Bacillus subtilis Strain QST 713 Variant Soil... existing exemption from the requirement of a tolerance for residues of the Bacillus subtilis strain QST 713 in or on all food commodities by including residues of Bacillus subtilis strain QST 713 variant soil...

  15. Fed-Batch Biomolecule Production by Bacillus subtilis: A State of the Art Review.

    Science.gov (United States)

    Ÿztürk, Sibel; Ÿalık, Pınar; Ÿzdamar, Tunçer H

    2016-04-01

    Bacillus subtilis is a highly promising production system for various biomolecules. This review begins with the algorithm of fed-batch operations (FBOs) and then illustrates the approaches to design the initial production medium and/or feed stream. Additionally, the feeding strategies developed with or without feedback control for fed-batch B. subtilis fermentations were compiled with a special emphasis on recombinant protein (r-protein) production. For biomolecule production by wild-type B. subtilis, due to the different intracellular production patterns, no consensus exists on the FBO strategy that gives the maximum productivity, whereas for r-protein production appropriate feeding strategies vary depending on the promoter used. Thus, we conclude that the B. subtilis community is still seeking an approved strong promoter and generalized FBO strategies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Dimethylglycine provides salt and temperature stress protection to Bacillus subtilis.

    Science.gov (United States)

    Bashir, Abdallah; Hoffmann, Tamara; Smits, Sander H J; Bremer, Erhard

    2014-05-01

    Glycine betaine is a potent osmotic and thermal stress protectant of many microorganisms. Its synthesis from glycine results in the formation of the intermediates monomethylglycine (sarcosine) and dimethylglycine (DMG), and these compounds are also produced when it is catabolized. Bacillus subtilis does not produce sarcosine or DMG, and it cannot metabolize these compounds. Here we have studied the potential of sarcosine and DMG to protect B. subtilis against osmotic, heat, and cold stress. Sarcosine, a compatible solute that possesses considerable protein-stabilizing properties, did not serve as a stress protectant of B. subtilis. DMG, on the other hand, proved to be only moderately effective as an osmotic stress protectant, but it exhibited good heat stress-relieving and excellent cold stress-relieving properties. DMG is imported into B. subtilis cells primarily under osmotic and temperature stress conditions via OpuA, a member of the ABC family of transporters. Ligand-binding studies with the extracellular solute receptor (OpuAC) of the OpuA system showed that OpuAC possesses a moderate affinity for DMG, with a Kd value of approximate 172 μM; its Kd for glycine betaine is about 26 μM. Docking studies using the crystal structures of the OpuAC protein with the sulfur analog of DMG, dimethylsulfonioacetate, as a template suggest a model of how the DMG molecule can be stably accommodated within the aromatic cage of the OpuAC ligand-binding pocket. Collectively, our data show that the ability to acquire DMG from exogenous sources under stressful environmental conditions helps the B. subtilis cell to cope with growth-restricting osmotic and temperature challenges.

  17. Effect of Bacillus subtilis on the growth and survival rate of shrimp ...

    African Journals Online (AJOL)

    The effect ofBacillus subtilis, isolated from digestive tract of Macrobrachium rosenbergii was investigated on growth and survival rate of Litopenaeus vannamei during 60 days of culture. Sixteen aquaria with four replicates were used for treatments and controls. Treatment groups were consisted of Bacillus subtilis, isolated ...

  18. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

    2015-01-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

  19. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

    2015-09-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. The Regulatory RNAs of Bacillus subtilis

    NARCIS (Netherlands)

    Mars, Ruben

    2014-01-01

    In vrijwel alle organismen wordt RNA aangemaakt dat niet codeert voor eiwit, maar een regulerende functie heeft. Dit proefschrift beschrijft de identificatie van ~1600 nieuwe potentiële regulatie-RNAs in de bodembacterie Bacillus subtilis die veel voor biotechnologische toepassingen ingezet wordt.

  1. Bacillus subtilis Protects Public Goods by Extending Kin Discrimination to Closely Related Species

    Directory of Open Access Journals (Sweden)

    Nicholas A. Lyons

    2017-07-01

    Full Text Available Kin discrimination systems are found in numerous communal contexts like multicellularity and are theorized to prevent exploitation of cooperative behaviors. The kin discrimination system in Bacillus subtilis differs from most other such systems because it excludes nonkin cells rather than including kin cells. Because nonkin are the target of the system, B. subtilis can potentially distinguish degrees of nonkin relatedness, not just kin versus nonkin. We examined this by testing a large strain collection of diverse Bacillus species against B. subtilis in different multicellular contexts. The effects of kin discrimination extend to nearby species, as the other subtilis clade species were treated with the same antagonism as nonkin. Species in the less-related pumilus clade started to display varied phenotypes but were mostly still discriminated against, while cereus clade members and beyond were no longer subject to kin discrimination. Seeking a reason why other species are perceived as antagonistic nonkin, we tested the ability of B. subtilis to steal communally produced surfactant from these species. We found that the species treated as nonkin were the only ones that made a surfactant that B. subtilis could utilize and that nonkin antagonism prevented such stealing when the two strains were mixed. The nonkin exclusion kin discrimination method thus allows effective protection of the cooperative behaviors prevalent in multicellularity while still permitting interactions with more distant species that are not a threat.

  2. Safety assessment of Bacillus subtilis CU1 for use as a probiotic in humans.

    Science.gov (United States)

    Lefevre, Marie; Racedo, Silvia M; Denayrolles, Muriel; Ripert, Gabrielle; Desfougères, Thomas; Lobach, Alexandra R; Simon, Ryan; Pélerin, Fanny; Jüsten, Peter; Urdaci, Maria C

    2017-02-01

    Bacillus subtilis CU1 is a recently described probiotic strain with beneficial effects on immune health in elderly subjects. The following work describes a series of studies supporting the safety of the strain for use as an ingredient in food and supplement preparations. Using a combination of 16S rDNA and gyrB nucleotide analyses, the species was identified as a member of the Bacillus subtilis complex (B. subtilis subsp. spizizenii). Further characterization of the organism at the strain level was achieved using random amplified polymorphic DNA polymerase chain reaction (RAPD PCR) and pulsed field gel electrophoresis (PFGE) analyses. B. subtilis CU1 did not demonstrate antibiotic resistance greater than existing regulatory cutoffs against clinically important antibiotics, did not induce hemolysis or produce surfactant factors, and was absent of toxigenic activity in vitro. Use of B. subtilis CU1 as a probiotic has recently been evaluated in a 16-week randomized, double-blind, placebo-controlled, parallel-arm study, in which 2 × 10 9 spores per day of B. subtilis CU1 were administered for a total 40 days to healthy elderly subjects (4 consumption periods of 10 days separated by 18-day washouts). This work describes safety related endpoints not previously reported. B. subtilis CU1 was safe and well-tolerated in the clinical subjects without undesirable physiological effects on markers of liver and kidney function, complete blood counts, hemodynamic parameters, and vital signs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Bacillus subtilis strain deficient for the protein-tyrosine kinase PtkA exhibits impaired DNA replication

    DEFF Research Database (Denmark)

    Petranovic, Dina; Michelsen, Ole; Zahradka, K

    2007-01-01

    Bacillus subtilis has recently come into the focus of research on bacterial protein-tyrosine phosphorylation, with several proteins kinases, phosphatases and their substrates identified in this Gram-positive model organism. B. subtilis protein-tyrosine phosphorylation system Ptk...... microscopy. B. subtilis cells lacking the kinase PtkA accumulated extra chromosome equivalents, exhibited aberrant initiation mass for DNA replication and an unusually long D period....

  4. The effect of stochasticity on the lac operon: an evolutionary perspective.

    Directory of Open Access Journals (Sweden)

    Milan van Hoek

    2007-06-01

    Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

  5. Sigma A recognition sites in the Bacillus subtilis genome

    DEFF Research Database (Denmark)

    Jarmer, Hanne Østergaard; Larsen, Thomas Schou; Krogh, Anders Stærmose

    2001-01-01

    A hidden Markov model of sigma (A) RNA polymerase cofactor recognition sites in Bacillus subtilis, containing either the common or the extended -10 motifs, has been constructed based on experimentally verified sigma (A) recognition sites. This work suggests that more information exists...... at the initiation site of transcription in both types of promoters than previously thought. When tested on the entire B. subtilis genome, the model predicts that approximately half of the sigma (A) recognition sites are of the extended type. Some of the response-regulator aspartate phosphatases were among...

  6. 40 CFR 180.1209 - Bacillus subtilis strain QST 713; exemption from the requirement of a tolerance.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis strain QST 713... RESIDUES IN FOOD Exemptions From Tolerances § 180.1209 Bacillus subtilis strain QST 713; exemption from the... the microbial pesticide Bacillus subtilis strain QST 713 when used in or on all food commodities. [65...

  7. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

    OpenAIRE

    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

    1993-01-01

    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  8. Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

    Science.gov (United States)

    Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

    2015-10-23

    The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

  9. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

    Science.gov (United States)

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

    2017-05-01

    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  10. Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis.

    Science.gov (United States)

    Chen, Po Ting; Chiang, Chung-Jen; Chao, Yun-Peng

    2007-01-01

    Bacillus subtilis (B. subtilis) is widely accepted as an excellent host cell for the secretory production of recombinant proteins. In this study, a shuttle vector was constructed by fusion of Staphylococcus aureus (S. aureus) plasmid pUB110 with Escherichia coli (E. coli) plasmid pUC18 and used for the expression of nattokinase in B. subtilis. The pUB110/pUC-based plasmid was found to exhibit high structural instability with the identification of a DNA deletion between two repeated regions. An initial attempt was made to eliminate the homologous site in the plasmid, whereas the stability of the resulting plasmid was not improved. In an alternative way, the pUC18-derived region in this hybrid vector was replaced by the suicidal R6K plasmid origin of E. coli. As a consequence, the pUB110/R6K-based plasmid displayed full structural stability, leading to a high-level production of recombinant nattokinase in the culture broth. This was mirrored by the detection of a very low level of high molecular weight DNAs generated by the plasmid. Moreover, 2-fold higher nattokinase production was obtained by B. subtilis strain carrying the pUB110/R6K-based plasmid as compared to the cell with the pAMbeta1-derived vector, a plasmid known to have high structural stability. Overall, it indicates the feasibility of the approach by fusing two compatible plasmid origins for stable and efficient production of recombinant nattokinase in B. subtilis.

  11. Genetic or chemical protease inhibition causes significant changes in the Bacillus subtilis exoproteome

    NARCIS (Netherlands)

    Westers, Lidia; Westers, Helga; Zanen, Geeske; Antelmann, Haike; Hecker, Michael; Noone, David; Devine, Kevin M.; van Dijl, Jan Maarten; Quax, Wim J.

    Bacillus subtilis is a prolific producer of enzymes and biopharmaceuticals. However, the susceptibility of heterologous proteins to degradation by (extracellular) proteases is a major limitation for use of B. subtilis as a protein cell factory. An increase in protein production levels has previously

  12. New tools for comparing microscopy images: quantitative analysis of cell types in Bacillus subtilis.

    Science.gov (United States)

    van Gestel, Jordi; Vlamakis, Hera; Kolter, Roberto

    2015-02-15

    Fluorescence microscopy is a method commonly used to examine individual differences between bacterial cells, yet many studies still lack a quantitative analysis of fluorescence microscopy data. Here we introduce some simple tools that microbiologists can use to analyze and compare their microscopy images. We show how image data can be converted to distribution data. These data can be subjected to a cluster analysis that makes it possible to objectively compare microscopy images. The distribution data can further be analyzed using distribution fitting. We illustrate our methods by scrutinizing two independently acquired data sets, each containing microscopy images of a doubly labeled Bacillus subtilis strain. For the first data set, we examined the expression of srfA and tapA, two genes which are expressed in surfactin-producing and matrix-producing cells, respectively. For the second data set, we examined the expression of eps and tapA; these genes are expressed in matrix-producing cells. We show that srfA is expressed by all cells in the population, a finding which contrasts with a previously reported bimodal distribution of srfA expression. In addition, we show that eps and tapA do not always have the same expression profiles, despite being expressed in the same cell type: both operons are expressed in cell chains, while single cells mainly express eps. These findings exemplify that the quantification and comparison of microscopy data can yield insights that otherwise would go unnoticed. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Production of Xylanase by Recombinant Bacillus subtilis DB104 Cultivated in Agroindustrial Waste Medium

    Directory of Open Access Journals (Sweden)

    Is Helianti

    2016-07-01

    Full Text Available A recombinant Bacillus subtilis DB104 strain harbouring recombinant plasmid pSKE194 containing an Open Reading Frame (ORF of endoxylanase and its indigenous promoter from the wild-type B. subtilis AQ1 strain was constructed. This recombinant B. subtilis DB104 strain had higher endoxylanase activity than the nonrecombinant B. subtilis DB104 strain in standard media, such as Luria Bertani (LB and LB with xylan. The agroindustrial wastes corncobs and tofu liquid waste were chosen as cost-effective carbon and nitrogen sources, respectively, to test the economics of xylanase production using the recombinant B. subtilis DB104 at a larger scale. Submerged fermentation using a 4.5 L working volume fermentor with tofu liquid waste and 4% corncobs produced maximum xylanase activity of 1296 ± 1.2 U/mg (601.7 ± 0.6 U/mL after 48-hour fermentation at 37°C with 150 rpm agitation; this is more than twofold higher than the activity produced in an Erlenmeyer flask. This is the first report of high xylanase activity produced from recombinant B. subtilis using inexpensive medium. During fermentation, the xylanase degrades corncobs into xylooligosaccharides, showing its potential as an enzyme feed additive or in xylooligosaccharide production.

  14. Structurally diverse natural products that cause potassium leakage trigger multicellularity in Bacillus subtilis.

    Science.gov (United States)

    López, Daniel; Fischbach, Michael A; Chu, Frances; Losick, Richard; Kolter, Roberto

    2009-01-06

    We report a previously undescribed quorum-sensing mechanism for triggering multicellularity in Bacillus subtilis. B. subtilis forms communities of cells known as biofilms in response to an unknown signal. We discovered that biofilm formation is stimulated by a variety of small molecules produced by bacteria--including the B. subtilis nonribosomal peptide surfactin--that share the ability to induce potassium leakage. Natural products that do not cause potassium leakage failed to induce multicellularity. Small-molecule-induced multicellularity was prevented by the addition of potassium, but not sodium or lithium. Evidence is presented that potassium leakage stimulates the activity of a membrane protein kinase, KinC, which governs the expression of genes involved in biofilm formation. We propose that KinC responds to lowered intracellular potassium concentration and that this is a quorum-sensing mechanism that enables B. subtilis to respond to related and unrelated bacteria.

  15. Enhanced extracellular production of L-asparaginase from Bacillus subtilis 168 by B. subtilis WB600 through a combined strategy.

    Science.gov (United States)

    Feng, Yue; Liu, Song; Jiao, Yun; Gao, Hui; Wang, Miao; Du, Guocheng; Chen, Jian

    2017-02-01

    L-asparaginase (EC 3.5.1.1, ASN) exhibits great commercial value due to its uses in the food and medicine industry. In this study, we reported the enhanced expression of type II ASN from Bacillus subtilis 168 in B. subtilis WB600 through a combined strategy. First, eight signal peptides (the signal peptide of the ASN, ywbN, yvgO, amyE, oppA, vpr, lipA, and wapA) were used for ASN secretion in B. subtilis by using Hpa II promoter, respectively. The signal peptide wapA achieved the highest extracellular ASN activity (28.91 U/mL). Second, Hpa II promoter was replaced by a strong promoter, P43 promoter, resulting in 38.1 % enhanced ASN activity. By two rounds of error-prone PCR mutation, the P43 promoter variants with remarkably enhanced strength (D7, E2, H6, B2, and F3) were identified. B2 (-28: A → G, -13: A → G) achieved ASN activity up to 51.13 U/mL. Third, after deletion of the N-terminal 25-residues, ASN activity reached 102.41 U/mL, which was 100 % higher than that of the intact ASN. At last, the extracellular ASN of the B. subtilis arrived at 407.6 U/mL (2.5 g/L of ASN protein) in a 3-L bioreactor by using a fed-batch strategy. The purified ASN showed maximal activity at 65 °C and its half-life at 65 °C was 61 min. The K m and k cat of the ASN were 5.29 mM and 54.4 s -1 , respectively. To the best of our knowledge, we obtained the highest yield of ASN in a food-grade host ever reported, which may benefit the industrial production and application of ASN.

  16. A part toolbox to tune genetic expression in Bacillus subtilis

    Science.gov (United States)

    Guiziou, Sarah; Sauveplane, Vincent; Chang, Hung-Ju; Clerté, Caroline; Declerck, Nathalie; Jules, Matthieu; Bonnet, Jerome

    2016-01-01

    Libraries of well-characterised components regulating gene expression levels are essential to many synthetic biology applications. While widely available for the Gram-negative model bacterium Escherichia coli, such libraries are lacking for the Gram-positive model Bacillus subtilis, a key organism for basic research and biotechnological applications. Here, we engineered a genetic toolbox comprising libraries of promoters, Ribosome Binding Sites (RBS), and protein degradation tags to precisely tune gene expression in B. subtilis. We first designed a modular Expression Operating Unit (EOU) facilitating parts assembly and modifications and providing a standard genetic context for gene circuits implementation. We then selected native, constitutive promoters of B. subtilis and efficient RBS sequences from which we engineered three promoters and three RBS sequence libraries exhibiting ∼14 000-fold dynamic range in gene expression levels. We also designed a collection of SsrA proteolysis tags of variable strength. Finally, by using fluorescence fluctuation methods coupled with two-photon microscopy, we quantified the absolute concentration of GFP in a subset of strains from the library. Our complete promoters and RBS sequences library comprising over 135 constructs enables tuning of GFP concentration over five orders of magnitude, from 0.05 to 700 μM. This toolbox of regulatory components will support many research and engineering applications in B. subtilis. PMID:27402159

  17. 40 CFR 180.1243 - Bacillus subtilis var. amyloliquefaciens strain FZB24; exemption from the requirement of a...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus subtilis var... EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Exemptions From Tolerances § 180.1243 Bacillus subtilis... the requirement of a tolerance for residues of the Bacillus subtilis var. amyloliquefaciens strain...

  18. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  19. Screen for agents that induce autolysis in Bacillus subtilis.

    Science.gov (United States)

    Lacriola, Christopher J; Falk, Shaun P; Weisblum, Bernard

    2013-01-01

    The growing prevalence of antibiotic-resistant infections underscores the need to discover new antibiotics and to use them with maximum effectiveness. In response to these needs, we describe a screening protocol for the discovery of autolysis-inducing agents that uses two Bacillus subtilis reporter strains, SH-536 and BAU-102. To screen chemical libraries, autolysis-inducing agents were first identified with a BAU-102-based screen and then subdivided with SH-536 into two major groups: those that induce autolysis by their direct action on the cell membrane and those that induce autolysis secondary to inhibition of cell wall synthesis. SH-536 distinguishes between the two groups of autolysis-inducing agents by synthesizing and then releasing β-galactosidase (β-Gal) in late stationary phase at a time that cells have nearly stopped growing and are therefore tolerant of cell wall synthesis inhibitors. Four hits, named compound 2, compound 3, compound 5, and compound 24, obtained previously as inducers of autolysis by screening a 10,080-compound discovery library with BAU-102, were probed with SH-536 and found to release β-Gal, indicating that their mode of action was to permeabilize the B. subtilis cell membrane. The four primary hits inhibited growth in Staphylococcus aureus, Enterococcus faecium, Bacillus subtilis, and Bacillus anthracis, with MICs in the 12.5- to 25-μg/ml (20 to 60 μM) range. The four primary hits were further used to probe B. subtilis, and their action was partially characterized with respect to the dependence of induced autolysis on specific autolysins.

  20. Evolution of exploitative interactions during diversification in Bacillus subtilis biofilms

    DEFF Research Database (Denmark)

    Dragoš, Anna; Lakshmanan, Nivedha; Martin, Marivic

    2018-01-01

    variants. These variants can settle in alternative biofilm niches and develop new types of interactions that greatly influence population productivity. Here, we explore the evolutionary diversification of pellicle biofilms of the Gram positive, spore-forming bacterium Bacillus subtilis. We discover that......-similarly to other species-B. subtilis diversifies into distinct colony variants. These variants dramatically differ in biofilm formation abilities and expression of biofilm-related genes. In addition, using a quantitative approach, we reveal striking differences in surface complexity and hydrophobicity...

  1. Association of Eu(III) and Cm(III) with Bacillus subtilis and Halobacterium salinarum

    International Nuclear Information System (INIS)

    Ozaki, Takuo; Kimura, Takaumi; Ohnuki, Toshihiko; Yoshida, Zenko

    2002-01-01

    Adsorption behavior of Eu(III) and Cm(III) by Bacillus subtilis and Halobacterium salinarum was investigated. Both microorganisms showed almost identical pH dependence on the distribution ratio (K d ) of the metals examined, i.e., K d of Eu(III) and Cm(III) increased with an increase of pH. The coordination state of Eu(III) adsorbed on the microorganisms was studied by time-resolved laser-induced fluorescence spectroscopy (TRLFS). The coordination states of Eu(III) adsorbed on the B. subtilis and H. salinarum was of different characteristics. H. salinarum exhibited more outer-spherical interaction with Eu(III) than B. subtilis. (author)

  2. Bacillus subtilis spores as vaccine adjuvants: further insights into the mechanisms of action.

    Directory of Open Access Journals (Sweden)

    Renata Damásio de Souza

    Full Text Available Bacillus subtilis spores have received growing attention regarding potential biotechnological applications, including the use as probiotics and in vaccine formulations. B. subtilis spores have also been shown to behave as particulate vaccine adjuvants, promoting the increase of antibody responses after co-administration with antigens either admixed or adsorbed on the spore surface. In this study, we further evaluated the immune modulatory properties of B. subtilis spores using a recombinant HIV gag p24 protein as a model antigen. The adjuvant effects of B. subtilis spores were not affected by the genetic background of the mouse lineage and did not induce significant inflammatory or deleterious effects after parenteral administration. Our results demonstrated that co-administration, but not adsorption to the spore surface, enhanced the immunogenicity of that target antigen after subcutaneous administration to BALB/c and C57BL/6 mice. Spores promoted activation of antigen presenting cells as demonstrated by the upregulation of MHC and CD40 molecules and enhanced secretion of pro-inflammatory cytokines by murine dendritic cells. In addition, in vivo studies indicated a direct role of the innate immunity on the immunomodulatory properties of B. subtilis spores, as demonstrated by the lack of adjuvant effects on MyD88 and TLR2 knockout mouse strains.

  3. PEMANFAATAN LIMBAH BULU AYAM MENJADI BAHAN PAKAN IKAN DENGAN FERMENTASI Bacillus subtilis (Utilization of Waste Chicken Feather to Fish Feed Ingredients Material with Fermentation of Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Dini Siswani Mulia

    2016-02-01

    Full Text Available ABSTRAK Penelitian ini bertujuan untuk memanfaatkan limbah bulu ayam menjadi bahan pakan ikan dengan fermentasi Bacillus subtilis. Penelitian menggunakan metode eksperimen dengan Rancangan Acak Lengkap (RAL 4 perlakuan, 3 kali ulangan, yaitu P0 : tepung bulu ayam non fermentasi; P1 : fermentasi dengan inokulum B. subtilis 5 mL/2 g tepung bulu ayam; P2 : fermentasi dengan inokulum B. subtilis 10 mL/2 g tepung bulu ayam; P3 : fermentasi dengan inokulum B. subtilis 15 mL/2 g tepung bulu ayam. Parameter yang diamati adalah hasil uji proksimat meliputi kadar protein kasar, kadar air, kadar abu, kadar lemak kasar, kadar serat kasar, dan parameter pendukung yaitu uji organoleptik, berupa sifat fisik tepung bulu ayam, meliputi warna, tekstur, dan bau. Data berupa hasil uji proksimat dianalisis menggunakan ANAVA dan Duncan Multiple Range Test (DMRT dengan taraf uji 5%, sedangkan untuk data hasil organoleptik dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa pemanfaatan limbah bulu ayam menjadi bahan pakan ikan dapat dilakukan dengan fermentasi B. subtilis. Fermentasi tepung bulu ayam menggunakan B. subtillis dapat meningkatkan kualitas bahan baku pakan ikan. Perlakuan P2 (inokulum 10 mL/2 g tepung bulu ayamadalah perlakuan yang paling efektif karena menghasilkan protein tertinggi yaitu 80,59%, dengan perubahan sifat fisik menjadi putih sampai putih kekuningan (warna, lembut (tekstur, dan khas kurang menyengat (bau.   ABSTRACT This study aims to utilize waste chicken feathers into fish feed ingredients by fermentation of Bacillus subtilis. The research has done by experimental methods with completely randomized design (CRD 4 treatments, 3 repetitions, ie P0: non-fermented chicken feather meal; P1: fermentation with B. subtilis 5 mL inoculum/2 g chicken feather meal; P2: 10 mL/2 g chicken feather meal; P3: 15 mL/2 g chicken feather meal. Parameters measured were the proximate test results include the levels of crude protein

  4. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

    Science.gov (United States)

    Kim, Dae Hun; Ko, Kwan Soo

    2015-07-01

    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  6. Efektivitas Formula Bacillus subtilis TM4 untuk Pengendalian Penyakit pada Tanaman Jagung

    Directory of Open Access Journals (Sweden)

    Nurasiah Djaenuddin

    2017-11-01

    Full Text Available Banded leaf and sheath blight (BLSB and maydis leaf blight (MLB caused by Rhizoctonia solani and Bipolaris maydis, respectively are considered as important diseases in maize.   The use of biopesticides is an alternative method to control the diseases. This study was conducted to determine the effectiveness of bacterial formula Bacillus subtilis to inhibit the development of BLSB and MLB on the plant. Testing of biopesticide formula was done in two different applications, i.e. seed treatment for BLSB control and leaf spraying in the field for MLB. The results showed that the B.subtilis formula effectively suppressed the development of BLSB but it was not effectively suppressed the development of MLB .Key words: Bacillus subtilis, biopesticide, Bipolaris maydis, leaf blight diseaseBanded leaf and sheath blight (BLSB and maydis leaf blight (MLB caused by Rhizoctonia solani and Bipolaris maydis, respectively are considered as important diseases in maize.   The use of biopesticides is an alternative method to control the diseases. This study was conducted to determine the effectiveness of bacterial formula Bacillus subtilis to inhibit the development of BLSB and MLB on the plant. Testing of biopesticide formula was done in two different applications, i.e. seed treatment for BLSB control and leaf spraying in the field for MLB. The results showed that the B.subtilis formula effectively suppressed the development of BLSB but it was not effectively suppressed the development of MLB.

  7. The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2008-01-01

    The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

  8. Preliminary X-ray crystallographic studies of Bacillus subtilis SpeA protein

    International Nuclear Information System (INIS)

    Liu, Xiao-Yan; Lei, Jian; Liu, Xiang; Su, Xiao-Dong; Li, Lanfen

    2009-01-01

    In order to further illustrate the catalytic mechanism of arginine decarboxylase by determining the three-dimensional structure of the enzyme the speA gene was amplified from B. subtilis genomic DNA and cloned. The enzyme was expressed in Escherichia coli and purified to homogeneity by nickel-chelation chromatography followed by size-exclusion chromatography. High-quality crystals were obtained using the hanging-drop vapour-diffusion method at 298 K. The speA gene in Bacillus subtilis encodes arginine decarboxylase, which catalyzes the conversion of arginine to agmatine. Arginine decarboxylase is an important enzyme in polyamine metabolism in B. subtilis. In order to further illustrate the catalytic mechanism of arginine decarboxylase by determining the three-dimensional structure of the enzyme, the speA gene was amplified from B. subtilis genomic DNA and cloned into the expression vector pET-28a(+). SpeA was expressed in Escherichia coli and purified to homogeneity by nickel-chelation chromatography followed by size-exclusion chromatography. High-quality crystals were obtained using the hanging-drop vapour-diffusion method at 289 K. The best crystal diffracted to 2.0 Å resolution and belonged to space group P2 1 , with unit-cell parameters a = 86.4, b = 63.3 c = 103.3 Å, β = 113.9°

  9. The studies on radiation mutation breeding of Bacillus subtilis with high-yield of amylase

    International Nuclear Information System (INIS)

    Chen Xiaoming; Zhang Liang; Zhang Jianguo; Zhou Liwei

    2008-01-01

    The mutagenesis effects on the yield of amylase have been investigated with Bacillus subtilis irradiated by γ-rays and fast neutrons in once or twice irradiation at various dose rates and total irradiation doses. Several parameters such as flat transparent circle, colony diameter, transparent circle diameter and the ratio of flat transparent circle to colony diameter (HC) are used to estimate the radiation mutation of Bacillus subtilis. A series of results has been obtained as (1) Irradiation both with neutrons and γ-rays could make Bacillus subtilis mutationed to produce high-yield amylase effectively. (2) The average colony diameter of Bacillus subtilis irradiated by γ-rays or fast neutrons is smaller than that of control group at various total doses and dose rates. And their colony diameter becomes smaller slightly with the increment of γ-rays irradiation dose. (3) After the second neutrons irradiation, the values of average colony diameter, the biggest colony diameter, average transparent circle diameter and the biggest transparent circle diameter of all mutationed Bacillus subtilis exceed that of original strains greatly. (4) Three kinds of mutationed Bacillus subtilis strains with high-yield amylase have been screened out, in which two strains can produce high-yield amylase steadily after 15 times breeding. Their biggest colony diameter, the biggest transparent circle diameter and the biggest HC value are up to 8.32 mm, 22.38 mm and 5.39 respectively. (authors)

  10. Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    T Sabari Sankar

    2009-03-01

    Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

  11. Enhancement of Cellulase Production by Cellulomonas Fimi and Bacillus Subtilis

    International Nuclear Information System (INIS)

    Omer, A.M.

    2012-01-01

    Two bacterial strains identified as Cellulomonas fimi and Baciliius subtilus are cosidered as highly active cellulytic bacteria. Trials for maximizing the cellulolytic activites of the two strains were conducted. A maximum cellulase production was achieved at 1 and 1.5%carboxy methyl cellulose as carbon source, sodium nitrate and yeast as nitrogen source for Cellulomonas fimi and Bacillus subtilis, respectively. Incubation temprature at 30 and 45 degree C, ph at 6 and 7 achieved the highest activity of cellulase for Cellulomonas fimi and bacillus subtilis, respectively

  12. Engineering the Xylan Utilization System in Bacillus subtilis for Production of Acidic Xylooligosaccharides

    Science.gov (United States)

    Mun Su Rhee; Lusha Wei; Neha Sawhney; John D. Rice; Franz J. St. John; Jason C. Hurlbert; James F. Preston

    2014-01-01

    Xylans are the predominant polysaccharides in hemicelluloses and an important potential source of biofuels and chemicals. The ability of Bacillus subtilis subsp. subtilis strain 168 to utilize xylans has been ascribed to secreted glycoside hydrolase family 11 (GH11) and GH30 endoxylanases, encoded by the xynA and...

  13. The Cell Wall of Bacillus subtilis

    NARCIS (Netherlands)

    Scheffers, Dirk-Jan; Graumann, Peter

    2012-01-01

    The cell wall of Bacillus subtilis is a rigid structure on the outside of the cell that forms the first barrier between the bacterium and the environment, and at the same time maintains cell shape and withstands the pressure generated by the cell’s turgor. In this chapter, the chemical composition

  14. Recent progress in Bacillus subtilis spore-surface display: concept, progress, and future.

    Science.gov (United States)

    Wang, He; Wang, Yunxiang; Yang, Ruijin

    2017-02-01

    With the increased knowledge on spore structure and advances in biotechnology engineering, the newly developed spore-surface display system confers several inherent advantages over other microbial cell-surface display systems including enhanced stability and high safety. Bacillus subtilis is the most commonly used Bacillus species for spore-surface display. The expression of heterologous antigen or protein on the surface of B. subtilis spores has now been practiced for over a decade with noteworthy success. As an update and supplement to other previous reviews, we comprehensively summarize recent studies in the B. subtilis spore-surface display technique. We focus on its benefits as well as the critical factors affecting its display efficiency and offer suggestions for the future success of this field.

  15. Phylogenetic analysis of Bacillus subtilis strains applicable to natto (fermented soybean) production.

    Science.gov (United States)

    Kubo, Yuji; Rooney, Alejandro P; Tsukakoshi, Yoshiki; Nakagawa, Rikio; Hasegawa, Hiromasa; Kimura, Keitarou

    2011-09-01

    Spore-forming Bacillus strains that produce extracellular poly-γ-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 424 strains, including Bacillus subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting natto. Biotin auxotrophism was tightly linked to natto fermentation. A multilocus nucleotide sequence of six genes (rpoB, purH, gyrA, groEL, polC, and 16S rRNA) was used for phylogenetic analysis, and amplified fragment length polymorphism (AFLP) analysis was also conducted on the natto-fermenting strains. The ability to ferment natto was inferred from the two principal components of the AFLP banding pattern, and natto-fermenting strains formed a tight cluster within the B. subtilis subsp. subtilis group.

  16. Bacillus subtilis Protects Public Goods by Extending Kin Discrimination to Closely Related Species.

    Science.gov (United States)

    Lyons, Nicholas A; Kolter, Roberto

    2017-07-05

    Kin discrimination systems are found in numerous communal contexts like multicellularity and are theorized to prevent exploitation of cooperative behaviors. The kin discrimination system in Bacillus subtilis differs from most other such systems because it excludes nonkin cells rather than including kin cells. Because nonkin are the target of the system, B. subtilis can potentially distinguish degrees of nonkin relatedness, not just kin versus nonkin. We examined this by testing a large strain collection of diverse Bacillus species against B. subtilis in different multicellular contexts. The effects of kin discrimination extend to nearby species, as the other subtilis clade species were treated with the same antagonism as nonkin. Species in the less-related pumilus clade started to display varied phenotypes but were mostly still discriminated against, while cereus clade members and beyond were no longer subject to kin discrimination. Seeking a reason why other species are perceived as antagonistic nonkin, we tested the ability of B. subtilis to steal communally produced surfactant from these species. We found that the species treated as nonkin were the only ones that made a surfactant that B. subtilis could utilize and that nonkin antagonism prevented such stealing when the two strains were mixed. The nonkin exclusion kin discrimination method thus allows effective protection of the cooperative behaviors prevalent in multicellularity while still permitting interactions with more distant species that are not a threat. IMPORTANCE Multicellular systems like bacterial biofilms and swarms rely on cooperative behaviors that could be undermined by exploitative invaders. Discriminating kin from nonkin is one way to help guard against such exploitation but has thus far been examined only intraspecifically, so the phylogenetic range of this important trait is unknown. We tested whether Bacillus subtilis treats other species as nonkin by testing a single strain against a

  17. Oscillating behavior of Clostridium difficile Min proteins in Bacillus subtilis.

    Science.gov (United States)

    Makroczyová, Jana; Jamroškovič, Ján; Krascsenitsová, Eva; Labajová, Nad'a; Barák, Imrich

    2016-06-01

    In rod-shaped bacteria, the proper placement of the division septum at the midcell relies, at least partially, on the proteins of the Min system as an inhibitor of cell division. The main principle of Min system function involves the formation of an inhibitor gradient along the cell axis; however, the establishment of this gradient differs between two well-studied gram-negative and gram-positive bacteria. While in gram-negative Escherichia coli, the Min system undergoes pole-to-pole oscillation, in gram-positive Bacillus subtilis, proper spatial inhibition is achieved by the preferential attraction of the Min proteins to the cell poles. Nevertheless, when E.coli Min proteins are inserted into B.subtilis cells, they still oscillate, which negatively affects asymmetric septation during sporulation in this organism. Interestingly, homologs of both Min systems were found to be present in various combinations in the genomes of anaerobic and endospore-forming Clostridia, including the pathogenic Clostridium difficile. Here, we have investigated the localization and behavior of C.difficile Min protein homologs and showed that MinDE proteins of C.difficile can oscillate when expressed together in B.subtilis cells. We have also investigated the effects of this oscillation on B.subtilis sporulation, and observed decreased sporulation efficiency in strains harboring the MinDE genes. Additionally, we have evaluated the effects of C.difficile Min protein expression on vegetative division in this heterologous host. © 2016 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  18. Bacillus subtilis based-formulation for the control of postbloom fruit drop of citrus.

    Science.gov (United States)

    Klein, Mariana Nadjara; da Silva, Aline Caroline; Kupper, Katia Cristina

    2016-12-01

    Postbloom fruit drop (PFD) caused by Colletotrichum acutatum affects flowers and causes early fruit drop in all commercial varieties of citrus. Biological control with the isolate ACB-69 of Bacillus subtilis has been considered as a potential method for controlling this disease. This study aimed to develop and optimize a B. subtilis based-formulation with a potential for large-scale applications and evaluate its effect on C. acutatum in vitro and in vivo. Bacillus subtilis based-formulations were developed using different carrier materials, and their ability to control PFD was evaluated. The results of the assays led to the selection of the B. subtilis based-formulation with talc + urea (0.02 %) and talc + ammonium molybdate (1 mM), which inhibited mycelial growth and germination of C. acutatum. Studies with detached citrus flowers showed that the formulations were effective in controlling the pathogen. In field conditions, talc + urea (0.02 %) provided 73 % asymptomatic citrus flowers and 56 % of the average number of effective fruit (ANEF), equating with fungicide treatment. On the contrary, non-treated trees had 8.8 % of asymptomatic citrus flowers and 0.83 % ANEF. The results suggest that B. subtilis based-formulations with talc as the carrier supplemented with a nitrogen source had a high potential for PFD control.

  19. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    Science.gov (United States)

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Christiansen, Gunna; Molin, S

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

  1. Immune responses induced by recombinant Bacillus subtilis expressing the spike protein of transmissible gastroenteritis virus in pigs.

    Science.gov (United States)

    Mou, Chunxiao; Zhu, Liqi; Xing, Xianping; Lin, Jian; Yang, Qian

    2016-07-01

    Transmissible gastroenteritis (TGE) causes severe diarrhea in suckling piglets, results in enormous economic loss in swine-producing areas of the world. To develop an effective, safe, and convenient vaccine for the prevention of TGE, we have constructed a recombinant Bacillus subtilis strain (B. subtilis CotGSG) displaying the transmissible gastroenteritis virus (TGEV) spike (S) protein and discussed its immune function to intestinal submucosal dendritic cells (DCs). Our results showed that the recombinant B. subtilis had the ability to recruit more DCs to sample B. subtilis CotGSG, migrate to MLNs, and induce immune responses. Immunized piglets with B. subtilis CotGSG could significantly elevate the specific SIgA titers in feces, IgG titers and neutralizing antibodies in serum. Collectively, our results suggested that recombinant B. subtilis CotGSG expressing the TGEV S protein could effectively induce immune responses via DCs, and provided a perspective on potential novel strategy and approach that may be applicable to the development of the next generation of TGEV vaccines. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Potrich D.P.

    2001-01-01

    Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

  3. Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

    Science.gov (United States)

    Deaner, Matthew; Holzman, Allison; Alper, Hal S

    2018-04-16

    Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Characterization of a Bacillus subtilis surfactin synthetase knockout and antimicrobial activity analysis.

    Science.gov (United States)

    Liu, Hongxia; Qu, Xiaoxu; Gao, Ling; Zhao, Shengming; Lu, Zhaoxin; Zhang, Chong; Bie, Xiaomei

    2016-11-10

    Gene knockout is an important approach to improve the production of antimicrobial compounds. B. subtilis PB2-LS10, derived from B. subtilis PB2-L by a surfactin synthetase (srf) genes knockout, exhibits stronger inhibitory action than its parental strain against all tested pathogenic bacteria and fungi. The antimicrobial extracts produced by B. subtilis PB2-L and B. subtilis PB2-LS10 respectively were characterized by the high-resolution LC-ESI-MS. To provide further insight into the distinct antimicrobial activities, we investigated the impact of the srf genes deletion on the growth and gene transcriptional profile of the strains. The mutant strain grew quickly and reached stationary phase 2h earlier than the wild-type. Prominent expression changes in the modified strain involved genes that were essential to metabolic pathways and processes. Genes related to amino acid transport, ATP-binding cassette (ABC) transporters and protein export were up-regulated in strain PB2-LS10. However, amino acid metabolism, carbohydrate metabolism and fatty acid metabolism were repressed. Because of its excellent antimicrobial activity, strain PB2-LS10 has potential for use in food preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

    Science.gov (United States)

    Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

    2001-01-01

    The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

  6. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Czech Academy of Sciences Publication Activity Database

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

    2007-01-01

    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  7. Genomic comparisons of two Bacillus subtilis biocontrol strains with different modes of actions

    Science.gov (United States)

    Bacillus subtilis strains AS 43.3 and OH131.1 were isolated from wheat anthers and shown to be efficacious in managing Fusarium head blight in greenhouse and some field trials. Chemical analysis of the cell-free culture supernatant identified B. subtilis strain AS 43.3 to be a potent producer of the...

  8. Effects of Bacillus subtilis on some physiological and biochemical parameters of Triticum aestivum L. (wheat) under salinity.

    Science.gov (United States)

    Lastochkina, Oksana; Pusenkova, Ludmila; Yuldashev, Ruslan; Babaev, Marat; Garipova, Svetlana; Blagova, Dar'ya; Khairullin, Ramil; Aliniaeifard, Sasan

    2017-12-01

    Endophytic strain Bacillus subtilis (B. subtilis) 10-4, producing indole-3-acetic acid (IAA) and siderofores but not active in phosphate solubilization, exerted a protective effect on Triticum aestivum L. (wheat) plant grown under salinity (2% NaCl) stress. Exposure to salt stress resulted in an essential increase of proline (Pro) and malondialdehyde (MDA) level in the seedlings. At the same time the seedlings inoculated with B. subtilis 10-4 were characterized by decreased level of stress-induced Pro and MDA accumulation. It was revealed that both B. subtilis 10-4 and salinity caused increase in the content of endogenous salicylic acid (SA) in wheat seedlings as compared to SA content in the control, while B. subtilis 10-4 suppressed stress-induced SA accumulation. Water storage capacity (WSC) in leaf tissues was increased and stress-induced hydrolysis of statolite starch in root cap cells of the germinal roots was reduced by B. subtilis 10-4. The obtained data indicated that the activation of the defense reactions induced by B. subtilis 10-4 induced defense reactions may be connected with their ability to decrease the level of stress-induced oxidative and osmotic stress in seedlings and with the increase of endogenous SA level that can make a significant contribution to the implementation of the protective effect of B. subtilis 10-4 and is manifested in the improvement of plant growth, WSC of leaves and slowing down of the process of statolite starch hydrolysis under salinity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Design of a CRISPR-Cas system to increase resistance of Bacillus subtilis to bacteriophage SPP1.

    Science.gov (United States)

    Jakutyte-Giraitiene, Lina; Gasiunas, Giedrius

    2016-08-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) together with CRISPR-associated (cas) genes form an adaptive prokaryotic immune system which provides acquired resistance against viruses and plasmids. Bacillus subtilis presently is the best-characterized laboratory model for Gram-positive bacteria and also widely used for industrial production of enzymes, vitamins and antibiotics. In this study, we show that type II-A CRISPR-Cas system from Streptococcus thermophilus can be transferred into B. subtilis and provides heterologous protection against phage infection. We engineered a heterologous host by cloning S. thermophilus Cas9 and a spacer targeting bacteriophage SPP1 into the chromosome of B. subtilis, which does not harbor its own CRISPR-Cas systems. We found that the heterologous CRISPR-Cas system is functionally active in B. subtilis and provides resistance against bacteriophage SPP1 infection. The high efficiency of the acquired immunity against phage could be useful in generation of biotechnologically important B. subtilis strains with engineered chromosomes.

  10. Influence of heterologous MreB proteins on cell morphology of Bacillus subtilis.

    Science.gov (United States)

    Schirner, Kathrin; Errington, Jeff

    2009-11-01

    The prokaryotic cytoskeletal protein MreB is thought to govern cell shape by positioning the cell wall synthetic apparatus at growth sites in the cell. In rod-shaped bacteria it forms helical filaments that run around the periphery of the rod during elongation. Gram-positive bacteria often contain more than one mreB gene. Bacillus subtilis has three mreB-like genes, mreB, mbl and mreBH, the first two of which have been shown to be essential under normal growth conditions. Expression of an mreB homologue from the closely related organism Bacillus licheniformis did not have any effect on cell growth or morphology. In contrast, expression of mreB from the phylogenetically more distant bacterium Clostridium perfringens produced shape defects and ultimately cell death, due to disruption of the endogenous MreB cytoskeleton. However, expression of either mreB(B. licheniformis) (mreB(Bl)) or mreB(C. perfringens) (mreB(Cp)) was sufficient to confer a rod shape to B. subtilis deleted for the three mreB isologues, supporting the idea that the three proteins have largely redundant functions in cell morphogenesis. Expression of mreBCD(Bl) could fully compensate for the loss of mreBCD in B. subtilis and led to the formation of rod-shaped cells. In contrast, expression of mreBCD(Cp) was not sufficient to confer a rod shape to B. subtilis Delta mreBCD, indicating that a complex of these three cell shape determinants is not enough for cell morphogenesis of B. subtilis.

  11. From the genome sequence to the protein inventory of Bacillus subtilis.

    Science.gov (United States)

    Becher, Dörte; Büttner, Knut; Moche, Martin; Hessling, Bernd; Hecker, Michael

    2011-08-01

    Owing to the low number of proteins necessary to render a bacterial cell viable, bacteria are extremely attractive model systems to understand how the genome sequence is translated into actual life processes. One of the most intensively investigated model organisms is Bacillus subtilis. It has attracted world-wide research interest, addressing cell differentiation and adaptation on a molecular scale as well as biotechnological production processes. Meanwhile, we are looking back on more than 25 years of B. subtilis proteomics. A wide range of methods have been developed during this period for the large-scale qualitative and quantitative proteome analysis. Currently, it is possible to identify and quantify more than 50% of the predicted proteome in different cellular subfractions. In this review, we summarize the development of B. subtilis proteomics during the past 25 years. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Analysis of the Function of a Putative 2,3-Diphosphoglyceric Acid-Dependent Phosphoglycerate Mutase from Bacillus subtilis

    Science.gov (United States)

    Pearson, Claire L.; Loshon, Charles A.; Pedersen, Lotte B.; Setlow, Barbara; Setlow, Peter

    2000-01-01

    A Bacillus subtilis gene termed yhfR encodes the only B. subtilis protein with significant sequence similarity to 2,3-diphosphoglycerate-dependent phosphoglycerate mutases (dPGM). This gene is expressed at a low level during growth and sporulation, but deletion of yhfR had no effect on growth, sporulation, or spore germination and outgrowth. YhfR was expressed in and partially purified from Escherichia coli but had little if any PGM activity and gave no detectable PGM activity in B. subtilis. These data indicate that B. subtilis does not require YhfR and most likely does not require a dPGM. PMID:10869096

  13. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  14. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

    Science.gov (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  15. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

    Science.gov (United States)

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

    2016-08-01

    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  16. Thiopeptide antibiotics stimulate biofilm formation in Bacillus subtilis.

    Science.gov (United States)

    Bleich, Rachel; Watrous, Jeramie D; Dorrestein, Pieter C; Bowers, Albert A; Shank, Elizabeth A

    2015-03-10

    Bacteria have evolved the ability to produce a wide range of structurally complex natural products historically called "secondary" metabolites. Although some of these compounds have been identified as bacterial communication cues, more frequently natural products are scrutinized for antibiotic activities that are relevant to human health. However, there has been little regard for how these compounds might otherwise impact the physiology of neighboring microbes present in complex communities. Bacillus cereus secretes molecules that activate expression of biofilm genes in Bacillus subtilis. Here, we use imaging mass spectrometry to identify the thiocillins, a group of thiazolyl peptide antibiotics, as biofilm matrix-inducing compounds produced by B. cereus. We found that thiocillin increased the population of matrix-producing B. subtilis cells and that this activity could be abolished by multiple structural alterations. Importantly, a mutation that eliminated thiocillin's antibiotic activity did not affect its ability to induce biofilm gene expression in B. subtilis. We go on to show that biofilm induction appears to be a general phenomenon of multiple structurally diverse thiazolyl peptides and use this activity to confirm the presence of thiazolyl peptide gene clusters in other bacterial species. Our results indicate that the roles of secondary metabolites initially identified as antibiotics may have more complex effects--acting not only as killing agents, but also as specific modulators of microbial cellular phenotypes.

  17. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  18. Enhanced biomass production study on probiotic Bacillus subtilis ...

    African Journals Online (AJOL)

    user

    2010-11-22

    Nov 22, 2010 ... INTRODUCTION. Probiotic organisms find their potential use in food and ..... complex nutrients, temperature and pH on bacteriocin production by. Bacillus subtilis ... B, Gupta R (2004). Application of statistical experimental.

  19. [Sporulation or competence development? A genetic regulatory network model of cell-fate determination in Bacillus subtilis].

    Science.gov (United States)

    Lu, Zhenghui; Zhou, Yuling; Zhang, Xiaozhou; Zhang, Guimin

    2015-11-01

    Bacillus subtilis is a generally recognized as safe (GRAS) strain that has been widely used in industries including fodder, food, and biological control. In addition, B. subtilis expression system also plays a significant role in the production of industrial enzymes. However, its application is limited by its low sporulation frequency and transformation efficiency. Immense studies have been done on interpreting the molecular mechanisms of sporulation and competence development, whereas only few of them were focused on improving sporulation frequency and transformation efficiency of B. subtilis by genetic modification. The main challenge is that sporulation and competence development, as the two major developmental events in the stationary phase of B. subtilis, are regulated by the complicated intracellular genetic regulatory systems. In addition, mutual regulatory mechanisms also exist in these two developmental events. With the development of genetic and metabolic engineering, constructing genetic regulatory networks is currently one of the most attractive research fields, together with the genetic information of cell growth, metabolism, and development, to guide the industrial application. In this review, the mechanisms of sporulation and competence development of B. subtilis, their interactions, and the genetic regulation of cell growth were interpreted. In addition, the roles of these regulatory networks in guiding basic and applied research of B. subtilis and its related species were discussed.

  20. Bacillus subtilis and yeast cell wall improve the intestinal health of broilers challenged by Clostridium perfringens.

    Science.gov (United States)

    Li, Z; Wang, W; Lv, Z; Liu, D; Guo, Y

    2017-12-01

    1. The objective was to investigate the effects of Bacillus subtilis, yeast cell wall (YCW) and their combination on intestinal health of broilers challenged by Clostridium perfringens over a 21-d period. 2. Using a 5 × 2 factorial arrangement of treatments, 800 1-d-old male Cobb 500 broilers were used to study the effects of feed additives (without additive or with zinc bacitracin, B. subtilis, YCW, and the combination of B. subtilis and YCW), pathogen challenge (without or with Clostridium perfringens challenge), and their interactive effects. 3. C. perfringens infection increased intestinal lesions scores, damaged intestinal histomorphology, increased serum endotoxin concentration, cytokine mRNA expression and intestinal population of C. perfringens and Escherichia coli and decreased ileal bifidobacteria numbers. The 4 additives decreased serum endotoxin. Zinc bacitracin tended to decrease cytokine mRNA expression and the intestinal number of C. perfringens and E. coli. B. subtilis, YCW and their combination increased cytokine mRNA expression. B. subtilis and YCW decreased the number of C. perfringens and E. coli in the ileum, and their combination decreased pathogens numbers in the ileum and caecum. 4. In conclusion, B. subtilis, YCW and their combination improved the intestinal health of NE-infected broilers, and could be potential alternatives to antibiotics.

  1. A microbial transformation using Bacillus subtilis B7-S to produce natural vanillin from ferulic acid.

    Science.gov (United States)

    Chen, Peng; Yan, Lei; Wu, Zhengrong; Li, Suyue; Bai, Zhongtian; Yan, Xiaojuan; Wang, Ningbo; Liang, Ning; Li, Hongyu

    2016-02-04

    Bacillus subtilis strain B7-S screened from18 strains is an aerobic, endospore-forming, model organism of Gram-positive bacteria which is capable to form vanillin during ferulic acid bioconversion. The bioconversion of ferulic acid to vanillin by Bacillus subtilis B7-S (B. subtilis B7-S) was investigated. Based on our results, the optimum bioconversion conditions for the production of vanillin by B. subtilis B7-S can be summarized as follows: temperature 35 °C; initial pH 9.0; inoculum volume 5%; ferulic acid concentration 0.6 g/L; volume of culture medium 20%; and shaking speed 200 r/min. Under these conditions, several repeated small-scale batch experiments showed that the maximum conversion efficiency was 63.30% after 3 h of bioconversion. The vanillin products were confirmed by spectral data achieved from UV-vis, inductively coupled plasma atomic emission spectroscope (ICP-AES) and Fourier transform infrared spectrometer (FT-IR) spectra. Scanning electron microscopy (SEM) and transmission electron spectroscopy (TEM) results confirmed that the cell surface of B. subtilis plays a role in the induction of ferulic acid tolerance. These results demonstrate that B. subtilis B7-S has the potential for use in vanillin production through bioconversion of ferulic acid.

  2. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Science.gov (United States)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  3. Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

    Science.gov (United States)

    Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

    2001-01-01

    Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

  4. Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120.

    Science.gov (United States)

    Frías, José E; Flores, Enrique

    2015-07-01

    Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

  5. A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

    Science.gov (United States)

    Tadmor, Arbel

    2009-03-01

    In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

  6. CysB-dependent upregulation of the Salmonella Typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress.

    Science.gov (United States)

    Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando

    2015-02-27

    It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Response of Bacillus cereus ATCC 14579 to challenges with sublethal concentrations of enterocin AS-48

    Directory of Open Access Journals (Sweden)

    Gálvez Antonio

    2009-10-01

    Full Text Available Abstract Background Enterocin AS-48 is produced by Enterococcus faecalis S48 to compete with other bacteria in their environment. Due to its activity against various Gram positive and some Gram negative bacteria it has clear potential for use as a food preservative. Here, we studied the effect of enterocin AS-48 challenges on vegetative cells of Bacillus cereus ATCC 14579 by use of transcriptome analysis. Results Of the 5200 genes analysed, expression of 24 genes was found to change significantly after a 30 min treatment with a subinhibitory bacteriocin concentration of 0.5 μg/ml. Most of up-regulated genes encode membrane-associated or secreted proteins with putative transmembrane segments or signal sequences, respectively. One operon involved in arginine metabolism was significantly downregulated. The BC4206-BC4207 operon was found to be the most upregulated target in our experiments. BC4206 codes for a PadR type transcriptional regulator, while BC4207 codes for a hypothetical membrane protein. The operon structure and genes are conserved in B. cereus and B. thuringiensis species, but are not present in B. anthracis and B. subtilis. Using real-time qPCR, we show that these genes are upregulated when we treated the cells with AS-48, but not upon nisin treatment. Upon overexpression of BC4207 in B. cereus, we observed an increased resistance against AS-48. Expression of BC4207 in B. subtilis 168, which lacks this operon also showed increased resistance against AS-48. Conclusion BC4207 membrane protein is involved in the resistance mechanism of B. cereus cells against AS-48.

  8. Improvement of iturin A production in Bacillus subtilis ZK0 by overexpression of the comA and sigA genes.

    Science.gov (United States)

    Zhang, Z; Ding, Z T; Zhong, J; Zhou, J Y; Shu, D; Luo, D; Yang, J; Tan, H

    2017-06-01

    Bacillus subtilis ZK0, which was isolated from cotton, produces a type of lipopeptide antibiotic iturin A that inhibits the growth of pathogenic fungi on agricultural crops. However, the low level of iturin A production by B. subtilis ZK0 does not support its large-scale application. In this study, B. subtilis ZK0 was subjected to genetic manipulation to improve iturin A production. By the independent or simultaneous overexpression of two regulatory genes (comA and sigA), iturin A production by B. subtilis ZK0 was significantly increased. When both genes were simultaneously overexpressed under optimal conditions, iturin A production increased up to 215 mg l -1 (an approximate 43-fold increase compared with B. subtilis ZK0). Moreover, overexpression of both genes was unexpectedly found to inhibit biofilm formation by B. subtilis ZK0, indicating that the phenomenon of 'stuck fermentation' would be avoided during B. subtilis ZK0 fermentation. In conclusion, a genetic manipulation method that improves iturin A production and inhibits biofilm formation in B. subtilis ZK0 is reported for the first time and this method has the potential to be widely applied in B. subtilis ZK0 commercial fermentation. This study provides new perspectives on improving iturin A production by Bacillus subtilis. Our newly engineered strains could be applied to commercial fermentation by enhancing yields of iturin A and reducing the rate of 'stuck fermentation'. Increased production would facilitate more widespread application of this powerful antibiotic. © 2017 The Society for Applied Microbiology.

  9. Translation Control of Swarming Proficiency in Bacillus subtilis by 5-Amino-pentanolylated Elongation Factor P.

    Science.gov (United States)

    Rajkovic, Andrei; Hummels, Katherine R; Witzky, Anne; Erickson, Sarah; Gafken, Philip R; Whitelegge, Julian P; Faull, Kym F; Kearns, Daniel B; Ibba, Michael

    2016-05-20

    Elongation factor P (EF-P) accelerates diprolyl synthesis and requires a posttranslational modification to maintain proteostasis. Two phylogenetically distinct EF-P modification pathways have been described and are encoded in the majority of Gram-negative bacteria, but neither is present in Gram-positive bacteria. Prior work suggested that the EF-P-encoding gene (efp) primarily supports Bacillus subtilis swarming differentiation, whereas EF-P in Gram-negative bacteria has a more global housekeeping role, prompting our investigation to determine whether EF-P is modified and how it impacts gene expression in motile cells. We identified a 5-aminopentanol moiety attached to Lys(32) of B. subtilis EF-P that is required for swarming motility. A fluorescent in vivo B. subtilis reporter system identified peptide motifs whose efficient synthesis was most dependent on 5-aminopentanol EF-P. Examination of the B. subtilis genome sequence showed that these EF-P-dependent peptide motifs were represented in flagellar genes. Taken together, these data show that, in B. subtilis, a previously uncharacterized posttranslational modification of EF-P can modulate the synthesis of specific diprolyl motifs present in proteins required for swarming motility. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Potential application of cyclic lipopeptide biosurfactants produced by Bacillus subtilis strains in laundry detergent formulations.

    Science.gov (United States)

    Mukherjee, A K

    2007-09-01

    Crude cyclic lipopeptide (CLP) biosurfactants from two Bacillus subtilis strains (DM-03 and DM-04) were studied for their compatibility and stability with some locally available commercial laundry detergents. CLP biosurfactants from both B. subtilis strains were stable over the pH range of 7.0-12.0, and heating them at 80 degrees C for 60 min did not result in any loss of their surface-active property. Crude CLP biosurfactants showed good emulsion formation capability with vegetable oils, and demonstrated excellent compatibility and stability with all the tested laundry detergents. CLP biosurfactants from B. subtilis strains act additively with other components of the detergents to further improve the wash quality of detergents. The thermal resistance and extreme alkaline pH stability of B. subtilis CLP biosurfactants favour their inclusion in laundry detergent formulations. This study has great significance because it is already known that microbial biosurfactants are considered safer alternative to chemical or synthetic surfactants owing to lower toxicity, ease of biodegradability and low ecological impact. The present study provides further evidence that CLP biosurfactants from B. subtilis strains can be employed in laundry detergents.

  11. Lysinibacillus fusiformis M5 induces increased complexity in Bacillus subtilis 168 colony biofilms via hypoxanthine

    DEFF Research Database (Denmark)

    Gallegos-Monterrosa, Ramses; Kankel, Stefanie; Götze, Sebastian

    2017-01-01

    to identify soil bacteria, which induce architectural changes in biofilm colonies when cocultured with B. subtilis. We identified the soil bacterium Lysinibacillus fusiformis M5 as inducer of wrinkle-formation in B. subtilis colonies mediated by a diffusible signaling molecule. This compound was isolated......O, but not PbuG, is necessary for hypoxanthine to induce an increase in wrinkle formation of B. subtilis biofilm colonies. Our results suggest that hypoxanthine-stimulated wrinkle development is not due to a direct induction of biofilm-related gene expression, but rather caused by the excess of hypoxanthine...... within B. subtilis cells, which may lead to cell stress and death. Importance Biofilms are a bacterial lifestyle with high relevance regarding diverse human activities. Biofilms can be favorable, for instance in crop protection. In nature, biofilms are commonly found as multispecies communities...

  12. Comparative genome analysis of Bacillus cereus group genomes withBacillus subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Iain; Sorokin, Alexei; Kapatral, Vinayak; Reznik, Gary; Bhattacharya, Anamitra; Mikhailova, Natalia; Burd, Henry; Joukov, Victor; Kaznadzey, Denis; Walunas, Theresa; D' Souza, Mark; Larsen, Niels; Pusch,Gordon; Liolios, Konstantinos; Grechkin, Yuri; Lapidus, Alla; Goltsman,Eugene; Chu, Lien; Fonstein, Michael; Ehrlich, S. Dusko; Overbeek, Ross; Kyrpides, Nikos; Ivanova, Natalia

    2005-09-14

    Genome features of the Bacillus cereus group genomes (representative strains of Bacillus cereus, Bacillus anthracis and Bacillus thuringiensis sub spp israelensis) were analyzed and compared with the Bacillus subtilis genome. A core set of 1,381 protein families among the four Bacillus genomes, with an additional set of 933 families common to the B. cereus group, was identified. Differences in signal transduction pathways, membrane transporters, cell surface structures, cell wall, and S-layer proteins suggesting differences in their phenotype were identified. The B. cereus group has signal transduction systems including a tyrosine kinase related to two-component system histidine kinases from B. subtilis. A model for regulation of the stress responsive sigma factor sigmaB in the B. cereus group different from the well studied regulation in B. subtilis has been proposed. Despite a high degree of chromosomal synteny among these genomes, significant differences in cell wall and spore coat proteins that contribute to the survival and adaptation in specific hosts has been identified.

  13. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    NARCIS (Netherlands)

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

    2006-01-01

    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  14. Towards a complete proteome of Bacillus subtilis : cytosolic, cell wall-associated and extracellular proteins

    NARCIS (Netherlands)

    Antelmann, Haike; van Dijl, Jan Maarten; Hecker, Michael

    2003-01-01

    Bacillus subtilis is widely regarded as a model organism for the functional genome analysis of Gram-positive bacteria. This is based on two factors: first, the genome sequence that predicts about 4100 open reading frames was completed in 1997 (1) and second, B. subtilis strain 168 is highly amenable

  15. Effect of Bacillus subtilis microecological probiotics on livestock breeding

    Directory of Open Access Journals (Sweden)

    Xiaohui ZHOU

    2016-10-01

    Full Text Available As a kind of green and healthy microecologics, Bacillus subtilis could balance the intestinal flora, promote the nutrient absorption and enhance immunity. Microecologics is one of the ideal antibiotics alternative, which are effective in preventing and treating animal disease and promoting the growth and development of the animal. Because of its advantages, such as no toxin side effect and no residual or drug-resistant, microecologics has been used in livestock breeding widely. Here, we concluded the characteristics and mechanism of Bacillus subtilis,elaborated application of microecologics on livestock breeding, discussed its problems and suggested its solved methods. In the end, the future of microecologics was expected in order to provide a reference for subsequent livestock breeding.

  16. Characterization of high hydrostatic pressure-injured Bacillus subtilis cells.

    Science.gov (United States)

    Inaoka, Takashi; Kimura, Keitarou; Morimatsu, Kazuya; Yamamoto, Kazutaka

    2017-06-01

    High hydrostatic pressure (HHP) affects various cellular processes. Using a sporulation-deficient Bacillus subtilis strain, we characterized the properties of vegetative cells subjected to HHP. When stationary-phase cells were exposed to 250 MPa of HHP for 10 min at 25 °C, approximately 50% of cells were viable, although they exhibited a prolonged growth lag. The HHP-injured cells autolyzed in the presence of NaCl or KCl (at concentrations ≥100 mM). Superoxide dismutase slightly protected the viability of HHP-treated cells, whereas vegetative catalases had no effect. Thus, unlike HHP-injured Escherichia coli, oxidative stress only slightly affected vegetative B. subtilis subjected to HHP.

  17. An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans.

    Science.gov (United States)

    Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine

    2014-10-01

    The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Carbohydrate metabolism in Bacillus subtilis

    International Nuclear Information System (INIS)

    Riedel, K.

    1980-01-01

    The glucose metabolism via the glycolytic pathway as well as via the oxidative and inoxidative hexose monophosphate pathways in Bacillus subtilis was studied applying 1- 14 C- and 6- 14 C-glucose, respectively, and determining labelled CO 2 and RNA. A method for calculating the catabolic pathways was developed. In nonproliferating cultures glucose is catabolized to 62% via the glycolytic pathway, to 20% via the oxidative, and to 18% via the inoxidative pathway

  19. High Pressure Germination of Bacillus subtilis Spores with Alterations in Levels and Types of Germination Proteins

    Science.gov (United States)

    2014-01-01

    1ITLE AND SUBTITLE 5a CONTRACTNUMBER High pressure germination of Bacillus subtilis spores with W911NF-09-l-0286 alterations in levels and types of...A moderate high pressure (mHP) of 150 megaPascals (MPa) triggers germination of Bacillus subtilis spores via germinant receptors (GRs), while...germination by a very high pressure (vHP) of550 MPa is GR-independent. The mHP and vHP germination of Bacillus subtilis spores with different levels ofGRs

  20. Effects of Bacillus subtilis natto and Different Components in Culture on Rumen Fermentation and Rumen Functional Bacteria In Vitro.

    Science.gov (United States)

    Sun, Peng; Li, Jinan; Bu, Dengpan; Nan, Xuemei; Du, Hong

    2016-05-01

    This study was to investigate the effects of live or autoclaved Bacillus subtilis natto, their fermented products and media on rumen fermentation and rumen functional bacteria in vitro. Rumen fluid from three multiparous lactating Holstein cows was combined and transferred into serum bottles after diluted. Fifteen serum bottles were divided into five treatments, which were designed as following: CTR (the fermentation of 0.5 g TMR and ruminal fluids from dairy cows), LBS (CTR plus a minimum of 10(11) cfu live Bacillus subtilis natto), ABS (CTR plus a minimum of 10(11) cfu autoclaved Bacillus subtilis natto), BSC (CTR plus 1 ml Bacillus subtilis natto fermentation products without bacteria), and BSM (CTR plus 1 ml liquid fermentation medium). When separated from the culture, live Bacillus subtilis natto individually increased the concentrations of ammonia-N (P Bacillus subtilis natto has the similar function with the live bacteria except for the ratio of acetate and propionate. Except B. fibrisolvens, live or autoclaved Bacillus subtilis natto did not influence or decreased the 16S rRNA gene quantification of the detected bacteria. BSC and BSM altered the relative expression of certain functional bacteria in the rumen. These results indicated that it was Bacillus subtilis natto thalli that played the important role in promoting rumen fermentation when applied as a probiotic in dairy ration.

  1. [New antibiotics produced by Bacillus subtilis strains].

    Science.gov (United States)

    Malanicheva, I A; Kozlov, D G; Efimenko, T A; Zenkova, V A; Kastrukha, G S; Reznikova, M I; Korolev, A M; Borshchevskaia, L N; Tarasova, O D; Sineokiĭ, S P; Efremenkova, O V

    2014-01-01

    Two Bacillus subtilis strains isolated from the fruiting body of a basidiomycete fungus Pholiota squarrosa exhibited a broad range of antibacterial activity, including those against methicillin-resistant Staphylococcus aureus INA 00761 (MRSA) and Leuconostoc mes6nteroides VKPM B-4177 resistant to glycopep-> tide antibiotics, as well as antifungal activity. The strains were identified as belonging to the "B. subtilis" com- plex based on their morphological and physiological characteristics, as well as by sequencing of the 16S rRNA gene fragments. Both strains (INA 01085 and INA 01086) produced insignificant amounts of polyene antibiotics (hexaen and pentaen, respectively). Strain INA 01086 produced also a cyclic polypeptide antibiotic containing Asp, Gly, Leu, Pro, Tyr, Thr, Trp, and Phe, while the antibiotic of strain INA 01085 contained, apart from these, two unidentified nonproteinaceous amino acids. Both polypeptide antibiotics were new compounds efficient against gram-positive bacteria and able to override the natural bacterial antibiotic resistance.

  2. Cannibalism enhances biofilm development in Bacillus subtilis.

    Science.gov (United States)

    López, Daniel; Vlamakis, Hera; Losick, Richard; Kolter, Roberto

    2009-11-01

    Cannibalism is a mechanism to delay sporulation in Bacillus subtilis. Cannibal cells express the skf and sdp toxin systems to lyse a fraction of their sensitive siblings. The lysed cells release nutrients that serve to feed the community, effectively delaying spore formation. Here we provide evidence that the subpopulation of cells that differentiates into cannibals is the same subpopulation that produces the extracellular matrix that holds cells together in biofilms. Cannibalism and matrix formation are both triggered in response to the signalling molecule surfactin. Nutrients released by the cannibalized cells are preferentially used by matrix-producing cells, as they are the only cells expressing resistance to the Skf and Sdp toxins. As a result this subpopulation increases in number and matrix production is enhanced when cannibalism toxins are produced. The cannibal/matrix-producing subpopulation is also generated in response to antimicrobials produced by other microorganisms and may thus constitute a defense mechanism to protect B. subtilis from the action of antibiotics in natural settings.

  3. Effects of dietary inulin and heat-inactivated Bacillus subtilis on gilthead seabream (Sparus aurata L.) innate immune parameters.

    Science.gov (United States)

    Cerezuela, R; Cuesta, A; Meseguer, J; Esteban, M A

    2012-03-01

    In the present study, a feeding trial was conducted to evaluate the effect of inulin and heat-inactivated Bacillus subtilis, single or combined, on several innate immune activities of gilthead seabream (Sparus aurata). Forty-eight specimens were randomly assigned to four dietary treatments: 0 (control), inulin (10 g/kg, prebiotic group), B. subtilis (10(7) cfu/g, probiotic group), or B. subtilis + inulin (10(7) cfu/g + 10 g/kg, synbiotic group). After two and four weeks, six fish of each group were sampled, with the main innate immune parameters (natural haemolytic complement activity, serum and leucocyte peroxidase, phagocytosis, respiratory burst, and cytotoxic activities) being determined. Inulin or heat-inactivated B. subtilis failed to significantly stimulate the innate immune parameters assayed, although some activities showed no significant increase through these treatments. A combination of inulin and B. subtilis resulted in an increase of such parameters, with the haemolytic complement activity being the only one significantly stimulated. To conclude, inulin and B. subtilis, when administered as a synbiotic, have a synergistic effect and enhance some innate immune parameters of gilthead seabream.

  4. Growth of and valine production by a Bacillus subtilis mutant in the small intestine of pigs

    DEFF Research Database (Denmark)

    Canibe, Nuria; Poulsen, Henrik Vestergaard; Nørgaard, Jan Værum

    2016-01-01

    :Lys of 0.63:1 (Neg), 2) the Neg diet with added Bacillus subtilis-valine (1.28 × 108 cfu/g feed) (+Bac), and 3) the Neg diet with added L-Val to a Val:Lys of 0.69:1 (+Val). Eighteen gilts (6 on each treatment) with initial weights of ∼15 kg were fed the diets for 23 d before the animals were euthanized...... and samples from the small intestine were obtained. The number of B. subtilis cfu in digesta was higher in the +Bac group than in the Neg group (P subtilis cfu were detected in the Neg group, whereas numbers between 3.4 and 4.4 log cfu/g and numerically higher Val and Lys...... concentrations were measured in the +Bac group. Short-term in vitro incubations of digesta showed a decrease (P ≤ 0.03) in the number of B. subtilis cfu over time for the +Bac group and no difference in the rate of Val production compared to that in the Neg group. In conclusion, more B. subtilis cfu were present...

  5. Digestibility and fecal characteristics of dogs fed with Bacillus subtilis in diet

    OpenAIRE

    Félix,Ananda Portella; Netto,Marina Volanski Teixeira; Murakami,Fabiane Yukiko; Brito,Cleusa Bernardete Marcon de; Oliveira,Simone Gisele de; Maiorka,Alex

    2010-01-01

    Considering the benefice demonstrated by the modulating action of probiotics on the host intestinal microbiota, this study aimed to evaluate diet digestibility and fecal characteristics of dogs fed with diets supplemented with Bacillus subtilis (C-3102). Twelve young Beagle dogs were distributed in a completely randomized experimental design consisting of two treatments: diet with no addition or with the addition of 0.01% Bacillus subtilis (C-3102). Dogs passed through 25 days of adaptation t...

  6. EFEKTIVITAS BIOPESTISIDA BACILLUS SUBTILIS BNt 8 DAN PESTISIDA NABATI UNTUK PENGENDALIAN PENYAKIT HAWAR PELEPAH DAN UPIH DAUN JAGUNG

    Directory of Open Access Journals (Sweden)

    Nurasiah Djaenuddin

    2017-05-01

    Full Text Available Effectiveness of the biopesticide of Bacillus subtilis BNt 8 and botanical pesticide in controlling banded leaf and sheath blight disease on maize. Banded leaf and sheath blight disease (BLSB caused by the fungus Rhizoctonia solani is difficult to control because it pertained soil borne fungus that can survive in a long time in the soil. Control the disease with synthetic pesticide causing contamination to the environment, so that an environmentally friendly alternative control is needed. This study aimed to obtain a Bacillus subtilis formulation as biological agents and selected botanical pesticides that effective to control BLSB in the field. The study was conducted at the Plant Pathology Laboratory of Indonesia Cereals Research Institute in Maros and at the Bajeng Experimental Farm in Gowa, held from February to August 2015. The reatments consists of several botanical pesticides, B. subtilis formulation, a synthetic fungicide, positive and negative controls. In vitro test was inhibition test between botanical pesticide with R. solani and antagonistic test between the B. subtilis and botanical pesticides, each of them consists of 6 treatments and 3 replications, while the field activity consists of test of effectiveness of single treatment and combination between B. subtilis formulation and botanical pesticides. The results showed that combination of formulated B. subtilis with botanical pesticide of cloves leaves, betel leaves, and turmeric were not significantly different from single treatment of formulated B. subtilis and botanical pesticides. Formulated B. subtilis suppressed the severity of BLSB as much as 39.1% and yield reached 8.4 t/ha.

  7. Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

    Science.gov (United States)

    Ghosh, Semanti; Bagchi, Angshuman

    2015-12-01

    Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

  8. Analysis of the Effects of a gerP Mutation on the Germination of Spores of Bacillus subtilis

    Science.gov (United States)

    2012-11-01

    REPORT Analysis of the effects of a gerP mutation on the germination of spores of Bacillus subtilis 14. ABSTRACT 16. SECURITY CLASSIFICATION OF... Bacillus subtilis spores with a gerP mutation triggered spore germination via nutrient germinant receptors (GRs) slowly, although this defect was...gerP, Bacillus subtilis , dipicolinic acid Xuan Y. Butzin, Anthony J. Troiano, William H. Coleman, Keren K. Griffiths, Christopher J. Doona, Florence E

  9. Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

    Science.gov (United States)

    Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

    2017-11-01

    Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

  10. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Science.gov (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  11. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  12. Production of alkaline proteases by alkalophilic Bacillus subtilis ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-11-23

    Nov 23, 2016 ... Key words: Production, alkaline protease, Bacillus subtilis, animal wastes, enzyme activity. ... Generally, alkaline proteases are produced using submerged fermentation .... biopolymer concentrations were reported to have an influence ... adding nitrogenous compounds stimulate microorganism growth and ...

  13. The sensitivity of Bacillus subtilis to diverse antimicrobial compounds is influenced by Abh.

    Science.gov (United States)

    Murray, Ewan J; Stanley-Wall, Nicola R

    2010-12-01

    Abh is a transition state regulator of Bacillus subtilis that controls biofilm formation and the production of several diverse antimicrobial compounds. Using a high-throughput non-biased technique, we show for the first time that Abh influences the sensitivity of B. subtilis to diverse antimicrobial compounds. Following up on these findings with a combination of classical genetics and antibiotic susceptibility assays, we demonstrate that Abh influences cellular processes such as the remodelling of the cell wall. We present data demonstrating that the extracytoplasmic function sigma factor σ(X) controls resistance to β-lactam antibiotics by activating abh transcription. Downstream from Abh, activation of slrR expression by Abh is responsible for controlling the sensitivity of B. subtilis to such antibiotics due to the role that SlrR plays in regulating autolysin biosynthesis. The abh mutant additionally exhibits increased resistance to aminoglycoside antimicrobials. We confirm that aminoglycoside killing of B. subtilis is likely to be caused by oxidative damage but rule out the possibility that the increased resistance of the abh mutant to aminoglycosides is due to a general increase in resistance to oxidative stress.

  14. Metabolic pathway analysis and kinetic studies for production of nattokinase in Bacillus subtilis.

    Science.gov (United States)

    Unrean, Pornkamol; Nguyen, Nhung H A

    2013-01-01

    We have constructed a reaction network model of Bacillus subtilis. The model was analyzed using a pathway analysis tool called elementary mode analysis (EMA). The analysis tool was used to study the network capabilities and the possible effects of altered culturing conditions on the production of a fibrinolytic enzyme, nattokinase (NK) by B. subtilis. Based on all existing metabolic pathways, the maximum theoretical yield for NK synthesis in B. subtilis under different substrates and oxygen availability was predicted and the optimal culturing condition for NK production was identified. To confirm model predictions, experiments were conducted by testing these culture conditions for their influence on NK activity. The optimal culturing conditions were then applied to batch fermentation, resulting in high NK activity. The EMA approach was also applied for engineering B. subtilis metabolism towards the most efficient pathway for NK synthesis by identifying target genes for deletion and overexpression that enable the cell to produce NK at the maximum theoretical yield. The consistency between experiments and model predictions proves the feasibility of EMA being used to rationally design culture conditions and genetic manipulations for the efficient production of desired products.

  15. Interspecies interactions that result in Bacillus subtilis forming biofilms are mediated mainly by members of its own genus.

    Science.gov (United States)

    Shank, Elizabeth A; Klepac-Ceraj, Vanja; Collado-Torres, Leonardo; Powers, Gordon E; Losick, Richard; Kolter, Roberto

    2011-11-29

    Many different systems of bacterial interactions have been described. However, relatively few studies have explored how interactions between different microorganisms might influence bacterial development. To explore such interspecies interactions, we focused on Bacillus subtilis, which characteristically develops into matrix-producing cannibals before entering sporulation. We investigated whether organisms from the natural environment of B. subtilis--the soil--were able to alter the development of B. subtilis. To test this possibility, we developed a coculture microcolony screen in which we used fluorescent reporters to identify soil bacteria able to induce matrix production in B. subtilis. Most of the bacteria that influence matrix production in B. subtilis are members of the genus Bacillus, suggesting that such interactions may be predominantly with close relatives. The interactions we observed were mediated via two different mechanisms. One resulted in increased expression of matrix genes via the activation of a sensor histidine kinase, KinD. The second was kinase independent and conceivably functions by altering the relative subpopulations of B. subtilis cell types by preferentially killing noncannibals. These two mechanisms were grouped according to the inducing strain's relatedness to B. subtilis. Our results suggest that bacteria preferentially alter their development in response to secreted molecules from closely related bacteria and do so using mechanisms that depend on the phylogenetic relatedness of the interacting bacteria.

  16. Study of UV-induced mutagenesis in Bacillus subtilis

    International Nuclear Information System (INIS)

    Filippov, V.D.; Lotareva, O.V.

    1978-01-01

    The mechanism of UV-induced mutagenesis was studied in Bacillus subtilis departing from the assumption that a lower yield of UV-induced mutations should be found in mutants deficient in the recombination if production of mutations is coupled with the recombination process. Three recombination-deficient strains were used: two (recA and recF) with defects in different recombination pathways and the third (recB) has a block at a stage common for both of them. UV light induced reversions to prototrophy in recB cells and did not in recA and recF strains. Direct mutations, which confer to the cell additional growth requirements, were induced by UV light in recA and recF mutants. It is concluded that UV-induced mutagenesis in B subtilis is independent of the two known recombination mechanisms

  17. Bacillus subtilis and surfactin inhibit the transmissible gastroenteritis virus from entering the intestinal epithelial cells.

    Science.gov (United States)

    Wang, Xiaoqing; Hu, Weiwei; Zhu, Liqi; Yang, Qian

    2017-04-28

    Intestinal epithelial cells are the targets for transmissible gastroenteritis (TGE) virus (TGEV) infection. It is urgent to develop a novel candidate against TGEV entry. Bacillus subtilis is a probiotic with excellent anti-microorganism properties and one of its secretions, surfactin, has been regarded as a versatile weapon for most plant pathogens, especially for the enveloped virus. We demonstrate for the first time that B. subtilis OKB105 and its surfactin can effectively inhibit one animal coronavirus, TGEV, entering the intestinal porcine epithelial cell line (IPEC-J2). Then, several different experiments were performed to seek the might mechanisms. The plaque assays showed that surfactant could reduce the plaque generation of TGEV in a dose-dependent manner. Meanwhile, after incubation with TGEV for 1.5 h, B. subtilis could attach TGEV particles to their surface so that the number of virus to bind to the host cells was declined. Furthermore, our data showed that the inhibition of B. subtilis was closely related to the competition with TGEV for the viral entry receptors, including epidermal growth factor receptor (EGFR) and aminopeptidase N (APN) protein. In addition, Western blotting and apoptosis analysis indicated that B. subtilis could enhance the resistance of IPEC-J2 cells by up-regulating the expression of toll-like receptor (TLR)-6 and reducing the percentage of apoptotic cells. Taken together, our results suggest that B. subtilis OKB105 and its surfactin can antagonize TGEV entry in vitro and may serve as promising new candidates for TGEV prevention. © 2017 The Author(s).

  18. Strain Screening from Traditional Fermented Soybean Foods and Induction of Nattokinase Production in Bacillus subtilis MX-6.

    Science.gov (United States)

    Man, Li-Li; Xiang, Dian-Jun; Zhang, Chun-Lan

    2018-02-06

    The plasminogen-free fibrin plate assay method was used to isolate Bacillus subtilis MX-6, a strain with high production of nattokinase from Chinese douchi. The presence of aprN, a gene-encoding nattokinase, was verified with PCR method. The predicted amino acid sequence was aligned with homologous sequences, and a phylogenetic tree was constructed. Nattokinase was sublimated with ammonium sulfate, using a DEAE-Sepharose Fast Flow column, a CM-Sepharose Fast Flow column and a Sephadex G-75 gel filtration column. SDS-PAGE analysis indicated that the molecular weight of the purified nattokinase from Bacillus subtilis MX-6 was about 28 kDa. Fermentation of Bacillus subtilis MX-6 nattokinase showed that nattokinase production was maximized after 72 h; the diameter of clear zone reached 21.60 mm on the plasminogen-free fibrin plate. Nattokinase production by Bacillus subtilis MX-6 increased significantly after supplementation with supernatant I, supernatant II and soy peptone but decreased substantially after the addition of amino acids. This result indicated that the nattokinase production by B. subtilis MX-6 might be induced by soybean polypeptides. The addition of MgSO 4 and CaCl 2 increased B. subtilis MX-6 nattokinase production.

  19. Bio-remediation of acephate-Pb(II) compound contaminants by Bacillus subtilis FZUL-33.

    Science.gov (United States)

    Lin, Wenting; Huang, Zhen; Li, Xuezhen; Liu, Minghua; Cheng, Yangjian

    2016-07-01

    Removal of Pb(2+) and biodegradation of organophosphorus have been both widely investigated respectively. However, bio-remediation of both Pb(2+) and organophosphorus still remains largely unexplored. Bacillus subtilis FZUL-33, which was isolated from the sediment of a lake, possesses the capability for both biomineralization of Pb(2+) and biodegradation of acephate. In the present study, both Pb(2+) and acephate were simultaneously removed via biodegradation and biomineralization in aqueous solutions. Batch experiments were conducted to study the influence of pH, interaction time and Pb(2+) concentration on the process of removal of Pb(2+). At the temperature of 25°C, the maximum removal of Pb(2+) by B.subtilis FZUL-33 was 381.31±11.46mg/g under the conditions of pH5.5, initial Pb(2+) concentration of 1300mg/L, and contact time of 10min. Batch experiments were conducted to study the influence of acephate on removal of Pb(2+) and the influence of Pb(2+) on biodegradation of acephate by B.subtilis FZUL-33. In the mixed system of acephate-Pb(2+), the results show that biodegradation of acephate by B.subtilis FZUL-33 released PO4(3+), which promotes mineralization of Pb(2+). The process of biodegradation of acephate was affected slightly when the concentration of Pb(2+) was below 100mg/L. Based on the results, it can be inferred that the B.subtilis FZUL-33 plays a significant role in bio-remediation of organophosphorus-heavy metal compound contamination. Copyright © 2016. Published by Elsevier B.V.

  20. TRANSDUCTION OF BACILLUS LICHENIFORMIS AND BACILLUS SUBTILIS BY EACH OF TWO PHAGES1

    Science.gov (United States)

    Taylor, Martha J.; Thorne, Curtis B.

    1963-01-01

    Taylor, Martha J. (U.S. Army Biological Laboratories, Fort Detrick, Frederick, Md.) and Curtis B. Thorne. Transduction of Bacillus licheniformis and Bacillus subtilis by each of two phages. J. Bacteriol. 86:452–461. 1963.—A second transducing bacteriophage, designated SP-15, was isolated from the same soil-sample culture filtrate that supplied the Bacillus subtilis transducing phage, SP-10, reported earlier from this laboratory. SP-10 and SP-15 differ serologically and in several other respects, but share the ability to propagate on B. subtilis W-23-Sr (streptomycin-resistant) and B. licheniformis ATCC 9945a, and to mediate general transduction in either species when propagated homologously. Attempts to transduce between the species have failed. SP-10 forms plaques readily on both W-23-Sr and 9945a; SP-15 forms minute plaques on W-23-Sr and has shown no evidence of any lytic activity on 9945a. Maximal recoveries of prototrophic colonies from mixtures of SP-10 with auxotrophs of either W-23-Sr or 9945a were obtained only when excess phage was neutralized by post-transduction treatment with specific phage antiserum. Such treatment was not necessary for maximal recovery of transductants effected by SP-15. Unlike SP-10, SP-15 propagated on W-23-Sr did not transduce B. subtilis 168 (indole−). SP-15 transduced B. licheniformis more efficiently than did SP-10. Neither phage was able to transduce B. licheniformis as efficiently as it transduced B. subtilis. The differing influences of multiplicity of infection were compared for the two phages in both species. PMID:14066421

  1. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

    Science.gov (United States)

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

    2015-01-01

    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  2. Isolation and characterization of lipopeptide antibiotics produced by Bacillus subtilis.

    Science.gov (United States)

    Chen, H; Wang, L; Su, C X; Gong, G H; Wang, P; Yu, Z L

    2008-09-01

    Antibiotics from Bacillus subtilis JA show strong pathogen inhibition ability, which has potential market application; yet, the composition of these antibiotics has not been elucidated. The aim of this paper is to isolate and identify these antibiotics. The antagonistic activity of JA was tested in vitro; it exhibited strong inhibition against some important phytopathogens and postharvest pathogens. Crude antibiotic production was extracted with methanol from the precipitate by adding 6 mol l(-1) HCl to the bacillus-free culture broth. The crude extract was run on Diamonsil C18 column (5 microm, 250 x 4.6 mm) in HPLC system to separate the antibiotics. Major antibiotics were classified into three lipopeptide families according to electrospray ionization-mass spectrometry analysis. Subsequently, the classification of antibiotics was confirmed with typical collision-induced dissociation fragments. Three kinds of antibiotics were isolated from B. subtilis JA and were identified to the lipopeptide families, surfactin, iturin and fengycin. These compounds could function as biocontrol agents against a large spectrum of pathogens. This study provided a reliable and rapid method for isolation and structural characterization of lipopeptide antibiotics from B. subtilis.

  3. Small regulatory RNA-induced growth rate heterogeneity of Bacillus subtilis.

    Science.gov (United States)

    Mars, Ruben A T; Nicolas, Pierre; Ciccolini, Mariano; Reilman, Ewoud; Reder, Alexander; Schaffer, Marc; Mäder, Ulrike; Völker, Uwe; van Dijl, Jan Maarten; Denham, Emma L

    2015-03-01

    Isogenic bacterial populations can consist of cells displaying heterogeneous physiological traits. Small regulatory RNAs (sRNAs) could affect this heterogeneity since they act by fine-tuning mRNA or protein levels to coordinate the appropriate cellular behavior. Here we show that the sRNA RnaC/S1022 from the Gram-positive bacterium Bacillus subtilis can suppress exponential growth by modulation of the transcriptional regulator AbrB. Specifically, the post-transcriptional abrB-RnaC/S1022 interaction allows B. subtilis to increase the cell-to-cell variation in AbrB protein levels, despite strong negative autoregulation of the abrB promoter. This behavior is consistent with existing mathematical models of sRNA action, thus suggesting that induction of protein expression noise could be a new general aspect of sRNA regulation. Importantly, we show that the sRNA-induced diversity in AbrB levels generates heterogeneity in growth rates during the exponential growth phase. Based on these findings, we hypothesize that the resulting subpopulations of fast- and slow-growing B. subtilis cells reflect a bet-hedging strategy for enhanced survival of unfavorable conditions.

  4. Study on mutagenic breeding of bacillus subtilis and properties of its antifungal substances

    International Nuclear Information System (INIS)

    Liu Jing; Yao Jianming

    2004-01-01

    Bacillus subtilis JA isolated by our laboratory produced a large amount of antifungal substances, which had strong inhibitory activity against various plant pathogenic fungi, such as Rhizoctonia solani, Fusarium graminearum and so on. Ion beam implantation as a new mutagenic methods was applied in our study. After B. subtilis JA was implanted by N + ions, a strain designated as B. Subtilis JA-026 was screened and obtained, which had a higher ability to produce those antifungal substances. A series of experiments indicated that the antifungal substances were thermostable and partially sensitive to proteinases K and tryproteinase. When the fermentating broth was fractionated with ammonium sulphate of a final saturation of 70%, the precipitate enhanced inhibitory activity while the supernatant lost this activity. It appeared that the antifungal substances were likely to be protein. (authors)

  5. Phylogenetic Analysis of Bacillus subtilis Strains Applicable to Natto (Fermented Soybean) Production ▿

    Science.gov (United States)

    Kubo, Yuji; Rooney, Alejandro P.; Tsukakoshi, Yoshiki; Nakagawa, Rikio; Hasegawa, Hiromasa; Kimura, Keitarou

    2011-01-01

    Spore-forming Bacillus strains that produce extracellular poly-γ-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 424 strains, including Bacillus subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting natto. Biotin auxotrophism was tightly linked to natto fermentation. A multilocus nucleotide sequence of six genes (rpoB, purH, gyrA, groEL, polC, and 16S rRNA) was used for phylogenetic analysis, and amplified fragment length polymorphism (AFLP) analysis was also conducted on the natto-fermenting strains. The ability to ferment natto was inferred from the two principal components of the AFLP banding pattern, and natto-fermenting strains formed a tight cluster within the B. subtilis subsp. subtilis group. PMID:21764950

  6. How Changes in Anti-SD Sequences Would Affect SD Sequences in Escherichia coli and Bacillus subtilis.

    Science.gov (United States)

    Abolbaghaei, Akram; Silke, Jordan R; Xia, Xuhua

    2017-05-05

    The 3' end of the small ribosomal RNAs (ssu rRNA) in bacteria is directly involved in the selection and binding of mRNA transcripts during translation initiation via well-documented interactions between a Shine-Dalgarno (SD) sequence located upstream of the initiation codon and an anti-SD (aSD) sequence at the 3' end of the ssu rRNA. Consequently, the 3' end of ssu rRNA (3'TAIL) is strongly conserved among bacterial species because a change in the region may impact the translation of many protein-coding genes. Escherichia coli and Bacillus subtilis differ in their 3' ends of ssu rRNA, being GAUC ACCUCCUUA 3' in E. coli and GAUC ACCUCCUU UCU3' or GAUC ACCUCCUU UCUA3' in B. subtilis Such differences in 3'TAIL lead to species-specific SDs (designated SD Ec for E. coli and SD Bs for B. subtilis ) that can form strong and well-positioned SD/aSD pairing in one species but not in the other. Selection mediated by the species-specific 3'TAIL is expected to favor SD Bs against SD Ec in B. subtilis , but favor SD Ec against SD Bs in E. coli Among well-positioned SDs, SD Ec is used more in E. coli than in B. subtilis , and SD Bs more in B. subtilis than in E. coli Highly expressed genes and genes of high translation efficiency tend to have longer SDs than lowly expressed genes and genes with low translation efficiency in both species, but more so in B. subtilis than in E. coli Both species overuse SDs matching the bolded part of the 3'TAIL shown above. The 3'TAIL difference contributes to the host specificity of phages. Copyright © 2017 Abolbaghaei et al.

  7. Biocontrol of Bacterial Fruit Blotch by Bacillus subtilis 9407 via Surfactin-Mediated Antibacterial Activity and Colonization

    Science.gov (United States)

    Fan, Haiyan; Zhang, Zhanwei; Li, Yan; Zhang, Xun; Duan, Yongming; Wang, Qi

    2017-01-01

    In this study, Bacillus subtilis 9407 showed a strong antibacterial activity against Acidovorax citrulli in vitro and 61.7% biocontrol efficacy on melon seedlings 4 days post inoculation under greenhouse conditions. To understand the biocontrol mechanism of B. subtilis 9407, identify the primary antibacterial compound and determine its role in controlling bacterial fruit blotch (BFB), a srfAB deletion mutant (ΔsrfAB) was constructed. The ΔsrfAB which was deficient in production of surfactin, not only showed almost no ability to inhibit growth of A. citrulli but also decreased biofilm formation and reduced swarming motility. Colonization assay demonstrated that B. subtilis 9407 could conlonize on melon roots and leaves in a large population, while ΔsrfAB showed a four- to ten-fold reduction in colonization of melon roots and leaves. Furthermore, a biocontrol assay showed that ΔsrfAB lost the biocontrol efficacy. In summary, our results indicated that surfactin, which consists of C13- to C16-surfactin A was the primary antibacterial compound of B. subtilis 9407, and it played a major role in biofilm formation, swarming motility, colonization and suppressing BFB. We propose that the biocontrol activity of B. subtilis 9407 is the results of the coordinated action of surfactin-mediated antibacterial activity and colonization. This study reveals for the first time that the use of a B. subtilis strain as a potential biological control agent could efficiently control BFB by producing surfactin. PMID:29075242

  8. Effects of water chemistry and surface contact on the toxicity of silver nanoparticles to Bacillus subtilis.

    Science.gov (United States)

    Yi, Jun; Cheng, Jinping

    2017-07-01

    The growing use of silver nanoparticles (AgNPs) has created concerns about its potential impacts on natural microbial communities. In this study, the physicochemical properties of AgNPs and its toxicity on natural bacteria Bacillus subtilis (B. subtilis) were investigated in aqueous conditions. The characterization data showed that AgNPs highly aggregated in aqueous conditions, and the hydrodynamic diameter of AgNPs in aqueous conditions was larger than its primary size. The studied AgNPs was less toxic to B. subtilis in estuarine water as compared to that in Milli-Q water and artificial seawater, which might be due to the observed enhanced aggregation of AgNPs in estuarine water. The toxicity of AgNPs to B. subtilis was greatly reduced when their surface contact was blocked by a dialysis membrane. Scanning electron microscope images showed that exposure contact to AgNPs resulted in damage of the microbial cell wall and enhanced formation of fibrillar structures. These results suggest that particle-cell contact is largely responsible for the observed toxicity of AgNPs in B. subtilis. This study can help to understand the potential impacts of AgNPs to natural microbes, especially in the complex aquatic environments.

  9. In Bacillus subtilis, the SatA (Formerly YyaR) Acetyltransferase Detoxifies Streptothricin via Lysine Acetylation.

    Science.gov (United States)

    Burckhardt, Rachel M; Escalante-Semerena, Jorge C

    2017-11-01

    Soil is a complex niche, where survival of microorganisms is at risk due to the presence of antimicrobial agents. Many microbes chemically modify cytotoxic compounds to block their deleterious effects. Streptothricin is a broad-spectrum antibiotic produced by streptomycetes that affects Gram-positive and Gram-negative bacteria alike. Here we identify the SatA (for s treptothricin a ce t yltransferase A , formerly YyaR) enzyme of Bacillus subtilis as the mechanism used by this soil bacterium to detoxify streptothricin. B. subtilis strains lacking satA were susceptible to streptothricin. Ectopic expression of satA + restored streptothricin resistance to B. subtilis satA ( Bs SatA) strains. Purified Bs SatA acetylated streptothricin in vitro at the expense of acetyl-coenzyme A (acetyl-CoA). A single acetyl moiety transferred onto streptothricin by SatA blocked the toxic effects of the antibiotic. SatA bound streptothricin with high affinity ( K d [dissociation constant] = 1 μM), and did not bind acetyl-CoA in the absence of streptothricin. Expression of B. subtilis satA + in Salmonella enterica conferred streptothricin resistance, indicating that SatA was necessary and sufficient to detoxify streptothricin. Using this heterologous system, we showed that the SatA homologue from Bacillus anthracis also had streptothricin acetyltransferase activity. Our data highlight the physiological relevance of lysine acetylation for the survival of B. subtilis in the soil. IMPORTANCE Experimental support is provided for the functional assignment of gene products of the soil-dwelling bacilli Bacillus subtilis and Bacillus anthracis This study focuses on one enzyme that is necessary and sufficient to block the cytotoxic effects of a common soil antibiotic. The enzyme alluded to is a member of a family of proteins that are broadly distributed in all domains of life but poorly studied in B. subtilis and B. anthracis The initial characterization of the enzyme provides insights into its

  10. Study on enhancement protease-producing of Bacillus subtilis by combining ribosome engineering and gamma irradiation

    International Nuclear Information System (INIS)

    Tran Bang Diep; Nguyen Thi Thom; Hoang Dang Sang; Nguyen Van Binh; Tran Xuan An; Hoang Phuong Thao; Pham Duy Duong; Tran Minh Quynh; Ta Bich Thuan; Vo Thi Thuong Lan

    2017-01-01

    Bacillus subtilis B5, Bacillus subtilis H12 and Bacillus subtilis VI are high protease-producing bacteria selected from various domestic laboratories. The suspensions in logarithmic growth phase and nutrient agar plates inoculated these bacteria were irradiated at dose ranging 0-3000 Gy under gamma Cobalt-60 source at Hanoi Irradiation Center. In both cases of irradiation treatment, the viability of Bacillus subtilis strains was much affected by gamma radiation and the survival rate of bacteria decreases with the increasing dose. The rate of high protease-producing mutation in three kinds of Bacillus strains seems to be greater at the dose range of 700-1500 Gy, at which the survival cells of bacteria was reduced by 3-4 log unit. In this study, the effect of gamma irradiation at different doses to mutation frequency of antibiotic resistance (rifampicin 0.2 µg/ml and streptomycin 20 µg/ml) of Bacillus subtilis strains is also investigated. The results show that the mutation frequency of antibiotic resistance was improved significantly by radiation treatment. The frequency of rifampicin-resistance reached the highest value at dose of 2000 Gy, 0.93-5.46x10 3 times higher than the frequency of spontaneous mutation. On the other hand, the highest streptomycin mutation frequency was obtained by irradiation at 1000 Gy. After the first screening, 82 potential 0.2 µg/ml rifampicin-resistant and 25 potential 20 µg/ml streptomycin-resistant colonies with higher production of protease than original strain were selected from the irradiated Bacillus subtilis B5 and H12. In the subsequent screening, some mutants having 2-2.5 times higher of protease activity than that of parent strain were obtained by using the culture medium containing incrementally higher antibiotic concentrations. The results of PCR, cloning and sequencing techniques proved that the antibiotic-resistance of Bacillus subtilis due to mutate in rpoB gene involved in these bacteria’s protease synthesis

  11. Differential actions of chlorhexidine on the cell wall of Bacillus subtilis and Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hon-Yeung Cheung

    Full Text Available Chlorhexidine is a chlorinated phenolic disinfectant used commonly in mouthwash for its action against bacteria. However, a comparative study of the action of chlorhexidine on the cell morphology of gram-positive and gram-negative bacteria is lacking. In this study, the actions of chlorhexidine on the cell morphology were identified with the aids of electron microscopy. After exposure to chlorhexidine, numerous spots of indentation on the cell wall were found in both Bacillus subtilis and Escherichia coli. The number of indentation spots increased with time of incubation and increasing chlorhexidine concentration. Interestingly, the dented spots found in B. subtilis appeared mainly at the hemispherical caps of the cells, while in E. coli the dented spots were found all over the cells. After being exposed to chlorhexidine for a prolonged period, leakage of cellular contents and subsequent ghost cells were observed, especially from B subtilis. By using 2-D gel/MS-MS analysis, five proteins related to purine nucleoside interconversion and metabolism were preferentially induced in the cell wall of E. coli, while three proteins related to stress response and four others in amino acid biosynthesis were up-regulated in the cell wall materials of B. subtilis. The localized morphological damages together with the biochemical and protein analysis of the chlorhexidine-treated cells suggest that chlorhexidine may act on the differentially distributed lipids in the cell membranes/wall of B. subtilis and E. coli.

  12. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

    Science.gov (United States)

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

    2017-07-01

    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  13. Bottleneck in secretion of α-amylase in Bacillus subtilis.

    Science.gov (United States)

    Yan, Shaomin; Wu, Guang

    2017-07-19

    Amylase plays an important role in biotechnology industries, and Gram-positive bacterium Bacillus subtilis is a major host to produce heterogeneous α-amylases. However, the secretion stress limits the high yield of α-amylase in B. subtilis although huge efforts have been made to address this secretion bottleneck. In this question-oriented review, every effort is made to answer the following questions, which look simple but are long-standing, through reviewing of literature: (1) Does α-amylase need a specific and dedicated chaperone? (2) What signal sequence does CsaA recognize? (3) Does CsaA require ATP for its operation? (4) Does an unfolded α-amylase is less soluble than a folded one? (5) Does α-amylase aggregate before transporting through Sec secretion system? (6) Is α-amylase sufficient stable to prevent itself from misfolding? (7) Does α-amylase need more disulfide bonds to be stabilized? (8) Which secretion system does PrsA pass through? (9) Is PrsA ATP-dependent? (10) Is PrsA reused after folding of α-amylase? (11) What is the fate of PrsA? (12) Is trigger factor (TF) ATP-dependent? The literature review suggests that not only the most of those questions are still open to answers but also it is necessary to calculate ATP budget in order to better understand how B. subtilis uses its energy for production and secretion.

  14. Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

    NARCIS (Netherlands)

    Nouwen, N; Driessen, AJM

    2005-01-01

    Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

  15. Enhanced secretion of natto phytase by Bacillus subtilis.

    Science.gov (United States)

    Tsuji, Shogo; Tanaka, Kosei; Takenaka, Shinji; Yoshida, Ken-ichi

    2015-01-01

    Phytases comprise a group of phosphatases that trim inorganic phosphates from phytic acid (IP6). In this study, we aimed to achieve the efficient secretion of phytase by Bacillus subtilis. B. subtilis laboratory standard strain 168 and its derivatives exhibit no phytase activity, whereas a natto starter secretes phytase actively. The natto phytase gene was cloned into strain RIK1285, a protease-defective derivative of 168, to construct a random library of its N-terminal fusions with 173 different signal peptides (SPs) identified in the 168 genome. The library was screened to assess the efficiency of phytase secretion based on clear zones around colonies on plates, which appeared when IP6 was hydrolyzed. The pbp SP enhanced the secretion of the natto phytase most efficiently, i.e. twice that of the original SP. Thus, the secreted natto phytase was purified and found to remove up to 3 phosphates from IP6.

  16. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression

    Science.gov (United States)

    Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.

    2016-01-01

    SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798

  17. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression.

    Science.gov (United States)

    Mars, Ruben A T; Nicolas, Pierre; Denham, Emma L; van Dijl, Jan Maarten

    2016-12-01

    Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5' untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5' ends of mRNA molecules. These can include 5' secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Microbial Activation of Bacillus subtilis-Immobilized Microgel Particles for Enhanced Oil Recovery.

    Science.gov (United States)

    Son, Han Am; Choi, Sang Koo; Jeong, Eun Sook; Kim, Bohyun; Kim, Hyun Tae; Sung, Won Mo; Kim, Jin Woong

    2016-09-06

    Microbially enhanced oil recovery involves the use of microorganisms to extract oil remaining in reservoirs. Here, we report fabrication of microgel particles with immobilized Bacillus subtilis for application to microbially enhanced oil recovery. Using B. subtilis isolated from oil-contaminated soils in Myanmar, we evaluated the ability of this microbe to reduce the interfacial tension at the oil-water interface via production of biosurfactant molecules, eventually yielding excellent emulsification across a broad range of the medium pH and ionic strength. To safely deliver B. subtilis into a permeable porous medium, in this study, these bacteria were physically immobilized in a hydrogel mesh of microgel particles. In a core flooding experiment, in which the microgel particles were injected into a column packed with silica beads, we found that these particles significantly increased oil recovery in a concentration-dependent manner. This result shows that a mesh of microgel particles encapsulating biosurfactant-producing microorganisms holds promise for recovery of oil from porous media.

  19. Effect of gamma irradiation on thermal inactivation and injury of Bacillus subtilis spores

    International Nuclear Information System (INIS)

    El-Zawahry, Y.A.; Mostafa, S.A.; Awny, N.M.

    1986-01-01

    Bacillus subtilis spores which received preliminary irradiation doses were more sensitive to subsequent heating than non-irradiated spores. The thermal inactivation increased by increasing any of exposure temperature, thermal exposure time or preliminary irradiation dose. The thermal (D T -) value was much higher for non-irradiated spores than the D TR value for the pre-thermal irradiated spores. The radiosensitizing effect was directly proportional to the preliminary irradiation dose. The pre-thermal irradiation treatment of B. subtilis spores resulted in a synergistic effect in spore deactivation. This synergistic effect increased gradually by increasing the preliminary irradiation dose and/or the thermal temperature from 60 to 80 0 C, but decreased for 90 0 C and for the longer exposure periods at any of the examined temperature. Thermal injury of B. subtilis spores was more for the non-irradiated than for the irradiated spores

  20. [Use of antagonistic Bacillus subtilis bacteria for treatment of nosocomial urinary tract infections].

    Science.gov (United States)

    Pushkarev, A M; Tuĭgunova, V G; Zaĭnullin, R R; Kuznetsova, T N; Gabidullin, Iu Z

    2007-01-01

    Effect of Bactisporin--a probiotic, containing spores of aerobic Bacillus subtilis 3H bacterium--for complex treatment of patients with nosocomial urinary tract infections was studied. 68 Cultures of different species of conditionally pathogenic bacteria were isolated from urine of the patients. Susceptibility of the isolated cultures to antibiotics before and after application of B. subtilis 3H metabolites was determined. The metabolites were accumulated on potato-glucose agar (PGA) while bacterium was cultivated on kapron membranes placed on surface of the medium. Influence of obtained metabolites on isolated strains was assessed by cultivation of each strain in metabolites-rich PGA during 24 h. Metabolites of B. subtilis led to decrease in resistance of isolated uropathogenic microflora to antibiotics. Use of Bactisporin in complex treatment of nosocomial urinary tract infections resulted in accelerated elimination of causative microorganism.

  1. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

    Science.gov (United States)

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2015-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  2. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

    Science.gov (United States)

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

    2010-07-01

    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  3. Primary structure of the tms and prs genes of Bacillus subtilis

    DEFF Research Database (Denmark)

    Nilsson, Dan; Hove-Jensen, Bjarne; Arnvig, Kirsten

    1989-01-01

    The nucleotide sequence was determined of a 3211 nucleotide pair EcoRI-PvuII DNA fragment containing the tms and prs genes as well as a part of the ctc gene of Bacillus subtilis. The prs gene encodes phosphoribosylpyrophosphate (PRPP) synthetase, whereas the functioning of the tms and ctc gene...... products remains to be established. The prs gene contains an open reading frame of 317 codons resulting in a subunit Mr of 34828. An open reading frame comprising the tms gene contained 456 codons resulting in a putative translation product with an Mr of 49,554. Comparison of the deduced B. subtilis PRPP...

  4. Biodegradation of furfural by Bacillus subtilis strain DS3.

    Science.gov (United States)

    Zheng, Dan; Bao, Jianguo; Lu, Jueming; Lv, Quanxi

    2015-07-01

    An aerobic bacterial strain DS3, capable of growing on furfural as sole carbon source, was isolated from actived sludge of wastewater treatment plant in a diosgenin factory after enrichment. Based on morphological physiological tests as well as 16SrDNA sequence and Biolog analyses it was identified as Bacillus subtilis. The study revealed that strain DS3 utilized furfural, as analyzed by high-performance liquid chromatography (HPLC). Under following conditions: pH 8.0, temperature 35 degrees C, 150 rpm and 10% inoculum, strain DS3 showed 31.2% furfural degradation. Furthermore, DS3 strain was found to tolerate furfural concentration as high as 6000 mg(-1). The ability of Bacillus subtilis strain DS3 to degrade furfural has been demonstrated for the first time in the present study.

  5. Protein export in bacillus subtilis and escherichia coli

    NARCIS (Netherlands)

    Dijl, Jan Maarten van

    1990-01-01

    The export of heterologous proteins in Bacillus subtilis and Escherichia coli is often inefficient. Frequently observed problems are: 1) accumulation of the precursor form of the exported protein in the cytoplasm or in the membrane; 2), inefficient or incorrect processing of the precursor; 3),

  6. Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

    Science.gov (United States)

    2012-01-01

    Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

  7. The structure of the transposable genetic element ISBsu2 from the cryptic plasmid p1516 of a soil Bacillus subtilis strain and the presence of homologues of this element in the chromosomes of various Bacillus subtilis strains

    NARCIS (Netherlands)

    Holsappel, S; Gagarina, EY; Poluektova, EU; Nezametdinova, VZ; Gel'fand, MS; Prozorov, AA; Bron, S

    2003-01-01

    A cryptic plasmid from a soil strain of Bacillus subtilis was found to contain a sequence having features of an IS element. Homologous sequences were also found in the chromosome of this strain and in the chromosomes of some other B. subtilis strains.

  8. Increasing plasmid transformation efficiency of natural spizizen method in Bacillus Subtilis by a cell permeable peptide

    Directory of Open Access Journals (Sweden)

    Mehrdad Moosazadeh Moghaddam

    2013-01-01

    Full Text Available Introduction: Some of bacterial species are able to uptake DNA molecule from environment, the yield of this process depends on some conditions such as plasmid size and host type. In the case of Bacillus subtilis, DNA uptake has low efficacy. Using Spizizen minimal medium is common method in plasmid transformation into B. subtilis, but rate of this process is not suitable and noteworthy. The aim of this study was investigation of novel method for improvement of DNA transformation into B. subtilis based on CM11 cationic peptide as a membrane permeable agent.Materials and methods: In this study, for optimization of pWB980 plasmid transformation into B. subtilis, the CM11 cationic peptide was used. For this purpose, B. subtilis competent cell preparation in the present of different concentration of peptide was implemented by two methods. In the first method, after treatment of bacteria with different amount of peptide for 14h, plasmid was added. In the second method, several concentration of peptide with plasmid was exposed to bacteria simultaneously. Bacteria that uptake DNA were screened on LB agar medium containing kanamycin. The total transformed bacteria per microgram of DNA was calculated and compared with the control.Results: Plasmid transformation in best conditions was 6.5 folds higher than the control. This result was statistically significant (P value <0.001.Discussion and conclusion: This study showed that CM11 cationic peptide as a membrane permeable agent was able to increase plasmid transformation rate into B. subtilis. This property was useful for resolution of low transformation efficacy.

  9. Bioaccumulation of copper, zinc, cadmium and lead by Bacillus sp., Bacillus cereus, Bacillus sphaericus and Bacillus subtilis Bioacumulação de cobre, zinco, cádmio e chumbo por Bacillus sp., Bacillus cereus, Bacillus sphaericus e Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Antonio Carlos Augusto da Costa

    2001-03-01

    Full Text Available This work presents some results on the use of microbes from the genus Bacillus for uptake of cadmium, zinc, copper and lead ions. Maximum copper bioaccumulations were 5.6 mol/g biomass for B. sphaericus, 5.9 mol/g biomass for B. cereus and B. subtilis, and 6.4 mol/g biomass for Bacillus sp. Maximum zinc bioaccumulations were 4.3 mol/g biomass for B. sphaericus, 4.6 mol/g biomass for B. cereus, 4.8 mol/g biomass for Bacillus sp. and 5.0 mol/g biomass for B. subtilis. Maximum cadmium bioaccumulations were 8.0 mol/g biomass for B. cereus, 9.5 mol/g biomass for B. subtilis, 10.8 mol/g biomass for Bacillus sp. and 11.8 mol/g biomass for B. sphaericus. Maximum lead biomaccumulations were 0.7 mol/g biomass for B. sphaericus, 1.1 mol/g biomass for B. cereus, 1.4 mol/g biomass for Bacillus sp. and 1.8 mol/g biomass for B. subtilis. The different Bacillus strains tested presented distinct uptake capacities, and the best results were obtained for B. subtilis and B. cereus.Este trabalho apresenta resultados de acumulação dos íons metálicos cádmio, zinco, cobre e chumbo por bactérias do gênero Bacillus. A bioacumulação máxima de cobre foi 5,6 mol/g biomassa para B. sphaericus, 5,9 mol/g biomassa para B. cereus e B. subtilis, e 6,4 mol/g biomassa para Bacillus sp.. A bioacumulação máxima de zinco foi 4,3 mol/g biomassa para B. sphaericus, 4,6 mol/g biomassa para B. cereus, 4,8 mol/g biomassa para Bacillus sp. e 5,0 mol/g biomassa para B. subtilis. A bioacumulação máxima de cádmio foi 8,0 mol/g biomassa para B. cereus, 9,5 mol/g biomassa para B. subtilis, 10,8 mol/g biomassa para Bacillus sp. e 11,8 mol/g biomassa para B. sphaericus. A bioacumulação máxima de chumbo foi 0,7 mol/g biomassa para B. sphaericus, 1,1 mol/g biomassa para B. cereus, 1,4 mol/g biomassa para Bacillus sp. e 1,8 mol/g biomassa para B. subtilis. As distintas linhagens de Bacillus testadas apresentaram variáveis capacidades de carregamento de íons metálicos, sendo os

  10. Purine biosynthesis is the bottleneck in trimethoprim-treated Bacillus subtilis.

    Science.gov (United States)

    Stepanek, Jennifer Janina; Schäkermann, Sina; Wenzel, Michaela; Prochnow, Pascal; Bandow, Julia Elisabeth

    2016-10-01

    Trimethoprim is a folate biosynthesis inhibitor. Tetrahydrofolates are essential for the transfer of C 1 units in several biochemical pathways including purine, thymine, methionine, and glycine biosynthesis. This study addressed the effects of folate biosynthesis inhibition on bacterial physiology. Two complementary proteomic approaches were employed to analyze the response of Bacillus subtilis to trimethoprim. Acute changes in protein synthesis rates were monitored by radioactive pulse labeling of newly synthesized proteins and subsequent 2DE analysis. Changes in protein levels were detected using gel-free quantitative MS. Proteins involved in purine and histidine biosynthesis, the σ B -dependent general stress response, and sporulation were upregulated. Most prominently, the PurR-regulon required for de novo purine biosynthesis was derepressed indicating purine depletion. The general stress response was activated energy dependently and in a subpopulation of treated cultures an early onset of sporulation was observed, most likely triggered by low guanosine triphosphate levels. Supplementation of adenosine triphosphate, adenosine, and guanosine to the medium substantially decreased antibacterial activity, showing that purine depletion becomes the bottleneck in trimethoprim-treated B. subtilis. The frequently prescribed antibiotic trimethoprim causes purine depletion in B. subtilis, which can be complemented by supplementing purines to the medium. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0 : PedB is the immunity protein and PedD is the precursor processing enzyme

    NARCIS (Netherlands)

    Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.

    The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises

  12. Localization of the Bacillus subtilis beta-propeller phytase transcripts in nodulated roots of Phaseolus vulgaris supplied with phytate.

    Science.gov (United States)

    Maougal, Rim Tinhinen; Bargaz, Adnane; Sahel, Charaf; Amenc, Laurie; Djekoun, Abdelhamid; Plassard, Claude; Drevon, Jean-Jacques

    2014-04-01

    Soil organic phosphorus (Po) such as phytate, which comprises up to 80 % of total Po, must be hydrolyzed by specific enzymes called phytases to be used by plants. In contrast to plants, bacteria, such as Bacillus subtilis, have the ability to use phytate as the sole source of P due to the excretion of a beta-propeller phytase (BPP). In order to assess whether the B. subtilis BPP could make P available from phytate for the benefit of a nodulated legume, the P-sensitive recombinant inbred line RIL147 of Phaseolus vulgaris was grown under hydroaeroponic conditions with either 12.5 μM phytate (C₆H₁₈O₂₄P₆) or 75 μmol Pi (K₂HPO₄), and inoculated with Rhizobium tropici CIAT899 alone, or co-inoculated with both B. subtilis DSM 10 and CIAT899. The in situ RT-PCR of BPP genes displayed the most intense fluorescent BPP signal on root tips. Some BPP signal was found inside the root cortex and the endorhizosphere of the root tip, suggesting endophytic bacteria expressing BPP. However, the co-inoculation with B. subtilis was associated with a decrease in plant P content, nodulation and the subsequent plant growth. Such a competitive effect of B. subtilis on P acquisition from phytate in symbiotic nitrogen fixation might be circumvented if the rate of inoculation were reasoned in order to avoid the inhibition of nodulation by excess B. subtilis proliferation. It is concluded that B. subtilis BPP gene is expressed in P. vulgaris rhizosphere.

  13. Salmonella enterica Typhimurium fljBA operon stability: implications regarding the origin of Salmonella enterica I 4,[5],12:i:.

    Science.gov (United States)

    Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M

    2015-12-29

    Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.

  14. Immobilization of cadmium in soils by UV-mutated Bacillus subtilis 38 bioaugmentation and NovoGro amendment

    International Nuclear Information System (INIS)

    Jiang Chunxiao; Sun Hongwen; Sun Tieheng; Zhang Qingmin; Zhang Yanfeng

    2009-01-01

    Immobilization of cadmium (10 mg Cd per kilogram soil) in soil by bioaugmentation of a UV-mutated microorganism, Bacillus subtilis 38 accompanied with amendment of a bio-fertilizer, NovoGro was investigated using extractable cadmium (E-Cd) by DTPA. B. subtilis 38, the mutant with the strongest resistance against Cd, could bioaccumulate Cd four times greater than the original wild type. Single bioaugmentation of B. subtilis 38 (SB treatment) to soil however did not reduce E-Cd significantly, while the amendment of NovoGro (SN treatment) reduced E-Cd remarkably. Simultaneous application of B. subtilis 38 and NovoGro (SNB treatment) exhibited a synergetic effect compared to the single SB and SN treatment. The immobilization effect was significantly affected by temperature, soil moisture, and pH. It seems that the immobilization on Cd reached the maximum when environmental conditions favored the activity of microorganisms. Under the optimum conditions, after 90 days incubation, E-Cd was 3.34, 3.39, 2.25 and 0.87 mg kg -1 in the control soil, SB, SN and SNB soils, respectively. NovoGro not only showed a great capacity for Cd adsorption, but also promoted the growth of B. subtilis 38. This study provides a potential cost-effective technique for in situ remediation of Cd contaminated soils with bioaugmentation.

  15. Molecular evidence for the coordination of nitrogen and carbon metabolisms, revealed by a study on the transcriptional regulation of the agl3EFG operon that encodes a putative carbohydrate transporter in Streptomyces coelicolor.

    Science.gov (United States)

    Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin

    2016-03-18

    In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Deletion of the budBAC operon in Klebsiella pneumoniae to understand the physiological role of 2,3-butanediol biosynthesis.

    Science.gov (United States)

    Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon

    2016-05-18

    Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.

  17. Generation of multiple cell types in Bacillus subtilis.

    Science.gov (United States)

    Lopez, Daniel; Vlamakis, Hera; Kolter, Roberto

    2009-01-01

    Bacillus subtilis is a Gram-positive bacterium that is well known for its ability to differentiate into metabolically inactive spores that are highly resistant to environmental stresses. In fact, populations of genetically identical B. subtilis comprise numerous distinct cell types. In addition to spores, cells can become genetically competent, motile, produce extracellular matrix or degradative enzymes, or secrete toxins that allow them to cannibalize their neighbors. Many of the cell fates listed above appear to be mutually exclusive. In this review, we discuss how individual cells within a population control their gene expression to ensure that proper regulation of differentiation occurs. These different cell fates are regulated by an intricate network that relies primarily on the activity of three major transcriptional regulators: Spo0A, DegU, and ComK. While individual cells must choose distinct cell fates, the population as a whole exhibits a spectrum of phenotypes whose diversity may increase fitness.

  18. Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor.

    Science.gov (United States)

    Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander

    2015-02-01

    Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Bacillus subtilis genome diversity.

    Science.gov (United States)

    Earl, Ashlee M; Losick, Richard; Kolter, Roberto

    2007-02-01

    Microarray-based comparative genomic hybridization (M-CGH) is a powerful method for rapidly identifying regions of genome diversity among closely related organisms. We used M-CGH to examine the genome diversity of 17 strains belonging to the nonpathogenic species Bacillus subtilis. Our M-CGH results indicate that there is considerable genetic heterogeneity among members of this species; nearly one-third of Bsu168-specific genes exhibited variability, as measured by the microarray hybridization intensities. The variable loci include those encoding proteins involved in antibiotic production, cell wall synthesis, sporulation, and germination. The diversity in these genes may reflect this organism's ability to survive in diverse natural settings.

  20. Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

    Science.gov (United States)

    Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

    2018-01-22

    Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

  1. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Directory of Open Access Journals (Sweden)

    Johanna Rintahaka

    Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we

  2. Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

    Science.gov (United States)

    Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

    2014-01-01

    A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

  3. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  4. Genome Sequencing of Bacillus subtilis SC-8, Antagonistic to the Bacillus cereus Group, Isolated from Traditional Korean Fermented-Soybean Food

    OpenAIRE

    Yeo, In-Cheol; Lee, Nam Keun; Hahm, Young Tae

    2012-01-01

    Bacillus subtilis SC-8 is a Gram-positive bacterium displaying narrow antagonistic activity for the Bacillus cereus group. B. subtilis SC-8 was isolated from Korean traditional fermented-soybean food. Here we report the draft genome sequence of B. subtilis SC-8, including biosynthetic genes for antibiotics that may have beneficial effects for control of food-borne pathogens.

  5. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  6. Stable Isotope Labeling by Amino Acids in Cell Culture (SILAC) Applied to Quantitative Proteomics of Bacillus subtilis

    DEFF Research Database (Denmark)

    Soufi, Boumediene; Kumar, C.; Gnad, F.

    2010-01-01

    We applied stable isotope labeling by amino acids in cell culture (SILAC) to large-scale quantitative proteomics analyses of the model bacterium Bacillus subtilis in two physiological conditions: growth on succinate and growth under phosphate starvation. Using a B. subtilis strain auxotrophic...... of the most comprehensive quantitative proteomics studies in bacteria, covering more than 75% of the B. subtilis genes expressed in the log phase of growth. Furthermore, we detect and quantify dynamics of 35 Ser/Thr/Tyr phosphorylation sites under growth on succinate, and 10 phosphorylation sites under...

  7. Bacillus subtilis Biofilm Development – A Computerized Study of Morphology and Kinetics

    Directory of Open Access Journals (Sweden)

    Sarah Gingichashvili

    2017-11-01

    Full Text Available Biofilm is commonly defined as accumulation of microbes, embedded in a self-secreted extra-cellular matrix, on solid surfaces or liquid interfaces. In this study, we analyze several aspects of Bacillus subtilis biofilm formation using tools from the field of image processing. Specifically, we characterize the growth kinetics and morphological features of B. subtilis colony type biofilm formation and compare these in colonies grown on two different types of solid media. Additionally, we propose a model for assessing B. subtilis biofilm complexity across different growth conditions. GFP-labeled B. subtilis cells were cultured on agar surfaces over a 4-day period during which microscopic images of developing colonies were taken at equal time intervals. The images were used to perform a computerized analysis of few aspects of biofilm development, based on features that characterize the different phenotypes of B. subtilis colonies. Specifically, the analysis focused on the segmented structure of the colonies, consisting of two different regions of sub-populations that comprise the biofilm – a central “core” region and an “expanding” region surrounding it. Our results demonstrate that complex biofilm of B. subtillis grown on biofilm-promoting medium [standard lysogeny broth (LB supplemented with manganese and glycerol] is characterized by rapidly developing three-dimensional complex structure observed at its core compared to biofilm grown on standard LB. As the biofilm develops, the core size remains largely unchanged during development and colony expansion is mostly attributed to the expansion in area of outer cell sub-populations. Moreover, when comparing the bacterial growth on biofilm-promoting agar to that of colonies grown on LB, we found a significant decrease in the GFP production of colonies that formed a more complex biofilm. This suggests that complex biofilm formation has a diminishing effect on cell populations at the biofilm

  8. Purification and characterization of nattokinase from Bacillus subtilis natto B-12.

    Science.gov (United States)

    Wang, Cong; Du, Ming; Zheng, Dongmei; Kong, Fandong; Zu, Guoren; Feng, Yibing

    2009-10-28

    Bacillus subtilis natto B-12 was isolated from natto, a traditional fermented soybean food in Japan. A fibrinolytic enzyme (B-12 nattokinase) was purified from the supernatant of B. subtilis natto B-12 culture broth and showed strong fibrinolytic activity. The enzyme was homogenously purified to 56.1-fold, with a recovery of 43.2% of the initial activity. B-12 nattokinase was demonstrated to be homogeneous by SDS-PAGE and was identified as a monomer of 29000 +/- 300 Da in its native state by SDS-PAGE and size exclusion methods. The optimal pH value and temperature were 8.0 and 40 degrees C, respectively. Purified nattokinase showed high thermostability at temperatures from 30 to 50 degrees C and alkaline stability within the range of pH 6.0-9.0. The enzyme activity was activated by Zn(2+) and obviously inhibited by Fe(3+) and Al(3+). This study provides some important information for the effect factors of fibrinolytic activity, the purification methods, and characterization of nattokinase from B. subtilis natto B-12, which enriches the theoretical information of nattokinase for the research and development of nattokinase as a functional additive of food.

  9. Isolation, purification and characterization of Bacillus subtilis Phytase from Holiwood Gresik

    Directory of Open Access Journals (Sweden)

    Leny Yuanita

    2012-01-01

    Full Text Available The aim of the research were isolation, purification and characterization of Bacillus subtilis phytase from Holiwood Gresik. The research was done in two stages; the first include enzyme isolation, precipitation with amonium sulphate, dialysis, gel filtration chromatography, SDS-PAGE analysis, while second determining optimum pH, optimum temperature, the effect of pH and temperature to enzim stability, the values of KM and Vmax Bacillus subtilis phytase from Holiwood Gresik. The first stage research design were One Shot Case Study and Post Test Only Control Group Design, while the second stage were Post Test Only Control Group Design and Factorial Design. The data being analyzed by one-way and two-way Anova. The results of research showed that Bacillus subtilis phytase has the molecular mass of 36.5 kDa, optimum pH at 6.5–7.0, optimum temperature at 41°C and it was found to be stable for 30 minute incubation at pH 7or 30° C with 2% or 3% lost of its activity respectively. KM value was 0.62 mM and VMax 0.393 mmol/ml/minute.

  10. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    Science.gov (United States)

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  11. Bacillus subtilis HJ18-4 from traditional fermented soybean food inhibits Bacillus cereus growth and toxin-related genes.

    Science.gov (United States)

    Eom, Jeong Seon; Lee, Sun Young; Choi, Hye Sun

    2014-11-01

    Bacillus subtilis HJ18-4 isolated from buckwheat sokseongjang, a traditional Korean fermented soybean food, exhibits broad-spectrum antimicrobial activity against foodborne pathogens, including Bacillus cereus. In this study, we investigated the antibacterial efficacy and regulation of toxin gene expression in B. cereus by B. subtilis HJ18-4. Expression of B. cereus toxin-related genes (groEL, nheA, nheC, and entFM) was downregulated by B. subtilis HJ18-4, which also exhibited strong antibacterial activity against B. cereus. We also found that water extracts of soy product fermented with B. subtilis HJ18-4 significantly inhibited the growth of B. cereus and toxin expression. These results indicate that B. subtilis HJ18-4 could be used as an antimicrobial agent to control B. cereus in the fermented soybean food industry. Our findings also provide an opportunity to develop an efficient biological control agent against B. cereus. © 2014 The Authors. Journal of Food Science published by Wiley Periodicals, Inc. on behalf of Institute of Food Technologists®

  12. Enhanced biomass production study on probiotic Bacillus subtilis ...

    African Journals Online (AJOL)

    The culture conditions of lactose fermenting, spore forming probiotic Bacillus subtilis SK09 isolated from dairy effluent were optimized by response surface methodology to maximize the biomass production. The student's t-test of the Placket-Burman screening design revealed that the effects of pH, ammonium citrate and ...

  13. DisA and c-di-AMP act at the intersection between DNA-damage response and stress homeostasis in exponentially growing Bacillus subtilis cells.

    Science.gov (United States)

    Gándara, Carolina; Alonso, Juan C

    2015-03-01

    Bacillus subtilis contains two vegetative diadenylate cyclases, DisA and CdaA, which produce cyclic di-AMP (c-di-AMP), and one phosphodiesterase, GdpP, that degrades it into a linear di-AMP. We report here that DisA and CdaA contribute to elicit repair of DNA damage generated by alkyl groups and H2O2, respectively, during vegetative growth. disA forms an operon with radA (also termed sms) that encodes a protein distantly related to RecA. Among different DNA damage agents tested, only methyl methane sulfonate (MMS) affected disA null strain viability, while radA showed sensitivity to all of them. A strain lacking both disA and radA was as sensitive to MMS as the most sensitive single parent (epistasis). Low c-di-AMP levels (e.g. by over-expressing GdpP) decreased the ability of cells to repair DNA damage caused by MMS and in less extent by H2O2, while high levels of c-di-AMP (absence of GdpP or expression of sporulation-specific diadenylate cyclase, CdaS) increased cell survival. Taken together, our results support the idea that c-di-AMP is a crucial signalling molecule involved in DNA repair with DisA and CdaA contributing to modulate different DNA damage responses during exponential growth. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Paralogous gene analysis reveals a highly enantioselective 1,2-O-isopropylideneglycerol caprylate esterase of Bacillus subtilis

    NARCIS (Netherlands)

    Droge, MJ; Bos, R; Quax, WJ

    Carboxylesterase NP of Bacillus subtilis Thai 1-8, characterized in 1992 as a very enantioselective (S)-naproxen esterase, was found to show no enantiopreference towards (S)-1,2-O-isopropylideneglycerol (IPG) esters. The ybfK gene was identified by the B. subtilis genome project as an unknown gene

  15. Autolysis of Escherichia coli and Bacillus subtilis cells in low gravity

    Science.gov (United States)

    Kacena, M. A.; Smith, E. E.; Todd, P.

    1999-01-01

    The role of gravity in the autolysis of Bacillus subtilis and Escherichia coli was studied by growing cells on Earth and in microgravity on Space Station Mir. Autolysis analysis was completed by examining the death phase or exponential decay of cells for approximately 4 months following the stationary phase. Consistent with published findings, the stationary-phase cell population was 170% and 90% higher in flight B. subtilis and E. coli cultures, respectively, than in ground cultures. Although both flight autolysis curves began at higher cell densities than control curves, the rate of autolysis in flight cultures was identical to that of their respective ground control rates.

  16. [Molecular cloning and expression of Nattokinase gene in Bacillus subtilis].

    Science.gov (United States)

    Liu, B Y; Song, H Y

    2002-05-01

    In order to characterize biochemically the nattokinase,the nucleotide sequence of the nattokinase gene was amplified from the chromosomal DNA of B.subtilis (natto) by PCR. The expression plasmid pBL NK was constructed and was used to transform Bacillus subtilis containing a chromosomal deletion in its subtilisin gene. The supernatant of the culture was collected after 15 h culture. The target proteins were identified by SDS-PAGE. Nattokinase was purified by a method including ultrafiltration, Sephacryl S-100 gel filtration and S-Sepharose ion-exchange chromatography, and 100 mg of purified nattokinase was obtained from one liter of culture. The purity of the protein and the specific activity were 95% and 12 000 u/mg (compared to tPA), respectively.

  17. Expression of the N2 fixation gene operon of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21.

    Science.gov (United States)

    Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng

    2015-10-01

    To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.

  18. RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.

    Science.gov (United States)

    Lei, Mei G; Lee, Chia Y

    2015-12-01

    Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

  19. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  20. A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

    Directory of Open Access Journals (Sweden)

    Enrico eMuhr

    2016-01-01

    Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

  1. A novel expression vector for the secretion of abaecin in Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Li Li

    Full Text Available ABSTRACT This study aimed to describe a Bacillus subtilis expression system based on genetically modified B. subtilis. Abaecin, an antimicrobial peptide obtained from Apis mellifera, can enhance the effect of pore-forming peptides from other species on the inhibition of bacterial growth. For the exogenous expression, the abaecin gene was fused with a tobacco etch virus protease cleavage site, a promoter Pglv, and a mature beta-glucanase signal peptide. Also, a B. subtilis expression system was constructed. The recombinant abaecin gene was expressed and purified as a recombinant protein in the culture supernatant. The purified abaecin did not inhibit the growth of Escherichia coli strain K88. Cecropin A and hymenoptaecin exhibited potent bactericidal activities at concentrations of 1 and 1.5 µM. Combinatorial assays revealed that cecropin A and hymenoptaecin had sublethal concentrations of 0.3 and 0.5 µM. This potentiating functional interaction represents a promising therapeutic strategy. It provides an opportunity to address the rising threat of multidrug-resistant pathogens that are recalcitrant to conventional antibiotics.

  2. Poly-γ-Glutamic Acids Contribute to Biofilm Formation and Plant Root Colonization in Selected Environmental Isolates of Bacillus subtilis

    Science.gov (United States)

    Yu, Yiyang; Yan, Fang; Chen, Yun; Jin, Christopher; Guo, Jian-Hua; Chai, Yunrong

    2016-01-01

    Bacillus subtilis is long known to produce poly-γ-glutamic acids (γ-PGA) as one of the major secreted polymeric substances. In B. subtilis, the regulation of γ-PGA production and its physiological role are still unclear. B. subtilis is also capable of forming structurally complex multicellular communities, or biofilms, in which an extracellular matrix consisting of secreted proteins and polysaccharides holds individual cells together. Biofilms were shown to facilitate B. subtilis–plant interactions. In this study, we show that different environmental isolates of B. subtilis, all capable of forming biofilms, vary significantly in γ-PGA production. This is possibly due to differential regulation of γ-PGA biosynthesis genes. In many of those environmental isolates, γ-PGA seems to contribute to robustness and complex morphology of the colony biofilms, suggesting a role of γ-PGA in biofilm formation. Our evidence further shows that in selected B. subtilis strains, γ-PGA also plays a role in root colonization by the bacteria, pinpointing a possible function of γ-PGA in B. subtilis–plant interactions. Finally, we found that several pathways co-regulate both γ-PGA biosynthesis genes and genes for the biofilm matrix in B. subtilis, but in an opposing fashion. We discussed potential biological significance of that. PMID:27891125

  3. Identification and characterization of the vanillin dehydrogenase YfmT in Bacillus subtilis 3NA.

    Science.gov (United States)

    Graf, Nadja; Wenzel, Marian; Altenbuchner, Josef

    2016-04-01

    With vanillin as one of the most important flavoring agents, many efforts have been made to optimize its biotechnological production from natural abundant substrates. However, its toxicity against the hosts results in rather low yields and product concentrations. Bacillus subtilis as a soil-dwelling bacterium is a possible lignin-derived compound-degrading microorganism. Therefore, its vanillin and ferulic acid metabolism was investigated. With a rather high tolerance for vanillin up to 20 mM, it is a promising candidate to produce natural vanillin. In this study, the well-studied phenolic acid decarboxylases PadC and BsdBCD could be ascribed to function as the only enzymes in B. subtilis 3NA converting ferulic acid to 4-vinylguaiacol and vanillic acid to guaiacol, respectively. As vanillin also becomes converted to guaiacol, a previous conversion to vanillic acid was assumed. Usage of bioinformatic tools revealed YfmT, which could be shown to function as the only vanillin dehydrogenase in B. subtilis 3NA. Thus, YfmT was further characterized regarding its temperature and pH optima as well as its substrate range. Vanillin and ferulic acid metabolic routes in the tested B. subtilis strain were revealed, a direct conversion of ferulic acid to vanillin, however, could not be found.

  4. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  5. Awakening sleeping beauty: production of propionic acid in Escherichia coli through the sbm operon requires the activity of a methylmalonyl-CoA epimerase.

    Science.gov (United States)

    Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban

    2017-07-17

    Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway

  6. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Science.gov (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  7. Bacillus subtilis affects miRNAs and flavanoids production in Agrobacterium-Tobacco interaction.

    Science.gov (United States)

    Nazari, Fahimeh; Safaie, Naser; Soltani, Bahram Mohammad; Shams-Bakhsh, Masoud; Sharifi, Mohsen

    2017-09-01

    Agrobacterium tumefaciens is a very destructive plant pathogen. Selection of effective biological agents against this pathogen depends on more insight into molecular plant defence responses during the biocontrol agent-pathogen interaction. Auxin as a phytohormone is a key contributor in pathogenesis and plant defence and accumulation of auxin transport carriers are accompanied by increasing in flavonoid and miRNAs concentrations during plant interactions with bacteria. The aim of this research was molecular analysis of Bacillus subtilis (ATCC21332) biocontrol effect against A. tumefaciens (IBRC-M10701) pathogen interacting with Nicotiana tabacum plants. Tobacco plants were either treated with both or one of the challenging bacteria and the expression of miRNAs inside the plants were analysed through qRT-PCR. The results indicated that the bacterial treatments affect expression level of nta-miRNAs. In tobacco plants treated only with A. tumefaciens the expression of nta-miR393 was more than that was recorded for nta-miR167 (3.8 folds, P subtilis (2.1 folds, P subtilis alone, was similar to the amount recorded for the plants challenged with the both bacteria. This study suggests a relationship between the upregulation of nta-miR167, nta-miR393 and accumulation of flavanoid compounds. Overall, the expression of these miRNAs as well as flavonoid derivatives has the potential of being used as biomarkers for the interaction of B. subtilis and A. tumefaciens model system in N. tabacum. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Osmoprotection of Bacillus subtilis through Import and Proteolysis of Proline-Containing Peptides

    Science.gov (United States)

    Zaprasis, Adrienne; Brill, Jeanette; Thüring, Marietta; Wünsche, Guido; Heun, Magnus; Barzantny, Helena; Hoffmann, Tamara

    2013-01-01

    Bacillus subtilis can attain cellular protection against the detrimental effects of high osmolarity through osmotically induced de novo synthesis and uptake of the compatible solute l-proline. We have now found that B. subtilis can also exploit exogenously provided proline-containing peptides of various lengths and compositions as osmoprotectants. Osmoprotection by these types of peptides is generally dependent on their import via the peptide transport systems (Dpp, Opp, App, and DtpT) operating in B. subtilis and relies on their hydrolysis to liberate proline. The effectiveness with which proline-containing peptides confer osmoprotection varies considerably, and this can be correlated with the amount of the liberated and subsequently accumulated free proline by the osmotically stressed cell. Through gene disruption experiments, growth studies, and the quantification of the intracellular proline pool, we have identified the PapA (YqhT) and PapB (YkvY) peptidases as responsible for the hydrolysis of various types of Xaa-Pro dipeptides and Xaa-Pro-Xaa tripeptides. The PapA and PapB peptidases possess overlapping substrate specificities. In contrast, osmoprotection by peptides of various lengths and compositions with a proline residue positioned at their N terminus was not affected by defects in the PapA and PapB peptidases. Taken together, our data provide new insight into the physiology of the osmotic stress response of B. subtilis. They illustrate the flexibility of this ubiquitously distributed microorganism to effectively exploit environmental resources in its acclimatization to sustained high-osmolarity surroundings through the accumulation of compatible solutes. PMID:23144141

  9. Bacillus subtilis is a Potential Degrader of Pyrene and Benzo[a]pyrene

    Directory of Open Access Journals (Sweden)

    Lynette Ekunwe

    2005-08-01

    Full Text Available Polycyclic Aromatic Hydrocarbons (PAHs are a group of compounds that pose many health threats to human and animal life. They occur in nature as a result of incomplete combustion of organic matter, as well as from many anthropogenic sources including cigarette smoke and automobile exhaust. PAHs have been reported to cause liver damage, red blood cell damage and a variety of cancers. Because of this, methods to reduce the amount of PAHs in the environment are continuously being sought. The purpose of this study was to find soil bacteria capable of degrading high molecular weight PAHs, such as pyrene (Pyr and benzo[a]pyrene (BaP, which contain more than three benzene rings and so persist in the environment. Bacillus subtilis, identified by fatty acid methyl ester (FAME analysis, was isolated from PAH contaminated soil. Because it grew in the presence of 33μg/ml each of pyrene, 1-AP and 1-HP, its biodegradation capabilities were assessed. It was found that after a four-day incubation period at 30oC in 20μg/ml pyrene or benzo[a]pyrene, B. subtilis was able to transform approximately 40% and 50% pyrene and benzo[a]pyrene, respectively. This is the first report implicating B. subtilis in PAH degradation. Whether or not the intermediates resulting from the transformation are more toxic than their parent compounds, and whether B. subtilis is capable of mineralizing pyrene or benzo[a]pyrene to carbon dioxide and water, remains to be evaluated.

  10. Investigation of biosurfactant production by Bacillus pumilus 1529 and Bacillus subtilis WPI

    Directory of Open Access Journals (Sweden)

    shila khajavi shojaei

    2016-06-01

    Full Text Available Introduction: Biosurfactants are unique amphipathic molecules with extensive application in removing organic and metal contaminants. The purpose of this study was to investigate production of biosurfactant and determine optimal conditions to produce biosurfactant by Bacillus pumilus 1529 and Bacillus subtilis WPI. Materials and methods: In this study, effect of carbon source, temperature and incubation time on biosurfactant production was evaluated. Hemolytic activity, emulsification activity, oil spreading, drop collapse, cell hydrophobicity and measurement of surface tension were used to detect biosurfactant production. Then, according to the results, the optimal conditions for biosurfactant production by and Bacillus subtilis WPI was determined. Results: In this study, both bacteria were able to produce biosurfactant at an acceptable level. Glucose, kerosene, sugarcane molasses and phenanthrene used as a sole carbon source and energy for the mentioned bacteria. Bacillus subtilis WPI produced maximum biosurfactant in the medium containing kerosene and reduced surface tension of the medium to 33.1 mN/m after 156 hours of the cultivation at 37°C. Also, the highest surface tension reduction by Bacillus pumilus 1529 occurred in the medium containing sugarcane molasses and reduce the surface tension of culture medium after 156 hours at 37°C from 50.4 to 28.83 mN/m. Discussion and conclusion: Bacillus pumilus 1529 and Bacillus subtilis WPI had high potential in production of biosurfactant and degradation of petroleum hydrocarbons and Phenanthrene. Therefore, it could be said that these bacteria had a great potential for applications in bioremediation and other environmental process.

  11. Potassium sensing histidine kinase in Bacillus subtilis.

    Science.gov (United States)

    López, Daniel; Gontang, Erin A; Kolter, Roberto

    2010-01-01

    The soil-dwelling organism Bacillus subtilis is able to form multicellular aggregates known as biofilms. It was recently reported that the process of biofilm formation is activated in response to the presence of various, structurally diverse small-molecule natural products. All of these small-molecule natural products made pores in the membrane of the bacterium, causing the leakage of potassium cations from the cytoplasm of the cell. The potassium cation leakage was sensed by the membrane histidine kinase KinC, triggering the genetic pathway to the production of the extracellular matrix that holds cells within the biofilm. This chapter presents the methodology used to characterize the leakage of cytoplasmic potassium as the signal that induces biofilm formation in B. subtilis via activation of KinC. Development of novel techniques to monitor activation of gene expression in microbial populations led us to discover the differentiation of a subpopulation of cells specialized to produce the matrix that holds all cells together within the biofilm. This phenomenon of cell differentiation was previously missed by conventional techniques used to monitor transcriptional gene expression. Copyright © 2010 Elsevier Inc. All rights reserved.

  12. Phosphoribosylpyrophosphate synthetase of Bacillus subtilis. Cloning, characterization and chromosomal mapping of the prs gene

    DEFF Research Database (Denmark)

    Nilsson, Dan; Hove-Jensen, Bjarne

    1987-01-01

    The gene (prs) encoding phosphoribosylpyrophosphate (PRPP) synthetase has been cloned from a library of Bacillus subtilis DNA by complementation of an Escherichia coli prs mutation. Flanking DNA sequences were pruned away by restriction endonuclease and exonuclease BAL 31 digestions, resulting...... in a DNA fragment of approx. 1.8 kb complementing the E. coli prs mutation. Minicell experiments revealed that this DNA fragment coded for a polypeptide, shown to be the PRPP synthetase subunit, with an Mr of approx. 40,000. B. subtilis strains harbouring the prs gene in a multicopy plasmid contained up...... to nine-fold increased PRPP synthetase activity. The prs gene was cloned in an integration vector and the resulting hybrid plasmid inserted into the B. subtilis chromosome by homologous recombination. The integration site was mapped by transduction and the gene order established as purA-guaA-prs-cysA....

  13. Sporulation during growth in a gut isolate of Bacillus subtilis.

    Science.gov (United States)

    Serra, Cláudia R; Earl, Ashlee M; Barbosa, Teresa M; Kolter, Roberto; Henriques, Adriano O

    2014-12-01

    Sporulation by Bacillus subtilis is a cell density-dependent response to nutrient deprivation. Central to the decision of entering sporulation is a phosphorelay, through which sensor kinases promote phosphorylation of Spo0A. The phosphorelay integrates both positive and negative signals, ensuring that sporulation, a time- and energy-consuming process that may bring an ecological cost, is only triggered should other adaptations fail. Here we report that a gastrointestinal isolate of B. subtilis sporulates with high efficiency during growth, bypassing the cell density, nutritional, and other signals that normally make sporulation a post-exponential-phase response. Sporulation during growth occurs because Spo0A is more active per cell and in a higher fraction of the population than in a laboratory strain. This in turn, is primarily caused by the absence from the gut strain of the genes rapE and rapK, coding for two aspartyl phosphatases that negatively modulate the flow of phosphoryl groups to Spo0A. We show, in line with recent results, that activation of Spo0A through the phosphorelay is the limiting step for sporulation initiation in the gut strain. Our results further suggest that the phosphorelay is tuned to favor sporulation during growth in gastrointestinal B. subtilis isolates, presumably as a form of survival and/or propagation in the gut environment. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. Foam separation of Pseudomonas fluorescens and Bacillus subtilis var. niger.

    Science.gov (United States)

    Grieves, R B; Wang, S L

    1967-01-01

    An experimental investigation established the effect of the presence of inorganic salts on the foam separation of Pseudomonas fluorescens and of Bacillus subtilis var. niger (B. globigii) from aqueous suspension by use of a cationic surfactant. For P. fluorescens, 5.0 mueq/ml of NaCl, KCl, Na(2)SO(4), K(2)SO(4), CaCl(2), CaSO(4), MgCl(2), or MgSO(4) produced increases in the cell concentration in the residual suspension (not carried into the foam) from 2.9 x 10(5) up to 1.6 x 10(6) to 2.8 x 10(7) cells per milliliter (initial suspensions contain from 3.3 x 10(7) to 4.8 x 10(7) cells per milliliter). The exceptional influence of magnesium was overcome by bringing the cells into contact first with the surfactant and then the salt. For B. subtilis, the presence of 5.0 mueq/ml of any of the eight salts increased the residual cell concentration by one order of magnitude from 1.2 x 10(4) to about 4.0 x 10(5) cells per milliliter. This occurred regardless of the sequence of contact as long as the surfactant contact period was sufficient. The presence of salts increased collapsed foam volumes with P. fluorescens and decreased collapsed foam volumes with B. subtilis.

  15. Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

    Science.gov (United States)

    2011-01-01

    Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to

  16. Characterization of dacC, which encodes a new low-molecular-weight penicillin-binding protein in Bacillus subtilis

    DEFF Research Database (Denmark)

    Pedersen, Lotte Bang; Murray, T; Popham, D L

    1998-01-01

    The pbp gene (renamed dacC), identified by the Bacillus subtilis genome sequencing project, encodes a putative 491-residue protein with sequence homology to low-molecular-weight penicillin-binding proteins. Use of a transcriptional dacC-lacZ fusion revealed that dacC expression (i) is initiated...... at the end of stationary phase; (ii) depends strongly on transcription factor sigmaH; and (iii) appears to be initiated from a promoter located immediately upstream of yoxA, a gene of unknown function located upstream of dacC on the B. subtilis chromosome. A B. subtilis dacC insertional mutant grew...

  17. Improvement of Fibrinolytic Activity of Bacillus subtilis 168 by Integration of a Fibrinolytic Gene into the Chromosome.

    Science.gov (United States)

    Jeong, Seon-Ju; Park, Ji Yeong; Lee, Jae Yong; Lee, Kang Wook; Cho, Kye Man; Kim, Gyoung Min; Shin, Jung-Hye; Kim, Jong-Sang; Kim, Jeong Hwan

    2015-11-01

    Fibrinolytic enzyme genes (aprE2, aprE176, and aprE179) were introduced into the Bacillus subtilis 168 chromosome without any antibiotic resistance gene. An integration vector, pDG1662, was used to deliver the genes into the amyE site of B. subtilis 168. Integrants, SJ3-5nc, SJ176nc, and SJ179nc, were obtained after two successive homologous recombinations. The integration of each fibrinolytic gene into the middle of the amyE site was confirmed by phenotypes (Amy(-), Spec(S)) and colony PCR results for these strains. The fibrinolytic activities of the integrants were higher than that of B. subtilis 168 by at least 3.2-fold when grown in LB broth. Cheonggukjang was prepared by inoculating each of B. subtilis 168, SJ3-5nc, SJ176nc, and SJ179nc, and the fibrinolytic activity of cheonggukjang was 4.6 ± 0.7, 10.8 ± 0.9, 7.0 ± 0.6, and 8.0 ± 0.2 (U/g of cheonggukjang), respectively at 72 h. These results showed that construction of B. subtilis strains with enhanced fibrinolytic activities is possible by integration of a strong fibrinolytic gene via a marker-free manner.

  18. On the use of a probiotic (Bacillus subtilis - strain DSM 17299 as growth promoter in broiler diets

    Directory of Open Access Journals (Sweden)

    M Opalinski

    2007-06-01

    Full Text Available The objective of this experiment was to evaluate the effect of a probiotic (Bacillus subtilis, strain DSM 17299 in broiler diets on feed intake, weight gain, and feed conversion ratio. The experiment included 1,200 male Ross broilers from 1 to 42 days of age. Birds were randomly allocated to 4 treatments, with 10 replicates of 30 birds. The following treatments were applied: T1 - Negative Control (basal diet, with no added growth promoter; T2 - Negative Control + Bacillus subtilis (8 x 10(5 CFUs/g feed; T3 - Negative Control + Bacillus subtilis (3 x 10(5 CFUs/ g de feed and T4 - Positive Control (avilamycin + anticoccidial from 1 to 35 days of age. At 21, 35, and 42 days of age, there was an increase of antibiotic-free diet intake as compared to the diets with growth promoters (p0.05. The use of growth promoter did not improve weight gain at the studied ages. There was a marked improvement in the feed conversion ratio of broilers fed the diet with antibiotics and of broilers fed the diet with added B. subtilis. It is concluded that the Bacillus subtilis probiotic can be used as a growth promoter in broiler diets.

  19. Investigation of the toxic effect of cadmium on Candida humicola and Bacillus subtilis using a microcalorimetric method

    International Nuclear Information System (INIS)

    Chen Haiyan; Yao Jun; Zhou Yong; Chen Huilun; Wang Fei; Gai Nan; Zhuang Rensheng; Ceccanti, Brunello; Maskow, Thomas; Zaray, Gyula

    2008-01-01

    In this study, the technique of microcalorimetry based on heat-output by aerobic bacterial respiration was explored to evaluate the toxic effect of cadmium on Candida humicola, Bacillus subtilis, singularly or in a mixture of both. Power-time curves of the growth metabolism of C. humicola and B. subtilis and the effect of Cd 2+ were studied using the TAM III (the third generation thermal activity monitor) multi-channel microcalorimetric system, isothermal mode, at 28 deg. C. The differences in shape of the power-time curves and the thermodynamic and kinetic characteristics of microorganisms growth were compared. The effect of cadmium added into microorganism would significantly reduce the life cycle and change the thermal effect of microbial metabolic process with different concentrations of Cd 2+ . The experimental results revealed that at the same concentration, the sequence of inhibitory ratio (I) and maximum thermal power (P max ) of the Cd 2+ was: mixed microorganisms > C. humicola > B. subtilis. The sequence of total thermal effect (Q total ) and growth rate constant (k) is mixed microorganisms > B. subtilis > C. humicola. These results are important to further studies of the physiology and pharmacology of C. humicola and B. subtilis and may support the theory of restoring contaminated soil

  20. From Genome to Function: Systematic Analysis of the Soil Bacterium Bacillus Subtilis

    Science.gov (United States)

    Crawshaw, Samuel G.; Wipat, Anil

    2001-01-01

    Bacillus subtilis is a sporulating Gram-positive bacterium that lives primarily in the soil and associated water sources. Whilst this bacterium has been studied extensively in the laboratory, relatively few studies have been undertaken to study its activity in natural environments. The publication of the B. subtilis genome sequence and subsequent systematic functional analysis programme have provided an opportunity to develop tools for analysing the role and expression of Bacillus genes in situ. In this paper we discuss analytical approaches that are being developed to relate genes to function in environments such as the rhizosphere. PMID:18628943

  1. Transcriptome analysis documents induced competence of Bacillus subtilis during nitrogen limiting conditions

    DEFF Research Database (Denmark)

    Jarmer, Hanne Østergaard; Berka, R.; Knudsen, Steen

    2002-01-01

    DNA microarrays were used to analyze the changes in gene expression in Bacillus subtilis strain 168 when nitrogen limiting (glutamate) and nitrogen excess (ammonium plus glutamate) growth conditions were compared. Among more than 100 genes that were significantly induced during nitrogen starvation...... we detected the comG, comF, comE, nin-nucA and comK transcription units together with recA. DNA was added to B. subtilis grown in minimal medium with glutamate as the sole nitrogen source and it was demonstrated that the cells were competent. Based on these observations we propose a simplification...

  2. Extracellular protease produced by Bacillus subtilis isolated from ...

    African Journals Online (AJOL)

    In a study to evaluate the microbiological safety of some paracetamol oral solutions sold in some Nigerian drug stores, 40.0% of the samples examined was contaminated with protease-producing Bacillus subtilis. The production of extracellular protease was induced by casein in the minimal medium and was found to be the ...

  3. Production of mannanase from Bacillus Subtilis LBF-005 and its potential for manno-oligosaccharides production

    Science.gov (United States)

    Yopi, Rahmani, Nanik; Jannah, Alifah Mafatikhul; Nugraha, Irfan Pebi; Ramadana, Roni Masri

    2017-11-01

    Endo-β-1, 4-mannanase is the key enzymes for randomly hydrolyzing the β-1,4-linkages within the mannan backbone releasing manno-oligosaccharides (MOS). A marine bacterium of Bacillus subtilis LBF-005 was reported have ability to produce endo-type mannanase. The aims of this research were to compare commercial biomass Locust Bean Gum (LBG) and raw biomass contaning mannan as carbon source for mannanase production from Bacillus subtilis LBF-005, to analyze the optimum condition of mannanase production, and to find out the potential of the mannanase for MOS production. Bacillus subtilis LBF-005 was cultivated in Artificial Sea Water (ASW) medium contain NaCl and various mannan biomass as carbon source for mannanase production. The cells were grown in submerged fermentation. The maximum enzyme activity was obtained with porang potato as a substrate with concentration 1%, pH medium 8, and incubation temperature 50°C with an enzyme activity of 37.7 U/mL. The mainly MOS product released by crude mannanase produced by Bacillus subtilis LBF-005 were mannobiose (M2), mannotriose (M3), mannotetraose (M4), and mannopentaose (M5).

  4. Construction of novel shuttle expression vectors for gene expression in Bacillus subtilis and Bacillus pumilus.

    Science.gov (United States)

    Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong

    2015-01-01

    A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.

  5. Characterization of the Holliday junction resolving enzyme encoded by the Bacillus subtilis bacteriophage SPP1.

    Directory of Open Access Journals (Sweden)

    Lisa Zecchi

    Full Text Available Recombination-dependent DNA replication, which is a central component of viral replication restart, is poorly understood in Firmicutes bacteriophages. Phage SPP1 initiates unidirectional theta DNA replication from a discrete replication origin (oriL, and when replication progresses, the fork might stall by the binding of the origin binding protein G38P to the late replication origin (oriR. Replication restart is dependent on viral recombination proteins to synthesize a linear head-to-tail concatemer, which is the substrate for viral DNA packaging. To identify new functions involved in this process, uncharacterized genes from phage SPP1 were analyzed. Immediately after infection, SPP1 transcribes a number of genes involved in recombination and replication from P(E2 and P(E3 promoters. Resequencing the region corresponding to the last two hypothetical genes transcribed from the P(E2 operon (genes 44 and 45 showed that they are in fact a single gene, re-annotated here as gene 44, that encodes a single polypeptide, named gene 44 product (G44P, 27.5 kDa. G44P shares a low but significant degree of identity in its C-terminal region with virus-encoded RusA-like resolvases. The data presented here demonstrate that G44P, which is a dimer in solution, binds with high affinity but without sequence specificity to several double-stranded DNA recombination intermediates. G44P preferentially cleaves Holliday junctions, but also, with lower efficiency, replicated D-loops. It also partially complemented the loss of RecU resolvase activity in B. subtilis cells. These in vitro and in vivo data suggest a role for G44P in replication restart during the transition to concatemeric viral replication.

  6. Adhesion of Bacillus subtilis and Pseudoalteromonas lipolytica to steel in a seawater environment and their effects on corrosion.

    Science.gov (United States)

    Guo, Zhangwei; Liu, Tao; Cheng, Y Frank; Guo, Na; Yin, Yansheng

    2017-09-01

    In a marine environment, Bacillus subtilis and Pseudoalteromonas lipolytica are commonly found in the biofilms adherent to low-alloy engineering steel, and they have distinct effects on corrosion. In the present work, this phenomenon was investigated through the study of various materials characterization methods, electrochemical techniques, and contact angle measurements. It was found that the surface film formed on the steel in the presence of B. subtilis was compact, uniform, free of cracks, and hydrophobic. However, the film formed in the presence of P. lipolytica was loose, rough, heterogeneous, and hydrophilic. The main components of the films formed in the presence of B. subtilis and P. lipolytica were polysaccharides/TasA amyloid fibers and proteins/carboxylic acid, respectively. The composition, structure, and properties of the surface films formed on the steel were associated with different effects on corrosion. The presence of B. subtilis enhances the steel's resistance to corrosion, whereas corrosion was increased by the presence of P. lipolytica. In short, the compact and hydrophobic biofilm of B. subtilis appears to inhibit the corrosion of steel, while the loose, hydrophilic film of P. lipolytica tends to induce pitting corrosion. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. One-step production of biocommodities from lignocellulosic biomass by recombinant cellulolytic bacillus subtilis: opportunities and challenges

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiao-Zhou [Department of Biological Systems Engineering, Virginia Polytechnic Institute and State University, Blacksburg, VA (United States); Zhang, Yi-Heng P. [Department of Biological Systems Engineering, Virginia Polytechnic Institute and State University, Blacksburg, VA (United States); Institute for Critical Technology and Applied Science, Virginia Polytechnic Institute and State University, Blacksburg, VA (United States); BioEnergy Science Center of Department of Energy, Oak Ridge, TN (United States)

    2010-10-15

    One-step consolidated bioprocessing that integrates cellulase production, cellulose hydrolysis, and product fermentation into a single step for decreasing costly cellulase use, increasing volumetric productivity, and reducing capital investment is widely accepted for low-cost production of biofuels or other value-added biochemicals. Considering the narrow margins between biomass and low-value biocommodities, good physiological performance of industrial microbes is crucial for economically viable production. Bacillus subtilis, the best-characterized Gram-positive microorganism, is a major industrial microorganism with numerous valuable features such as hexose and pentose utilization, low-nutrient needs, fast growth rate, high protein secretion capacity, industrial safety, etc. As compared with other potential consolidated bioprocessing microorganisms such as Clostridium spp., Escherichia coli, and the yeast Saccharomyces cerevisiae, recombinant cellulolytic B. subtilis strains would be a potential platform for biocommodity production from nonfood biomass. Here, we review the advances in recombinant cellulolytic B. subtilis development and metabolic engineering for biocommodity production, and discuss the opportunities and challenges of cellulolytic B. subtilis for biocommodity production. (Copyright copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  8. Antimicrobial Peptide Trichokonin VI-Induced Alterations in the Morphological and Nanomechanical Properties of Bacillus subtilis

    OpenAIRE

    Su, Hai-Nan; Chen, Zhi-Hua; Song, Xiao-Yan; Chen, Xiu-Lan; Shi, Mei; Zhou, Bai-Cheng; Zhao, Xian; Zhang, Yu-Zhong

    2012-01-01

    Antimicrobial peptides are promising alternative antimicrobial agents compared to conventional antibiotics. Understanding the mode of action is important for their further application. We examined the interaction between trichokonin VI, a peptaibol isolated from Trichoderma pseudokoningii, and Bacillus subtilis, a representative Gram-positive bacterium. Trichokonin VI was effective against B. subtilis with a minimal inhibitory concentration of 25 µM. Trichokonin VI exhibited a concentration- ...

  9. Digestibility and fecal characteristics of dogs fed with Bacillus subtilis in diet Digestibilidade e características das fezes de cães suplementados com Bacillus subtilis na dieta

    Directory of Open Access Journals (Sweden)

    Ananda Portella Félix

    2010-10-01

    Full Text Available Considering the benefice demonstrated by the modulating action of probiotics on the host intestinal microbiota, this study aimed to evaluate diet digestibility and fecal characteristics of dogs fed with diets supplemented with Bacillus subtilis (C-3102. Twelve young Beagle dogs were distributed in a completely randomized experimental design consisting of two treatments: diet with no addition or with the addition of 0.01% Bacillus subtilis (C-3102. Dogs passed through 25 days of adaptation to the diets, and five days of total feces collection. The following fecal characteristics were evaluated: pH, fecal score (1 - watery feces; 5: dry and hard feces, and ammonia content. Diet mean digestibility was compared by the Tukey test, and fecal characteristics by the Tukey-Kramer test. Diet digestibility was not different between treatments, but dogs supplemented with the tested probiotic presented dryer feces (39.1% vs. 36.5% dry matter, higher fecal score (3.4 vs. 3.0 and lower fecal ammonia content (0.45% vs. 0.56%, than dogs fed with the control diet. The dietary supplementation with Bacillus subtilis (C-3102 improves fecal texture and odor in dogs.Em virtude da capacidade moduladora dos probióticos sobre a microbiota intestinal a favor da saúde do hospedeiro, objetivou-se, com este estudo, avaliar a digestibilidade e as características das fezes de cães suplementados com Bacillus subtilis (C-3102 na dieta. Foram utilizados 12 cães adultos da raça Beagle, os quais foram distribuídos inteiramente ao acaso, em dois tratamentos: dieta controle e dieta com adição de 0,01% de Bacillus subtilis (C-3102. Os animais passaram por 25 dias de adaptação às dietas e por cinco dias para colheita total de fezes. As características das fezes foram avaliadas por meio da matéria seca, do escore (1: fezes moles, malformadas a 5: fezes secas e duras, do pH, da amônia e da produção de fezes. Não houve diferença na digestibilidade; entretanto, os c

  10. Development and characterization of membrane surface display system using molecular chaperon, prsA, of Bacillus subtilis

    International Nuclear Information System (INIS)

    Kim, June-Hyung; Park, In-Suk; Kim, Byung-Gee

    2005-01-01

    We report a new membrane surface display system based on molecular chaperon, prsA, of Bacillus subtilis. Clostridium thermocellum cellulase, celA, was fused to C-terminal end of PrsA. Cellulase activity of B. subtilis protoplast, which expressed PrsA-CelA was 15 times higher compared to control strain. More than 85% of total cellulase activity was observed in surface displayed format and less than 15% of total cellulase activity was found in supernatant. Flow cytometric analysis of protoplast of PrsA-CelA fusion expressing bacteria provided another proof of uniform expression of fusion protein onto cytoplasmic membrane of B. subtilis. Without lysozyme treatment, only part of cellulase activity (10%) was observed in whole cell fraction

  11. Effect of Coat Layers in Bacillus Subtilis Spores Resistance to Photo-Catalytic Inactivation

    Directory of Open Access Journals (Sweden)

    Luz del Carmen Huesca-Espitia

    2017-10-01

    Full Text Available Different water treatment processes (physical and chemical exist to obtain safe water for human or food industry supply. The advanced oxidation technologies are rising as a new alternative to eliminate undesirable chemicals and waterborne diseases. In this work, we analyze the power of the photo-assisted Fenton process using Fe(II/H2O2 and UV radiation (365 nm to inactivate Bacillus subtilis spores, considered among the most resistant biological structures known. Different concentrations of Fe(II, H2O2 and UV radiation (365 nm were used to inactivate wt and some coat spore mutants of B. subtilis. Wt spores of B. subtilis were inactivated after 60 min using this process. In general, all defective coat mutants were more sensitive than the wt spores and, particularly, the double mutant was 10 folds more sensitive than others being inactivated during the first 10 minutes using soft reaction conditions. Presence of Fe(II ions was found essential for spore inactivating process and, for those spores inactivated using the Fe(II/H2O2 under UV radiation process, it is suggested that coat structures are important to their resistance to the treatment process. The photo-assisted Fenton process using Fe(II, H2O2 and UV radiation (365 nm can be used to inactivate any water microorganisms with the same or less resistance that B. subtilis spores to produce safe drinking water in relatively short treatment time.

  12. Caracterización de cristales de calcita bioprecipitada por un aislamiento nativo de Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Carolina Montoya

    2007-02-01

    Full Text Available Bacillus subtilis es una bacteria útil en algunas aplicaciones biotecnológicas por poseer enzimas como las amilasas, las cuales desempeñan un papel importante en diferentes procesos industriales. Una de sus propiedades, poco estudiada, ha sido su capacidad de inducir bioprecipitación química de carbonato de calcio (Ca2+ + HCO3 3> CaCO3 + H+ mediante un mecanismo similar al observado en la formación de rocas, suelos y estructuras biológicas como huesos, conchas y dientes. En esta investigación se estudiaron los cristales producidos por un aislamiento nativo de B. subtilis, tomado de una mina de oro situada en Segovia (Antioquia. Se determinó su capacidad calcificante utilizando el medio de cultivo B4. La caracterización del cristal producido se realizó con lupa binocular, microscopio petrográfico de luz plana polarizada (MOLP en su modo de luz transmitida, microscopio electrónico de barrido con analizador de estado sólido (ESEM/EDX y espectroscopía infrarroja con transformada de Fourier (FTIR. A partir de los resultados obtenidos por medio de la caracterización utilizando la combinación de las técnicas analíticas que se mencionaron, fue posible determinar que el aislado nativo de B. subtilis generó y por ende es productor de cristales de carbonato de calcio (CaCO3 en su forma polimórfica de baja temperatura (calcite.Palabras clave: Bacillus subtilis, calcita, bioprecipitación, mineralogía aplicada, biomineralogía.ABSTRACTBacillus subtilis, a bacterium useful in some biotechnology applications, contains enzymes such as amylases, which play an important role in several industrial processes. One of its properties, not very well studied, is its capacity to induce the chemical bioprecipitation of CaCO3 (Ca2+ + HCO3 —> CaCO3 + H+, a similar mechanism commonly observed in the formation of rocks, soils and biological structures like bones, shells and teeth. In this work we have studied carbonate crystals produced by a B

  13. Caracterización de cristales de calcita bioprecipitada por un aislamiento nativo de Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Carolina Montoya

    2005-07-01

    Full Text Available Bacillus subtilis es una bacteria útil en algunas aplicaciones biotecnológicas por poseer enzimas como las amilasas, las cuales desempeñan un papel importante en diferentes procesos industriales. Una de sus propiedades, poco estudiada, ha sido su capacidad de inducir bioprecipitación química de carbonato de calcio (Ca2+ + HCO3 3> CaCO3 + H+ mediante un mecanismo similar al observado en la formación de rocas, suelos y estructuras biológicas como huesos, conchas y dientes. En esta investigación se estudiaron los cristales producidos por un aislamiento nativo de B. subtilis, tomado de una mina de oro situada en Segovia (Antioquia. Se determinó su capacidad calcificante utilizando el medio de cultivo B4. La caracterización del cristal producido se realizó con lupa binocular, microscopio petrográfico de luz plana polarizada (MOLP en su modo de luz transmitida, microscopio electrónico de barrido con analizador de estado sólido (ESEM/EDX y espectroscopía infrarroja con transformada de Fourier (FTIR. A partir de los resultados obtenidos por medio de la caracterización utilizando la combinación de las técnicas analíticas que se mencionaron, fue posible determinar que el aislado nativo de B. subtilis generó y por ende es productor de cristales de carbonato de calcio (CaCO3 en su forma polimórfica de baja temperatura (calcite.Palabras clave: Bacillus subtilis, calcita, bioprecipitación, mineralogía aplicada, biomineralogía.ABSTRACTBacillus subtilis, a bacterium useful in some biotechnology applications, contains enzymes such as amylases, which play an important role in several industrial processes. One of its properties, not very well studied, is its capacity to induce the chemical bioprecipitation of CaCO3 (Ca2+ + HCO3 —> CaCO3 + H+, a similar mechanism commonly observed in the formation of rocks, soils and biological structures like bones, shells and teeth. In this work we have studied carbonate crystals produced by a B

  14. Interaction between N-methyl-N'-nitro-N-nitrosoguanidine and ultraviolet irradiation on Bacillus subtilis

    International Nuclear Information System (INIS)

    Lotareva, O.V.

    1990-01-01

    The mutagenic interaction between ultraviolet-irradiation and the alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine was studied in a repaid-competent and excision-deficient strains of Bacillus subtilis. Pre-exposure to low doses of MNNG with following treatment by low and intermediate doses of UV-light increase the resistance of Bac. subtilis to UV-radiation (antagonistic effect). Probably pre-exposition with MNNG leads to induction of enzymes reparation, UV-damages being controlled with adaptive respons genes

  15. Genome analysis of the freshwater planktonic Vulcanococcus limneticus sp. nov. reveals horizontal transfer of nitrogenase operon and alternative pathways of nitrogen utilization.

    Science.gov (United States)

    Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana

    2018-04-16

    Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for

  16. Adaptation of Bacillus subtilis carbon core metabolism to simultaneous nutrient limitation and osmotic challenge : a multi-omics perspective

    NARCIS (Netherlands)

    Kohlstedt, Michael; Sappa, Praveen K; Meyer, Hanna; Maaß, Sandra; Zaprasis, Adrienne; Hoffmann, Tamara; Becker, Judith; Steil, Leif; Hecker, Michael; van Dijl, Jan Maarten; Lalk, Michael; Mäder, Ulrike; Stülke, Jörg; Bremer, Erhard; Völker, Uwe; Wittmann, Christoph

    The Gram-positive bacterium Bacillus subtilis encounters nutrient limitations and osmotic stress in its natural soil ecosystem. To ensure survival and sustain growth, highly integrated adaptive responses are required. Here, we investigated the system-wide response of B.subtilis to different,

  17. Inoculação de sementes com Bacillus subtilis, formulado com farinha de ostras e desenvolvimento de milho, soja e algodão Seed inoculation with Bacillus subtilis, formulated with oyster meal and growth of corn, soybean and cotton

    Directory of Open Access Journals (Sweden)

    Fabio Fernando de Araujo

    2008-04-01

    Full Text Available Bacillus subtilis, bactéria habitante natural do solo, produz antibióticos, enzimas e fitohormonios que proporcionam benefícios para as plantas. Essa espécie microbiana é também descrita como rizobactéria promotora de crescimento de plantas (RPCP. Sementes de milho, algodão e soja foram inoculadas com células de B. subtilis formulado com farinha de ostras objetivando-se avaliar a emergência e o desenvolvimento das plantas. A inoculação proporcionou aumento de emergências em algodão e soja. Além disso, a inoculação com o produto biológico incrementou significativamente a produção de massa seca, na parte aérea do milho. Os teores de fósforo e nitrogênio foram maiores no tecido foliar de milho, inoculados com a bactéria e farinha de ostras, comparando-se com a testemunha. A interação do resíduo orgânico com a bactéria proporcionou ganhos no crescimento e nutrição das plantas. A inoculação de sementes com B. subtilis, formulado com o resíduo orgânico, apresentou-se como uma alternativa tecnológica viável para a inoculação de sementes.Bacillus subtilis is a soil bacteria able to synthesize antibiotics, enzymes and phytohormones importants for plant growth. This specie is also classified in plant growth as promoting rhizobacteria (PGPR. A biological product containing oyster meal and cells of B. subtilis was inoculated in seeds of corn, cotton and soybean. This inoculation increased emergence in cotton and soybean. The growth of corn was stimulated by seed inoculation with B. subtilis and organic amendment. The concentration of phosphorus and nitrogen significantly increased in the corn treated with the product. The interaction bacteria with organic amendment provided increments in plant growth. The inoculation of seeds with B. subtilis and amendments is promising technological alternative for seed treatment.

  18. Identification of a Bacillus subtilis secretion mutant using a ß-galactosidase screening procedure

    DEFF Research Database (Denmark)

    Jacobs, Myra F.; Andersen, Jens Bo; Borchert, Torben V.

    1995-01-01

    High-level synthesis of exportable beta-galactosidase (LacZ) fusion proteins in Bacillus subtilis results in a lethal phenotype, and has been suggested as a tool for the selection of secretion mutants. We tested a plasmid-based, inducible lacZ fusion gene system for this purpose, but frequent...... mutations in cis, which reduced expression of the fusion gene, forced abandonment of the induction-selection strategy. Instead, after modification of the indicator plasmid, a screening procedure for increased basal LacZ activity levels was adopted. This led to the identification of a conditional B. subtilis...

  19. Identification of a Bacillus subtilis secretion mutant using a beta-galactosidase screening procedure

    DEFF Research Database (Denmark)

    Jacobs, M F; Borchert, T V; Kontinen, V P

    1995-01-01

    High-level synthesis of exportable beta-galactosidase (LacZ) fusion proteins in Bacillus subtilis results in a lethal phenotype, and has been suggested as a tool for the selection of secretion mutants. We tested a plasmid-based, inducible lacZ fusion gene system for this purpose, but frequent...... mutations in cis, which reduced expression of the fusion gene, forced abandonment of the induction-selection strategy. Instead, after modification of the indicator plasmid, a screening procedure for increased basal LacZ activity levels was adopted. This led to the identification of a conditional B. subtilis...

  20. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Directory of Open Access Journals (Sweden)

    Astha Agarwal

    2013-01-01

    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  1. Use of Bacillus Subtilis PB6 as a potential antibiotic growth promoter replacement in improving performance of broiler birds.

    Science.gov (United States)

    Jayaraman, Sathishkumar; Das, Partha Pratim; Saini, Prakash Chandra; Roy, Barun; Chatterjee, Paresh Nath

    2017-08-01

    The intestinal gut health is one of the primary determinants of broiler growth and performance. Among the various enteric diseases, necrotic enteritis (NE) is an enterotoxemic disease caused by Clostridium perfringens, which can result in severe economic losses in poultry farming. Antibiotics like bacitracin methylene disalicylate (BMD) and avilamycin (AVL) are commonly used antibiotic growth promoters (AGP) in poultry feed to control necrotic enteritis in birds. Bacillus subtilis PB6 was reported to prevent necrotic enteritis and improve performance in birds. This paper investigated the influence of Bacillus subtilis PB6 in improving the performance of broiler birds in comparison with BMD and avilamycin. A 35 day trial was conducted with 240 day-old commercial broiler chicks (VenCobb 400), which were divided into four treatment groups, where each treatment group was composed of 6 replicates each containing 10 birds, for a total of 60 birds per treatment. The treatment groups included a negative control (no AGP), Bacillus subtilis PB6, BMD, and avilamycin. The parameters analyzed included body weight, feed conversion ratio (FCR), mortality, villus histomorphometry, and European efficiency factor (EEF). Bacillus subtilis PB6 significantly (P < 0.05) improved body weight and FCR (8 points) compared to the control. The group supplemented with B. subtilis PB6 or BMD had higher (P < 0.05) body weight compared to all other treatment groups. The supplementation of B. subtilis PB6 significantly improved the villus height (P < 0.05) compared to control and other AGP groups. The EEF was found to be the highest in the B. subtilis PB6 supplemented group at 35th day as compared to other treatment groups. The combined data from this study indicate that supplementation of B. subtilis PB6 improves overall performance of broilers compared to BMD and avilamycin, and can be used as potential AGP replacement in poultry farming. © 2017 Poultry Science Association Inc.

  2. The conserved nhaAR operon is drastically divergent between B2 and non-B2 Escherichia coli and is involved in extra-intestinal virulence.

    Science.gov (United States)

    Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier

    2014-01-01

    The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.

  3. A novel expression vector for the secretion of abaecin in Bacillus subtilis.

    Science.gov (United States)

    Li, Li; Mu, Lan; Wang, Xiaojuan; Yu, Jingfeng; Hu, Ruiping; Li, Zhen

    This study aimed to describe a Bacillus subtilis expression system based on genetically modified B. subtilis. Abaecin, an antimicrobial peptide obtained from Apis mellifera, can enhance the effect of pore-forming peptides from other species on the inhibition of bacterial growth. For the exogenous expression, the abaecin gene was fused with a tobacco etch virus protease cleavage site, a promoter Pglv, and a mature beta-glucanase signal peptide. Also, a B. subtilis expression system was constructed. The recombinant abaecin gene was expressed and purified as a recombinant protein in the culture supernatant. The purified abaecin did not inhibit the growth of Escherichia coli strain K88. Cecropin A and hymenoptaecin exhibited potent bactericidal activities at concentrations of 1 and 1.5μM. Combinatorial assays revealed that cecropin A and hymenoptaecin had sublethal concentrations of 0.3 and 0.5μM. This potentiating functional interaction represents a promising therapeutic strategy. It provides an opportunity to address the rising threat of multidrug-resistant pathogens that are recalcitrant to conventional antibiotics. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  4. Control of Initiation of DNA Replication in Bacillus subtilis and Escherichia coli

    Directory of Open Access Journals (Sweden)

    Katie H. Jameson

    2017-01-01

    Full Text Available Initiation of DNA Replication is tightly regulated in all cells since imbalances in chromosomal copy number are deleterious and often lethal. In bacteria such as Bacillus subtilis and Escherichia coli, at the point of cytokinesis, there must be two complete copies of the chromosome to partition into the daughter cells following division at mid-cell during vegetative growth. Under conditions of rapid growth, when the time taken to replicate the chromosome exceeds the doubling time of the cells, there will be multiple initiations per cell cycle and daughter cells will inherit chromosomes that are already undergoing replication. In contrast, cells entering the sporulation pathway in B. subtilis can do so only during a short interval in the cell cycle when there are two, and only two, chromosomes per cell, one destined for the spore and one for the mother cell. Here, we briefly describe the overall process of DNA replication in bacteria before reviewing initiation of DNA replication in detail. The review covers DnaA-directed assembly of the replisome at oriC and the multitude of mechanisms of regulation of initiation, with a focus on the similarities and differences between E. coli and B. subtilis.

  5. Production of nattokinase by batch and fed-batch culture of Bacillus subtilis.

    Science.gov (United States)

    Cho, Young-Han; Song, Jae Yong; Kim, Kyung Mi; Kim, Mi Kyoung; Lee, In Young; Kim, Sang Bum; Kim, Hyeon Shup; Han, Nam Soo; Lee, Bong Hee; Kim, Beom Soo

    2010-09-30

    Nattokinase was produced by batch and fed-batch culture of Bacillus subtilis in flask and fermentor. Effect of supplementing complex media (peptone, yeast extract, or tryptone) was investigated on the production of nattokinase. In flask culture, the highest cell growth and nattokinase activity were obtained with 50 g/L of peptone supplementation. In this condition, nattokinase activity was 630 unit/ml at 12 h. In batch culture of B. subtilis in fermentor, the highest nattokinase activity of 3400 unit/ml was obtained at 10h with 50 g/L of peptone supplementation. From the batch kinetics data, it was shown that nattokinase production was growth-associated and culture should be harvested before stationary phase for maximum nattokinase production. In fed-batch culture of B. subtilis using pH-stat feeding strategy, cell growth (optical density monitored at 600 nm) increased to ca. 100 at 22 h, which was 2.5 times higher than that in batch culture. The highest nattokinase activity was 7100 unit/ml at 19 h, which was also 2.1 times higher than that in batch culture. Copyright 2010 Elsevier B.V. All rights reserved.

  6. Control of Initiation of DNA Replication in Bacillus subtilis and Escherichia coli

    Science.gov (United States)

    Jameson, Katie H.; Wilkinson, Anthony J.

    2017-01-01

    Initiation of DNA Replication is tightly regulated in all cells since imbalances in chromosomal copy number are deleterious and often lethal. In bacteria such as Bacillus subtilis and Escherichia coli, at the point of cytokinesis, there must be two complete copies of the chromosome to partition into the daughter cells following division at mid-cell during vegetative growth. Under conditions of rapid growth, when the time taken to replicate the chromosome exceeds the doubling time of the cells, there will be multiple initiations per cell cycle and daughter cells will inherit chromosomes that are already undergoing replication. In contrast, cells entering the sporulation pathway in B. subtilis can do so only during a short interval in the cell cycle when there are two, and only two, chromosomes per cell, one destined for the spore and one for the mother cell. Here, we briefly describe the overall process of DNA replication in bacteria before reviewing initiation of DNA replication in detail. The review covers DnaA-directed assembly of the replisome at oriC and the multitude of mechanisms of regulation of initiation, with a focus on the similarities and differences between E. coli and B. subtilis. PMID:28075389

  7. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  8. The antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 prevents premature expression of the flv4-2 operon upon shift in inorganic carbon supply.

    Science.gov (United States)

    Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari

    2012-09-28

    The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.

  9. The Antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 Prevents Premature Expression of the flv4-2 Operon upon Shift in Inorganic Carbon Supply*

    Science.gov (United States)

    Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari

    2012-01-01

    The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963