WorldWideScience

Sample records for subgenus rubus watson

  1. Anatomical study of Rubus subgenus Rubus in Iran

    Directory of Open Access Journals (Sweden)

    Razieh Kasalkheh

    2016-06-01

    Full Text Available Rubus L. genus from Rosaceae has about 750 species, from which 8 species and 5 hybrids from Iran. In this study stem, leaflet, petiole, stipule and pedicle anatomy of 7 species of the genus Rubus subgenus. Rubus is invesgitated. These species include R. sanctus, R. persicus, R. hyrcanus, R. hirtus, R. dilichocarpus, R. discolor and R. caesius. Plant samples were collected and then fixed and handmade cross-section of leave were prepared and stained with methyl green and carmine. Several slides were studies and photographed with light microscope (LM. Among studied character, five quantitative features such as shape of transvers cross section, type of glandular and non-glandular trichome, presence or absence of stalk glandular trichome, distribution of calcium oxalate crystal and thickness of cuticle were studied in separation of species. Also, five quantitative features such as number of vascular bundles, number of collenchyma layer (in stem and petiole, number of palisade and spongy paranchymatous layer (in leaflet and presence or absence palisade paranchymatous in stipule are valuable and can be used in distinguishing species.

  2. Capricious, or tied to history’s apron strings? Floristic regions in north-west European brambles (Rubus subgenus Rubus, Rosaceae)

    NARCIS (Netherlands)

    Haveman, R.; Bijlsma, R.J.; Ronde, de I.; Schaminee, J.H.J.

    2016-01-01

    Aim
    To classify and describe distributional patterns in apomictic Rubus subgenus Rubus in north-west Europe and to characterize the major regions by statistically derived character species.

    Location
    North-western Europe, in particular Ireland, the United Kingdom, the Netherlands,

  3. Phylogeny and biogeography of pacific Rubus subgenus Idaeobatus (Rosaceae) species: Investigating the origin of the endemic Hawaiian raspberry R. macraei

    Science.gov (United States)

    Morden, C.W.; Gardner, D.E.; Weniger, D.A.

    2003-01-01

    The endemic Hawaiian raspberries Rubus hawaiensis and R. macraei (both subgenus Idaeobatus) had been thought to be closely related species until recent molecular studies demonstrated otherwise. These studies suggest that they are the products of separate colonizations to the Hawaiian Islands. Affinities of R. hawaiensis to R. spectabilis of western North America were clearly confirmed. However, no clear relation to R. macraei has been published. This study was initiated to examine species of subg. Idaeobatus from the surrounding Pacific region as well as species from other subgenera to better evaluate biogeographic and phylogenetic affinities of R. macraei by means of chromosome analysis and molecular data using the chloroplast gene ndbF. Results show that R. macraei clusters in a clade with species of blackberries, subg. Rubus, and of these it is most closely linked to R. ursinus. Chromosomally, R. macraei is 2n = 6x = 42, a number that would be a new report for subg. Idaeobatus. However, polyploidy is common in subg. Rubus. Analyses indicate that R. macraei and R. hawaiensis are derived from separate colonizations from North America and that similarities between them are due to convergent evolution in the Hawaiian environment.

  4. Distributional Watson transforms

    NARCIS (Netherlands)

    Dijksma, A.; Snoo, H.S.V. de

    1974-01-01

    For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.

  5. The genus Rubus (Rosaceae in South Africa. IV. Natural hybridiza­ tion

    Directory of Open Access Journals (Sweden)

    J. J. Spies

    1987-12-01

    Full Text Available The genus  Rubus L. is represented in southern Africa by the subgenera  Eubatus Focke and  Idaeobatus Focke. A combination o f morphological data, data on the reproductive systems of some collections and meiotic chromosome behaviour indicates that a hybrid swarm in the eastern Transvaal was formed subsequent to the hybridization between R. cuneifolius Pursh. taxon B (subgenus Eubatus and R. longepedicellatus (C. E. Gust. C. H. Stirton (subgenus Idaeobatus. Other examples of intra- and intersubgeneric hybridization were found during this study of the South African material. These instances, with examples found in the literature, indicate that the subgeneric subdivisions of Rubus are artificial. Three different methods were used to analyse the meiotic chromosome configurations. The genome relationship system of Alonso & Kimber (1981 and Kimber & Alonso (1981 and the modification of the binomial system of Jackson & Casey (1980 by Spies (1984 proved to be the most sensitive for distinguishing between alio-, segmental alio- and autoploids.

  6. A Challenge to Watson

    Science.gov (United States)

    Detterman, Douglas K.

    2011-01-01

    Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

  7. Data Discovery with IBM Watson

    Science.gov (United States)

    Fessler, J.

    2016-12-01

    BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

  8. Making IBM's Computer, Watson, Human

    Science.gov (United States)

    Rachlin, Howard

    2012-01-01

    This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

  9. Weighted Watson-Crick automata

    Energy Technology Data Exchange (ETDEWEB)

    Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)

    2014-07-10

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  10. Interview with Mark Watson

    Directory of Open Access Journals (Sweden)

    Katy Shaw

    2016-04-01

    Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

  11. Closure properties of Watson-Crick grammars

    Science.gov (United States)

    Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

    2015-12-01

    In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

  12. de Jean Watson

    Directory of Open Access Journals (Sweden)

    Thaís Schossler

    2008-01-01

    Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

  13. Rubus fruit myths vs. reality

    Science.gov (United States)

    This factsheet corrects several popular media inaccuracies about Rubus fruit. Supplying the public with scientific facts is part of our continued efforts to assist consumers in making sound health conscious decisions. This project was partially funded by a Specialty Crop Research Initiative grant fr...

  14. A new subgenus of Heterotrigona from New Guinea (Hymenoptera: Apidae)

    DEFF Research Database (Denmark)

    Engel, Michael S.; Rasmussen, Claus

    2017-01-01

    A new subgenus is established within the Indomalayan stingless bee genus Heterotrigona Schwarz (Meliponini). Sahulotrigona Engel & Rasmussen, new subgenus, is distinguished from amongst other Heterotrigona, particularly the subgenus Platytrigona Moure, within which one of the two included species...

  15. Novel Microsatellite Markers Acquired from Rubus coreanus Miq. and Cross-Amplification in Other Rubus Species

    Directory of Open Access Journals (Sweden)

    Gi-An Lee

    2015-04-01

    Full Text Available The Rubus genus consists of more than 600 species that are distributed globally. Only a few Rubus species, including raspberries and blueberries, have been domesticated. Genetic diversity within and between Rubus species is an important resource for breeding programs. We developed genomic microsatellite markers using an SSR-enriched R. coreanus library to study the diversity of the Rubus species. Microsatellite motifs were discovered in 546 of 646 unique clones, and a dinucleotide repeat was the most frequent (75.3% type of repeat. From 97 microsatellite loci with reproducible amplicons, we acquired 29 polymorphic microsatellite markers in the Rubus coreanus collection. The transferability values ranged from 59.8% to 84% across six Rubus species, and Rubus parvifolius had the highest transferability value (84%. The average number of alleles and the polymorphism information content were 5.7 and 0.541, respectively, in the R. coreanus collection. The diversity index of R. coreanus was similar to the values reported for other Rubus species. A phylogenetic dendrogram based on SSR profiles revealed that seven Rubus species could be allocated to three groups, and that R. coreanus was genetically close to Rubus crataegifolius (mountain berry. These new microsatellite markers might prove useful in studies of the genetic diversity, population structure, and evolutionary relationships among Rubus species.

  16. Ed Watson - 1940-2006

    CERN Multimedia

    2006-01-01

    Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

  17. John Watson's paradoxical struggle to explain Freud.

    Science.gov (United States)

    Rilling, M

    2000-03-01

    John Watson was fascinated by the discoveries of psychoanalysis, but he rejected Freud's central concept of the unconscious as incompatible with behaviorism. After failing to explain psychoanalysis in terms of William James's concept of habit, Watson borrowed concepts from classical conditioning to explain Freud's discoveries. Watson's famous experiment with Little Albert is interpreted not only in the context of Pavlovian conditioning but also as a psychoanalytically inspired attempt to capture simplified analogues of adult phobic behavior, including the "transference" of emotion in an infant. Watson used his behavioristic concept of conditioned emotional responses to compete with Freud's concepts of displacement and the unconscious transference of emotion. Behind a mask of anti-Freudian bias, Watson surprisingly emerges as a psychologist who popularized Freud and pioneered the scientific appraisal of his ideas in the laboratory.

  18. Ed Watson 1940-2006

    CERN Document Server

    2006-01-01

    Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

  19. A chat with James Watson

    CERN Multimedia

    2011-01-01

    On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

  20. Validating the Watson Glaser Critical Thinking Appraisal

    Science.gov (United States)

    Hassan, Karma El; Madhum, Ghida

    2007-01-01

    This study validated the Watson Glaser Critical Thinking Appraisal (WGCTA) on a sample of 273 private university students in Lebanon. For that purpose, evidence for construct validation was investigated through identifying the test's factor structure and subscale total correlations, in addition to differences in scores by gender, different levels,…

  1. Oncologists partner with Watson on genomics.

    Science.gov (United States)

    2015-08-01

    A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

  2. Rubus pharmacology: antiquity to the present

    Science.gov (United States)

    Aeschylus, Hippocrates, Krataeus, Dioscorides, and Galen; Romans: Cato, Ovid, and Pliny the Elder; Asian medicinal traditions, such as the Unani Tibb, traditional Chinese medicine, and the Ayurvedic tradition of India. Folk traditions of native peoples throughout the world have also applied Rubus fo...

  3. Did John B. Watson Really "Found" Behaviorism?

    Science.gov (United States)

    Malone, John C

    2014-05-01

    Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

  4. Revision of Rubus (Rosaceae in Taiwan

    Directory of Open Access Journals (Sweden)

    Juinn-Yih Huang

    2009-11-01

    Full Text Available The genus Rubus L. in Taiwan is taxonomically revised based on morphological and phytogeographical patterns. Forty taxa (34 species, 3 varieties, and 3 hybrids of the genus are recognized, including two new hybrid species R. croceacanthus × corchorifolius and R. rosifolius × fraxinifolius. Among the Rubus taxa in Taiwan, R. croceacanthus H. Lév. exhibits tremendous variation and we do believe that more investigations are needed in the future. Several taxa described in the Flora of Taiwan, 2nd ed. are treated as synonyms of other species, and several taxa in Taiwan are revised. The existence of R. howii Merr. & Chun, R. linearifoliolus Hayata, and R. parvifraxinifolius Hayata in Taiwan are reconfirmed, we described R. howii fruit information which was absent in original literature; and the third taxon is treated as a natural hydrid R. × parvifraxinifolius Hayata which putatively derived from R. rosifolius Sm. and R. linearifoliolus based on intermediate morphology and the scarcity of fruit set. Rubus pseudoacer Makino ssp. flexuosus (Y.-C. Liu & F.-Y. Lu H. Ohashi & C.-F. Hsieh is treated as synonym of R. pseudoacer Makino and is excluded in Taiwan. A key to the taxa, synonyms and taxonomic descriptions of each taxon are presented. Moreover, information about phenology, chromosome number, distribution and specimens examined for each taxon are also provided.

  5. The genome of black raspberry (Rubus occidentalis).

    Science.gov (United States)

    VanBuren, Robert; Bryant, Doug; Bushakra, Jill M; Vining, Kelly J; Edger, Patrick P; Rowley, Erik R; Priest, Henry D; Michael, Todd P; Lyons, Eric; Filichkin, Sergei A; Dossett, Michael; Finn, Chad E; Bassil, Nahla V; Mockler, Todd C

    2016-09-01

    Black raspberry (Rubus occidentalis) is an important specialty fruit crop in the US Pacific Northwest that can hybridize with the globally commercialized red raspberry (R. idaeus). Here we report a 243 Mb draft genome of black raspberry that will serve as a useful reference for the Rosaceae and Rubus fruit crops (raspberry, blackberry, and their hybrids). The black raspberry genome is largely collinear to the diploid woodland strawberry (Fragaria vesca) with a conserved karyotype and few notable structural rearrangements. Centromeric satellite repeats are widely dispersed across the black raspberry genome, in contrast to the tight association with the centromere observed in most plants. Among the 28 005 predicted protein-coding genes, we identified 290 very recent small-scale gene duplicates enriched for sugar metabolism, fruit development, and anthocyanin related genes which may be related to key agronomic traits during black raspberry domestication. This contrasts patterns of recent duplications in the wild woodland strawberry F. vesca, which show no patterns of enrichment, suggesting gene duplications contributed to domestication traits. Expression profiles from a fruit ripening series and roots exposed to Verticillium dahliae shed insight into fruit development and disease response, respectively. The resources presented here will expedite the development of improved black and red raspberry, blackberry and other Rubus cultivars. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  6. Diuretic Activity of Rubus idaeus L (Rosaceae) in Rats | Zhang ...

    African Journals Online (AJOL)

    Purpose: To evaluate the diuretic activity of Rubus idaeus L in experimental rats. Methods: Hot-water and methanol extract of three kinds of Rubus idaeus L. fruits were administered to experimental rats orally at a dose of 2 and 5 mg/kg. Hydrochlorothiazide (10 mg/kg) was used as positive control in study. The diuretic effect ...

  7. Aspergillus subgenus Polypaecilum from the built environment

    Directory of Open Access Journals (Sweden)

    J.B. Tanney

    2017-09-01

    Full Text Available Xerophilic fungi, especially Aspergillus species, are prevalent in the built environment. In this study, we employed a combined culture-independent (454-pyrosequencing and culture-dependent (dilution-to-extinction approach to investigate the mycobiota of indoor dust collected from 93 buildings in 12 countries worldwide. High and low water activity (aw media were used to capture mesophile and xerophile biodiversity, resulting in the isolation of approximately 9 000 strains. Among these, 340 strains representing seven putative species in Aspergillus subgenus Polypaecilum were isolated, mostly from lowered aw media, and tentatively identified based on colony morphology and internal transcribed spacer rDNA region (ITS barcodes. Further morphological study and phylogenetic analyses using sequences of ITS, β-tubulin (BenA, calmodulin (CaM, RNA polymerase II second largest subunit (RPB2, DNA topoisomerase 1 (TOP1, and a pre-mRNA processing protein homolog (TSR1 confirmed the isolation of seven species of subgenus Polypaecilum, including five novel species: A. baarnensis, A. keratitidis, A. kalimae sp. nov., A. noonimiae sp. nov., A. thailandensis sp. nov., A. waynelawii sp. nov., and A. whitfieldii sp. nov. Pyrosequencing detected six of the seven species isolated from house dust, as well as one additional species absent from the cultures isolated, and three clades representing potentially undescribed species. Species were typically found in house dust from subtropical and tropical climates, often in close proximity to the ocean or sea. The presence of subgenus Polypaecilum, a recently described clade of xerophilic/xerotolerant, halotolerant/halophilic, and potentially zoopathogenic species, within the built environment is noteworthy.

  8. Training IBM Watson using Automatically Generated Question-Answer Pairs

    OpenAIRE

    Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

    2016-01-01

    IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

  9. Graham Watson: Eesti vajab enam riigi sekkumist majandusse

    Index Scriptorium Estoniae

    Watson, Graham

    2009-01-01

    18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

  10. Genome Duplication in Soybean (Glycine Subgenus Soja)

    Science.gov (United States)

    Shoemaker, R. C.; Polzin, K.; Labate, J.; Specht, J.; Brummer, E. C.; Olson, T.; Young, N.; Concibido, V.; Wilcox, J.; Tamulonis, J. P.; Kochert, G.; Boerma, H. R.

    1996-01-01

    Restriction fragment length polymorphism mapping data from nine populations (Glycine max X G. soja and G. max X G. max) of the Glycine subgenus soja genome led to the identification of many duplicated segments of the genome. Linkage groups contained up to 33 markers that were duplicated on other linkage groups. The size of homoeologous regions ranged from 1.5 to 106.4 cM, with an average size of 45.3 cM. We observed segments in the soybean genome that were present in as many as six copies with an average of 2.55 duplications per segment. The presence of nested duplications suggests that at least one of the original genomes may have undergone an additional round of tetraploidization. Tetraploidization, along with large internal duplications, accounts for the highly duplicated nature of the genome of the subgenus. Quantitative trait loci for seed protein and oil showed correspondence across homoeologous regions, suggesting that the genes or gene families contributing to seed composition have retained similar functions throughout the evolution of the chromosomes. PMID:8878696

  11. Antioxidant properties of Rubus discolor leaf extracts

    OpenAIRE

    Veličković Ivona Z.; Grujić Slavica M.; Marin Petar D.

    2016-01-01

    In this work were examined aqueous, methanol, ethanol and acetone leaf extracts of Rubus discolor, wild growing blackberry, for their antioxidant properties and total phenol and flavonoid content. The total phenol content (TPC) varried from 250.05 to 446.61 mg GAE/g of dry extract, while total flavonoid content (TFC) was in range between 22.44 and 61.15 mg QE/g of dry extract. Aqueous extracts were the richest in phenols, as well as in flavonoids. In vitro ...

  12. Antjie Krog, Stephen Watson and the Metaphysics of Presence ...

    African Journals Online (AJOL)

    In this paper I explore some of the questions that follow from Stephen Watson's assertions that Antjie Krog's the stars say 'tsau' exhibits elements of plagiarism. In particular, I examine different conceptions of originality that can be identified in Watson and Krog's statements concerning the reworking of the /Xam materials into ...

  13. Micropropagation of Rubus and Ribes spp.

    Science.gov (United States)

    Dziedzic, Ewa; Jagła, Joanna

    2013-01-01

    Micropropagation is the most appropriate method for large-scale production of Rubus and Ribes spp. The proliferation rate of Rubus spp. differs in shoot tips and nodal segments. The culture media used for raspberry and blackberry propagation are MS-based supplemented with different combination and ratio of plant growth regulators, depending on the stage of culture. The initiation medium containing 0.4 mg L(-1) BA and 0.1 mg L(-1) IBA is used to stabilize shoot cultures. In multiplication media, concentration of cytokinin is doubled. In vitro rooting of shoots is achieved on media supplemented with 1.0 mg L(-1) IBA. Ribes spp. cultures are initiated from shoot tips, meristem, or dormant buds on MS medium supplemented with 2.0 mg L(-1) BA, 0.5 mg L(-1) IBA, and 0.1 mg L(-1) GA(3.) After stabilization of shoot cultures in 3-4-week time, shoot multiplication is carried out on MS medium containing 1.0 mg L(-1) BA and 0.1 mg L(-1) IBA. Shoots 2 cm long are cultured to rooting on a medium amended with 2.0 mg L(-1) IBA and 5.0 mg L(-1) IAA. Rooted plantlets are transferred to universal peat substrate and acclimatized in the greenhouse.

  14. Proceedings of the XI international Rubus and Ribes symposium

    Science.gov (United States)

    This proceedings book summarizes the latest internationial research concerning Rubus, Ribes and their wild relatives. This proceedings includes 82 scientific reports from international scientists concerning the genetics and germplasm, pests and diseases, physiology and production systems, post harve...

  15. A new subgenus and species of Neotropical Trichomyia (Diptera: Psychodidae

    Directory of Open Access Journals (Sweden)

    Maíra Xavier Araújo

    2013-08-01

    Full Text Available A singular group of 19 species of Neotropical Trichomyia Haliday in Curtis, 1839 presents four segments in the palpus, the first two partially fused; five of these species were included in the subgenus Opisthotrichomyia Bravo, 2001 and seven in the subgenus BrachiotrichomyiaBravo & Araújo, 2013. A new species from Brazil is described and a new subgenus proposed for four Neotropical species of this morphological group: T. biloba Quate, 1999 from Panama, and T. onorei Bravo, 2002, T. queirozi Bravo, 2002 and T. horrida sp. nov. from Brazil. Syntrichomyia subgen. nov. can be recognized by its fused gonocoxites and gonostyli, and by its bilobed hypoproct. A key to the known species (males of this new subgenus is presented.

  16. Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

    OpenAIRE

    Stojić, Igor

    2016-01-01

    Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

  17. An analysis and evaluation of Watson's theory of human care.

    Science.gov (United States)

    Sourial, S

    1996-08-01

    Despite a high priority placed on theory-testing in nursing, there continues to be minimal research undertaken which adequately tests nursing theories. A study was planned to contribute to theory-testing in nursing by testing an aspect of Watson's (1988) theory of human care. Watson essentially believes that nursing is an intersubjective human process and places a high value on the caring relationship between the nurse and the recipient of care. Before proceeding with the intended study, the following analysis and evaluation of Watson's theory presented here was undertaken, with guidance from a tool developed by Fawcett & Downs (1992). In this tool, the analysis identifies the concepts and propositions that make up the theory and the evaluation includes the criteria of significance, internal consistency, parsimony, testability and empirical adequacy of the theory being tested. Overall, this analysis and evaluation found two areas of Watson's work which were in need of further development.

  18. The Equivalence of Two Constructions of Galton-Watson Processes

    CERN Document Server

    Kurata, K

    2004-01-01

    In most textbooks on branching processes, the Galton-Watson process is defined as an integer valued Markov chain with a special kind of transition probability, somtimes supplemented with an intuitive description of random family trees. A precise construction of the Galton-Watson process on the space of trees was first given by R. Otter in 1949, and later independently by J. Neveu in 1986. In this note, we show that these two constructions are actually equivalent.

  19. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  20. Occurrence of nepoviruses in Rubus species in the Czech Republic.

    Science.gov (United States)

    Spak, J; Kubelková, D; Honetslegrová-Fránová, J

    1997-06-01

    The occurrence of arabis mosaic virus (AMV), raspberry ringspot virus (RRV), tomato black ring virus (TBRV), strawberry latent ringspot virus (SLRV) and cherry leaf roll virus (CLRV) in cultivated and wild plants of raspberry and blackberry has been studied in the Czech Republic in 1993-1996. Five hundred and seventy samples were collected at 51 localities and assayed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). The results represent the first evidence on the occurrence of AMV, RRV, TBRV and SLRV in cultivated Rubus species in the Czech Republic. Isolates AMV M20 and TBRV ML15 which were successfully transmitted by mechanical inoculation and characterized by reactions of differential host plants and by electron microscopy are the first isolates from Rubus from this territory. CLRV was not detected in either cultivated or wild Rubus species.

  1. Antioxidant properties of Rubus discolor leaf extracts

    Directory of Open Access Journals (Sweden)

    Veličković Ivona Z.

    2016-01-01

    Full Text Available In this work were examined aqueous, methanol, ethanol and acetone leaf extracts of Rubus discolor, wild growing blackberry, for their antioxidant properties and total phenol and flavonoid content. The total phenol content (TPC varried from 250.05 to 446.61 mg GAE/g of dry extract, while total flavonoid content (TFC was in range between 22.44 and 61.15 mg QE/g of dry extract. Aqueous extracts were the richest in phenols, as well as in flavonoids. In vitro antioxidant capacity of leaf extracts was evaluated by 2,2-diphenyl-1-picrylhydrazil (DPPH, 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS free radical scavenging procedures and ferric reducing ability of plasma (FRAP assay. Aqueous extracts were the most effective through all antioxidant tests. The total phenol content highly correlated with antioxidant activity of extracts. Moreover, weak correlation was established between total phenol and total flavonoid content. The results presented in this work indicate that phenol compounds contribute to antioxidant ability of extracts. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. 173029

  2. Coalescing the theories of two nurse visionaries: Parse and Watson.

    Science.gov (United States)

    Walker, C A

    1996-11-01

    The theories of two nurse visionaries, Rosemarie Rizzo Parse and Jean Watson, are examined for areas of agreement and notable differences. Watson and Parse reject (or hold seriously suspect) traditional, positivistic methods of studying human behaviour and posit their theories as alternatives to the totality paradigm. Since both of these theories, Parse's theory of human becoming and Watson's theory of transpersonal care, borrow heavily from existential phenomenology, major tenets of this philosophic perspective are outlined. Each theory is then described with emphasis on anchoring motifs, concepts, and principles. Next both theories are analysed and critiqued simultaneously. Finally, the theories are applied to a case study with the intent of maximizing their mutual strengths and diminishing their limitations. Coalescence of compatible theories is recommended as a way of enhancing the application of nursing knowledge in practice.

  3. Hygrophoraceae of the Greater Antilles : Hygrocybe subgenus Hygrocybe

    Science.gov (United States)

    Sharon A. Cantrell; D. Jean Lodge

    2000-01-01

    A key to six taxa of Hygrocybe, subgenus Hygrocybe, sections Chlorophanae and Hygrocybe is provided. One species is new and four species are reported for the first time from the Greater Antilles. The new species is H. chimaeroderma (section Chlarophanae). Hygrocybe acutoconica, H. calyptriformis and H. incolor (section Hygrocybe) are reported for the first time, and...

  4. Mistaken identity: Clarification of Rubus coreanus Miquel (bokbunja)

    Science.gov (United States)

    This chapter was written to target the research communities currently studying (misidentified) native bokbunja (Rubus coreanus Miquel). Most Korean growers and researchers are cultivating or conducting work on R. occidentalis L. (American black raspberries), not R. coreanus. We summarized fruit, pla...

  5. Rubus: A compiler for seamless and extensible parallelism.

    Directory of Open Access Journals (Sweden)

    Muhammad Adnan

    Full Text Available Nowadays, a typical processor may have multiple processing cores on a single chip. Furthermore, a special purpose processing unit called Graphic Processing Unit (GPU, originally designed for 2D/3D games, is now available for general purpose use in computers and mobile devices. However, the traditional programming languages which were designed to work with machines having single core CPUs, cannot utilize the parallelism available on multi-core processors efficiently. Therefore, to exploit the extraordinary processing power of multi-core processors, researchers are working on new tools and techniques to facilitate parallel programming. To this end, languages like CUDA and OpenCL have been introduced, which can be used to write code with parallelism. The main shortcoming of these languages is that programmer needs to specify all the complex details manually in order to parallelize the code across multiple cores. Therefore, the code written in these languages is difficult to understand, debug and maintain. Furthermore, to parallelize legacy code can require rewriting a significant portion of code in CUDA or OpenCL, which can consume significant time and resources. Thus, the amount of parallelism achieved is proportional to the skills of the programmer and the time spent in code optimizations. This paper proposes a new open source compiler, Rubus, to achieve seamless parallelism. The Rubus compiler relieves the programmer from manually specifying the low-level details. It analyses and transforms a sequential program into a parallel program automatically, without any user intervention. This achieves massive speedup and better utilization of the underlying hardware without a programmer's expertise in parallel programming. For five different benchmarks, on average a speedup of 34.54 times has been achieved by Rubus as compared to Java on a basic GPU having only 96 cores. Whereas, for a matrix multiplication benchmark the average execution speedup of 84

  6. Rubus: A compiler for seamless and extensible parallelism.

    Science.gov (United States)

    Adnan, Muhammad; Aslam, Faisal; Nawaz, Zubair; Sarwar, Syed Mansoor

    2017-01-01

    Nowadays, a typical processor may have multiple processing cores on a single chip. Furthermore, a special purpose processing unit called Graphic Processing Unit (GPU), originally designed for 2D/3D games, is now available for general purpose use in computers and mobile devices. However, the traditional programming languages which were designed to work with machines having single core CPUs, cannot utilize the parallelism available on multi-core processors efficiently. Therefore, to exploit the extraordinary processing power of multi-core processors, researchers are working on new tools and techniques to facilitate parallel programming. To this end, languages like CUDA and OpenCL have been introduced, which can be used to write code with parallelism. The main shortcoming of these languages is that programmer needs to specify all the complex details manually in order to parallelize the code across multiple cores. Therefore, the code written in these languages is difficult to understand, debug and maintain. Furthermore, to parallelize legacy code can require rewriting a significant portion of code in CUDA or OpenCL, which can consume significant time and resources. Thus, the amount of parallelism achieved is proportional to the skills of the programmer and the time spent in code optimizations. This paper proposes a new open source compiler, Rubus, to achieve seamless parallelism. The Rubus compiler relieves the programmer from manually specifying the low-level details. It analyses and transforms a sequential program into a parallel program automatically, without any user intervention. This achieves massive speedup and better utilization of the underlying hardware without a programmer's expertise in parallel programming. For five different benchmarks, on average a speedup of 34.54 times has been achieved by Rubus as compared to Java on a basic GPU having only 96 cores. Whereas, for a matrix multiplication benchmark the average execution speedup of 84 times has been

  7. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    IAS Admin

    In this article, we start with John McCarthy's definition of. Artificial Intelligence and describe select approaches to its sub-areas: natural language processing and question answer- ing. We then outline the challenge that IBM Research under- took to build Watson, a question-answering computer system that would compete at ...

  8. Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

    Indian Academy of Sciences (India)

    http://www.ias.ac.in/article/fulltext/reso/019/03/0222-0241. Keywords. John McCarthy; artificial intelligence; natural language processing; question answering system; IBM; DeepQA; Watson; Jeopardy!; quiz show. Author Affiliations. Raman Chandrasekar1. ProQuest 501 North 34th Street Suite 300, Seattle, WA 98103, USA ...

  9. Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

    DEFF Research Database (Denmark)

    Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

    2013-01-01

    For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

  10. Watson-Crick hydrogen bonding of unlocked nucleic acids

    DEFF Research Database (Denmark)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-01-01

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

  11. Korean Species of the Subgenus Ophina (Diptera: Tachinidae

    Directory of Open Access Journals (Sweden)

    Jong-Su Lim

    2013-07-01

    Full Text Available We recognized Linnaemya microchaetopsis Shima, L. picta (Meigen and L. zachvatkini Zimin in Korean Linnaemya subgenus Ophina Robineau-Desvoidy and the latter two are reported for the first time in Korea. The subgenus Ophina shares the following morphological characteristics (sensu Shima: 1 the male tergite 6 is fused mid-dorsally with sternite 7+8; 2 the female tergite 6 and tergite 7 are almost always divided longitudinally into two hemitergites; 3 the female tergite 6 is always longer than the tergite 7; 4 circus parallelsided in caudal view; 5 epiphallus present; and 6 pteropleural seta long, reaching posterior margin of lower calypter. We provide a key to the included Korean species, as well as descriptions and illustrations with their diagnostic characters indicated.

  12. The Pragmatic Utility of Watson-Based Caring Measures.

    Science.gov (United States)

    Atiyeh, Huda; Ahmad, Muayyad; Alslman, Eman Tariq; Hani, Manar Ali Bani

    2016-12-01

    This study aims to clarify the caring concept with emphasis on the pragmatic utility of caring measures. The Morse et al. (Morse, Hupcey, Mitcham, & Lenz, 1996; Morse, Mitcham, Hupcey, & Tasón, 1996) criteria for concept maturity were used as a framework. A literature review of Watson-based caring concept was undertaken to evaluate the logical, epistemological, linguistical, and pragmatic parameters. The concept of caring as conceptualized by Watson and operationalized through different measures appeared mature. Despite differences, shorter scales of caring measures were effective to capture caring behavior. Caring concept was further clarified and more confidence in using caring measures for assessment, evaluation, and modification of caring behavior become more feasible.

  13. Watson-Crick hydrogen bonding of unlocked nucleic acids.

    Science.gov (United States)

    Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

    2015-11-15

    We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

  15. Some Econometric Results for the Blanchard-Watson Bubble Model

    DEFF Research Database (Denmark)

    Johansen, Soren; Lange, Theis

    The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

  16. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics

    OpenAIRE

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-01-01

    Background We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistic...

  17. The anthocyanin composition of different Vaccinium, Ribes and Rubus genotypes.

    Science.gov (United States)

    Scalzo, Jessica; Currie, Alastair; Stephens, Jo; McGhie, Tony; Alspach, Peter; Horticulture And Food Research Institute Of New Zealand Limited Hortresearch

    2008-01-01

    Anthocyanins, which give berryfruit their characteristic colour, have attracted the interest of researchers because of their putative health benefits. Over the past eight years, HortResearch has been analysing the anthocyanin content of numerous samples of different species of Vaccinium, Rubus and also Ribes nigrum. These samples were taken from different genotypes held in germplasm collections, cultivar and advanced selection trials, genetic studies and seedling populations. Averaged over all samples, Ribes had higher total anthocyanin contents (total ACY) than Vaccinium which was, in turn, higher than Rubus. However, all genera provided rich sources of anthocyanins and individual crop types within genera varied considerably. Five percent (i.e., 223) of our samples had total ACY of more than 5000 microg/g: most of these were blackcurrants, but some were black raspberries and three were ornamental blueberries. Vaccinium species generally contained the most diverse range of individual anthocyanins. In contrast, Ribes nigrum samples were dominated by cyanidin and delphinidin rutinosides which, on average, comprised almost 80% of the total ACY. For Rubus species almost all anthocyanins were cyanidins, although which ones were more prevalent varied with the species. The high degree of variation in total ACY and individual anthocyanin contents reported herein, coupled with the moderate to high heritabilities reported in the literature, indicate that good progress could be made in breeding cultivars with still higher total ACY levels.

  18. Holothuria (Selenkothuria) parvispinea n. sp. (Echinodermata, Hololthuroidea, Holothuriidae) with key to the sub-genus Selenkothuria.

    Science.gov (United States)

    Massin, Claude

    2013-01-30

    Description of a new species from Australia, belonging to the subgenus Selenkothuria (Holothuria, Aspidochirotida). A dichotomous key of the thirteen valid species included in the subgenus is also given. The species H. perrieri Thandar, 1977 and H. spinea Cherbonnier, 1988 are considered as non valid.

  19. A New Subgenus of CULEX in the Neotropical Region (Diptera: Culicidae)

    Science.gov (United States)

    1992-11-01

    subgenus in the the Greek nouns phtwna.v (m, deceiver, cheat. New World, and the results of the present impostor: combining form /phnaco’-) and study...mistaken for members of the characters oftthe lar\\al stage, subgenus (’tlehv. The name is feminine in The affinities of tth’nao,,. via arc un- gender. The

  20. Cortinarius subgenus Callistei in North America and Europe-type studies, diversity, and distribution of species.

    Science.gov (United States)

    Niskanen, Tuula; Liimatainen, Kare; Kytövuori, Ilkka; Lindström, Håkan; Dentinger, Bryn T M; Ammirati, Joseph F

    2016-09-01

    Five species of Cortinarius subgenus Callistei, are recognized in Europe and North America. Cortinarius callisteus, C. infucatus, and C. neocallisteus sp. nov. have a broad distribution, extending from western North America to Europe. Cortinarius tofaceus is known from eastern North America and Europe, while C. callistei sp. is known only from one locality in Sweden. All five species are primarily associated with coniferous trees. Previously the species were included either in subgenus Leprocybe or subgenus Cortinarius, but recently they have been separated into subgenus Callistei based on molecular data. Type specimens of the names associated with this subgenus were studied and a neotype proposed for C. tofaceus and an epitype for C. infucatus Barcodes for the species are deposited in RefSeq and UNITE. © 2016 by The Mycological Society of America.

  1. IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

    Science.gov (United States)

    Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

    2016-10-11

    We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

  2. How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

    Science.gov (United States)

    Rilling, M

    2000-01-01

    Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

  3. "Elementary, my dear Watson". Per una falsa citazione

    Directory of Open Access Journals (Sweden)

    Irene Minella

    2014-12-01

    Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

  4. On the asymptotic behavior of the Durbin-Watson statistic for ARX processes in adaptive tracking

    OpenAIRE

    Bercu, Bernard; Portier, Bruno; Vazquez, V.

    2012-01-01

    International audience; A wide literature is available on the asymptotic behavior of the Durbin-Watson statistic for autoregressive models. However, it is impossible to find results on the Durbin-Watson statistic for autoregressive models with adaptive control. Our purpose is to fill the gap by establishing the asymptotic behavior of the Durbin Watson statistic for ARX models in adaptive tracking. On the one hand, we show the almost sure convergence as well as the asymptotic normality of the ...

  5. A survey of the Rubus species (Rosaceae described from the Canary Islands

    Directory of Open Access Journals (Sweden)

    Matzke-Hajek, Günter

    1999-06-01

    Full Text Available Taxonomy, nomenclatura and distribution of the bramble species (Rubus L., subgen. Rubus described from the Canary Islands are studied. Apart from the widespread Mediterranean R. ulmifolius Schott two species occur: R. bollei Focke (Syn.: R. canariensis Focke, R. suspiciosus Menezes and R. palmensis A. Hansen. The latter is not an endemic of La Palma as assumed by its discoverer, but is recorded for the first time also in Gran Canaria and Tenerife. Complete descriptions are provided, and illustrations of distinctive features often lacking in herbarium specimens are presented. Problems concerning the typification are discussed. Rubus x wolfredoi-wildpretii H. E. Weber nothospec. nov., the frequent hybrid between Rubus bollei and R. ulmifolius is described as new to science. Rubus bornmuelleri Focke from Gran Canaria is based on a specimen dubium and has to be deleted from the list of Canarían species.Se han estudiado la taxonomía, la nomenclatura y la distribución de las especies de zarzas (Rubus L., subgen. Rubus descritas de las Islas Canarias. Junto a Rubus ulmifolius Schott, especie muy frecuente en el Mediterráneo, se encontraron dos especies: R. bollei Focke (Syn.: R. canariensis Focke, R. suspiciosus Menezes y R. palmensis A. Hansen. Se incluyen descripciones completas e ilustraciones de algunas características relevantes y que no siempre se han observado en especímenes de herbario revisados. Además, se discuten problemas de tipificación y se describe como nuevo para la ciencia Rubus x wolfredoi-wildpretii H.E. Weber nothospec. nov., híbrido frecuente entre R. bollei y R. ulmifolius. R. bornmuelleri Focke de Gran Canaria debe ser excluido de la lista de las especies canarias, al estar basada su descripción en un specimen dubium.

  6. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  7. Genetic diversity of wild and cultivated Rubus species in Colombia using AFLP and SSR markers

    Directory of Open Access Journals (Sweden)

    Sandra Bibiana Aguilar

    2007-01-01

    Full Text Available The Andean blackberry belongs to the genus Rubus, the largest of the Rosaceae family and one of the mostdiverse of the plant kingdom. In Colombia Rubus glaucus Benth, known as the Andean raspberry or blackberry, is one of thenine edible of the genus out of forty-four reported species. In this study wild and cultivated genotypes, collected in the CentralAndes of Colombia were analyzed by AFLP and SSR markers. Sexual reproduction seems to play an important role inmaintaining the genetic variability in R. glaucus, and the viability of using the SSR of Rubus alceifolius to characterizeColombian Rubus species was clearly demonstrated. All species evaluated produced very specific banding patterns,differentiating them from the others. Both AFLP and SSR produced bands exclusive to each of the following species: R.robustus, R. urticifolius, R. glaucus, and R. rosifolius. The SSR markers differentiated diploid and tetraploid genotypes of R.glaucus.

  8. Dehydrogenase isoenzyme polymorphism in genus Prunus, subgenus Cerasus

    Directory of Open Access Journals (Sweden)

    Čolić Slavica

    2012-01-01

    Full Text Available Dehydrogenase polymorphism was studied in 36 sour cherry (Prunus cerasus L., sweet cherry (Prunus avuim L., mahaleb (Prunus mahaleb L., ground cherry (Prunus fruticosa Pall., duke cherry (Prunus gondounii Redh., Japanese flowering cherry (Prunus serrulata Lindl. and four iterspecific hybrids (standard cherry rootstocks ‘Gisela 5’, ‘Gisela 6’, ‘Max Ma’ and ‘Colt’. Inner bark of one-year-old shoots, in dormant stage, was used for enzyme extraction. Vertical PAGE was used for isoenzyme analysis: alcohol dehydrogenase (ADH, formate dehydrogenase (FDH, glutamate dehydrogenase (GDH, isocitrate dehydrogenaze (IDH, malate dehydrogenase (MDH, phosphogluconate dehydrogenase (PGD, and shikimate dehydrogenase (SDH. All studied systems were polymorphic at 10 loci: Adh -1 (3 genotypes and Adh-2 (5 genotypes, Fdh-1 (2 genotypes, Gdh-1 (3 genotypes, Idh-1 (4 genotypes i Idh -2 (5 genotypes, Mdh-1 (3 genotypes, Pgd-1 (4 genotypes, Sdh-1 (1 genotype i Sdh-2 (3 genotypes. Cluster analysis was used to construct dendrogram on which four groups of similar genotypes were separated. Obtained results indicate that studied enzyme systems can be used for determination of genus Prunus, subgenus Cerasus. Among studied enzyme systems ADH, IDH and SDH were the most polymorphic and most useful to identify genetic variability. Polymorphism of FDH and GDH in genus Prunus, subgenus Cerasus was described first time in this work. First results for dehydrogenase variability of Oblačinska indicate that polymorphism of loci Idh-2 and Sdh-2 can be useful for discrimination of different clones.

  9. Neopetromyces gen. nov and an overview of teleomorphs of Aspergillus subgenus Circumdati

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Samson, R. A.

    2000-01-01

    Species in the anamorph genus Aspergillus are associated with several teleomorphic genera in the Eurotiales and the most important mycotoxin producers are concentrated in Aspergillus subgenus Circumdati. A new genus, Neopetromyces, is proposed for the recently described Petromyces muricatus, beca...

  10. [Polymorphism of KPI-A genes from plants of the subgenus Potatoe (sect. Petota, Estolonifera and Lycopersicum) and subgenus Solanum].

    Science.gov (United States)

    Krinitsyna, A A; Mel'nikova, N V; Belenikin, M S; Poltronieri, P; Santino, A; Kudriavtseva, A V; Savilova, A M; Speranskaia, A S

    2013-01-01

    Kunitz-type proteinase inhibitor proteins of group A (KPI-A) are involved in the protection of potato plants from pathogens and pests. Although sequences of large number of the KPI-A genes from different species of cultivated potato (Solanum tuberosum subsp. tuberosum) and a few genes from tomato (Solanum lycopersicum) are known to date, information about the allelic diversity of these genes in other species of the genus Solanum is lacking. In our work, the consensus sequences of the KPI-A genes were established in two species of subgenus Potatoe sect. Petota (Solanum tuberosum subsp. andigenum--5 genes and Solanum stoloniferum--2 genes) and in the subgenus Solanum (Solanum nigrum--5 genes) by amplification, cloning, sequencing and subsequent analysis. The determined sequences of KPI-A genes were 97-100% identical to known sequences of the cultivated potato of sect. Petota (cultivated potato Solanum tuberosum subsp. tuberosum) and sect. Etuberosum (S. palustre). The interspecific variability of these genes did not exceed the intraspecific variability for all studied species except Solanum lycopersicum. The distribution of highly variable and conserved sequences in the mature protein-encoding regions was uniform for all investigated KPI-A genes. However, our attempts to amplify the homologous genes using the same primers and the genomes of Solanum dulcamarum, Solanum lycopersicum and Mandragora officinarum resulted in no product formation. Phylogenetic analysis of KPI-A diversity showed that the sequences of the S. lycopersicum form independent cluster, whereas KPI-A of S. nigrum and species of sect. Etuberosum and sect. Petota are closely related and do not form species-specific subclasters. Although Solanum nigrum is resistant to all known races of economically one of the most important diseases of solanaceous plants oomycete Phytophthora infestans aminoacid sequences encoding by KPI-A genes from its genome have nearly or absolutely no differences to the same from

  11. Bio-accumulation of copper, zinc, iron and manganese in oyster Saccostrea cucullata, Snail Cerithium rubus and Clam Tellina angulata from the Bombay coast

    Digital Repository Service at National Institute of Oceanography (India)

    Krishnakumari, L.; Nair, V.R.; Moraes, C.

    and C. rubus. Sexwise, iron content was high in male and manganese in female oysters. In T. angulata male specimens showed maximum zinc content. Stationwise, difference in copper and iron was significant in C. rubus. In general, copper and zinc...

  12. Mistaken Identity: Clarification of Rubus coreanus Miquel (Bokbunja

    Directory of Open Access Journals (Sweden)

    Jungmin Lee

    2014-07-01

    Full Text Available In the U.S., there has been a recent surge in Korean black raspberry products available and in the number of reports about this species appearing in the scientific literature. Despite this, the majority of products sold and the work carried out has been on Rubus occidentalis L., not R. coreanus Miquel. The importance of accurate recognition of all starting material is multiplied for research downstream, including genetics/genomics, plant breeding, phenolic identification, food processing improvements and pharmacokinetic investigations. An overview of distinguishing characteristics separating R. coreanus from R. occidentalis will be presented. Research conducted on correctly identified fruit will also be summarized to aid future studies that might showcase the unique qualities that bokbunja can offer.

  13. Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

    Science.gov (United States)

    Doyle-Lindrud, Susan

    2015-02-01

    IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

  14. A new subgenus and species of Topomyia (Diptera: Culicidae: Sabethini) based on a remarkable male mosquito from Sabah, Malaysia.

    Science.gov (United States)

    Harbach, Ralph E; Culverwell, C Lorna

    2014-05-08

    Miyagiella Harbach, subgen. nov., is introduced as a new subgenus of Topomyia Leicester for a remarkable male mosquito, Topomyia discors Harbach, sp. nov., from Sabah, Malaysia. A diagnosis of the subgenus is provided that features unique anatomical characters of the genitalia of the holotype male. Miyagiella is very distinct from the two previously recognised subgenera of Topomyia, but is perhaps more closely related to the nominotypical subgenus than to subgenus Suaymyia Thurman. Salient differences that distinguish the three subgenera are contrasted; the holotype male of To. discors is described and its unique genitalia are illustrated.

  15. Durbin-Watson statistics for model life tables.

    Science.gov (United States)

    Smith, D P

    1983-05-01

    In populations with inaccurate age reporting, even very careful mortality surveys can produce implausible survival estimates because of age heaping, because of a mismatch between numerators and denominators (e.g., when deaths are taken from vital registration and population from a census), or because of a combination of the 2. The Brass logit regression enables one to smooth least squares values estimated from census or survey data to those of a reference life table, but the characteristics of human mortality are so strong, and the differences between related life tables so subtle, that it is often difficult to determine which model table gives the best fit. Standard tests, such as r squared by 2, t, and x squared by 2 tests, are generally not sensitive enough to help with our selection. The presence of a systematic pattern of errors, however, implies that the reference life table is not closely representative of the observed population (or that the data contain systematic biases). The Durbin-Watson test for serial correlation of errors is a powerful tool for detecting systematic error, and consequently, can be quite useful for determining the best reference table for a smoothing operation.

  16. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  17. Watson's behaviorism: a comparison of the two editions (1925 and 1930).

    Science.gov (United States)

    Carpintero, Helio

    2004-05-01

    J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

  18. A Durbin-Watson serial correlation test for ARX processes via excited adaptive tracking

    Science.gov (United States)

    Bercu, Bernard; Portier, Bruno; Vazquez, Victor

    2015-12-01

    We propose a new statistical test for the residual autocorrelation in ARX adaptive tracking. The introduction of a persistent excitation in the adaptive tracking control allows us to build a bilateral statistical test based on the well-known Durbin-Watson statistic. We establish the almost sure convergence and the asymptotic normality for the Durbin-Watson statistic leading to a powerful serial correlation test. Numerical experiments illustrate the good performances of our statistical test procedure.

  19. A Durbin-Watson serial correlation test for ARX processes via excited adaptive tracking

    OpenAIRE

    Bercu, Bernard; Portier, Bruno; Vazquez, Victor

    2014-01-01

    We propose a new statistical test for the residual autocorrelation in ARX adaptive tracking. The introduction of a persistent excitation in the adaptive tracking control allows us to build a bilateral statistical test based on the well-known Durbin-Watson statistic. We establish the almost sure convergence and the asymptotic normality for the Durbin-Watson statistic leading to a powerful serial correlation test. Numerical experiments illustrate the good performances of our statistical test pr...

  20. Morphological and Genotypic Variations among the Species of the Subgenus Adlerius (Diptera: Psychodidae, Phlebotomus in Iran

    Directory of Open Access Journals (Sweden)

    Alireza Zahraei-Ramazani

    2015-10-01

    Full Text Available Background: Female sand flies of subgenus Adlerius are considered as probable vectors of visceral leishmaniasis in Iran. The objective of this study was to determine the morphological and genotypic variations in the populations of this subgenus in the country.Methods: Sand flies collected using sticky traps from 17 provinces during 2008–2010. The morphometric measurements were conducted with an Ocular Micrometer. Data was analyzed by SPSS. The Cytb gene was used to estimate population genetic diversity and identify the female specimens. UPGMA phenetic tree was used for DNA haplotypes of Cytb gene.Results: Six species of subgenus Adlerius identified from which one species, P. (Adlerius kabulensis, is new record. The identification key is provided for males. Results revealed the molecular systematic in the species of subgenus Adlerius and determine the relationship of three females of P. comatus, P. balcanicus and P. halepensis.Conclusion: The positions of three females and the males in the UPGMA tree are correct and the similarities among them confirm our results. The branches of each species are not genetically distinct which justify the overlapping morphological characters among them. Molecular sequencing of Cytb-mtDNA haplotypes can be used for female identification for different species of subgenus Adlerius in Iran.

  1. Compostos bioativos presentes em amora-preta (Rubus spp. Bioactive compounds of blackberry fruits (Rubus spp. grown in Brazil

    Directory of Open Access Journals (Sweden)

    Daniela Souza Ferreira

    2010-09-01

    Full Text Available A amora-preta (Rubus spp., pequena fruta de clima temperado, possui coloração atraente, variando do vermelho púrpura ao azul, devido ao elevado teor de antocianinas. As antocianinas, juntamente com os carotenoides, compõem os pigmentos naturais, majoritários encontrados em diversas frutas. Diversos estudos têm relatado a importância destes pigmentos naturais como protetores e/ou inibidores de doenças degenerativas, porém são escassos os estudos sobre compostos bioativos presentes em amora-preta cultivada no Brasil. Os objetivos do presente estudo foram identificar as antocianinas e os carotenoides presentes em amora-preta, determinar os conteúdos totais de compostos fenólicos, carotenoides, flavonoides, antocianinas totais, monoméricas, poliméricas e copigmentadas, e a capacidade antioxidante frente aos radicais livres ABTS e DPPH. O teor total de carotenoides foi baixo (86,5 ± 0,2 µg/100 g, com all-trans-β-caroteno (39,6 % e all-trans-luteína (28,2 % como os majoritários. As amoras-pretas apresentaram elevado potencial antioxidante principalmente pelo teor representativo de antocianinas monoméricas (104,1 ± 1,8 mg/100 g de fruto, presença de antocianinas poliméricas (22,9 ± 0,4 %, baixa porcentagem de antocianinas copigmentadas (1,6 ± 0,1 % e altos teores de compostos fenólicos (241,7 ± 0,8 mg equivalente de ácido gálico/100 g e de flavonoides totais (173,7 ± 0,7 mg equivalente de catequina/100 g. Cianidina 3-glucosídeo foi a antocianina majoritária (92,9 %. Diante destes resultados, a amora-preta pode ser considerada uma fonte natural rica em antioxidantes e pigmentos.The blackberry (Rubus spp., a small fruit grown in temperate climate, shows an attractive color ranging from purple red to blue, due to the high content of anthocyanins. The anthocyanins, along with carotenoids, are the major natural pigments found in several fruits. Many studies have reported the importance of these natural pigments as protectors

  2. A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

    NARCIS (Netherlands)

    Meijer, Rob R.

    I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

  3. Rubus Fruticosus L.: Constituents, Biological Activities and Health Related Uses

    Directory of Open Access Journals (Sweden)

    Muhammad Zia-Ul-Haq

    2014-07-01

    Full Text Available Rubus fruticosus L. is a shrub famous for its fruit called blackberry fruit or more commonly blackberry. The fruit has medicinal, cosmetic and nutritive value. It is a concentrated source of valuable nutrients, as well as bioactive constituents of therapeutic interest highlighting its importance as a functional food. Besides use as a fresh fruit, it is also used as ingredient in cooked dishes, salads and bakery products like jams, snacks, desserts, and fruit preserves. R. fruticosus contains vitamins, steroids and lipids in seed oil and minerals, flavonoids, glycosides, terpenes, acids and tannins in aerial parts that possess diverse pharmacological activities such as antioxidant, anti-carcinogenic, anti-inflammatory, antimicrobial anti-diabetic, anti-diarrheal, and antiviral. Various agrogeoclimatological factors like cultivar, environmental conditions of the area, agronomic practices employed, harvest time, post-harvest storage and processing techniques all influence the nutritional composition of blackberry fruit. This review focuses on the nutrients and chemical constituents as well as medicinal properties of different parts of R. fruticosus. Various cultivars and their physicochemical characteristics, polyphenolic content and ascorbic acid content are also discussed. The information in the present work will serve as baseline data and may lead to new biomedical applications of R. fruticosus as functional food.

  4. Phylogeny and nomenclature of the genus Talaromyces and taxa accommodated in Penicillium subgenus Biverticillium

    DEFF Research Database (Denmark)

    Samson, R.A.; Yilmaz, N.; Houbraken, J.

    2011-01-01

    . Talaromyces species and most species of Penicillium subgenus Biverticillium sensu Pitt reside in a monophyletic clade distant from species of other subgenera of Penicillium. For detailed phylogenetic analysis of species relationships, the ITS region (incl. 5.8S nrDNA) was sequenced for the available type...... in Penicillium and should be taxonomically unified with the Talaromyces species that reside in the same clade. Following the concepts of nomenclatural priority and single name nomenclature, we transfer all accepted species of Penicillium subgenus Biverticillium to Talaromyces. A holomorphic generic diagnosis......The taxonomic history of anamorphic species attributed to Penicillium subgenus Biverticillium is reviewed, along with evidence supporting their relationship with teleomorphic species classified in Talaromyces. To supplement previous conclusions based on ITS, SSU and/or LSU sequencing...

  5. Taxonomic study of Festuca L. subgenus Schedonorus (P. Beauv. Peterm. in Iran

    Directory of Open Access Journals (Sweden)

    Sayed Zabihollah Hosseini

    2013-11-01

    Full Text Available This study was based upon a taxonomic review of the subgenus Schedonorus in Iran. A collection of 30 specimens belonging to the herbaria: W, B and HUI (herbarium of the University of Isfahan were studied. Based on the results of this study, this subgenus included three species: Festuca arundinacea, F. gigantea and F. pratensis in Iran. Furthermore, this study showed that F. arundinacea, occured in this country with two subspecies: orientalis (Hack. Tzvelev and fenas (Lag. Arcang. with the greatest area of distribution compared to the other two species. Our examination of the type specimen of F. elatior subsp. pratensis var. elbursiana confirmed its synonymy with F. arundinacea.

  6. Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

    Science.gov (United States)

    Cubero, Elena; Luque, F. Javier; Orozco, Modesto

    2006-01-01

    A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

  7. The Watson-Forbes Biogeographical Controversy Untangled 170 Years Later.

    Science.gov (United States)

    Fattorini, Simone

    2017-08-01

    Hewett Cottrell Watson and Edward Forbes were two naturalists of the Victorian age. They were protagonists on a dispute that generated comment and serves as an illuminating case study of misunderstanding in priority issues. Watson accused Forbes of having plagiarized his original classification of the British plants into groups on the basis of their geographical distribution. This controversy originated mostly from a so-far-ignored basic difference in Watson's and Forbes' ideas about biogeographical regionalization. Watson's classification of the British flora into groups of species with similar distribution was probably the first application of the concept of "regional chorotype." By contrast, the biogeographical classification of the British flora proposed by Forbes belongs to the concept of "element," because it was based on assumed species history (i.e. colonization routes). The two approaches may produce similar outcomes, but remain conceptually different. Although personal reasons may have contributed to exacerbate the Watson-Forbes controversy, failure in recognizing this distinction by its actors and their contemporaries, such as Hooker and Darwin, was the most important cause.

  8. IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

    Science.gov (United States)

    Chen, Ying; Elenee Argentinis, J D; Weber, Griff

    2016-04-01

    Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Nitrogen fertilization interacts with light to increase Rubus spp. cover in a temperate forest

    Science.gov (United States)

    Christopher A. Walter; Devon T. Raiff; Mark B. Burnham; Frank S. Gilliam; Mary Beth Adams; William T. Peterjohn

    2016-01-01

    Nitrogen additions have caused species composition changes in many ecosystems by facilitating the growth of nitrophilic species. After 24 years of nitrogen fertilization in a 40 year-old stand at the Fernow Experimental Forest (FEF) in Central Appalachia, USA, the cover of Rubus spp. has increased from 1 to 19 % of total herbaceous-layer cover....

  10. Performance and phenology of wild black raspberry (Rubus occidentalis L.) germplasm in a common garden

    Science.gov (United States)

    A lack of genetic diversity in cultivated black raspberry (Rubus occidentalis L.) germplasm has been widely recognized as a major factor limiting progress towards breeding improved cultivars. Despite this, little effort has been made since the early twentieth century to systematically collect and ev...

  11. A history of the term radical behaviorism: From Watson to Skinner

    Science.gov (United States)

    Schneider, Susan M.; Morris, Edward K.

    1987-01-01

    This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

  12. [Embracing Jean Watson's theory of Human Caring through a reflective practice within a clinical situation].

    Science.gov (United States)

    Cara, Chantal; O'Reilly, Louise

    2008-12-01

    Essentially based on humanistic values of respect, collaboration, and uniqueness rather than on objectification, control, and categorization of the person cared-for, a professional's practice rooted in caring is aimed at helping individuals and their families, which can only be carried out through respect for human dignity. If we are to consider caring as the core of nursing, nurses will undoubtedly have to make a conscious effort to preserve human caring within their clinical practice (Cara, 2004b; O'Reilly, 2008, Watson, 2002). However, to support this endeavour, caring theories, such as the one proposed by Jean Watson, are essential. Inspired by Cara's (2003) continuing education paper, this reflection paper takes a pragmatic approach to promote the understanding of key elements involved in Watson's caring theory through a process of reflective practice within a rehabilitation clinical situation.

  13. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-01-01

    Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

  14. Phylogeography of three snubnose darters (Percidae: subgenus Ulocentra) endemic to the southeastern U.S

    Science.gov (United States)

    Steven L. Powers; Melvin L Warren

    2009-01-01

    The Yazoo Darter, Etheostoma raneyi (Percidae: subgenus Ulocentra), is a narrowly restricted endemic occurring in small tributaries in the Loessial Hills of the upper Yazoo River basin in northern Mississippi. The range of the species is shared between the Little Tallahatchie and adjacent upper Yocona rivers, but populations in the two...

  15. On the West-African species of the subgenus Eupalaemon Ortm

    NARCIS (Netherlands)

    Man, de J.G.

    1911-01-01

    In addition to my description of Palaemon (Eupalaemon) Lenzii de Man (see p. 225 of this volume) I give here a key to the species of the subgenus Eupalaemon Ortm. as yet known to occur in the rivers of West-Africa. Six species are at present known from there, viz.: 1. Pal. (Eupalaemon) macrobrachion

  16. Hygrophoraceae (Agaricales) of the Greater Antilles : Hygrocybe subgenus Pseudohygrocybe sections Coccineae and Neohygrocybe

    Science.gov (United States)

    Sharon A. Cantrell; D. Jean Lodge

    2004-01-01

    A key to 17 species in the genus Hygrocybe, subgenus Pseudohygrocybe, sections Coccineae and Neohygrocybe sensu Boertmann is provided for the Greater Antilles. Five new species and five taxa that are new reports for the region are described. The new species in section Coccineae are H. pseudoadonis, H. viridiphylla, and H. zonata. The new species in section Neohygrocybe...

  17. Typification of the Linnaean names Plantago serraria and P. subulata (Plantago subgenus Coronopus, Plantaginaceae)

    DEFF Research Database (Denmark)

    Hassemer, Gustavo; Iamonico, Duilio; Rønsted, Nina

    2017-01-01

    Plantago subg. Coronopus is a mainly Mediterranean group of plantains whose taxonomy is very complex. Two Linnaean names within this subgenus still remain untypified: P. serraria and P. subulata. We here discuss the possible types for these names, and designate lectotypes for both....... For nomenclatural purposes, the names P. triquetra and P. pungens are also included in the treatment of P. subulata....

  18. On the Iberian distribution of the species of Tipula, subgenus Tipula (Diptera, Tipulidae)

    NARCIS (Netherlands)

    Oosterbroek, Pjotr

    1994-01-01

    A list is provided for the species of Tipula, subgenus Tipula, indicating from which Spanish and Portuguese provinces they are known. T. (T.) oleracea is apparently distributed throughout the peninsula, the other three species and kleinschmidti) seem to possess a more limited distribution. The four

  19. On the Iberian distribution of the species of Tipula, subgenus Tipula (Diptera, Tipulidae)

    OpenAIRE

    Oosterbroek, Pjotr

    1994-01-01

    A list is provided for the species of Tipula, subgenus Tipula, indicating from which Spanish and Portuguese provinces they are known. T. (T.) oleracea is apparently distributed throughout the peninsula, the other three species and kleinschmidti) seem to possess a more limited distribution. The four species are recorded here for the first time from Portugal. (paludosa, mediterranean

  20. Phylogeny of osmophillic aspergilli (subgenus Aspergillus) and taxonomic revision of section Restricti

    Science.gov (United States)

    Aspergillus section Restricti together with sister sect. Aspergillus (formerly Eurotium) comprises osmophilic species, that are able to grow on substrates with low water activity and in extreme environments. We addressed the monophyly of both sections within subgenus Aspergillus and applied multidis...

  1. Studies of Lactarius from Mexico: a new species in subgenus Piperites

    NARCIS (Netherlands)

    Montoya, L.; Bandala, V.M.; Moreno, G.

    1998-01-01

    Lactarius lacteolutescens is described as a new member in subgenus Piperites subsect. Croceini. It was found growing in a mixed forest of Pinus spp. and Abies hickellii, at Mt. Cofre de Perote, Central Region of the State of Veracruz (Gulf Area, Mexico).

  2. A case study based on Watson's theory of human caring: being an infertile woman in Turkey.

    Science.gov (United States)

    Ozkan, Ilkay Arslan; Okumus, Hülya; Buldukoglu, Kadriye; Watson, Jean

    2013-10-01

    Nursing theories and models form a framework for systematizing nursing practices. In Turkey, nurses are generally organized on the basis of the medical model, which makes the essence of nursing invisible. The authors here aim to explain how to maintain a theory-based care approach for nurses working with persons experiencing infertility. The interaction between an infertile woman and a nurse is shared within the framework of Watson's theory of human caring. Watson's theory has been found useful for the infertile group in practice.

  3. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    OpenAIRE

    Roberta Maria Savieto; Eliseth Ribeiro Leão

    2016-01-01

    Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-...

  4. Teaching holistic child health promotion using Watson's theory of human science and human care.

    Science.gov (United States)

    Sessanna, Loralee

    2003-02-01

    "Preservation and advancement of human care is a critical issue for nursing today in our increasingly depersonalized society. The mandate for nursing within science as well as within society is a demand for cherishing of the wholeness of human personality" (Watson, 1999, p. 29). Children today are being faced with having to deal with this societal "depersonalization." How children grow up to perceive themselves and others is crucial in developing future adults who genuinely care about themselves and humankind in its totality. Watson's (1999) human science and human care theory was incorporated into teaching health promotion to a group of preadolescent children. Copyright 2003, Elsevier Science (USA). All rights reserved.

  5. J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

    Directory of Open Access Journals (Sweden)

    FELIPE PARRADO CORREDOR

    2013-12-01

    Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

  6. Contribution to the knowledge of the subgenus Scymnus (Parapullus Yang, 1978 (Coleoptera, Coccinellidae, with description of eight new species

    Directory of Open Access Journals (Sweden)

    Xiaosheng Chen

    2015-08-01

    Full Text Available Eight new species of the subgenus Scymnus (Parapullus Yang, 1978 from China are described and illustrated: S. (P. hastatus sp. n., S. (P. baxianshanensis sp. n., S. (P. laojielingensis sp. n., S. (P. annuliformis sp. n., S. (P. papillatus sp. n., S. (P. dichotomus sp. n., S. (P. shenmuensis sp. n. and S. (P. yanzigouensis sp. n. Diagnoses and distributions are provided for each species. An updated key to the Chinese species of the subgenus Parapullus is given. A catalogue to all known species of this subgenus is also presented.

  7. Watson-Glaser Critical Thinking Appraisal, Form-S for Education Majors

    Science.gov (United States)

    Gadzella, Bernadette M.; Stacks, James; Stephens, Rebecca C.; Masten, William G.

    2005-01-01

    The purpose of this study was to investigate whether the Watson-Glaser Critical Thinking Appraisal-Form S was a reliable and valid instrument to measure critical thinking for students pursuing a teacher career. The participants were 137 students enrolled in Educational Psychology. The data showed that the alpha for the total WGTA-FS was 0.76 and…

  8. The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

    Science.gov (United States)

    Hicks, R. E.; Southey, G. N.

    1990-01-01

    The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

  9. N. Watson- A. Parker (eds). Sports and Christianity.Historical and Contemporary Perspectives.

    OpenAIRE

    Páramo, Víctor; Sebastián Solanes, Raúl F.

    2013-01-01

    El estudio de la relación entre el deporte y las religiones en general ha proliferado en los últimos años, como evidencia la ingente cantidad de investigaciones llevadas a cabo y que los editores de la obra, Nick J. Watson y Andrew Parker, detallan al término de la Introducción.

  10. Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

    Science.gov (United States)

    IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

  11. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Unknown

    [Chandrasekhar K and Malathi R 2003 Non-Watson Crick base pairs might stabilize RNA structural motifs in ribozymes – A comparative study of group-I intron structures; ... recognition sites for proteins, metal ions and small mole- cules (Jeffrey et al 1999; ..... From the sequence analysis (table 1, figure 1) we find an extreme ...

  12. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  13. E.L.C. Watson se pionierstog deur Suid-Afrika (1912) | van der ...

    African Journals Online (AJOL)

    E.L.C. Watson's pioneering trip through South Africa (1912): The pre-First World War era in South Africa can undoubtedly be characterised by a number of aspects. However, two widely divergent aspects with a common denominator have been selected as the topic. On the one hand there was the struggle for women's rights ...

  14. "I May Be Crackin', But Um Fackin": Racial Humor in "The Watsons Go To Birmingham--1963"

    Science.gov (United States)

    McNair, Jonda C.

    2008-01-01

    This article examines the utilization of racial humor in Christopher Paul Curtis' novel, "The Watsons Go To Birmingham--1963." The theoretical perspectives that inform the analysis include critical race theory and humor theory. The results of the analysis reveal that the use of humor in this book is influenced to a significant degree by race and…

  15. Euglossa obrima, a new species of orchid bee from Mesoamerica, with notes on the subgenus Dasystilbe Dressler (Hymenoptera, Apidae).

    Science.gov (United States)

    Hinojosa-Díaz, Ismael A; Melo, Gabriel A R; Engel, Michael S

    2011-05-11

    A new species of the orchid bee subgenus Dasystilbe Dressler (Euglossini: Euglossa Latreille) is described and figured from a series of males and females collected broadly in Mesoamerica. Euglossa (Dasystilbe) obrima, sp. n., is differentiated from the one known species of Dasystilbe, Euglossa (Dasystilbe) villosa Moure, which occurs only in Panamá and perhaps Costa Rica. The subgenus and its constituent species are diagnosed, and comments provided on Dasystilbe.

  16. Sphincterochilidae from Tunisia, with a note on the subgenus Rima Pallary, 1910 (Gastropoda, Pulmonata).

    Science.gov (United States)

    Abbes, Intidhar; Nouira, Said; Neubert, Eike

    2011-01-01

    In order to establish an updated checklist of terrestrial gastropod from Tunisia, a revision of the species of Sphincterochilidae is presented, using bibliographic and museum records and the results of our own field work. As a result, only two species, Sphincterochila candidissima and Sphincterochila tunetana, are accepted to occur in Tunisia, and their type specimens are illustrated. The study of the morphological characters of the genital organs of both species clarified their subgeneric affiliation. Comparison of Sphincterochila tunetana with Sphincterochila cariosa from Lebanonshowed that the first has to be classified within the subgenus Albea, and the latter within Sphincterochila s. str.; the subgenus Rima Pallary, 1910 remains in the synonymy of Sphincterochila s. str. Bibliographic records of Sphincterochila baetica and Sphincterochila otthiana from Tunisia could not be confirmed, the latter probably lives close to the border with Algeria.

  17. Sphincterochilidae from Tunisia, with a note on the subgenus Rima Pallary, 1910 (Gastropoda, Pulmonata

    Directory of Open Access Journals (Sweden)

    Intidhar Abbes

    2011-12-01

    Full Text Available In order to establish an updated checklist of terrestrial gastropod from Tunisia, a revision of the species of Sphincterochilidae is presented, using bibliographic and museum records and the results of our own field work. As a result, only two species, Sphincterochila candidissima and S. tunetana, are accepted to occur in Tunisia, and their type specimens are illustrated. The study of the morphological characters of the genital organs of both species clarified their subgeneric affiliation. Comparison of S. tunetana with S. cariosa from Lebanon showed that the first has to be classified within the subgenus Albea, and the latter within Sphincterochila s. str.; the subgenus Rima Pallary, 1910 remains in the synonymy of Sphincterochila s. str. Bibliographic records of S. baetica and S. otthiana from Tunisia could not be confirmed, the latter probably lives close to the border with Algeria.

  18. [Acceleration of osmotic dehydration process through ohmic heating of foods: raspberries (Rubus idaeus)].

    Science.gov (United States)

    Simpson, Ricardo R; Jiménez, Maite P; Carevic, Erica G; Grancelli, Romina M

    2007-06-01

    Raspberries (Rubus idaeus) were osmotically dehydrated by applying a conventional method under the supposition of a homogeneous solution, all in a 62% glucose solution at 50 degrees C. Raspberries (Rubus idaeus) were also osmotically dehydrated by using ohmic heating in a 57% glucose solution at a variable voltage (to maintain temperature between 40 and 50 degrees C) and an electric field intensity <100 V/cm. When comparing the results from both experiments it was evident that processing time is reduced when ohmic heating technique was used. In some cases this reduction reached even 50%. This is explained by the additional effect to the thermal damage that is generated in an ohmic process, denominated electroporation.

  19. Sesquiterpene lactones. XXXIII. Guaianolides in the subgenus Psephellus (Cass. Schmalh., genus Centaurea L.

    Directory of Open Access Journals (Sweden)

    Gerard Nowak

    2014-01-01

    Full Text Available Sesquiterpene lactones were found to occur in all of the studied species of the subgenus Psephellus (Cass. Schmalh. Differing compositions were found in the representatives of three sections. In Centaurea declinata MB. from the section Leucophylle (Sosn. Sosn.. 15-deoxyrepin, linichlorin B and cynaropicrin were found. Linichlorin B dominated in Centaurea hypoleucu DC. from section Hypoleucae (Sosn. Sosn., while in the species classified in section Psephellus Sosn., repin, acroptilin, jenerin, centaurepensin and, in some, also cynaropicrin. dominated.

  20. Contributions to the Mosquito Fauna of Southeast Asia. XV. Genus Aedes Meigen, Subgenus Ayurakitia Thurman

    Science.gov (United States)

    1972-01-01

    small hair- like spicules; proctiger long, paraproct pigmented and bluntly pointed at apex, cereal setae absent; phallosome with aedeagus divided into...Thailand. The range of the subgenus may well extend into the mountain ranges of eastern Burma and northern Malaysia since similar habitats and climates...large flattened, curved bristle at apex, proctiger with cereal setae, and gonostylus long, narrow with an apical gonostylar claw; pupae with abdominal

  1. The genus Solanum (Solanaceae in southern Africa: subgenus Leptostemonum, section Giganteiformia

    Directory of Open Access Journals (Sweden)

    W. G. Welman

    2008-12-01

    Full Text Available In the genus Solanum L. (Solanaceae, subgenus Leptostemonum (Dunal Bitter, section Giganteiformia (Bitter Child has four representatives in the Flora of southern Africa region (South Africa, Namibia. Botswana. Swaziland. Lesotho, namely S. giganteum Jacq.. S. goetzei Dammer, S. tettense Klotzsch var.  renschii (Vatke A.E.Gonsalves and S. tettense Klotsch var.tettense. Descriptions, discussions, distribution maps and keys are presented, as well as an illustration of  S. goetzei.

  2. Quantitative and fingerprint analyses of Chinese sweet tea plant (Rubus Suavissimus S. Lee)

    OpenAIRE

    Chou, Guixin; Xu, Shun-Jun; Liu, Dong; Koh, Gar Yee; Zhang, Jian; Liu, Zhijun

    2009-01-01

    Quality of botanical food is increasingly assessed by the content of multiple bioactive compounds. In this study we report, for the first time, an HPLC fingerprinting method for the quality evaluation of Rubus suavissimus leaves possessing multiple bioactivities. Five constituents, gallic acid, rutin, ellagic acid, rubusoside, and steviol monoside were quantified and used in developing qualitative chromatographic fingerprints. The limits of detection and quantification ranged from 0.29 μg/mL ...

  3. Enhanced Immunomodulatory Activity of Gelatin-Encapsulated Rubus coreanus Miquel Nanoparticles

    OpenAIRE

    Drummen, Gregor P. C.; Hyeon Yong Lee; Jin-Chul Kim; Young Ock Kim; Seon Woo Cha; Yong Chang Seo; Woon Yong Choi; Choon Geun Lee

    2011-01-01

    The aim of this work was to investigate the immunomodulatory activities of Rubus coreanus Miquel extract-loaded gelatin nanoparticles. The mean size of the produced nanoparticles was 143 ± 18 nm with a bandwidth of 76 nm in the size distribution and a maximum size of ~200 nm, which allows effective nanoparticle uptake by cells. Confocal imaging confirmed this, since the nanoparticles were internalized within 30 min and heterogeneously distributed throughout the cell. Zeta-potential measuremen...

  4. A blackberry (Rubus L.) expressed sequence tag library for the development of simple sequence repeat markers

    OpenAIRE

    Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P

    2008-01-01

    Abstract Background The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by ge...

  5. The taxonomic significance of seed morphology in the Passiflora subgenus Astrophea (Passifloraceae

    Directory of Open Access Journals (Sweden)

    Ana Carolina Mezzonato-Pires

    Full Text Available ABSTRACT The center of diversity for Passiflora subg. Astrophea is in low altitude areas of northern South America. The majority of species of this group are difficult to find in nature. Seed morphology was described in detail for 25 species of Passiflora subgenus Astrophea, a subgenus that until now did not exist. For morphological analysis, 20 seeds per species were measured for length, width and thickness, and the arithmetic means calculated. The seeds varied in length, width and thickness. Eight types of ornamentation were found. The margins varied among crestate, dentate, parted, entire and parted-crestate. The seed apex can be distinguished by the shape and position of the apical appendage. Seed shape varied among obovate, lanceolate, cordiform, and oblong to elliptical. An identification key was developed and a PCA was performed both using the principal morphological characters. Morphological characters of seeds are a new source of data for delimiting taxa with quite conflicting morphological boundaries, such as seen here with the Passiflora subgenus Astrophea. Furthermore, seed morphology is especially useful for the identification of specimens with only fruits and, consequently, seeds available.

  6. Bathyraja panthera, a new species of skate (Rajidae: Arhynchobatinae) from the western Aleutian Islands, and resurrection of the subgenus Arctoraja Ishiyama

    OpenAIRE

    Orr, James W.; Stevenson , Duane E.; Hoff, Gerald R.; Spies, Ingrid; McEachran, John D.

    2011-01-01

    We provide morphological and molecular evidence to recognize a new species of skate from the North Pacific, Bathyraja panthera. We also resurrect the skate subgenus Arctoraja Ishiyama, confirming its monophyly and the validity of the subgenus. Arctoraja was previously recognized as a distinct subgenus of Breviraja and later synonymized with Bathyraja (family Rajidae). Although the nominal species of Arctoraja have all been considered synonyms of Bathyraja parmifera by various authors, on t...

  7. The practice of nurses caring for families of pediatric inpatients in light of Jean Watson.

    Science.gov (United States)

    Santos, Maiara Rodrigues Dos; Bousso, Regina Szylit; Vendramim, Patrícia; Baliza, Michelle Freire; Misko, Maira Deguer; Silva, Lucía

    2014-08-01

    Objective To know the facilities and the difficulties of nurses in caring practice of hospitalized children's families in the light of Jean Watson's Theory of Human Caring. Method It was used the descriptive qualitative approach. The data collection was conducted in three stages: presentation of theoretical content; engagement with families in the light of Watson's theory; and semi-structured interview with 12 pediatric nurses. The interviews were analysed using inductive thematic analysis, being possible to form three themes: Recognizing a framework for care; Considering the institutional context; and Challenges in family's relationship. Results The theory favored reflections about self, about the institutions and about nurses' relationship with the family of the child, normalized by a consciousness toward caring attitudes. Conclusion In this process, it is imperative that nurses recognize the philosophical-theoretical foundations of care to attend the child's family in hospital.

  8. Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

    DEFF Research Database (Denmark)

    Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

    2014-01-01

    –2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

  9. Moderate deviations for the Durbin-Watson statistic related to the first-order autoregressive process

    OpenAIRE

    Bitseki Penda, Valère; Djellout, Hacène; Proïa, Frédéric

    2012-01-01

    24 pages.; The purpose of this paper is to investigate moderate deviations for the Durbin-Watson statistic associated with the stable first-order autoregressive process where the driven noise is also given by a first-order autoregressive process. We first establish a moderate deviation principle for both the least squares estimator of the unknown parameter of the autoregressive process as well as for the serial correlation estimator associated with the driven noise. It enables us to provide a...

  10. Comparing the Concept of Caring in Islamic Perspective with Watson and Parse's Nursing Theories

    OpenAIRE

    Sadat-Hoseini, Akram-Sadat; Khosropanah, Abdoul-Hosein

    2017-01-01

    Background: In the nursing profession, it is apparent that the definition of caring differs between various perspectives. This article compares the difference of caring in Islamic with the Parse and Watson theories. Materials and Methods: In this study, we use concept analyses of Walker?Avants and compare research methods. Material used is all Islamic documents. Results: According to Islamic documents, there are four major types of caring, namely, (1) God taking care of humans, (2) Humans tak...

  11. When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

    Science.gov (United States)

    Malone, John C; García-Penagos, Andrés

    2014-07-25

    Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

  12. Two portraits of caring: a comparison of the artists, Leininger and Watson.

    Science.gov (United States)

    Cohen, J A

    1991-08-01

    Two nursing leaders, Madeleine Leininger and Jean Watson, have devoted their careers to studying and evolving the meaning of caring. The theme of caring as presented by each theorist was explored along with their views of the nature of nursing, use of theory development strategies, and their individual contributions to the development of nursing knowledge. Both identify nursing as a humanistic science, with the concept of caring being the central unifying domain of nursing. Consistent with their belief that the humanistic sciences require a different research methodology to study that which is uniquely human, both have utilized qualitative research methodologies in their study of care. The evolution of each theorist perspective of care reflects their own background and experiences. Each theorist, therefore, has painted a different portrait of caring, demonstrating a differing emphasis on philosophical, cultural and empirical concerns. For Leininger, caring must be placed in a cultural context since caring patterns can differ transculturally. Watson has focused on the philosophic (existential--phenomenological) and spiritual basis of caring and sees caring as the ethical and moral ideal of nursing. Both Leininger and Watson have demonstrated their artistry in their individual portraits of caring and in their contributions to the development of nursing knowledge.

  13. O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

    Directory of Open Access Journals (Sweden)

    Cláudio Ivan de Oliveira

    Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

  14. Mitochondrial COI gene as a tool in the taxonomy of mosquitoes Culex subgenus Melanoconion.

    Science.gov (United States)

    Torres-Gutierrez, Carolina; Bergo, Eduardo Sterlino; Emerson, Kevin J; de Oliveira, Tatiane M P; Greni, Susan; Sallum, Maria Anice Mureb

    2016-12-01

    The subgenus Melanoconion is the second largest subgenus within the genus Culex, with 160 described species. Several of the species are proven vectors of arboviruses, including West Nile virus, Venezuelan equine encephalitis virus complex and Eastern equine encephalomyelitis virus. Species of Melanoconion are well distributed from southern North America to most countries of South America and display the highest species diversity in tropical regions. Taxonomical identification within this group has been primarily based on morphological characters, with the male genitalia as the source of the most solid diagnostic features. The difficulty in reaching accurate species determinations when studying specimens of Culex (Melanoconion) has been extensively documented as a real limitation to expand knowledge of these insects. We tested the utility of the mitochondrial gene COI as a complementary tool in the taxonomy of Melanoconion. Using a data set of 120 COI sequences from Culex specimen captured in several localities in Brazil, the utility of COI barcodes for species delimitation is discussed through the evaluation of genetic divergences among specimens and the clustering patterns of species in three topologies obtained with Neighbor Joining, Maximum Likelihood and Bayesian phylogenetic inference. For all specimens included in this study a previous morphological examination was performed, and most of the taxonomical determinations were corroborated using the COI barcode. We generated COI sequences that belong to 48 species of Melanoconion, with a mean intraspecific K2P genetic divergence of 3%; and all interspecific divergence values higher than the intraspecific divergence values. This is the first comprehensive study of subgenus Melanoconion, with evidence of COI as a useful and accessible DNA barcode. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. The oribatid mite subgenus Galumna (Galumna (Acari, Oribatida, Galumnidae in the Philippines

    Directory of Open Access Journals (Sweden)

    Sergey Ermilov

    2014-11-01

    Full Text Available Five species of the subgenus Galumna (Galumna (Acari, Oribatida, Galumnidae are registered in the Philippine oribatid mite fauna. A new species, G. (G. makilingensis sp. n., is described; it is most similar morphologically to G. (G. tokyoensis Aoki, 1966, but differs from the latter by the morphology of porose areas Aa and Ap, rostral setae, and length of interlamellar setae. Three species, G. (G. crenata Deb & Raychaudhuri, 1975, G. (G. cf. exigua Sellnick, 1925 and G. (G. khoii Mahunka, 1989, are recorded in the Philippines for the first time. The species G. (G. crenata is redescribed. An identification key to the Philippine species of Galumna (Galumna is given.

  16. Enhanced Immunomodulatory Activity of Gelatin-Encapsulated Rubus coreanus Miquel Nanoparticles

    Directory of Open Access Journals (Sweden)

    Gregor P. C. Drummen

    2011-12-01

    Full Text Available The aim of this work was to investigate the immunomodulatory activities of Rubus coreanus Miquel extract-loaded gelatin nanoparticles. The mean size of the produced nanoparticles was 143 ± 18 nm with a bandwidth of 76 nm in the size distribution and a maximum size of ~200 nm, which allows effective nanoparticle uptake by cells. Confocal imaging confirmed this, since the nanoparticles were internalized within 30 min and heterogeneously distributed throughout the cell. Zeta-potential measurements showed that from pH = 5 onwards, the nanoparticles were highly negatively charged, which prevents agglomeration to clusters by electrostatic repulsion. This was confirmed by TEM imaging, which showed a well dispersed colloidal solution. The encapsulation efficiency was nearly 60%, which is higher than for other components encapsulated in gelatin nanoparticles. Measurements of immune modulation in immune cells showed a significant effect by the crude extract, which was only topped by the nanoparticles containing the extract. Proliferation of B-, T- and NK cells was notably enhanced by Rubus coreanus-gelatin nanoparticles and in general ~2–3 times higher than control and on average ~2 times higher than ferulic acid. R. coreanus-gelatin nanoparticles induced cytokine secretion (IL-6 and TNF-α from B- and T-cells on average at a ~2–3 times higher rate compared with the extract and ferulic acid. In vivo immunomodulatory activity in mice fed with R. coreanus-gelatin nanoparticles at 1 mL/g body weight showed a ~5 times higher antibody production compared to control, a ~1.3 times higher production compared to the extract only, and a ~1.6 times higher production compared to ferulic acid. Overall, our results suggest that gelatin nanoparticles represent an excellent transport vehicle for Rubus coreanus extract and extracts from other plants generally used in traditional Asian medicine. Such nanoparticles ensure a high local concentration that results in

  17. Enhanced immunomodulatory activity of gelatin-encapsulated Rubus coreanus Miquel nanoparticles.

    Science.gov (United States)

    Seo, Yong Chang; Choi, Woon Yong; Lee, Choon Geun; Cha, Seon Woo; Kim, Young Ock; Kim, Jin-Chul; Drummen, Gregor P C; Lee, Hyeon Yong

    2011-01-01

    The aim of this work was to investigate the immunomodulatory activities of Rubus coreanus Miquel extract-loaded gelatin nanoparticles. The mean size of the produced nanoparticles was 143 ± 18 nm with a bandwidth of 76 nm in the size distribution and a maximum size of ~200 nm, which allows effective nanoparticle uptake by cells. Confocal imaging confirmed this, since the nanoparticles were internalized within 30 min and heterogeneously distributed throughout the cell. Zeta-potential measurements showed that from pH = 5 onwards, the nanoparticles were highly negatively charged, which prevents agglomeration to clusters by electrostatic repulsion. This was confirmed by TEM imaging, which showed a well dispersed colloidal solution. The encapsulation efficiency was nearly 60%, which is higher than for other components encapsulated in gelatin nanoparticles. Measurements of immune modulation in immune cells showed a significant effect by the crude extract, which was only topped by the nanoparticles containing the extract. Proliferation of B-, T- and NK cells was notably enhanced by Rubus coreanus-gelatin nanoparticles and in general ~2-3 times higher than control and on average ~2 times higher than ferulic acid. R. coreanus-gelatin nanoparticles induced cytokine secretion (IL-6 and TNF-α) from B- and T-cells on average at a ~2-3 times higher rate compared with the extract and ferulic acid. In vivo immunomodulatory activity in mice fed with R. coreanus-gelatin nanoparticles at 1 mL/g body weight showed a ~5 times higher antibody production compared to control, a ~1.3 times higher production compared to the extract only, and a ~1.6 times higher production compared to ferulic acid. Overall, our results suggest that gelatin nanoparticles represent an excellent transport vehicle for Rubus coreanus extract and extracts from other plants generally used in traditional Asian medicine. Such nanoparticles ensure a high local concentration that results in enhancement of immune cell

  18. Functional morphology underlies performance differences among invasive and non-invasive ruderal Rubus species.

    Science.gov (United States)

    Caplan, Joshua S; Yeakley, J Alan

    2013-10-01

    The ability of some introduced plant species to outperform native species under altered resource conditions makes them highly productive in ecosystems with surplus resources. However, ruderal native species are also productive when resources are available. The differences in abundance among invasive and non-invasive ruderal plants may be related to differences in ability to maintain access to or store resources for continual use. For a group of ruderal species in the Pacific Northwest of North America (invasive Rubus armeniacus; non-invasive R. ursinus, R. parviflorus, R. spectabilis, and Rosa nutkana), we sought to determine whether differences in functional morphological traits, especially metrics of water access and storage, were consistent with differences in water conductance and growth rate. We also investigated the changes in these traits in response to abundant vs. limited water availability. Rubus armeniacus had among the largest root systems and cane cross-sectional areas, the lowest cane tissue densities, and the most plastic ratios of leaf area to plant mass and of xylem area to leaf area, often sharing its rank with R. ursinus or Rosa nutkana. These three species had the highest water conductance and relative growth rates, though Rubus armeniacus grew the most rapidly when water was not limited. Our results suggest that water access and storage abilities vary with morphology among the ruderal species investigated, and that these abilities, in combination, are greatest in the invasive. In turn, functional morphological traits allow R. armeniacus to maintain rapid gas exchange rates during the dry summers in its invaded range, conferring on it high productivity.

  19. Enraizamento de estacas caulinares e radiculares de Rubus fruticosus tratadas com AIB Rooting of stems and root cuttings of Rubus fruticosus using IBA

    Directory of Open Access Journals (Sweden)

    Maraísa Hellen Tadeu

    2012-12-01

    Full Text Available O objetivo deste trabalho foi avaliar o enraizamento de estacas caulinares e radiculares de Rubus fruticosus, tratadas com AIB. Estacas radiculares e caulinares dessa espécie foram coletadas em março, tendo posteriormente suas bases tratadas com diferentes concentrações de ácido indolbutírico (AIB, 1000, 2000, 3000 e 4000 mg L-1 por 10 segundos. O tratamento controle foi baseado somente no uso da água. As estacas caulinares foram enterradas a 2/3 de seu comprimento, em posição vertical, e as radiculares foram totalmente enterradas, na horizontal, utilizando-se a vermiculitaï como substrato, em telado com sombreamento de 50%. Após 60 dias, pôde-se concluir que as estacas caulinares apresentaram melhores resultados para formação das mudas, não se devendo tratá-las com AIB.The objective of the present work was to evaluate the rizogenic potential for stems and root cuttings of Rubus fruticosus treated with indolbutyric acid. Roots and stems cuttings of this specie were collected in March, and had their basal portions treated with different concentrations of indolbutyric acid (IBA (1000, 2000, 3000 and 4000 mg L-1 for 10 seconds. The control treatment used only water. The stem cuttings were planted with 2/3 of their length in the vertical position and the root cuttings were totally covered in the horizontal position, using vermiculite as substrate, in screenhouse with 50% of shade. After 60 days, the stem cuttings presented better results for seedling formation, without IBA.

  20. A new species of Cladotanytarsus (Lenziella) from Oregon supports the systematic concept of the subgenus (Diptera: Chironomidae).

    Science.gov (United States)

    Puchalski, Mateusz; Giłka, Wojciech

    2017-05-18

    A new species of the genus Cladotanytarsus Kieffer, 1921 and the small subgenus Lenziella Kieffer, 1922 is described from Southern Oregon, USA. The adult male of C. (L.) glaber Giłka et Puchalski, sp. nov., featuring tibial lobes armed with dense setae and a large globular swelling of the hypopygial inferior volsella, supports the recently defined systematic concept for Lenziella. This subgenus is known from seven species distributed in the Northern Hemisphere (1 European, 1 Palaearctic and 5 Nearctic), the males of which are included in an updated identification key.

  1. Phenotypic differentiation and phylogenetic signal of wing shape in western European biting midges, Culicoides spp., of the subgenus Avaritia

    DEFF Research Database (Denmark)

    Muñoz-Muñoz, F.; Talavera, S.; Carpenter, S.

    2014-01-01

    of cytochrome oxidase subunit I barcode sequencing and geometric morphometric analyses to investigate wing shape as a means to infer species identification within this subgenus. In addition the congruence of morphological data with different phylogenetic hypotheses is tested. Five different species...... of the subgenus Avaritia were considered in the study (C. obsoletus (Meigen); C. scoticus Kettle and Lawson; C. chiopterus (Meigen); C. dewulfi Goetghebuer and C. imicola (Kieffer)). The study demonstrated that over 90% of individuals could be separated correctly into species by their wing shape and that patterns...

  2. Rubus occidentalis: The black raspberry--its potential in the prevention of cancer.

    Science.gov (United States)

    Kula, Marta; Krauze-Baranowska, Mirosława

    2016-01-01

    Rubus occidentalis is a black-fruited raspberry originating from North America. Its popularity and demand has been growing over the years, as studies outline its high anthocyanin and ellagitannin content and significance for human health. Interaction between chemical composition and pharmacological activity, mechanisms of action at cellular and molecular levels are all active areas of study. The vast majority of research concerning black raspberries is focused on chemoprevention and anticancer effects. This review summarizes the data on chemical composition and anticancer activity of black raspberry fruits throughout the years.

  3. Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

    Directory of Open Access Journals (Sweden)

    Lina Affifatusholihah

    2017-04-01

    In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

  4. Applying Watson's nursing theory to assess patient perceptions of being cared for in a multicultural environment.

    Science.gov (United States)

    Suliman, Wafika A; Welmann, Elizabeth; Omer, Tagwa; Thomas, Laisamma

    2009-12-01

    J. Watson's (2002) caring theory addresses caring relationships among humans and the deep experiences of life itself. M. Leininger (1988) noted that caring is a universal phenomenon, which is likely to be perceived differently by patients and nurses if they come from different cultural backgrounds. Little is known about the patients' perception of "being cared for" in the Kingdom of Saudi Arabia, where most nurses in the workforce come from cultural backgrounds different from their patients. This study was designed to explore Saudi patient perceptions of important caring behaviors and those most frequently attended to by staff nurses in a multicultural environment. A questionnaire survey was used to explore discrepancies between the perceived importance of caring behaviors and how frequently those caring behaviors were attended to by staff nurses. A probability sample of 393 patients was drawn from three hospitals in three different regions of Saudi Arabia. The Caring Behaviors Assessment instrument of S. N. Cronin and B. Harrison (1988) was used in data collection. Patients rated overall caring behaviors as important (97.2%) and frequently experienced (73.7%). The discrepancy between the importance of and frequency of attendance to caring behaviors by nurses was statistically significant (t = -4.689, p = .001). The caring behaviors based upon Jean Watson's theory were valued by Saudi patients irrespective of their cultural differences with the caregiver. However, the frequency of caring attended to by nurses in teaching/learning and helping/trust behavior subcategories were rated lower. Such is most likely the result of culture differences and language barriers existing between patients and nurses in Saudi Arabia. Results showed that the carative factors in Jean Watson's theory were also applicable to patients in Saudi Arabia and that nursing professionals should base their care on such theory to meet patient needs.

  5. Finite sample of the Durbin-Watson test against fractionally integrated disturbances

    OpenAIRE

    Kleiber, Christian; Krämer, Walter

    2004-01-01

    We consider the finite sample power of various tests against serial correlation in the disturbances of a linear regression when these disturbances follow a stationary long memory process. It emerges that the power depends on the form of the regressor matrix and that, for the Durbin-Watson test and many other tests that can be written as ratios of quadratic forms in the disturbances, the power can drop to zero for certain regressors. We also provide a means to detect this zero-power trap. Our ...

  6. Molecular phylogeny of Crematogaster subgenus Decacrema ants (Hymenoptera: Formicidae) and the colonization of Macaranga (Euphorbiaceae) trees.

    Science.gov (United States)

    Feldhaar, Heike; Fiala, Brigitte; Gadau, Jürgen; Mohamed, Maryati; Maschwitz, Ulrich

    2003-06-01

    To elucidate the evolution of one of the most species-rich ant-plant symbiotic systems, the association between Crematogaster (Myrmicinae) and Macaranga (Euphorbiaceae) in South-East Asia, we conducted a phylogenetic analysis of the ant partners. For the phylogenetic analysis partial mitochondrial cytochrome oxidase I and II were sequenced and Maximum Parsimony analysis was performed. The analyzed Crematogaster of the subgenus Decacrema fell into three distinct clades which are also characterized by specific morphological and ecological traits (queen morphology, host-plants, and colony structure). Our results supported the validity of our currently used morphospecies concept for Peninsula Malaysia. However, on a wider geographic range (including North and North-East Borneo) some morphospecies turned out to be species complexes with genetically quite distinct taxa. Our phylogenetic analysis and host association studies do not indicate strict cocladogenesis between the subgenus Decacrema and their Macaranga host-plants because multiple ant taxa occur on quite distinct host-plants belonging to different clades within in the genus Macaranga. These results support the view that host-shifting or host-expansion is common in the ants colonizing Macaranga. Additionally, the considerable geographic substructuring found in the phylogenetic trees of the ants suggests that allopatric speciation has also played a role in the diversification and the current distribution of the Decacrema ants.

  7. Unusual sub-genus associations of faecal Prevotella and Bacteroides with specific dietary patterns.

    Science.gov (United States)

    De Filippis, Francesca; Pellegrini, Nicoletta; Laghi, Luca; Gobbetti, Marco; Ercolini, Danilo

    2016-10-21

    Diet has a recognized effect in shaping gut microbiota. Many studies link an increase in Prevotella to high-fibre diet, while Bacteroides abundance is usually associated with the consumption of animal fat and protein-rich diets. Nevertheless, closely related species and strains may harbour different genetic pools; therefore, further studies should aim to understand whether species of the same genus are consistently linked to dietary patterns or equally responsive to diet variations. Here, we used oligotyping of 16S rRNA gene sequencing data to exploit the diversity within Prevotella and Bacteroides genera in faecal samples of omnivore and non-omnivore subjects from a previously studied cohort. A great heterogeneity was found in oligotype composition. Nevertheless, different oligotypes within the same genus showed distinctive correlation patterns with dietary components and metabolome. We found that some Prevotella oligotypes are significantly associated with the plant-based diet but some are associated with animal-based nutrients, and the same applies to Bacteroides. Therefore, an indiscriminate association of Bacteroidetes genera with specific dietary patterns may lead to an oversimplified vision that does not take into account sub-genus diversity and the different possible responses to dietary components. We demonstrated that Prevotella and Bacteroides oligotypes show distinctive correlation patterns with dietary components and metabolome. These results substantiate a current oversimplification of diet-dependent microbe-host associations and highlighted that sub-genus differences must be taken into account when planning gut microbiota modulation for health benefits.

  8. Revision of the Neotropical species of the subgenus Atrichopogon (Psilokempia) (Diptera: Ceratopogonidae).

    Science.gov (United States)

    Spinelli, Gustavo R; Marino, Pablo I; Huerta, Herón

    2015-08-20

    This revision of the midges in the subgenus Psilokempia Enderlein of Atrichopogon Kieffer provides a brief description of the subgenus, diagnoses, descriptions, illustrations and a key to adult males and females of the 17 species from the Neotropical region, as well as distributional records of both new and previously described species. Six new species are described and illustrated: A. arti, A. javieri, A. longirostris, A. nahuelbutensis, A. sergioi and A. woodruffi (n. spp.). The type materials of all previously known Neotropical species except A. penicillatus Delècolle & Rieb were examined. Atrichopogon altivolans Macfie, A. aridus Spinelli & Marino, A. domizii Spinelli, A. glaber Macfie, A. gordoni Macfie, A. insigniventris Macfie, A. pectinatus Macfie and A. penicillatus are redescribed and illustrated, and notes on the types of A. echinodes Macfie, A. harrisi Macfie and A. sanctaeclarae Macfie are provided. Lectotypes are designated for A. glaber, A. insigniventris and A. pectinatus. The previously unknown males of A. altivolans, A. pectinatus and A. penicillatus are described and illustrated, and A. fimbriatus Macfie is recognized as a junior synonym of A. gordoni.

  9. Sesquiterpene lactones. XXIX. Cnicin in species of the subgenus Acrolophus (Cass. Dobrocz

    Directory of Open Access Journals (Sweden)

    Gerard Nowak

    2014-01-01

    Full Text Available Cnicin was isolated from 18 species or subspecies of the subgenus Acrolophus (Cass. Dobrocz.: Centaurea aplolepa Moretti subsp. aplolepa, C. aplolepa Moretti subsp. lunensis (Fiori Dostal, C. arenaria Bieb. ex Wild. subsp. arenaria, C. arenaria Bieb. ex Wild, subsp. odessana (Prodan Dostal, C. arenaria Bieb ex Wild. subsp. majorowii (Dumbadze Dostal, C. calvescens Pančić, C. cineraria L. subsp. cineraria, C. cineraria L. var, circae Somm., C. diffusa Lam. var. brevispina Boiss., C. grisebachi (Nyman Form. subsp. grisebachi, C. grisebachi (Nyman Form. subsp. confusa (Halácsy Dostal, C. leucophaea Jordan subsp. leucophaea, C. attica Nyman subsp. ossaea (Halácsy Dostal, C. pallidior Halácsy subsp. palidior, C. pelia DC., C. rhenana Boreau subsp. savranica (Klokow Dostal, C. tymphaea Hausskn subsp. tymphaea, C. tymphaea Hausskn subsp. brevispina Hausskn (Dostal. Chromatographic analysis has shown appearance of cnicin in 10 investigated species or subspecies of subgenus Acrolophus (Cass. Dobrocz.: Centaurea attica Nyman subsp. drakiensis (Freyn, Sint. Dostal, C. kartschiana Scop., C. aggregata Fisch. et Mey, C. cuneifolia Sibth. SM. subsp. pallida (Friv. Hayek, C. exarata Boiss. ex Cosson., C. mantoudii Georg., C. orphanidea Heldr. Sart. ex Boiss, subsp. orphanidea, C. spinosa L. subsp. spinosa, C. transiens Halácsy, C. zuccariniana DC.

  10. North American crop wild relatives of temperate berries (Fragaria L., Ribes L., Rubus L., and Vaccinium L.)

    Science.gov (United States)

    The crop wild relatives of temperate berry species abound on the North American continent; >170 species are endemic in North America. The development and production of berry crops, such as strawberries (Fragaria L.), currants and gooseberries (Ribes L.), raspberries and blackberries (Rubus L.), blue...

  11. Optimizing shoot culture media for Rubus germplasm: the effects of NH4+, NO3-, and total nitrogen

    Science.gov (United States)

    The nitrogen components of Murashige and Skoog (MS) medium were significant factors for improved growth in our earlier study that modeled the effects of mineral nutrition on growth and development of micropropagated red raspberry(Rubus idaeus L.). In this study, a mixture component design was applie...

  12. El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

    Directory of Open Access Journals (Sweden)

    Carme Ferré-Grau

    2008-03-01

    Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

  13. Strong enhancement of vibrational relaxation by Watson-Crick base pairing.

    Science.gov (United States)

    Woutersen, Sander; Cristalli, Gloria

    2004-09-15

    We have studied the ultrafast dynamics of NH-stretch vibrational excitations in Watson-Crick base pairs consisting of adenine and uracil derivatives. To estimate the influence of the A:U hydrogen bonding on the vibrational dynamics, we have also studied the uracil derivative in monomeric form. The vibrational relaxation of the NH-stretching mode is found to occur much faster in the Watson-Crick base pair than in monomeric uracil. From the delay dependence of the transient vibrational spectra, it can be concluded that both in base-paired and monomeric uracil, the energy relaxation takes place in two steps, the first step being a rapid transfer of energy from the NH-stretching mode to an accepting mode, the second step the relaxation of this accepting mode. The transient spectra show evidence that in the base pair the hydrogen bond between the nucleobases acts as the accepting mode, and that the hydrogen bonding between the bases is responsible for the extremely fast vibrational relaxation in this system.

  14. James Watson's most inconvenient truth: race realism and the moralistic fallacy.

    Science.gov (United States)

    Rushton, J Philippe; Jensen, Arthur R

    2008-11-01

    Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

  15. Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

    Directory of Open Access Journals (Sweden)

    Roberta Maria Savieto

    2016-03-01

    Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

  16. An oil-soluble extract of Rubus idaeus cells enhances hydration and water homeostasis in skin cells.

    Science.gov (United States)

    Tito, A; Bimonte, M; Carola, A; De Lucia, A; Barbulova, A; Tortora, A; Colucci, G; Apone, F

    2015-12-01

    Raspberry plants, belonging to the species of Rubus idaeus, are known for their excellent therapeutic properties as they are particularly rich in compounds with strong antioxidant activity, which promote health and well-being of human cells. Besides their high content of phenolic compounds, Rubus plants are rich in oil-soluble compounds, which are also primary components of the hydrolipidic film barrier of the skin. As plant cell cultures represented a valuable system to produce interesting compounds and ingredients for cosmetic applications, we developed liquid suspension cultures from Rubus idaeus leaves and used them to obtain an active ingredient aimed at improving hydration and moisturization capacity in the skin. Rubus idaeus cells, grown in the laboratory under sterile and controlled conditions as liquid suspension cultures, were processed to obtain an oil-soluble (liposoluble) extract, containing phenolic compounds and a wide range of fatty acids. The extract was tested on cultured keratinocytes and fibroblasts and then on the skin in vivo, to assess its cosmetic activities. When tested on skin cell cultures, the extract induced the genes responsible for skin hydration, such as aquaporin 3, filaggrin, involucrin and hyaluronic acid synthase, and stimulated the expression and the activity of the enzyme glucocerebrosidase, involved in ceramide production. Moreover, the liposoluble extract increased the synthesis of the extracellular matrix components in cultured fibroblasts and showed a remarkable skin-hydrating capacity when tested on human skin in vivo. Thanks to these activities, the Rubus idaeus liposoluble extract has several potential applications in skin care cosmetics: it can be used as hydrating and moisturizing ingredient in face and body lotions, and as anti-ageing product in face creams specifically designed to fight wrinkle formation. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  17. The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

    Science.gov (United States)

    Caplan, R M

    1982-06-01

    The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

  18. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  19. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  20. ARCHITECTONICS OF BOREAL SPECIES IN THE SUBGENUS SALIX AND VETRIX DUMORT.

    Directory of Open Access Journals (Sweden)

    O. I. Nedoseko

    2017-09-01

    Full Text Available Background. The basis for understanding the patterns of plant growth and development is the research of their structural and functional organization. One of the successfully developing areas of this research is the study of architectural models of woody plants. At the same time, widespread species of willow in the middle belt of European Russia from subgenus Salix and Vetrix are not fully studied in this respect. The goal is to develop a methodology for studying the structural and functional organization of dioecious tree species and on its basis to identify and describe the main structural and functional units (architectural modules of boreal species of willows of subgenus Salix and Vetrix. Materials and methods. Architectural modules are described for 15 boreal species in subgenus Salix and Vetrix. For this, a method based on the analysis of three features of the structural and functional organization of the species was developed: ramification type, the size of the vegetative shoots die-off zone and the longevity of the vegetative parts of the earrings. Results. 7 architectural modules have been identified in the examined species: one- and two-stage drop-down earrings on the basis of acro-, meso- and basitonium, and also with conditionally non-decreasing earrings based on acrotonia. It is established that the degree of death of the upper metamers of annual shoots correlates with the development of shoots from sleeping buds: in low shrubs such shoots develop 4–6 times more often than in trees and high shrubs. It is determined that the architectural modules of female individuals, unlike male individuals, are more branched and contain a greater number of annual assimilative shoots. It is shown that maximum number of architectural types is characteristic of the upper and middle branches, and the smaller of the lower branches in the crowns of female and male individuals of trees and tall shrubs. Conclusions. The offered technique allows us to

  1. Dormancy and Germination of Castilla Blackberry Seeds (Rubus glaucus Benth / Latencia y Germinación de Semillas de Mora de Castilla (Rubus glaucus Benth

    Directory of Open Access Journals (Sweden)

    Díaz Diez Cipriano Arturo

    2013-08-01

    Full Text Available We categorized the dormancy and germination ofblackberry (Rubus glaucus Benth seeds from the GermplasmBank System for Food and Agriculture of the Colombian Nation. A tetrazolium test showed normal seedling production viability, but seed coat impermeability prevented imbibition, which is considered an expression of exogenous dormancy; however, this was released by immersing the seeds in 5.25% sodium hypochlorite for 16 to 21 hours. The treatment was applied to 10 accessions of Castilla blackberry, harvested during the dry and rainy seasons. The seeds were germinated under light and dark conditions. The highest germination counts were obtained with the dry-season-collected seeds incubated in darkness and with the rainy-season seeds incubated under light conditions. Differential germination responses were also independently determined by genotype, incubation conditions (light or darkness and collecting season. / Se categorizaron la latencia y la germinación ensemillas de mora de Castilla (Rubus glaucus Benth, provenientes del Sistema de Bancos de Germoplasma para la Alimentación y la Agricultura de la Nación Colombiana. La prueba del tetrazolio demostró que las semillas tenían la capacidad para dar origen a una plántula normal; sin embargo, al contacto con el agua la imbibición fue restringida por la impermeabilidad de la testa, lo que se considera como una expresión de latencia exógena. Ésta pudo ser removida con la inmersión de las semillas durante 16 a 21 horas en hipoclorito de sodio al 5,25%. El tratamiento fue aplicado a 10 accesiones de mora de Castila cosechadas en épocas seca y lluviosa; las semillas se germinaron bajo condiciones deluz y oscuridad, con una mayor germinación al incubar lasprovenientes de tiempo seco en condiciones de oscuridad y en aquellas de época lluviosa al ser germinadas con luz. También al aplicar el procedimiento de remoción de latencia exógena se observaron respuestas germinativas diferenciales

  2. Evaluación de un sistema para la micorrización in vitro en plantas de mora de castilla (Rubus glaucus, Benth)

    OpenAIRE

    Víctor Manuel Núñez-Zarante; Gabriel Roveda-Hoyos; Marcela Franco-Correa; María Margarita Ramírez-Gómez; Urley Adrian Pérez-Moncada

    2012-01-01

    Evaluation of an in vitro mycorrhization system of blackberry plants (Rubus glaucus, Benth). Objective. Obtain an in vitromycorrhization system in autotrophic culture systems of blackberry plants (Rubus glaucus, Benth). Materials and methods. We usedspores and root fragments with vesicles of Arbuscular Mycorrhizal Fungus (AMF) Glomus sp (GEV02). We established an autotrophicculture system of blackberry plantlets comparing two methods of direct inoculation of the AMF. We measured the number of...

  3. Phylogeny and taxonomic revision of the subgenus Velleius Leach (Coleoptera: Staphylinidae: Staphylininae).

    Science.gov (United States)

    Zhao, Zong-Yi; Zhou, Hong-Zhang

    2015-05-15

    The subgenus Velleius Leach, 1819 of the genus Quedius Stephens, 1829 is a small and very distinctive group in the subtribe Quediina (Staphylinidae: Staphylininae) with pectinate antennal segments and larvae living in nests of Vespa species. This paper reviews the taxonomy of all Velleius species and analyzes the phylogeny of this group. Two new species, Quedius (Velleius) sagittalis sp. nov. from Shaanxi, China and Q. (V.) rectilatus sp. nov. from Guangdong, China, are described. Q. (V.) simillimus (Fairmaire,1891) syn. nov. is proposed as a new synonym of Q. (V.) pectinatus (Sharp, 1874). Phylogenetic result shows that all nine Velleius species can be divided into two clades and both have strong tree supports of Bremer/Bootstrap/Jackknife values.

  4. Growth and differentiation on a trypanosome of the subgenus Schizotrypanum from the bat Phyllostomus hastatus

    Directory of Open Access Journals (Sweden)

    Sônia I. Hamanaka

    1993-12-01

    Full Text Available The effects of temperature, pH, osmolarity and aeration on the growth and differentiation of a trypanosome ofthe subgenus Schizotrypanum isolatedfrom the bat Phyllostomus hastatus were studied. In general, the growth characteristics ofthe flagellate were similar to those of Trypanosoma (Schizotrypanum cruzi. However, the parasite did not growth at 33 or 37C. Increase in the osmolarity and aeration promoted growth at 33C. Significant metacyclogenesis was detected only in the growth condition where maximal growth occured (28C, pH 7.3, 380m0s/kg, in tissue cullure flasks, at the end ofthe exponential growth phase. The begining of the metacyclogenesis process was coincident with most glucose utilization and lowest pH. During metacyclogenesis both culture medium pH and osmolarity increased steadly.

  5. The genus Solanum (Solanaceae in southern Africa: subgenus Leptostemonum, the introduced sections Acanthophora and Torva

    Directory of Open Access Journals (Sweden)

    W. G. Welman

    2003-12-01

    Full Text Available In the genus Solanum L. (Solanaceae, subgenus Leptostemonum (Dunal Bitter, section Acanthophora Dunal has four representatives in the Flora of southern Africa region (South Africa. Lesotho, Swaziland, Namibia. Botswana, namely  S. aculeatissimum Jacq.. S. capsicoides Allioni. S. mammosum L. (cultivated only and S. viarum Dunal. Section  Ton a Nees has two representatives in southern Africa, namely S.  chnsotriclium Schltdl. (S.  hispidum auctt. non Pers. and S.  ton um Sw.; both are naturalized weeds.  Solanum capsicoides, S. viarum and S.  torvum have not been listed before for southern Africa. All are introduced species native to the New World. Descriptions, discussions, illustrations and distribution maps of the naturalized species are presented, as well as keys to the species of both sections.

  6. Systematic studies on Anopheles galvaoi Causey, Deane & Deane from the subgenus Nysssorhynchus blanchard (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Maria Anice Mureb Sallum

    2002-12-01

    Full Text Available Anopheles galvaoi, a member of the subgenus Nyssorhynchus, is redescribed based on morphological characters of the adults male and female, fourth-instar larva and pupa. Female, male genitalia, larval and pupal stages are illustrated. Data about medical importance, bionomics, and distribution are given based on literature records. Adult female of An. galvaoi can be easily misidentified as An. benarrochi Gabaldón and An. aquasalis Curry. A few characters are indicated for identifying female and immatures of An. galvaoi. Phylogenetic relationships among An. galvaoi and six other species of the Oswaldoi Subgroup are estimated using COII mtDNA and ITS2 rDNA gene sequences. Lectotype of An. galvaoi, an adult female from Rio Branco, State of Acre, is invalidated.

  7. The genus Solanum (Solanaceae in southern Africa: subgenus Leptostemonum, the introduced sections Acanthophora and Torva

    Directory of Open Access Journals (Sweden)

    W. G. Welman

    2003-09-01

    Full Text Available In the genus Solanum L. (Solanaceae, subgenus Leptostemonum (Dunal Bitter, section Acanthophora Dunal has four representatives in the Flora of southern Africa region (South Africa. Lesotho, Swaziland, Namibia. Botswana, namely  S. aculeatissimum Jacq.. S. capsicoides Allioni. S. mammosum L. (cultivated only and S. viarum Dunal. Section  Ton a Nees has two representatives in southern Africa, namely S.  chnsotriclium Schltdl. (S.  hispidum auctt. non Pers. and S.  ton um Sw.; both are naturalized weeds.  Solanum capsicoides, S. viarum and S.  torvum have not been listed before for southern Africa. All are introduced species native to the New World. Descriptions, discussions, illustrations and distribution maps of the naturalized species are presented, as well as keys to the species of both sections.

  8. Phylogenetic analysis of Penicillium subgenus Penicillium using partial P-tubulin sequences

    DEFF Research Database (Denmark)

    Samson, R.A.; Seifert, K.A.; Kuijpers, A.F.A.

    2004-01-01

    with the classification into sections and series proposed in the accompanying monograph. There was good strict consensus support for much of the gene tree, and good bootstrap support for some parts. The phylogenetic analyses suggested that sect. Viridicata, the largest section in the subgenus, is divided into three...... the paraphyletic P. nordicum. The phylogeny for sect. Roqueforti (100%) was robust, with excellent bootstrap support for all included species, i.e. P. roqueforti (100%), P. carneum (94%) and P. paneum (100%). In sect. Penicillium, Series Expansa was paraphyletic, with the monophyletic ser. Italica derived within...... it. The synnematous species in ser. Claviformia were a paraphyletic group with the species of ser. Urticicolae., including P. griseofulvum (99%), derived within. Section Digitata, ser. Digitata comprised a single well-supported species, P. digitatum (100%). The phylogenetic structure of sect...

  9. Phylogenetic Patterns of Geographical and Ecological Diversification in the Subgenus Drosophila

    Science.gov (United States)

    Morales-Hojas, Ramiro; Vieira, Jorge

    2012-01-01

    Colonisation of new geographic regions and/or of new ecological resources can result in rapid species diversification into the new ecological niches available. Members of the subgenus Drosophila are distributed across the globe and show a large diversity of ecological niches. Furthermore, taxonomic classification of Drosophila includes the rank radiation, which refers to closely related species groups. Nevertheless, it has never been tested if these taxonomic radiations correspond to evolutionary radiations. Here we present a study of the patterns of diversification of Drosophila to test for increased diversification rates in relation to the geographic and ecological diversification processes. For this, we have estimated and dated a phylogeny of 218 species belonging to the major species groups of the subgenus. The obtained phylogenies are largely consistent with previous studies and indicate that the major groups appeared during the Oligocene/Miocene transition or early Miocene, characterized by a trend of climate warming with brief periods of glaciation. Ancestral reconstruction of geographic ranges and ecological resource use suggest at least two dispersals to the Neotropics from the ancestral Asiatic tropical disribution, and several transitions to specialized ecological resource use (mycophagous and cactophilic). Colonisation of new geographic regions and/or of new ecological resources can result in rapid species diversification into the new ecological niches available. However, diversification analyses show no significant support for adaptive radiations as a result of geographic dispersal or ecological resource shift. Also, cactophily has not resulted in an increase in the diversification rate of the repleta and related groups. It is thus concluded that the taxonomic radiations do not correspond to adaptive radiations. PMID:23152919

  10. Phylogenetic patterns of geographical and ecological diversification in the subgenus Drosophila.

    Directory of Open Access Journals (Sweden)

    Ramiro Morales-Hojas

    Full Text Available Colonisation of new geographic regions and/or of new ecological resources can result in rapid species diversification into the new ecological niches available. Members of the subgenus Drosophila are distributed across the globe and show a large diversity of ecological niches. Furthermore, taxonomic classification of Drosophila includes the rank radiation, which refers to closely related species groups. Nevertheless, it has never been tested if these taxonomic radiations correspond to evolutionary radiations. Here we present a study of the patterns of diversification of Drosophila to test for increased diversification rates in relation to the geographic and ecological diversification processes. For this, we have estimated and dated a phylogeny of 218 species belonging to the major species groups of the subgenus. The obtained phylogenies are largely consistent with previous studies and indicate that the major groups appeared during the Oligocene/Miocene transition or early Miocene, characterized by a trend of climate warming with brief periods of glaciation. Ancestral reconstruction of geographic ranges and ecological resource use suggest at least two dispersals to the Neotropics from the ancestral Asiatic tropical disribution, and several transitions to specialized ecological resource use (mycophagous and cactophilic. Colonisation of new geographic regions and/or of new ecological resources can result in rapid species diversification into the new ecological niches available. However, diversification analyses show no significant support for adaptive radiations as a result of geographic dispersal or ecological resource shift. Also, cactophily has not resulted in an increase in the diversification rate of the repleta and related groups. It is thus concluded that the taxonomic radiations do not correspond to adaptive radiations.

  11. ALGUNOS ASPECTOS ESENCIALES DEL PENSAMIENTO DE JEAN WATSON Y SU TEORÍA DE CUIDADOS TRANSPERSONALES

    OpenAIRE

    Urra M,Eugenia; Jana A,Alejandra; García V,Marcela

    2011-01-01

    En este trabajo se realiza una síntesis del pensamiento de Jean Watson a partir de dos perspectivas fundamentales a saber: su filosofía de cuidados y su teoría de cuidados transpersonales. El análisis se centra, por una parte, en los fundamentos filosóficos del cuidado que derivan del existencialismo y de la teoría de la alteridad levin-asiana y, por otra, en los 10 factores de cuidado que caracterizan su teoría. El artículo además rescata aspectos de la utilización de su teoría de cuidados e...

  12. End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

    Directory of Open Access Journals (Sweden)

    Gerry Joseph Nagtzaam

    2014-03-01

    Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

  13. Comparing the Concept of Caring in Islamic Perspective with Watson and Parse's Nursing Theories.

    Science.gov (United States)

    Sadat-Hoseini, Akram-Sadat; Khosropanah, Abdoul-Hosein

    2017-01-01

    In the nursing profession, it is apparent that the definition of caring differs between various perspectives. This article compares the difference of caring in Islamic with the Parse and Watson theories. In this study, we use concept analyses of Walker-Avants and compare research methods. Material used is all Islamic documents. According to Islamic documents, there are four major types of caring, namely, (1) God taking care of humans, (2) Humans taking care of themselves, (3) Other humans taking care of humans, and (4) The universe taking care of humans and vice versa. God caring for humans affects the three other types of caring. All three definitions of caring have humanistic and holistic view. According to Watson's and Parse's definition, the development of the caring theory is based on the person's experiences that result from human interactions with, and experiences of, their environment. In Islamic definition, although the caring process is affected by environmental experiences and interactions, human not developed only base the effect of environment; rather, it is developed on the basis of human nature and divine commands. God taking care of humans is specific to Islamic perspective and is not found in other definitions. Islamic perspective maintains that God is the creator of humanity and is in charge of guiding humans. A superior form of human can always be discovered. Thus, nursing implementation in Muslims must be done based on Islamic commands, and Islamic commands are superior to human experiences. However, Islamic commands interpreted with human wisdom and thought can be striving toward excellence.

  14. Morpholino oligonucleotides do not participate perfectly in standard Watson-Crick complexes with RNA.

    Science.gov (United States)

    Xiao, Gaoping; Wesolowski, Donna; Izadjoo, Mina; Altman, Sidney

    2010-11-01

    RNase P from E. coli will cleave a RNA at a site designated in a complex with an external guide sequence (EGS). The location of the site is determined by the Watson-Crick complementary sequence that can be formed between the RNA and the EGS. Morpholino oligonucleotides (PMOs) that have the same base sequences as any particular EGS will not direct cleavage by RNase P of the target RNA at the expected site in three mRNAs. Instead, cleavage occurs at a secondary site that does not correspond exactly to the expected Watson-Crick sequence in the PMO. This cleavage in the mRNA for a drug resistance gene, CAT mRNA, is at least second order in the concentration of the PMOs, but the mechanism is not understood yet and might be more complicated than a simple second-order reaction. EGSs and PMOs inhibit the reactions of each other effectively in a competitive fashion. A basic peptide attached to the PMO (PPMO) is more effective because of its binding properties to the mRNA as a substrate. However, a PMO is just as efficient as a PPMO on a mRNA that is mutated so that the canonical W-C site has been altered. The altered mRNA is not recognizable by effective extensive W-C pairing to an EGS or PMO. The complex of a PMO on a mutated mRNA as a substrate shows that the dimensions of the modified oligonucleotide cannot be the same as a naked piece of single-stranded RNA.

  15. Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

  16. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  17. Comparison of bioimpedance spectroscopy and the Watson formula for measuring body volume in patients on peritoneal dialysis

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusions: There are significant differences in the V of PD Unit patients when obtained by Watson formula or by BIS. A difference between the measurements is associated with the presence of DM, HTN, hypoalbuminaemia, obesity, malnutrition, inflammation, E/I ratio ≥1 and the absence of residual diuresis.

  18. Microbiological and Pharmacological Evaluation of the Micropropagated Rubus liebmannii Medicinal Plant

    Directory of Open Access Journals (Sweden)

    Adelina Jiménez-Arellanes

    2012-01-01

    Full Text Available Rubus liebmannii is an endemic species from Mexico used in traditional medicine primarily to treat dysentery and cough. The in vitro activity against Giardia lamblia and Entamoeba histolytica that produces the ethanolic extract of the aerial parts of the plant led us to expand the pharmacological and phytochemical research of this species. Gastrointestinal disorders including amebiasis remain one of the health problems that need to be addressed and it is of interest to find alternatives that improve their treatment. Also, it is important to emphasize that R. liebmannii grows wild in the country and is not found in abundance; therefore, alternatives that avoid overexploitation of the natural resource are mandatory. Ongoing with the evaluation of the potentialities that R. liebmannii possesses for treating infectious gastrointestinal diseases, the aim of the present study was to evaluate the biological effects and the chemical composition of the micropropagated plant.

  19. Phytochemicals in blackberry/ Fitoquímicos em amora-preta (Rubus spp

    Directory of Open Access Journals (Sweden)

    Rui Carlos Zambiazi

    Full Text Available Among the options for fruit species with market prospects, the blackberry (Rubus spp stands out as one of the most promising. This is a species that has shown an increase of cultivated area in recent years in Rio Grande do Sul (main Brazilian producer. Regular consumption of fruits and vegetables is associated with low risk of incidence and mortality from cancer and heart disease due to the presence of compounds derived from secondary metabolism, especially flavonoids and anthocyanins, which have great capacity to react with free radicals that cause oxidative stress, and therefore contribute to the prevention of these diseases. The phenolic acids and flavonoids were identificated in the group of phenolic compounds in blackberry. Among the flavonoids, stands out the anthocyanins, which vary in concentration according to the stage of maturation of fruits. Based on the antocyanin content related in literature and the great variation between different genetic materials, there is great potential in the production of blackberry and its utilization as a natural colorant in the food and pharmaceuticals industry. In addition to these compounds, the blackberry also has other phytochemicals such as vitamin C, vitamin E and carotenoids. This paper aims to review literature of the main phytochemicals in blackberry (Rubus spp.Dentre as opções de espécies frutíferas com perspectivas de comercialização, a amoreira-preta (Rubus spp se destaca como uma das mais promissoras. Esta é uma das espécies que tem apresentado um crescimento de área cultivada nos últimos anos no Rio Grande do Sul (principal produtor brasileiro. O consumo regular de frutas e hortaliças está associado com o baixo risco de incidência e mortalidade por câncer e doenças cardíacas, devido à presença de compostos oriundos do metabolismo secundário, especialmente flavonóides e antocianinas, os quais apresentam grande capacidade de reagir com radicais livres que causam estresse

  20. Microbiological and Pharmacological Evaluation of the Micropropagated Rubus liebmannii Medicinal Plant

    Science.gov (United States)

    Jiménez-Arellanes, Adelina; Cornejo-Garrido, Jorge; Rojas-Bribiesca, Gabriela; Nicasio-Torres, María del Pilar; Said-Fernández, Salvador; Mata-Cárdenas, Benito David; Molina-Salinas, Gloria María; Tortoriello, Jaime; Meckes-Fischer, Mariana

    2012-01-01

    Rubus liebmannii is an endemic species from Mexico used in traditional medicine primarily to treat dysentery and cough. The in vitro activity against Giardia lamblia and Entamoeba histolytica that produces the ethanolic extract of the aerial parts of the plant led us to expand the pharmacological and phytochemical research of this species. Gastrointestinal disorders including amebiasis remain one of the health problems that need to be addressed and it is of interest to find alternatives that improve their treatment. Also, it is important to emphasize that R. liebmannii grows wild in the country and is not found in abundance; therefore, alternatives that avoid overexploitation of the natural resource are mandatory. Ongoing with the evaluation of the potentialities that R. liebmannii possesses for treating infectious gastrointestinal diseases, the aim of the present study was to evaluate the biological effects and the chemical composition of the micropropagated plant. PMID:22966243

  1. Chiral resolution and bioactivity of enantiomeric benzofuran neolignans from the fruit of Rubus ideaus L.

    Science.gov (United States)

    Zhou, Le; Xi, Yu-Fei; Wang, Wei; Lin, Bin; Wang, Xiao-Bo; Huang, Xiao-Xiao; Song, Shao-Jiang

    2018-01-31

    Rubus ideaus L., a member of the Rosaceae family, is popular for its distinctive flavor and attractive red color. In order to explore the functional factors possibly presented in the fruit, seven new benzofuran neolignans (1a/1b-3a/3b and 4b), together with one known neolignan 4a, were isolated from the fruit of R. ideaus. Compounds 1a/1b-4a/4b as four pairs of enantiomers were separated on a chiral chromatographic column. Their structures including absolute configurations were elucidated by extensive spectroscopic data analyses, including UV, IR, HRESIMS, NMR, and comparing their experimental electronic circular dichroism (ECD) spectra with calculated ECD spectra. Additionally, all these enantiomeric compounds were evaluated for their antioxidant, neuroprotective, and anti-Aβ 1-42 aggregation activities. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. The influence of biodegradable mulches on the yielding of autumn raspberry (Rubus idaeus L.

    Directory of Open Access Journals (Sweden)

    Król-Dyrek Katarzyna

    2015-06-01

    Full Text Available A three-year experiment was set up to assess the effect of three mulch types on the growth and yield of ‘Polka’ autumn fruiting raspberry (Rubus idaeus L.. The experimental arrangement comprised four combinations of two parallel blocks, one of which was a field crop and the second was a covered crop in the form of a high tunnel with raised beds sides. The crop was grown on raised beds (approximately 30 cm high covered with a mulch made of: 1 polypropylene non-woven (PP; 2 PP with a photodegradant; 3 polylactide nonwoven (PLA. A crop on a raised bed without any mulch was the control. Biometric, physiological and yield parameters were assessed and included the number of canes, plant height, chlorophyll content in the leaves, fruit yield, weight of 20 fruits and the extract content.

  3. Saccharomyces cerevisiae Mixed Culture of Blackberry (Rubus ulmifolius L. Juice: Synergism in the Aroma Compounds Production

    Directory of Open Access Journals (Sweden)

    Pedro Ulises Bautista-Rosales

    2014-01-01

    Full Text Available Blackberry (Rubus sp. juice was fermented using four different strains of Saccharomyces cerevisiae (Vitilevure-CM4457, Enoferm-T306, ICV-K1, and Greroche Rhona-L3574 recognized because of their use in the wine industry. A medium alcoholic graduation spirit (<6GL° with potential to be produced at an industrial scale was obtained. Alcoholic fermentations were performed at 28C°, 200 rpm, and noncontrolled pH. The synergistic effect on the aromatic compounds production during fermentation in mixed culture was compared with those obtained by monoculture and physic mixture of spirits produced in monoculture. The aromatic composition was determined by HS-SPME-GC. The differences in aromatic profile principally rely on the proportions in aromatic compounds and not on the number of those compounds. The multivariance analysis, principal component analysis (PCA, and factorial discriminant analysis (DFA permit to demonstrate the synergism between the strains.

  4. Screening of antibacterial activity of raspberry (Rubus idaeus L. fruit and pomace extracts

    Directory of Open Access Journals (Sweden)

    Velićanski Aleksandra S.

    2012-01-01

    Full Text Available Antibacterial activity of fruit and pomace extracts (concentration 50 mg/ml of two raspberry (Rubus idaeus L. cultivars (Meeker and Willamette was tested against selected Gram-positive and Gram-negative bacteria (reference and wild strains. Disc diffusion method with 15 μl of extracts and agar-well diffusion method with 50 and 100 μl were used. Antibiotic (cefotaxime/clavulanic acid was used as a control. Both raspberry fruit extracts showed the strongest antibacterial activity against Pseudomonas aeruginosa (wild strain and Bacillus cereus, where the largest clear zones (without growth appeared. Escherichia coli was the most resistant strain, with only zone of reduced growth. The highest antibacterial activity of pomace extracts was against Staphylococcus aureus and Staphylococcus saprophyticus. There were no differences in the antibacterial activity between cultivars for both fruit and pomace extracts. [Projekat Ministarstva nauke Republike Srbije, br. TR 31044

  5. Ellagic acid derivatives from Rubus ulmifolius inhibit Staphylococcus aureus biofilm formation and improve response to antibiotics.

    Directory of Open Access Journals (Sweden)

    Cassandra L Quave

    Full Text Available Biofilms contribute to the pathogenesis of many forms of Staphylococcus aureus infection. Treatment of these infections is complicated by intrinsic resistance to conventional antibiotics, thus creating an urgent need for strategies that can be used for the prevention and treatment of biofilm-associated infections.This study demonstrates that a botanical natural product composition (220D-F2 rich in ellagic acid and its derivatives can limit S. aureus biofilm formation to a degree that can be correlated with increased antibiotic susceptibility. The source of this composition is Rubus ulmifolius Schott. (Rosaceae, a plant used in complementary and alternative medicine in southern Italy for the treatment of skin and soft tissue infections. All S. aureus clonal lineages tested exhibited a reduced capacity to form a biofilm at 220D-F2 concentrations ranging from 50-200 µg/mL, which were well below the concentrations required to limit bacterial growth (530-1040 µg/mL. This limitation was therapeutically relevant in that inclusion of 220D-F2 resulted in enhanced susceptibility to the functionally-distinct antibiotics daptomycin, clindamycin and oxacillin. Testing with kidney and liver cell lines also demonstrated a lack of host cell cytotoxicity at concentrations of 220D-F2 required to achieve these effects.These results demonstrate that extract 220D-F2 from the root of Rubus ulmifolius can be used to inhibit S. aureus biofilm formation to a degree that can be correlated with increased antibiotic susceptibility without toxic effects on normal mammalian cells. Hence, 220D-F2 is a strong candidate for development as a botanical drug for use in the prevention and treatment of S. aureus biofilm-associated infections.

  6. Traditional herbal drugs of southern Uganda. Part III: isolation and methods for physical characterization of bioactive alkanols from Rubus apetalus.

    Science.gov (United States)

    Hamill, F A; Apio, S; Mubiru, N K; Mosango, M; Bukenya-Ziraba, R; Maganyi, O W; Soejarto, D D

    2003-07-01

    The East African plant Rubus apetalus Poir. was collected as a component of an ethnobotanical survey in southern Uganda. No phytochemical investigations of this plant have been found in the literature. Preliminary antimicrobial susceptibility tests performed in Uganda indicated biological activity against several bacterial and one fungal human pathogen. Bulk re-collection of Rubus apetalus was accomplished and crude extraction performed in preparation for further testing. Two chemical fractions of the crude extract were active in the antimicrobial susceptibility assay. Fractionation of one of the active crude fractions led to the isolation and elucidation of a mixture of related compounds that exhibit antimicrobial activity against Staphylococcus aureus (MIC=62 microg/ml), Streptococcus faecalis (16 microg/ml) and Candida albicans (32 microg/ml).

  7. Two new species of the acifer species group of Polypedilum subgenus Tripodura Townes from China (Diptera: Chironomidae).

    Science.gov (United States)

    Zhang, Ruilei; Song, Chao; Wang, Liqing; Wang, Xinhua

    2015-02-13

    Polypedilum (Tripodura) falcatum sp. n. and P. (T.) procerum sp. n. of the acifer species group of Polypedilum subgenus Tripodura Townes are described and illustrated as male imagines from China. The male adult of P. (T.) falcatum sp. n. is distinguished by the presence of two faint markings on wing; short and interrupted abdominal tergite bands; the sickle-like superior volsella bearing 0-2 outer setae and a tuft of short setae on its apex. The male adult of P. (T.) procerum sp. n. differs in having short abdominal tergite bands; a long, slender and apically curved superior volsella; a high fore leg ratio (2.30-2.33). A key to known male imagines of Polypedilum subgenus Tripodura from China is presented.

  8. Purification of a water extract of Chinese sweet tea plant (Rubus suavissimus S. Lee) by alcohol precipitation

    OpenAIRE

    Koh, Gar Yee; Chou, Guixin; Liu, Zhijun

    2009-01-01

    The aqueous extraction process of the leaves of Rubus suavissimus often brings in a large amount of non-active polysaccharides as part of the constituents. To purify this water extract for potential elevated bioactivity, alcohol precipitation (AP) consisting of gradient regimens was applied, and its resultants were examined through colorimetric and HPLC analyses. AP was effective in partitioning the aqueous crude extract into a soluble supernatant and an insoluble precipitant, and its effect ...

  9. LICOR DE MORA DE CASTILLA (Rubus glaucus Benth CON DIFERENTES PORCENTAJES DE PULPA BLACKBERRY LIQUOR (Rubus glaucus Benth WITH DIFFERENT PULP PERCENTAGES

    Directory of Open Access Journals (Sweden)

    Álvaro Montoya Gómez

    2005-12-01

    Full Text Available La mora de Castilla (Rubus glaucus Benth es una fruta de interés comercial y altamente perecedera, que presenta deterioro debido a su fragilidad e inadecuado manejo poscosecha, cantidades apreciables de fruta son afectadas, básicamente en sus características físicas, siendo este producto apto para el procesamiento industrial. Veinte kg de mora fueron despulpados, homogenizados y caracterizada la pulpa, determinando; grados brix de 6,0; porcentaje de acidez de 2,91 % y densidad de 0,991 g/ml en promedio. Se formularon licores, con una participación de la pulpa del 25 %, 30 %, 35 %, 40 %, 45 %, 50 % y 55 % iniciando con 35 °Brix, para todos los casos en el mosto fermentable, ajustando las formulaciones con sacarosa; la levadura inoculada fue Saccharomyces cerevisiae Meyen ex E.C. Hansen en concentración del 0,2 %; la fermentación se llevó a cabo en reactores con capacidad de 2 litros, con desfogue de manguera de látex, el mosto fermentable fue dejado en los reactores durante 20 semanas, luego los licores fueron filtrados y caracterizados físico-químicamente, evaluando el porcentaje de alcohol por destilación, encontrando que el porcentaje de 40 % de participación de pulpa, fue el de mayor concentración con 8,36 % de volumen de alcohol en promedio. Los resultados estadísticos mostraron una diferencia significativa entre los porcentajes de participación de pulpa y su influencia sobre la producción de alcohol para los valores de 25 % y 30 % con respecto a los porcentajes 35 %, 40 %, 45 %, 50 % y 55 %. Un modelo matemático lineal apropiado para la producción de alcohol en función de la participación de pulpa fue obtenido. La prueba sensorial con 10 jueces, mostró que el licor preparado con 35 % de participación de pulpa, fue el de mayor aceptación.The blackberry (Rubus glaucus Benth is a fruit of commercial interest that is highly perishable, showing appreciable damage due to fragileness and inadequate pos-harvesting handling

  10. Phylogeography, population structure and evolution of coral-eating butterflyfishes (Family Chaetodontidae, genus Chaetodon , subgenus Corallochaetodon )

    KAUST Repository

    Waldrop, Ellen

    2016-01-11

    Aim This study compares the phylogeography, population structure and evolution of four butterflyfish species in the Chaetodon subgenus Corallochaetodon, with two widespread species (Indian Ocean – C. trifasciatus and Pacific Ocean – C. lunulatus), and two species that are largely restricted to the Red Sea (C. austriacus) and north-western (NW) Indian Ocean (C. melapterus). Through extensive geographical coverage of these taxa, we seek to resolve patterns of genetic diversity within and between closely related butterflyfish species in order to illuminate biogeographical and evolutionary processes. Location Red Sea, Indian Ocean and Pacific Ocean. Methods A total of 632 individuals from 24 locations throughout the geographical ranges of all four members of the subgenus Corallochaetodon were sequenced using a 605 bp fragment (cytochrome b) of mtDNA. In addition, 10 microsatellite loci were used to assess population structure in the two widespread species. Results Phylogenetic reconstruction indicates that the Pacific Ocean C. lunulatus diverged from the Indian Ocean C. trifasciatus approximately 3 Ma, while C. melapterus and C. austriacus comprise a cluster of shared haplotypes derived from C. trifasciatus within the last 0.75 Myr. The Pacific C. lunulatus had significant population structure at peripheral locations on the eastern edge of its range (French Polynesia, Johnston Atoll, Hawai\\'i), and a strong break between two ecoregions of the Hawaiian Archipelago. The Indian Ocean C. trifasciatus showed significant structure only at the Chagos Archipelago in the central Indian Ocean, and the two range-restricted species showed no population structure but evidence of recent population expansion. Main conclusions Patterns of endemism and genetic diversity in Corallochaetodon butterflyfishes have been shaped by (1) Plio-Pleistocene sea level changes that facilitated evolutionary divergences at biogeographical barriers between Indian and Pacific Oceans, and the Indian

  11. First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

    Science.gov (United States)

    Charlton, Bruce G

    2008-01-01

    In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

  12. Applications of the Galton-Watson process to human DNA evolution and demography

    CERN Document Server

    Neves, A G M

    2005-01-01

    We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

  13. Laparoscopic Watson Fundoplication Is Effective and Durable in Children with Gastrooesophageal Reflux

    Directory of Open Access Journals (Sweden)

    Matthew G. Dunckley

    2014-01-01

    Full Text Available Gastroesophageal reflux (GOR affects 2–8% of children over 3 years of age and is associated with significant morbidity. The disorder is particularly critical in neurologically impaired children, who have a high risk of aspiration. Traditionally, the surgical antireflux procedure of choice has been Nissen’s operation. However, this technique has a significant incidence of mechanical complications and has a reoperation rate of approximately 7%, leading to the development of alternative approaches. Watson’s technique of partial anterior fundoplication has been shown to achieve long-lasting reflux control in adults with few mechanical complications, but there is limited data in the paediatric population. We present here short- and long-term outcomes of laparoscopic Watson fundoplication in a series of 76 children and infants, 34% of whom had a degree of neurological impairment including severe cerebral palsy and hypoxic brain injury. The overall complication rate was 27.6%, of which only 1 was classified as major. To date, we have not recorded any incidences of perforation and no revisions. In our experience, Watson’s laparoscopic partial fundoplication can be performed with minimal complications and with durable results, not least in neurologically compromised children, making it a viable alternative to the Nissen procedure in paediatric surgery.

  14. The complex gastrointestinal patient and Jean Watson's Theory of Caring in nutrition support.

    Science.gov (United States)

    Childs, Anne

    2006-01-01

    The care of the patient with gastrointestinal disease is complex and challenging. The reasons for the complexity are varied and different for each patient. Any of these variables can affect the nutritional health of the patient, an essential element of care that supports healing, recovery, and improved quality of life. A nutritional assessment, an evaluation of the patient's nutritional status, can be used to establish the patient's weight history, dietary habits, tolerances, and likes and dislikes. Intake and output values from this assessment provide information relating to the patient's ability to meet his or her nutritional requirements orally or whether alternate methods for nutrition support need be considered, such as a feeding tube or a central intravenous catheter. Parenteral nutrition is the intravenous nutrition supplementation required when the oral or enteral route for nutrition support is unavailable or impossible. In this article, a clinical case scenario for a 34-year-old man with a history of cancer and an extensive bowel resection will be presented to better explore the decision-making process for determining appropriate nutrition support. In addition, various issues the health practitioner needs to consider when managing the nutritional health of the complex gastrointestinal patient will be explored, relative to Jean Watson's Theory of Caring.

  15. Case of the missing fingerprints or Dr. Watson's cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Longair, M.S.

    1987-01-01

    The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

  16. Illustrating microorganisms: Sir William Watson Cheyne (1852-1932) and bacteriology.

    Science.gov (United States)

    Coutts, Jane

    2016-11-01

    Sir William Watson Cheyne is largely known to medical history as Lord Lister's 'trusted assistant'.1 He spent a lifetime defending Joseph Lister's (1827-1912) antiseptic principle in the wake of scepticism and misunderstanding. However, his main contribution to Lister's work was in the embryonic field of bacteriology in the 1870s-1890s, which brought him into contact with continental researchers, particularly Robert Koch (1843-1910). In this field, Cheyne built an independent reputation as an assessor, chronicler and promoter of continental laboratory methodology. He pioneered bacteriological training in British teaching hospitals and incorporated laboratory testing into case notes as standard procedure. This paper reconsiders Cheyne's contribution to the development of bacteriology in British medicine at the end of the 19th century. It examines his motives in promoting new laboratory techniques and the methods he used to embed them in hospital procedure. It also considers how he continued to use bacteriological arguments to keep the Listerian antiseptic principle on the medical agenda well after Lister withdrew from active involvement in the field. © The Author(s) 2015.

  17. Systematics and biology of Xylocopa subgenus Schonnherria (Hymenoptera, Apidae) in Argentina

    Science.gov (United States)

    Lucia, Mariano; Gonzalez, Victor H.; Abrahamovich, Alberto H.

    2015-01-01

    Abstract Biological information on the species of the large carpenter bee Xylocopa subgenus Schonnherria occurring in Argentina is revised. Based on the appraisal of museum specimens, the study of type material, and field surveys conducted across 15 provinces between 2007 and 2011, the following seven species are recognized for the country: Xylocopa bambusae Schrottky, Xylocopa chrysopoda Schrottky, Xylocopa macrops Lepeletier de Saint Fargeau, Xylocopa simillima Smith Xylocopa splendidula Lepeletier de Saint Fargeau, Xylocopa pulchra Smith, and Xylocopa viridis Smith. Previous literature records of Xylocopa dimidiata Latreille, Xylocopa subcyanea Pérez, and Xylocopa varians Smith for the province of Misiones appear to have been misidentified specimens, although the presence of these species in Argentina cannot be entirely ruled out given the proximity of this province to Brazil and Paraguay where they occur; Xylocopa boops Maidl was described from a male specimen with unusually enlarged eyes and is newly synonymized under Xylocopa macrops. Males and females of all species are diagnosed, described, and figured, including details of the male genitalia. Taxonomic comments, data on the geographical distribution and nesting substrates, and identification keys to all Argentinean species of Schonnherria are provided. The nesting biologies of Xylocopa splendidula and Xylocopa viridis are documented. PMID:26798288

  18. Developmental and ultrastructural characters of the pollen grains and tapetum in species of Nymphaea subgenus Hydrocallis.

    Science.gov (United States)

    Zini, Lucía Melisa; Galati, Beatriz Gloria; Zarlavsky, Gabriela; Ferrucci, María Silvia

    2017-07-01

    Variations in pollen characters and tapetum behavior were recently acknowledged in the early-divergent family Nymphaeaceae and even within the genus Nymphaea, which probably is not monophyletic; some traits such as infratectum and tapetum type are also a matter of different interpretations. In this study, developmental characters of the pollen grains and tapetum in Nymphaea subgenus Hydrocallis are provided for the first time. Observations were made in N. amazonum, N. gardneriana, and N. prolifera using light, scanning, and transmission electron microscopy. Tapetum is of the secretory type and produces orbicules. At microspore and pollen grain stages, the distal and proximal walls differ considerably. This result supports the operculate condition of the aperture in Hydrocallis, and such aperture might be plesiomorphic for Nymphaeoideae. The infratectum is intermediate, composed of inter-columellae granular elements, robust columellae consisting of agglomerated granules, complete columellae, and fused columellae. Narrow microchannels are present and persist until the mature pollen grain stage. The membranous granular layer is often present in the pollen grains of Nymphaeaceae. In N. gardneriana, this layer is most probably a component of the intine because it is lost after acetolysis. Orbicules in the Nymphaeaceae are characterized as spherical or subspherical, with a smooth sporopolleninic wall that surrounds an electron-lucent core and with individual orbicules that usually merge to give irregular aggregations. The aperture, pollen wall ultrastructure, and the tapetum of the studied species are discussed in an evolutionary and systematic context, and these characters are also compared with those of other angiosperm lineages.

  19. A review of the orientalis group of the Otostigmus subgenus Otostigmus Porat, 1876 (Chilopoda: Scolopendromorpha: Scolopendridae).

    Science.gov (United States)

    Lewis, John G E

    2014-12-02

    The Otostigmus subgenus Otostigmus, which currently comprises 58 species, was subdivided by Lewis (2010a) into nine species groups based on Attems' (1930a) monograph. The orientalis group comprising 19 species and two subspecies is the subject of this paper. In most cases, the type material is redescribed and variation discussed. The following species are valid: O. ateles Chamberlin, 1920, O. australianus Attems, 1930, O. brevidentatus Verhoeff, 1937, O. foveolatus Verhoeff, 1937, O. kashmiranus Lewis, 1992, O. metallicus Haase, 1887, O. multidens multidens Haase, 1887, O. oatesi Kraepelin, 1903, O. orientalis Porat, 1876, O. ruficeps Pocock, 1890, and O. striolatus Verhoeff, 1937. O. seychellarum Attems, 1900, is reinstated as a valid species and O. niasensis Silvestri, 1895, and O. sucki Krae-pelin, 1903 which may be O. metallicus are regarded as valid pro tem. O. greggi Chamberlin, 1944, is a junior subjective synonym of O. astenus (Kohlrausch, 1881), and O. loriae Silvestri, 1895, and O. multidens carens Attems, 1938, junior subjective synonyms of O. multidens. O. loriae nordicus Schileyko, 1995, becomes O. multidens nordicus comb. nov. O. nemorensis Silvestri, 1895, O. poonamae Khanna & Tripathi, 1986, and O. telus Chamberlin, 1939, are nomina dubia. A key to the species is provided.

  20. The rediscovery of Passiflora kwangtungensis Merr. (subgenus Decaloba supersection Disemma: a critically endangered Chinese endemic

    Directory of Open Access Journals (Sweden)

    Shawn Krosnick

    2013-06-01

    Full Text Available Passiflora kwangtungensis is a critically endangered Chinese species known from Guangxi, Guangdong, and Jiangxi Provinces. The species belongs to Passiflora subgenus Decaloba, supersection Disemma, section Octandranthus. Field observations decreased rapidly during the 1970s to 1980s, and it was suspected that this species might have been extirpated due to repeated deforestation events throughout southern China. In recent years, however, small isolated populations of this species have been rediscovered in Hunan Province, representing new locality records for P. kwangtungensis. New herbarium collections, color photographs, and silica gel collections have provided an unexpected opportunity to examine the evolutionary significance of this species. The current study presents a revised morphological description of P. kwangtungensis based on fresh material, along with an updated distribution map. Using nrITS sequence data, preliminary insights into the phylogenetic position of P. kwangtungensis are presented. Molecular data support the placement of P. kwangtungensis within supersection Disemma section Octandranthus. However, the exact placement of P. kwangtungensis within this lineage is unclear. The nrITS data suggest that P. kwangtungensis may be sister to a clade containing Passiflora from China, Nepal, India, and Southeast Asia. Morphologically, P. kwangtungensis displays the most similarity P. geminiflora (Nepal, India and P. henryi (China. Lastly, conservation status and recommendations are made for P. kwangtungensis following the IUCN Red List Criteria, where this species is classified as CR C1+C2a(i; D.

  1. A sharp analysis on the asymptotic behavior of the Durbin-Watson statistic for the first-order autoregressive process

    OpenAIRE

    Bercu, Bernard; Proia, Frédéric

    2013-01-01

    International audience; The purpose of this paper is to provide a sharp analysis on the asymptotic behavior of the Durbin-Watson statistic. We focus our attention on the first-order autoregressive process where the driven noise is also given by a first-order autoregressive process. We establish the almost sure convergence and the asymptotic normality for both the least squares estimator of the unknown parameter of the autoregressive process as well as for the serial correlation estimator asso...

  2. The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

    Directory of Open Access Journals (Sweden)

    Mei-Yu LEE

    2014-11-01

    Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

  3. Preparation of a glucan from the roots of Rubus crataegifolius Bge. and its immunological activity.

    Science.gov (United States)

    Ni, Weihua; Zhang, Xu; Bi, Hongtao; Iteku, Jeff; Ji, Li; Sun, Chengxin; Fang, Jinbo; Tai, Guihua; Zhou, Yifa; Zhao, Jimin

    2009-12-14

    A water-soluble glucan (RCP-1) was prepared from the roots of Rubus crataegifolius Bge. by extraction with hot-water, deproteination by Sevag reagent, alpha-amylase treatment and ultrafiltration. RCP-1 consisted of only glucose, and its molecular weight was determined to be approximately 7KD by high performance gel permeation chromatography (HPGPC). Fourier transform infra-red spectroscopy (FT-IR), nuclear magnetic resonance spectroscopy (NMR), methylation and periodate oxidation analyses indicated that RCP-1 was an alpha-d-glucan. Its main chains were composed of (1-->4)- and (1-->6)-linked alpha-glucopyranosyls, and side chains were single alpha-glucopyranosyl residues attached to the O-6 of glucosyls in the main chains. RCP-1 could increase both cytotoxic activity against B16 melanoma cells and the production of nitric oxide (NO) of macrophages in vitro. Furthermore, in vivo bioassay tests indicated that RCP-1 could remarkably enhance T and B lymphocyte proliferations, augment the phagocytosis of macrophages and increase the tumour necrosis factor-alpha (TNF-alpha) levels in serum.

  4. Quantitative and fingerprint analyses of Chinese sweet tea plant ( Rubus suavissimus S. Lee).

    Science.gov (United States)

    Chou, Guixin; Xu, Shun-Jun; Liu, Dong; Koh, Gar Yee; Zhang, Jian; Liu, Zhijun

    2009-02-11

    The quality of botanical food is increasingly assessed by the content of multiple bioactive compounds. This study reports, for the first time, an HPLC fingerprinting method for the quality evaluation of Rubus suavissimus leaves possessing multiple bioactivities. Five constituents, gallic acid, rutin, ellagic acid, rubusoside, and steviol monoside, were quantified and used in developing qualitative chromatographic fingerprints. The limits of detection and quantification ranged from 0.29 to 37.86 mug/mL. The relative standard deviations (RSDs) of intra- and interday precisions were no more than 3.14 and 3.01%, respectively. The average recoveries were between 93.1 and 97.5%. The developed method was validated in the analysis 14 leaf samples with satisfactory results. The contents of the five marker compounds accounted for an average of about 6% w/w with a variability of 16% among the 14 samples collected from a single site and year. Gallic acid was the least, whereas steviol monoside the most, variable compound among the 14 leaf samples. The characteristic compound rubusoside that is responsible for the sweet taste accounted for 5% of leaf weight. The validated method can now be used to quantitatively and qualitatively assess the quality of R. suavissimus leaves as traditional beverage or potential medicines.

  5. Chemical composition and biological activities of the essential oil from Rubus pungens var. oldhamii.

    Science.gov (United States)

    Zhang, Yaojie; Chen, Jiajing; Wang, Lizhi; Cao, Jingjing; Xu, Lishan

    2017-06-01

    This paper presents a study on chemical composition, antimicrobial, antioxidant and tyrosinase inhibitory properties of the essential oil from leaves of Rubus pungens var. oldhamii (REO). The major component of the REO is sesquiterpenes (36.04%), which consists of 1,5-Cyclooctadiene,3-(1-me thylallyl)-(8CI)(17.66%), 5,6-Diethenyl-1-methylcyclohexene (12%), (+) - γ-Elemene (10.48%) and β-Caryophyllene (8.39%).The REO is shown to be moderately active against Staphylococcus aureus, Aspergillus niger and Penicillium glaucum, and has weak antioxidant activity in 1,1-diphenyl-2-picrylhydrazyl (DPPH) assay. Furthermore, tyrosinase inhibition was investigated against monophenolase (L-tyrosine). IC 50 values of REO and arbutin were found 0.923 and 0.657 mg/mL, respectively. The REO exerted potential antityrosinase activity. Our test results indicated that the REO was rich in sesquiterpenes, and also exhibited good antityrosinase activity, and moderate antimicrobial activity against pathogenic micro-organisms. The REO can be used as a natural source of promising antimicrobial and tyrosinase inhibiting agent.

  6. Quality baseline of the castilla blackberry (Rubus glaucus in its food chain

    Directory of Open Access Journals (Sweden)

    Fernanda Iza

    2016-09-01

    Full Text Available A proposal for improvement in the performance of the food chain of castilla blackberry (Rubus glaucus in order to potentiate their productivity can only start from a baseline or situational diagnosis of the quality of the fruit and hence identify the main points of improvement. The food chain of the fruit identifies three stages, harvest, post-harvest (storage and transport and marketing or sale. The diagnosis in each stage began with reverse mode. It was identified the most representative producer and the supplying for traders to the point of sale. The quality evaluation of the fruit was performed through chemical and physical characterization in the four stages. Weight loss or losses were evident in all stages, light no significant changes of color from bright red bluish hue in the collection stage until opaque bluish red or off, at the stage of sale due to the short cycle time and the characteristics non-climacteric fruit. However, at all stages of collection, storage, transportation and sale, they presented significant changes in the indices of maturity which meant an increase of sugars, decreased of pH, and increase acidity. The results indicate that the fruit changed its physicochemical characteristics during the stages of the food chain affecting its productivity.

  7. Phenolic extracts of Rubus ulmifolius Schott flowers: characterization, microencapsulation and incorporation into yogurts as nutraceutical sources.

    Science.gov (United States)

    Martins, Ana; Barros, Lillian; Carvalho, Ana Maria; Santos-Buelga, Celestino; Fernandes, Isabel P; Barreiro, Filomena; Ferreira, Isabel C F R

    2014-06-01

    Rubus ulmifolius Schott (Rosaceae), known as wild blackberry, is a perennial shrub found in wild and cultivated habitats in Europe, Asia and North Africa. Traditionally, it is used for homemade remedies because of its medicinal properties, including antioxidant activity. In the present work, phenolic extracts of R. ulmifolius flower buds obtained by decoction and hydroalcoholic extraction were chemically and biologically characterized. Several phenolic compounds were identified in both decoction and hydroalcoholic extracts of flowers, ellagitannin derivatives being the most abundant ones, namely the sanguiin H-10 isomer and lambertianin. Additionally, comparing with the decoction form, the hydroalcoholic extract presented both higher phenolic content and antioxidant activity. The hydroalcoholic extract was thereafter microencapsulated in an alginate-based matrix and incorporated into a yogurt to achieve antioxidant benefits. In what concerns the performed incorporation tests, the obtained results pointed out that, among the tested samples, the yoghurt containing the microencapsulated extract presented a slightly higher antioxidant activity, and that both forms (free and microencapsulated extracts) gave rise to products with higher activity than the control. In conclusion, this study demonstrated the antioxidant potential of the R. ulmifolius hydroalcoholic extract and the effectiveness of the microencapsulation technique used for its preservation, thus opening new prospects for the exploitation of these natural phenolic extracts in food applications.

  8. A blackberry (Rubus L.) expressed sequence tag library for the development of simple sequence repeat markers.

    Science.gov (United States)

    Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P

    2008-06-20

    The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST) library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR), and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry.

  9. Cloning and characterization of cinnamate-4-hydroxylase gene from Rubus occidentalis L

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eun Mi; Lee, Seung Sik; An, Byung Chull; Barampuram, Shyamkuma; Kim, Jae Sung; Chung, Byung Yeoup [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Cho, Jae Young [Dept. of Applied Life Sciences, Chonbuk National University, Jeonju (Korea, Republic of); Lee, In Chul [Senior Industry Cluster Agency, Youngdong University, Youngdong (Korea, Republic of)

    2008-08-15

    Cinnamate-4-hydroxylase (C4H) is a key enzyme of phenylpropanoid pathway, which leads a variety of secondary metabolites to participate in differentiation and protection of plant against environmental stresses. In this study, we isolated a full-length cDNA of the C4H gene from a black raspberry (Rubus occidentalis L.), using a reverse transcriptase-PCR and rapid amplification of the cDNA ends (RACE)-PCR. The full-length cDNA of the RocC4H gene contained a 1,515 bp open reading frame (ORF) encoding a 504 amino acid protein with a calculated molecular weight of about 57.9 kDa and an isoelectric point (pI) value of 9.1. The genomic DNA analysis revealed that RocC4H gene had three exons and two introns. By multiple sequence alignment, RocC4H protein was highly homologous with other plant C4Hs, and the cytochrome P450-featured motifs, such as the heme-binding domain, the T-containing binding pocket motif (AAIETT), the ERR triad, and the tetrapeptide (PPGP) hinge motif, were highly conserved. Southern blot analysis revealed that RocC4H is a single copy gene in R. occidentalis.

  10. Antiviral Effects of Black Raspberry (Rubus coreanus Seed and Its Gallic Acid against Influenza Virus Infection

    Directory of Open Access Journals (Sweden)

    Ji-Hye Lee

    2016-06-01

    Full Text Available Influenza is a serious public health concern worldwide, as it causes significant morbidity and mortality. The emergence of drug-resistant viral strains requires new approaches for the treatment of influenza. In this study, Rubus coreanus seed (RCS that is left over from the production of wine or juice was found to show antiviral activities against influenza type A and B viruses. Using the time-of-addition plaque assay, viral replication was almost completely abolished by simultaneous treatment with the RCS fraction of less than a 1-kDa molecular weight (RCSF1. One of the polyphenols derived from RCSF1, gallic acid (GA, identified by liquid chromatography-tandem mass spectrometry, showed inhibitory effects against both influenza type A and B viruses, albeit at relatively high concentrations. RCSF1 was bound to hemagglutinin protein, inhibited hemagglutination significantly and disrupted viral particles, whereas GA was found to only disrupt the viral particles by using transmission electron microscopy. In BALB/c mice infected with influenza virus, oral administration of RCSF1 significantly improved the survival rate and reduced the viral titers in the lungs. Our results demonstrate that RCSF1 and GA show potent and broad antiviral activity against influenza A and B type viruses and are promising sources of agents that target virus particles.

  11. Rubus rosaefolius extract as a natural preservative candidate in topical formulations.

    Science.gov (United States)

    Ostrosky, Elissa Arantes; Marcondes, Elda Maria Cecilio; Nishikawa, Suzana de Oliveira; Lopes, Patricia Santos; Varca, Gustavo Henrique Costa; Pinto, Terezinha de Jesus Andreoli; Consiglieri, T Vladi Olga; Baby, Andre Rolim; Velasco, Maria Valéria Robles; Kaneko, Telma Mary

    2011-06-01

    Even though the synthetic preservatives may offer a high antimicrobial efficacy, they are commonly related to adverse reactions and regarded as having potentially harmful effects caused by chronic consumption. The development of natural preservatives provides a way of reducing the amount of synthetic preservatives normally used in pharmaceutical and cosmetic preparations. In addition, these agents have less toxic effects and represent a possible natural and safer alternative of the preservatives. The purpose of this research was to evaluate the Rubus rosaefolius Smith extract efficiency as a natural preservative in base formulations. Of the extract, 0.2% (w/w) was assayed for its effectiveness of antimicrobial protection in two different base formulations (emulsion and gel). The microbial challenge test was performed following the standard procedures proposed by The United States Pharmacopoeia 33nd, European Pharmacopoeia 6th, Japanese Pharmacopoeia 15th, and the Cosmetics, Toiletries, and Fragrance Association using standardized microorganisms. The results demonstrated that R. rosaefolius extract at the studied concentration reduced the bacterial inocula, satisfying the criterion in all formulations, even though it was not able to present an effective preservative behavior against fungi. Thus, the investigation of new natural substances with preservative properties that could be applied in pharmaceutical and cosmetic products is relevant due to the possibility of substituting or decreasing the concentration of synthetic preservatives, providing a way for the development of safer formulas for the use of consumers.

  12. Ultrasound as pretreatment to convective drying of Andean blackberry (Rubus glaucus Benth).

    Science.gov (United States)

    Romero J, Carlos A; Yépez V, Byron D

    2015-01-01

    In this study, we evaluated the use of ultrasound as a pretreatment for convective drying of Andean blackberry (Rubus glaucus Benth). For this, a Box-Behnken experimental design was used to study the effect of ultrasound vibration amplitude (0-90μm), time of sonication (10-30min) and air temperature (40-60°C) on the retention of antioxidant compounds and on the kinetics of convective drying. The results showed that the antioxidant activity on fruit was reduced as the vibration amplitude and time of sonication increased, while was found that vibration amplitude ultrasound and air drying temperature were the variables that more affect the drying rate of blackberries. The drying rate increased by almost five times when samples were treated with ultrasound at 90μm for 20min. They were then dried using air at 60°C. It is concluded that the application of ultrasound in blackberry processing allows to obtain a dehydrated product with better functional quality and shows to be effective in reducing the time necessary to achieve a given value of moisture during convective drying. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Ellagitannins from Raspberry (Rubus idaeus L.) Fruit as Natural Inhibitors of Geotrichum candidum.

    Science.gov (United States)

    Klewicka, Elżbieta; Sójka, Michał; Klewicki, Robert; Kołodziejczyk, Krzysztof; Lipińska, Lidia; Nowak, Adriana

    2016-07-13

    The paper presents the chemical characteristics of ellagitannins isolated from raspberry (Rubus idaeus L.) fruit and their in vitro and in situ antifungal activity against Geotrichum candidum ŁOCK 0511. The study investigated a complex preparation containing various raspberry ellagitannins at a concentration of 86% w/w, as well as pure lambertianin C and sanguiin H-6. The ellagitannin preparation was obtained by extracting raspberry press cake and purifying the extract using Amberlite XAD resin, while individual compounds were isolated by means of preparative HPLC. The complex preparation was analyzed for the content of ellagitannins, anthocyanins, and flavan-3-ols using HPLC and LC-MS. The antifungal activity of the complex ellagitannin preparation and the isolated ellagitannins was determined for the strain Geotrichum candidum. The MIC and MFC values (10.0 mg/mL and 30.0 mg/mL, respectively) were found to be the same for lambertianin C, sanguiin H-6, and the complex ellagitannin preparation. The fungistatic activity of the studied ellagitannin preparation at a concentration of 10 mg/mL, as determined by the poisoned medium method, was 65.2% following 6 day incubation of Geotrichum candidum, with the linear growth rate of only 16.2 mm/day. The corresponding parameters for the control sample were 0% and 56 mm/day, respectively. The study demonstrated both in vitro and in situ antifungal activity of raspberry ellagitannins against Geotrichum candidum.

  14. Differential expression of ethylene biosynthesis genes in drupelets and receptacle of raspberry (Rubus idaeus).

    Science.gov (United States)

    Fuentes, Lida; Monsalve, Liliam; Morales-Quintana, Luis; Valdenegro, Mónika; Martínez, Juan-Pablo; Defilippi, Bruno G; González-Agüero, Mauricio

    2015-05-01

    Red Raspberry (Rubus idaeus) is traditionally classified as non-climacteric, and the role of ethylene in fruit ripening is not clear. The available information indicates that the receptacle, a modified stem that supports the drupelets, is involved in ethylene production of ripe fruits. In this study, we report receptacle-related ethylene biosynthesis during the ripening of fruits of cv. Heritage. In addition, the expression pattern of ethylene biosynthesis transcripts was evaluated during the ripening process. The major transcript levels of 1-aminocyclopropane-1-carboxylic acid synthase (RiACS1) and 1-aminocyclopropane-1-carboxylic acid oxidase (RiACO1) were concomitant with ethylene production, increased total soluble solids (TSS) and decreased titratable acidity (TA) and fruit firmness. Moreover, ethylene biosynthesis and transcript levels of RiACS1 and RiACO1 were higher in the receptacle, sustaining the receptacle's role as a source of ethylene in regulating the ripening of raspberry. Copyright © 2015 Elsevier GmbH. All rights reserved.

  15. Antiviral Effects of Black Raspberry (Rubus coreanus) Seed and Its Gallic Acid against Influenza Virus Infection.

    Science.gov (United States)

    Lee, Ji-Hye; Oh, Mi; Seok, Jong Hyeon; Kim, Sella; Lee, Dan Bi; Bae, Garam; Bae, Hae-In; Bae, Seon Young; Hong, Young-Min; Kwon, Sang-Oh; Lee, Dong-Hun; Song, Chang-Seon; Mun, Ji Young; Chung, Mi Sook; Kim, Kyung Hyun

    2016-06-06

    Influenza is a serious public health concern worldwide, as it causes significant morbidity and mortality. The emergence of drug-resistant viral strains requires new approaches for the treatment of influenza. In this study, Rubus coreanus seed (RCS) that is left over from the production of wine or juice was found to show antiviral activities against influenza type A and B viruses. Using the time-of-addition plaque assay, viral replication was almost completely abolished by simultaneous treatment with the RCS fraction of less than a 1-kDa molecular weight (RCSF1). One of the polyphenols derived from RCSF1, gallic acid (GA), identified by liquid chromatography-tandem mass spectrometry, showed inhibitory effects against both influenza type A and B viruses, albeit at relatively high concentrations. RCSF1 was bound to hemagglutinin protein, inhibited hemagglutination significantly and disrupted viral particles, whereas GA was found to only disrupt the viral particles by using transmission electron microscopy. In BALB/c mice infected with influenza virus, oral administration of RCSF1 significantly improved the survival rate and reduced the viral titers in the lungs. Our results demonstrate that RCSF1 and GA show potent and broad antiviral activity against influenza A and B type viruses and are promising sources of agents that target virus particles.

  16. The concept of Watson's carative factors in nursing and their (dis)harmony with patient satisfaction.

    Science.gov (United States)

    Pajnkihar, Majda; Štiglic, Gregor; Vrbnjak, Dominika

    2017-01-01

    Constant reviews of the caring behavior of nurses and patient satisfaction help to improve the quality of nursing. The aim of our research was to explore relationships between the level of nursing education, the perception of nurses and nursing assistants of Watson's carative factors, and patient satisfaction. A questionnaire survey using a convenience sample of 1,098 members of nursing teams and a purposive sample of 1,123 patients in four health care institutions in Slovenia was conducted in August 2012. A demographic questionnaire and the Caring Nurse-Patient Interactions Scale (nurse version) were delivered to the nurses. A Hospital Consumer Assessment of Health Plans Survey was delivered to discharged patients. Data were analyzed using descriptive and inferential statistics. Carative factor sensibility was related to the level of nursing education. Patients were satisfied with the care received from nurses, nursing assistants and hospitals, although we found differences between the perceptions of nurses and nursing assistants of carative factors and patient satisfaction. By comparing only the perceptions of nurses and nursing assistants of carative factors in health care institutions, differences were found for seven out of ten carative factors. We did not find major significant differences between carative factors and level of nurse education, except in one carative factor. Differences in perceptions of carative factors between health care institutions are probably the result of different institutional factors. The results can be of great benefit to nurse administrators and educators, indicating the factors that must be taken into account for enhancing patient satisfaction. Emphasis on caring theories should be placed in nursing education and their application in nursing practice.

  17. Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

    Directory of Open Access Journals (Sweden)

    María L. Román-Miranda

    2013-01-01

    Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

  18. Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

    Directory of Open Access Journals (Sweden)

    Siddharth Jain

    Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

  19. Estudios preliminares para la propagación clonal "in vitro" de mora (Rubus glaucus L. Preliminary studies on In Vitro clonal propagation of Blackberry (Rubus glaucus l.

    Directory of Open Access Journals (Sweden)

    Ramirez del Castillo Amparo

    1990-12-01

    Full Text Available Con el objeto de obtener in vitro plántulas de mora (Rubus glaucus L. que permitan adelantar la micropropagación de la especie, se obtuvieron yemas axilares activas de plantas de mora cultivadas en invernadero. Dichos explantes fueron llevados a" tubo de ensayo, despuésde eliminar primordios
    foliares más'externos. Se encontró que una inmersión en hipoclorito de sodio al 0,5% por cinco minutos dio el mejor resultado para desinfección: concentraciones y tiempos mayores no promueven supervivencia del explante. En segundotérmino sedefinió el uso del mejor antioxidante, ya que se detectó un proceso de oxidación generalizado desde el inicio del cultivo in vitro. Al probar varios antioxidantes y clases de sustratos se determinó como el mejor antioxidante el ácido ascórbico (100 ppm adicionado a la solución nutritiva y como mejor sustrato el líquido sobre papel. Se realizaron ensayos con el objeto de obtener un balance hormonal óptimo. Se probó el efecto de Kinetina y la BAP en diferentes concentraciones adicionadas a un medio básico MS suplementado con ANA (0,1 ppm; calificando desarrollo de ptántula, número de follolos y presenciade callo; se determinó la BAP (2ppm como responsable del mejor resultado. En el siguiente ensayo se probó interacción citoqulninagiberelina; los mejores resultados se obtuvieron
    con AG3 (1ppm y BAP (2ppm. Posteriormente se planteó un ensayo con el objeto de obtener tallos verdaderos y brotes múltiples, para lo cual se quiso probar AlA en interacción con las hormonas anteriormente probadas, con concentraciones de AlA de 0.1 ppm, BAP (2ppm y AG3 (1ppm obteniendo como resultado de esta interacción plántulas óptimas para micropropagación. Los datos de la valoración de desarrollo de las plántulas, brotes múltiples, tallo verdadero, número de folíolos, presencia o no de callos, presencia o ausencia de raíces, fueron analizados estadísticamente con base en un diseño completamente al

  20. Multigenomic Delineation of Plasmodium Species of the Laverania Subgenus Infecting Wild-Living Chimpanzees and Gorillas.

    Science.gov (United States)

    Liu, Weimin; Sundararaman, Sesh A; Loy, Dorothy E; Learn, Gerald H; Li, Yingying; Plenderleith, Lindsey J; Ndjango, Jean-Bosco N; Speede, Sheri; Atencia, Rebeca; Cox, Debby; Shaw, George M; Ayouba, Ahidjo; Peeters, Martine; Rayner, Julian C; Hahn, Beatrice H; Sharp, Paul M

    2016-07-02

    Plasmodium falciparum, the major cause of malaria morbidity and mortality worldwide, is only distantly related to other human malaria parasites and has thus been placed in a separate subgenus, termed Laverania Parasites morphologically similar to P. falciparum have been identified in African apes, but only one other Laverania species, Plasmodium reichenowi from chimpanzees, has been formally described. Although recent studies have pointed to the existence of additional Laverania species, their precise number and host associations remain uncertain, primarily because of limited sampling and a paucity of parasite sequences other than from mitochondrial DNA. To address this, we used limiting dilution polymerase chain reaction to amplify additional parasite sequences from a large number of chimpanzee and gorilla blood and fecal samples collected at two sanctuaries and 30 field sites across equatorial Africa. Phylogenetic analyses of more than 2,000 new sequences derived from the mitochondrial, nuclear, and apicoplast genomes revealed six divergent and well-supported clades within the Laverania parasite group. Although two of these clades exhibited deep subdivisions in phylogenies estimated from organelle gene sequences, these sublineages were geographically defined and not present in trees from four unlinked nuclear loci. This greatly expanded sequence data set thus confirms six, and not seven or more, ape Laverania species, of which P. reichenowi, Plasmodium gaboni, and Plasmodium billcollinsi only infect chimpanzees, whereas Plasmodium praefalciparum, Plasmodium adleri, and Pladmodium blacklocki only infect gorillas. The new sequence data also confirm the P. praefalciparum origin of human P. falciparum. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Molecular differentiation of Culicoides biting midges (Diptera: Ceratopogonidae) from the subgenus Culicoides Latreille in Denmark

    DEFF Research Database (Denmark)

    Lassen, S. B.; Nielsen, S. Achim; Skovgård, H.

    2012-01-01

    complexes are hard to distinguish. We evaluated the use of the mitochondrial DNA cytochrome oxidase I gene (COI) barcode region in the identification of species within the subgenus Culicoides. COI barcode sequence divergence within species was ... impunctatus, and Culicoides grisescens. Additionally, this study confirms the existence of Culicoides halophilus as a valid taxon and presents the first Culicoides deltus barcode sequences. Three additional groups of specimens were identified: Culicoides dk1 with a COI barcode diverging by 14.3% to 17.2% from...... other subgenus Culicoides species and Culicoides Kalix and Culicoides dk3, which diverged by 5.9% from each other and showed 12.5% to 17.6% divergence in COI barcode to subgenus Culicoides specimens....

  2. Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.).

    Science.gov (United States)

    Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

    2017-01-01

    Raspberries (Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm-plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus. These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop.

  3. Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.).

    Science.gov (United States)

    Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A

    2015-10-26

    Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs.  Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.

  4. New species and records of Chimarra (Trichoptera, Philopotamidae) from Northeastern Brazil, and an updated key to subgenus Chimarra (Chimarrita)

    Science.gov (United States)

    Vilarino, Albane; Calor, Adolfo Ricardo

    2015-01-01

    Abstract Two new species of Chimarra (Chimarrita) are described and illustrated, Chimarra (Chimarrita) mesodonta sp. n. and Chimarra (Chimarrita) anticheira sp. n. from the Chimarra (Chimarrita) rosalesi and Chimarra (Chimarrita) simpliciforma species groups, respectively. The morphological variation of Chimarra (Curgia) morio is also illustrated. Chimarra (Otarrha) odonta and Chimarra (Chimarrita) kontilos are reported to occur in the northeast region of Brazil for the first time. An updated key is provided for males and females of the all species in the subgenus Chimarrita. PMID:25878540

  5. Penicillium subgenus Penicillium - A guide to identification of food and air-borne terverticillate Penicillia and their mycotoxins

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Samson, R.A.

    2004-01-01

    Species in Penicillium subgenus Penicillium have terverticillate penicilli and are related to the ascomycete genus Eupenicillium series Crustacea, Many of its species are very common, being associated with stored foods of human beings and other animals, but also with animal dung and building...... illustrations of the colonies and micromorphology of the 58 accepted species are given. Keys to the taxa in the various series are given, but for a more detailed electronic database including partial beta tubulin sequences reference is made to http: //www.cbs.knaw.nl/ penicillium.htm...

  6. From introduced American weed to Cape Verde Islands endemic: the case of Solanum rigidum Lam. (Solanaceae, Solanum subgenus Leptostemonum).

    Science.gov (United States)

    Knapp, Sandra; Vorontsova, Maria S

    2013-01-01

    A Solanum species long considered an American introduction to the Cape Verde Islands off the west coast of Africa is identified as Solanum rigidum, a member of the Eggplant clade of Old World spiny solanums (Solanum subgenus Leptostemonum) and is probably endemic to the Cape Verde Islands. Collections of this species from the Caribbean are likely to have been introduced from the Cape Verde Islands on slave ships. We discuss the complex nomenclatural history of this plant and provide a detailed description, illustration and distribution map. The preliminary conservation status of Solanum rigidum is Least Concern, but needs to be reassessed in light of its endemic rather than introduced status.

  7. Taxonomy of 'Euconnus complex'. Part III. Morphology of Euconnus subgenus Napochus and revision of the Australian species (Coleoptera, Staphylinidae, Scydmaeninae).

    Science.gov (United States)

    Jałoszyński, Paweł

    2015-02-26

    Morphological structures of the type species of Euconnus (Napochus) are described and illustrated, and compared with those of Euconnus s. str. Napochus is maintained as a subgenus of Euconnus, and its revised diagnosis is given. Australian species of Napochus are revised: E. palmwoodianus Franz and E. pisoniae Franz are redescribed, and E. setiphallus sp. n., E. yadhaigana sp. n., E. microlaminatus sp. n, E. feeneyi sp. n. (with a subspecies E. feeneyi parallelilaminatus ssp. n.) are described. An unusual variability in body size and proportions of body parts found in E. feeneyi is analyzed and discussed.

  8. Los cuidados enfermeros en los centros geriátricos según el modelo de Watson Nursing care adopted for use in Homes for the Elderly based on Watson model

    Directory of Open Access Journals (Sweden)

    Mercedes Abades Porcel

    2007-12-01

    Full Text Available El objetivo de este estudio pretende describir y analizar los cuidados enfermeros adoptados en las instituciones geriátricas, basándose para ello en los "factores del cuidado" de la teoría de Jean Watson. El estudio se aborda desde la perspectiva teórica fenomenológica, paradigma interpretativista. Como método de generación de información se utilizará el análisis del discurso de la "Entrevista en profundidad" realizadas a las enfermeras sobre el concepto de cuidar en los centros geriátricos. Una vez finalizado el estudio podrá ser de gran utilidad para los profesionales del ámbito geriátrico, dado que permitirá conocer los problemas que surgen a la hora de adoptar el modelo de Watson en la atención geriátrica.The aim of this study is to describe and analyse the nursing care adopted for use in Homes for the Elderly, which is based on the "carative factors" as described in the Theory of Jean Watson. In order to do this, a phenomenological perspective, interpretative paradigm will be carried out. As a method for generating information, discourse analysis of in-depth interviews carried out on the nurses concerning the concept of caring in homes for the elderly will be used. Once the study has been finalised it could be extremely useful for those healthcare professionals working with the elderly, given that it will highlight problems arising when adopting Watson’s model when caring for the elderly.

  9. Taxonomic study on the subgenus Uresipedilum (Diptera: Chironomidae: Polypedilum, with description of a new species from the Yaewyama Islands, Okinawa, Japan

    Directory of Open Access Journals (Sweden)

    Nao Yamamoto

    2015-07-01

    Full Text Available As a result of a multi-year survey, we recognized four species including a new species of the subgenus Uresipedilum from the Yaeyama Islands, the Ryukyus, Japan. Polypedilum (Uresipedilum paraconvictum sp. nov. is described. P. (U. classiglobum Zhang et Wang (2004 P. (U. bingoparadoxum Kawai et al. (1998 and P. (U. iriofegeum Sasa et Suzuki (2000 are re-described. The first species is newly recorded from Japan, and the second species is new to the Ryukyus. The diagnostic characters of the subgenus are discussed.

  10. Investigation of the H7 ordinary chondrite, Watson 012: Implications for recognition and classification of Type 7 meteorites

    Science.gov (United States)

    Tait, Alastair W.; Tomkins, Andrew G.; Godel, Bélinda M.; Wilson, Siobhan A.; Hasalova, Pavlina

    2014-06-01

    Despite the fact that the number of officially classified meteorites is now over 45,000, we lack a clearly defined sequence of samples from a single parent body that records the entire range in metamorphic temperatures from pristine primitive meteorites up to the temperatures required for extensive silicate partial melting. Here, we conduct a detailed analysis of Watson 012, an H7 ordinary chondrite, to generate some clarity on the textural and chemical changes associated with equilibrium-based silicate partial melting in chondritic meteorites. To do this we compare the textures in the meteorite with those preserved in metamorphic contact aureoles on Earth. The most distinctive texture generated by the partial melting that affected Watson 012 is an extensively interconnected plagioclase network, which is clearly observable with a petrographic microscope. Enlarged metal-troilite grains are encapsulated at widenings in this plagioclase network, and this is clearly visible in reflected light. Together with these features, we define a series of other characteristics that can be used to more clearly classify chondritic meteorites as being of petrologic Type 7. To provide comprehensive evidence of silicate partial melting and strengthen the case for using simple petrographic observations to classify similar meteorites, we use high-resolution X-ray computed tomography to demonstrate that the plagioclase network has a high degree of interconnectedness and crystallised as large (cm-scale) skeletal crystals within an olivine-orthopyroxene-clinopyroxene framework, essentially pseudomorphing a melt network. Back-scattered electron imaging and element mapping are used to show that some of the clino- and orthopyroxene in Watson 012 also crystallised from silicate melt, and the order of crystallisation was orthopyroxene → clinopyroxene → plagioclase. X-ray diffraction data, supported by bulk geochemistry, are used to show that plagioclase and ortho- and clinopyroxene were

  11. Porfiria aguda intermitente: valor do teste de Watson e Schwartz para o diagnóstico

    Directory of Open Access Journals (Sweden)

    José Lamartine de Assis

    1957-03-01

    (técnica de Watson e Schwartz.

  12. Comparison of bioimpedance spectroscopy and the Watson formula for measuring body volume in patients on peritoneal dialysis.

    Science.gov (United States)

    Martínez Fernández, Gonzalo; Ortega Cerrato, Agustín; de la Vara Iniesta, Lourdes; Oliver Galera, Eva; Gómez Roldán, Carmen; Pérez Martínez, Juan

    2016-01-01

    Knowing total body volume (V) is crucial in patients on peritoneal dialysis (PD). It is usually calculated by the Watson anthropometric formula, although the use of bioimpedance spectroscopy (BIS) is becoming increasingly widespread. Measuring V with both methods can at times produce quite different results. We aimed to identify differences between the 2 forms of measuring volume in a PD unit and determine which clinical factors are associated with these differences. Ours is an observational study of 74 patients on PD. We measured V using BIS (Vbis) and the Watson formula (Vw); 271 measurements were made with each method. We calculated the difference between Vbis and Vw in each patient and classified them into 2 groups: Difference between volumes ≥10% or diabetes mellitus (DM) (p=0,03), hypertension (HTN) (p=0,036), hypoalbuminemia (p<0,01), hypoprealbuminemia (p<0,01), low phase angle at 50 Hz (p<0,01), high C reactive protein (p<0,01), obesity (p=0,027), E/I ratio (ratio between extracellular and intracellular water) ≥1 (p<0.01) and residual diuresis (p=0.029). There are significant differences in the V of PD Unit patients when obtained by Watson formula or by BIS. A difference between the measurements is associated with the presence of DM, HTN, hypoalbuminaemia, obesity, malnutrition, inflammation, E/I ratio ≥1 and the absence of residual diuresis. Copyright © 2015 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

  13. Saturated linkage map construction in Rubus idaeus using genotyping by sequencing and genome-independent imputation

    Directory of Open Access Journals (Sweden)

    Ward Judson A

    2013-01-01

    Full Text Available Abstract Background Rapid development of highly saturated genetic maps aids molecular breeding, which can accelerate gain per breeding cycle in woody perennial plants such as Rubus idaeus (red raspberry. Recently, robust genotyping methods based on high-throughput sequencing were developed, which provide high marker density, but result in some genotype errors and a large number of missing genotype values. Imputation can reduce the number of missing values and can correct genotyping errors, but current methods of imputation require a reference genome and thus are not an option for most species. Results Genotyping by Sequencing (GBS was used to produce highly saturated maps for a R. idaeus pseudo-testcross progeny. While low coverage and high variance in sequencing resulted in a large number of missing values for some individuals, a novel method of imputation based on maximum likelihood marker ordering from initial marker segregation overcame the challenge of missing values, and made map construction computationally tractable. The two resulting parental maps contained 4521 and 2391 molecular markers spanning 462.7 and 376.6 cM respectively over seven linkage groups. Detection of precise genomic regions with segregation distortion was possible because of map saturation. Microsatellites (SSRs linked these results to published maps for cross-validation and map comparison. Conclusions GBS together with genome-independent imputation provides a rapid method for genetic map construction in any pseudo-testcross progeny. Our method of imputation estimates the correct genotype call of missing values and corrects genotyping errors that lead to inflated map size and reduced precision in marker placement. Comparison of SSRs to published R. idaeus maps showed that the linkage maps constructed with GBS and our method of imputation were robust, and marker positioning reliable. The high marker density allowed identification of genomic regions with segregation

  14. A blackberry (Rubus L. expressed sequence tag library for the development of simple sequence repeat markers

    Directory of Open Access Journals (Sweden)

    Main Dorrie S

    2008-06-01

    Full Text Available Abstract Background The recent development of novel repeat-fruiting types of blackberry (Rubus L. cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR, and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry.

  15. Molecular cloning and characterization of a flavanone-3-hydroxylase gene from rubus occidentalis L

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seung Sik; Lee, Eun Mi; An, Byung Chull; Barampuram, Shyamkumar; Kim, Jae Sung; Chung, Jae Sung [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Cho, Jae Young [Dept. of Applied Life Sciences, Chonbuk National University, Jeonju (Korea, Republic of); Lee, In Chul [Senior Industry Cluster Agency, Youngdong University, Youngdong (Korea, Republic of)

    2008-08-15

    Flavanone-3-hydroxylase (F3H) is one of the key enzymes for the biosynthesis of flavonals, anthocyanins, catechins and proanthocyanins. F3H catalyzes the 3β-hydroxylation of (2S)-flavonones to form (2R, 3R)-dihydroflavonols. In this report, we isolated a full-length cDNA of RocF3H from black raspberry (Rubus occidentalis L.) using a reverse transcriptase-PCR and rapid amplification of the cDNA ends (RACE)-PCR. The full-length cDNA of RocF3H contains a 1,098 bp open reading frame (ORF) encoding a 365 amino acid protein with a calculated molecular weight of about 41.1 kDa and isoelectric point (pI) of 5.45. The genomic DNA analysis revealed that the RocF3H gene had three exons and two introns. Comparison of the deduced amino acid sequence of the RocF3H with other F3Hs revealed that the protein is highly homologous with various plant species. The conserved amino acids ligating the ferrous iron and the residues participating in the 2-oxoglutarate binding (R-X-S) were found in RocF3H at the similar positions to other F3Hs. Southern blot analysis indicated that RocF3H exist a multi-gene family. The isolation of RocF3H gene will be helpful to further study the role of F3H gene in the biosynthesis of flavonoids in R. occidnetalis.

  16. Gastroprotective Value of Berries: Evidences from Methanolic Extracts of Morus nigra and Rubus niveus Fruits

    Directory of Open Access Journals (Sweden)

    Luciane Angela Nottar Nesello

    2017-01-01

    Full Text Available This study evaluated the gastroprotective value of the methanol extracts from fruits of Morus nigra L. (black mulberry (MEMN and Rubus niveus Thunb (raspberry (MERN. The total phenolic compounds and flavonoids were measured, as well as the in vitro 2,2-diphenyl-1-picrylhydrazyl (DPPH free radical scavenger activity. The gastroprotective effects of the extracts against 60% ethanol/0.3 M HCl were evaluated in mice. After that, the lipid hydroperoxides and reduced glutathione levels at ulcerated tissue were determined. The effects of extracts on H+/K+-ATPase activity were also verified. The extracts exhibited high contents of polyphenols; however, MERN presented 1.5-fold higher levels. The presence of flavonoids also was confirmed. In addition, MEMN (IC50 = 13.74 μg/mL and MERN (IC50 = 14.97 μg/mL scavenged DPPH radical. The MEMN reduced the ulcer area only at 300 mg/kg (p.o. by 64.06%. Interestingly, MERN decreased the ulcer area in a superior potency (ED50 = 20.88 mg/kg, reducing the ulcer area by 81.86% at 300 mg/kg, and increased the gastric mucin levels. The antioxidant effects of extracts were evidenced by reduced lipoperoxides and increased reduction of glutathione amount in the gastric mucosa. However, MEMN or MERN did not change the H+/K+-ATPase activity. These results confirm that M. nigra and R. niveus are berries with a gastroprotective value by strengthening of gastric protective factors.

  17. Antiviral effects of black raspberry (Rubus coreanus) juice on foodborne viral surrogates.

    Science.gov (United States)

    Oh, Mi; Bae, Seon Young; Lee, Ji-Hye; Cho, Ki Joon; Kim, Kyung Hyun; Chung, Mi Sook

    2012-10-01

    Abstract Human noroviruses (HuNoVs) are the most frequent cause of foodborne viral gastroenteritis, causing approximately 90% of non-bacterial epidemic outbreaks around the world. Rubus coreanus is a species of black raspberry, rich in polyphenols, and known to exert anti-inflammatory, antibacterial, and antiviral activities. In the present study, the antiviral effects of R. coreanus juice (black raspberry [BRB] juice) on foodborne viral surrogates, murine norovirus-1 (MNV-1) and feline calicivirus-F9 (FCV-F9), were compared with those of cranberry juice, grape juice, and orange juice by plaque assays. Among the four juices tested, BRB juice was the most effective in reducing plaques formation of these viruses. Time-of-addition experiments were designed to determine the mechanism of action of BRB juice on MNV-1 and FCV-F9. The maximal antiviral effect of BRB juice against MNV-1 was observed when it was added to RAW 264.7 cells (mouse leukemic monocyte macrophage cell line) simultaneously with the virus. Pre-treatment of either Crandell Reese Feline Kidney cells or FCV-F9 with BRB juice exhibited significant antiviral activity. The inhibition of viral infection by BRB juice on MNV-1 and FCV-F9 probably occurs at the internalization of virions into the cell or the attachment of the viral surface protein to the cellular receptor. The polyphenol components in BRB (i.e., gallic acid and quercetin), however, did not show any activity against these viruses. Our data provide great promise for the utilization of BRB in the prevention of foodborne viral outbreaks.

  18. Evolution of a soldier caste specialized to lay unfertilized eggs in the ant genus Crematogaster (subgenus Orthocrema).

    Science.gov (United States)

    Peeters, Christian; Lin, Chung-Chi; Quinet, Yves; Martins Segundo, Glauco; Billen, Johan

    2013-05-01

    Among social Hymenoptera, only some ant genera have more than one morphological kind of non-reproductive adults. Individuals that are bigger than ordinary workers can function for defence and/or food storage. In Crematogaster (Orthocrema) smithi from Arizona, a third caste exists in addition to winged queens and workers; it is intermediate in size, weight and morphology, and individuals lay many unfertilized eggs that are mostly eaten by larvae (Heinze et al., 1995, 1999). We studied another three species belonging to the subgenus Orthocrema: Crematogaster pygmaea from Brazil, Crematogaster biroi and Crematogaster schimmeri from Taiwan. Using scanning electron microscopy and ovarian dissections, we show that 'intermediates' are a patchwork of queen-like and worker-like traits, just as in C. smithi; importantly the combinations differ across species. 'Intermediates' are numerically few in the colonies, and in C. pygmaea they are produced seasonally. Using histology we confirmed the lack of a spermatheca, thus they are not ergatoid queens. Based on the similarity of their mosaic phenotypes with those in other ant lineages, we suggest that Orthocrema 'intermediates' are a soldier caste with a specialized trophic function. This soldier caste has been reported in other Orthocrema species from Madagascar, Guinea and Costa Rica, suggesting that it is widespread in this subgenus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. A review of the genus Mirostenella Bayer, 1988 (Octocorallia: Primnoidae) with a description of a new subgenus and species

    Science.gov (United States)

    Zapata-Guardiola, Rebeca; López-González, Pablo J.; Gili, Josep-Maria

    2013-06-01

    In the present study, the genus Mirostenella Bayer (Proc Biol Soc Wash 101:251-256, 1988) is revised. We add to knowledge of the type species of the genus M. articulata Bayer (Proc Biol Soc Wash 101:251-256, 1988) from newly collected material from the Antarctic cruise Polarstern ANT XIX/5, and an illustrated description of this species is included. Cairns and Bayer (Smithson Contrib Zool 629:1-79, 2009) included Dicholaphis delicatula Thomson and Rennet (Sci Rept C Zool Bot 9(3):1-46, 1931) in the genus Mirostenella but after the examination of the type material, it is proposed to include the species in the recently described Plumarella subgenus, Faxiella (Zapata-Guardiola and López-González in Sci Mar 76:357-380, 2012). In addition, a new species of Plumarella, Plumarella castellviae sp. nov. from SubAntarctic waters is also described and illustrated. The species has similarities to Mirostenella but differs from it in the absence of organic nodes at bifurcation points and the presence of a sympodial branching pattern. Moreover, a new subgenus, Verticillata, is also proposed to include Plumarella species with polyps arranged in whorls around branchlets.

  20. First report of a resistance-breaking strain of Raspberry bushy dwarf virus in red raspberry (Rubus idaeus) in North America

    Science.gov (United States)

    Raspberry bushy dwarf virus (RBDV) is pollen-transmitted and the most important virus of Rubus worldwide. Infection of RBDV is associated with drupelet abortion, resulting in crumbly fruit. Multiple RBDV strains have been reported, with the Scottish-type (D200) strains being the most prevalent, and...

  1. A revision of Ornithogalum subgenus Aspasia section Aspasia, the chincherinchees (Hyacinthaceae

    Directory of Open Access Journals (Sweden)

    J. C. Manning

    2007-08-01

    Full Text Available The species of Ornithogalum L. subgenus Aspasia section Aspasia are revised. Section Aspasia is defined by a rosette of  lanceolate to oblong leaves; large, boat-shaped, ± petaloid bracts; moderately-sized white, yellow or orange flowers, sometimes with dark central markings; thin-textured, ellipsoid capsules that are enclosed by and concealed within the persistent, papery perianth; and angular, colliculate to echinulate seeds. Twelve species are recognized in the section, separable into three series based on seed morphology. O. conicum is redefined to exclude specimens from the Eastern Cape, which are recognized as O. synanthifolium, and O. conicum subsp.  strictum is raised to species status as O. strictum. The circumscription of O. duhium is expanded to include O.fimbrimarginatum and O. subcoriaceum, previously distinguished on account of their longer styles.Collections from the Roggeveld Escarpment and Klein Roggeveld that were previously included in O. fimbrimaiginatum are recognized as the new species O. corticatum Mart.-Azarin, on the basis of their unusual, thick, cartilaginous outer tunics and puberulous adaxial leaf surface. O. ceresianum is removed from the synonomy of O. thyrsoides and recognized as a distinct species on account of its extensive glossy black tepal markings, winged inner filaments, and glossy black ovary. The poorly known  O. puberuhim is more ftilly described based on several recent collections, and  O. leeupoortense is neotypified in the absence of any original type material.  O. rupestre and O. multifolium are regarded as colour forms of the same species, for which  O. rupestre is the older name. Similarly, O. roussouwii is a depauperate, pale form of O. maculatum and is thus included in the synonomy of that species. The circumscription of O. pruinosum remains unchanged. The species O. haurii, O. diphyllum and O. sephtonii from the Drakensberg Mountains of Eastern Cape and KwaZulu-Natal are excluded from

  2. Ciscoes (Coregonus, subgenus Leucichthys) of the Laurentian Great Lakes and Lake Nipigon

    Science.gov (United States)

    Eshenroder, Randy L.; Vecsei, Paul; Gorman, Owen T.; Yule, Daniel; Pratt, Thomas C.; Mandrak, Nicholas E.; Bunnell, David B.; Muir, Andrew M.

    2016-01-01

    This study of the ciscoes (Coregonus, subgenus Leucichthys) of the Great Lakes and Lake Nipigon represents a furtherance through 2015 of field research initiated by Walter Koelz in 1917 and continued by Stanford Smith in the mid-1900s—a period spanning nearly a century. Like Koelz’s study, this work contains information on taxonomy, geographical distribution, ecology, and status of species (here considered forms). Of the seven currently recognized forms (C. artedi, C. hoyi, C. johannae, C. kiyi, C. nigripinnis, C. reighardi, and C. zenithicus) described by Koelz as major in his 1929 monograph, two (C. johannae and C. reighardi) are extinct. In addition, C. alpenae, described by Koelz but subsequently synonymized with C. zenithicus, although extinct, is recognized as valid making a total of eight major forms. Six of these forms, all but C. artedi and C. hoyi, have been lost from Lake Michigan, and seven have been lost from Lake Huron, leaving in Lake Huron only C. artedi and an introgressed deepwater form that we term a hybrid swarm. C. artedi appears, like its sister form C. alpenae, to have been lost from Lake Erie. Only C. artedi remains extant in Lake Ontario, its three sister forms (C. hoyi, C. kiyi, and C. reighardi) having disappeared long ago.Lakes Superior and Nipigon have retained their original species flocks consisting of four forms each: C. artedi, C. hoyi, and C. zenithicus in both lakes; C. kiyi in Lake Superior; and C. nigripinnis in Lake Nipigon. Morphological deviations from the morphotypes described by Koelz have been modest in contemporary samples. Overall, C. kiyi and C. artedi were the most morphologically stable forms while C. hoyi, C. nigripinnis, and C. zenithicus were the least stable. Although contemporary populations of C. artedi from Lakes Michigan and Huron are highly diverged from the morphotypes described by Koelz, the contemporary samples were of undescribed deep-bodied forms unlikely to have been sampled by Koelz because of

  3. The current challenges of dourine: difficulties in differentiating Trypanosoma equiperdum within the subgenus Trypanozoon.

    Science.gov (United States)

    Zablotskij, V T; Georgiu, C; de Waal, Th; Clausen, P H; Claes, F; Touratier, L

    2003-12-01

    During its 20th annual meeting in Paris in May 1999, the OIE (World organisation for animal health) Ad Hoc Group on Non-Tsetse Transmitted Animal Trypanosomoses expressed the following concerns about dourine: the discrepancies in some of the results of the complement fixation test (CFT), which is the only international diagnostic test officially recognised by the International Organisation for the Transportation of Equidae; the persistence of suspected cases of dourine in some Asian, European and African countries; the impossibility of differentiating Trypanosoma equiperdum from Trypanosoma evansi and of isolating new strains of T. equiperdum from clinical cases that have appeared in various parts of the world since 1982. In the light of these concerns, it was decided, in agreement with the Directorate of the Federal Veterinary Services of Russia in Moscow, to perform comparative trials on the value of CFT/dourine at the OIE Reference Laboratory for dourine in Moscow (The All-Russian Research Institute of Experimental Veterinary Medicine) using reagents (antigens and sera) from seven countries with extensive experience in the field of dourine diagnosis, namely, South Africa, France, Italy, Germany, Russia, the United States of America and the People's Republic of China. It is thanks to the successful co-operation of these countries that the trials were made possible. Results showed an overall concordance and were submitted for consideration to the OIE Biological Standards Commission, the commission which is in charge of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. These trials serve as a starting point for further study, particularly in the following areas: the isolation of new strains of T. equiperdum from clinical dourine cases; the identification of specific markers for T. equiperdum which would make it possible to differentiate it from among the other species within the subgenus Trypanozoon; the experimental infection of horses with

  4. A revision of Ornithogalum subgenus Aspasia section Aspasia, the chincherinchees (Hyacinthaceae

    Directory of Open Access Journals (Sweden)

    J. C. Manning

    2007-12-01

    Full Text Available The species of Ornithogalum L. subgenus Aspasia section Aspasia are revised. Section Aspasia is defined by a rosette of  lanceolate to oblong leaves; large, boat-shaped, ± petaloid bracts; moderately-sized white, yellow or orange flowers, sometimes with dark central markings; thin-textured, ellipsoid capsules that are enclosed by and concealed within the persistent, papery perianth; and angular, colliculate to echinulate seeds. Twelve species are recognized in the section, separable into three series based on seed morphology. O. conicum is redefined to exclude specimens from the Eastern Cape, which are recognized as O. synanthifolium, and O. conicum subsp.  strictum is raised to species status as O. strictum. The circumscription of O. duhium is expanded to include O.fimbrimarginatum and O. subcoriaceum, previously distinguished on account of their longer styles.Collections from the Roggeveld Escarpment and Klein Roggeveld that were previously included in O. fimbrimaiginatum are recognized as the new species O. corticatum Mart.-Azarin, on the basis of their unusual, thick, cartilaginous outer tunics and puberulous adaxial leaf surface. O. ceresianum is removed from the synonomy of O. thyrsoides and recognized as a distinct species on account of its extensive glossy black tepal markings, winged inner filaments, and glossy black ovary. The poorly known  O. puberuhim is more ftilly described based on several recent collections, and  O. leeupoortense is neotypified in the absence of any original type material.  O. rupestre and O. multifolium are regarded as colour forms of the same species, for which  O. rupestre is the older name. Similarly, O. roussouwii is a depauperate, pale form of O. maculatum and is thus included in the synonomy of that species. The circumscription of O. pruinosum remains unchanged. The species O. haurii, O. diphyllum and O. sephtonii from the Drakensberg Mountains of Eastern Cape and KwaZulu-Natal are excluded from

  5. Phylogeny of xerophilic aspergilli (subgenus Aspergillus) and taxonomic revision of section Restricti.

    Science.gov (United States)

    Sklenář, F; Jurjević, Ž; Zalar, P; Frisvad, J C; Visagie, C M; Kolařík, M; Houbraken, J; Chen, A J; Yilmaz, N; Seifert, K A; Coton, M; Déniel, F; Gunde-Cimerman, N; Samson, R A; Peterson, S W; Hubka, V

    2017-09-01

    Aspergillus section Restricti together with sister section Aspergillus (formerly Eurotium) comprises xerophilic species, that are able to grow on substrates with low water activity and in extreme environments. We adressed the monophyly of both sections within subgenus Aspergillus and applied a multidisciplinary approach for definition of species boundaries in sect. Restricti. The monophyly of sections Aspergillus and Restricti was tested on a set of 102 isolates comprising all currently accepted species and was strongly supported by Maximum likelihood (ML) and Bayesian inferrence (BI) analysis based on β-tubulin (benA), calmodulin (CaM) and RNA polymerase II second largest subunit (RPB2) loci. More than 300 strains belonging to sect. Restricti from various isolation sources and four continents were characterized by DNA sequencing, and 193 isolates were selected for phylogenetic analyses and phenotypic studies. Species delimitation methods based on multispecies coalescent model were employed on DNA sequences from four loci, i.e., ID region of rDNA (ITS + 28S), CaM, benA and RPB2, and supported recognition of 21 species, including 14 new. All these species were also strongly supported in ML and BI analyses. All recognised species can be reliably identified by all four examined genetic loci. Phenotype analysis was performed to support the delimitation of new species and includes colony characteristics on seven cultivation media incubated at several temperatures, growth on an osmotic gradient (six media with NaCl concentration from 0 to 25 %) and analysis of morphology including scanning electron microscopy. The micromorphology of conidial heads, vesicle dimensions, temperature profiles and growth parameters in osmotic gradient were useful criteria for species identification. The vast majority of species in sect. Restricti produce asperglaucide, asperphenamate or both in contrast to species in sect. Aspergillus. Mycophenolic acid was detected for the first time in

  6. Antimicrobial activity against Helicobacter pylori strains and antioxidant properties of blackberry leaves (Rubus ulmifolius) and isolated compounds.

    Science.gov (United States)

    Martini, Silvia; D'Addario, Claudia; Colacevich, Andrea; Focardi, Silvia; Borghini, Francesca; Santucci, Annalisa; Figura, Natale; Rossi, Claudio

    2009-07-01

    Rubus spp. (Rosaceae) provide extracts used in traditional medicine as antimicrobial, anticonvulsant, muscle relaxant and radical scavenging agents. Resistance to antibiotics used to treat Helicobacter pylori infection as well as their poor availability in developing countries prompted us to test the antimicrobial activity of Rubus ulmifolius leaves and isolated polyphenols against two H. pylori strains with different virulence (CagA+ strain 10K and CagA(-) strain G21). The antioxidant activity (TEAC values) of the tested compounds ranged from 4.88 (gallic acid) to 1.60 (kaempferol), whilst the leaf extract gave a value of 0.12. All the isolated polyphenols as well as the leaf extract showed antibacterial activity against both of the H. pylori strains. The minimum bactericidal concentrations (MBCs) of the extract for H. pylori strains G21 and 10K, respectively, were 1200 microg/mL and 1500 microg/mL after 24h of exposure and 134 microg/mL and 270 microg/mL after 48 h exposure. Ellagic acid showed very low MBC values towards both of the H. pylori strains after 48 h (2 microg/mL and 10 microg/mL for strains G21 and 10K, respectively) and kaempferol toward G21 strain (MBC=6 microg/mL). A relationship between antimicrobial activity and antioxidant capacity was found only for H. pylori strain G21 CagA(-) strain.

  7. Review of Cycadophila Xu, Tang & Skelley (Coleoptera: Erotylidae: Pharaxonothinae) inhabiting Cycas (Cycadaceae) in Asia, with descriptions of a new subgenus and thirteen new species.

    Science.gov (United States)

    Skelley, Paul; Xu, Guang; Tang, William; Lindström, Anders J; Marler, Thomas; Khuraijam, Jibankumar Singh; Singh, Rita; Radha, P; Rich, Stephen

    2017-05-12

    The genus Cycadophila Xu, Tang & Skelley (Coleoptera: Erotylidae: Pharaxonothinae) associated with Cycas L. (Cycadacaeae) in Asia is reviewed. Strobilophila, new subgenus, with five species is described: Cycadophila (Strobilophila) assamensis new species, C. (S.) hiepi new species, C. (S.) kwaiensis new species, C. (S.) tansachai new species and C. (S.) yangi new species, all associated with Cycas. For the nominate subgenus Cycadophila eight new species are described, Cycadophila (Cycadophila) abyssa new species, C. (C.) collina new species,C. (C.) samara new species, C. (C.) convexa new species, C. (C.) cyclochasma new species, C. (C.) eurynota new species, C. (C.) papua new species, and C. (C.) torquata new species and four new generic combinations are proposed: C. (C.) vittata (Arrow) new combination, C. (C.) discimaculata (Mader) new combination, C. (C.) intermedia (Chûjô) new combination, and C. (C.) lata (Grouvelle) new combination. Only the first three listed species of the nominate subgenus have known associations with Cycas. Species are distinguished on the basis of morphology and/or by analysis of 16S rRNA gene sequences. The larva of subgenus Strobilophila is described based on individuals collected together with adults and matched with analysis of 16S rRNA gene sequences. Keys to subgenera and species of known adults and larvae are provided.

  8. Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

    Science.gov (United States)

    Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

    2015-09-01

    Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Durbin-Watson partial least-squares regression applied to MIR data on adulteration with edible oils of different origins.

    Science.gov (United States)

    Jović, Ozren

    2016-12-15

    A novel method for quantitative prediction and variable-selection on spectroscopic data, called Durbin-Watson partial least-squares regression (dwPLS), is proposed in this paper. The idea is to inspect serial correlation in infrared data that is known to consist of highly correlated neighbouring variables. The method selects only those variables whose intervals have a lower Durbin-Watson statistic (dw) than a certain optimal cutoff. For each interval, dw is calculated on a vector of regression coefficients. Adulteration of cold-pressed linseed oil (L), a well-known nutrient beneficial to health, is studied in this work by its being mixed with cheaper oils: rapeseed oil (R), sesame oil (Se) and sunflower oil (Su). The samples for each botanical origin of oil vary with respect to producer, content and geographic origin. The results obtained indicate that MIR-ATR, combined with dwPLS could be implemented to quantitative determination of edible-oil adulteration. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. ITS2 secondary structure improves phylogeny estimation in a radiation of blue butterflies of the subgenus Agrodiaetus (Lepidoptera: Lycaenidae: Polyommatus

    Directory of Open Access Journals (Sweden)

    Wolf Matthias

    2009-12-01

    Full Text Available Abstract Background Current molecular phylogenetic studies of Lepidoptera and most other arthropods are predominantly based on mitochondrial genes and a limited number of nuclear genes. The nuclear genes, however, generally do not provide sufficient information for young radiations. ITS2 , which has proven to be an excellent nuclear marker for similarly aged radiations in other organisms like fungi and plants, is only rarely used for phylogeny estimation in arthropods, although universal primers exist. This is partly due to difficulties in the alignment of ITS2 sequences in more distant taxa. The present study uses ITS2 secondary structure information to elucidate the phylogeny of a species-rich young radiation of arthropods, the butterfly subgenus Agrodiaetus. One aim is to evaluate the efficiency of ITS2 to resolve the phylogeny of the subgenus in comparison with COI , the most important mitochondrial marker in arthropods. Furthermore, we assess the use of compensatory base changes in ITS2 for the delimitation of species and discuss the prospects of ITS2 as a nuclear marker for barcoding studies. Results In the butterfly family Lycaenidae, ITS2 secondary structure enabled us to successfully align sequences of different subtribes in Polyommatini and produce a Profile Neighbour Joining tree of this tribe, the resolution of which is comparable to phylogenetic trees obtained with COI+COII . The subgenus Agrodiaetus comprises 6 major clades which are in agreement with COI analyses. A dispersal-vicariance analysis (DIVA traced the origin of most Agrodiaetus clades to separate biogeographical areas in the region encompassing Eastern Anatolia, Transcaucasia and Iran. Conclusions With the inclusion of secondary structure information, ITS2 appears to be a suitable nuclear marker to infer the phylogeny of young radiations, as well as more distantly related genera within a diverse arthropod family. Its phylogenetic signal is comparable to the

  11. ITS2 secondary structure improves phylogeny estimation in a radiation of blue butterflies of the subgenus Agrodiaetus (Lepidoptera: Lycaenidae: Polyommatus ).

    Science.gov (United States)

    Wiemers, Martin; Keller, Alexander; Wolf, Matthias

    2009-12-26

    Current molecular phylogenetic studies of Lepidoptera and most other arthropods are predominantly based on mitochondrial genes and a limited number of nuclear genes. The nuclear genes, however, generally do not provide sufficient information for young radiations. ITS2 , which has proven to be an excellent nuclear marker for similarly aged radiations in other organisms like fungi and plants, is only rarely used for phylogeny estimation in arthropods, although universal primers exist. This is partly due to difficulties in the alignment of ITS2 sequences in more distant taxa. The present study uses ITS2 secondary structure information to elucidate the phylogeny of a species-rich young radiation of arthropods, the butterfly subgenus Agrodiaetus. One aim is to evaluate the efficiency of ITS2 to resolve the phylogeny of the subgenus in comparison with COI , the most important mitochondrial marker in arthropods. Furthermore, we assess the use of compensatory base changes in ITS2 for the delimitation of species and discuss the prospects of ITS2 as a nuclear marker for barcoding studies. In the butterfly family Lycaenidae, ITS2 secondary structure enabled us to successfully align sequences of different subtribes in Polyommatini and produce a Profile Neighbour Joining tree of this tribe, the resolution of which is comparable to phylogenetic trees obtained with COI+COII . The subgenus Agrodiaetus comprises 6 major clades which are in agreement with COI analyses. A dispersal-vicariance analysis (DIVA) traced the origin of most Agrodiaetus clades to separate biogeographical areas in the region encompassing Eastern Anatolia, Transcaucasia and Iran. With the inclusion of secondary structure information, ITS2 appears to be a suitable nuclear marker to infer the phylogeny of young radiations, as well as more distantly related genera within a diverse arthropod family. Its phylogenetic signal is comparable to the mitochondrial marker COI . Compensatory base changes are very rare

  12. Complete Mitochondrial Genome of Three Bactrocera Fruit Flies of Subgenus Bactrocera (Diptera: Tephritidae and Their Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Hoi-Sen Yong

    Full Text Available Bactrocera latifrons is a serious pest of solanaceous fruits and Bactrocera umbrosa is a pest of Artocarpus fruits, while Bactrocera melastomatos infests the fruit of Melastomataceae. They are members of the subgenus Bactrocera. We report here the complete mitochondrial genome of these fruit flies determined by next-generation sequencing and their phylogeny with other taxa of the subgenus Bactrocera. The whole mitogenomes of these three species possessed 37 genes namely, 13 protein-coding genes (PCGs, 2 rRNA and 22 tRNA genes. The mitogenome of B. latifrons (15,977 bp was longer than those of B. melastomatos (15,954 bp and B. umbrosa (15,898 bp. This difference can be attributed to the size of the intergenic spacers (283 bp in B. latifrons, 261 bp in B. melastomatos, and 211 bp in B. umbrosa. Most of the PCGs in the three species have an identical start codon, except for atp8 (adenosine triphosphate synthase protein 8, which had an ATG instead of GTG in B. umbrosa, whilst the nad3 (NADH dehydrogenase subunit 3 and nad6 (NADH dehydrogenase subunit 6 genes were characterized by an ATC instead of ATT in B. melastomatos. The three species had identical stop codon for the respective PCGs. In B. latifrons and B. melastomatos, the TΨC (thymidine-pseudouridine-cytidine-loop was absent in trnF (phenylalanine and DHU (dihydrouracil-loop was absent in trnS1 (serine S1. In B. umbrosa, trnN (asparagine, trnC (cysteine and trnF lacked the TψC-loop, while trnS1 lacked the DHU-stem. Molecular phylogeny based on 13 PCGs was in general concordant with 15 mitochondrial genes (13 PCGs and 2 rRNA genes, with B. latifrons and B. umbrosa forming a sister group basal to the other species of the subgenus Bactrocera which was monophyletic. The whole mitogenomes will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general.

  13. Complete Mitochondrial Genome of Three Bactrocera Fruit Flies of Subgenus Bactrocera (Diptera: Tephritidae) and Their Phylogenetic Implications.

    Science.gov (United States)

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip; Suana, I Wayan

    2016-01-01

    Bactrocera latifrons is a serious pest of solanaceous fruits and Bactrocera umbrosa is a pest of Artocarpus fruits, while Bactrocera melastomatos infests the fruit of Melastomataceae. They are members of the subgenus Bactrocera. We report here the complete mitochondrial genome of these fruit flies determined by next-generation sequencing and their phylogeny with other taxa of the subgenus Bactrocera. The whole mitogenomes of these three species possessed 37 genes namely, 13 protein-coding genes (PCGs), 2 rRNA and 22 tRNA genes. The mitogenome of B. latifrons (15,977 bp) was longer than those of B. melastomatos (15,954 bp) and B. umbrosa (15,898 bp). This difference can be attributed to the size of the intergenic spacers (283 bp in B. latifrons, 261 bp in B. melastomatos, and 211 bp in B. umbrosa). Most of the PCGs in the three species have an identical start codon, except for atp8 (adenosine triphosphate synthase protein 8), which had an ATG instead of GTG in B. umbrosa, whilst the nad3 (NADH dehydrogenase subunit 3) and nad6 (NADH dehydrogenase subunit 6) genes were characterized by an ATC instead of ATT in B. melastomatos. The three species had identical stop codon for the respective PCGs. In B. latifrons and B. melastomatos, the TΨC (thymidine-pseudouridine-cytidine)-loop was absent in trnF (phenylalanine) and DHU (dihydrouracil)-loop was absent in trnS1 (serine S1). In B. umbrosa, trnN (asparagine), trnC (cysteine) and trnF lacked the TψC-loop, while trnS1 lacked the DHU-stem. Molecular phylogeny based on 13 PCGs was in general concordant with 15 mitochondrial genes (13 PCGs and 2 rRNA genes), with B. latifrons and B. umbrosa forming a sister group basal to the other species of the subgenus Bactrocera which was monophyletic. The whole mitogenomes will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general.

  14. Acute toxicity, brine shrimp cytotoxicity, anthelmintic and relaxant potentials of fruits of Rubus fruticosus Agg

    Science.gov (United States)

    2013-01-01

    Background Rubus fruticosus is used in tribal medicine as anthelmintic and an antispasmodic. In the current work, we investigated the anthelmintic and antispasmodic activities of crude methanol extract of fruits of R. fruticosus on scientific grounds. Acute toxicity and brine shrimp cytotoxicity activity of the extract were also performed. Methods Acute toxicity study of crude methanol extract of R. fruticosus was performed on mice. In vitro Brine shrimp cytotoxicity assay was performed on shrimps of Artemia salina. In vitro Anthelmintic activity was tested against Raillietina spiralis and Ascaridia galli. Relaxant activities were tested on spontaneous rabbits’ jejunal preparations. Calcium chloride curves were constructed to elucidate possible mode of action of the extract. Results LD 50 of the extract for acute toxicity studies was 887.75 ± 9.22 mg/ml. While CC 50 of the extract for Brine shrimps cytotoxicity assay was 13.28 ± 2.47 μg/ml. Test samples of crude methanolic extract of R. fruticosus (Rf.Cr) at concentration 20 mg/ml showed excellent anthelmintic activity against Raillietina spiralis. Anthelmintic activity was 1.37 times of albendazole against the Raillietina spiralis at concentration 40 mg/ml. At higher concentration (40 mg/ml), Rf.Cr has 89. 83% parasiticidal activity. The mean EC50 relaxation activity for spontaneous and KCl-induced contractions was 7.96 ± 0.1 and 6.45 ± 0.29 mg/ml, respectively. EC 50 (Log[Ca++]M) for control calcium chloride curves was −1.75 ± 0.01 vs. EC 50 −1.78 ± 0.06 in the presence of 3.0 mg/ml of Rf.Cr. Similarly, EC 50(Log[Ca++]M) in the absence and presence of verapamil (0.1 μM) were −2.46 ± 0.01 and −1.72 ± 0.02, respectively. Conclusions The anthelmintic and relaxant activities explained traditional uses of R. fruticosus on scientific grounds. Relaxant activity follows the inhibition of voltage gated channels. Although the plant extract has cytotoxic effects, yet it is

  15. An evaluation of the rust fungus Gymnoconia nitensas a potential biological control agent for alien Rubus species in Hawaii

    Science.gov (United States)

    Gardner, D.E.; Hodges, C.S.; Killgore, E.; Anderson, R.C.

    1997-01-01

    The rust fungus Gymnoconia nitens infects blackberry (Rubus argutus) systemically in regions of the continental United States, producing bright yellow–orange masses of spores on newly developing floricanes during springtime. In tests to determine the suitability of this rust as a biological control agent for R. penetransin Hawaii, a species now thought to be conspecific with R. argutus,rooted cuttings of the Hawaiian plants were grown at North Carolina State University, inoculated, and observed. Other introduced weedy Rubus spp. in Hawaii, including R. ellipticus, R. rosifolius, and R. glaucus,as well as the two endemic species R. hawaiensis and R. macraei,also were inoculated. No species of Rubusare of commercial importance in Hawaii, but the protection of the native species, of which R. macraei is rare, was of utmost concern. The native Hawaiian species did not survive well in North Carolina in this study, however. Later availability of a plant pathogen containment laboratory in Hawaii enabled similar tests to be conducted at that facility. In addition to the above species, R. spectabilis (salmonberry), a species native to the Pacific Northwest with which the Hawaiian Rubus spp. are thought to share a common ancestor, was inoculated in Hawaii. Infection with G. nitens under natural field conditions becomes apparent only when sporulation occurs on floricanes the second year following infection. However, experimental inoculation led to early responses of chlorotic leaf flecking and puckering, leaf and stem contortion, and stem gall formation, indicating the sensitivity of R. penetrans (=R. argutus), R. hawaiensis, and R. macraei to this rust. Apparent systemic infection also resulted in sporulation on one plant of R. macraei. Ability to attack the endemic species suggests that G. nitens would not be suitable for release in Hawaii as a biological control agent, at least on the islands with populations of the native species.

  16. Studies in the genus Riccia (Marchantiales from southern Africa. 21. R. stricta, R. purpurascens and R. fluitans, subgenus Ricciella

    Directory of Open Access Journals (Sweden)

    S. M. Perold

    1990-12-01

    Full Text Available Lindenberg (1836 regarded and published Riccia stricta as a variety of R. fluitans L. Subsequently, Nees (1838 and Gottsche et al. (1846 also treated it as a variety. Trevisan (1877 raised its rank and published the epithet,  Ricciella stricta Trevis.Ricciella is, however, regarded as a subgenus; Ricciella stricta is, therefore, transferred to Riccia stricta (Lindenb. Perold.It is described in detail and illustrated.  R. purpurascens Lehm. & Lindenb., a related endemic species, is also more fully described than before and illustrated.  R. fluitans L. apparently does not occur naturally in southern Africa. As far as is known, a single local specimen of it was introduced.

  17. Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

    Science.gov (United States)

    Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

    2017-09-18

    Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

  18. Possible impacts of the invasive plant Rubus niveus on the native vegetation of the Scalesia forest in the Galapagos islands.

    Directory of Open Access Journals (Sweden)

    Jorge Luis Rentería

    Full Text Available Originally from Asia, Rubus niveus has become one of the most widespread invasive plant species in the Galapagos Islands. It has invaded open vegetation, shrubland and forest alike. It forms dense thickets up to 4 m high, appearing to displace native vegetation, and threaten the integrity of several native communities. This study used correlation analysis between a R. niveus cover gradient and a number of biotic (vascular plant species richness, cover and vegetation structure and abiotic (light and soil properties parameters to help understand possible impacts in one of the last remaining fragments of the Scalesia forest in Santa Cruz Island, Galapagos. Higher cover of R. niveus was associated with significantly lower native species richness and cover, and a different forest structure. Results illustrated that 60% R. niveus cover could be considered a threshold for these impacts. We suggest that a maximum of 40% R. niveus cover could be a suitable management target.

  19. Possible Impacts of the Invasive Plant Rubus niveus on the Native Vegetation of the Scalesia Forest in the Galapagos Islands

    Science.gov (United States)

    Rentería, Jorge Luis; Gardener, Mark R.; Panetta, F. Dane; Atkinson, Rachel; Crawley, Mick J.

    2012-01-01

    Originally from Asia, Rubus niveus has become one of the most widespread invasive plant species in the Galapagos Islands. It has invaded open vegetation, shrubland and forest alike. It forms dense thickets up to 4 m high, appearing to displace native vegetation, and threaten the integrity of several native communities. This study used correlation analysis between a R. niveus cover gradient and a number of biotic (vascular plant species richness, cover and vegetation structure) and abiotic (light and soil properties) parameters to help understand possible impacts in one of the last remaining fragments of the Scalesia forest in Santa Cruz Island, Galapagos. Higher cover of R. niveus was associated with significantly lower native species richness and cover, and a different forest structure. Results illustrated that 60% R. niveus cover could be considered a threshold for these impacts. We suggest that a maximum of 40% R. niveus cover could be a suitable management target. PMID:23118934

  20. Trienylfuranol A and trienylfuranone A-B: metabolites isolated from an endophytic fungus, Hypoxylon submoniticulosum, in the raspberry Rubus idaeus.

    Science.gov (United States)

    Burgess, Kevin M N; Ibrahim, Ashraf; Sørensen, Dan; Sumarah, Mark W

    2017-06-01

    A strain of Hypoxylon submonticulosum was isolated as an endophyte from a surface-sterilized leaf of a cultivated raspberry (Rubus idaeus). The liquid culture extract displayed growth inhibition activity against Saccharomyces cerevisiae using a disc diffusion assay. The extract's major component was identified as a new natural product, trienylfuranol A (1S,2S,4R)-1-((1'E,3'E)-hexa-1',3',5'-trienyl)-tetrahydro-4-methylfuran-2-ol (1), by high-resolution LC-MS and 1D and 2D NMR spectroscopy. Two additional new metabolites, trienylfuranones A (2) and B (3), were isolated as minor components of the extract and their structure elucidation revealed that they were biosynthetically related to 1. Absolute stereochemical configurations of compounds 1-3 were confirmed by NOE NMR experiments and by the preparation of Mosher esters. Complete hydrogenation of 1 yielded tetrahydrofuran 7 that was used for stereochemical characterization and assessment of antifungal activity.

  1. NMR-based metabolomic investigation of bioactivity of chemical constituents in black raspberry (Rubus occidentalis L.) fruit extracts.

    Science.gov (United States)

    Paudel, Liladhar; Wyzgoski, Faith J; Giusti, M Monica; Johnson, Jodee L; Rinaldi, Peter L; Scheerens, Joseph C; Chanon, Ann M; Bomser, Joshua A; Miller, A Raymond; Hardy, James K; Reese, R Neil

    2014-02-26

    Black raspberry (Rubus occidentalis L.) (BR) fruit extracts with differing compound profiles have shown variable antiproliferative activities against HT-29 colon cancer cell lines. This study used partial least-squares (PLS) regression analysis to develop a high-resolution (1)H NMR-based multivariate statistical model for discerning the biological activity of BR constituents. This model identified specific bioactive compounds and ascertained their relative contribution against cancer cell proliferation. Cyanidin 3-rutinoside and cyanidin 3-xylosylrutinoside were the predominant contributors to the extract bioactivity, but salicylic acid derivatives (e.g., salicylic acid glucosyl ester), quercetin 3-glucoside, quercetin 3-rutinoside, p-coumaric acid, epicatechin, methyl ellagic acid derivatives (e.g., methyl ellagic acetyl pentose), and citric acid derivatives also contributed significantly to the antiproliferative activity of the berry extracts. This approach enabled the identification of new bioactive components in BR fruits and demonstrates the utility of the method for assessing chemopreventive compounds in foods and food products.

  2. Exact Derivation of a Finite-Size Scaling Law and Corrections to Scaling in the Geometric Galton-Watson Process

    Science.gov (United States)

    Corral, Álvaro; Garcia-Millan, Rosalba; Font-Clos, Francesc

    2016-01-01

    The theory of finite-size scaling explains how the singular behavior of thermodynamic quantities in the critical point of a phase transition emerges when the size of the system becomes infinite. Usually, this theory is presented in a phenomenological way. Here, we exactly demonstrate the existence of a finite-size scaling law for the Galton-Watson branching processes when the number of offsprings of each individual follows either a geometric distribution or a generalized geometric distribution. We also derive the corrections to scaling and the limits of validity of the finite-size scaling law away the critical point. A mapping between branching processes and random walks allows us to establish that these results also hold for the latter case, for which the order parameter turns out to be the probability of hitting a distant boundary. PMID:27584596

  3. Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

    Directory of Open Access Journals (Sweden)

    Gabriele Guidi

    2016-07-01

    Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

  4. Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

    Science.gov (United States)

    Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

    2014-01-01

    The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

  5. Two new species and a new subgenus of toothed Brachyhypopomus electric knifefishes (Gymnotiformes, Hypopomidae) from the central Amazon and considerations pertaining to the evolution of a monophasic electric organ discharge

    OpenAIRE

    Sullivan,John P.; Zuanon,Jansen; Cox Fernandes,Cristina

    2013-01-01

    We describe two new, closely related species of toothed Brachyhypopomus (Hypopomidae: Gymnotiformes: Teleostei) from the central Amazon basin and create a new subgenus for them. Odontohypopomus, new subgenus of Brachyhypopomus, is diagnosed by (1) small teeth present on premaxillae; (2) medialmost two branchiostegal rays thin with blades oriented more vertically than remaining three rays; (3) background color in life (and to lesser extent in preservation) distinctly yellowish with head and si...

  6. Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

    2018-02-01

    Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

  7. Construction of black (Rubus occidentalis) and red (R. idaeus) raspberry linkage maps and their comparison to the genomes of strawberry, apple, and peach.

    Science.gov (United States)

    Bushakra, J M; Stephens, M J; Atmadjaja, A N; Lewers, K S; Symonds, V V; Udall, J A; Chagné, D; Buck, E J; Gardiner, S E

    2012-07-01

    The genus Rubus belongs to the Rosaceae and is comprised of 600-800 species distributed world-wide. To date, genetic maps of the genus consist largely of non-transferable markers such as amplified fragment length polymorphisms. An F(1) population developed from a cross between an advanced breeding selection of Rubus occidentalis (96395S1) and R. idaeus 'Latham' was used to construct a new genetic map consisting of DNA sequence-based markers. The genetic linkage maps presented here are constructed of 131 markers on at least one of the two parental maps. The majority of the markers are orthologous, including 14 Rosaceae conserved orthologous set markers, and 60 new gene-based markers developed for raspberry. Thirty-four published raspberry simple sequence repeat markers were used to align the new maps to published raspberry maps. The 96395S1 genetic map consists of six linkage groups (LG) and covers 309 cM with an average of 10 cM between markers; the 'Latham' genetic map consists of seven LG and covers 561 cM with an average of 5 cM between markers. We used BLAST analysis to align the orthologous sequences used to design primer pairs for Rubus genetic mapping with the genome sequences of Fragaria vesca 'Hawaii 4', Malus × domestica 'Golden Delicious', and Prunus 'Lovell'. The alignment of the orthologous markers designed here suggests that the genomes of Rubus and Fragaria have a high degree of synteny and that synteny decreases with phylogenetic distance. Our results give unprecedented insights into the genome evolution of raspberry from the putative ancestral genome of the single ancestor common to Rosaceae.

  8. Evaluación de un sistema para la micorrización in vitro en plantas de mora de castilla (Rubus glaucus, Benth

    Directory of Open Access Journals (Sweden)

    Víctor Manuel Núñez-Zarante

    2012-08-01

    Full Text Available Evaluation of an in vitro mycorrhization system of blackberry plants (Rubus glaucus, Benth. Objective. Obtain an in vitromycorrhization system in autotrophic culture systems of blackberry plants (Rubus glaucus, Benth. Materials and methods. We usedspores and root fragments with vesicles of Arbuscular Mycorrhizal Fungus (AMF Glomus sp (GEV02. We established an autotrophicculture system of blackberry plantlets comparing two methods of direct inoculation of the AMF. We measured the number of sporesproduced, the length of the extraradical mycelium as well as the percentage of colonization of the AMF. Additionally, we measuredthe shoot and root length, and the fresh and dry weight of the leaf and root parts to determine the plant development. Results. Theautotrophic culture system was successful for blackberry plants (Rubus glaucus, Benth; an optimal shoot and root growth was observed.Additionally, we obtained a system that allowed the development of Glomus sp. in in vitro conditions, with the formation of structurestypical of the symbiosis as well as a good intraradical colonization, with the production of arbuscules and vesicles, development ofextraradical mycelium with branched hyphae, and formation of new spores. Conclusion. For the first time, micropropagated blackberryplants associated successfully with an AMF under in vitro conditions, enabling the development of the symbiotic system AMF Glomussp. associated to roots of micropropagated blackberry plantlets.

  9. Taxonomic review on the subgenus Tripodura Townes (Diptera: Chironomidae: Polypedilum) from China with eleven new species and a supplementary world checklist.

    Science.gov (United States)

    Zhang, Ruilei; Song, Chao; Qi, Xin; Wang, Xinhua

    2016-07-05

    The subgenus Tripodura Townes of Polypedilum Kieffer from China including 26 species is reviewed. Eleven new species, named P. (T.) absensilobum Zhang & Wang sp. n., P. (T.) apiculusetosum Zhang & Wang sp. n., P. (T.) arcuatum Zhang & Wang sp. n., P. (T.) bilamella Zhang & Wang sp. n., P. (T.) conghuaense Zhang & Wang sp. n., P. (T.) dengae Zhang & Wang sp. n., P. (T.) mengmanense Zhang & Wang sp. n., P. (T.) napahaiense Zhang & Wang sp. n., P. (T.) parallelum Zhang & Wang sp. n., P. (T.) pollicium Zhang & Wang sp. n. and P. (T.) trapezium Zhang & Wang sp. n. are described and illustrated based on male imagines. Three species, P. (T.) quadriguttatum Kieffer, P. (T.) unifascia (Tokunaga) and P. (T.) udominutum Niitsuma are firstly recorded in China. A key to known male imagines of Chinese species and an updated world checklist of subgenus Tripodura are presented.

  10. On the colour types in Lycodes nakamurae (Tanaka, 1914) and species composition of the subgenus Furcimanus (Perciformes: Zoarcidae: Lycodes) in the sea of Japan.

    Science.gov (United States)

    Saveliev, Pavel A; Balanov, Andrey A; Kukhlevskii, Andrey D

    2014-05-30

    Two colour types were revealed in a zoarcid fish of the subgenus Furcimanus, genus Lycodes, in the Sea of Japan. A comparison of morphometric, meristic and genetic characters in dark coloured and light coloured individuals suggests that the two colour morphs represent a single species, determined to be Lycodes nakamurae (Tanaka, 1914). Variability in colouration within L. nakamurae and a lack of morphological or molecular characters distinguishing L. nakamurae from L. nishimurai Shinohara & Shirai, 2005 suggest that the latter should be considered a synonym of L. nakamurae (Tanaka, 1914). A record of L. pectoralis in the waters of the Republic of Korea is regarded as a misidentification. Thus, we conclude that only one species of the Lycodes subgenus Furcimanus, L. nakamurae, with dark and light colour morphs as well as specimens of intermediate colouration, inhabits the Sea of Japan.

  11. A taxonomic review of Korean species of the Atheta Thomson subgenus Microdota Mulsant & Rey, with descriptions of two new species (Coleoptera, Staphylinidae, Aleocharinae

    Directory of Open Access Journals (Sweden)

    Seung-Gyu Lee

    2015-05-01

    Full Text Available A taxonomic review of the Atheta Thomson subgenus Microdota Mulsant & Rey in Korea is presented. The subgenus is represented in Korea by 15 species including two new species, Atheta (Microdota jangtaesanensis Lee & Ahn, sp. n. and A. (M. pasniki Lee & Ahn, sp. n. Four species [A. (M. kawachiensis Cameron, A. (M. muris Sawada, A. (M. spiniventris Bernhauer, and A. (M. spinula (Sawada] are new to the Korean Peninsula and two [A. (M. formicetorum Bernhauer and A. (M. subcrenulata Bernhauer] to South Korea. Two other species [A. (M. kobensis Cameron and A. (M. scrobicollis (Kraatz] previously recorded in North Korea had been identified incorrectly. A key, descriptions, habitus photographs and illustrations of the diagnostic features are provided. Species distributions and diversity in East Asia are discussed.

  12. The Mosquitoes of the Subgenus Culex in Southwestern Asia and Egypt (Diptera: Culicidae) (Contributions of the American Entomological Institute. Volume 24, Number 1, 1988)

    Science.gov (United States)

    1988-01-01

    data: “Type // Entebbe / Dr. Row // Culex / quasigelidus / (Type) Theobald // Entebbe. / bred from / larvae. / Sep . 20. 02”; left wing mounted on...Bigot, J.M.F. 1857. Dipteros, pp. 328-349. In: R. de la Sagra, Historia fisica, politica y natural de la lsla de Cuba. Vol. 7. Paris. 1859. Dipteres de...Naturaleza Mexico 7: 203-213. Harbach: Subgenus Culex in Southwestern Asia 135 Say, T. 1823. Descriptions of dipterous insects of the United States

  13. La mirada de Watson, Parse y Benner para el análisis complejo y la buena práctica The glance of Watson, Pair and Benner for the complex analysis and the good practice

    Directory of Open Access Journals (Sweden)

    Sagrario Acebedo-Urdiales

    2007-06-01

    Full Text Available La necesidad de encontrar el significado y orden del quehacer enfermero por encima de especialidades, culturas, tareas, funciones o competencias, hace necesario llevar a la práctica teorías y conceptos de análisis que se puedan insertar en cada situación, como fundamento que guía la buena práctica enfermera. Los modelos y filosofías enfermeras nos dan elementos de reflexión, nos siembran la duda respecto a la práctica, nos dan elementos de investigación y cuando los integramos o nos reconocemos en ellos, además de flexibilizar la interpretación y el cuidado persona-situación, colocan a la enfermería dentro de su marco más maduro consistente con el modelo de Nithingale actualizado. Este trabajo tiene como objetivo plantear lo que para nosotras son los elementos básicos de las filosofías y teorías de Watson, Parse y Benner, que nos permiten el análisis complejo de las situaciones de cuidados y la comprensión del juicio clínico, que emerge de la práctica como acontecimiento real. El paradigma de la complejidad nos lleva a prácticas responsables, a estar no en objetivos, sino en procesos, no en partes o en todos sino en individuos que son a la vez sujeto-objeto.The need to find the meaning of nursing activity independently of specialties, cultures, tasks, functions or competences, leads us to the usage of theories and concepts of analysis than can be applied in each situation, as a guide for the right nursing activity. Nursing philosophies and models provide us elements of reflection, creating doubts in relation to the practice, and once they are assumed, we recognize ourselves on them, helping us to the interpretation of the person-situation caring, carrying nursing to its matures side, validating Nigthingale's model. This work has the aim of implanting the basic elements of Watson, Parse and Benner's theories in order to analyze situations of caring and understand the clinical judgment emerging from the practice. The

  14. Rhynchelmis subgenus Sutroa Eisen new rank, with two new species from western North America (Annelida, Clitellata, Lumbriculidae).

    Science.gov (United States)

    Fend, Steven V; Carter, James L

    2014-01-31

    The lumbriculid Rhynchelmis subgenus Sutroa Eisen, 1888 new rank is defined for a group of Nearctic species having multiple diverticula originating at the spermathecal ducts and eversible penial bulbs. Characters are confirmed in specimens of the type species, Rhynchelmis (Sutroa) rostrata (Eisen, 1888), collected from the type locality. Rhynchelmis (Sutroa) klamathensis Fend n. sp. is described from open water benthic habitats in Upper Klamath Lake, Oregon, USA. It resembles other R. (Sutroa) species in the paired spermathecal diverticula, the spermathecal and penial bulbs, the histological structure of the atria, the nonfunctional anterior male funnels, and the arrangement of blood vessels. Rhynchelmis klamathensis differs from all Nearctic Rhynchelmis in lacking a filiform proboscis. The combination of large body size, the elongate spermathecal ducts with paired and usually unbranched diverticula, the highly contorted atria, and the complex male pores with conical penes also distinguish typical R. klamathensis from other Rhynchelmis species. Smaller specimens with otherwise similar morphology, from the Sacramento River Delta, California, are also assigned to this species. Rhynchelmis (Sutroa) diespluviae Fend n. sp. is described from several stream sites, mostly in northern Idaho, USA. Rhynchelmis diespluviae differs from closely related species in morphology of the conical penes, and in the structure and anterolateral position of the paired spermathecae.

  15. Species delimitation of three species within the Russula subgenus Compacta in Korea: R. eccentrica, R. nigricans, and R. subnigricans.

    Science.gov (United States)

    Park, Myung Soo; Lee, Hyun; Oh, Seung-Yoon; Jung, Paul Eunil; Seok, Soon Ja; Fong, Jonathan J; Lim, Young Woon

    2014-08-01

    Distinguishing individual Russula species can be very difficult due to extensive phenotypic plasticity and obscure morphological and anatomical discontinuities. In this study, we use the internal transcribed spacer (ITS) and 28S nuclear ribosomal large subunit (LSU) markers to identify and study the genetic diversity of species in the Russula subgenus Compacta in Korea. We focus on two morphologically similar species that are often misidentified for each other: R. nigricans and R. subnigricans. Based on molecular phylogenetic analyses, we identify three subgroups of R. nigricans, with two from Asia and one from Europe/North America. Surprisingly, we find Korean R. subnigricans are more closely related to R. eccentrica from North America than the type specimen of R. subnigricans from Japan. These molecular data, along with habitat data, reveal that Korean R. subnigricans had previously been misclassified and should now be recognized as R. eccentrica. Both ITS and LSU exhibit high interspecific and low intraspecific variation for R. eccentrica, R. nigricans, and R. subnigricans. These markers provide enough resolutional power to differentiate these species and uncover phylogeographic structure, and will be powerful tools for future ecological studies of Russula.

  16. A new extinct dwarfed buffalo from Sulawesi and the evolution of the subgenus Anoa: An interdisciplinary perspective

    Science.gov (United States)

    Rozzi, Roberto

    2017-02-01

    The fossil and extant faunas of Sulawesi, the largest island within the Wallacea biogeographic region, exhibit a high degree of endemism. The lowland anoa Bubalus depressicornis and the mountain anoa Bubalus quarlesi, two closely-related dwarfed buffaloes, are among the most peculiar endemic mammals of the region. Here, I describe a new species, Bubalus grovesi, from the Late Pleistocene/Holocene of South Sulawesi and I give a revised diagnosis of Anoa. Bubalus grovesi sp. nov. differs from all previously described Bubalus in both the size and proportions of the skeleton and in possessing a unique combination of discrete character states. Body mass estimates suggest an average mass of 117 kg for Bubalus grovesi sp. nov. and a body size reduction of about 90% with respect to a typical water buffalo. A comprehensive overview of body mass estimates of dwarfed buffaloes and differences in their dental and postcranial features is included. Finally, new evidence on the taxonomy and island dwarfing of the anoas and available data from different disciplines are used to discuss the timing and mode of their evolution. The representatives of the subgenus Anoa would be dwarfed forms of the Asian water buffalo that arose following dispersal to Sulawesi during the Middle/Late Pleistocene.

  17. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  18. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  19. UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

  20. Effect of Thermoultrasound on the Antioxidant Compounds and Fatty Acid Profile of Blackberry (Rubus fruticosus spp. Juice

    Directory of Open Access Journals (Sweden)

    José de Jesús Manríquez-Torres

    2016-11-01

    Full Text Available Blackberry (Rubus fruticosus spp. fruit has high antioxidant activity due to its significant content of anthocyanins and antioxidant compounds. Among emerging technologies for food preservation, thermoultrasound is a technique that reduces microbial loads and releases compounds with antioxidant properties. The objective of this study was to determine the antioxidant content and fatty acid profile of blackberry juice subjected to thermoultrasound treatment in comparison to pasteurized juice. Blackberry juice and n-hexane extracts from a control (untreated juice, pasteurized, and thermoultrasonicated samples were evaluated for antioxidant activity, fatty acid profile, and antioxidant content. The juice treated with thermoultrasound exhibited significantly (p < 0.05 higher levels of total phenols (1011 mg GAE/L, anthocyanins (118 mg Cy-3-GlE/L; antioxidant activity by ABTS (44 mg VCEAC/L and DPPH (2665 µmol TE/L in comparison to the control and pasteurized samples. Oil extract from thermoultrasound juice also had the highest antioxidant activity (177.5 mg VCEAC/L and 1802.6 µmol TE/L. The fatty acid profile of the n-hexane extracts showed the presence of myristic, linolenic, stearic, oleic, and linoleic acids and was not affected by the treatments except for stearic acid, whose amount was particularly higher in the control. Our results demonstrated that thermoultrasound can be an alternative technology to pasteurization that maintains and releases antioxidant compounds and preserves the fatty acids of fruit juice.

  1. Rubus imperialis (Rosaceae) extract and pure compound niga-ichigoside F1: wound healing and anti-inflammatory effects.

    Science.gov (United States)

    Tonin, Talita Dacroce; Thiesen, Liliani Carolini; de Oliveira Nunes, Maria Luisa; Broering, Milena Fronza; Donato, Marcos Paulo; Goss, Marina Jagielski; Petreanu, Marcel; Niero, Rivaldo; Machado, Isabel Daufenback; Santin, José Roberto

    2016-11-01

    Here, we evaluate the anti-inflammatory and wound-healing effects of methanolic crude extract obtained from aerial parts (leaves and branches) of Rubus imperialis Chum. Schl. (Rosaceae) and the pure compound niga-ichigoside F1. Anti-inflammatory activity was determined in vivo and in vitro, and the healing effect was evaluated in surgical lesions in mice skin. The 1,1-diphenyl-2-picrylhydrazyl radical (DPPH) assay and H2O2-induced oxidative stress were used to determine antioxidant activity. The efferocytosis activity was also determined. The data obtained show that the extract of R. imperialis promote reduction in the inflammatory process induced by lipopolysaccharide (LPS) or carrageenan in the air pouch model; the effects could be reinforced by nitric oxide reduction in LPS-stimulated neutrophils, and an increase in the efferocytosis. The extract showed wound healing property in vitro and in vivo, scavenging activity for DPPH, and cytoprotection in the H2O2-induced oxidative stress in L929 cells. In addition, the compound niga-ichigoside F1 was able to reduce the NO secretion; however, it did not present wound-healing activity in vitro. Together, the data obtained point out the modulatory actions of R. imperialis extract on leukocyte migration to the inflamed tissue, the antioxidant, and the pro-resolutive activity. However, the R. imperialis anti-inflammatory activity may be mediated in parts by niga-ichigoside F1, and on wound healing do not correlated with niga-ichigoside F1.

  2. Purification of a water extract of Chinese sweet tea plant (Rubus suavissimus S. Lee) by alcohol precipitation.

    Science.gov (United States)

    Koh, Gar Yee; Chou, Guixin; Liu, Zhijun

    2009-06-10

    The aqueous extraction process of the leaves of Rubus suavissimus often brings in a large amount of nonactive polysaccharides as part of the constituents. To purify this water extract for potential elevated bioactivity, an alcohol precipitation (AP) consisting of gradient regimens was applied, and its resultants were examined through colorimetric and HPLC analyses. AP was effective in partitioning the aqueous crude extract into a soluble supernatant and an insoluble precipitant, and its effect varied significantly with alcohol regimens. Generally, the higher the alcohol concentration, the purer was the resultant extract. At its maximum, approximately 36% (w/w) of the crude extract, of which 23% was polysaccharides, was precipitated and removed, resulting in a purified extract consisting of over 20% bioactive marker compounds (gallic acid, ellagic acid, rutin, rubusoside, and steviol monoside). The removal of 11% polysaccharides from the crude water extract by using alcohol precipitation was complete at 70% alcohol regimen. Higher alcohol levels resulted in even purer extracts, possibly by removing some compounds of uncertain bioactivity. Alcohol precipitation is an effective way of removing polysaccharides from the water extract of the sweet tea plant and could be used as an initial simple purification tool for many water plant extracts that contain large amounts of polysaccharides.

  3. Further study on the 1,4-alpha-transglucosylation of rubusoside, a sweet steviol-bisglucoside from Rubus suavissimus.

    Science.gov (United States)

    Ohtani, K; Aikawa, Y; Ishikawa, H; Kasai, R; Kitahata, S; Mizutani, K; Doi, S; Nakaura, M; Tanaka, O

    1991-02-01

    Rubusoside (the beta-D-glucosyl ester of 13-O-beta-D-glucosyl-steviol), which is the major sweet principle of leaves of Rubus suavissimus S. Lee, was subjected to 1,4-alpha-transglucosylation by the cyclodextringlucanotransferase-starch system (the CGTase system). The tri- and tetra-glucosylated products were isolated together with the mono- and di-glucosylated products, which had already been isolated. A prominent increase in intensity of the sweetness was observed for the compounds which were di- and tri-glucosylated at the 13-O-glucosyl moiety. This result further substantiated the structure-sweetness relationship for 1,4-alpha-glucosylated compounds of steviol-glycosides reported previously. For protection of the 19-COO-glucosyl moiety against glucosylation by the CGTase system, the 4-hydroxyl group of the 19-COO-glucosyl moiety was beta-galactosylated by the beta-galactosidase-lactose system. This galactosylated compound was subjected to a regio-selective glucosylation of the 13-O-glucosyl moiety by the CGTase system, which was followed by enzymic elimination of the galactosyl group to furnish an exclusive preparation of the improved sweeteners just mentioned.

  4. Characterization of the antibacterial activity and the chemical components of the volatile oil of the leaves of Rubus parvifolius L.

    Science.gov (United States)

    Cai, Yongqing; Hu, Xiaogang; Huang, Mingchun; Sun, Fengjun; Yang, Bo; He, Juying; Wang, Xianfeng; Xia, Peiyuan; Chen, Jianhong

    2012-06-25

    Rubus parvifolius L. (Rp) is a medicinal herb that possesses antibacterial activity. In this study, we extracted the volatile oil from the leaves of Rp to assess its antibacterial activity and analyze its chemical composition. A uniform distribution design was used to optimize the extraction procedure, which yielded 0.36% (w/w) of light yellowish oil from the water extract of Rp leaves. We found that the extracted oil effectively inhibited the growth of a wide range of Gram positive and negative bacteria, including Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumanii, Bacillus cloacae, and Klebsiella pneumoniae. We further analyzed the components contained in the hydro-distillated Rp volatile oil by gas chromatography-mass spectroscopy. Twenty nine compounds were identified, including 4-hydroxy-3-methoxystyrene (66%), 3,7,11,15-tetramethyl-2-hexadecen-1-ol (10%) and 4-tert-butylbenzoic acid (2%). Our results suggest that one or multiple constituents contained in Rp volatile oil may account for its antibacterial activity.

  5. Metabolite Profiling Reveals the Effect of Dietary Rubus coreanus Vinegar on Ovariectomy-Induced Osteoporosis in a Rat Model.

    Science.gov (United States)

    Lee, Mee Youn; Kim, Hyang Yeon; Singh, Digar; Yeo, Soo Hwan; Baek, Seong Yeol; Park, Yoo Kyoung; Lee, Choong Hwan

    2016-01-26

    The study was aimed at exploring the curative effects of Rubus coreanus (RC) vinegar against postmenopausal osteoporosis by using ovariectomized rats as a model. The investigations were performed in five groups: sham, ovariectomized (OVX) rats without treatment, low-dose RC vinegar (LRV)-treated OVX rats, high-dose RC vinegar (HRV)-treated OVX rats and alendronate (ALEN)-treated OVX rats. The efficacy of RC vinegar was evaluated using physical, biochemical, histological and metabolomic parameters. Compared to the OVX rats, the LRV and HRV groups showed positive effects on the aforementioned parameters, indicating estrogen regulation. Plasma metabolome analysis of the groups using gas chromatography-time of flight mass spectrometry (GC-TOF-MS) and ultra-performance liquid chromatography quadrupole-TOF-MS (UPLC-Q-TOF-MS) with multivariate analysis revealed 19 and 16 metabolites, respectively. Notably, the levels of butyric acid, phenylalanine, glucose, tryptophan and some lysophosphatidylcholines were marginally increased in RC vinegar-treated groups compared to OVX. However, the pattern of metabolite levels in RC vinegar-treated groups was found similar to ALEN, but differed significantly from that in sham group. The results highlight the prophylactic and curative potential of dietary vinegar against postmenopausal osteoporosis. RC vinegar could be an effective natural alternative for the prevention of postmenopausal osteoporosis.

  6. Metabolite Profiling Reveals the Effect of Dietary Rubus coreanus Vinegar on Ovariectomy-Induced Osteoporosis in a Rat Model

    Directory of Open Access Journals (Sweden)

    Mee Youn Lee

    2016-01-01

    Full Text Available The study was aimed at exploring the curative effects of Rubus coreanus (RC vinegar against postmenopausal osteoporosis by using ovariectomized rats as a model. The investigations were performed in five groups: sham, ovariectomized (OVX rats without treatment, low-dose RC vinegar (LRV-treated OVX rats, high-dose RC vinegar (HRV-treated OVX rats and alendronate (ALEN-treated OVX rats. The efficacy of RC vinegar was evaluated using physical, biochemical, histological and metabolomic parameters. Compared to the OVX rats, the LRV and HRV groups showed positive effects on the aforementioned parameters, indicating estrogen regulation. Plasma metabolome analysis of the groups using gas chromatography-time of flight mass spectrometry (GC-TOF-MS and ultra-performance liquid chromatography quadrupole-TOF-MS (UPLC-Q-TOF-MS with multivariate analysis revealed 19 and 16 metabolites, respectively. Notably, the levels of butyric acid, phenylalanine, glucose, tryptophan and some lysophosphatidylcholines were marginally increased in RC vinegar-treated groups compared to OVX. However, the pattern of metabolite levels in RC vinegar-treated groups was found similar to ALEN, but differed significantly from that in sham group. The results highlight the prophylactic and curative potential of dietary vinegar against postmenopausal osteoporosis. RC vinegar could be an effective natural alternative for the prevention of postmenopausal osteoporosis.

  7. [Characteristics of the composition of Caucasian blackberry (Rubus caucasicus L.) leaves as a raw material for tea production].

    Science.gov (United States)

    Melkadze, R G; Chichkovani, N Sh; Kakhniashvili, E Z

    2008-01-01

    The composition of Caucasian blackberry (Rubus caucasicus L.) six-leaf shoot was studied. The weight of the stem reached 50% of the total weight of the shoot. The content of moisture, extractive substances, and phenolic compounds was minimal at the beginning and end of the vegetation season. Phenolic compounds were represented by catechins, leukoanthocyanidins, and flavonols. The most abundant phenolic compounds in all parts of the blackberry shoot were leukoanthocyanidins, which accounted for approximately 50% of all compounds of this class. Phenolic compounds accumulated most actively in July and August. The average content of free amino acids in the blackberry leaf during the vegetation season was 26.68 mg/g. Among the total free amino acids, eleven have been identified, five of which proved to be essential (His, Arg, Met, Leu, Val) and accounted for 40% of the total amount of amino acids. The oxidability of acetone extract of the blackberry leaf was compared to the oxidability of total phenolic compounds and tea tannin. The tea product obtained from the blackberry leaf had good organoleptic parameters and a saturated extractive complex.

  8. In vitro antioxidant activity of dewberry (Rubus caesius L. var. aquáticus Weihe. & Nees. leaf extracts

    Directory of Open Access Journals (Sweden)

    Veličković Ivona

    2015-01-01

    Full Text Available In this study, the antioxidant properties and total phenolic and flavonoid contents of Rubus caesius L. var. aquáticus Weihe & Nees leaf extracts were examined. The radical scavenging capacity of four leaf extracts (methanol, ethanol, acetone and aqueous was estimated against 2,2-diphenyl-1-picrylhydrazil (DPPH and 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS assays. Total antioxidant capacity was tested by ferric reducing ability of plasma (FRAP and total reducing capacity (TRC procedures. Total contents of phenols and flavonoids were also determined. Total phenol content in the extracts was determined using Folin-Ciocalteu reagent and amounts ranged between 263.74 for ethanol to 366.27 mg gallic acid (GA/g for acetone extracts. The amounts of flavonoids varied from 10.73 mg quercetin equivalent (QE/g for aqueous to 75.83 mg QE/g for acetone extract. The highest antioxidant activity against DPPH and ABTS●+ radicals was that of the acetone extract. Values for FRAP varied between 3.00 μmol Fe+2/mg for the ethanol extract and 5.31 μmol Fe+2/mg for the methanol extract. The results obtained for total reducing capacity indicate that the acetone extract has the highest antioxidant potential. [Projekat Ministarstva nauke Republike Srbije, br. 173029

  9. Adaptation in Caco-2 Human Intestinal Cell Differentiation and Phenolic Transport with Chronic Exposure to Blackberry (Rubus sp.) Extract.

    Science.gov (United States)

    Redan, Benjamin W; Albaugh, George P; Charron, Craig S; Novotny, Janet A; Ferruzzi, Mario G

    2017-04-05

    As evidence mounts for a health-protective role of dietary phenolics, the importance of understanding factors influencing bioavailability increases. Recent evidence has suggested chronic exposure to phenolics may impact their absorption and metabolism. To explore alterations occurring from chronic dietary exposure to phenolics, Caco-2 cell monolayers were differentiated on Transwell inserts with 0-10 μM blackberry (Rubus sp.) total phenolics extracts rich in anthocyanins, flavonols, and phenolic acids. Following differentiation, apical to basolateral transport of phenolics was assessed from an acute treatment of 100 μM blackberry phenolics from 0 to 4 h. Additionally, differences in gene expression of transport and phase II metabolizing systems including ABC transporters, organic anion transporters (OATs), and uridine 5'-diphospho (UDP) glucuronosyltransferases (UGTs) were probed. After 4 h, 1 μM pretreated monolayers showed a significant (P transport including less epicatechin (42.1 ± 0.53), kaempferol glucoside (23.5 ± 0.29), and dicaffeoylquinic acid (31.9 ± 0.20) compared to control. Finally, significant (P transport proteins were observed with treatment. Therefore, adaptation to blackberry extract exposure may impact intestinal transport and metabolism of phenolics.

  10. Local Ecological Knowledge and Importance of Bakeapple (Rubus chamaemorus L. in a Southeast Labrador Métis Community

    Directory of Open Access Journals (Sweden)

    Amanda L. Karst

    2011-07-01

    Full Text Available Bakeapple, or cloudberry (Rubus chamaemorus L.; Rosaceae is a circumpolar perennial with orange aggregate fruits, which has been a vital food resource for many northern peoples including those of the Subarctic and Arctic areas of North America. This study documented the importance and local knowledge of bakeapple in the predominantly Métis community of Charlottetown, Labrador. The cultural importance of bakeapple is evidenced by the social customs surrounding its picking, by its prevalence in people’s homes and at community events, and by its formal and informal economic exchange, within and outside the community. The local ecological knowledge of bakeapple that residents of Charlottetown possessed also illustrates its importance. Local knowledge of interviewees included different habitat types associated with various bakeapple densities and fruit sizes, bakeapple development/phenology (e.g., “turned in” stage and variations in the berry (e.g. in color and size. Bakeapple remains a culturally important species with a high profile in Charlottetown, although lack of interest in bakeapple picking by younger people may affect future use.

  11. Optimization of microwave-assisted extraction for anthocyanins, polyphenols, and antioxidants from raspberry (Rubus Coreanus Miq.) using response surface methodology.

    Science.gov (United States)

    Teng, Hui; Lee, Won Young; Choi, Yong Hee

    2013-09-01

    Anthocyanins (Acys), polyphenols, and antioxidants were extracted from raspberry (Rubus Coreanus Miq.) using a highly efficient microwave-assisted extraction technique. Different solvents, including methanol, ethanol, and acetone, were tested. The colors of the extracts varied from light yellow to purple red or dark red. SEM and other nutrient analyses verified that ethanol was the most favorable medium for the microwave-assisted extraction of raspberry due to its high output and low toxicity. Effects of process parameters, including microwave power, irradiation time, and solvent concentration, were investigated through response surface methodology. Canonical analysis estimated that the highest total Acys content, total polyphenols content, and antioxidant activity of raspberry were 17.93 mg cyanidin-3-O-glucoside equivalents per gram dry weight, 38.57 mg gallic acid equivalents per gram dry weight, and 81.24%, respectively. The polyphenol compositions of raspberry extract were identified by HPLC with diode array detection, and nine kinds of polyphenols were identified and quantified, revealing that chlorogenic acid, syringic acid, and rutin are the major polyphenols contained in raspberry fruits. Compared with other fruits and vegetables, raspberry contains higher Acy and polyphenol contents with stronger antioxidant activity, suggesting that raspberry fruits are a good source of natural food colorants and antioxidants. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. A revision of the species of the pseudoscorpion subgenus Chthonius (Ephippiochthonius) (Arachnida, Pseudoscorpiones, Chthoniidae) from Italy and neighbouring areas.

    Science.gov (United States)

    Gardini, Giulio

    2013-01-01

    A taxonomic revision and a key to the species of the subgenus Chthonius (Ephippiochthonius) Beier, 1930 from Italy, Corsica and the Swiss Canton of Ticino are provided. The species are arranged in two species-groups (tetrachelatus group and fuscimanus group) on the basis of the shape of pedipalpal hand and of the type of dentition of the fixed and movable chelal fingers. The following new species are described: i) in the tetrachelatus group: Chthonius (E.) altamurae n. sp. (♀, loc. typ.: Apulia, Bari Prov., Altamura, Grotta Lamalunga 1295 Pu/BA), C. (E.) elymus n. sp. (♂, loc. typ.: Sicily, Trapani Prov., Custonaci, Abisso del Purgatorio 8064 Si/TP), Chthonius (E.) messapicus n. sp. (♂, loc. typ.: Apulia, Brindisi Prov., San Pietro Vernotico, Cerano); ii) in the fuscimanus group: C. (E.) aeneae n. sp. (♂♀, loc. typ.: Liguria, Genoa Prov., Sestri Levante, Punta Manara), C. (E.) etruscus n. sp. (♂♀, loc. typ.: Tuscany, Grosseto Prov., Semproniano, Grotta di Montecchio 254 To/GR), C. (E.) gallii n. sp. (♂♀, loc. typ.: Liguria, Savona Prov., Bergeggi), C. (E.) intemelius n. sp. (♂♀, loc. typ.: Liguria, Imperia Prov., Apricale, Mt Cianela), C. (E.) latellai n. sp. (♂♀, loc. typ.: Latium, Latina Prov., Bassiano, Grotta di Fiume Coperto 1361 La/LT), C. (E.) ligur n. sp. (♂♀, loc. typ.: Liguria, Imperia Prov., near Baiardo), C. (E.) magrinii n. sp. (♂, loc. typ.: Latium, Frosinone Prov., San Giovanni Incarico, Grotta sulla strada per il Santuario della Madonna della Guardia n. c. La/FR), C. (E.) monguzzii n. sp. (♂♀, loc. typ.: Lombardia, Brescia Prov., Sulzano, Oricina de la Pofa del Giardì 438 Lo/BS), C. (E.) sulphureus n. sp. (♂♀, loc. typ.: Marche, Ancona Prov., Genga, Grotta di Frasassi 1 Ma/AN), C. (E.) tyrrhenicus n. sp. (♂♀, loc. typ.: Liguria, Genoa Prov., Genoa, Quinto al Mare, Mt Moro). The following new synonymies are proposed: Chthonius (E.) bauneensis Callaini, 1983 is a junior subjective synonym of C. (E

  13. Identification of Sand flies of the Subgenus Larroussius based on Molecular and Morphological Characters in North Western Iran

    Directory of Open Access Journals (Sweden)

    A Absavaran

    2009-12-01

    Full Text Available Background: The adult female sand flies (Diptera: Psychodidae of the subgenus Larroussius are important vectors of Leishmania infantum (Kinetoplastida: Tripanosomatidae in Meshkinshahr district, Northwest of Iran. Four Phle­boto­mus (Larroussius species are present in this area, i.e. Phlebotomus (Larroussius kandelakii, P. (La. major, P. (La. perfiliewi and P. (La. tobbi. The objective of the present study was to identify and distinguish the females of P. per­filiewi, P. major and P. tobbi, in this district.Methods: Adult sand flies were collected with sticky papers, CDC light traps, and aspirator in 2006. Individual sand flies of this four species from thirty different locations were characterized morphologically and by comparative DNA se­quences analyses of a fragment of mitochondrial gene Cytochrome b (Cyt b and nuclear gene Elongation Factor 1- al­pha (EF-1α. PCR amplification was carried out for all three species P. major, P. perfiliewi and P. tobbi in the sub­ge­nus Larroussius.Results: Phylogenetic analyses of P. major populations in this study displayed two different populations and genetic di­ver­sity. Spermathecal segment number, pharyngeal armature and other morphological characters of these three spe­cies were examined and found to present consistent interspecific differences.Conclusion: According to our findings, the phylogeny of Cyt b and EF-1α haplotypes confirms the relationships be­tween P. major, P. tobbi and P. perfiliewi as already defined by their morphological similarities.

  14. Application of multiple DNA fingerprinting techniques to study the genetic relationships among three members of the subgenus Trypanozoon (Protozoa: Trypanosomatidae).

    Science.gov (United States)

    Li, Feng-Jun; Gasser, Robin B; Zheng, Jia-Yu; Claes, Filip; Zhu, Xing-Quan; Lun, Zhao-Rong

    2005-12-01

    Three different DNA fingerprinting techniques, the mobile genetic element (MGE)-PCR, simple sequence repeat (SSR)-PCR and random amplified polymorphic DNA (RAPD)-PCR, were used to define a large set of genetic markers to study genetic similarity within and among Trypanosoma brucei, Trypanosoma equiperdum and Trypanosoma evansi strains (n=18) from China, Africa and South America and to investigate their genetic relationships. Using the three fingerprinting techniques, >890 bands (ranging in size from 0.2 to 2kb) were defined for all 18 strains of Trypanosoma. Within each of the strains, 39-59 bands were defined. The similarity coefficients between strains ranged from approximately 41 to 94%, with a mean of 65%. There was more genetic similarity among strains within T. evansi (mean of approximately 79%) compared with T. equiperdum ( approximately 65%) and T. brucei ( approximately 59%). The similarity coefficient data were used to construct the dendrogram, which revealed that (irrespective of species) the majority of strains from China and South America grouped together to the exclusion of those from Africa. The exceptions were a T. brucei strain from Africa and a T. equiperdum strain of unknown origin. Hence, employing data sets generated using the three different fingerprinting methods, it was not possible to unequivocally distinguish among T. brucei, T. evansi and T. equiperdum, although there was a tendency for T. evansi strains to group together to the exclusion of T. brucei. The findings provide support for the hypothesis that T. evansi originated from a mutated form of T. equiperdum and stimulate further investigations of the genetic make-up and evolution of members of the subgenus Trypanozoon.

  15. New malaria parasites of the subgenus Novyella in African rainforest birds, with remarks on their high prevalence, classification and diagnostics.

    Science.gov (United States)

    Valkiūnas, Gediminas; Iezhova, Tatjana A; Loiseau, Claire; Smith, Thomas B; Sehgal, Ravinder N M

    2009-04-01

    Blood samples from 655 passerine birds were collected in rainforests of Ghana and Cameroon and examined both by microscopy and polymerase chain reaction (PCR)-based techniques. The overall prevalence of Plasmodium spp. was 46.6%, as determined by combining the results of both these diagnostic methods. In comparison to PCR-based diagnostics, microscopic examination of blood films was more sensitive in determining simultaneous infection of Plasmodium spp., but both detection methods showed similar trends of prevalence of malaria parasites in the same study sites. Plasmodium (Novyella) lucens n. sp., Plasmodium (Novyella) multivacuolaris n. sp. and Plasmodium (Novyella) parahexamerium n. sp. were found in the olive sunbird Cyanomitra olivacea (Nectariniidae), yellow-whiskered greenbul Andropadus latirostris (Picnonotidae), and white-tailed alethe Alethe diademata (Turdidae), respectively. These parasites are described based on the morphology of their blood stages and a segment of the mitochondrial cytochrome b (cyt b) gene, which can be used for molecular identification and diagnosis of these species. Illustrations of blood stages of new species are given, and phylogenetic analysis identifies DNA lineages closely related to these parasites. Malaria parasites of the subgenus Novyella with small erythrocytic meronts clearly predominate in African passerines. It is probable that the development of such meronts is a characteristic feature of evolution of Plasmodium spp. in African rainforest birds. Subgeneric taxonomy of avian Plasmodium spp. is discussed based on the recent molecular phylogenies of these parasites. It is concluded that a multi-genome phylogeny is needed before revising the current subgeneric classification of Plasmodium. We supported a hypothesis by Hellgren, Krizanauskiene, Valkiūnas, Bensch (J Parasitol 93:889-896, 2007), according to which, haemosporidian species with a genetic differentiation of over 5% in mitochondrial cyt b gene are expected to be

  16. A pilot study applying the plant Anchored Hybrid Enrichment method to New World sages (Salvia subgenus Calosphace; Lamiaceae).

    Science.gov (United States)

    Fragoso-Martínez, Itzi; Salazar, Gerardo A; Martínez-Gordillo, Martha; Magallón, Susana; Sánchez-Reyes, Luna; Moriarty Lemmon, Emily; Lemmon, Alan R; Sazatornil, Federico; Granados Mendoza, Carolina

    2017-12-01

    We conducted a pilot study using Anchored Hybrid Enrichment to resolve relationships among a mostly Neotropical sage lineage that may have undergone a recent evolutionary radiation. Conventional markers (ITS, trnL-trnF and trnH-psbA) have not been able to resolve the relationships among species nor within portions of the backbone of the lineage. We sampled 12 representative species of subgenus Calosphace and included one species of Salvia's s.l. closest relative, Lepechinia, as outgroup. Hybrid enrichment and sequencing were successful, yielding 448 alignments of individual loci with an average length of 704bp. The performance of the phylogenomic data in phylogenetic reconstruction was superior to that of conventional markers, increasing both support and resolution. Because the captured loci vary in the amount of net phylogenetic informativeness at different phylogenetic depths, these data are promising in phylogenetic reconstruction of this group and likely other lineages within Lamiales. However, special attention should be placed on the amount of phylogenetic noise that the data could potentially contain. A prior exploration step using phylogenetic informativeness profiles to detect loci with sites with disproportionately high substitution rates (showing "phantom" spikes) and, if required, the ensuing filtering of the problematic data is recommended. In our dataset, filtering resulted in increased support and resolution for the shallow nodes in maximum likelihood phylogenetic trees resulting from concatenated analyses of all the loci. Additionally, it is expected that an increase in sampling (loci and taxa) will aid in resolving weakly supported, short deep internal branches. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Carabus of Subgenus Cathoplius C.G. Thomson, 1875, with description of their life-way, life-cycle and pre-imaginal morphology (Coleoptera: Carabidae) .

    Science.gov (United States)

    Busato, Enrico; Ghittino, Claudio; Casale, Achille

    2014-09-25

    According to current taxonomy, Subgenus Cathoplius C.G. Thomson, 1875, within the Genus Carabus Linnaeus, 1758 (in the broad sense), includes two species: C. (Cathoplius) asperatus (Dejean, 1826), monotypic with a northern distribution, and the southern polytypic substitutive species C. (Cathoplius) stenocephalus Lucas, 1866. The authors describe the life-way, life-cycle and pre-imaginal characters of the taxa currently ascribed to Subgenus Cathoplius, with details never provided before. Cathoplius are ground beetles adapted to live in arid environments and extreme habitats such as sub-desert areas. All of them are strictly helicophagous, both during the pre-imaginal stages and as adults, and are localized in a narrow fringe along the Atlantic coast of northwestern Africa. Several data and observations on the eco-ethology of the different taxa, obtained both in field and in laboratory, are reported. The life-cycle of Cathoplius belongs to the winter breeding type, with an extremely high fecundity rate concentrated in a very short period of time, that has no similarity to any other Carabus species. Eggs, larvae and pupae of the different species and subspecies of Cathoplius are described and illustrated. Larval characters clearly place Subgenus Cathoplius into the lineage of Neocarabi, confirming it as a monophyletic and homogeneous assemblage. Hybridization trials between some taxa led to a reduced survival rate of the progeny, thus confirming their specific or subspecific differentiation as proposed by classical taxonomy. Furthermore, hybridization results suggest that C. (Cathoplius) stenocephalus aliai could be considered as a distinct species. Notes about the origin, biogeography and phylogeny of Cathoplius are also provided.

  18. Foliar Essential Oil Glands of Eucalyptus Subgenus Eucalyptus (Myrtaceae Are a Rich Source of Flavonoids and Related Non-Volatile Constituents.

    Directory of Open Access Journals (Sweden)

    Jason Q D Goodger

    Full Text Available The sub-dermal secretory cavities (glands embedded within the leaves of Eucalyptus (Myrtaceae were once thought to be the exclusive repositories of monoterpene and sesquiterpene oils. Recent research has debunked this theory and shown that abundant non-volatile compounds also occur within foliar glands. In particular, glands of four species in subgenus Eucalyptus contain the biologically active flavanone pinocembrin. Pinocembrin shows great promise as a pharmaceutical and is predominantly plant-sourced, so Eucalyptus could be a potential commercial source of such compounds. To explore this we quantified and assessed the purity of pinocembrin in glands of 11 species of E. subg. Eucalyptus using Electro-Spray Ionisation Liquid Chromatography Mass Spectrometry of acetonitrile extracts and Gas Chromatography Mass Spectrometry analyses of hexane extracts of isolated glands which were free from other leaf tissues. Our results showed that the glands of subgenus Eucalyptus contain numerous flavanones that are structurally related to pinocembrin and often present in much greater abundance. The maximum concentration of pinocembrin was 2 mg g-1 dry leaf found in E. stellulata, whereas that of dimethylpinocembrin (5,7-dimethoxyflavanone was 10 mg g-1 in E. oreades and that of pinostrobin (5-hydroxy-7-methoxyflavanone was 12 mg g-1 in E. nitida. We also found that the flavanones are exclusively located within the foliar glands rather than distributed throughout leaf tissues. The flavanones differ from the non-methylated pinocembrin in the degree and positions of methylation. This finding is particularly important given the attractiveness of methylated flavonoids as pharmaceuticals and therapeutics. Another important finding was that glands of some members of the subgenus also contain flavanone O-glucosides and flavanone-β-triketone conjugates. In addition, glands contain free β-triketones, β-triketone heterodimers and chromone C-glucosides. Therefore, the

  19. Foliar Essential Oil Glands of Eucalyptus Subgenus Eucalyptus (Myrtaceae) Are a Rich Source of Flavonoids and Related Non-Volatile Constituents.

    Science.gov (United States)

    Goodger, Jason Q D; Seneratne, Samiddhi L; Nicolle, Dean; Woodrow, Ian E

    2016-01-01

    The sub-dermal secretory cavities (glands) embedded within the leaves of Eucalyptus (Myrtaceae) were once thought to be the exclusive repositories of monoterpene and sesquiterpene oils. Recent research has debunked this theory and shown that abundant non-volatile compounds also occur within foliar glands. In particular, glands of four species in subgenus Eucalyptus contain the biologically active flavanone pinocembrin. Pinocembrin shows great promise as a pharmaceutical and is predominantly plant-sourced, so Eucalyptus could be a potential commercial source of such compounds. To explore this we quantified and assessed the purity of pinocembrin in glands of 11 species of E. subg. Eucalyptus using Electro-Spray Ionisation Liquid Chromatography Mass Spectrometry of acetonitrile extracts and Gas Chromatography Mass Spectrometry analyses of hexane extracts of isolated glands which were free from other leaf tissues. Our results showed that the glands of subgenus Eucalyptus contain numerous flavanones that are structurally related to pinocembrin and often present in much greater abundance. The maximum concentration of pinocembrin was 2 mg g-1 dry leaf found in E. stellulata, whereas that of dimethylpinocembrin (5,7-dimethoxyflavanone) was 10 mg g-1 in E. oreades and that of pinostrobin (5-hydroxy-7-methoxyflavanone) was 12 mg g-1 in E. nitida. We also found that the flavanones are exclusively located within the foliar glands rather than distributed throughout leaf tissues. The flavanones differ from the non-methylated pinocembrin in the degree and positions of methylation. This finding is particularly important given the attractiveness of methylated flavonoids as pharmaceuticals and therapeutics. Another important finding was that glands of some members of the subgenus also contain flavanone O-glucosides and flavanone-β-triketone conjugates. In addition, glands contain free β-triketones, β-triketone heterodimers and chromone C-glucosides. Therefore, the foliar glands

  20. Foliar Essential Oil Glands of Eucalyptus Subgenus Eucalyptus (Myrtaceae) Are a Rich Source of Flavonoids and Related Non-Volatile Constituents

    Science.gov (United States)

    Nicolle, Dean; Woodrow, Ian E.

    2016-01-01

    The sub-dermal secretory cavities (glands) embedded within the leaves of Eucalyptus (Myrtaceae) were once thought to be the exclusive repositories of monoterpene and sesquiterpene oils. Recent research has debunked this theory and shown that abundant non-volatile compounds also occur within foliar glands. In particular, glands of four species in subgenus Eucalyptus contain the biologically active flavanone pinocembrin. Pinocembrin shows great promise as a pharmaceutical and is predominantly plant-sourced, so Eucalyptus could be a potential commercial source of such compounds. To explore this we quantified and assessed the purity of pinocembrin in glands of 11 species of E. subg. Eucalyptus using Electro-Spray Ionisation Liquid Chromatography Mass Spectrometry of acetonitrile extracts and Gas Chromatography Mass Spectrometry analyses of hexane extracts of isolated glands which were free from other leaf tissues. Our results showed that the glands of subgenus Eucalyptus contain numerous flavanones that are structurally related to pinocembrin and often present in much greater abundance. The maximum concentration of pinocembrin was 2 mg g-1 dry leaf found in E. stellulata, whereas that of dimethylpinocembrin (5,7-dimethoxyflavanone) was 10 mg g-1 in E. oreades and that of pinostrobin (5-hydroxy-7-methoxyflavanone) was 12 mg g-1 in E. nitida. We also found that the flavanones are exclusively located within the foliar glands rather than distributed throughout leaf tissues. The flavanones differ from the non-methylated pinocembrin in the degree and positions of methylation. This finding is particularly important given the attractiveness of methylated flavonoids as pharmaceuticals and therapeutics. Another important finding was that glands of some members of the subgenus also contain flavanone O-glucosides and flavanone-β-triketone conjugates. In addition, glands contain free β-triketones, β-triketone heterodimers and chromone C-glucosides. Therefore, the foliar glands

  1. Comportamento fenológico e produtivo de cultivares de amora-preta (Rubus sp.) em região subtropical

    OpenAIRE

    Ibrar Hussain

    2015-01-01

    O cultivo da amora-preta (Rubus sp.) tem despertado o interesse de muitos produtores do mundo, como as plantas entram em produção em um ano após o plantio, e a demanda para as indústrias também aumentaram. No entanto, o cultivo desta árvore frutífera em condições subtropicais, com inverno ameno ainda é desconhecido. O objetivo do trabalho foi avaliar o desempenho de cultivares de amora. Tupy e Xavante cresceram em uma área subtropical. O experimento foi conduzido na Estação ...

  2. Estudo botânico, fitoquímico e avaliação da atividade antimicrobiana de Rubus rosaefolius Sm. - Rosaceae

    Directory of Open Access Journals (Sweden)

    Claudia Mauro

    Full Text Available Rubus rosaefolius Sm., Rosaceae, is a shrub with compound leaves, recurvate prickles, white flowers and aggregate fruit, popularly known as sylvan strawberry. The present research concerns its botany (macroscopic and microscopic studies, phytochemistry and antimicrobial properties. The presence of antraquinones, saponins, flavonoids, alkaloids and tannins on stem, root and leaves, were confirmed by specific phytochemical tests. Antimicrobial activity of aqueous and hydroalchoolic fractions were tested against E. coli, S. aureus, P. aeruginosa and C. albicans. The hydroalchoolic fraction revealed antimicrobial activity against all species tested and the aqueous fraction inhibited the growth of S. aureus and C. albicans.

  3. A raspberry bushy dwarf virus isolate from Ecuadorean Rubus glaucus contains an additional RNA that is a rearrangement of RNA-2.

    Science.gov (United States)

    Quito-Avila, D F; Ibarra, M A; Alvarez, R; Peralta, E L; Martin, R R

    2014-09-01

    Sequencing of the complete genome of a raspberry bushy dwarf virus isolate from Rubus glaucus in Ecuador revealed that its RNA-1 and RNA-2 were 5449 and 2231 nucleotides (nt) long, respectively, and phylogenetically closest to isolates from Sweden and Slovenia. In dsRNA analysis of infected plants, an additional band of 3 kbp was observed. Sequencing of this band revealed that it was 3279 nt long. BLAST searches revealed that this band contained a modified version of RNA-2, which consisted of RNA-2 (2231 nt) plus an additional 1048-nt fragment that was concatenated in a reverse-complement fashion to its 5' terminus.

  4. RESPUESTA FISIOLÓGICA Y CAPACIDAD ANTAGONISTA DE AISLAMIENTOS FILOSFÉRICOS DE LEVADURAS OBTENIDOS EN CULTIVOS DE MORA (Rubus glaucus Physiological Responses And Antagonistic Capacity Of Yeast Phyllospheric Isolates Obtained In Blackberry Crops (Rubus glaucus

    Directory of Open Access Journals (Sweden)

    CLAUDIA M MEDINA

    Full Text Available La filósfera es un ecosistema complejo que a pesar de contar con un gran número de microorganismos asociados, presenta pocos estudios diseñados para entender las características ecofisiológicas de los microorganismos que lo habitan. Las levaduras, como elemento importante de este hábitat, están expuestas a un ambiente variable afectado por la planta hospedera, edad y posición de la hoja, disponibilidad y calidad de nutrientes, temperatura, pH, radiación y actividad del agua. Estos factores producen una presión de selección para el establecimiento de poblaciones naturales o introducidas de levaduras que puedan desplazar otras poblaciones de hongos fitopatógenos. En este estudio se obtuvieron 80 aislamientos de levaduras filosféricas de dos cultivos de mora (Rubus glaucus, a las que se les determinó su nicho potencial en términos de su capacidad para crecer a diferentes condiciones de temperatura, pH, estrés osmótico y tolerancia a radiación UV. El estrés osmótico fue la condición evaluada más restrictiva para las levaduras obtenidas, ya que únicamente seis aislamientos presentaron un crecimiento superior a 0,3 unidades de DO a 405 nm, cuando fueron crecidas a 50% y 60% de glucosa. Este estudio permitió seleccionar diez aislamientos filosféricos de levaduras, destacados por su capacidad para crecer en un amplio rango de condiciones. De estos, cuatro aislamientos LvF 34, LvF 43, LvF 44 y LvF 50 se destacaron por su capacidad de antagonismo contra el hongo fitopatógeno Botritys cinérea. Su determinación taxonómica permitió reportar por primera vez las especies Candida kunwinensis y Rhodotorula colostri con potencial biocontrolador.The phyllosphere is a complex ecosystem in which despite of having a great number of associated microorganisms, few studies have been designed to understand the ecophysiological characteristics of the microorganism’s inhabitant. Yeasts, as an important element of this habitat, are exposed to

  5. The Complete Chloroplast Genome Sequences of Aconitum pseudolaeve and Aconitum longecassidatum, and Development of Molecular Markers for Distinguishing Species in the Aconitum Subgenus Lycoctonum

    Directory of Open Access Journals (Sweden)

    Inkyu Park

    2017-11-01

    Full Text Available Aconitum pseudolaeve Nakai and Aconitum longecassidatum Nakai, which belong to the Aconitum subgenus Lycoctonum, are distributed in East Asia and Korea. Aconitum species are used in herbal medicine and contain highly toxic components, including aconitine. A. pseudolaeve, an endemic species of Korea, is a commercially valuable material that has been used in the manufacture of cosmetics and perfumes. Although Aconitum species are important plant resources, they have not been extensively studied, and genomic information is limited. Within the subgenus Lycoctonum, which includes A. pseudolaeve and A. longecassidatum, a complete chloroplast (CP genome is available for only one species, Aconitum barbatum Patrin ex Pers. Therefore, we sequenced the complete CP genomes of two Aconitum species, A. pseudolaeve and A. longecassidatum, which are 155,628 and 155,524 bp in length, respectively. Both genomes have a quadripartite structure consisting of a pair of inverted repeated regions (51,854 and 52,108 bp, respectively separated by large single-copy (86,683 and 86,466 bp and small single-copy (17,091 and 16,950 bp regions similar to those in other Aconitum CP genomes. Both CP genomes consist of 112 unique genes, 78 protein-coding genes, 4 ribosomal RNA (rRNA genes, and 30 transfer RNA (tRNA genes. We identified 268 and 277 simple sequence repeats (SSRs in A. pseudolaeve and A. longecassidatum, respectively. We also identified potential 36 species-specific SSRs, 53 indels, and 62 single-nucleotide polymorphisms (SNPs between the two CP genomes. Furthermore, a comparison of the three Aconitum CP genomes from the subgenus Lycoctonum revealed highly divergent regions, including trnK-trnQ, ycf1-ndhF, and ycf4-cemA. Based on this finding, we developed indel markers using indel sequences in trnK-trnQ and ycf1-ndhF. A. pseudolaeve, A. longecassidatum, and A. barbatum could be clearly distinguished using the novel indel markers AcoTT (Aconitum trnK-trnQ and Aco

  6. The Complete Chloroplast Genome Sequences of Aconitum pseudolaeve and Aconitum longecassidatum, and Development of Molecular Markers for Distinguishing Species in the Aconitum Subgenus Lycoctonum.

    Science.gov (United States)

    Park, Inkyu; Yang, Sungyu; Choi, Goya; Kim, Wook Jin; Moon, Byeong Cheol

    2017-11-21

    Aconitum pseudolaeve Nakai and Aconitum longecassidatum Nakai, which belong to the Aconitum subgenus Lycoctonum, are distributed in East Asia and Korea. Aconitum species are used in herbal medicine and contain highly toxic components, including aconitine. A. pseudolaeve, an endemic species of Korea, is a commercially valuable material that has been used in the manufacture of cosmetics and perfumes. Although Aconitum species are important plant resources, they have not been extensively studied, and genomic information is limited. Within the subgenus Lycoctonum, which includes A. pseudolaeve and A. longecassidatum, a complete chloroplast (CP) genome is available for only one species, Aconitum barbatum Patrin ex Pers. Therefore, we sequenced the complete CP genomes of two Aconitum species, A. pseudolaeve and A. longecassidatum, which are 155,628 and 155,524 bp in length, respectively. Both genomes have a quadripartite structure consisting of a pair of inverted repeated regions (51,854 and 52,108 bp, respectively) separated by large single-copy (86,683 and 86,466 bp) and small single-copy (17,091 and 16,950 bp) regions similar to those in other Aconitum CP genomes. Both CP genomes consist of 112 unique genes, 78 protein-coding genes, 4 ribosomal RNA (rRNA) genes, and 30 transfer RNA (tRNA) genes. We identified 268 and 277 simple sequence repeats (SSRs) in A. pseudolaeve and A. longecassidatum, respectively. We also identified potential 36 species-specific SSRs, 53 indels, and 62 single-nucleotide polymorphisms (SNPs) between the two CP genomes. Furthermore, a comparison of the three Aconitum CP genomes from the subgenus Lycoctonum revealed highly divergent regions, including trnK-trnQ, ycf1-ndhF, and ycf4-cemA. Based on this finding, we developed indel markers using indel sequences in trnK-trnQ and ycf1-ndhF. A. pseudolaeve, A. longecassidatum, and A. barbatum could be clearly distinguished using the novel indel markers AcoTT (Aconitum trnK-trnQ) and AcoYN (Aconitum

  7. Badister Clairville, 1806: A new species and new continental record for the nominate subgenus in Amazonian Perú (Coleoptera, Carabidae, Licinini

    Directory of Open Access Journals (Sweden)

    Terry Erwin

    2011-11-01

    Full Text Available Badister (Badister amazonus sp. n. is described from Perú, Loreto, 1.0 km SW Boca del Rio Samiria, Vigilante Post 1, 130m, “04°40.5`S, 074°18.9`W" its type locality. It is known also from two other localities in Loreto Department, Perú, in both the Varzea and Igapó river systems. This new species is sufficiently different that a new informal higher taxon, the amazonus species complex, is recognized. An updated key to the Western Hemisphere species of subgenus Badister is provided.

  8. Biomolecules and Natural Medicine Preparations: Analysis of New Sources of Bioactive Compounds from Ribes and Rubus spp. Buds

    Directory of Open Access Journals (Sweden)

    Dario Donno

    2016-02-01

    Full Text Available It is well known that plants are important sources for the preparation of natural remedies as they contain many biologically active compounds. In particular, polyphenols, terpenic compounds, organic acids, and vitamins are the most widely occurring groups of phytochemicals. Some endemic species may be used for the production of herbal preparations containing phytochemicals with significant bioactivity, as antioxidant activity and anti-inflammatory capacities, and health benefits. Blackberry sprouts and blackcurrant buds are known to contain appreciable levels of bioactive compounds, including flavonols, phenolic acids, monoterpenes, vitamin C, and catechins, with several clinical effects. The aim of this research was to perform an analytical study of blackcurrant and blackberry bud-preparations, in order to identify and quantify the main biomarkers, obtaining a specific phytochemical fingerprint to evaluate the single botanical class contribution to total phytocomplex and relative bioactivity, using a High Performance Liquid Chromatograph−Diode Array Detector; the same analyses were performed both on the University laboratory and commercial preparations. Different chromatographic methods were used to determine concentrations of biomolecules in the preparations, allowing for quantification of statistically significant differences in their bioactive compound content both in the case of Ribes nigrum and Rubus cultivated varieties at different harvest stages. In blackcurrant bud-extracts the most important class was organic acids (50.98% followed by monoterpenes (14.05%, while in blackberry preparations the main bioactive classes were catechins (50.06% and organic acids (27.34%. Chemical, pharmaceutical and agronomic-environmental knowledge could be important for obtaining label certifications for the valorization of specific genotypes, with high clinical and pharmaceutical value: this study allowed to develop an effective tool for the natural

  9. In vitro conservation of two plant species (Prunus cerasifera Ehrh. and Rubus fruticosus L. shoot tips by encapsulation dehydration

    Directory of Open Access Journals (Sweden)

    Ružić Đurđina

    2013-01-01

    Full Text Available In vitro grown shoot tips of cherry plum (Prunus cerasifera Ehrh. and blackberry ‘Cacanska Bestrna’ (Rubus fruticosus L. were tested for regrowth after cryopreservation using encapsulation dehydration method. Apical, 2-3 mm long shoot tips, were encapsulated in alginate beads composed of 3, 5 and 10% (w/v alginic acid sodium salt in calcium-free liquid Murashige and Skoog (MS medium containing 1.0 mg l-1 benzyladenine, 0.1 mg l-1 indole-3-butyric acid and 0.1 mg l-1 gibberellic acid. Polymerization was done in liquid MS medium with 100 mM CaCl2 for 30 min at room temperature. Encapsulated shoot tips were pre-treated in liquid MS medium with 0.75 or 1 M sucrose for 24 h in growth room and dehydrated for 4 and 8 h (29% and 20% moisture content respectively before rapid immersion in liquid nitrogen. Upon thawing which involved placing the cryovials in the air current of the laminar airflow cabinet for 2 min, the beads were directly transferred to regrowth medium. In cherry plum, osmotic dehydration in 0.75 M sucrose followed by 8-hour desiccation gave the highest regrowth (60% of explants encapsulated in 3% and 5% alginate beads. However, in comparison with cherry plum, blackberry displayed significantly lower capacity for regrowth after cryopreservation under described experimental conditions. In this genotype, osmotic dehydration in 1 M sucrose followed by 8-hour desiccation resulted in the highest regrowth (16.7% of explants encapsulated in 5% alginate beads. Cryopreserved shoot tips of both genotypes multiplied in the three subcultures had normal morphology and similar multiplication capacity in comparison with non-cryopreserved shoots. [Projekat Ministarstva nauke Republike Srbije, br. TR-20013 i br. TR-31064

  10. Germinación in vitro e inducción de callo en Rubus adenotrichus Schltdl.

    Directory of Open Access Journals (Sweden)

    N.S. Martínez-Cruz

    2015-08-01

    Full Text Available Una alternativa para resolver problemas de dormancia, obtención masiva de plantas y biomoléculas de interés es el cultivo in vitro, el objetivo de este trabajo fue inducir la germinación y establecer el cultivo de callo deRubus adenotrichus. Se probaron tres métodos de escarificación: 1 inmersión en ácido sulfúrico (30 y 60 min, 2 inmersión en hipoclorito de sodio (72 h y 3 remoción de la cubierta de la semilla, este último tratamiento fue el mejor, generando un 68% de porcentaje de germinación, en medio Murashige Skoog (MS sin reguladores. Las plántulas obtenidas tuvieron un desarrollo similar al de las plantas silvestres. Para la inducción de callo, se emplearon hojas de plantas silvestres como explantes y fueron colocadas en dos tipos de medio: MS, con 1 mg/L de ácido naftalenacético y 0.5 mg/L cinetina y Woody Plant Medium (WPM con 0.5 mg/L de ácido 2,4-diclorofenoxiacético y 0.75 mg/L de cinetina. En ambos medios se desarrolló un callo friable y pigmentado. El proceso de escarifi cación es fundamental para la germinación de esta especie. El empleo de los medios MS y WPM, con los reguladores adicionados son promotores de la producción de callos friables.

  11. Herpetogramma bipunctalis (Lepidoptera: Crambidae biology and techniques for rearing on leaves of the blackberry (Rubus spp., Rosaceae

    Directory of Open Access Journals (Sweden)

    GI. Diez-Rodríguez

    Full Text Available The larvae of the southern beet webworm Herpetogramma bipunctalis (Fabricius, 1794 damage the leaves of species in the plant genus Rubus. The present study investigated the biology of H. bipunctalis and developed a protocol for raising H. bipunctalis under laboratory conditions. On the basis of the biological data, we devised a life table. In order to develop the rearing procedures, we determined which oviposition substrate and blackberry cultivar were the most appropriate for larval development. The mean durations of the egg, larval, and pupal stages were 5.59 days, 26.37 days, and 13.37 days, respectively, and the corresponding survival rates were 80.83%, 49.07%, and 83.23%. The mean pupal weight was 0.0491 g for males and 0.0536 g for females. The mean life cycle (egg-to-adult period was 45.33 days, and overall survival to adulthood was 33.01%. H. bipunctalis females laid a mean of 252.63 eggs over a mean of 13.60 days of oviposition; the mean pre-oviposition period was 2.67 days. Mean female and male life spans were 17.51 and 19.25 days, respectively, and the sex ratio was 0.51. The life-table data indicated that H. bipunctalis can reproduce 57.9 times per generation. Each cage contained one blackberry leaf placed on a paper towel. This method allowed us to obtain the greatest number of eggs. The larval stage was shorter for insects reared on leaves of the Guarani cultivar than for those reared on leaves of the Xavante cultivar (22.63 vs. 26.37 days. These basic data can aid in establishing strategies for the management of H. bipunctalis on blackberry farms.

  12. Herpetogramma bipunctalis (Lepidoptera: Crambidae) biology and techniques for rearing on leaves of the blackberry (Rubus spp., Rosaceae).

    Science.gov (United States)

    Diez-Rodríguez, G I; Hübner, L K; Antunes, L E C; Nava, D E

    2013-02-01

    The larvae of the southern beet webworm Herpetogramma bipunctalis (Fabricius, 1794) damage the leaves of species in the plant genus Rubus. The present study investigated the biology of H. bipunctalis and developed a protocol for raising H. bipunctalis under laboratory conditions. On the basis of the biological data, we devised a life table. In order to develop the rearing procedures, we determined which oviposition substrate and blackberry cultivar were the most appropriate for larval development. The mean durations of the egg, larval, and pupal stages were 5.59 days, 26.37 days, and 13.37 days, respectively, and the corresponding survival rates were 80.83%, 49.07%, and 83.23%. The mean pupal weight was 0.0491 g for males and 0.0536 g for females. The mean life cycle (egg-to-adult) period was 45.33 days, and overall survival to adulthood was 33.01%. H. bipunctalis females laid a mean of 252.63 eggs over a mean of 13.60 days of oviposition; the mean pre-oviposition period was 2.67 days. Mean female and male life spans were 17.51 and 19.25 days, respectively, and the sex ratio was 0.51. The life-table data indicated that H. bipunctalis can reproduce 57.9 times per generation. Each cage contained one blackberry leaf placed on a paper towel. This method allowed us to obtain the greatest number of eggs. The larval stage was shorter for insects reared on leaves of the Guarani cultivar than for those reared on leaves of the Xavante cultivar (22.63 vs. 26.37 days). These basic data can aid in establishing strategies for the management of H. bipunctalis on blackberry farms.

  13. Biomolecules and Natural Medicine Preparations: Analysis of New Sources of Bioactive Compounds from Ribes and Rubus spp. Buds.

    Science.gov (United States)

    Donno, Dario; Mellano, Maria Gabriella; Cerutti, Alessandro Kim; Beccaro, Gabriele Loris

    2016-02-05

    It is well known that plants are important sources for the preparation of natural remedies as they contain many biologically active compounds. In particular, polyphenols, terpenic compounds, organic acids, and vitamins are the most widely occurring groups of phytochemicals. Some endemic species may be used for the production of herbal preparations containing phytochemicals with significant bioactivity, as antioxidant activity and anti-inflammatory capacities, and health benefits. Blackberry sprouts and blackcurrant buds are known to contain appreciable levels of bioactive compounds, including flavonols, phenolic acids, monoterpenes, vitamin C, and catechins, with several clinical effects. The aim of this research was to perform an analytical study of blackcurrant and blackberry bud-preparations, in order to identify and quantify the main biomarkers, obtaining a specific phytochemical fingerprint to evaluate the single botanical class contribution to total phytocomplex and relative bioactivity, using a High Performance Liquid Chromatograph-Diode Array Detector; the same analyses were performed both on the University laboratory and commercial preparations. Different chromatographic methods were used to determine concentrations of biomolecules in the preparations, allowing for quantification of statistically significant differences in their bioactive compound content both in the case of Ribes nigrum and Rubus cultivated varieties at different harvest stages. In blackcurrant bud-extracts the most important class was organic acids (50.98%) followed by monoterpenes (14.05%), while in blackberry preparations the main bioactive classes were catechins (50.06%) and organic acids (27.34%). Chemical, pharmaceutical and agronomic-environmental knowledge could be important for obtaining label certifications for the valorization of specific genotypes, with high clinical and pharmaceutical value: this study allowed to develop an effective tool for the natural preparation quality

  14. Insectos plagas y benéficos asociados al cultivo de mora (Rubus glaucus, benth en La Sabana, Madriz, Nicaragua

    Directory of Open Access Journals (Sweden)

    Edgardo Jiménez-Martínez

    2006-12-01

    Full Text Available LA MORA (RUBUS GLAUCUS, BENTH ES UNA PLANTA en proceso de domesticación que se cultiva en pequeñas parcelas. Es hospedera de muchos insectos plaga y enfermedades. En Nicaragua se establecieron plantaciones de mora desde hace unos tres años, como alternativa de diversificación de fincas cafetaleras en los departamentos de Madriz y Nueva Segovia. Hasta ahora no hay información formal sobre los principales insectos plaga y benéficos presentes en este cultivo, que está tomando gran importancia. Por ello, se hizo una investigación para describir la fluctuación poblacional de los insectos plaga y sus depredadores naturales, asociados a este cultivo. El estudio se realizó en la finca La Patasta, municipio La Sabana, departamento de Madriz, entre septiembre de 2004 y abril de 2005. El monitoreo se realizó semanalmente en cinco sitios específicos, mediante capturas manuales de especimenes, con ayuda de bolsas de plástico y vasos de vidrio con alcohol. Como resultado, se identificó y describió la fluctuación poblacional de insectos de las principales familias Scarabaeidae, Chrysomelidae, Curculionidae, Cantharidae, y de los órdenes Hemíptero (Cicadellidae, Pentatomidae, Miridae y Orthóptero (Acrididae y Tettigonidae. Igualmente, se identificó y describió la fluctuación poblacional de depredadores naturales de insectos de la familia Staphilinidae, Coccinelidae, Vespidae y Aracnidae, presentes en este cultivo.

  15. Caracterización fenotípica de accesiones de especies de Rubus L. de los municipios de Pamplona y Chitagá, región Nororiental de Colombia

    Directory of Open Access Journals (Sweden)

    Enrique Quevedo-García

    2011-12-01

    Full Text Available Phenotypical characterization of Rubus L. species accessions in the provinces of Pamplona and Chitagá, northeastern region ofColombia. Objective. Determine the cultivated and wild species of Rubus in 53 commercial farms of Rubus glaucus Benth, owned byfour blackberry growers association in the provinces of Pamplona and Chitagá (North of Santander, Colombia. Materials and methods.Three to five specimens were collected from each farm and along the roadside. Plants aged 9 to 12 months established in the commercialfarms and wild materials with characteristics of Rubus were selected. Twenty two descriptors (fourteen quantitative and eight qualitativewere assessed. We considered the seventh and eighth branch buds both male and female (with five repetitions and fruits and flowersof each material. Principal component analysis was done with the fourteen quantitative variables, to identify the descriptors that mostcontribute to the morphological differentiation of accessions. A conglomerate analysis was used for grouping accessions accordingto their similarity and dissimilarity. Results. Among the 147 accessions analyzed from the different farms, our study determined the presence of 6 different taxa: R. glaucus Benth (with and without spines, R. alpinus Macfad, R. adenotrichos Schltdl, R. rosifolius Sm.,R. bogotensis Kunth and R. floribundus Kunth Conclusions. The descriptors that differentiated the species and discriminated them bygroups by providing 77% of the information with the use of principal component analysis, were: length and width of central and lateralleaflets, length of flower and leaf structures, apex shape and number of secondary veins.

  16. The Chilean wild raspberry (Rubus geoides Sm.) increases intracellular GSH content and protects against H2O2 and methylglyoxal-induced damage in AGS cells.

    Science.gov (United States)

    Jiménez-Aspee, Felipe; Theoduloz, Cristina; Ávila, Felipe; Thomas-Valdés, Samanta; Mardones, Claudia; von Baer, Dietrich; Schmeda-Hirschmann, Guillermo

    2016-03-01

    The Chilean raspberry Rubus geoides Sm. (Rosaceae) is a native species occurring in the Patagonia. Five R. geoides samples were assessed for phenolic content and composition, antioxidant activity, effect on total reduced glutathione (GSH) synthesis and protective effect against H2O2 and methylglyoxal (MGO)-induced stress in epithelial gastric AGS cells. The HPLC-DAD/ESI-MS profiles allowed the tentative identification of 39 phenolics including flavonol glycosides and tannins. R. geoides presented higher total phenolic and flavonoid content than Rubus idaeus. Two out of the five phenolic enriched R. geoides extracts (PEEs) exhibited better antioxidant activity than R. idaeus in the DPPH, FRAP and TEAC assays. A significant cytoprotective activity was observed when AGS cells were pre-incubated with extracts and subsequently challenged with H2O2 or MGO. Treatment with the PEEs increased the intracellular GSH content. R. geoides fruit extracts may induce the activation of intracellular protection mechanisms against oxidative and dicarbonyl-induced stress. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. O processo Clinical Caritas de Jean Watson na assistência de enfermagem brasileira: uma revisão sistemática

    OpenAIRE

    Carvalho, Nirvania V.; Neta, Dinah Sá Rezende; Silva, Grazielle Roberta Freitas da; Araújo, Telma M. Evangelista de

    2011-01-01

    Esta revisión sistemática tiene por objetivo revisar la aplicación del proceso Clinical Caritas, la reformulación de la teoría del cuidado humano: Jean Watson, a través de trabajos científico. Sólo cinco se encontraron productos en la bases de datos LILACS, SciELO, MEDLINE y BDENF después de la aplicación de rigurosos criterios de inclusión. Los resultados mostraron que el 80% de las publicaciones son de 2006 y el 60% realizados en el Sur. Los autores son enfermeros de postgrado, que trabajan...

  18. Cuidador domiciliar do idoso e o cuidado de si : uma análise através da teoria do cuidado humano de Jean Watson

    OpenAIRE

    Schossler,Thaís; Crossetti,Maria da Graça Oliveira

    2008-01-01

    Este estudo objetivou conhecer a percepção do cuidador domiciliar do idoso sobre o cuidado de si, através da Teoria do Cuidado Humano de Jean Watson. Trata-se de uma pesquisa qualitativa, do tipo exploratório-descritiva, desenvolvida na Unidade de Saúde da Vila Floresta, com nove cuidadores domiciliares de idosos integrantes do Programa de Assistência Domiciliar. As informações foram coletadas no período de agosto a outubro de 2006, através da entrevista semi-estruturada, cuja análise e inter...

  19. Plastid genome evolution across the genus Cuscuta (Convolvulaceae): two clades within subgenus Grammica exhibit extensive gene loss.

    Science.gov (United States)

    Braukmann, Thomas; Kuzmina, Maria; Stefanovic, Sasa

    2013-02-01

    The genus Cuscuta (Convolvulaceae, the morning glory family) is one of the most intensely studied lineages of parasitic plants. Whole plastome sequencing of four Cuscuta species has demonstrated changes to both plastid gene content and structure. The presence of photosynthetic genes under purifying selection indicates that Cuscuta is cryptically photosynthetic. However, the tempo and mode of plastid genome evolution across the diversity of this group (~200 species) remain largely unknown. A comparative investigation of plastid genome content, grounded within a phylogenetic framework, was conducted using a slot-blot Southern hybridization approach. Cuscuta was extensively sampled (~56% of species), including groups previously suggested to possess more altered plastomes compared with other members of this genus. A total of 56 probes derived from all categories of protein-coding genes, typically found within the plastomes of flowering plants, were used. The results indicate that two clades within subgenus Grammica (clades 'O' and 'K') exhibit substantially more plastid gene loss relative to other members of Cuscuta. All surveyed members of the 'O' clade show extensive losses of plastid genes from every category of genes typically found in the plastome, including otherwise highly conserved small and large ribosomal subunits. The extent of plastid gene losses within this clade is similar in magnitude to that observed previously in some non-asterid holoparasites, in which the very presence of a plastome has been questioned. The 'K' clade also exhibits considerable loss of plastid genes. Unlike in the 'O' clade, in which all species seem to be affected, the losses in clade 'K' progress phylogenetically, following a pattern consistent with the Evolutionary Transition Series hypothesis. This clade presents an ideal opportunity to study the reduction of the plastome of parasites 'in action'. The widespread plastid gene loss in these two clades is hypothesized to be a

  20. Identification of Sand flies of the Subgenus Larroussius based on Molecular and Morphological Characters in North Western Iran

    Directory of Open Access Journals (Sweden)

    A Absavaran

    2009-12-01

    Full Text Available Background: The adult female sand flies (Diptera: Psychodidae of the subgenus Larroussius are important vectors of Leishmania infantum (Kinetoplastida: Tripanosomatidae in Meshkinshahr district, Northwest of Iran. Four Phle­boto­mus (Larroussius species are present in this area, i.e. Phlebotomus (Larroussius kandelakii, P. (La. major, P. (La. perfiliewi and P. (La. tobbi. The objective of the present study was to identify and distinguish the females of P. per­filiewi, P. major and P. tobbi, in this district."nMethods: Adult sand flies were collected with sticky papers, CDC light traps, and aspirator in 2006. Individual sand flies of this four species from thirty different locations were characterized morphologically and by comparative DNA se­quences analyses of a fragment of mitochondrial gene Cytochrome b (Cyt b and nuclear gene Elongation Factor 1- al­pha (EF-1α. PCR amplification was carried out for all three species P. major, P. perfiliewi and P. tobbi in the sub­ge­nus Larroussius."nResults: Phylogenetic analyses of P. major populations in this study displayed two different populations and genetic di­ver­sity. Spermathecal segment number, pharyngeal armature and other morphological characters of these three spe­cies were examined and found to present consistent interspecific differences."nConclusion: According to our findings, the phylogeny of Cyt b and EF-1α haplotypes confirms the relationships be­tween P. major, P. tobbi and P. perfiliewi as already defined by their morphological similarities.                                                                                  Keywords: Phlebotomus, Larroussius, Cytochrome b, Elongation Factor-1α, Morphology, Iran                 

  1. Pan-African phylogeny of Mus (subgenus Nannomys) reveals one of the most successful mammal radiations in Africa.

    Science.gov (United States)

    Bryja, Josef; Mikula, Ondřej; Šumbera, Radim; Meheretu, Yonas; Aghová, Tatiana; Lavrenchenko, Leonid A; Mazoch, Vladimír; Oguge, Nicholas; Mbau, Judith S; Welegerima, Kiros; Amundala, Nicaise; Colyn, Marc; Leirs, Herwig; Verheyen, Erik

    2014-12-14

    Rodents of the genus Mus represent one of the most valuable biological models for biomedical and evolutionary research. Out of the four currently recognized subgenera, Nannomys (African pygmy mice, including the smallest rodents in the world) comprises the only original African lineage. Species of this subgenus became important models for the study of sex determination in mammals and they are also hosts of potentially dangerous pathogens. Nannomys ancestors colonized Africa from Asia at the end of Miocene and Eastern Africa should be considered as the place of their first radiation. In sharp contrast with this fact and despite the biological importance of Nannomys, the specimens from Eastern Africa were obviously under-represented in previous studies and the phylogenetic and distributional patterns were thus incomplete. We performed comprehensive genetic analysis of 657 individuals of Nannomys collected at approximately 300 localities across the whole sub-Saharan Africa. Phylogenetic reconstructions based on mitochondrial (CYTB) and nuclear (IRBP) genes identified five species groups and three monotypic ancestral lineages. We provide evidence for important cryptic diversity and we defined and mapped the distribution of 27 molecular operational taxonomic units (MOTUs) that may correspond to presumable species. Biogeographical reconstructions based on data spanning all of Africa modified the previous evolutionary scenarios. First divergences occurred in Eastern African mountains soon after the colonization of the continent and the remnants of these old divergences still occur there, represented by long basal branches of M. (previously Muriculus) imberbis and two undescribed species from Ethiopia and Malawi. The radiation in drier lowland habitats associated with the decrease of body size is much younger, occurred mainly in a single lineage (called the minutoides group, and especially within the species M. minutoides), and was probably linked to aridification and

  2. 8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

  3. DNA barcoding of the leaf-mining moth subgenus Ectoedemia s. str. (Lepidoptera: Nepticulidae) with COI and EF1-α: two are better than one in recognising cryptic species

    NARCIS (Netherlands)

    Nieukerken, E.J.; Doorenweerd, C.; Stokvis, F.R.; Groenenberg, D.S.J.

    2012-01-01

    We sequenced 665bp of the Cytochrome C Oxidase I (COI) barcoding marker for 257 specimens and 482bp of Elongation Factor 1-α (EF1-α) for 237 specimens belonging to the leafmining subgenus Ectoedemia (Ectoedemia) in the basal Lepidopteran family Nepticulidae. The dataset includes 45 out of 48 West

  4. A new subgenus of the weevil genus Otiorhynchus Germar, 1822 (Coleoptera: Curculionidae: Entiminae for a new species from Mediterranean Turkey associated with the carob tree, Ceratonia siliqua L. (Fabaceae

    Directory of Open Access Journals (Sweden)

    Genrik E. Davidian

    2017-03-01

    Full Text Available A new species Otiorhynchus ceratoniae Davidian, Gültekin & Korotyaev sp. nov. is described from eastern Mediterranean Turkey. A new monotypic subgenus Arnoldinus Davidian, Gültekin & Korotyaev subgen. nov. is erected for this species. The new species was found only under Ceratonia siliqua L. trees with lower leaves damaged by adults.

  5. Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

    Science.gov (United States)

    Durgun Ozan, Yeter; Okumuş, Hülya

    2017-06-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

  6. Deshidratación de mora de castilla (rubus glaucus bajo régimen convectivo con aire forzado.

    Directory of Open Access Journals (Sweden)

    Márquez C Carlos Julio

    2002-12-01

    Full Text Available Moras de castilla (Rubus glaucus calibre B con un índice de color de 5 y 6, según norma técnica colombiana (NTC-4106, fueron deshidratadas por convección forzada a temperaturas de 35, 50 y 65°C utilizando un deshidratador de bandejas de flujo paralelo. La deshidratación fue llevada a cabo en dos tamaños de partícula: mora triturada y pulpa de mora. La mora triturada fue obtenida por trituración mecánica y la pulpa por licuado. La granulometría fue hecha siguiendo la norma S319.2 American Society of Agricultural Engineers (ASAE (1994, realizada para los dos tamaños de partículas de mora, una vez finalizado el proceso de deshidratación, a las temperaturas consideradas. Se encontró que la deshidratación con moras licuadas (pulpa de mora es más rápida que las moras trituradas mecánicamente, alcanzándose una humedad de equilibrio menor, en menos tiempo, para todas las temperaturas evaluadas: a 35ºC la humedad de equilibrio fue de 28,06% b.s para mora triturada y de 17,40% b.s para mora licuada; a 50ºC fue de 20,64% b.s para mora triturada y de 15,04% b.s en mora licuada y para 65ºC la humedad de equilibrio fueron de 16,60% b.s y 11,02% b.s, para moras trituradas y licuadas respectivamente. La mora licuada deshidratada o harina de mora, presentó una mayor cantidad de material fino, con un módulo de fineza de 2,386, índice de uniformidad 0:4:6 y un diámetro promedio de partícula de 0,55 mm. En moras trituradas, se encontró un módulo de fineza de 4,93, índice de uniformidad de 7:3:0 y un diámetro promedio de partícula de 3,175 mm, la mora licuada presentó una mayor capacidad de transferencia de calor y masa haciendo más acelerado el proceso de evaporación del agua.

  7. Rubus crataegifolius Bunge regulates adipogenesis through Akt and inhibits high-fat diet-induced obesity in rats.

    Science.gov (United States)

    Jung, Min-Sup; Lee, Soo-Jung; Song, Yuno; Jang, Sun-Hee; Min, Wongi; Won, Chung-Kil; Kim, Hong-Duck; Kim, Tae Hoon; Cho, Jae-Hyeon

    2016-01-01

    Obesity is one of the greatest public health problems and major risk factors for serious metabolic diseases and significantly increases the risk of premature death. The aim of this study was to determine the inhibitory effects of Rubus crataegifolius Bunge (RCB) on adipocyte differentiation in 3 T3-L1 cells and its anti-obesity properties in high fat diet (HFD)-induced obese rats. 3 T3-L1 adipocytes and HFD-induced obese rats were treated with RCB, and its effect on gene expression was analyzed using RT-PCR and Western blotting experiments. RCB treatment significantly inhibited adipocyte differentiation by suppressing the expression of C/EBPβ, C/EBPα, and PPARγ in the 3 T3-L1 adipocytes. Subsequently, the expression of the PPARγ target genes aP2 and fatty acid synthase (FAS) decreased following RCB treatment during adipocyte differentiation. In uncovering the specific mechanism that mediates the effects of RCB, we demonstrated that the insulin-stimulated phosphorylation of Akt strongly decreased and that its downstream substrate phospho-GSK3β was downregulated following RCB treatment in the 3 T3-L1 adipocytes. Moreover, LY294002, an inhibitor of Akt phosphorylation, exerted stronger inhibitory effects on RCB-mediated suppression of adipocyte differentiation, leading to the inhibition of adipocyte differentiation through the downregulation of Akt signaling. An HFD-induced obesity rat model was used to determine the inhibitory effects of RCB on obesity. Body weight gain and fat accumulation in adipose tissue were significantly reduced by the supplementation of RCB. Moreover, RCB treatment caused a significant decrease in adipocyte size, associated with a decrease in epididymal fat weight. The serum total cholesterol (TC) and triglyceride (TG) levels decreased in response to RCB treatment, whereas HDL cholesterol (HDL-C) increased, indicating that RCB attenuated lipid accumulation in adipose tissue in HFD-induced obese rats. Our results demonstrate an

  8. Color, phenolics, and antioxidant activity of blackberry (Rubus glaucus Benth.), blueberry (Vaccinium floribundum Kunth.), and apple wines from Ecuador.

    Science.gov (United States)

    Ortiz, Jacqueline; Marín-Arroyo, María-Remedios; Noriega-Domínguez, María-José; Navarro, Montserrat; Arozarena, Iñigo

    2013-07-01

    Seventy wines were produced in Ecuador under different processing conditions with local fruits: Andean blackberries (Rubus glaucus Benth.) and blueberries (Vaccinium floribundum Kunth.) and Golden Reinette apples. Wines were evaluated for antioxidant activity (AA) using the radical scavenging capacity (DPPH) method, total phenolic content (TPC) using the Folin-Ciocalteu method, total monomeric anthocyanins (TMAs) using the pH differential test, and color parameters using VIS-spectrophotometry. For blackberry wines, ellagitannins and anthocyanins were also analyzed using high-performance liquid chromatography with diode-array detection (HPLC-DAD). Apples wines (n = 40) had the lowest TPC (608 ± 86 mg/L) and AA (2.1 ± 0.3 mM Trolox). Blueberry wines (n = 12) had high TPC (1086 ± 194 mg/L) and moderate AA (5.4 ± 0.8 mM) but very low TMA (8 ± 3 mg/L), with a color evolved toward yellow and blue shades. Blackberry wines (n = 10) had the highest TPC (1265 ± 91 mg/L) and AA (12 ± 1 mM). Ellagitannins were the major phenolics (1172 ± 115 mg/L) and correlated well with AA (r = 0.88). Within anthocyanins (TMA 73 ± 16 mg/L), cyanidin-3-rutinoside (62%) and cyanidin-3-glucoside (15%) were predominant. Wines obtained by cofermentation of apples and blackberries (n = 8) showed intermediate characteristics (TPC 999 ± 83 mg/L, AA 6.2 ± 0.7 mM, TMA 35 ± 22 mg/L) between the blackberry and blueberry wines. The results suggest that the Andean berries, particularly R. glaucus, are suitable raw materials to produce wines with an in vitro antioxidant capacity that is comparable to red grape wines. © 2013 Institute of Food Technologists®

  9. Factor personal e institucional en el desarrollo del “cuidado humano de ayuda confianza”, de la teoria de Jean Watson en los enfermeros del servicio de medicina 3B del Hospital Nacional Guillermo Almenara Irigoyen, 2013

    OpenAIRE

    Sebastián Llancari, Carolina; Velásquez Carranza, Doris

    2016-01-01

    La teoría del cuidado humano de Watson sostiene que ante el riesgo de deshumanización en el cuidado del paciente, se hace necesario el rescate del aspecto humano por parte de los profesionales de enfermería. Objetivos: determinar el factor personal e institucional en el desarrollo del “cuidado humano de ayuda-confianza”, de la teoría de Jean Watson en los enfermeros en el Servicio de Medicina 3B del HNGAI. Material y métodos:estudio descriptivo de corte transversal. Población conformada por e...

  10. Redefinition of the millipede subgenus Megaphyllum sensu stricto Verhoeff, 1894 and neotype designation for Megaphyllum austriacum (Latzel, 1884) (Myriapoda: Diplopoda: Julida: Julidae).

    Science.gov (United States)

    Lazányi, Eszter; Vagalinski, Boyan

    2013-11-26

    Megaphyllum sensu stricto, i.e. the nominotypical subgenus of the very complicated genus Megaphyllum Verhoeff, 1894, is redefined on the basis of examination of type and non-type material and literature data. Four species-groups including twenty species in all are listed, and the identity of M. austriacum (C. L. Koch, 1838) is clarified with a proposal of neotype designation under ICZN Article 75.6. in order to stabilize the current usage of the name. Prevailing usage of M. silvaticum (Verhoeff, 1898) syn. nov. (nomen protectum) over the senior synonym M. nigrescens (Latzel, 1884) (nomen oblitum) is maintained under ICZN Article 23.9. M. banaticum (Verhoeff, 1899) is syn. nov. of M. erythronotum (Latzel, 1884) comb. nov., M. bosniense cotinophilum (Loksa, 1962) syn. nov. of M. bosniense bosniense (Verhoeff, 1897) and M. transsylvanicum transdanubicum (Loksa, 1962) syn. nov. of M. transsylvanicum transsylvanicum (Verhoeff, 1897). M. unilineatum (C. L. Koch, 1838) is new to the fauna of Turkey.

  11. Molecular systematics of the phlebotomine sandflies of the subgenus Paraphlebotomus (diptera, psychodidae, phlebotomus) based on ITS2 rDNA sequences. Hypotheses Of dispersion and speciation.

    Science.gov (United States)

    Depaquit, J; Ferté, H; Léger, N; Killick-Kendrick, R; Rioux, J A; Killick-Kendrick, M; Hanafi, H A; Gobert, S

    2000-06-01

    Phylogenetic Paraphlebotomus relationships are inferred by a study based on the sequences of ITS2, which has been sequenced in nine Paraphlebotomus species: P. alexandri, P. andrejevi, P. jacusieli, P. kazeruni, P. mireillae, P. mongolensis, P. saevus, P. sergenti and P. similis and in two out-groups species of the subgenus Phlebotomus: P. papatasi and P. duboscqi. Paraphlebotomus alexandri appears as the sister group of all other Paraphlebotomus sandflies. Among the other species, three groupings are clearly highlighted: andrejevi and mongolensis; mireillae and saevus; jacusieli, kazeruni, sergenti and similis. These groupings are related to speculations about the migration of Paraphlebotomus from a centre of dispersion located in the Middle East sometime from the early Eocene to the late Miocene.

  12. Phylogeny of New World Salvia subgenus Calosphace (Lamiaceae) based on cpDNA (psbA-trnH) and nrDNA (ITS) sequence data.

    Science.gov (United States)

    Jenks, Aaron A; Walker, Jay B; Kim, Seung-Chul

    2013-07-01

    Salvia subgenus Calosphace (Lamiaceae) is economically and ethnomedicinally significant and comprised of more than 500 species. Although strongly supported as monophyletic, it has received no comprehensive systematic research since the initial establishment of 91 taxonomic sections in 1939. Representative taxa of 73 sections of Calosphace were sampled to investigate the phylogenetic relationships and identify major lineages using chloroplast (intergenic spacer psbA-trnH) and nuclear ribosomal DNA (internal transcribed spacer). Phylogenetic analysis of the combined data sets established monophyly of seven sections (Blakea, Corrugatae, Erythrostachys, Hastatae, Incarnatae, Microsphace, and Sigmoideae) and four major lineages (S. axillaris, "Hastatae clade", "Uliginosae clade", and "core Calosphace"). Sections spanning two or more centers of diversity are not supported by our results; rather, supported relationships exhibit significant geographic structure. Mexico is supported as the geographic origin of Calosphace, and no more than seven dispersal events to South America are required to account for current disjunct distributions.

  13. Traceability of marketable Japanese shoro in New Zealand: using multiplex PCR to exploit phylogeographic variation among taxa in the Rhizopogon subgenus Roseoli.

    Science.gov (United States)

    Visnovsky, Sandra B; Guerin-Laguette, Alexis; Wang, Yun; Pitman, Andrew R

    2010-01-01

    Rhizopogon roseolus Corda (synonym Rhizopogon rubescens Tul.), an economically important edible mushroom associated with the Pinaceae (mostly Pinus sp.), has a global distribution resulting from the introduction of exotic trees into the Southern Hemisphere for plantation forestry. However, the marketability of R. roseolus varies with the place of origin. R. roseolus strains cultivated in New Zealand from local carpophores for the Japanese market are morphologically and biologically distinct from those produced in Japan and are consequently considered less valuable. In this study, the ITS1-5.8S-ITS2 rRNA (internal transcribed spacer [ITS]) region was used to examine the phylogenetic relationships of R. roseolus and other closely related fungi belonging to Rhizopogon subgenus Roseoli to determine the genetic basis for phenotypic differences among R. roseolus isolates from different geographic regions. Phylogenetic comparison revealed phylogeographic variation within Rhizopogon subgenus Roseoli. Collections from the United States and Europe grouped into four distinct clades. Rhizopogon roseolus isolates found in New Zealand were closely related to those from the United States, likely due to introduction of Pinus radiata from its native California in the United States. In contrast, Japanese R. roseolus isolates clustered closely with European collections. Phylogenetic differences between Japanese and New Zealand R. roseolus isolates may explain the morphological and biological properties attributed to these geographical variants. The ITS region was subsequently used to design a multiplex PCR for the simultaneous identification of Japanese and New Zealand R. roseolus isolates to track the establishment of ectomycorrhiza on P. radiata seedlings inoculated with commercially valuable R. roseolus. This diagnostic demonstrated the first fruiting of Japanese shoro cultivated on P. radiata in the Southern Hemisphere.

  14. Nonanthocyanin secondary metabolites of black raspberry (Rubus occidentalis L.) fruits: identification by HPLC-DAD, NMR, HPLC-ESI-MS, and ESI-MS/MS analyses.

    Science.gov (United States)

    Paudel, Liladhar; Wyzgoski, Faith J; Scheerens, Joseph C; Chanon, Ann M; Reese, R Neil; Smiljanic, Danijela; Wesdemiotis, Chrys; Blakeslee, Joshua J; Riedl, Kenneth M; Rinaldi, Peter L

    2013-12-11

    Nonanthocyanin secondary metabolites potentially contributing to the antiproliferative bioactivity of black raspberry ( Rubus occidentalis L.) fruits were extracted in ethyl acetate and isolated by semipreparative and analytical HPLC and analyzed by NMR, HPLC-ESI-MS, and ESI-MS/MS techniques. Here we present complete and partial structures of a variety of the chemical entities such as quercetin 3-glucoside, quercetin 3-rutinoside, myricetin glucoside, dihydrokaempferol glucoside, benzoic acid β-d-glucopyranosyl ester, 3,4-dihydroxybenzoic acid, epicatechin, caffeic acid, p-coumaric acid, p-coumaryl glucoside, p-coumaryl sugar ester, ellagic acid, methyl ellagic acid acetylpentose, methyl ellagic acid valerylpentose, trans-piceid, phloretin glucoside (phloridzin), dihydrosinapic acid, salicylic acid β-d-glucopyranosyl ester, a salicylic acid derivative without attached sugar, p-alkylphenyl glucoside, and a citric acid derivative. To our knowledge, 15 of these compounds were not previously reported in black raspberry fruits.

  15. A genetic linkage map of black raspberry (Rubus occidentalis) and the mapping of Ag(4) conferring resistance to the aphid Amphorophora agathonica.

    Science.gov (United States)

    Bushakra, Jill M; Bryant, Douglas W; Dossett, Michael; Vining, Kelly J; VanBuren, Robert; Gilmore, Barbara S; Lee, Jungmin; Mockler, Todd C; Finn, Chad E; Bassil, Nahla V

    2015-08-01

    We have constructed a densely populated, saturated genetic linkage map of black raspberry and successfully placed a locus for aphid resistance. Black raspberry (Rubus occidentalis L.) is a high-value crop in the Pacific Northwest of North America with an international marketplace. Few genetic resources are readily available and little improvement has been achieved through breeding efforts to address production challenges involved in growing this crop. Contributing to its lack of improvement is low genetic diversity in elite cultivars and an untapped reservoir of genetic diversity from wild germplasm. In the Pacific Northwest, where most production is centered, the current standard commercial cultivar is highly susceptible to the aphid Amphorophora agathonica Hottes, which is a vector for the Raspberry mosaic virus complex. Infection with the virus complex leads to a rapid decline in plant health resulting in field replacement after only 3-4 growing seasons. Sources of aphid resistance have been identified in wild germplasm and are used to develop mapping populations to study the inheritance of these valuable traits. We have constructed a genetic linkage map using single-nucleotide polymorphism and transferable (primarily simple sequence repeat) markers for F1 population ORUS 4305 consisting of 115 progeny that segregate for aphid resistance. Our linkage map of seven linkage groups representing the seven haploid chromosomes of black raspberry consists of 274 markers on the maternal map and 292 markers on the paternal map including a morphological locus for aphid resistance. This is the first linkage map of black raspberry and will aid in developing markers for marker-assisted breeding, comparative mapping with other Rubus species, and enhancing the black raspberry genome assembly.

  16. Mapping of A1 conferring resistance to the aphid Amphorophora idaei and dw (dwarfing habit in red raspberry (Rubus idaeus L. using AFLP and microsatellite markers

    Directory of Open Access Journals (Sweden)

    Knight Victoria H

    2007-03-01

    Full Text Available Abstract Background Raspberry breeding programmes worldwide aim to produce improved cultivars to satisfy market demands and within these programmes there are many targets, including increased fruit quality, yield and season, and improved pest and disease resistance and plant habit. The large raspberry aphid, Amphorophora idaei, transmits four viruses and vector resistance is an objective in raspberry breeding. The development of molecular tools that discriminate between aphid resistance genes from different sources will allow the pyramiding of such genes and the development of raspberry varieties with superior pest resistance. We have raised a red raspberry (Rubus idaeus F1 progeny from the cross 'Malling Jewel' × 'Malling Orion' (MJ × MO, which segregates for resistance to biotype 1 of the aphid Amphorophora idaei and for a second phenotypic trait, dwarf habit. These traits are controlled by single genes, denoted (A1 and (dw respectively. Results The progeny of 94 seedlings was scored for the segregation of 95 AFLP and 22 SSR markers and a linkage map was constructed that covers a total genetic distance of 505 cM over seven linkage groups. The average linkage group length was 72.2 cM and there was an average of 17 markers per linkage group, of which at least two were codominant SSRs, allowing comparisons with previously published maps of raspberry. The two phenotypic traits, A1 and dw, mapped to linkage groups 3 and 6 respectively. Conclusion The mapping of A1 will facilitate the discrimination of resistance genes from different sources and the pyramiding of aphid resistance genes in new raspberry cultivars; the mapping of dw will allow further investigations into the genetics of dwarfing habit in Rubus.

  17. Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

    Directory of Open Access Journals (Sweden)

    Luciane Favero

    2009-01-01

    Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

  18. The Female Cibarial Armature of New World Culex, Subgenus Melanoconion and Related Subgenera with Notes on this Character in Subgenera Culex, Lutzia and Neoculex and Genera Galindomyia and Deinocerites (Diptera: Culicidae)

    Science.gov (United States)

    1978-01-01

    Peru ). deeZarator Dyar Subgenus lVeo&!ex: arixonensis Bohart (USA-Arizona), derivator Dyar and Knab (Costa Rica), territans Walker (USA-Maryland...apparently characteris- tic of aZbir,ensis. (d) batesi subtype (Fig. 3E). This subtype is apparently distinc- tive of batesi. The cibarial teeth...in the spissipes subtype (spissipes, eprmastasis, opisthopus, por- tesi , taeniopus and vomerifer) based on the cibarial armature as shown here and

  19. Notes on two species of the cavernicolous subgenus Neobisium (Blothrus) Schiödte, 1847 (Arachnida: Pseudoscorpiones) from Transylvania (Romania), with a key to the species of the Carpathian Mountains.

    Science.gov (United States)

    Novák, János

    2014-05-19

    Redescriptions of Neobisium (Blothrus) minutum (Tömösváry, 1882) and N. (B.) brevipes (Frivaldszky, 1865) are given, accompanied by new illustrations. Neobisium (B.) brevipes montanum is elevated to full species rank as N. (B.) montanum Beier, 1939. New records of N. (B.) minutum and N. (B.) brevipes from Romania are presented. A key to the members of the subgenus Blothrus occurring in the Carpathian Mountains is provided.

  20. Medical Entomology Studies - VI. A Revision of the Subgenus Lophoceraomyia of the Genus Culex in the Oriental Region (Diptera: Culicidae) (Contributions of the American Entomological Institute, Volume 13, Number 4, 1977)

    Science.gov (United States)

    1977-01-01

    cephalothorax and metanotum. Trumpet. Brownish, short, stout, sausage -like, apex slightly projecting beyond margin of middorsal ridge in flat preparation...Subgenus LoPhoceraow2yia in the Oriental Region 137 lighter or yellowish white. Trumpet. Dark brown, short, stout, sausage -like. Complete chaetotaxy...Publ. 20: 1-147. Les moustiques de la Cochinchine et du Sud-Annam. Arch. Inst. Pasteur d’Indochine 3-4: 75-121. Les moustiques de la Cochinchine

  1. Medical Entomolgy Studies - VI. A Revision of the Subgenus Lophoceraomyia of the Genus Culex in the Oriental Region (Diptera: Culicidae) (Contributions of the American Entomological Institute. Volume 13, Number 4)

    Science.gov (United States)

    1977-01-01

    cephalothorax and metanotum. Trumpet. Brownish, short, stout, sausage -like, apex slightly projecting beyond margin of middorsal ridge in flat preparation...Subgenus LoPhoceraow2yia in the Oriental Region 137 lighter or yellowish white. Trumpet. Dark brown, short, stout, sausage -like. Complete chaetotaxy...Publ. 20: 1-147. Les moustiques de la Cochinchine et du Sud-Annam. Arch. Inst. Pasteur d’Indochine 3-4: 75-121. Les moustiques de la Cochinchine

  2. A new species of Reithrodontomys, subgenus Aporodon (Cricetidae: Neotominae), from the highlands of Costa Rica, with comments on Costa Rican and Panamanian Reithrodontomys

    Science.gov (United States)

    Gardner, Alfred L.; Carleton, Michael D.

    2009-01-01

    A new species of the rodent genus Reithrodontomys (Cricetidae: Neotominae) is described from Cerro Asuncion in the western Cordillera de Talamanca, Costa Rica. The long tail, elongate rostrum, bulbous braincase, and complex molars of the new species associate it with members of the subgenus Aporodon, tenuirostris species group. In its diminutive size and aspects of cranial shape, the new species (Reithrodontomys musseri, sp. nov.) most closely resembles R. microdon, a form known from highlands in Guatemala and Chiapas, Mexico. In the course of differentially diagnosing the new species, we necessarily reviewed the Costa Rican and Panamanian subspecies of R. mexicanus based on morphological comparisons, study of paratypes and vouchers used in recent molecular studies, and morphometric analyses. We recognize Reithrodontomys cherrii (Allen, 1891) and R. garichensis finders and Pearson, 1940, as valid species, and allocate R. mexicanus potrerograndei Goodwin, 1945, as a subjective synonym of R. brevirostris Goodwin, 1943. Critical review of museum specimens collected subsequent to Hooper's (1952) revision is needed and would do much to improve understanding of Reithrodontomys taxonomy and distribution in Middle America.

  3. Albucacrispa and A. grandis (Hyacinthaceae: Omithogaloideae, two new species of subgenus Albuca, the rediscovery of A. albucoides (sub­ genus Osmyne, and the identity of A. reflexa

    Directory of Open Access Journals (Sweden)

    J. C. Manning

    2009-08-01

    Full Text Available Albuca crispa is a new species of section Falconera series Trianthera with crispulate leaves from the Great Karoo, known  at least since 1947 but overlooked until now. A second new species. A grandis. from the southwestern Cape was previously included in  A. fragrans Jacq. (section  Falconera series  Falconera. It is a robust species that flowers in winter and early spring and the styles are rugulose with ± isodiametric epidermal cells, unlike typical  A. fragrans which is a more slender species flowering in early summer and with derived, smooth styles with fusiform epidermal cells. The recent discovery of a flowering population matching the type of A. albucoides (Aiton J.C.Manning & Goldblatt (subgenus Osmyne allows for a full description and illustration of this poorly know n and taxonomically neglected species that has often been included in A. suaveolens (Jacq. J.C.Manning & Goldblatt. Lastly, examination of the type  of A. reflexa Krause & Dinter from Namibia shows it to be conspecific w ith Drimia indica (Roxb. Jessop.

  4. Albucacrispa and A. grandis (Hyacinthaceae: Omithogaloideae, two new species of subgenus Albuca, the rediscovery of A. albucoides (sub­ genus Osmyne, and the identity of A. reflexa

    Directory of Open Access Journals (Sweden)

    J. C. Manning

    2009-12-01

    Full Text Available Albuca crispa is a new species of section Falconera series Trianthera with crispulate leaves from the Great Karoo, known  at least since 1947 but overlooked until now. A second new species. A grandis. from the southwestern Cape was previously included in  A. fragrans Jacq. (section  Falconera series  Falconera. It is a robust species that flowers in winter and early spring and the styles are rugulose with ± isodiametric epidermal cells, unlike typical  A. fragrans which is a more slender species flowering in early summer and with derived, smooth styles with fusiform epidermal cells. The recent discovery of a flowering population matching the type of A. albucoides (Aiton J.C.Manning & Goldblatt (subgenus Osmyne allows for a full description and illustration of this poorly know n and taxonomically neglected species that has often been included in A. suaveolens (Jacq. J.C.Manning & Goldblatt. Lastly, examination of the type  of A. reflexa Krause & Dinter from Namibia shows it to be conspecific w ith Drimia indica (Roxb. Jessop.

  5. Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

    Science.gov (United States)

    Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

    2017-10-01

    In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

  6. Health specific traits beyond the Five Factor Model, cognitive processes and trait expression: replies to Watson (2012), Matthews (2012) and Haslam, Jetten, Reynolds, and Reicher (2012).

    Science.gov (United States)

    Ferguson, Eamonn; Ward, Jane W; Skatova, Anya; Cassaday, Helen J; Bibby, Peter A; Lawrence, Claire

    2013-05-01

    In this article we reply to the issues raised by the three commentaries on Ferguson's (2012) article. Watson argues that the four traits identified by Ferguson (2012) - health anxiety, alexithymia, empathy and Type D - do not lie outside the Five Factor Model (FFM). We present factor analytic data showing that health anxiety forms a separate factor from positive and negative affectivity, alexithymia forms a factor outside the FFM and while emotional empathy loads with agreeableness, cognitive empathy forms a separate factor outside the FFM. Across these analyses there was no evidence for a general factor of personality. We also show that health anxiety, empathic facets and alexithymia show incremental validity over FFM traits. However, the evidence that Type D lies outside the FFM is less clear. Matthews (2012) argues that traits have a more distributed influence on cognitions and that attention is not part of Ferguson's framework. We agree; but Ferguson's original statement concerned where traits have their maximal effect. Finally, Haslam et al. suggest that traits should be viewed from a dynamic interactionist perspective. This is in fact what Ferguson (2012) suggested and we go on to highlight that traits can also influence group processes.

  7. De-novo RNA sequencing and metabolite profiling to identify genes involved in anthocyanin biosynthesis in Korean black raspberry (Rubus coreanus Miquel.

    Directory of Open Access Journals (Sweden)

    Tae Kyung Hyun

    Full Text Available The Korean black raspberry (Rubus coreanus Miquel, KB on ripening is usually consumed as fresh fruit, whereas the unripe KB has been widely used as a source of traditional herbal medicine. Such a stage specific utilization of KB has been assumed due to the changing metabolite profile during fruit ripening process, but so far molecular and biochemical changes during its fruit maturation are poorly understood. To analyze biochemical changes during fruit ripening process at molecular level, firstly, we have sequenced, assembled, and annotated the transcriptome of KB fruits. Over 4.86 Gb of normalized cDNA prepared from fruits was sequenced using Illumina HiSeq™ 2000, and assembled into 43,723 unigenes. Secondly, we have reported that alterations in anthocyanins and proanthocyanidins are the major factors facilitating variations in these stages of fruits. In addition, up-regulation of F3'H1, DFR4 and LDOX1 resulted in the accumulation of cyanidin derivatives during the ripening process of KB, indicating the positive relationship between the expression of anthocyanin biosynthetic genes and the anthocyanin accumulation. Furthermore, the ability of RcMCHI2 (R. coreanus Miquel chalcone flavanone isomerase 2 gene to complement Arabidopsis transparent testa 5 mutant supported the feasibility of our transcriptome library to provide the gene resources for improving plant nutrition and pigmentation. Taken together, these datasets obtained from transcriptome library and metabolic profiling would be helpful to define the gene-metabolite relationships in this non-model plant.

  8. Characterization of the Antibacterial Activity and the Chemical Components of the Volatile Oil of the Leaves of Rubus parvifolius L.

    Directory of Open Access Journals (Sweden)

    Yongqing Cai

    2012-06-01

    Full Text Available Rubus parvifolius L. (Rp is a medicinal herb that possesses antibacterial activity. In this study, we extracted the volatile oil from the leaves of Rp to assess its antibacterial activity and analyze its chemical composition. A uniform distribution design was used to optimize the extraction procedure, which yielded 0.36% (w/w of light yellowish oil from the water extract of Rp leaves. We found that the extracted oil effectively inhibited the growth of a wide range of Gram positive and negative bacteria, including Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumanii, Bacillus cloacae, and Klebsiella pneumoniae. We further analyzed the components contained in the hydro-distillated Rp volatile oil by gas chromatography-mass spectroscopy. Twenty nine compounds were identified, including 4-hydroxy-3-methoxystyrene (66%, 3,7,11,15-tetramethyl-2-hexadecen-1-ol (10% and 4-tert-butylbenzoic acid (2%. Our results suggest that one or multiple constituents contained in Rp volatile oil may account for its antibacterial activity.

  9. Simultaneous determination and pharmacokinetic study of three flavonoid glycosides in rat plasma by LC-MS/MS after oral administration of Rubus chingii Hu extract.

    Science.gov (United States)

    Zan, Tao; Piao, Li; Wei, Yuntao; Gu, Yue; Liu, Baohua; Jiang, Daqing

    2018-03-01

    A simple and sensitive liquid chromatography tandem mass spectrometry (LC-MS/MS) method was developed for the simultaneous determination of isoquercitrin, kaempferol-3-O-rutinoside and tiliroside in rat plasma. Plasma samples were deproteinized with methanol and separated on a Hypersil Gold C 18 column (2.1 × 50 mm, i.d., 3.0 μm) using gradient elution with the mobile phase of water and methanol at a flow rate of 0.4 mL/min. Mass spectrometric detection was performed with negative ion electrospray ionization in selected reaction monitoring mode. All analytes showed good linearity over their investigated concentration ranges (r 2  > 0.99). The lower limit of quantification was 1.0 ng/mL for isoquercitrin and 2.0 ng/mL for kaempferol-3-O-rutinoside and tiliroside, respectively. Intra- and inter-day precisions were 80.4%. The assay was successfully applied to investigate the pharmacokinetic study of the three ingredients after oral administration of Rubus chingii Hu to rats. Copyright © 2017 John Wiley & Sons, Ltd.

  10. Novel ent-Kaurane Diterpenoid from Rubus corchorifolius L. f. Inhibits Human Colon Cancer Cell Growth via Inducing Cell Cycle Arrest and Apoptosis.

    Science.gov (United States)

    Chen, Xuexiang; Wu, Xian; Ouyang, Wen; Gu, Min; Gao, Zili; Song, Mingyue; Chen, Yunjiao; Lin, Yanyin; Cao, Yong; Xiao, Hang

    2017-03-01

    The tender leaves of Rubus corchorifolius L. f. have been consumed as tea for drinking in China since ancient times. In this study, a novel ent-kaurane diterpenoid was isolated and identified from R. corchorifolius L. f. leaves as ent-kaur-2-one-16β,17-dihydroxy-acetone-ketal (DEK). DEK suppressed the growth of HCT116 human colon cancer cells with an IC50 value of 40 ± 0.21 μM, while it did not cause significant growth inhibition on CCD-18Co human colonic myofibroblasts at up to100 μM. Moreover, DEK induced extensive apoptosis and S phase cell cycle arrest in the colon cancer cells. Accordingly, DEK caused profound effects on multiple signaling proteins associated with cell proliferation, cell death, and inflammation. DEK significantly upregulated the expression levels of pro-apoptotic proteins such as cleaved caspase-3, cleaved caspase-9, cleaved PARP, p53, Bax, and tumor suppressor p21Cip1/Waf1, downregulated the levels of cell cycle regulating proteins such as cyclinD1, CDK2, and CDK4 and carcinogenic proteins such as EGFR and COX-2, and suppressed the activation of Akt. Overall, our results provide a basis for using DEK as a potential chemopreventive agent against colon carcinogenesis.

  11. Rapid Identification of Flavonoid Constituents Directly from PTP1B Inhibitive Extract of Raspberry (Rubus idaeus L.) Leaves by HPLC-ESI-QTOF-MS-MS.

    Science.gov (United States)

    Li, Zhuan-Hong; Guo, Han; Xu, Wen-Bin; Ge, Juan; Li, Xin; Alimu, Mireguli; He, Da-Jun

    2016-01-01

    Many potential health benefits of raspberry (Rubus idaeus L.) leaves were attributed to polyphenolic compounds, especially flavonoids. In this study, the methanol extract of R. idaeus leaves showed significant protein tyrosine phosphatase-1B (PTP1B) inhibitory activity with IC50 value of 3.41 ± 0.01 µg mL(-1) Meanwhile, a rapid and reliable method, employed high-performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry, was established for structure identification of flavonoids from PTP1B inhibitive extract of R. idaeus leaves using accurate mass measurement and characteristic fragmentation patterns. A total of 16 flavonoids, including 4 quercetin derivatives, 2 luteolin derivatives, 8 kaempferol derivatives and 2 isorhamnetin derivatives, were identified. Compounds 3: and 4: , Compounds 6: and 7: and Compounds 15: and 16: were isomers with different aglycones and different saccharides. Compounds 8: , 9: and 10: were isomers with the same aglycone and the same saccharide but different substituent positions. Compounds 11: and 12: were isomers with the same aglycone but different saccharides. Compounds 2: , 8: , 9: and 10: possessed the same substituent saccharide of glycuronic acid. Most of them were reported inR. idaeus for the first time. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. De-novo RNA sequencing and metabolite profiling to identify genes involved in anthocyanin biosynthesis in Korean black raspberry (Rubus coreanus Miquel).

    Science.gov (United States)

    Hyun, Tae Kyung; Lee, Sarah; Rim, Yeonggil; Kumar, Ritesh; Han, Xiao; Lee, Sang Yeol; Lee, Choong Hwan; Kim, Jae-Yean

    2014-01-01

    The Korean black raspberry (Rubus coreanus Miquel, KB) on ripening is usually consumed as fresh fruit, whereas the unripe KB has been widely used as a source of traditional herbal medicine. Such a stage specific utilization of KB has been assumed due to the changing metabolite profile during fruit ripening process, but so far molecular and biochemical changes during its fruit maturation are poorly understood. To analyze biochemical changes during fruit ripening process at molecular level, firstly, we have sequenced, assembled, and annotated the transcriptome of KB fruits. Over 4.86 Gb of normalized cDNA prepared from fruits was sequenced using Illumina HiSeq™ 2000, and assembled into 43,723 unigenes. Secondly, we have reported that alterations in anthocyanins and proanthocyanidins are the major factors facilitating variations in these stages of fruits. In addition, up-regulation of F3'H1, DFR4 and LDOX1 resulted in the accumulation of cyanidin derivatives during the ripening process of KB, indicating the positive relationship between the expression of anthocyanin biosynthetic genes and the anthocyanin accumulation. Furthermore, the ability of RcMCHI2 (R. coreanus Miquel chalcone flavanone isomerase 2) gene to complement Arabidopsis transparent testa 5 mutant supported the feasibility of our transcriptome library to provide the gene resources for improving plant nutrition and pigmentation. Taken together, these datasets obtained from transcriptome library and metabolic profiling would be helpful to define the gene-metabolite relationships in this non-model plant.

  13. Rapid Identification of Flavonoid Constituents Directly from PTP1B Inhibitive Extract of Raspberry (Rubus idaeus L.) Leaves by HPLC–ESI–QTOF–MS-MS

    Science.gov (United States)

    Li, Zhuan-Hong; Guo, Han; Xu, Wen-Bin; Ge, Juan; Li, Xin; Alimu, Mireguli; He, Da-Jun

    2016-01-01

    Many potential health benefits of raspberry (Rubus idaeus L.) leaves were attributed to polyphenolic compounds, especially flavonoids. In this study, the methanol extract of R. idaeus leaves showed significant protein tyrosine phosphatase-1B (PTP1B) inhibitory activity with IC50 value of 3.41 ± 0.01 µg mL−1. Meanwhile, a rapid and reliable method, employed high-performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry, was established for structure identification of flavonoids from PTP1B inhibitive extract of R. idaeus leaves using accurate mass measurement and characteristic fragmentation patterns. A total of 16 flavonoids, including 4 quercetin derivatives, 2 luteolin derivatives, 8 kaempferol derivatives and 2 isorhamnetin derivatives, were identified. Compounds 3 and 4, Compounds 6 and 7 and Compounds 15 and 16 were isomers with different aglycones and different saccharides. Compounds 8, 9 and 10 were isomers with the same aglycone and the same saccharide but different substituent positions. Compounds 11 and 12 were isomers with the same aglycone but different saccharides. Compounds 2, 8, 9 and 10 possessed the same substituent saccharide of glycuronic acid. Most of them were reported in R. idaeus for the first time. PMID:26896347

  14. Persistent negative temperature response of mesophyll conductance in red raspberry (Rubus idaeus L.) leaves under both high and low vapour pressure deficits: a role for abscisic acid?

    Science.gov (United States)

    Qiu, Changpeng; Ethier, Gilbert; Pepin, Steeve; Dubé, Pascal; Desjardins, Yves; Gosselin, André

    2017-09-01

    The temperature dependence of mesophyll conductance (gm ) was measured in well-watered red raspberry (Rubus idaeus L.) plants acclimated to leaf-to-air vapour pressure deficit (VPDL) daytime differentials of contrasting amplitude, keeping a fixed diurnal leaf temperature (Tleaf ) rise from 20 to 35 °C. Contrary to the great majority of gm temperature responses published to date, we found a pronounced reduction of gm with increasing Tleaf irrespective of leaf chamber O2 level and diurnal VPDL regime. Leaf hydraulic conductance was greatly enhanced during the warmer afternoon periods under both low (0.75 to 1.5 kPa) and high (0.75 to 3.5 kPa) diurnal VPDL regimes, unlike stomatal conductance (gs ), which decreased in the afternoon. Consequently, the leaf water status remained largely isohydric throughout the day, and therefore cannot be evoked to explain the diurnal decrease of gm . However, the concerted diurnal reductions of gm and gs were well correlated with increases in leaf abscisic acid (ABA) content, thus suggesting that ABA can induce a significant depression of gm under favourable leaf water status. Our results challenge the view that the temperature dependence of gm can be explained solely from dynamic leaf anatomical adjustments and/or from the known thermodynamic properties of aqueous solutions and lipid membranes.​. © 2017 John Wiley & Sons Ltd.

  15. Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

    Directory of Open Access Journals (Sweden)

    Gonzalo Martínez Fernández

    2016-01-01

    Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

  16. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  17. Scratching the surface? Taxonomic revision of the subgenus Schizoptera (Odontorhagus) reveals vast undocumented biodiversity in the largest litter bug genus Schizoptera Fieber (Hemiptera: Dipsocoromorpha).

    Science.gov (United States)

    Leon, Stephanie; Weirauch, Christiane

    2016-11-03

    Schizoptera Fieber, currently the largest genus of litter bugs (Hemiptera: Dipsocoromorpha), comprises 61 extant species in 4 subgenera. Specimens are abundant in New World bulk and residue samples. Schizoptera species showcase stunning morphology including intricate, asymmetrical genitalia in males that have proven to provide excellent species diagnostic features in the past. Recent bulk sample sorting efforts have revealed a vast number of Schizoptera specimens from across the New World, with the majority representing undescribed species. We here taxonomically revise the subgenus Schizoptera (Odontorhagus) that has recently been shown to form a monophyletic group within Schizoptera. Characterized by the blunt tooth on the posterior margin of the propleuron, Schizoptera (Odontorhagus) previously comprised 10 species from Central and the northern part of South America. We here describe 20 new species in S. (Odontorhagus): S. acuta, n. sp., S. angularis, n. sp., S. ansata, n. sp., S. aspera, n. sp., S. brevis, n. sp., S. dentata, n. sp., S. dolosa, n. sp., S. enigmatica, n. sp., S. exacta, n. sp., S. gorgonensis, n. sp., S. insidiosa, n. sp., S. monstrosa, n. sp., S. piscicaudata, n. sp., S. quasicompleta, n. sp., S. radicata, n. sp., S. serrata, n. sp., S. simpla, n. sp., S. singularis, n. sp., S. trivialis, n. sp., S. ungulata, n. sp., increasing the species count of Schizoptera to 81. We provide morphological documentation including digital habitus images and genitalic drawings for all new species and document and redescribe existing species where feasible. Distribution maps and a key to the species of Schizoptera (Odontorhagus) are also presented. We predict that similar increases in species numbers are to be expected for the remaining subgenera of Schizoptera, making this genus a very diverse lineage of minute litter bugs.

  18. The comparison of molecular and morphology-based phylogenies of trichaline net-winged beetles (Coleoptera: Lycidae: Metriorrhynchini with description of a new subgenus

    Directory of Open Access Journals (Sweden)

    Matej Bocek

    2017-10-01

    Full Text Available Separate morphological and molecular phylogenetic analyses are presented and the classification of trichaline net-winged beetles is revised. The clade, earlier given a subfamily, tribe or subtribe rank, is a terminal lineage in Metriorrhynchina and contains Diatrichalus Kleine, 1926, Eniclases Waterhouse, 1879, Flabellotrichalus Pic, 1921, Lobatang Bocak, 1998, Microtrichalus Pic, 1921, Schizotrichalus Kleine, 1926, and Trichalus Waterhouse, 1877. Maibrius subgen. nov. is proposed in Flabellotrichalus with the type-species Flabellotrichalus (Maibrius horaki sp. nov. Unlike previous studies, Lobatang is included in the trichaline clade. Further, Spinotrichalus Kazantsev, 2010, stat. nov. is down-ranked to the subgenus in Lobatang Bocak, 1998 and a new combination, Lobatang (Spinotrichalus telnovi (Kazantsev, 2010 comb. nov., is proposed. The morphology does not provide a sufficient support for robust phylogeny due to the intrageneric variability of most phenotypic traits and the limited number of characters supporting deep relationships. Most morphological generic diagnoses must be based on the shape of male genitalia. Other characters, such as the shapes of pronotum and antennae are commonly variable within genera. The fronto-lateral pronotal ridges of Eniclases + Schizotrichalus resemble the ancestral condition in Metriorrhynchini and they re-evolved in the terminal clade and do not indicate the early split of Eniclases + Schizotrichalus from other trichaline genera. The evolution of morphological traits and the conflict in the morphological and molecular phylogenetic signal are discussed in details. We suggest that the general appearance is affected by the evolution of mimetic complexes, the patterns of elytral costae by their strengthening function, and the presence of flabellate antennae by their role in sexual communication. Then, similar phenotypic traits evolve in unrelated lineages. The results demonstrate that phylogenetic

  19. Population genetic structure, genetic diversity, and natural history of the South American species of Nothofagus subgenus Lophozonia (Nothofagaceae) inferred from nuclear microsatellite data.

    Science.gov (United States)

    Vergara, Rodrigo; Gitzendanner, Matthew A; Soltis, Douglas E; Soltis, Pamela S

    2014-06-01

    The effect of glaciation on the levels and patterns of genetic variation has been well studied in the Northern Hemisphere. However, although glaciation has undoubtedly shaped the genetic structure of plants in the Southern Hemisphere, fewer studies have characterized the effect, and almost none of them using microsatellites. Particularly, complex patterns of genetic structure might be expected in areas such as the Andes, where both latitudinal and altitudinal glacial advance and retreat have molded modern plant communities. We therefore studied the population genetics of three closely related, hybridizing species of Nothofagus (N. obliqua, N. alpina, and N. glauca, all of subgenus Lophozonia; Nothofagaceae) from Chile. To estimate population genetic parameters and infer the influence of the last ice age on the spatial and genetic distribution of these species, we examined and analyzed genetic variability at seven polymorphic microsatellite DNA loci in 640 individuals from 40 populations covering most of the ranges of these species in Chile. Populations showed no significant inbreeding and exhibited relatively high levels of genetic diversity (H E = 0.502-0.662) and slight, but significant, genetic structure (R ST = 8.7-16.0%). However, in N. obliqua, the small amount of genetic structure was spatially organized into three well-defined latitudinal groups. Our data may also suggest some introgression of N. alpina genes into N. obliqua in the northern populations. These results allowed us to reconstruct the influence of the last ice age on the genetic structure of these species, suggesting several centers of genetic diversity for N. obliqua and N. alpina, in agreement with the multiple refugia hypothesis.

  20. How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

    Science.gov (United States)

    Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

    2016-06-01

    Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

  1. Two new species and a new subgenus of toothed Brachyhypopomus electric knifefishes (Gymnotiformes, Hypopomidae) from the central Amazon and considerations pertaining to the evolution of a monophasic electric organ discharge.

    Science.gov (United States)

    Sullivan, John P; Zuanon, Jansen; Cox Fernandes, Cristina

    2013-01-01

    We describe two new, closely related species of toothed Brachyhypopomus (Hypopomidae: Gymnotiformes: Teleostei) from the central Amazon basin and create a new subgenus for them. Odontohypopomus, new subgenus of Brachyhypopomus, is diagnosed by (1) small teeth present on premaxillae; (2) medialmost two branchiostegal rays thin with blades oriented more vertically than remaining three rays; (3) background color in life (and to lesser extent in preservation) distinctly yellowish with head and sides peppered with small, widely spaced, very dark brown stellate chromatophores that greatly contrast with light background coloration; (4) a dark blotch or bar of subcutaneous pigment below the eye; (5) electric organ discharge waveform of very long duration (head-positive phase approx. 2 milliseconds or longer, head-negative phase shorter or absent) and slow pulse repetition rate (3-16 Hz). The type species of the new subgenus, Brachyhypopomus (Odontohypopomus) walteri sp. n., is diagnosed by the following additional character states: (1) subcutaneous dark pigment at base of orbit particularly prominent, (2) body semi-translucent and nearly bright yellow background coloration in life, (3) a biphasic electric organ discharge (EOD) waveform of very long duration (between 3.5 and 4 milliseconds at 25° C) with head-positive first phase significantly longer than second head-negative phase in both sexes. Brachyhypopomus (Odontohypopomus) bennetti sp. n. is diagnosed by two character states in addition to those used to diagnose the subgenus Odontohypopomus: (1) a deep electric organ, visible as large semi-transparent area, occupying approximately 14-17% body depth directly posterior to the abdominal cavity in combination with a short, but deep, caudal filament, and (2) a monophasic, head-positive EOD waveform, approximately 2.1 milliseconds in duration in both sexes. These are the only described rhamphichthyoid gymnotiforms with oral teeth, and Brachyhypopomus bennetti is the first

  2. Two new species and a new subgenus of toothed Brachyhypopomus electric knifefishes (Gymnotiformes, Hypopomidae from the central Amazon and considerations pertaining to the evolution of a monophasic electric organ discharge

    Directory of Open Access Journals (Sweden)

    John Sullivan

    2013-08-01

    Full Text Available We describe two new, closely related species of toothed Brachyhypopomus (Hypopomidae: Gymnotiformes: Teleostei from the central Amazon basin and create a new subgenus for them. Odontohypopomus, new subgenus of Brachyhypopomus, is diagnosed by (1 small teeth present on premaxillae; (2 medialmost two branchiostegal rays thin with blades oriented more vertically than remaining three rays; (3 background color in life (and to lesser extent in preservation distinctly yellowish with head and sides peppered with small, widely spaced, very dark brown stellate chromatophores that greatly contrast with light background coloration; (4 a dark blotch or bar of subcutaneous pigment below the eye; (5 electric organ discharge waveform of very long duration (head-positive phase approx. 2 milliseconds or longer, head-negative phase shorter or absent and slow pulse repetition rate (3–16 Hz. The type species of the new subgenus, Brachyhypopomus (Odontohypopomus walteri sp. n., is diagnosed by the following additional character states: (1 subcutaneous dark pigment at base of orbit particularly prominent, (2 body semi-translucent and nearly bright yellow background coloration in life, (3 a biphasic electric organ discharge (EOD waveform of very long duration (between 3.5 and 4 milliseconds at 25° C with head-positive first phase significantly longer than second head-negative phase in both sexes. Brachyhypopomus (Odontohypopomus bennetti sp. n. is diagnosed by two character states in addition to those used to diagnose the subgenus Odontohypopomus: (1 a deep electric organ, visible as large semi-transparent area, occupying approximately 14–17% body depth directly posterior to the abdominal cavity in combination with a short, but deep, caudal filament, and (2 a monophasic, head-positive EOD waveform, approximately 2.1 milliseconds in duration in both sexes. These are the only described rhamphichthyoid gymnotiforms with oral teeth, and B. bennetti is the first

  3. In vitro activity of 2-pyridinecarboxylic acid against trypanosomes of the subgenus Schizotrypanum isolated from the bat Phyllostomus hastatus - doi: 10.4025/actascibiolsci.v33i4.6482 In vitro activity of 2-pyridinecarboxylic acid against trypanosomes of the subgenus Schizotrypanum isolated from the bat Phyllostomus hastatus - doi: 10.4025/actascibiolsci.v33i4.6482

    Directory of Open Access Journals (Sweden)

    Sueli Fumie Yamada-Ogatta

    2011-09-01

    Full Text Available The effect of 2-pyridinecarboxylic acid (picolinic acid on trypanosomes of the subgenus Schizotrypanum isolated from the bat Phyllostomus hastatus was determined in this study. Picolinic acid, at 50 µg mL-1, inhibited epimastigote growth by 99% after 12 days incubation. In addition, trypomastigote motility decreased by 50% after 6h and completely after 24h in the presence of 50 µg mL-1 picolinic acid. The 50% cytotoxic concentration on HEp-2 cell line was 275 µg mL-1 after 4 days incubation. Altogether, these results indicate higher toxicity against trypanosomes. The inhibitory effect of picolinic acid on epimastigote growth can be partially reversed by nicotinic acid and L-tryptophan, suggesting a competitive inhibition. Furthermore, two anti-Trypanosoma (Schizotrypanum cruzi drugs were also evaluated with regard to bat trypanosome growth. Benznidazole, at 50 µg mL-1, inhibited epimastigote growth by 90% after 12 days incubation. Nifurtimox, at the same concentration, caused 96% growth inhibition after four days incubation. Corroborating a previous study, bat trypanosomes are a good model for screening new trypanocidal compounds. Moreover, they can be used to study many biological processes common to human pathogenic trypanosomatids.The effect of 2-pyridinecarboxylic acid (picolinic acid on trypanosomes of the subgenus Schizotrypanum isolated from the bat Phyllostomus hastatus was determined in this study. Picolinic acid, at 50 µg mL-1, inhibited epimastigote growth by 99% after 12 days incubation. In addition, trypomastigote motility decreased by 50% after 6h and completely after 24h in the presence of 50 µg mL-1 picolinic acid. The 50% cytotoxic concentration on HEp-2 cell line was 275 µg mL-1 after 4 days incubation. Altogether, these results indicate higher toxicity against trypanosomes. The inhibitory effect of picolinic acid on epimastigote growth can be partially reversed by nicotinic acid and L-tryptophan, suggesting a

  4. Establecimiento y multiplicación in vitro de mora de castilla (Rubus glaucus Benth. variedad sin espinas, mediante ápices meristemáticos

    Directory of Open Access Journals (Sweden)

    Sigarroa Rieche Alina Katil

    2011-12-01

    Full Text Available Se evaluó una técnica de micropropagación de plantas de mora (Rubus glaucus de la variedad sin espinas, a partir de ápices meristemáticos. En la fase de establecimiento se evaluó un protocolo de desinfección utilizando por 5 min solución de jabón detergente comercial y agua + alcohol 70% por 2 min + hipoclorito 3% con dos tiempos de exposición diferentes: T1 por 5 min y T2 por 10 min. Después de desinfectar las microestacas se extrajeron los ápices meristemáticos y se establecieron in vitro bajo un diseño completamente al azar para evaluar dos medios de cultivo: M1 y M2. A partir de las plántulas desarrolladas se efectuó la multiplicación en los medios de cultivo M1, M3 y M4. Ambos tratamientos de desinfección resultaron efectivos alcanzando 100% de desinfección de los explantes con cada uno de ellos. La siembra de ápices meristemáticos permitió el establecimiento de cultivos asépticos y un adecuado desarrollo de los explantes después de seis semanas de cultivo, con prendimiento de 83.4% para M1 y 66.6% para M2. El análisis de varianza (Anova y la prueba de rangos múltiples mostraron que la multiplicación fue mejor en el medio M1 con una mayor tasa de crecimiento y desarrollo del explante, al obtener coeficientes de multiplicación de 7.5 brotes/plántula y una altura promedio de 1.95 cm.

  5. Improved recovery of cryotherapy-treated shoot tips following thermotherapy of in vitro-grown stock shoots of raspberry (Rubus idaeus L.).

    Science.gov (United States)

    Wang, Qiaochun; Valkonen, Jari P T

    2009-01-01

    Raspberry bushy dwarf virus (RBDV) can be efficiently eradicated from raspberry plants (Rubus idaeus) by a procedure combining thermotherapy and cryotherapy. However, the bottleneck of this procedure is that, following thermotherapy, cryopreserved shoot tips become chlorotic during regrowth and eventually die after several subcultures. In addition, survival of heat-treated stock shoots and recovery of cryopreserved shoot tips following thermotherapy are low. The present study focused towards improving regrowth of cryopreserved raspberry shoot tips following thermotherapy. Results showed that preconditioning stock shoots with salicylic acid (SA; 0.01-0.1 mM) markedly increased survival of stock shoots after 4 weeks of thermotherapy. Regrowth of cryopreserved shoot tips following thermotherapy was also significantly enhanced when SA (0.05-0.1 mM) was used for preconditioning stock shoots. Addition of either Fe-ethylenediaminetetracetic acid (Fe-EDTA, 50 mg per L) or Fe-ethylenediaminedi(o)hydroxyphenylacetic acid (Fe-EDDHA, 50 mg per L) to post-culture medium strongly promoted regrowth and totally prevented chlorosis of shoots regenerated from cryopreserved shoot tips following thermotherapy. Using the parameters optimized in the present study, about 80 percent survival of heat-treated stock shoots and about 33 percent regrowth of cryopreserved shoot tips following thermotherapy were obtained. Morphology of plants regenerated from cryopreserved shoot tips following thermotherapy was identical to that of control plants, based on observations of leaf shape and size, internode length and plant height. Optimization of the thermotherapy procedure followed by cryotherapy will facilitate the wider application of this technique to eliminate viruses which can invade meristems.

  6. A comparative study on composition and antioxidant activities of supercritical carbon dioxide, hexane and ethanol extracts from blackberry (Rubus fruticosus) growing in Poland.

    Science.gov (United States)

    Wajs-Bonikowska, Anna; Stobiecka, Agnieszka; Bonikowski, Radosław; Krajewska, Agnieszka; Sikora, Magdalena; Kula, Józef

    2017-08-01

    Large quantities of blackberry seeds are produced as a pomace during the processing of juice and jam production; this by-product is a very interesting raw material both for oil manufacturing and as a source of bioactive compounds. In this work the composition, yield and antioxidant activity of three types of Rubus fructicosus pomace extracts isolated by liquid extraction using solvents of different polarity, as well with supercritical CO 2 fluid extraction have been compared. The highest extract yield was reported for Soxhlet extraction using ethanol as a solvent (14.2%). Supercritical carbon dioxide and hexane extracts were characterised by the highest content of phytosterols (1445 and 1583 mg 100 g -1 of extract, respectively) among which β-sitosterol was the main one, while the concentration of tocopherols, with predominant γ-isomer, was the highest for both hexane and ethanol extracts, being 2364 and 2334 mg 100 g -1 , respectively. Using a GC-MS method 95 volatiles, in which non-saturated aldehydes were predominant, were identified in the essential oil of seed pomace and in the volatile oil isolated from supercritical extract. The ethanolic extract which is characterised by the highest phenolic content (9443 mg GAE 100 g -1 ) exhibited the highest antioxidant activity (according to the ABTS •+ and DPPH • assays). All pomace extracts examined were of high quality, rich in essential omega fatty acids and with a very high content of bioactive compounds, such as phytosterols and tocopherols. The high nutritional value of extracts from berry seed pomace could justify the commercialisation of specific extracts not only as food additives but also as cosmetic components. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  7. STABILITY OF ANTHOCYANINS FROM Rubus glaucus Benth AND Solanum betaceum Cav.dark-red strain AS AFFECTED BY TEMPERATURE, STORAGE TIME AND WATER ACTIVITY

    Directory of Open Access Journals (Sweden)

    C.M. OLAYA

    2009-01-01

    Full Text Available Se comparó el efecto del tiempo de almacenamiento, la temperatura y la actividad de agua (Aw sobre la estabilidad de antocianinas microencapsuladas de Mora de Castilla (Rubus glaucus y tamarillo (Solanum betaceum. Las frutas se sometieron a deshidratación osmótica con etanol y el extracto antociánico se microencapsuló con maltodextrina ED 20 por atomización. La vida media de las antocianinas; los cambios en color, fenoles totales y actividad antioxidante se analizaron durante el almacenamiento a dos temperaturas (25 °C y 40 °C y dos niveles de Aw (0,20 y 0,35. Se observó una disminución de la antocianina monomérica en las dos muestras. La vida media de los pigmentos de mora de Castilla varió entre 11 y 32 días, mientras que la vida media de los pigmentos del tamarillo varió entre 9 y 21 días. Hubo oscurecimiento de las muestras como resultado del tiempo de almacenamiento. La actividad antioxidante de las dos muestras disminuyó, mientras que el contenido fenólico aumentó con el tiempo. La actividad antioxidante de las muestras de mora de Castilla presentó una alta correlación con los contenidos de antocianinas y fenoles totales mientras que la actividad antioxidante de las muestras de tamarillo se correlacionó con el contenido de fenoles totales. Estos resultados son útiles en el desarrollo de aplicaciones de antocianinas microencapsuladas como colorantes alimenticios.

  8. A case study on toxicological aspects of the pest and disease control in the production of the high-quality raspberry (Rubus idaeus L.).

    Science.gov (United States)

    Sadło, Stanisław; Szpyrka, Ewa; Piechowicz, Bartosz; Grodzicki, Przemysław

    2015-01-01

    The field studies on the residue levels of the fungicides and insecticides used in commercial raspberry (Rubus idaeus L.) plantation have been performed. Starting on the first day of harvesting (on June 19), 20 laboratory samples of fruit, 10 laboratory samples of leaves and 4 samples of soil were analyzed and the residue levels were compared to the Maximum Residue Limits (MRL) and Acceptable Daily Intakes (ADI). All analyses were carried out using extraction method and gas chromatography technique. Esfenwalerate (Sumi-alpha 050 EC) and beta-cyfluthrin (Bulldock 025 EC), the insecticides belonging to the group of synthetic pyrethroids, were not found in harvested ripe fruits, while cypermethrin residues (Cyperkill 25 EC) applied on May 24, 25 days later was still found on low levels in fruits (0.026 mg kg(-1)) and in leaves (2.58 mg kg(-1)). In turn, residues of chlorpyrifos (Dursban 480 EC), applied to the soil on May 15 against the cockchafers Melolontha melolontha and Otiorhynchus sp., were found at the level 0.004 mg kg(-1). The content of pesticides in ripe fruits depended mainly on the dose and on the time that has elapsed from the date of their application and were as follows: boscalid -0.950, pyrimethanil -0.917, pyraclostrobin -0.253 cypermethrin -0.026 and chlorpyrifos -0.004 mg kg(-1) while in leaves: boscalid -30.64, pyrimethanil -8.13, pyraclostrobin -15.82, cypermethrin -2.58 and chlorpyrifos -0.15 mg kg(-1). The highest average daily intake was in the case of boscalid, and in fruits and leaves reached the levels 0.205 and 6.63, in total 0.33% and 12.18% of ADI, respectively.

  9. Gene expression analysis of enzymes of the carotenoid biosynthesis pathway involved in β-cryptoxanthin accumulation in wild raspberry, Rubus palmatus.

    Science.gov (United States)

    Mizuno, Kouichi; Tokiwano, Tetsuo; Yoshizawa, Yuko

    2017-03-18

    β-cryptoxanthin (β-Cry), a xanthophyll, is unlike other abundant carotenoids, such as α-carotene, β-carotene, lycopene, lutein, and zeaxanthin. It is not found in most fruits or vegetables but is found only in specific fruits, such as hot chili pepper, persimmon, and citrus fruits. Because recent reports suggest that β-Cry intake is beneficial to human health, the xanthophyll requires further investigation. Although β-Cry accumulates in the fruit of wild raspberry, Rubus palmatus, it is not present in cultivated raspberry. In the present study, two wild raspberry species were studied-R. palmatus, which accumulates β-Cry in the fruit, and R. crataegifolius, which does not accumulate β-Cry. Four carotenoid biosynthetic enzymes derived from these two species were analyzed-phytoene synthase (PSY), lycopene β-cyclase (LCYb), β-carotene hydroxylase (HYb), and zeaxanthin epoxidase (ZEP). Expression levels of their genes were also assessed to elucidate mechanism underlying β-Cry accumulation. Partial gene sequences of RubPSY, RubLCYb, RubHYb, and RubZEP, isolated from immature raspberry fruits of R. palmatus, were used as probes for Northern blot analysis. RubZEP expression ceased as the fruits matured, possibly because of reduced production of zeaxanthin. β-Cry is considered to be an intermediate compound that accumulates in the mature fruits of R. palmatus. High expression of RubPSY was detectable in the mature fruits of R. crataegifolius, and the expression of RubLCYb, RubHYb, and RubZEP was detectable during all stages of fruit maturation. In contrast, β-Cry was absent in the mature fruits of R. crataegifolius. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Development of Chloroplast and Nuclear DNA Markers for Chinese Oaks (Quercus Subgenus Quercus and Assessment of Their Utility as DNA Barcodes

    Directory of Open Access Journals (Sweden)

    Jia Yang

    2017-05-01

    Full Text Available Chloroplast DNA (cpDNA is frequently used for species demography, evolution, and species discrimination of plants. However, the lack of efficient and universal markers often brings particular challenges for genetic studies across different plant groups. In this study, chloroplast genomes from two closely related species (Quercus rubra and Castanea mollissima in Fagaceae were compared to explore universal cpDNA markers for the Chinese oak species in Quercus subgenus Quercus, a diverse species group without sufficient molecular differentiation. With the comparison, nine and 14 plastid markers were selected as barcoding and phylogeographic candidates for the Chinese oaks. Five (psbA-trnH, matK-trnK, ycf3-trnS, matK, and ycf1 of the nine plastid candidate barcodes, with the addition of newly designed ITS and a single-copy nuclear gene (SAP, were then tested on 35 Chinese oak species employing four different barcoding approaches (genetic distance-, BLAST-, character-, and tree-based methods. The four methods showed different species identification powers with character-based method performing the best. Of the seven barcodes tested, a barcoding gap was absent in all of them across the Chinese oaks, while ITS and psbA-trnH provided the highest species resolution (30.30% with the character- and BLAST-based methods, respectively. The six-marker combination (psbA-trnH + matK-trnK + matK + ycf1 + ITS + SAP showed the best species resolution (84.85% using the character-based method for barcoding the Chinese oaks. The barcoding results provided additional implications for taxonomy of the Chinese oaks in subg. Quercus, basically identifying three major infrageneric clades of the Chinese oaks (corresponding to Groups Quercus, Cerris, and Ilex referenced to previous phylogenetic classification of Quercus. While the morphology-based allocations proposed for the Chinese oaks in subg. Quercus were challenged. A low variation rate of the chloroplast genome, and

  11. Development of Chloroplast and Nuclear DNA Markers for Chinese Oaks (Quercus Subgenus Quercus) and Assessment of Their Utility as DNA Barcodes

    Science.gov (United States)

    Yang, Jia; Vázquez, Lucía; Chen, Xiaodan; Li, Huimin; Zhang, Hao; Liu, Zhanlin; Zhao, Guifang

    2017-01-01

    Chloroplast DNA (cpDNA) is frequently used for species demography, evolution, and species discrimination of plants. However, the lack of efficient and universal markers often brings particular challenges for genetic studies across different plant groups. In this study, chloroplast genomes from two closely related species (Quercus rubra and Castanea mollissima) in Fagaceae were compared to explore universal cpDNA markers for the Chinese oak species in Quercus subgenus Quercus, a diverse species group without sufficient molecular differentiation. With the comparison, nine and 14 plastid markers were selected as barcoding and phylogeographic candidates for the Chinese oaks. Five (psbA-trnH, matK-trnK, ycf3-trnS, matK, and ycf1) of the nine plastid candidate barcodes, with the addition of newly designed ITS and a single-copy nuclear gene (SAP), were then tested on 35 Chinese oak species employing four different barcoding approaches (genetic distance-, BLAST-, character-, and tree-based methods). The four methods showed different species identification powers with character-based method performing the best. Of the seven barcodes tested, a barcoding gap was absent in all of them across the Chinese oaks, while ITS and psbA-trnH provided the highest species resolution (30.30%) with the character- and BLAST-based methods, respectively. The six-marker combination (psbA-trnH + matK-trnK + matK + ycf1 + ITS + SAP) showed the best species resolution (84.85%) using the character-based method for barcoding the Chinese oaks. The barcoding results provided additional implications for taxonomy of the Chinese oaks in subg. Quercus, basically identifying three major infrageneric clades of the Chinese oaks (corresponding to Groups Quercus, Cerris, and Ilex) referenced to previous phylogenetic classification of Quercus. While the morphology-based allocations proposed for the Chinese oaks in subg. Quercus were challenged. A low variation rate of the chloroplast genome, and complex

  12. Cuidado humanizado de enfermería según la teoría de Jean Watson, servicio de medicina del Hospital Daniel Alcides Carrión. Lima- Callao, 2015.

    OpenAIRE

    Guerrero-Ramírez, Rosa; Meneses-La Riva, Mónica Elisa; De La Cruz-Ruiz, María

    2017-01-01

    El Cuidado Humanizado es una necesidad que urge en la práctica profesional y esto se evidencia en las políticas, disposiciones normativas establecidas por las entidades de salud que velan por el derecho de los pacientes y garantizan la calidad del servicio que se brinda. Objetivo: determinar el Cuidado Humanizado que brinda el profesional deEnfermería según la Teoría de Jean Watson, Servicio de Medicina del Hospital Daniel Alcides Carrión. Material y métodos: la población total estuvo conform...

  13. RESPUESTA FISIOLÓGICA Y CAPACIDAD ANTAGONISTA DE AISLAMIENTOS FILOSFÉRICOS DE LEVADURAS OBTENIDOS EN CULTIVOS DE MORA (Rubus glaucus

    Directory of Open Access Journals (Sweden)

    CLAUDIA M. MEDINA

    2009-01-01

    Full Text Available La filósfera es un ecosistema complejo que a pesar de contar con un gran número de microorganismos asociados, presenta pocos estudios diseñados para entender las características ecofisiológicas de los microorganismos que lo habitan. Las levaduras, como elemento importante de este hábitat, están expuestas a un ambiente variable afectado por la planta hospedera, edad y posición de la hoja, disponibilidad y calidad de nutrientes, temperatura, pH, radiación y actividad del agua. Estos factores producen una presión de selección para el establecimiento de poblaciones naturales o introducidas de levaduras que puedan desplazar otras poblaciones de hongos fitopatógenos. En este estudio se obtuvieron 80 aislamientos de levaduras filosféricas de dos cultivos de mora (Rubus glaucus, a las que se les determinó su nicho potencial en términos de su capacidad para crecer a diferentes condiciones de temperatura, pH, estrés osmótico y tolerancia a radiación UV. El estrés osmótico fue la condición evaluada más restrictiva para las levaduras obtenidas, ya que únicamente seis aislamientos presentaron un crecimiento superior a 0,3 unidades de DO a 405 nm, cuando fueron crecidas a 50% y 60% de glucosa. Este estudio permitió seleccionar diez aislamientos filosféricos de levaduras, destacados por su capacidad para crecer en un amplio rango de condiciones. De estos, cuatro aislamientos LvF 34, LvF 43, LvF 44 y LvF 50 se destacaron por su capacidad de antagonismo contra el hongo fitopatógeno Botritys cinérea. Su determinación taxonómica permitió reportar por primera vez las especies Candida kunwinensis y Rhodotorula colostri con potencial biocontrolador.

  14. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Gracilaria, Subgenus Textoriella (Gracilariaceae, Rhodophyta in the Gulf of Mexico and the Mexican Caribbean Gracilaria, subgénero Textoriella (Gracilariaceae, Rhodophyta en el golfo de México y el Caribe mexicano

    Directory of Open Access Journals (Sweden)

    Kurt M. Dreckmann

    2009-12-01

    Full Text Available Four species of Gracilaria (Gracilariaceae, Rhodophyta with textorii-type spermatangial conceptacles (subgenus Textoriella Yamamoto are recorded for the Gulf of Mexico and the Mexican Caribbean: Gracilaria blodgettii, G. cervicornis, G. mammillaris, and G. tikvahiae. The general distribution of the subgenus for Central America, both Pacific and Atlantic, displays a disjunct pattern explainable based on the geologic vicariant events that interrupted the connection between Pacific and Atlantic at the Isthmuses of Panama (closed 3.1-2.8 million years ago, and Tehuantepec (southern Mexico, closed 4-3.5 million years ago. Gracilaria cuneata/G. crispata, and G. mammillaris (G. hayi/G. veleroae are 2 pairs of sibling species, or sister taxa, that diverged as a result of the final emergence of the Isthmus, and of the same age as the Central American Isthmus itself.Se registran 4 especies de Gracilaria (Gracilariaceae, Rhodophyta con conceptáculos espematangiales tipo textorii- (subgénero Textoriella Yamamoto para el golfo de México y Caribe mexicano: Gracilaria blodgettii, G. cervicornis, G. mammillaris y G. tikvahiae. La distribución general del subgénero para Atlántico y Pacífico de Centroamérica despliega un patrón disyunto explicable por los eventos geológicos vicariantes que interrumpieron la conexión entre Pacífico y Atlántico en los istmos de Panamá (cerrado hace aprox. 3.1-2.8 millones de años y Tehuantepec (sur de México, cerrado hace aprox. 4-3.5 millones de años. Gracilaria cuneata/G. crispata y G. mammillaris (= G. hayi/ G. veleroae corresponden a 2 pares de especies hermanas que divergieron como resultado de la emersión del istmo, y con aproximadamente la misma edad del istmo centroamericano.

  16. Colect and Morphologic characterization of samples of blacberry Rubus spp of the producing zones of Valley, Cauca and Nariño departaments. Caracterización morfológica de mora en los departamentos del Valle del Cauca, Cauca y Nariño

    Directory of Open Access Journals (Sweden)

    Muñoz Flores Jaime Eduardo

    2007-06-01

    Full Text Available 36 materials of blackberry were collected belonging to three species: Rubus glaucus, Rubus urticifolius and Rubus robustus. The qualitative morphologic characterization identified the three collected species and the describers were generated that allowed to identify in leaves: form, type, margin, apex, color of leaf, and in steam presence of antocianinas and serosity.    The quantitative morphologic characterization allowed to identify characteristic of commercial importance in two materials of the Collection: 3 and 31, with a high fruit weight, few thorns in the stem and high Brix degrees, characters that give them potential so much for the market in fresh as frozen. In the multivaried analysis of the quantitative characters of steam and fruit 5 groups were obtained, mainly the variability of them was get for entrenudos distance, length of pedicels in male branch, length of petioles in female and male branch, wide of leaf, fruit weight, length of the heart of the fruit and number of drupes. The morphologic and molecular characterization was complementary for the study of the present variability in the Collection of Rubus spp. 

    Se colectaron 36 materiales de mora pertenecientes a tres especies: Rubus glaucus, Rubus urticifolius y Rubus robustus. La caracterización morfológica cualitativa identificó las 3 especies colectadas y se generaron los descriptores que permitieron identificar en hojas: forma, tipo, margen, ápice, color del envés, y en tallo presencia de antocianinas y serosidad. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  17. L’éthique à l’écran. Compte-rendu de What’s Good on TV? – Understanding Ethics Through Television, de Jamie Watson et Robert Arp, et de Seeing the Light – Exploring Ethics Through Movies, de Wanday Teays

    Directory of Open Access Journals (Sweden)

    Zaffran, Marc

    2012-11-01

    Full Text Available What’s Good on TV ? – Understanding Ethics Through Television by Jamie Watson and Robert Arp, and Seeing the Light – Exploring Ethics Through Movies by Wanday Teays, undertake each in their own way to show the interest of audiovisual fictions – film and television – for teaching ethics.

  18. Herpetogramma bipunctalis (Lepidoptera: Crambidae biology and techniques for rearing on leaves of the blackberry (Rubus spp., Rosaceae Biologia e técnica de criação de Herpetogramma bipunctalis (Lepidoptera: Crambidae em folhas de amoreira-preta (Rubus spp., Rosaceae

    Directory of Open Access Journals (Sweden)

    GI. Diez-Rodríguez

    2013-02-01

    Full Text Available The larvae of the southern beet webworm Herpetogramma bipunctalis (Fabricius, 1794 damage the leaves of species in the plant genus Rubus. The present study investigated the biology of H. bipunctalis and developed a protocol for raising H. bipunctalis under laboratory conditions. On the basis of the biological data, we devised a life table. In order to develop the rearing procedures, we determined which oviposition substrate and blackberry cultivar were the most appropriate for larval development. The mean durations of the egg, larval, and pupal stages were 5.59 days, 26.37 days, and 13.37 days, respectively, and the corresponding survival rates were 80.83%, 49.07%, and 83.23%. The mean pupal weight was 0.0491 g for males and 0.0536 g for females. The mean life cycle (egg-to-adult period was 45.33 days, and overall survival to adulthood was 33.01%. H. bipunctalis females laid a mean of 252.63 eggs over a mean of 13.60 days of oviposition; the mean pre-oviposition period was 2.67 days. Mean female and male life spans were 17.51 and 19.25 days, respectively, and the sex ratio was 0.51. The life-table data indicated that H. bipunctalis can reproduce 57.9 times per generation. Each cage contained one blackberry leaf placed on a paper towel. This method allowed us to obtain the greatest number of eggs. The larval stage was shorter for insects reared on leaves of the Guarani cultivar than for those reared on leaves of the Xavante cultivar (22.63 vs. 26.37 days. These basic data can aid in establishing strategies for the management of H. bipunctalis on blackberry farms.Lagartas de Herpetogramma bipunctalis (Fabricius, 1794 causam danos nas folhas da amoreira-preta (Rubus spp.. O objetivo deste trabalho foi estudar sua biologia e desenvolver uma técnica de criação, em condições de laboratório. Com os dados de biologia, foi elaborada uma tabela de vida de fertilidade. Para o estudo da técnica de criação, foram determinados o substrato para obten

  19. Anatomia do escapo floral de espécies brasileiras de Paepalanthus subgênero Platycaulon (Eriocaulaceae Anatomy of the inflorescence scape of Brazilian species of the Paepalanthus subgenus Platycaulon (Eriocaulaceae

    Directory of Open Access Journals (Sweden)

    Vera Lucia Scatena

    1998-08-01

    Full Text Available Foi estudada a anatomia dos escapos de 17 espécies de Paepalanthus subgênero Platycaulon, sendo 10 da sect. Divisi e sete da sect. Conferti. O trabalho foi realizado para caracterizar anatomicamente os escapos. como contribuição para o entendimento do grupo, uma vez que. morfologicamente, esse é o caráter laxonômico mais importante. Procurou-se, também, confirmar ou não o reconhecimento das duas seções dentro do subgênero. Para os estudos anatômicos utilizou-se material proveniente do Brasil, obtido de exsicatas de diferentes herbários e/ou coletado na Serra do Cipó, MG. Neste trabalho observou-se que Paepalanthus subg. Platycaulon é caracterizado morfologicamente por apresentar escapos pluricapitulados no ápice. Anatomicamente, as espécies estudadas da sect. Divisi apresentam escapos com vários cilindros vasculares, na região mediana e, ainda apresentam, em Paepalanthus vellozioides e P. spixianus, feixes vasculares corticais, características únicas na família. Diferentemente, as espécies avaliadas da sect. Conferti apresentam escapos com cilindro vascular único na região mediana, padrão análogo ao das demais Eriocaulaccae, e ainda apresentam, em Paepalanthus itatiaiensis, P. planifolius e P. paulensis, feixes vasculares medulares, que até então não haviam sido referidos para a família.The scape anatomy of 17 taxa of Paepalanthus subgenus Platycaylon were studied, being 10 taxa of sect. Divisi and seven of sect. Conferti. The study was carried out to see whether scape morphology and anatomy provide valid taxonomic characters at the subgeneric level in Paepalanthus and to lest a proposal to recognize two sections within Paepalanthus subgenus Platycaylon: sect. Divisi and sect. Conferti. The material for anatomical study was collected in Brazil, partly from herbarium specimens and partly from fresh material collected in the field, from the Serra do Cipó. Minas Gerais State. In this work, we observe that

  1. Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

    Science.gov (United States)

    Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

    2011-08-01

    The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

  2. The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

  3. Composição química, compostos bioativos e dissimilaridade genética entre cultivares de amoreira (Rubus spp. cultivadas no Sul de Minas Gerais

    Directory of Open Access Journals (Sweden)

    Mayara Neves Santos Guedes

    2014-03-01

    Full Text Available Frutos das cultivares Arapaho, Brazos, Caingangue, Cherokee, Choctaw, Comanche, Ébano, Guarani, Tupy e Xavante, e uma espécie de amoreira-vermelha (Rubus rosifolius Smith foram avaliados quanto à composição química. Avaliou-se também a variação genética entre as cultivares de amoreira-preta e a espécie de amoreira-vermelha. Os resultados demonstraram variações na composição química dos frutos estudados. A amora- vermelha apresentou menor teor de umidade e maiores valores para os componentes cinzas, açúcares totais, açúcares redutores, açúcares näo redutores, pectina total, pectina solúvel, fenóis, flavonoides, licopeno, β-caroteno e vitamina A. Os teores de umidade e antocianinas, a porcentagem de solubilização e a atividade antioxidante foram maiores nos frutos da cultivar Ébano. Verificou-se que os frutos da amoreira-vermelha e da cultivar Ébano apresentaram o maior grau de divergência genética para as variáveis analisadas. Isto indica a possibilidade de uso das mesmas em programas de melhoramento que visem à melhoria da composição química.

  4. How Mg(2+) ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg(2+) ions through water-mediated interaction. It is important to know the synergic role of Mg(2+) and the water network surrounding Mg(2+) in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg(2+) is pulled from RNA, which causes disturbance of the water network. It was found that Mg(2+) remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg(2+) interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg(2+) and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg(2+) is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  5. Molecular structure of deoxycytidyl-3'-methylphosphonate (RP) 5'-deoxyguanidine, d[Cp(CH3)G]. A neutral dinucleotide with Watson-Crick base pairing and a right handed helical twist.

    Science.gov (United States)

    Han, F; Watt, W; Duchamp, D J; Callahan, L; Kézdy, F J; Agarwal, K

    1990-01-01

    The crystal structure of d[Cp(CH3)G] has been determined as part of a project to study the mechanism of the B----Z transition in DNA. The asymmetric unit contains two dinucleotides and the equivalent of 7.5 water molecules, partially disordered over 12 definable positions. The two symmetry-independent dinucleotides form a duplex with Watson-Crick base-pairing and a right-handed helical sense. Comparison with previously determined structures of the B and A conformation showed that this duplex is closer to B than to A but significantly different from B. It corresponds to a stretched out helix with a 4 A rise per base pair and a helical twist of 32 degrees. This structure may serve as a model for the bending of DNA in certain situations. The configuration at the methyl phosphonate is RP, and a mechanism, based on this assignment, is presented for the B----Z transition in DNA. PMID:2339061

  6. Fine-scale phylogenetic structure and major events in the history of the current wild soybean (Glycine soja) and taxonomic assignment of semi-wild type (Glycine gracilis Skvortz.) within the Chinese subgenus Soja.

    Science.gov (United States)

    Wang, Ke-Jing; Li, Xiang-Hua; Liu, Yang

    2012-01-01

    Wild and cultivated species of soybeans have coexisted for 5000 years in China. Despite this long history, there is very little information on the genetic relationship of Glycine soja and G. max. To gain insight into the major events in the history of the subgenus Soja, we examined 20 simple sequence repeat (SSR) markers of a large number of accessions (910). The results showed no significant differences between wild and semi-wild soybeans in genetic diversity but significant differences between G. soja and G. max. Ancestry and cluster analyses revealed that semi-wild soybeans should belong to the wild category and not to G. max. Our results also showed that differentiation had occurred not only among G. soja, G. gracilis, and G. max but also within G. soja and within G. gracilis. Glycine soja had 3 clear genetic categories: typical small-seeded (≤2.0 g 100-seed weight), dual-origin middle-seeded (2.0-2.5 g), and large-seeded plants (2.51-3.0 g). These last were genetically close to G. gracilis, their defining some traits having been acquired mainly by introgression from soybeans. Small-seeded G. gracilis (3.01-3.5 g) were genetically different from larger seeded ones (from 3.51 to 4.0 to over 10 g). Seed size predominated over seed coat color in evolutionary degree. Typical and large-seeded G. soja were found to have 0.7% and 12% introgressive cultivar genes, respectively. The genetic boundary of G. gracilis was at the range of 2.51-3.0 g of G. soja. In the great majority of wild accessions, traits such as white flowers, gray pubescences, no-seed bloom, and colored seed coats were likely introgressive from domesticated soybeans.

  7. Single step polymerase chain reaction (PCR for the diagnosis of the Leishmania (Viannia subgenus Reação de polimerização em cadeia (PCR em etapa única para diagnóstico de Leishmania do subgênero (Viannia

    Directory of Open Access Journals (Sweden)

    Byanca Regina Paiva

    2004-04-01

    Full Text Available In Brazil, the main etiologic agent of Leishmaniasis that frequently presents with mucosal involvement belongs to the Viannia subgenus. The therapeutic conduct in this disease depends on the parasitological diagnosis, and classical methods are restricted in identifying the agent. In this paper we describe a polymerase chain reaction (PCR, which uses primers designed from mini-exons repetitive sequences. The PCR amplifies a 177bp fragment that can distinguish (Viannia from (Leishmania subgenus. This test could be a useful diagnostic tool.No Brasil, o principal agente etiológico da leishmaniose, apresentando freqüentemente comprometimento das mucosas, pertence ao subgênero (Viannia. A conduta terapêutica no tratamento da leishmaniose depende de seu diagnóstico parasitológico e os métodos clássicos restringem sua identificação. Neste trabalho, descrevemos uma reação de PCR, utilizando primers desenhados a partir de seqüências repetitivas de mini-exons, que amplificam um fragmento de 177pb e que são capazes de distinguir o subgênero (Viannia do subgênero (Leishmania, tornando-se uma ferramenta útil no diagnóstico desta doença.

  8. "Doktor Watson minu õuel!" / Allar Viivik

    Index Scriptorium Estoniae

    Viivik, Allar

    2002-01-01

    Äsjalahkunud näitlejat Vitali Solominit (1941-2002) meenutab Juuliku villa elanik Leo Orav. Siin filmis režissöör Igor Maslennikov paar episoodi "Baskerville'de koerast" vene Sherlock Holmes'i seriaalist. Vitali Solomin mängis doktor Watsonit. Ka teistest selle seriaali võttepaikadest Eestis

  9. Nailuj | Watson | SAFERE: Southern African Feminist Review

    African Journals Online (AJOL)

    SAFERE: Southern African Feminist Review. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 3, No 2 (1999) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. DOWNLOAD FULL TEXT Open Access ...

  10. Book Review Transformation through Occupation | Watson | Journal ...

    African Journals Online (AJOL)

    Journal of Child and Adolescent Mental Health. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 16, No 2 (2004) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. DOWNLOAD FULL TEXT Open Access ...

  11. Efecto de abonos orgánicos en las propiedades químicas del suelo y el rendimiento de la mora (Rubus adenotrichus en dos zonas agroecológicas de Costa Rica

    Directory of Open Access Journals (Sweden)

    Rafael Orozco Rodríguez

    2012-05-01

    Full Text Available El objetivo de esta investigación es evaluar el efecto de dos abonos orgánicos en las propiedades quími- cas del suelo y el rendimiento de plantas de mora (Rubus adenotrichus cv.’Vino’ en dos zonas de Costa Rica. Para ello se establecieron dos experimentos, uno en Buena Vista de Pérez Zeledón (BVPZ y otro en San Mar tín de León Cor tés (SMLC, ambos en la provin- cia de San José, Costa Rica. La investigación se realizó entre agosto del 2005 y julio del 2008. Se evaluaron tres tratamientos en cada experimen- to: Compost (C y Lombricompost (L, a razón de 4 kg/planta y 3 kg/planta respectivamente, y un testi- go sin abono (T. La frecuencia de aplicación de los abonos a la siembra se dio a los 6, 12, 18 y 24 meses para un total de 6,6 t/ha para el C y 4,9 t/ha para el L. Se tomaron muestras de suelo a los 0, 6, 12, 18, 24 y 35 meses, después de la siembra para su análisis. Los resultados muestran que, en ambos agro-ecosis- temas, la aplicación del C y L incrementó el pH del suelo, redujo la acidez, incrementó la disponibilidad de Ca, Mg, K, N, y P, y favoreció la capacidad de in- tercambio catiónico efectiva (CICE y el porcentaje de materia orgánica. No se observó acumulación de Mn, Cu y Zn. En cuanto al rendimiento, en BVPZ solo se encon- traron diferencias significativas (P=0,00188 entre C (1,8 t/ha y el T (0,9 t/ha; mientras que en SMLC, no se encontraron diferencias estadísticas significativas (P

  12. FILOGENIA DE ESPECIES DEL SUBGENERO Parides (LEPIDOPTERA: PAPILIONIDAE BASADA EN SECUENCIAS DEL GEN CITOCROMO OXIDASA I Species phylogeny of the Subgenus Parides (Lepidoptera: Papilionidae Based in Sequences of Citochrome Oxidase I Gene

    Directory of Open Access Journals (Sweden)

    INGRID MARCELA GUTIÉRREZ R

    2012-12-01

    Colombia where the biota of North and South America converge. This work presents a phylogenetic hypothesis of these butterflies and proposes a more robust definition of some taxa. For this, 15 taxa of the subgenus Parides were analyzed as ingroup; species of other two genera of Troidini, closer to Parides , were used as out-group. DNA was extracted using the Pascual et al. (1997 protocol and Quiagen DNAeasy kit. A terminal fragment of Cytochrome Oxidase I gen (476 bp were amplified. We obtained a phylogenetic approximation using maximum parsimony and evaluated the branch support with Jackknife and absolute Bremer support. We also conducted a bayesian analysis. The resulting phylogenetic hypothesis suggested that Parides is a paraphyletic group; the molecular evidence support one species and five subspecies. The analyzed taxa were divided in three principal groups coincident with the Lysander (group 1 and Aeneas (groups 1 and 2 groups proposed by Rothschild and Jordan (1906.

  13. A sugar pine consensus map: Comparative mapping between the Pinus subgenus Pinus and the subgenus Strobus

    Science.gov (United States)

    Kathleen D. Jermstad; Andrew J. Eckert; Bohun B. Kinloch; Dean A. Davis; Deems C. Burton; Annette D. Mix; Jill L. Wegrzyn; David B. Neale

    2011-01-01

    We have constructed a consensus genetic linkage map for sugar pine using three mapping populations that segregate for resistance to white pine blister rust, a disease caused by the fungal pathogen Cronartium ribicola. The major gene of resistance, Cr1, was mapped in two of the populations and included in the consensus map, which contains 400 markers organized into 19...

  14. Is Watson's Guess Right This Time?:type 2 diabetes as a redox disease%这一次沃森的“猜想”对吗?--糖尿病是一种氧化还原性疾病

    Institute of Scientific and Technical Information of China (English)

    李小华; 宋达琳

    2014-01-01

    As well known ,physical exercise has long been good for human health ,if a lack of exercise increases the risk of various diseases ,including type 2 diabetes .Diabetes's oxidative stress theory has been widely accepted ,there is a wealth of evidence to suggest that consumption of antioxidants can not boost insulin sensitivity ,even abrogated the capacity of physical exercise to make insulin more effective in lowering blood sugar concentrations .By failure of the endoplasmic reticulum to generate sufficient oxidative redox potential for disulphide bonds to be formed may be diabetes molecules mechanism .Disulphide bonds are necessary to stabilize insulin's 3D conformation .Above all ,Dr .Watson postulates that diabetes is a redox disease ,as well as dementias ,cardiovascular disease ,and some cancer .It is widely accepted that oxidative stress is harmful in body ,while Watson's call let people reexamine its role .%2型糖尿病发病机制的氧化应激学说被广泛地接受,可是大量的证据表明,服用抗氧化剂并不能增加胰岛素的敏感性,相反,体育锻炼能够增加氧化应激,却是治疗糖尿病的首选方案。分子机制的研究也表明,细胞内氧化应激不足时,会导致内质网无法合成二硫键,导致胰岛素生成不足。由此沃森推测,糖尿病是由于氧化应激不足所致。同理,氧化应激不足可能也是阿尔茨海默病、肿瘤等疾病的发病机制之一。沃森的呼声让现在普遍认为氧化应激有害理论的人们开始重新审视氧化应激在机体中的有益作用。

  15. In vitro activity of 2-pyridinecarboxylic acid against trypanosomes of the subgenus Schizotrypanum isolated from the bat Phyllostomus hastatus = Atividade in vitro do ácido 2-piridinocarboxílico em tripanossoma do subgênero Schizotrypanum isolado do morcego Phyllostomus hastatus

    Directory of Open Access Journals (Sweden)

    Paulo Roberto Ceridóreo Corrêa

    2011-09-01

    Full Text Available The effect of 2-pyridinecarboxylic acid (picolinic acid on trypanosomes of the subgenus Schizotrypanum isolated from the bat Phyllostomus hastatus was determined in this study. Picolinic acid, at 50 ƒÊg mL-1, inhibited epimastigote growth by 99% after 12 days incubation. In addition, trypomastigote motility decreased by 50% after 6h and completely after 24h in the presence of 50 ƒÊg mL-1 picolinic acid. The 50% cytotoxic concentration on HEp-2 cell line was275 ƒÊg mL-1 after 4 days incubation. Altogether, these results indicate higher toxicity against trypanosomes. The inhibitory effect of picolinic acid on epimastigote growth can be partially reversed by nicotinic acid and L-tryptophan, suggesting a competitive inhibition. Furthermore, two anti-Trypanosoma (Schizotrypanum cruzi drugs were also evaluated with regard to bat trypanosome growth. Benznidazole, at 50 ƒÊg mL-1, inhibited epimastigote growth by 90% after 12 days incubation. Nifurtimox, at the same concentration, caused 96% growth inhibition after four days incubation. Corroborating a previous study, bat trypanosomes are a good model for screening new trypanocidal compounds. Moreover, they can be used to study many biological processes common to human pathogenic trypanosomatids.O efeito do acido 2- piridinocarboxilico (acido picolinico sobre um tripanossoma do subgenero Schizotrypanum isolado do morcego Phyllostomus hastatus foi determinado neste estudo. O acido picolinico, na concentracao de 50 ƒÊg mL-1, inibiu 99% do crescimento de epimastigotas apos 12 dias de incubacao. Alem disso, houve um decrescimo de 50 e 100% na mobilidade dos tripomastigotas apos 6 e 24h, respectivamente, em presenca de acido picolinico na concentracao de 50 ƒÊg mL-1. A concentracao citotoxica 50% para celulas HEp-2 foi de 275 ƒÊg mL-1 apos quatro dias de incubacao. Esses resultados indicam maior toxicidade contra os tripanossomas. O efeito inibitoriodo acido picolinico sobre o crescimento de

  16. What Would It Be Like to Be IBM's Computer, Watson?

    Science.gov (United States)

    Schlinger, Henry D., Jr.

    2012-01-01

    Rachlin (2012) makes two general assertions: (a) "To be human is to behave as humans behave, and to function in society as humans function," and (b) "essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer'. Although Rachlin's article is an…

  17. Garri Potter povzroslel! / Daniel Radcliffe, Emma Watson ; interv. Stass Tõrkin

    Index Scriptorium Estoniae

    Radcliffe, Daniel, 1989-

    2005-01-01

    Peaosatäitja järjekorras neljandas Potteri ekraniseeringus "Harry Potter ja tulepeeker" endast, oma tegelaskuju arengust. Samas ka lühiintervjuu näitlejanna Emma Watsoniga. Režissöör Mike Newell : Suurbritannia-USA 2005

  18. Katherine Watson, Poisoned Lives: English Poisoners and their Victims

    OpenAIRE

    Emsley, Clive

    2009-01-01

    In October 1848 the great moral entrepreneur Edwin Chadwick wrote an alarming letter to Sir George Grey, then home secretary: My researches have opened to me at times, horrible revelations.I am compelled to believe that murders escape much more frequently than is supposed. I was told by undertakers of a large practice whom I examined, that they every now and then closed the coffin lids on the corpses of adult persons whom they had strong reason to suspect from the appearance of the corpse, an...

  19. The Durbin-Watson Ratio Under Infinite Variance Errors

    OpenAIRE

    Phillips, Peter C.B.; Mico Loretan

    1989-01-01

    This paper studies the properties of the von Neumann ratio for time series with infinite variance. The asymptotic theory is developed using recent results on the weak convergence of partial sums of time series with infinite variance to stable processes and of sample serial correlations to functions of stable variables. Our asymptotics cover the null of iid variates and general moving average (MA) alternatives. Regression residuals are also considered. In the static regression model the Durbin...

  20. Virus Structure: From Crick and Watson to a New Conjecture

    CERN Document Server

    Iorio, Alfredo

    2007-01-01

    We conjecture that certain patterns (scars), theoretically and numerically predicted to be formed by electrons arranged on a sphere to minimize the repulsive Coulomb potential (the Thomson problem) and experimentally found in spherical crystals formed by self-assembled polystyrene beads (an instance of the generalized Thomson problem), could be relevant to extend the classic Caspar and Klug construction for icosahedrally-shaped virus capsids. The main idea is that scars could be produced at an intermediate stage of the assembly of the virus capsids and the release of the bending energy present in scars into stretching energy could allow for a variety of non-spherical capsids' shapes. The conjecture can be tested in experiments on the assembly of artificial protein-cages where these scars should appear.

  1. Non-Watson-Crick RNA synthesis suited to origin functions.

    Science.gov (United States)

    Puthenvedu, Deepa; Majerfeld, Irene; Yarus, Michael

    2018-01-01

    A templated RNA synthesis is characterized in which G5'pp5'G accelerates synthesis of A5'pp5'A from pA and chemically activated ImpA precursors. Similar acceleration is not observable in the presence of UppU, CppC, AppG, AppA, or pG alone. Thus, it seems likely that AppA is templated by GppG via a form or forms of G:A base-pairing. AppA also appears, more slowly, via a previously known untemplated second-order chemical route. Such AppA synthesis requires only ordinary near-neutral solutions containing monovalent and divalent salts, and rates are only slightly sensitive to variation in pH. Templated synthesis rates are first order in pA, ImpA, and template GppG; thus third order overall. Therefore, this reaction resembles cross-templating of AppA on poly(U), but is notably slower and less sensitive to temperature. Viewing AppA as a coenzyme analog, GppG templating provides a simpler molecular route, termed para-templating, to encoded chemical functions. Para-templating can also arise from a single, localized nucleobase geosynthetic event which yields purines. It requires only a single backbone-forming chemistry. Thus it may have appeared earlier and served as evolutionary precursor for more complex forms of encoded genetic expression. © 2018 Puthenvedu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. Watson, Skinner y Algunas Disputas dentro del Conductismo

    Directory of Open Access Journals (Sweden)

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-12-01

    Full Text Available In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913 conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

  3. Watson, Skinner y Algunas Disputas dentro del Conductismo

    OpenAIRE

    RICARDO PELLÓN SUÁREZ DE PUGA

    2013-01-01

    In the context of the first centennial of the publication of the behaviorist manifesto, this article conducts a brief review of Watson’s (1913) conception of learning and behavior, and extends that analysis to B. F. Skinner’s behaviorism and to the debates among molar and molecular approaches to behavior analysis.

  4. Kate Watson on Reynold Humphries’ Hollywood’s Blacklists

    Directory of Open Access Journals (Sweden)

    2008-12-01

    Full Text Available Reynold Humphries. Hollywood’s Blacklists: A Political and Cultural History. Edinburgh: Edinburgh University Press, 2008. Reynold Humphries’ Hollywood’s Blacklists provides a comprehensive examination of the historical and political ramifications of the blacklisting process and of Communism in the motion picture industry. His section on ‘The Background’ initially sets up just this, making the debate and dispute accessible even to those not au fait with such knowledge. This section is informat...

  5. Measuring postgraduate cohort throughput: A case study | Watson ...

    African Journals Online (AJOL)

    This article reports on a study done into postgraduate throughput performance at one institution. The article examines the terminology adopted in the study, and reports general trends found in the data. The question of the length of time to graduation that should be examined when studying throughput data is examined, and ...

  6. Pollen morphology of some Geranium subgenus Robertium species of Iran

    Directory of Open Access Journals (Sweden)

    M. Keshavarzi

    2016-06-01

    Full Text Available Geranium (Geraniaceae comprises more than 23 annual or perennial species in Iran. There is no study in Iran with pollen morphology emphasize. The main aim of this study is to find diagnostic pollen characters in studied species. Totally 40 accessions of five species (G. albanum, G. molle, G. purpureum, G. mascatense and G. pusillum were collected. Pollen grains were studied by use of light and Scanning electron microscopy. To reveal the species relationships different multivariate statistical methods were used. The pollen grains were monad, isopolar, radially symmetric and of spheroid, prolate-spheroid or oblate-spheroid classes. The main ornamentation type was clavate, however reticulate but striate was also observed. All sections are clearly separated by their pollen features except of Batrachioidea which show confusion with Ruberta. Species relationship is discussed.

  7. A new subgenus of the Coleopterous family Drilidae

    NARCIS (Netherlands)

    Gorham, H.S.

    1883-01-01

    Generi Diplocladon Gorham 1) valde affine, sed antennae simpliciter pectinatae. Antennae duodecimi-articulatae, articulo basali valido subquadrato, secundo brevi quam hoc dimidio minore, tertio triangulari, angulo interno ramum emittente; quarto ad undecimum perbrevibus, latitudine haud longioribus,

  8. A revision of the genus Inocybe in Europe. I. Subgenus Inosperma and the smooth-spored species of subgenus Inocybe

    NARCIS (Netherlands)

    Kuyper, Th.W.

    1986-01-01

    Fries (1821: 11) established Agaricus series Derminus tribus Inocybe, which was later elevated by him to generic rank (Fries, 1863: 346). Originally Fries based his circumscription of Inocybe solely on macroscopical characters; when it was raised to generic status Fries added that the spores of all

  9. Концепция когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson

    OpenAIRE

    Мазуров Никита Юрьевич; Струков Иван Александрович; Лебедева Марина Юрьевна

    2016-01-01

    в данной статье рассматривается роль концепции когнитивно-вычислительных технологий в бизнесе на примере системы IBM Watson. Авторы отмечают, что сфера когнитивных технологий крайне перспективна.

  10. Refrigeration and edible coatings in blackberry (Rubus spp.) conservation.

    Science.gov (United States)

    Oliveira, Dalany Menezes; Kwiatkowski, Angela; Rosa, Cassia Ines Lourenzi Franco; Clemente, Edmar

    2014-09-01

    An experiment was conducted to evaluate the conservation of blackberry, cv. Tupy, stored under refrigeration and coated with different edible coatings. Four treatments were carried out: control T1 (uncoated), T2 (chitosan 1.5 %), T3 (cassava starch 2.5 %) and T4 (kefir grains in water 20 %), stored at temperatures of 0 and 10 °C; 1.0 % (m/v) sorbitol/glycerol was added as plasticizers. Chemical and physical-chemical evaluations (weight loss, firmness, pH, titratable acidity, soluble solids, SS/TA ratio and anthocyanins) were made, besides rot incidence. The results showed that cooling to 0 °C combined with T2 showed an effect in reducing the physiological loss of weight (4.41 %), in retaining fruit firmness (19.1 N) and presenting lower incidence of rot (6.19 %). Likewise, in physical and chemical parameters: SS did not alter significantly during the whole period of 18 days of storage.

  11. Elaboration of wild blackberry (Rubus fructicosus L. nectar

    Directory of Open Access Journals (Sweden)

    Cristina Encarnación Valencia Sullca

    2013-06-01

    Full Text Available In this research work was developed and characterized physicochemically blackberry nectar. Operations included in this process were: sorting, grading, washing, disinfection (sodium hypochlorite 100 ppm Free Chlorine Residual, pulping, refined, standardized, homogenization, pasteurization and packaging. In the raw material was found: 82.98% moisture, 0.93% protein, 15.74% carbohydrate, no fat, 2.48% fiber, 0.42% ash, 3.91% reducing sugar, 0.93% acidity, 3.4 pH, 10.5 °Brix, 400.67 mg of gallic acid/100 g sample of total phenolic compounds, 39.02 µmol Trolox / g of antioxidant capacity, 109.07 mg cyanidin 3-glucoside / 100 g sample of anthocyanin and 14.37 mg / 100 g of vitamin C. The fruits reported a yield of 78.2% pulp. Trials were conducted preliminary processing blackberry nectar at different dilutions (1:2.5, 1:2.6, 1:2.7, 1:2.8, 1:2.9 and 1:3, degrees °Brix (11,12 and 13 and pH values (3.4, 3.6 and 3.8. Given the greater acceptance in the sensory evaluation (extended preference test with 30 untrained judges whose results were statistically evaluated by nonparametric Friedman, was elected to the dilution containing 1:2.7 (pulp:water, 12 °Brix, 0.07% CMC and 3.8 pH. Nectar obtained reported: absence of fat and fiber, 87.3% moisture, 0.10% protein, 0.10% ash, 4.87% reducing sugars, 0.23% acidity, 3.8 pH, 115.25 mg gallic acid / 100 g sample of total phenolic compounds, 3.9 µmol Trolox / g of antioxidant capacity, 24.33 mg cyanidin 3-glucoside / 100 g sample of anthocyanins and 3.9 mg / 100 g of vitamin C

  12. Rubus: A compiler for seamless and extensible parallelism

    National Research Council Canada - National Science Library

    Muhammad Adnan; Faisal Aslam; Zubair Nawaz; Syed Mansoor Sarwar

    2017-01-01

    .... Furthermore, a special purpose processing unit called Graphic Processing Unit (GPU), originally designed for 2D/3D games, is now available for general purpose use in computers and mobile devices...

  13. Adaptation of eight American blackberry (Rubus fructicosus L ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... desserts, jams, seedless jellies and wine. It is known to contain naturally occurring polyphenol antioxidants that can regulate certain beneficial metabolic ..... 348-352. Crandall PC (1995). Bramble Production. The management Marketing of Raspberries and Blackberries, New York. London Norwood.

  14. Diuretic Activity of Rubus idaeus L (Rosaceae) in Rats

    African Journals Online (AJOL)

    Erah

    291). Diuretic test. Diuretic activity was determined, following the methods of Kawashima [15], but with a minor modification. The rats (48) were fasted for 18 h with free access to drinking water, and then orally administered 30 ml/kg of bicarbonate.

  15. Ethnobotanical review of wild edible plants of Slovakia

    Directory of Open Access Journals (Sweden)

    Łukasz Łuczaj

    2012-11-01

    Full Text Available This paper is an ethnobotanical review of wild edible plants gathered for consumption from the 19th century to the present day, within the present borders of Slovakia. Twenty-four sources (mainly ethnographic documenting the culinary use of wild plants were analysed. The use of 106 species (over 3% of the Slovak flora has been recorded. Nowadays most of them are no longer used, or used rarely, apart from a few species of wild fruits. The most frequently used plants include the fruits of Rubus idaeus, Fragaria spp., Rubus subgenus Rubus, Vaccinium myrtillus, V. vitis-idaea, Fagus sylvatica, Corylus avellana, Prunus spinosa, Pyrus spp., Malus spp., Crataegus spp. and the leaves of Urtica dioica, Rumex acetosa, Chenopodiaceae species, Cardamine amara, Glechoma spp., Taraxacum spp. and Oxalis acetosella. The most commonly used wild food taxa are nearly identical to those used in Poland, and the same negative association of wild vegetables with famine exists in Slovakia, resulting in their near complete disappearance from the present-day diet.

  16. Species origin of genomic factors in Nicotiana nudicaulis Watson controlling hybrid lethality in interspecific hybrids between N. nudicaulis Watson and N. tabacum L.

    Directory of Open Access Journals (Sweden)

    Hongshuo Liu

    Full Text Available Hybrid lethality is expressed at 28°C in the cross Nicotiana nudicaulis × N. tabacum. The S subgenome of N. tabacum has been identified as controlling this hybrid lethality. To clarify the responsible genomic factor(s of N. nudicaulis, we crossed N. trigonophylla (paternal progenitor of N. nudicaulis with N. tabacum, because hybrids between N. sylvestris (maternal progenitor of N. nudicaulis and N. tabacum are viable when grown in a greenhouse. In the cross N. trigonophylla×N. tabacum, approximately 50% of hybrids were vitrified, 20% were viable, and 20% were nonviable at 28°C. To reveal which subgenome of N. tabacum was responsible for these phenotypes, we crossed N. trigonophylla with two progenitors of N. tabacum, N. sylvestris (SS and N. tomentosiformis (TT. In the cross N. sylvestris × N. trigonophylla, we confirmed that over half of hybrids of N. sylvestris × N. trigonophylla were vitrified, and none of the hybrids of N. trigonophylla × N. tomentosiformis were. The results imply that the S subgenome, encoding a gene or genes inducing hybrid lethality in the cross between N. nudicaulis and N. tabacum, has one or more genomic factors that induce vitrification. Furthermore, in vitrified hybrids of N. trigonophylla × N. tabacum and N. sylvestris × N. trigonophylla, we found that nuclear fragmentation, which progresses during expression of hybrid lethality, was accompanied by vitrification. This observation suggests that vitrification has a relationship to hybrid lethality. Based on these results, we speculate that when N. nudicaulis was formed approximately 5 million years ago, several causative genomic factors determining phenotypes of hybrid seedlings were inherited from N. trigonophylla. Subsequently, genome downsizing and various recombination-based processes took place. Some of the causative genomic factors were lost and some became genomic factor(s controlling hybrid lethality in extant N. nudicaulis.

  17. Effects of Nursing Care Based on Watson?s Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial

    OpenAIRE

    Yeter Durgun Ozan; Hülya Okumuş

    2017-01-01

    Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson’s "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control g...

  18. Computer‐Assisted Library Instruction and Face‐to‐Face Library Instruction Prove Equally Effective for Teaching Basic Library Skills in Academic Libraries. A review of: Zhang, Li, Watson, Erin M. and Banfield, Laura. ʺThe Efficacy of Computer‐Assisted Instruction Versus Face‐to‐Face Instruction in Academic Libraries: A Systematic Review.ʺ The Journal of Academic Librarianship 33.4 (July 2007: 478‐484.

    Directory of Open Access Journals (Sweden)

    Stephanie Walker

    2008-03-01

    , and case studies, with a sample size greater than one and with pre‐ and post‐test measurements;study participants had to be academic library patrons; the study needed to compare CAI and face‐to‐face instruction; and both the students’ information skills and reactions to the instruction had to be measured. This left 40 unique studies, which were then retrieved in full text. Next, studies were selected to meet the inclusion criteria further using the QUOROM format, a reporting structure used for improving the quality of reports of meta‐analyses of randomised trials (Moher et al 1896‐1900. Evaluation of methodological quality was then done using a dual method: authors Watson and Zhang assessed the studies independently, each using the “Checklist for Study Quality” developed by Downs and Black (Downs and Black 377‐384, adapted slightly to remove non‐relevant questions. After analysis, when additional information was needed, original study authors werecontacted. Finally, ten studies were included in the analysis.The instruction sessions covered many topics, such as catalog use, reading citations, awareness of library services and collections, basic searching of bibliographic databases, and more. But all could qualify as basic, rather than advanced, library instruction. All studies did pre‐ and posttests of students’ skills – some immediatelyafter instruction, and others with a time lapse of up to six weeks. Most authors created their own tests, though one adapted an existing scale. Individual performance improvement was not studied in many cases due to privacy concerns.Main Results ‐ Nine of the ten studies found CAI and face‐to‐face instruction equally effective; the tenth study found face to‐face instruction more effective. The students’ reaction to instruction methods varied – some students felt more satisfied with face‐to‐face instruction and felt that they learned better, while other studies found that students receiving CAI

  19. Medical Entomology Studies - XVI. A Review of the Species of Subgenus Verrallina, Genus Aedes, from Sri Lanka and a Revised Description of the Subgenus (Diptera: Culicidae)

    Science.gov (United States)

    1984-01-01

    features can usually be found to identify specimens from a specific geographical area because only a few species are usually found in any one area...arboviruses of known (Kunjin, Murray Valley encephalitis, Ross River ) or suspected (Sepik) medical importance as well as others (Corriparta...28.10.99, Selangor , A. L. Butler; K. Selangor (mangroves) swarming; Klang jungle, Sept. [on the underside of a circular paper stage on which the

  20. Environ: E00837 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00837 Raspberry Rubus chingii, Rubus crataegifolius, Rubus [TAX:23216] Rosaceae (r...ose family) Rubus aggregate fruit Crude drugs [BR:br08305] Dicot plants: rosids Rosaceae (rose family) E00837 Raspberry ...

  1. VizieR Online Data Catalog: AAVSO International Variable Star Index VSX (Watson+, 2006-2014)

    Science.gov (United States)

    Watson, C.; Henden, A. A.; Price, A.

    2017-11-01

    This file contains Galactic stars known or suspected to be variable. It lists all stars that have an entry in the AAVSO International Variable Star Index (VSX; http://www.aavso.org/vsx). The database consisted initially of the General Catalogue of Variable Stars (GCVS) and the New Catalogue of Suspected Variables (NSV) and was then supplemented with a large number of variable star catalogues, as well as individual variable star discoveries or variables found in the literature. Effort has also been invested to update the entries with the latest information regarding position, type and period and to remove duplicates. The VSX database is being continually updated and maintained. For historical reasons some objects outside of the Galaxy have been included. (3 data files).

  2. Finding Superman & Global Competitiveness: A Conversation with Arthur Levine & Watson Scott Swail. Policy Perspectives

    Science.gov (United States)

    Levine, Arthur; Swail, Watson Scott

    2014-01-01

    On March 21 2013, the "Educational Policy Institute" held the first day of the EPI Forum on Education & the Economy in Orlando, Florida. The Forum was designed to discuss critical issues related to the nexus of education and the workforce. This document presents the transcribed session that featured two of the authors of the Teachers…

  3. The influence of fire on a southern Cape mountain forest | Watson ...

    African Journals Online (AJOL)

    ... Ocotea bullata and Cunonia capensis were killed, and these two species formed > 90 % of the large trees recorded in the margin, but lower proportions in the forest core. Fire is thus an important factor influencing species composition and diversity in mountain forest. Southern African Forestry Journal No.191 2001: 39-42 ...

  4. [Sherlock Holmes, Watson and cocaine. A literary contribution to the history of drug addiction].

    Science.gov (United States)

    Fouassier, E

    1994-01-01

    From 1887 to 1927, Conan Doyle devoted fifty-six short stories and four novels to the extraordinary investigations of Sherlock Holmes. Special passages from these works, gathered here in the form of long extracts, evoke the passion of the celebrated detective for cocaine and constitute rather generally an original sort of evidence on the emergence of drug addicts in Europe at the end of the 19th century.

  5. The case of Watson vs. James: effect-priming studies do not support ideomotor theory.

    Directory of Open Access Journals (Sweden)

    Ralf F A Cox

    Full Text Available In this paper we show that response facilitation in choice reaction tasks achieved by priming the (previously perceived effect is based on stimulus-response associations rather than on response-effect associations. The reduced key-press response time is not accounted for by earlier established couplings between the key-press movement and its subsequent effect, but instead results from couplings between this effect and the contingent key-release movement. This key-release movement is an intrinsic part of the entire performed response action in each trial of a reaction-time task, and always spontaneously follows the key-press movement. Eliminating the key-release movement from the task leads to the disappearance of the response facilitation, which raises the question whether response-effect associations actually play a role in studies that use the effect-priming paradigm. Together the three experiments presented in the paper cast serious doubts on the claim that action-effect couplings are acquired and utilized by the cognitive system in the service of action selection, and that the priming paradigm by itself can provide convincing evidence for this claim. As a corollary, we question whether the related two-step model for the ideomotor principle holds a satisfying explanation for how anticipation of future states guides action planning. The results presented here may have profound implications for priming studies in other disciplines of psychology as well.

  6. Molecular moment similarity between several nucleoside analogs of thymidine and thymidine. sil@watson.ibm.com.

    Science.gov (United States)

    Silverman, B D; Pitman, M C; Platt, D E

    1999-06-01

    Molecular moment descriptors of the shape and charge distributions of twenty five nucleoside structures have been examined. The structures include thymidine as well as the difluorotoluene nucleoside analog which has been found to pair efficiently with adenine by polymerase catalysis. The remaining twenty three structures have been chosen to be as structurally similar to thymidine and to the difluorotoluene nucleoside analog as possible. The moment descriptors which include a description of the relationship of molecular charge to shape show the difluorotoluene nucleoside to be one of the most proximate molecules to thymidine in the space of the molecular moments. The calculations, therefore, suggest that polymerase specificity might be not only a consequence of molecular steric features alone but also of the molecular electrostatic environment and its registration with molecular shape.

  7. Scott's Lake Site/Santee Indian Mound/Fort Watson Human Remains

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This is a generic dataset collected on human remains and funerary objects during Scott's Lake Site Excavation. Excavated by Dr. Leland G. Ferguson of SCIAA in 1973,...

  8. E.L.C. Watson se pionierstog deur Suid-Afrika (1912) | van der ...

    African Journals Online (AJOL)

    ... first person to travel through South Africa by motorcycle. Her trip can be regarded as a continuation of the emancipation of women that had caused thousands of women to turn to cycling a decade earlier. Rapid industrialisation led to the emergence of socialism, which protected the rights of workers. People became more ...

  9. Holographic goodness is not that bad: Repley to Olivers, Chater and Watson

    NARCIS (Netherlands)

    Helm, P.A. van der; Leeuwenberg, E.L.J.

    2004-01-01

    The holographic approach (HA) to goodness (P. A. van der Helm & E. L. J. Leeuwenberg, 1991, 1996, 1999) is an ideal-observer theory at, in D. Marr's (1982) terms, the computational and algorithmic levels of description. It provides an explanation of the detectability of visual regularities such as

  10. Compte rendu de Yung, Rawski, Watson, "Harmony and Counterpoint, Ritual Music in Chinese Context", 1996

    OpenAIRE

    Picard, François

    1999-01-01

    International audience; The review describes and discusses (in French) this important book on music and ritual, two main elements of the Chinese cosmovision and definitions of sociability.; Lecture d'un important livre sur musique et rituel, deux mondes complémentaires dans la Chine classique

  11. Nursing care provided to young people in two health centers compared with Watson Theory

    OpenAIRE

    María Alejandra Pichardo Meza; María Catalina Zúñiga Rodríguez

    2012-01-01

    This article has as objective to present the analysis of the care given by the nursing personnel to the young adult population in the Clinic of Pain Control and Palliative Care and in the Onco-hematology Service of the Max Peralta Hospital, related to Jean Watson’s theoretical proposal. The study corresponds to a joint research of parallel type with concurrent triangulation. The study populations were made up by twenty-six young adult people (who face morbid process health or chronic p...

  12. Nursing care provided to young people in two health centers compared with Watson Theory

    Directory of Open Access Journals (Sweden)

    María Alejandra Pichardo Meza

    2012-10-01

    Full Text Available This article has as objective to present the analysis of the care given by the nursing personnel to the young adult population in the Clinic of Pain Control and Palliative Care and in the Onco-hematology Service of the Max Peralta Hospital, related to Jean Watson’s theoretical proposal. The study corresponds to a joint research of parallel type with concurrent triangulation. The study populations were made up by twenty-six young adult people (who face morbid process health or chronic pain condition and four nursing professionals who worked in the Clinic of Pain Control and Palliative Care and in the Onco-hematology Service of the Max Peralta Hospital. A self-executed questionnaire and a semi-structured interview were used to collect the information, which was analyzed using the “SPSS” program and the qualitative categories, respectively. Results: The ten elements of the “Human Care Theory” can be included in the care given by the nursing personnel to the young adult population who faces morbid process health or chronic pain condition. The nursing care mainly focuses on the young adult population quality of life throughout education and pain management. The young adult population perceives a warm, pleasant and human nursing care. Conclusion: Nursing personnel put into practice elements of the Jean Watson’s theoretical proposal even when they do not know it.

  13. Contaminants in fish and birds of Watson Lake, Arizona 2000-2001

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — A wood treatment facility located on Yavapai-Prescott Indian Tribe land near Prescott, Arizona released pentachlorophenol (PCP), arsenic, and chromium into the...

  14. The practice of nurses caring for families of pediatric inpatients in light of Jean Watson

    Directory of Open Access Journals (Sweden)

    Maiara Rodrigues dos Santos

    2014-08-01

    Full Text Available Objective To know the facilities and the difficulties of nurses in caring practice of hospitalized children’s families in the light of Jean Watson’s Theory of Human Caring. Method It was used the descriptive qualitative approach. The data collection was conducted in three stages: presentation of theoretical content; engagement with families in the light of Watson’s theory; and semi-structured interview with 12 pediatric nurses. The interviews were analysed using inductive thematic analysis, being possible to form three themes: Recognizing a framework for care; Considering the institutional context; and Challenges in family’s relationship. Results The theory favored reflections about self, about the institutions and about nurses’ relationship with the family of the child, normalized by a consciousness toward caring attitudes. Conclusion In this process, it is imperative that nurses recognize the philosophical-theoretical foundations of care to attend the child’s family in hospital.

  15. EKSTRAKSI PEWARNA ALAMI DARI BUAH ARBEN (Rubus idaeus Linn. [Extraction of Natural Colorant from Red Raspberry (rubus idaeus linn. And its application in food sistem

    Directory of Open Access Journals (Sweden)

    Tensiska1

    2007-06-01

    Full Text Available Red raspberry fruit has not been optimally utilized even though it contains anthocyanin pigment. The pigment can be used as a natural colorant which also function as antioxidant. The aim of this study was to determine the appropriate solvent for anthocyanin extraction from red raspberry fruit and its possibility for food colorant. The research was started with preliminary research to determine appropriate acidulants (citric, acetic and tartaric acid with levels of 0,1 ;0,25;0,5 ;0,75 and 1 %. The main research was divided into three stages, which were: (1 to determine the appropriate solvent of extraction (aquadest, ethanol and etil acetate; (2 the best extract was determined its color stability in pH of 1,2,3,4,5,6,7,8,9 and (3 to examine the pigment solubility into some food system (aqua96%dest, 25% of acetic acid, 96% of ethanol and coconut oil. The best extract also was examined its solubility in carbonated drink (pH of 3.69, pasteurized milk (pH of 6.49 and yogurt (pH of 2.6. the results showed that the extraction using aquadest with 0.75% of tartaric acid resulted in the highest total anthocyanin and showed the best color intensity. This extract was stable at pH of 2-5 and its solubility was best in aquaeous system with low pHs, thus it can be applied for aqueous product with low pHs.

  16. OSMODESHIDRATACIÓN DE MORA DE CASTILLA (Rubus glaucus Benth CON TRES AGENTES EDULCORANTES OSMODEHYDRATION OF BLACKBERRY (Rubus glaucus Benth WITH THREE SWEETENING AGENTS

    Directory of Open Access Journals (Sweden)

    Diana Patricia Giraldo Bedoya

    2004-06-01

    Full Text Available La investigación sobre la deshidratación osmótica de mora de castilla con tres jarabes diferentes, sacarosa (js, sacarosa invertida (jsi y miel de caña (jmc, en iguales condiciones iniciales de concentración, 70 grados Brix, temperatura promedio de 20°C, y humedad relativa de 65% desarrollada en el Laboratorio de Frutas y Hortalizas de la Universidad Nacional de Colombia, Sede Medellín, permitió conocer que el jarabe de miel de caña presenta mayor poder osmótico (69,2% que los jarabes de sacarosa invertida (54,5% y sacarosa (50%, medido a partir del porcentaje de pérdida de peso de la mora. Con el proceso de estabilización del producto secado por convección forzada con aire caliente a 1,5 ms-1 de velocidad y 55°C de temperatura, durante 24 horas, logrando disminuir la humedad de los tres productos hasta 27,3%hbh, 30,8%hbh y 25,9%hbh para los jarabes de sacarosa, sacarosa invertida y miel de caña, respectivamente y mejorar las condiciones de empaque y almacenamiento, haciendo más estable el producto al ataque microbiano. Las pruebas preliminares de conservación se efectuaron en envases de vidrio de 250g durante 15 días. Se realizó además una prueba sensorial de ordenación con 10 jueces entrenados para la evaluación de las moras deshidratadas osmóticamente antes y después de la prueba de empaque y almacenamiento y como resultado se obtuvo que antes de la prueba de empaque y almacenamiento, el producto de mayor aceptación fue el correspondiente a las moras osmodeshidratadas en jarabe de sacarosa invertida y luego del empaque, la mayor aceptación fue para las moras osmodeshidratadas en jarabe de sacarosa.Studies of osmotic dehydration of blackberry with three different syrups, sucrose (ss, reverse sucrose (rss, and cane syrup (cs with identical initial concentration conditions, 70°Brix, mean temperature of 20°C, and relative humidity of 65% were undertaken in the Fruit and Vegetable Laboratory of the Universidad Nacional de Colombia, Sede Medellín, showing that the cane syrup presented greater osmotic potential (69,2% compared to the reverse sucrose (54,5% and sucrose (50%, measured as the percentage weight loss of the blackberry samples. With the product dehydration process of drying with forced convection hot air at 1,5 ms-1 velocity and 55°C during 24 hours, it was possible to reduce the humidity of the three products to 27,3% hbh, 30,8% hbh and 25,9 % hbh for syrups of sucrose, reverse sucrose and cane syrup, respectively and improve the packaging and storage conditions, making the product more stable against microbial attacks. An ordenation sensorial test also was conducted with 10 judges trained for evaluation of osmotically dehydrated blackberries before and after the packing and storage process, the most accepted product was the one corresponding to the blackberries osmodehydrated in inverted sucrose syrup and after packaging the most accepted was blackberries osmodehydrated in sucrose syrup.

  17. Sodium alginate edible coating for blackberry (Rubus ulmifolius fruits / Revestimento comestível de alginato de sódio para frutos de amorapreta (Rubus ulmifolius

    Directory of Open Access Journals (Sweden)

    Fábio Yamashita

    2008-08-01

    Full Text Available The objective of this work was to check the physical, chemical, microbiological and sensorial characteristics changes of blackberries in natura and coated with sodium alginate edible coating during refrigerated storage. Fruits of blackberries cv. Comanche were sanitized and coated with sodium alginate ( % w/w, sodium alginate plus potassium sorbate (0.1% w/w solutions and fruits in natura not sanitized, that served as control. Sensorial, microbiological and physical-chemical analysis of the fruits were made during 18 days storage at 0°C. After this period the fruits showed good acceptance, according to sensorial evaluation of flavor and appearance, and showed maximum counts of 3.0.108 cfu/g for molds and yeasts and .0.107 cfu/g for psicrotrofic microorganisms. Control fruits had microbiological counts lower than the coated ones because they were less manipulated. Blackberry fruits coated with sodium alginate showed sensorial acceptance and physical and chemical characteristics similar of the fruits in natura, being an alternative to produce minimally processed fruits ready-to-eat.O objetivo do trabalho foi acompanhar as alterações das características físicas, químicas, microbiológicas e sensoriais de frutos de amora-preta in natura e revestidas com cobertura comestível a base de alginato de sódio ao longo da armazenagem sob refrigeração. Frutos de amora-preta cultivar Comanche foram higienizados e revestidos com solução de alginato de sódio ( % p/p, alginato de sódio ( % p/p + conservador sorbato de potássio (0,1% p/p e frutos in natura sem tratamento fitossanitário, que serviram de controle. As análises sensoriais, microbiológicas e físico-químicas dos frutos foram realizadas ao longo da armazenagem a 0oC por 18 dias. Após este período, tanto os frutos revestidos como os não revestidos apresentaram boa aceitação, de acordo com a avaliação sensorial de sabor e aparência, e apresentaram contagens totais máximas de ,0.108 UFC/g de bolores e leveduras e ,0.107 UFC/g de microrganismos psicrotróficos. Os frutos controle apresentaram contagens microbiológicas menores que os revestidos pois foram menos manipulados. Frutos de amora-preta revestidos com alginato de sódio apresentaram aceitação sensorial e características físicas e químicas semelhantes aos frutos in natura, sendo uma alternativa para produção de frutos minimamente processados prontos para consumo.

  18. Mycotoxins, drugs and other extrolites produced by species in Penicillium subgenus Penicillium

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Smedsgaard, Jørn; Larsen, Thomas Ostenfeld

    2004-01-01

    by 13 species, penicillic acid which is produced by 10 species, and terrestric acid and 2-methyl isoborneol that are produced by 8 species. Most species produce both polyketides, terpenes and amino acid derived extrolites and a large number of the species produce bioactive metabolites. The nephrotoxic...

  19. A revision of the Solanum elaeagnifolium clade (Elaeagnifolium clade; subgenus Leptostemonum, Solanaceae)

    Science.gov (United States)

    Knapp, Sandra; Sagona, Eva; Carbonell, Anna K.Z.; Chiarini, Franco

    2017-01-01

    Abstract The Solanum elaeagnifolium clade (Elaeagnifolium clade) contains five species of small, often rhizomatous, shrubs from deserts and dry forests in North and South America. Members of the clade were previously classified in sections Leprophora, Nycterium and Lathyrocarpum, and were not thought to be closely related. The group is sister to the species-rich monophyletic Old World clade of spiny solanums. The species of the group have an amphitropical distribution, with three species in Mexico and the southwestern United States and three species in Argentina. Solanum elaeagnifolium occurs in both North and South America, and is a noxious invasive weed in dry areas worldwide. Members of the group are highly variable morphologically, and this variability has led to much synonymy, particularly in the widespread S. elaeagnifolium. We here review the taxonomic history, morphology, relationships and ecology of these species and provide keys for their identification, descriptions, full synonymy (including designations of lectotypes) and nomenclatural notes. Illustrations, distribution maps and preliminary conservation assessments are provided for all species. PMID:29033654

  20. Pollen morphology of Quercus (subgenus Quercus, section Quercus in Iran and its systematic implication

    Directory of Open Access Journals (Sweden)

    Parisa Panahi

    2012-03-01

    Full Text Available For the first time, pollen morphology of 9 (4 spp. and 5 subspp. taxa representing lobed leaved oaks of Iran in the family of Fagaceae has been examined and illustrated using light microscopy and scanning electron microscopy of acetolysed material. Detailed pollen morphological characteristics are given for Quercus section. The pollen grains are single, isopolar, radially symmetrical, tricolpate, tricolporoidate or tricolporate. Pollens were studied to show all possible characteristics like shape, size, apertures, wall thickness, etc., with special reference to the specific features of each pollen type such as structural, sculptural and suprasculptural patterns. There is considerable variation in pollen morphology between taxa so that, three types of pollen shape, five types of structural pattern, two types of sculptural pattern, five types of suprasculptural pattern and three types of perfora distribution are defined. Furthermore, the relationship between pollen morphology and taxonomy is discussed. Overall, pollen characters are shown to be a useful and informative tool for assessing taxonomic position within Quercus section in Iran.

  1. The Genus Culex, Subgenus Eumelanomyia Theobald in Southeast Asia and Adjacent Areas

    Science.gov (United States)

    1972-01-01

    tergal surface; subapical lobe short or elon or sma 1; distimere slender, sickle shaped and long; B ate; proximal division with 3 stout rods...Nok, 1 P. Tak: Huey Lan Saeng, 6d, 69, 12 p. Nakhon Ratchasima: Pak Chong; Musk Lek; Ban Tha Ma Prang; Khlong Pai; Khao Suan Horn; 7~r, 9?, 1 P, 7 p

  2. Argyritarsis Section of the Subgenus Nyssorhynchus of Anopheles (Diptera: Culicidae). Revision

    Science.gov (United States)

    1988-01-01

    Locality not specified, IM gen (JH). Goias: Santo Theresa, 22 Nov 1918, Peryassu, IM (JH). Para: Altamira Area, 7 Jun 1976, Moramy, 4F (M-1). Boa Vista...430. 1944. Um ano de combate os doencas parasitarias que atacam os rodoviarios da estrada Rio Bahia, 1942 o 1943. Mem. Inst. Oswaldo Cruz Rio de J

  3. A Revision of the Argyritarsis Section of the Subgenus Nyssorhynchus of Anopheles (Diptera: Culicidae)

    Science.gov (United States)

    1988-01-01

    May 1929, Fortaleza, 1 Ice, Causey, 22 Nov 1918, (M-l). Boa locality and (1200-102); 1F (JH); same locality, 27 March 1931, H. Kumm, 11F (JH...do Brasil. Mem. Inst. Oswald0 Cruz Rio de J. 34:293-430. 1944. Urn ano de combate OS doencas parasitarias que atacam OS rodoviarios da estrada Rio

  4. Systematics of Ipomoea subgenus Quamoclit (Convolvulaceae) based on ITS sequence data and a Bayesian phylogenetic analysis.

    Science.gov (United States)

    Miller, Richard E; McDonald, J Andrew; Manos, Paul S

    2004-08-01

    A Bayesian phylogenetic analysis of 36 Ipomoea species using sequence data from the internal transcribed spacer region was compared with classification schemes based on traditional methods and a previously published cpDNA restriction fragment length polymorphism (RFLP) study. These molecular studies support a diversity of groups that were circumscribed on the basis of phenetic principles and agree generally with the results from cpDNA RFLP analyses. The congruence between the phylogenetic hypotheses based on new molecular data and the understanding of relationships developed in earlier studies indicate that these classifications may reflect evolutionary history. Two large clades of species, with one including sections Tricolores, Calonyction, and Pharbitis and the other including sections Mina and Leptocallis, were identified. Furthermore, morphologically distinct groups of Ipomoea species received support from the DNA sequence data. Indices of convergence for the Markov chain Monte Carlo (MCMC) in the Bayesian phylogenetic analysis were evaluated. A limited range of posterior probabilities for each node in the trees from a set of five MCMC samples provides a useful index of convergence. Bayesian node support values were generally higher than bootstrap values from a maximum parsimony analysis. This is consistent with the notion that these measures of support estimate different qualities of the data.

  5. Studies in the genus Riccia (Marchantiales from southern Africa. 24. R. moenkemeyeri, subgenus Ricciella: new records

    Directory of Open Access Journals (Sweden)

    S. M. Perold

    1992-12-01

    Full Text Available Riccia moenkemeyeri was twice described by Stephani (1887, 1891, the second time as R abnormis. Amell (1952 described it as R. undulata. It is clearly a plastic species (Jones 1957 and is widely distributed in tropical Africa, from Sierra Leone (as R. undulata, Nigeria, Cameroon and into the Congo Basin. Until recendy, Sim’s specimens from the Matopos in Zimbabwe, were the most southerly records known, but the species has now also been collected in southern Africa, just east of Pretoria and at Kransberg, in the western Transvaal.

  6. Phylogeny of xerophilic aspergilli (subgenus Aspergillus and taxonomic revision of section Restricti

    Directory of Open Access Journals (Sweden)

    F. Sklenář

    2017-09-01

    The vast majority of species in sect. Restricti produce asperglaucide, asperphenamate or both in contrast to species in sect. Aspergillus. Mycophenolic acid was detected for the first time in at least six members of the section. The ascomata of A. halophilicus do not contain auroglaucin, epiheveadride or flavoglaucin which are common in sect. Aspergillus, but shares the echinulins with sect. Aspergillus.

  7. A note on Combretum subgenus Combretum section Macrostigmatea (Com-bretaceae

    Directory of Open Access Journals (Sweden)

    E. F. Hennessy

    1995-10-01

    Full Text Available The history of Combretum section Macrostigmatea, its circumscription and its representation in the Flora of southern Africa region are provided. A specimen from northern Botswana, Miller B/1199. initially misidentified as C. engleri. is shown to be C. kirkii, the first record of this taxon in the  FSA region.  Combretum mkuzense is placed in synonymy in C.  zeyheri section Spathulipetala.

  8. A revision of the Solanum elaeagnifolium clade (Elaeagnifolium clade; subgenus Leptostemonum, Solanaceae

    Directory of Open Access Journals (Sweden)

    Sandra Knapp

    2017-08-01

    Full Text Available The Solanum elaeagnifolium clade (Elaeagnifolium clade contains five species of small, often rhizomatous, shrubs from deserts and dry forests in North and South America. Members of the clade were previously classified in sections Leprophora, Nycterium and Lathyrocarpum, and were not thought to be closely related. The group is sister to the species-rich monophyletic Old World clade of spiny solanums. The species of the group have an amphitropical distribution, with three species in Mexico and the southwestern United States and three species in Argentina. Solanum elaeagnifolium occurs in both North and South America, and is a noxious invasive weed in dry areas worldwide. Members of the group are highly variable morphologically, and this variability has led to much synonymy, particularly in the widespread S. elaeagnifolium. We here review the taxonomic history, morphology, relationships and ecology of these species and provide keys for their identification, descriptions, full synonymy (including designations of lectotypes and nomenclatural notes. Illustrations, distribution maps and preliminary conservation assessments are provided for all species.

  9. A new species of subgenus Seriphidium of Artemisia L. (Asteraceae) from Turkey

    OpenAIRE

    KURŞAT, Murat; CİVELEK, Şemsettin; TÜRKOĞLU, İsmail; TABUR, Selma; GÜR, Nazmi

    2015-01-01

    Artemisia bashkalensis Kurşat & Civelek sp. nov. from Hakkari Province in East Anatolia, Turkey, has been described. The differences between Artemisia bashkalensis and the related species Artemisia stenocephala Krash. ex Poljak. and Artemisia khorassanica Podl. are reported. The diagnosis, description, distribution map, and taxonomic comments on the new species are provided.

  10. The mode and tempo of genome size evolution in the subgenus Sophophora.

    Science.gov (United States)

    Hjelmen, Carl E; Johnston, J Spencer

    2017-01-01

    Genome size varies widely across organisms, with no apparent tie to organismal complexity. While genome size is inherited, there is no established evolutionary model for this trait. Hypotheses have been postulated for the observed variation in genome sizes across species, most notably the effective population size hypothesis, the mutational equilibrium hypothesis, and the adaptive hypothesis. While much data has been collected on genome size, the above hypotheses have largely ignored impacts from phylogenetic relationships. In order to test these competing hypotheses, genome sizes of 87 Sophophora species were analyzed in a comparative phylogenetic approach using Pagel's parameters of evolution, Blomberg's K, Abouheif's Cmean and Moran's I. In addition to testing the mode and rate of genome size evolution in Sophophora species, the effect of number of taxa on detection of phylogenetic signal was analyzed for each of these comparative phylogenetic methods. Sophophora genome size was found to be dependent on the phylogeny, indicating that evolutionary time was important for predicting the variation among species. Genome size was found to evolve gradually on branches of the tree, with a rapid burst of change early in the phylogeny. These results suggest that Sophophora genome size has experienced gradual changes, which support the largely theoretical mutational equilibrium hypothesis. While some methods (Abouheif's Cmean and Moran's I) were found to be affected by increasing taxa numbers, more commonly used methods (λ and Blomberg's K) were found to have increasing reliability with increasing taxa number, with significantly more support with fifteen or more taxa. Our results suggest that these comparative phylogenetic methods, with adequate taxon sampling, can be a powerful way to uncover the enigma that is genome size variation through incorporation of phylogenetic relationships.

  11. A new species of the subgenus Scymnus from Pakistan (Coleoptera, Coccinellidae).

    Science.gov (United States)

    Rashid, Azad; Chen, Xiaosheng; Qiu, Baoli; Wang, Xingmin

    2017-01-01

    A new species, Scymnus (Scymnus) contortubus Rashid, Chen & Wang, sp. n. , is described and illustrated from Pakistan. A diagnosis, remarks, illustrations, and a distribution map are provided of the new species and its most similar congener, S. (S..) nubilus Mulsant.

  12. Phylogeny of xerophilic aspergilli (subgenus Aspergillus ) and taxonomic revision of section Restricti

    DEFF Research Database (Denmark)

    Sklenář, F.; Jurjević, Ž.; Zalar, P.

    2017-01-01

    a multidisciplinary approach for definition of species boundaries in sect. Restricti. The monophyly of sections Aspergillus and Restricti was tested on a set of 102 isolates comprising all currently accepted species and was strongly supported by Maximum likelihood (ML) and Bayesian inferrence (BI) analysis based on β......-tubulin (benA), calmodulin (CaM) and RNA polymerase II second largest subunit (RPB2) loci. More than 300 strains belonging to sect. Restricti from various isolation sources and four continents were characterized by DNA sequencing, and 193 isolates were selected for phylogenetic analyses and phenotypic studies......Cl concentration from 0 to 25 %) and analysis of morphology including scanning electron microscopy. The micromorphology of conidial heads, vesicle dimensions, temperature profiles and growth parameters in osmotic gradient were useful criteria for species identification. The vast majority of species in sect...

  13. Genepool Variation in Genus Glycine Subgenus Soja Revealed by Polymorphic Nuclear and Chloroplast Microsatellites

    Science.gov (United States)

    Powell, W.; Morgante, M.; Doyle, J. J.; McNicol, J. W.; Tingey, S. V.; Rafalski, A. J.

    1996-01-01

    A combination of nuclear and chloroplast simple sequence repeats (SSRs) have been used to investigate the levels and pattern of variability detected in Glycine max and G. soja genotypes. Based on the analysis of 700 soybean genotypes with 115 restriction fragment length polymorphism (RFLP) probes, 12 accessions were identified that represent 92% of the allelic variability detected in this genepool. These 12 core genotypes together with a sample of G. max and G. soja accessions were evaluated with 11 nuclear SSRs that detected 129 alleles. Compared with the other G. max and G. soja genotypes sampled, the core genotypes represent 40% of the allelic variability detected with SSRs. Despite the multi-allelic nature of soybean SSRs, dendrograms representing phenetic relationships between accessions clustered according to their subspecies origin. In addition to biparentally inherited nuclear SSRs, two uniparentally (maternally) transmitted chloroplast SSRs were also studied. A total of seven haplotypes were identified, and diversity indices of 0.405 +/- 0.088 and 0.159 +/- 0.071 were obtained for the two chloroplast SSRs. The availability of polymorphic SSR loci in the chloroplast genome provides new opportunities to investigate cytonuclear interactions in plants. PMID:8889540

  14. Two new species of Otiorhynchus GERMAR, 1822 subgenus Lixorrhynchus REITTER, 1914 from Morocco (Coleoptera: Curculionidae: Otiorhynchini

    Directory of Open Access Journals (Sweden)

    Białooki Piotr Z.

    2015-06-01

    Full Text Available Otiorhynchus (Lixorrhynchus deceptorius sp. n. and O. (L. incisus sp. n. from northern Morocco are described and illustrated. Both new species are superficially similar to Mirorhynchus bellus MAGNANO, 2003 based on the conspicuously laterally incised rostrum. The erroneous indication of M. bellus from Cyprus is corrected here to Crete

  15. Phylogeny of xerophilic aspergilli (subgenus Aspergillus ) and taxonomic revision of section Restricti

    DEFF Research Database (Denmark)

    Sklenář, F.; Jurjević, Ž.; Zalar, P.

    2017-01-01

    recognised species can be reliably identified by all four examined genetic loci. Phenotype analysis was performed to support the delimitation of new species and includes colony characteristics on seven cultivation media incubated at several temperatures, growth on an osmotic gradient (six media with Na...

  16. Phylogeography and palaeodistribution modelling of Nassauvia subgenus Strongyloma (Asteraceae): exploring phylogeographical scenarios in the Patagonian steppe.

    Science.gov (United States)

    Nicola, Marcela V; Sede, Silvana M; Pozner, Raúl; Johnson, Leigh A

    2014-11-01

    The Patagonian steppe is an immense, cold, arid region, yet phylogeographically understudied. Nassauvia subgen. Strongyloma is a characteristic element of the steppe, exhibiting a continuum of morphological variation. This taxon provides a relevant phylogeographical model not only to understand how past environmental changes shaped the genetic structure of its populations, but also to explore phylogeographical scenarios at the large geographical scale of the Patagonian steppe. Here, we (1) assess demographic processes and historical events that shaped current geographic patterns of haplotypic diversity; (2) analyze hypotheses of isolation in refugia, fragmentation of populations, and/or colonization of available areas during Pleistocene glaciations; and (3) model extant and palaeoclimatic distributions to support inferred phylogeographical patterns. Chloroplast intergenic spacers, rpl32-trnL and trnQ-5'rps16, were sequenced for 372 individuals from 63 populations. Nested clade analysis, analyses of molecular variance, and neutrality tests were performed to assess genetic structure and range expansion. The present potential distribution was modelled and projected onto a last glacial maximum (LGM) model. Of 41 haplotypes observed, ten were shared among populations associated with different morphological variants. Populations with highest haplotype diversity and private haplotypes were found in central-western and south-eastern Patagonia, consistent with long-term persistence in refugia during Pleistocene. Palaeomodelling suggested a shift toward the palaeoseashore during LGM; new available areas over the exposed Atlantic submarine platform were colonized during glaciations with postglacial retraction of populations. A scenario of fragmentation and posterior range expansion may explain the observed patterns in the center of the steppe, which is supported by palaeomodelling. Northern Patagonian populations were isolated from southern populations by the Chubut and the Deseado river basins during glaciations. Pleistocene glaciations indirectly impacted the distribution, demography, and diversification of subgen. Strongyloma through decreased winter temperatures and water availability in different areas of its range.

  17. Cortinarius prodigiosus—a new species of the subgenus Phlegmacium from Central Europe

    DEFF Research Database (Denmark)

    Borovička, Jan; Bušek, Bohumil; Mikšík, Michal

    2015-01-01

    A new species, Cortinarius prodigiosus, is reported from the Czech Republic and Hungary. This medium-sized Phlegmacium is distinguished by a yellow pileus and lower part of stipe, by greyish-violet lamellae, and by strikingly bicolorous flesh: yellow in most parts of stipe and whitish in pileus. ....... On the basis of its morphological and molecular characters (ITS rDNA and LSU D1/D2 domain), this novel taxon can be assigned to the Splendentes group of the section Calochroi; it occurs in thermophilous oak forests on calcareous bedrock....

  18. Systematics and biogeography of the ant genus Crematogaster Lund subgenus Orthocrema Santschi in Asia (Hymenoptera: Formicidae)

    National Research Council Canada - National Science Library

    Hosoishi, Shingo; Ogata, Kazuo

    2016-01-01

    .... Its systematics has remained poorly understood because of a lack of modern revisionary work. Crematogaster ( Orthocrema) is revised for the A sian region, and 27 species including ten new species are recognized...

  19. Flora Malesiana precursor for the treatment of Moraceae 3: Ficus subgenus Ficus

    NARCIS (Netherlands)

    Berg, C.C.

    2003-01-01

    The sections of Ficus L. subg. Ficus are described and their Malesian species listed and a key to their identification is provided. One new subsection is established: Ficus subg. Ficus sect. Eriosycea subsect. Auratae. Four new species and two new subspecies are described: F. auricoma, F.

  20. 220D-F2 from Rubus ulmifolius kills Streptococcus pneumoniae planktonic cells and pneumococcal biofilms.

    Directory of Open Access Journals (Sweden)

    Sharmila J Talekar

    Full Text Available Streptococcus pneumoniae (pneumococcus forms organized biofilms to persist in the human nasopharynx. This persistence allows the pneumococcus to produce severe diseases such as pneumonia, otitis media, bacteremia and meningitis that kill nearly a million children every year. While bacteremia and meningitis are mediated by planktonic pneumococci, biofilm structures are present during pneumonia and otitis media. The global emergence of S. pneumoniae strains resistant to most commonly prescribed antibiotics warrants further discovery of alternative therapeutics. The present study assessed the antimicrobial potential of a plant extract, 220D-F2, rich in ellagic acid, and ellagic acid derivatives, against S. pneumoniae planktonic cells and biofilm structures. Our studies first demonstrate that, when inoculated together with planktonic cultures, 220D-F2 inhibited the formation of pneumococcal biofilms in a dose-dependent manner. As measured by bacterial counts and a LIVE/DEAD bacterial viability assay, 100 and 200 µg/ml of 220D-F2 had significant bactericidal activity against pneumococcal planktonic cultures as early as 3 h post-inoculation. Quantitative MIC's, whether quantified by qPCR or dilution and plating, showed that 80 µg/ml of 220D-F2 completely eradicated overnight cultures of planktonic pneumococci, including antibiotic resistant strains. When preformed pneumococcal biofilms were challenged with 220D-F2, it significantly reduced the population of biofilms 3 h post-inoculation. Minimum biofilm inhibitory concentration (MBIC50 was obtained incubating biofilms with 100 µg/ml of 220D-F2 for 3 h and 6 h of incubation. 220D-F2 also significantly reduced the population of pneumococcal biofilms formed on human pharyngeal cells. Our results demonstrate potential therapeutic applications of 220D-F2 to both kill planktonic pneumococcal cells and disrupt pneumococcal biofilms.

  1. Elaboración de néctar de zarzamora (Rubus fructicosus L.

    Directory of Open Access Journals (Sweden)

    Cristina Encarnación Valencia Sullca

    2013-01-01

    Full Text Available En este trabajo de investigación se elaboró y caracterizó fisicoquímicamente néctar de zarzamora. Las operaciones comprendidas en este proceso fueron: selección, clasificación, lavado, desinfección (hipoclorito de sodio 100 ppm de Cloro Libre Residual, pulpeado, refinado, estandarizado, homogeneización, pasteurización y envasado. En la materia prima se encontró: 82,98% de humedad, 0,93% de proteínas,15,74% de carbohidratos, ausencia de grasa, 2,48% de fibra, 0,42% de cenizas, 3,91% de azúcares reductores, 0,93% de acidez, 3,4 de pH, 10,5 de °Brix, 400,67 mg de ácido gálico/100 g muestra de compuestos fenólicos totales, 39,02 μmol Trolox / g de capacidad antioxidante, 109,07 mg cianidina 3-glucósido / 100 g muestra de antocianinas y 14,37 mg / 100 g de vitamina C. Los frutos reportaron un rendimiento de 78,2 % de pulpa. Se llevaron a cabo ensayos preliminares de elaboración de néctar de zarzamora a diferentes diluciones (1:2,5; 1:2,6; 1:2,7; 1:2,8; 1:2,9 y 1:3, grados °Brix (11,12 y 13 y valores de pH (3,4; 3,6 y 3,8. Teniendo en cuenta la mayor aceptación en la evaluación sensorial (prueba de preferencia ampliada con 30 jueces no entrenados cuyos resultados fueron evaluados estadísticamente mediante la prueba no paramétrica de Friedman, se eligió a la que contenía dilución 1:2,7 (pulpa:agua, 12 °Brix, 0,07% de CMC y 3,8 de pH. El néctar obtenido reportó: ausencia de grasa y fibra, 87,3% de humedad, 0,10% de proteínas, 0,10% de cenizas, 4,87% de azúcares reductores, 0,23% de acidez, 3,8 de pH, 115,25 mg ácido gálico/100 g muestra de compuestos fenólicos totales, 3.9 μmol Trolox / g de capacidad antioxidante, 24,33 mg cianidina 3-glucósido / 100 g muestra de Antocianinas y 3,9 mg / 100 g de vitamina C.

  2. CARACTERIZACION FISICOQUÍMICA DE MORA DE CASTILLA (Rubus glaucus Benth. EN SEIS ESTADOS DE MADUREZ

    Directory of Open Access Journals (Sweden)

    LEIDY CAROLINA AYALA S

    2013-12-01

    Full Text Available El interés de productores, comercializadores y consumidores de la región por la mora de Castilla producida en el municipio de Ibagué y la poca información sobre sus cualidades dieron origen a la presente caracterización del fruto en seis estados de madurez. Los resultados morfológicos y fisicoquímicos indican que el grado óptimo de recolección es 5 atendiendo al buen índice de cosecha, firmeza, peso, sólidos solubles totales (SST, rendimiento y material insoluble en alcohol (MIA, en esta fase de maduración la acidez limita el crecimiento bacteriano no obstante persistan problemas fúngicos como Botritys Cinérea. Así mismo, la cosecha en grados de madurez 4 y 6 no son viables, debido a bajo peso y volumen; y fragilidad estructural que con frecuencia incide en la lixiviación, fermentación y magullado de la fruta respectivamente. En general el análisis estadístico pone de manifiesto diferencias significativas entre grados de madurez respecto a peso, diámetro mayor, volumen, acidez, SST, minerales y MIA, ratificando la importante relación entre el momento de cosecha y estado de desarrollo del fruto debido a su incidencia directa en la calidad del producto y competitividad comercial.

  3. Nomenclatorische en taxonomische toelichting op de naamlijst van de Nederlandse bramen (Rubus L.)

    NARCIS (Netherlands)

    Beek, van de Bram

    2014-01-01

    De publikatie van de naamlijst van de Nederlandse bramen vereiste een aanzienlijk aantal taxonomische en nomenclatorische beslissingen. In dit artikel worden deze toegelicht. The publication of the checklist of the Dutch brambles required a considerable number of taxonomic and nomenclatorial

  4. Estudio de durabilidad de la pulpa de mora de Castilla y mora San Antonio (rubus glaucus)

    OpenAIRE

    Galvis Murillo, Beatriz Sirley

    2003-01-01

    Teniendo presente que en nuestro país anualmente se produce anualmente sesenta mil toneladas de mora, y debido a su alto grado de perecebilidad algunas empresas ya ha empezado a transformar esta fruta en pulpa para llevarla al consumidor aprovechando sus vitaminas y minerales. En este trabajo se estudio la durabilidad de la pulpa de mora de dos variedades (Mora de Castilla y San Antonio), a través de la cinética de la fermentación durante operaciones de almacenamiento (refrigeración, congelac...

  5. Licor de mora de castilla (rubus glaucus benth) con diferentes porcentajes de pulpa

    National Research Council Canada - National Science Library

    Álvaro Montoya Gómez; Jenny Katherine Londoño Gómez; Carlos Julio Márquez Cardozo

    2005-01-01

    .... Se formularon licores, con una participación de la pulpa del 25 %, 30 %, 35 %, 40 %, 45 %, 50 % y 55 % iniciando con 35 °Brix, para todos los casos en el mosto fermentable, ajustando las formulaciones con sacarosa...

  6. LICOR DE MORA DE CASTILLA (Rubus glaucus Benth) CON DIFERENTES PORCENTAJES DE PULPA

    National Research Council Canada - National Science Library

    Montoya Gómez, Álvaro; Londoño Gómez, Jenny Katherine; Márquez Cardozo, Carlos Julio

    2005-01-01

    .... Se formularon licores, con una participación de la pulpa del 25 %, 30 %, 35 %, 40 %, 45 %, 50 % y 55 % iniciando con 35 °Brix, para todos los casos en el mosto fermentable, ajustando las formulaciones con sacarosa...

  7. Biofabrication of copper oxide nanoparticles using Andean blackberry (Rubus glaucus Benth.) fruit and leaf

    OpenAIRE

    Brajesh Kumar; Kumari Smita; Luis Cumbal; Alexis Debut; Yolanda Angulo

    2017-01-01

    Biofabrication of copper oxide nanoparticles (CuO-NPs) of a desired size remains a significant challenge. In this report, CuO-NPs were fabricated by treating 10 mM copper nitrate with Andean blackberry fruit (ABF) and leaf (ABL); and evaluated its antioxidant activity. As-prepared NPs characterization were determined by UV–visible spectrophotometry, Dynamic Light Scattering (DLS), transmission electron microscopy (TEM) with selected area electron diffraction (SAED) and X-ray diffraction (XRD)...

  8. Determination of Phenolic Compounds and Antioxidant Activity in Leaves from Wild Rubus L. Species

    OpenAIRE

    Oszmiański, Jan; Wojdyło, Aneta; Nowicka, Paulina; Teleszko, Mirosława; Cebulak, Tomasz; Wolanin, Mateusz

    2015-01-01

    Twenty-six different wild blackberry leaf samples were harvested from various localities throughout southeastern Poland. Leaf samples were assessed regarding their phenolic compound profiles and contents by LC/MS QTOF, and their antioxidant activity by ABTS and FRAP. Thirty-three phenolic compounds were detected (15 flavonols, 13 hydroxycinnamic acids, three ellagic acid derivatives and two flavones). Ellagic acid derivatives were the predominant compounds in the analyzed leaves, especially ...

  9. Determination of phenolic compounds and antioxidant activity in leaves from wild Rubus L. species.

    Science.gov (United States)

    Oszmiański, Jan; Wojdyło, Aneta; Nowicka, Paulina; Teleszko, Mirosława; Cebulak, Tomasz; Wolanin, Mateusz

    2015-03-18

    Twenty-six different wild blackberry leaf samples were harvested from various localities throughout southeastern Poland. Leaf samples were assessed regarding their phenolic compound profiles and contents by LC/MS QTOF, and their antioxidant activity by ABTS and FRAP. Thirty-three phenolic compounds were detected (15 flavonols, 13 hydroxycinnamic acids, three ellagic acid derivatives and two flavones). Ellagic acid derivatives were the predominant compounds in the analyzed leaves, especially sanguiin H-6, ellagitannins, lambertianin C, and casuarinin. The content of phenolic compounds was significantly correlated with the antioxidant activity of the analyzed samples. The highest level of phenolic compounds was measured for R. perrobustus, R. wimmerianus, R. pedemontanus and R. grabowskii. The study showed that wild blackberry leaves can be considered a good source of antioxidant compounds. There is clear potential for the utilization of blackberry leaves as a food additive, medicinal source or herbal tea.

  10. Determination of Phenolic Compounds and Antioxidant Activity in Leaves from Wild Rubus L. Species

    Directory of Open Access Journals (Sweden)

    Jan Oszmiański

    2015-03-01

    Full Text Available Twenty-six different wild blackberry leaf samples were harvested from various localities throughout southeastern Poland. Leaf samples were assessed regarding their phenolic compound profiles and contents by LC/MS QTOF, and their antioxidant activity by ABTS and FRAP. Thirty-three phenolic compounds were detected (15 flavonols, 13 hydroxycinnamic acids, three ellagic acid derivatives and two flavones. Ellagic acid derivatives were the predominant compounds in the analyzed leaves, especially sanguiin H-6, ellagitannins, lambertianin C, and casuarinin. The content of phenolic compounds was significantly correlated with the antioxidant activity of the analyzed samples. The highest level of phenolic compounds was measured for R. perrobustus, R. wimmerianus, R. pedemontanus and R. grabowskii. The study showed that wild blackberry leaves can be considered a good source of antioxidant compounds. There is clear potential for the utilization of blackberry leaves as a food additive, medicinal source or herbal tea.

  11. Biofabrication of copper oxide nanoparticles using Andean blackberry (Rubus glaucus Benth. fruit and leaf

    Directory of Open Access Journals (Sweden)

    Brajesh Kumar

    2017-01-01

    Full Text Available Biofabrication of copper oxide nanoparticles (CuO-NPs of a desired size remains a significant challenge. In this report, CuO-NPs were fabricated by treating 10 mM copper nitrate with Andean blackberry fruit (ABF and leaf (ABL; and evaluated its antioxidant activity. As-prepared NPs characterization were determined by UV–visible spectrophotometry, Dynamic Light Scattering (DLS, transmission electron microscopy (TEM with selected area electron diffraction (SAED and X-ray diffraction (XRD analysis. UV–visible spectroscopy showed an electronic excitonic transition at 250–255 nm clearly reveals the formation of ABF and ABL CuO-NPs. DLS analysis demonstrated mean diameter of ABF CuO-NPs (43.3 nm smaller than ABL CuO-NPs (52.5 nm. TEM with SAED confirmed the CuO-NPs are spherical and of partial crystalline nature. Furthermore, the antioxidant efficacy of ABF CuO-NPs showed 89.02%, 1 mM whereas ABL CuO-NPs 75.92%, 1 mM against 1,1-diphenyl-2-picrylhydrazyl. From the results obtained it is suggested that green CuO-NPs could be used effectively in future biomedical concerns.

  12. Quality characterization of Andean blackberry fruits (Rubus glaucus Benth. in different maturity stages in Antioquia, Colombia

    Directory of Open Access Journals (Sweden)

    Catarina Pedro Carvalho

    2015-04-01

    Full Text Available Product quality and safety are two essential characteristics for the fruit market, making it necessary to normalize and standardize processes in order to improve their commercialization. In this study, the quality of two Andean blackberry cultivars grown in two regions of Antioquia (Envigado and Guarne, Colombia, from different maturity stages as defined by the Norma Tecnica Colombiana 7146 (NTC Spanish was characterized. The parameters that were found suitable for the fruit quality characterization were: weight, total solid soluble content (TSS, titratable acidity (TA, maturity index (MI, color index (CI and firmness (F. The equatorial diameter (ED maintained its importance relative to the standard and the market, along with the juice yield (JY. The quotient a*/b* presented the best correlation with the visual color scale as defined in the standard. The TSS ranges defined in NTC 4106 were not verified in this studied for fruits grown in the agro-climatic conditions of Antioquia. Linear regression models are a useful tool for making quick and easy comparisons and estimations of the quality parameters.

  13. Nonsense mutation inside anthocyanidin synthase gene controls pigmentation in yellow raspberry (Rubus idaeus L..

    Directory of Open Access Journals (Sweden)

    Muhammad Zubair Rafique

    2016-12-01

    Full Text Available Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (Anne. A 5-bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect i.e. nonsense-mRNA mediated decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  14. Production and elicitation of benzalacetone and the raspberry ketone in cell suspension cultures of Rubus idaeus.

    Science.gov (United States)

    Pedapudi, S; Chin, C K; Pedersen, H

    2000-01-01

    Production levels of p-coumaric acid (p-CA), p-hydroxyphenylbut-3-ene-2-one (benzalacetone), and p-hydroxyphenyl-2-butanone (raspberry ketone) were measured in raspberry cell suspension cultures to investigate metabolite dynamics in a short (two-step) pathway. Intracellular concentrations of benzalacetone and the raspberry ketone fluctuated during the time course of a normal batch culture cycle but showed higher levels during periods of rapid growth. Cells elicited with the signal coupler methyl jasmonate yielded a 2- to 3-fold increase in metabolite concentrations after 24 h. The results suggest that raspberry ketone production is rapidly inducible during periods of high carbohydrate utilization. It is not an end product, however, and undergoes conversion to subsequent metabolites.

  15. Exogenous tocopherol and ascorbic acid improve in vitro recovery of cryopreserved Rubus shoot tips

    Science.gov (United States)

    Oxidative processes involved in stresses such as cold temperatures can decrease the viability of plant tissues. Antioxidants that counteract these oxidative reactions could improve plant viability following the stresses involved in cryopreservation. We studied the effects of exogenous vitamin E (V...

  16. Uncommon Trimethoxylated Flavonol Obtained from Rubus rosaefolius Leaves and Its Antiproliferative Activity

    Directory of Open Access Journals (Sweden)

    Marcel Petreanu

    2015-01-01

    Full Text Available This study shows the evaluation the antiproliferative effect of the extract, fractions, and uncommon compounds isolated from R. rosaefolius leaves. The compounds were identified by conventional spectroscopic methods such as NMR-H1 and C13 and identified as 5,7-dihydroxy-6,8,4′-trimethoxyflavonol (1, 5-hydroxy-3,6,7,8,4′-pentamethoxyflavone (2, and tormentic acid (3. Both hexane and dichloromethane fractions showed selectivity for multidrug-resistant ovary cancer cell line (NCI-ADR/RES with total growth inhibition values of 11.1 and 12.6 μg/ml, respectively. Compound 1 also showed selective activity against the same cell line (18.8 μg/ml; however, it was especially effective against glioma cells (2.8 μg/ml, suggesting that this compound may be involved with the in vitro antiproliferative action.

  17. Antithrombotic activity of fractions and components obtained from raspberry leaves (Rubus chingii).

    Science.gov (United States)

    Han, Na; Gu, Yuhong; Ye, Chun; Cao, Yan; Liu, Zhihui; Yin, Jun

    2012-05-01

    The 70% ethanol fraction from an aqueous extract of raspberry leaves was shown to be the most antithrombotic fraction in in vitro and in vivo tests. The total flavonoids and phenolics in this fraction were 0.286g/g and 0.518g/g by colorimetry. Six compounds, including salicylic acid, kaempferol, quercetin, tiliroside, quercetin 3-O-β-d-glucopyranoside and kaempferol 3-O-β-d-glucopyranoside, were isolated from the active fraction. Among them, kaempferol, quercetin and tiliroside obviously delayed plasma recalcification time (PRT) in blood. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

  18. Antiviral effects of black raspberry (Rubus coreanus) seed extract and its polyphenolic compounds on norovirus surrogates.

    Science.gov (United States)

    Lee, Ji-Hye; Bae, Sun Young; Oh, Mi; Seok, Jong Hyeon; Kim, Sella; Chung, Yeon Bin; Gowda K, Giri; Mun, Ji Young; Chung, Mi Sook; Kim, Kyung Hyun

    2016-06-01

    Black raspberry seeds, a byproduct of wine and juice production, contain large quantities of polyphenolic compounds. The antiviral effects of black raspberry seed extract (RCS) and its fraction with molecular weight less than 1 kDa (RCS-F1) were examined against food-borne viral surrogates, murine norovirus-1 (MNV-1) and feline calicivirus-F9 (FCV-F9). The maximal antiviral effect was achieved when RCS or RCS-F1 was added simultaneously to cells with MNV-1 or FCV-F9, reaching complete inhibition at 0.1-1 mg/mL. Transmission electron microscopy (TEM) images showed enlarged viral capsids or disruption (from 35 nm to up to 100 nm) by RCS-F1. Our results thus suggest that RCS-F1 can interfere with the attachment of viral surface protein to host cells. Further, two polyphenolic compounds derived from RCS-F1, cyanidin-3-glucoside (C3G) and gallic acid, identified by liquid chromatography-tandem mass spectrometry, showed inhibitory effects against the viruses. C3G was suggested to bind to MNV-1 RNA polymerase and to enlarge viral capsids using differential scanning fluorimetry and TEM, respectively.

  19. Characterization and biological activities of a novel polysaccharide isolated from raspberry (Rubus idaeus L.) fruits.

    Science.gov (United States)

    Yu, Zeyuan; Liu, Lu; Xu, Yaqin; Wang, Libo; Teng, Xin; Li, Xingguo; Dai, Jing

    2015-11-05

    A water-soluble polysaccharide namely RCP-II from raspberry fruits was obtained by complex enzyme method followed by successive purification using macroporous resin D4020 and Sephadex G-100 columns. RCP-II was an acidic heteropolysaccharide and the characteristic structure of polysaccharide was determined. The carbohydrate of RCP-II was composed with galacturonic acid, rhamnose, arabinose, xylose, glucose and galactose in a molar ratio of 1.00:0.55:1.19:0.52:0.44:1.90 and the average molecular weight was estimated to be 4013 Da, based on dextran standards. RCP-II presented high scavenging activity toward DPPH•, HO•, O2(•-) in a concentration-dependent manner. The determination of the inhibitory activity on protein glycation showed that in 14 days of incubation the inhibitory ability of RCP-II was more effective on the development of non-enzymatic glycation reaction at early phase than that at the following two phases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Quality and chemical composition of ten red raspberry (Rubus idaeus L.) genotypes during three harvest seasons.

    Science.gov (United States)

    Mazur, Sebastian Piotr; Nes, Arnfinn; Wold, Anne-Berit; Remberg, Siv Fagertun; Aaby, Kjersti

    2014-10-01

    Colour and chemical composition of fruits of 10 red raspberry genotypes grown in Nordic climate during three harvest seasons were studied. The main phenolic compounds in the fruits were ellagitannins and anthocyanins, contributing 57% and 42% to the quantified phenolic compounds, respectively. Cyanidin-3-sophoroside was the most abundant anthocyanin (61%). All quality parameters were significantly affected by genotype. The genotypes could be categorised into three groups. 'Veten' and 'RU984 06038' were characterised by high concentrations of flavonoids, i.e., anthocyanins and quercetin glycosides, and dark red colour. 'Octavia', 'Glen Magna', 'RU004 03067', 'Glen Ample' and 'RU974 07002' were characterised by light colour, high titratable acids and low flavonoid concentrations. 'Malling Hestia', 'RU024 01003' and 'RU004 04095' had high content of dry matter, soluble solids, ascorbic acid and ellagic acid containing compounds, in addition to high hue and chroma values. All quality parameters, except ascorbic acid and lambertianin C, varied significantly between harvest seasons. The lowest seasonal variation in fruit quality was observed in 'RU024 01003' and 'Glen Ample' and the highest 'RU004 03067' and 'Glen Magna'. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Antioxidant and antiproliferative activities of phenolics isolated from fruits of Himalayan yellow raspberry (Rubus ellipticus).

    Science.gov (United States)

    Saini, Ritu; Dangwal, Koushalya; Singh, Himani; Garg, Veena

    2014-11-01

    Yellow Himalayan raspberry, a wild edible fruit, was analyzed for phenolic contents, and antioxidant, antibacterial and antiproliferative activities. Phenolics were extracted using 80 % aqueous solvents containing methanol, acidic methanol, acetone and acidic acetone. Our analysis revealed that the acidic acetone extracts recovered the highest level of total phenolics (899 mg GAE/100 g FW) and flavonoids (433.5 mg CE/100 g FW). Free radical scavenging activities (DPPH, ABTS, superoxide and linoleate hydroperoxide radicals) and ferric reducing activity were highest in the acetone and acidic acetone extracts. No metal chelating or antibacterial activity was detected in any of the extracts. Acetone and methanol extracts showed potent antiproliferative activity against human cervical cancer cells (C33A) with an EC50 of inhibition at 5.04 and 4. 9 mg/ml fruit concentration respectively, while showing no cytotoxicity to normal PBMCs cells. Therefore, the present study concluded that the yellow Himalayan raspberry is a potent source of phytochemicals having super antioxidant and potent antiproliferative activities.

  2. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.).

    Science.gov (United States)

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase (Ans) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  3. Bioactivity of Meeker and Willamette raspberry (Rubus idaeus L.) pomace extracts.

    Science.gov (United States)

    Cetojević-Simin, Dragana D; Velićanski, Aleksandra S; Cvetković, Dragoljub D; Markov, Siniša L; Cetković, Gordana S; Tumbas Šaponjac, Vesna T; Vulić, Jelena J; Canadanović-Brunet, Jasna M; Djilas, Sonja M

    2015-01-01

    Taking into account the substantial potential of raspberry processing by-products, pomace extracts from two raspberry cultivars, Meeker and Willamette, were investigated. Total phenolic, flavonoid and anthocyanin contents were determined. Willamette pomace extract (EC₅₀=0.042 mg/ml) demonstrated stronger 2,2-diphenyl-1-picrylhydrazyl DPPH radical-scavenging activity than did Meeker pomace extract (EC₅₀=0.072 mg/ml). The most pronounced cell growth inhibition effect was obtained in the breast adenocarcinoma cell line, reaching EC50 values of 34.8 and 60.3 μg/ml for Willamette and Meeker extracts, respectively. Both extracts demonstrated favourable non-tumor/tumor cell growth ratios and potently increased the apoptosis/necrosis ratio in breast adenocarcinoma and cervix carcinoma cells. In reference and wild bacterial strains, minimal inhibitory concentrations (MIC) were achieved in a concentration range from 0.29 to 0.59 mg/ml, and minimal bactericidal concentrations (MBC) in a range from 0.39 to 0.78 mg/ml. The results indicate significant antioxidant, antiproliferative, proapoptotic and antibacterial activities of raspberry pomace and favour its use as a functional food ingredient. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Fermentative behavior of Saccharomyces strains during microvinification of raspberry juice (Rubus idaeus L.).

    Science.gov (United States)

    Duarte, Whasley F; Dragone, Giuliano; Dias, Disney R; Oliveira, José M; Teixeira, José A; Silva, João B Almeida E; Schwan, Rosane F

    2010-10-15

    Sixteen different strains of Saccharomyces cerevisiae and Saccharomyces bayanus were evaluated in the production of raspberry fruit wine. Raspberry juice sugar concentrations were adjusted to 16° Brix with a sucrose solution, and batch fermentations were performed at 22 °C. Various kinetic parameters, such as the conversion factors of the substrates into ethanol (Y(p/s)), biomass (Y(x/s)), glycerol (Y(g/s)) and acetic acid (Y(ac/s)), the volumetric productivity of ethanol (Q(p)), the biomass productivity (P(x)), and the fermentation efficiency (E(f)) were calculated. Volatile compounds (alcohols, ethyl esters, acetates of higher alcohols and volatile fatty acids) were determined by gas chromatography (GC-FID). The highest values for the E(f), Y(p/s), Y(g/s), and Y(x/s) parameters were obtained when strains commonly used in the fuel ethanol industry (S. cerevisiae PE-2, BG, SA, CAT-1, and VR-1) were used to ferment raspberry juice. S. cerevisiae strain UFLA FW 15, isolated from fruit, displayed similar results. Twenty-one volatile compounds were identified in raspberry wines. The highest concentrations of total volatile compounds were found in wines produced with S. cerevisiae strains UFLA FW 15 (87,435 μg/L), CAT-1 (80,317.01 μg/L), VR-1 (67,573.99 μg/L) and S. bayanus CBS 1505 (71,660.32 μg/L). The highest concentrations of ethyl esters were 454.33 μg/L, 440.33 μg/L and 438 μg/L for S. cerevisiae strains UFLA FW 15, VR-1 and BG, respectively. Similar to concentrations of ethyl esters, the highest concentrations of acetates (1927.67 μg/L) and higher alcohols (83,996.33 μg/L) were produced in raspberry wine from S. cerevisiae UFLA FW 15. The maximum concentration of volatile fatty acids was found in raspberry wine produced by S. cerevisiae strain VR-1. We conclude that S. cerevisiae strain UFLA FW 15 fermented raspberry juice and produced a fruit wine with low concentrations of acids and high concentrations of acetates, higher alcohols and ethyl esters. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Red raspberry (Rubus idaeus L.) intake decreases oxidative stress in obese diabetic (db/db) mice.

    Science.gov (United States)

    Noratto, Giuliana D; Chew, Boon P; Atienza, Liezl M

    2017-07-15

    Red raspberry fruit intake was investigated on obese diabetic (db/db) mice for 8weeks. Animals fed isocaloric diets (5.3% freeze-dried raspberry, or control) were assessed for obesity-diabetes-disease risk biomarkers. Results showed that raspberry intake improved antioxidant status and lessened plasma interleukin (IL)-6 (0.3-fold of control, p0.05). Plasma levels of total cholesterol (T-CHL), low density lipoprotein-cholesterol (LDL-CHL), and resistin were higher in the raspberry group. Overall, the enhanced detoxifying cell defenses exerted by raspberry intake might be due to its polyphenolics and fibre. This study demonstrates in vivo that raspberry intake, at a dose that can be achieved by human consumption, might protect against diabetes-induced oxidative stress. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Method to reduce low temperature stress (LTS) in red raspberry (Rubus idaeus L.)

    Science.gov (United States)

    In Norway and other Nordic regions, the floricanes of red raspberries often suffer 20 to 30 percent injury from exposures to extremely low temperatures. We studied from 2011 to 2014 to determine the effect of bending the floricanes of ‘Glen Ample’, ‘Stiora’ and KV91-39-7 red raspberries close to th...

  7. Hepatoprotective effects of raspberry (Rubus coreanus Miq.) seed oil and its major constituents.

    Science.gov (United States)

    Teng, Hui; Lin, Qiyang; Li, Kang; Yuan, Benyao; Song, Hongbo; Peng, Hongquan; Yi, Lunzhao; Wei, Ming-Chi; Yang, Yu-Chiao; Battino, Maurizio; Cespedes Acuña, Carlos L; Chen, Lei; Xiao, Jianbo

    2017-12-01

    Raspberry seed is a massive byproduct of raspberry juice and wine but usually discarded. The present study employed a microwave-assisted method for extraction of raspberry seed oil (RSO). The results revealed that omega-6 fatty acids (linoleic acid and γ-linolenic acid) were the major constituents in RSO. Cellular antioxidant enzyme activity such as superoxide dismutase (SOD), glutathione peroxidase (GPx), and catalase (CAT) were investigated in HepG2 cells treated with RSO. Induction of the synthesis of several antioxidants in H2O2-exposed HepG2 cells was found. RSO increased the enzyme activity of SOD, CAT, and GPx in H2O2-exposed HepG2. Furthermore, RSO inhibited the phosphorylation of upstream mitogen-activated protein kinases (MAPK) such as c-Jun N-terminal kinase (c-JNK) and extracellular signal-regulated kinase (ERK). Taken together, the possible mechanisms to increase antioxidant enzyme activities in HepG2 may through the suppression of ERK and JNK phosphorylation. Raspberry seed oil exhibited good effects on the activities of the intracellular antioxidant enzymes and seems to protect the liver from oxidative stress through the inhibition of MAPKs. Copyright © 2017. Published by Elsevier Ltd.

  8. Stress-Disorder Symptoms in Vietnam and Korean War Veterans: A Commentary on Thienes-Hontos, Watson, and Kucala.

    Science.gov (United States)

    Caroll, Edward

    1983-01-01

    Reviews a study which found that symptoms associated with posttraumatic stress disorder (PTSD) are neither unique to or common among Vietnam veteran psychiatric patients or their Korean war counterparts. Questions choice of study sample, confounding variables, and source of data. A rebuttal by the original author is included. (WAS)

  9. Analysis of the JP=1+ three-pion system using a generalized Watson theorem for production of multiquark states

    Science.gov (United States)

    Longacre, R. S.

    1982-07-01

    We analyze the JP=1+ three-pion production amplitudes obtained from the most recent diffractive, charge-exchange, and backward-production experiments. We have found effects in the amplitudes that we interpret in terms of qq¯, q2q¯2, and q3q¯3 interactions. tions. The qq¯ piece gives rise to the A1 resonance whose parameters are MA1=1230+/-30 MeV and ΓA1=330+/-60 MeV, whereas the backward-production reaction shows a strong qq¯ and q2q¯2 interference effect. The ɛπ scattering couples only to the q2q¯2 and q3q¯3, and thus argues in favor of Jaffe's four-quark model of the ɛ.

  10. 77 FR 64515 - Watson Pharmaceuticals, Inc., Actavis Inc., Actavis Pharma Holding 4 ehf., and Actavis S.a.r.l...

    Science.gov (United States)

    2012-10-22

    ... individually identifiable health information. In addition, do not include any `` rade secret or any commercial... for attention deficit hyperactivity disorder (``ADHD''). Actavis recently entered this market, joining...

  11. 77: IMPACT OF AN EDUCATIONAL PROGRAM BASED ON HUMAN CARE THEORY (WATSON) ON THE NURSING STUDENTS PERCEPTION OF THE CARE

    National Research Council Canada - National Science Library

    Saeedeh Elhami; Hojat Zareh Houshyari Khah; Khadijeh Moradbeigi; Nasim Hatefi Moadab; Bahman Cheraghian

    2017-01-01

    .... Thus, the present study was performed to assess the caring behavior educational plan on nursing student with the aim of develop the students' ability to become a health care professional staff. Methods...

  12. Exploratory Archeology at the Scott's Lake Site (38CR1) Santee Indian Mound - Ft. Watson Summer 1972

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This is a published report that contains a review of the Institute of Archeology and Anthropology's work relating to the Scott's Lake Site. Exploratory archeological...

  13. Noncanonical structures and their thermodynamics of DNA and RNA under molecular crowding: beyond the Watson-Crick double helix.

    Science.gov (United States)

    Sugimoto, Naoki

    2014-01-01

    How does molecular crowding affect the stability of nucleic acid structures inside cells? Water is the major solvent component in living cells, and the properties of water in the highly crowded media inside cells differ from that in buffered solution. As it is difficult to measure the thermodynamic behavior of nucleic acids in cells directly and quantitatively, we recently developed a cell-mimicking system using cosolutes as crowding reagents. The influences of molecular crowding on the structures and thermodynamics of various nucleic acid sequences have been reported. In this chapter, we discuss how the structures and thermodynamic properties of nucleic acids differ under various conditions such as highly crowded environments, compartment environments, and in the presence of ionic liquids, and the major determinants of the crowding effects on nucleic acids are discussed. The effects of molecular crowding on the activities of ribozymes and riboswitches on noncanonical structures of DNA- and RNA-like quadruplexes that play important roles in transcription and translation are also described. © 2014 Elsevier Inc. All rights reserved.

  14. Systematics and biogeography of Orconectes, subgenus Trisellescens, in the southeastern United States, a test of morphology-based classification

    Science.gov (United States)

    Christopher A. Taylor; Susan B. Adams; Guenter A. Schuster

    2014-01-01

    Diagnosable taxonomic units are fundamental to conservation biology and management of resources and the need for sound science in both fields is more pressing for aquatic ecosystems. Within freshwater crayfishes, the North American genus Orconectes is one of the most diverse in the World. Accurate assessments of species level relationships and species boundaries within...

  15. Resurrecting a subgenus to genus: molecular phylogeny of Euphyllia and Fimbriaphyllia (order Scleractinia; family Euphyllidae; clade V

    Directory of Open Access Journals (Sweden)

    Katrina S. Luzon

    2017-12-01

    Full Text Available Background The corallum is crucial in building coral reefs and in diagnosing systematic relationships in the order Scleractinia. However, molecular phylogenetic analyses revealed a paraphyly in a majority of traditional families and genera among Scleractinia showing that other biological attributes of the coral, such as polyp morphology and reproductive traits, are underutilized. Among scleractinian genera, the Euphyllia, with nine nominal species in the Indo-Pacific region, is one of the groups that await phylogenetic resolution. Multiple genetic markers were used to construct the phylogeny of six Euphyllia species, namely E. ancora, E. divisa, E. glabrescens, E. paraancora, E. paradivisa, and E. yaeyamaensis. The phylogeny guided the inferences on the contributions of the colony structure, polyp morphology, and life history traits to the systematics of the largest genus in Euphyllidae (clade V and, by extension, to the rest of clade V. Results Analyses of cytochrome oxidase 1 (cox1, cytochrome b (cytb, and β-tubulin genes of 36 colonies representing Euphyllia and a confamilial species, Galaxea fascicularis, reveal two distinct groups in the Euphyllia that originated from different ancestors. Euphyllia glabrescens formed a separate group. Euphyllia ancora, E. divisa, E. paraancora, E. paradivisa, and E. yaeyamaensis clustered together and diverged from the same ancestor as G. fascicularis. The 3′-end of the cox1 gene of Euphyllia was able to distinguish morphospecies. Discussion Species of Euphyllia were traditionally classified into two subgenera, Euphyllia and Fimbriaphyllia, which represented a dichotomy on colony structure. The paraphyletic groups retained the original members of the subgenera providing a strong basis for recognizing Fimbriaphyllia as a genus. However, colony structure was found to be a convergent trait between Euphyllia and Fimbriaphyllia, while polyp shape and length, sexuality, and reproductive mode defined the dichotomy better. Species in a genus are distinguished by combining polyp morphology and colony form. The cluster of E. glabrescens of the Euphyllia group is a hermaphroditic brooder with long, tubular tentacles with knob-like tips, and a phaceloid colony structure. The Fimbriaphyllia group, with F. paraancora, F. paradivisa, F. ancora, F. divisa, and F. yaeyamaensis, are gonochoric broadcast spawners with short polyps, mixed types of tentacle shapes, and a phaceloid or flabello-meandroid skeleton. Soft-tissue morphology of G. fascicularis and Ctenella chagius were found to be consistent with the dichotomy. Conclusions The paraphyly of the original members of the previous subgenera justify recognizing Fimbriaphyllia as a genus. The integrated approach demonstrates that combining polyp features, reproductive traits, and skeletal morphology is of high systematic value not just to Euphyllia and Fimbriaphyllia but also to clade V; thus, laying the groundwork for resolving the phylogeny of clade V.

  16. Evolution of fruit traits in Ficus subgenus Sycomorus (Moraceae)

    DEFF Research Database (Denmark)

    Harrison, Rhett D.; Rønsted, Nina; Xu, Lei

    2012-01-01

    constructed using 5 kilobases of DNA sequence data from 63 species (50% of global diversity). In particular, we ask whether patterns of trait correlations are consistent with dispersal agents as the primary selective force shaping morphological diversity or if other ecological factors may provide a better...

  17. Transfer of the Subgenus Davismyia from Wyeomyia to Sabethes and Description of the Type Species, Miamyia Petrocchiae (Diptera: Culicidae)

    Science.gov (United States)

    1990-12-01

    Ponte 1928) gave the following information about these specimens but did not indicate where they were deposited: “Localidad del tipo : Tucuman (Race...337-350. Shannon, R.C. 1930. List of species of argentine Cu- Iicidae. Sexta Reunion de la Sociedad Argentina de Patologia Regional de1 Norte. pp

  18. Contributions to the Mosquito Fauna of Southeast Asia. III. The Genus Aedes, Subgenus Neomacleaya Theobald in Southeast Asia

    Science.gov (United States)

    1968-01-01

    It is probable that there are still several unrecognized species within its geographical range. Very little information on adult bionomics is...skins, from about 4 mi. inland along Balsahan River (near Iwahig), Palawan, PHILIPPINES, in the U.S. National Museum. DISTRIBUTION. So far only known...same locality and date as type. DISTRIBUTION. Specimens examined: MALAYA: Selangor , 8 females, 2 males (USNM), 3 females (Bishop); BURMA: Rangoon

  19. Descriptions of Zavortinkius, a New Subgenus of Aedes, and the Eleven Included Species from the Afrotropical Region (Diptera: Culicidae)

    Science.gov (United States)

    1999-01-01

    19 17; Aders 19 17); leaf axils in palms (Haworth 1924); well-shaded rock pools with decaying leaves (Hopkins 1936); treeholes (Harris 1942...axils, seed pods, gutters, rockholes and steps cut in coconut palms (rare), snail shells, tins and wells (exceptional) (van Someren et al. 1955...maladies transmises et methodes de lutte. Mem. Mus. Natl. d’Histoire Nat., Ser. A, 109: 193-246. Collado, J. G. 1936. Culicidos de la Isla de Fernando

  20. Coetzeemyia, a new subgenus of Aedes, and a Redescription of the Holotype Female of Aedes (Coetzeemyia) fryeri (Theobald) (Diptera: Culicidae)

    Science.gov (United States)

    2010-10-06

    a). Etymology. The subgeneric name, Coetzeemyia, honors Prof. (Dr.) Maureen Coetzee (feminine, formed from her surname and myia, the Greek noun for...specimens in the [MRAC/ (CMT)]; Prof. Maureen Coetzee , Vector Control Reference Unit, National Institute for Communicable Diseases (NICD), Johannesburg