Rubus: A compiler for seamless and extensible parallelism.

Directory of Open Access Journals (Sweden)

Muhammad Adnan

Full Text Available Nowadays, a typical processor may have multiple processing cores on a single chip. Furthermore, a special purpose processing unit called Graphic Processing Unit (GPU, originally designed for 2D/3D games, is now available for general purpose use in computers and mobile devices. However, the traditional programming languages which were designed to work with machines having single core CPUs, cannot utilize the parallelism available on multi-core processors efficiently. Therefore, to exploit the extraordinary processing power of multi-core processors, researchers are working on new tools and techniques to facilitate parallel programming. To this end, languages like CUDA and OpenCL have been introduced, which can be used to write code with parallelism. The main shortcoming of these languages is that programmer needs to specify all the complex details manually in order to parallelize the code across multiple cores. Therefore, the code written in these languages is difficult to understand, debug and maintain. Furthermore, to parallelize legacy code can require rewriting a significant portion of code in CUDA or OpenCL, which can consume significant time and resources. Thus, the amount of parallelism achieved is proportional to the skills of the programmer and the time spent in code optimizations. This paper proposes a new open source compiler, Rubus, to achieve seamless parallelism. The Rubus compiler relieves the programmer from manually specifying the low-level details. It analyses and transforms a sequential program into a parallel program automatically, without any user intervention. This achieves massive speedup and better utilization of the underlying hardware without a programmer's expertise in parallel programming. For five different benchmarks, on average a speedup of 34.54 times has been achieved by Rubus as compared to Java on a basic GPU having only 96 cores. Whereas, for a matrix multiplication benchmark the average execution speedup of 84

Sorbitol, Rubus fruit, and misconception

Science.gov (United States)

It is unclear how the misunderstanding that Rubus fruits (e.g., blackberries, raspberries) are high in sugar alcohol began, or when it started circulating in the United States. In reality, they contain little sugar alcohol. Numerous research groups have reported zero detectable amounts of sugar alco...

Occurrence of nepoviruses in Rubus species in the Czech Republic.

Science.gov (United States)

Spak, J; Kubelková, D; Honetslegrová-Fránová, J

1997-06-01

The occurrence of arabis mosaic virus (AMV), raspberry ringspot virus (RRV), tomato black ring virus (TBRV), strawberry latent ringspot virus (SLRV) and cherry leaf roll virus (CLRV) in cultivated and wild plants of raspberry and blackberry has been studied in the Czech Republic in 1993-1996. Five hundred and seventy samples were collected at 51 localities and assayed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). The results represent the first evidence on the occurrence of AMV, RRV, TBRV and SLRV in cultivated Rubus species in the Czech Republic. Isolates AMV M20 and TBRV ML15 which were successfully transmitted by mechanical inoculation and characterized by reactions of differential host plants and by electron microscopy are the first isolates from Rubus from this territory. CLRV was not detected in either cultivated or wild Rubus species.

Keragaman Rubus di Gunung Kembang Kabupaten Wonosobo Jawa Tengah dan Potensi Pemanfaatannya

Directory of Open Access Journals (Sweden)

Ratna Susandarini

2016-06-01

Full Text Available Rubus is a member of Rosaceae family where its natural habitat is in open areas of lowland and upland forests. Rubus has been reported found in Mount Kembang which is situated in Wonosobo, Central Java, but the number of species was unclear. The objective of this study was to investigate the Rubus diversity in M. Kembang and its uses by local people. Sample collecting was carried out using explorative methods on the slopes of M. Kembang. Uses information was obtained by interviewing the local people. The data were analyzed descriptively to provide species description along with their uses and potential in biological research. The result showed that there were four species of Rubus in M. Kembang, R. rosifolius J.E.Smith, R. chrysophyllus Reinw. Ex Miq., R. fraxinifolius Poir., and R. moluccanus L. with altitudinal distribution ranging from 945 m to 1,387 m above sea level. Among these four species R. rosifolius is the well-known one, that people sell the fruits in its fruiting season in the local market. Based on the literature some Rubus species in other areas in Java have potential as fresh fruits, source for making fruit jam, traditional herbal drink to cure diarrhoea and dysentery, or as ornamental plants. A few studies showed that the fruit extract of R. rosifolius has potential for natural dye in cosmetic products.

Rubus pharmacology: antiquity to the present

Science.gov (United States)

Aeschylus, Hippocrates, Krataeus, Dioscorides, and Galen; Romans: Cato, Ovid, and Pliny the Elder; Asian medicinal traditions, such as the Unani Tibb, traditional Chinese medicine, and the Ayurvedic tradition of India. Folk traditions of native peoples throughout the world have also applied Rubus fo...

Ecologia da polinização da amoreira-preta (Rubus sp (Rosaceae em Timbó-SC, Brasil Pollination ecology of blackberry (Rubus sp. (Rosaceae in Timbo (SC, Brazil

Directory of Open Access Journals (Sweden)

Leônidas João de Mello Junior

2011-09-01

Full Text Available O presente trabalho verificou experimentalmente a ecologia da polinização da amoreira-preta (Rubus sp.. Objetivou-se confirmar a síndrome de polinização de Rubus sp., por meio de análise de seu sistema reprodutivo, quantificação da produção diária de néctar, levantamento da entomofauna que visita as flores da amoreira na área de estudo e análise do seu comportamento polinizador. Os experimentos foram realizados em uma área de cultivo de amoreira-preta, no mês de dezembro de 2005, município de Timbó (SC. Constatou-se que a maior taxa de frutificação (48,3 % ± 3,2 ocorreu via polinização livre, onde os insetos não foram excluídos. Foi verificada a ocorrência de autopolinização, porém com taxa inferior de frutificação (12,2% ± 4,9. A anemofilia não foi constatada na espécie. A avaliação da produção de néctar em Rubus sp. resultou em valores compatíveis com a síndrome de melitofilia. Os visitantes florais coletados e observados sobre as flores de Rubus sp. foram predominantemente abelhas da ordem Hymenoptera (97%, que iniciam, em menor número, a atividade de forrageamento às 8h, com pico de atividade às 12h e declinando até às 16h. As coletas resultaram numa amostragem de 1.360 abelhas, divididas em quatro famílias e 13 espécies. A família com maior riqueza de espécies (N = 7 foi Halictidae e a mais abundante foi Apidae, com 1.288 indivíduos. Em Apidae, houve o predomínio da espécie exótica Apis mellifera, cuja representação na amostra foi de 1.246 indivíduos. Os dados da abundância e as observações naturalísticas do seu comportamento da flor apontaram A. mellifera como o principal polinizador de Rubus sp., mas confirmam que as demais espécies de abelhas também participam na polinização de Rubus sp.The pollination ecology of the blackberry (Rubus sp. was studied by means of determining its reproductive system, the analysis of flower's nectar production. Sampling the insects that visit

Making IBM's Computer, Watson, Human

Science.gov (United States)

Rachlin, Howard

2012-01-01

This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

Alocanthedon, a new subgenus of Chalicodoma from Southeast Asia (Hymenoptera, Megachilidae)

Science.gov (United States)

Engel, Michael S.; Gonzalez, Victor H.

2011-01-01

Abstract A new subgenus, Alocanthedon Engel and Gonzalez subgen. n., is described for five species of unusual Southeast Asian bees in the genus Chalicodoma Lepeletier de Saint Fargeau (Megachilinae: Megachilini). The subgenus is most noteworthy for the deep postgenal depression or furrow in males (bordered outwardly near the base of the mandible by a protuberant, thick lamella) and the presence of a dense patch of black setae posteriorly in the forewing medial cell (except in one species) [resembling the dense patch of setae among the submarginal cells of Thrinchostoma Saussure (Halictidae: Halictinae: Halictini)]. The subgenus is characterized and distinguished from the related Callomegachile Michener. A key to the following five species presently included in the subgenus is provided: Chalicodoma aterrimum (Smith), Chalicodoma atratiforme (Meade-Waldo) comb. n., Chalicodoma memecylonae Engel sp. n., Chalicodoma odontophorum Engel sp. n., and Chalicodoma apoicola Engel sp. n. Chalicodoma (Callomegachile) atratiforme sininsulae (Cockerell) is newly placed in synonymy with C. (C.) fulvipenne (Smith). Species have been collected from Memecylaceae (Myrtales) and Fabaceae (Fabales). The phylogenetic relationships of Alocanthedon among other Megachilini are briefly elaborated upon. PMID:21747670

How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

Science.gov (United States)

Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

2014-04-02

A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

78 FR 43198 - Watson Cogeneration Company; Notice of Filing

Science.gov (United States)

2013-07-19

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...

Phylogenetic relationships among species of Lutzomyia, subgenus Lutzomyia (Diptera: Psychodidae).

Science.gov (United States)

Pinto, Israel S; Filho, José D Andrade; Santos, Claudiney B; Falqueto, Aloísio; Leite, Yuri L R

2010-01-01

Lutzomyia França is the largest and most diverse sand fly genus in the New World and contains all the species involved in the transmission of American visceral leishmaniasis (AVL). Morphological characters were used to test the monophyly and to infer phylogenetic relationships among members of the Lutzomyia subgenus. Fifty-two morphological characters from male and female adult specimens belonging to 18 species of Lu. (Lutzomyia) were scored and analyzed. The resulting phylogeny confirms the monophyly of this subgenus and reveals four main internal clades. These four clades, however, do not support the classification of the subgenus in two series, longipalpis and cavernicola, because neither is necessarily monophyletic. Knowledge on phylogenetic relationships among these relevant vectors of AVL should be used as a tool for monitoring target taxa and a first step for establishing an early warning system for disease control.

Genetic diversity of wild and cultivated Rubus species in Colombia using AFLP and SSR markers

Directory of Open Access Journals (Sweden)

Sandra Bibiana Aguilar

2007-01-01

Full Text Available The Andean blackberry belongs to the genus Rubus, the largest of the Rosaceae family and one of the mostdiverse of the plant kingdom. In Colombia Rubus glaucus Benth, known as the Andean raspberry or blackberry, is one of thenine edible of the genus out of forty-four reported species. In this study wild and cultivated genotypes, collected in the CentralAndes of Colombia were analyzed by AFLP and SSR markers. Sexual reproduction seems to play an important role inmaintaining the genetic variability in R. glaucus, and the viability of using the SSR of Rubus alceifolius to characterizeColombian Rubus species was clearly demonstrated. All species evaluated produced very specific banding patterns,differentiating them from the others. Both AFLP and SSR produced bands exclusive to each of the following species: R.robustus, R. urticifolius, R. glaucus, and R. rosifolius. The SSR markers differentiated diploid and tetraploid genotypes of R.glaucus.

The multiple personalities of Watson and Crick strands.

Science.gov (United States)

Cartwright, Reed A; Graur, Dan

2011-02-08

In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

The multiple personalities of Watson and Crick strands

Directory of Open Access Journals (Sweden)

Graur Dan

2011-02-01

Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

Mistaken identity: Clarification of Rubus coreanus Miquel (bokbunja)

Science.gov (United States)

This chapter was written to target the research communities currently studying (misidentified) native bokbunja (Rubus coreanus Miquel). Most Korean growers and researchers are cultivating or conducting work on R. occidentalis L. (American black raspberries), not R. coreanus. We summarized fruit, pla...

Increased phylogenetic resolution using target enrichment in Rubus

Science.gov (United States)

Phylogenetic analyses in Rubus L. have been challenging due to polyploidy, hybridization, and apomixis within the genus. Wide morphological diversity occurs within and between species, contributing to challenges at lower and higher systematic levels. Phylogenetic inferences to date have been based o...

Andinopanurgus, a new Andean subgenus of Protandrena (Hymenoptera, Andrenidae

Directory of Open Access Journals (Sweden)

Victor Gonzalez

2011-09-01

Full Text Available A new subgenus of Protandrena Cockerell (Panurginae: Protandrenini from South America, Andinopanurgus Gonzalez & Engel, subgen. n., is described and figured for distinctive species of the genus occurring at mid- and high elevations in the Andes from Venezuela to Peru (1100–3400 m. In addition to the distribution, the subgenus is easily distinguished from other subgenera by a unique combination of morphological characters in both sexes, especially in the hidden sterna and genitalia of the male. Protandrena amyae sp. n., and P. femoralis sp. n., are also described and figured from the Ecuadorian and Peruvian Andes. New geographical records and a key to the species are also provided.

Aspergillus subgenus Polypaecilum from the built environment

Directory of Open Access Journals (Sweden)

J.B. Tanney

2017-09-01

Full Text Available Xerophilic fungi, especially Aspergillus species, are prevalent in the built environment. In this study, we employed a combined culture-independent (454-pyrosequencing and culture-dependent (dilution-to-extinction approach to investigate the mycobiota of indoor dust collected from 93 buildings in 12 countries worldwide. High and low water activity (aw media were used to capture mesophile and xerophile biodiversity, resulting in the isolation of approximately 9 000 strains. Among these, 340 strains representing seven putative species in Aspergillus subgenus Polypaecilum were isolated, mostly from lowered aw media, and tentatively identified based on colony morphology and internal transcribed spacer rDNA region (ITS barcodes. Further morphological study and phylogenetic analyses using sequences of ITS, β-tubulin (BenA, calmodulin (CaM, RNA polymerase II second largest subunit (RPB2, DNA topoisomerase 1 (TOP1, and a pre-mRNA processing protein homolog (TSR1 confirmed the isolation of seven species of subgenus Polypaecilum, including five novel species: A. baarnensis, A. keratitidis, A. kalimae sp. nov., A. noonimiae sp. nov., A. thailandensis sp. nov., A. waynelawii sp. nov., and A. whitfieldii sp. nov. Pyrosequencing detected six of the seven species isolated from house dust, as well as one additional species absent from the cultures isolated, and three clades representing potentially undescribed species. Species were typically found in house dust from subtropical and tropical climates, often in close proximity to the ocean or sea. The presence of subgenus Polypaecilum, a recently described clade of xerophilic/xerotolerant, halotolerant/halophilic, and potentially zoopathogenic species, within the built environment is noteworthy.

Phytogeographical Analysis Of Euphorbia Subgenus Esula (Euphorbiaceae

Directory of Open Access Journals (Sweden)

Geltman Dmitry V.

2015-12-01

Full Text Available Euphorbia subg. Esula is one of four major clades within the genus. A geographical analysis of the 466 species in the subgenus is reported here. Every species was assigned to one of 29 geographical elements clustered in ten groups of elements. This geographical analysis showed that the Tethyan group (comprising nine geographical elements clearly dominates the subgenus and contains 260 species (55.79% of the total number of species. The most numerous geographical elements are Irano-Turanian (105 species and Mediterranean (85. Other significant groups of elements are Boreal (91 species, 19.54%, East Asian (40 species, 8.58%, Madrean (26 species, 5.58%, Paleotropical (23 species, 4.94% and South African (16 species, 3.43%. The area of the Tethyan floristic subkingdom is the center of the modern diversity of E. subg. Esula. It is likely that such diversity is the result of intensive speciation that took place during the Eocene–Miocene.

Micropropagation of Rubus and Ribes spp.

Science.gov (United States)

Dziedzic, Ewa; Jagła, Joanna

2013-01-01

Micropropagation is the most appropriate method for large-scale production of Rubus and Ribes spp. The proliferation rate of Rubus spp. differs in shoot tips and nodal segments. The culture media used for raspberry and blackberry propagation are MS-based supplemented with different combination and ratio of plant growth regulators, depending on the stage of culture. The initiation medium containing 0.4 mg L(-1) BA and 0.1 mg L(-1) IBA is used to stabilize shoot cultures. In multiplication media, concentration of cytokinin is doubled. In vitro rooting of shoots is achieved on media supplemented with 1.0 mg L(-1) IBA. Ribes spp. cultures are initiated from shoot tips, meristem, or dormant buds on MS medium supplemented with 2.0 mg L(-1) BA, 0.5 mg L(-1) IBA, and 0.1 mg L(-1) GA(3.) After stabilization of shoot cultures in 3-4-week time, shoot multiplication is carried out on MS medium containing 1.0 mg L(-1) BA and 0.1 mg L(-1) IBA. Shoots 2 cm long are cultured to rooting on a medium amended with 2.0 mg L(-1) IBA and 5.0 mg L(-1) IAA. Rooted plantlets are transferred to universal peat substrate and acclimatized in the greenhouse.

Training IBM Watson using Automatically Generated Question-Answer Pairs

OpenAIRE

Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh

2016-01-01

IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...

Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje

OpenAIRE

Stojić, Igor

2016-01-01

Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...

Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

Science.gov (United States)

Cubero, Elena; Luque, F Javier; Orozco, Modesto

2006-02-01

A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

Science.gov (United States)

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2006-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

Morphological and Genotypic Variations among the Species of the Subgenus Adlerius (Diptera: Psychodidae, Phlebotomus) in Iran.

Science.gov (United States)

Zahraei-Ramazani, Alireza; Kumar, Dinesh; Mirhendi, Hossein; Sundar, Shyam; Mishra, Rajnikan; Moin-Vaziri, Vahideh; Soleimani, Hassan; Shirzadi, Mohammad Reza; Jafari, Reza; Hanafi-Bojd, Ahmad Ali; Shahraky, Sodabe Hamedi; Yaghoobi-Ershadi, Mohammad Reza

2015-06-01

Female sand flies of subgenus Adlerius are considered as probable vectors of visceral leishmaniasis in Iran. The objective of this study was to determine the morphological and genotypic variations in the populations of this subgenus in the country. Sand flies collected using sticky traps from 17 provinces during 2008-2010. The morphometric measurements were conducted with an Ocular Micrometer. Data was analyzed by SPSS. The Cytb gene was used to estimate population genetic diversity and identify the female specimens. UPGMA phenetic tree was used for DNA haplotypes of Cytb gene. Six species of subgenus Adlerius identified from which one species, P. (Adlerius) kabulensis, is new record. The identification key is provided for males. Results revealed the molecular systematic in the species of subgenus Adlerius and determine the relationship of three females of P. comatus, P. balcanicus and P. halepensis. The positions of three females and the males in the UPGMA tree are correct and the similarities among them confirm our results. The branches of each species are not genetically distinct which justify the overlapping morphological characters among them. Molecular sequencing of Cytb-mtDNA haplotypes can be used for female identification for different species of subgenus Adlerius in Iran.

In vitro propagation of Rubus macrocarpus Benth. and Rubus bogotensis Kunth, as an ex situ conservation strategy

Directory of Open Access Journals (Sweden)

Belkys Adriana Pérez-Martínez

2017-01-01

Full Text Available This research aimed to evaluate techniques for in vitro multiplication and rooting and ex vitro adaptation of wild blackberry plants (Rubus bogotensis Benth. and Rubus macrocarpus Kunth. In in vitro phases, the influence of culture media was evaluated based on Murashige & Skoog (MS composition, with or without a 50% reduction in salts, vitamins, and myo-inositol and supplemented or not with benzylaminopurine (BAP, indole acetic acid (IAA, L-cysteine, agar, peat, perlite, and vermiculite. The ex vitro phase was based on a soil, rice husks, peat, and perlite substrate management. After two months of evaluation of the in vitro phases, it was determined that the MS medium at 50% salts, vitamins, and myo-inositol and supplemented with sucrose (15000 mg.l-1 and agar (5000 mg.l-1 was the most suitable for obtaining the highest values of apical length (cm, shoot number, rooting percentage, and root number. In ex vitro adaptation, the acclimation subphase, evaluated during three months, allowed to determine survival rates of 83.33% and 75% for R. macrocarpus and R. bogotensis, respectively. The average increase in stem length (cm was 2.35 cm and 1.30 cm, respectively. In the greenhouse subphase, evaluated for four months, 100% plant survivorship was obtained, and 2.75 cm and 5.31 cm increases in average stem length (cm for R. macrocarpus and R. bogotensis, were determined.

Diversification of Bromelioideae (Bromeliaceae) in the Brazilian Atlantic rainforest: A case study in Aechmea subgenus Ortgiesia.

Science.gov (United States)

Goetze, Márcia; Schulte, Katharina; Palma-Silva, Clarisse; Zanella, Camila M; Büttow, Miriam V; Capra, Fernanda; Bered, Fernanda

2016-05-01

Aechmea subgenus Ortgiesia comprises ca. 20 species distributed in Brazil, Argentina, Paraguay, and Uruguay, with a center of diversity in the Brazilian Atlantic rainforest. We examined interspecific relationships of Ortgiesia based on Amplified Fragment Length Polymorphisms (AFLP). Ninety-six accessions belonging to 14 species of Ortgiesia were sampled, and genotyped with 11 AFLP primer combinations. The neighbor joining (NJ) tree depicted two main genetic groups within Aechmea subgenus Ortgiesia, and four subgroups. The NJ tree showed short internal branches, indicating an overall shallow genetic divergence among Ortgiesia species as expected for the recently radiated subfamily Bromelioideae. Our results suggest that hybridization and/or incomplete lineage sorting may have hampered the reconstruction of interspecific relationships in Aechmea subgenus Ortgiesia. The mapping of petal color (yellow, blue, pink, or white), inflorescence type (simple or compound), and inflorescence shape (ellipsoid, subcylindric, cylindric, or pyramidal) against the NJ tree indicated that these characters are of limited taxonomic use in Aechmea subgenus Ortgiesia due to homoplasy. An analysis of the current distribution of Ortgiesia identified the southern region of the Brazilian Atlantic rainforest, between latitudes of 26° and 27°S, as the center of diversity for the subgenus. Copyright © 2016 Elsevier Inc. All rights reserved.

Morphological and Genotypic Variations among the Species of the Subgenus Adlerius (Diptera: Psychodidae, Phlebotomus in Iran

Directory of Open Access Journals (Sweden)

Alireza Zahraei-Ramazani

2015-10-01

Full Text Available Background: Female sand flies of subgenus Adlerius are considered as probable vectors of visceral leishmaniasis in Iran. The objective of this study was to determine the morphological and genotypic variations in the populations of this subgenus in the country.Methods: Sand flies collected using sticky traps from 17 provinces during 2008–2010. The morphometric measurements were conducted with an Ocular Micrometer. Data was analyzed by SPSS. The Cytb gene was used to estimate population genetic diversity and identify the female specimens. UPGMA phenetic tree was used for DNA haplotypes of Cytb gene.Results: Six species of subgenus Adlerius identified from which one species, P. (Adlerius kabulensis, is new record. The identification key is provided for males. Results revealed the molecular systematic in the species of subgenus Adlerius and determine the relationship of three females of P. comatus, P. balcanicus and P. halepensis.Conclusion: The positions of three females and the males in the UPGMA tree are correct and the similarities among them confirm our results. The branches of each species are not genetically distinct which justify the overlapping morphological characters among them. Molecular sequencing of Cytb-mtDNA haplotypes can be used for female identification for different species of subgenus Adlerius in Iran.

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

Science.gov (United States)

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

Mycotoxins, drugs and other extrolites produced by species in Penicillium subgenus Penicillium

DEFF Research Database (Denmark)

Frisvad, Jens Christian; Smedsgaard, Jørn; Larsen, Thomas Ostenfeld

2004-01-01

extrolite families are reported from the subgenus with an average of 5 extrolite families per species. This is an underestimate as several pigments, volatiles and uncharacterized extrolites are not included in this average. Several reported producers are reidentified and new producers of known extrolites...... species in Penicillium subgenus Penicillium. In most cases these extrolites are produced consistently by all isolates examined in a species. The important antibiotic penicillin is produced by all members of series Chrysogena and P. griseofulvum. The cholesterol-lowering agent compactin is produced by P...

Phytochemical Composition and Biological Activities of Selected Wild Berries (Rubus moluccanus L., R. fraxinifolius Poir., and R. alpestris Blume

Directory of Open Access Journals (Sweden)

Mohd Fadzelly Abu Bakar

2016-01-01

Full Text Available Berries, from the genus Rubus, are among the vital components in a healthy diet. In this study, 80% methanol extracts from the three wild Rubus species (Rubus moluccanus L., Rubus fraxinifolius Poir., and Rubus alpestris Blume were evaluated for their phytochemical contents (total phenolics, flavonoid, anthocyanin, and carotenoid content, antioxidant (DPPH, FRAP, and ABTS assays, antiacetylcholinesterase, and antibacterial activities. GC-MS was used for quantification of naturally occurring phytochemicals. The results showed that R. alpestris contained the highest total phenolic [24.25±0.1 mg gallic acid equivalent (GAE/g] and carotenoid content [21.86±0.63 mg β-carotene equivalents (BC/g], as well as the highest DPPH scavenging and FRAP activities. The highest total flavonoid [18.17±0.20 mg catechin equivalents (CE/g] and anthocyanin content [36.96±0.39 mg cyanidin-3-glucoside equivalents (c-3-gE/g] have been shown by R. moluccanus. For antibacterial assays, R. moluccanus and R. alpestris extracts showed mild inhibition towards Bacillus subtilis, Staphylococcus aureus, Escherichia coli, and Salmonella enteritidis. Anticholinesterase activity for all extracts was in the range of 23–26%. The GC-MS analysis revealed the presence of at least 12, 21, and 7 different organic compounds in 80% methanol extracts of R. alpestris, R. moluccanus, and R. fraxinifolius, respectively, which might contribute to the bioactivity.

An oil-soluble extract of Rubus idaeus cells enhances hydration and water homeostasis in skin cells.

Science.gov (United States)

Tito, A; Bimonte, M; Carola, A; De Lucia, A; Barbulova, A; Tortora, A; Colucci, G; Apone, F

2015-12-01

Raspberry plants, belonging to the species of Rubus idaeus, are known for their excellent therapeutic properties as they are particularly rich in compounds with strong antioxidant activity, which promote health and well-being of human cells. Besides their high content of phenolic compounds, Rubus plants are rich in oil-soluble compounds, which are also primary components of the hydrolipidic film barrier of the skin. As plant cell cultures represented a valuable system to produce interesting compounds and ingredients for cosmetic applications, we developed liquid suspension cultures from Rubus idaeus leaves and used them to obtain an active ingredient aimed at improving hydration and moisturization capacity in the skin. Rubus idaeus cells, grown in the laboratory under sterile and controlled conditions as liquid suspension cultures, were processed to obtain an oil-soluble (liposoluble) extract, containing phenolic compounds and a wide range of fatty acids. The extract was tested on cultured keratinocytes and fibroblasts and then on the skin in vivo, to assess its cosmetic activities. When tested on skin cell cultures, the extract induced the genes responsible for skin hydration, such as aquaporin 3, filaggrin, involucrin and hyaluronic acid synthase, and stimulated the expression and the activity of the enzyme glucocerebrosidase, involved in ceramide production. Moreover, the liposoluble extract increased the synthesis of the extracellular matrix components in cultured fibroblasts and showed a remarkable skin-hydrating capacity when tested on human skin in vivo. Thanks to these activities, the Rubus idaeus liposoluble extract has several potential applications in skin care cosmetics: it can be used as hydrating and moisturizing ingredient in face and body lotions, and as anti-ageing product in face creams specifically designed to fight wrinkle formation. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Replication infidelity via a mismatch with Watson-Crick geometry.

Science.gov (United States)

Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

2011-02-01

In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

A Challenge to Watson

Science.gov (United States)

Detterman, Douglas K.

2011-01-01

Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

Ed Watson - 1940-2006

CERN Multimedia

2006-01-01

Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...

Taxonomic study of Festuca L. subgenus Schedonorus (P. Beauv. Peterm. in Iran

Directory of Open Access Journals (Sweden)

Sayed Zabihollah Hosseini

2013-11-01

Full Text Available This study was based upon a taxonomic review of the subgenus Schedonorus in Iran. A collection of 30 specimens belonging to the herbaria: W, B and HUI (herbarium of the University of Isfahan were studied. Based on the results of this study, this subgenus included three species: Festuca arundinacea, F. gigantea and F. pratensis in Iran. Furthermore, this study showed that F. arundinacea, occured in this country with two subspecies: orientalis (Hack. Tzvelev and fenas (Lag. Arcang. with the greatest area of distribution compared to the other two species. Our examination of the type specimen of F. elatior subsp. pratensis var. elbursiana confirmed its synonymy with F. arundinacea.

Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities

Science.gov (United States)

Kidd, Gary R.

2004-05-01

Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.

78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

Science.gov (United States)

2013-03-20

... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...

Physicochemical and Sensory Characteristics of Sponge Cakes with Rubus coreanus Powder.

Science.gov (United States)

Lee, Jun Ho

2015-09-01

To develop new type of sponge cake, the effects of partial (0~40%) replacement with Rubus coreanus powder (RCP) on the quality characteristics of sponge cakes were investigated. The pH level and moisture content ranged from 4.05~8.23 and 28.49~36.59, respectively, and significantly decreased upon addition of RCP (PBaking loss rate and cake firmness significantly increased with higher RCP content in the formulation, whereas morphological characteristics of cakes such as height, volume, and symmetry indices significantly decreased (P<0.05). For crumb color values, L*- and b*-values significantly decreased while a*-value significantly increased as a result of RCP substitution (P<0.05). Hedonic sensory results indicated that sponge cakes supplemented with 30~40% RCP showed the most favorable acceptance scores for most of the sensory attributes evaluated. Overall, Rubus coreanus sponge cake could be developed with comparable physicochemical qualities without sacrificing consumer acceptability.

78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

Science.gov (United States)

2013-10-25

... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...

Bio-accumulation of copper, zinc, iron and manganese in oyster Saccostrea cucullata, Snail Cerithium rubus and Clam Tellina angulata from the Bombay coast

Digital Repository Service at National Institute of Oceanography (India)

Krishnakumari, L.; Nair, V.R; Moraes, C.

accumulation was high in S. cucullata, manganese in C. rubus and iron in T. angulata. Similarly, copper and zinc in S. cucullata and copper in C. rubus were found occasionally higher than accepted health standards...

Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory

International Nuclear Information System (INIS)

Geltman, S.

1996-01-01

Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society

On the scaling limits of Galton Watson processes in varying environment

NARCIS (Netherlands)

Bansaye, V.; Simatos, F.

2011-01-01

Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition

Cytogeography and chromosome evolution of subgenus Tridentatae of Artemisia (Asteraceae)

Science.gov (United States)

E. Durant McArthur; Stewart C. Sanderson

1999-01-01

The subgenus Tridentatae of Artemisia (Asteraceae: Anthemideae) is composed of 11 species of various taxonomic and geographic complexities. It is centered on Artemisia tridentata with its three widespread common subspecies and two more geographically confined ones. Meiotic chromosome counts on pollen mother cells...

Sommerfeld-Watson transformation for nuclear fission

International Nuclear Information System (INIS)

Alexandru, G.

1978-01-01

It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)

ANÁLISIS DE LA DIVERSIDAD GENÉTICA DE LA MORA (Rubus spp. EN EL DEPARTAMENTO DE BOYACÁ

Directory of Open Access Journals (Sweden)

MÓNICA YADIRA DOTOR ROBAYO

2016-12-01

Full Text Available A simple of 21 Rubus spp genetic ecotypes were characterized using markers Random Microsatellite RAMs. The seven primers produced a total of 160 polymorphic bands with molecular weights between 350 and 1500 Kb. RAMs analysis at a level of 55% similarity distinguished the population into five groups generally agree to the site where the ecotypes were collected. The number of polymorphic loci ranged from 16 (ACA to 27 (CGA. For the total population the percentage of polymorphic loci and the expected average heterozygosity (He were 88% and 0,29, respectively, much lower than values found in other genetic diversity studies in the genus Rubus. Therefore, strategies must be found to increase genetic variability. The coefficient of genetic differentiation (Fst obtained in evaluating ecotypes Rubus, with seven RAMs microsatellite markers was 0,29 with a standard deviation of 0,03, values showing high genetic differentiation, which is associated with the level of population structure it tends to stabilize

The role of wing geometric morphometrics in the identification of sandflies within the subgenus Lutzomyia.

Science.gov (United States)

Giordani, B F; Andrade, A J; Galati, E A B; Gurgel-Gonçalves, R

2017-12-01

The Lutzomyia subgenus (Diptera: Psychodidae) includes sibling species with morphologically indistinguishable females. The aims of this study were to analyse variations in the size and shape of wings of species within the Lutzomyia subgenus and to assess whether these analyses might be useful in their identification. Wings (n = 733) of 18 species deposited in Brazilian collections were analysed by geometric morphometrics, using other genera and subgenera as outgroups. Shape variation was summarized in multivariate analyses and differences in wing size among species were tested by analysis of variance. The results showed significant variation in the sizes and shapes of wings of different Lutzomyia species. Two clusters within the Lutzomyia subgenus were distinguished in analyses of both males and females. In Cluster 1 (Lutzomyia ischnacantha, Lutzomyia cavernicola, Lutzomyia almerioi, Lutzomyia forattinii, Lutzomyia renei and Lutzomyia battistinii), scores for correct reclassification were high (females, kappa = 0.91; males, kappa = 0.90), whereas in Cluster 2 (Lutzomyia alencari, Lutzomyia ischyracantha, Lutzomyia cruzi, Lutzomyia longipalpis, Lutzomyia gaminarai and Lutzomyia lichyi), scores for correct reclassification were low (females, kappa = 0.42; males, kappa = 0.48). Wing geometry was useful in the identification of some species of the Lutzomyia subgenus, but did not allow the identification of sibling species such as L. longipalpis and L. cruzi. © 2017 The Royal Entomological Society.

Ecologia da polinização da amoreira-preta (Rubus sp (Rosaceae em Timbó-SC, Brasil

Directory of Open Access Journals (Sweden)

Leônidas João de Mello Junior

2011-09-01

Full Text Available O presente trabalho verificou experimentalmente a ecologia da polinização da amoreira-preta (Rubus sp.. Objetivou-se confirmar a síndrome de polinização de Rubus sp., por meio de análise de seu sistema reprodutivo, quantificação da produção diária de néctar, levantamento da entomofauna que visita as flores da amoreira na área de estudo e análise do seu comportamento polinizador. Os experimentos foram realizados em uma área de cultivo de amoreira-preta, no mês de dezembro de 2005, município de Timbó (SC. Constatou-se que a maior taxa de frutificação (48,3 % ± 3,2 ocorreu via polinização livre, onde os insetos não foram excluídos. Foi verificada a ocorrência de autopolinização, porém com taxa inferior de frutificação (12,2% ± 4,9. A anemofilia não foi constatada na espécie. A avaliação da produção de néctar em Rubus sp. resultou em valores compatíveis com a síndrome de melitofilia. Os visitantes florais coletados e observados sobre as flores de Rubus sp. foram predominantemente abelhas da ordem Hymenoptera (97%, que iniciam, em menor número, a atividade de forrageamento às 8h, com pico de atividade às 12h e declinando até às 16h. As coletas resultaram numa amostragem de 1.360 abelhas, divididas em quatro famílias e 13 espécies. A família com maior riqueza de espécies (N = 7 foi Halictidae e a mais abundante foi Apidae, com 1.288 indivíduos. Em Apidae, houve o predomínio da espécie exótica Apis mellifera, cuja representação na amostra foi de 1.246 indivíduos. Os dados da abundância e as observações naturalísticas do seu comportamento da flor apontaram A. mellifera como o principal polinizador de Rubus sp., mas confirmam que as demais espécies de abelhas também participam na polinização de Rubus sp.

Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

Science.gov (United States)

Digdon, Nancy; Powell, Russell A; Harris, Ben

2014-11-01

In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

OpenAIRE

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2005-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...

How the challenge of explaining learning influenced the origins and development of John B. Watson's behaviorism.

Science.gov (United States)

Rilling, M

2000-01-01

Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.

Graham Watson: Eesti vajab enam riigi sekkumist majandusse

Index Scriptorium Estoniae

Watson, Graham

2009-01-01

18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse

From theory to practice: caring science according to Watson and Brewer.

Science.gov (United States)

Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

2009-10-01

Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

Studies of Lactarius from Mexico: a new species in subgenus Piperites

NARCIS (Netherlands)

Montoya, L.; Bandala, V.M.; Moreno, G.

1998-01-01

Lactarius lacteolutescens is described as a new member in subgenus Piperites subsect. Croceini. It was found growing in a mixed forest of Pinus spp. and Abies hickellii, at Mt. Cofre de Perote, Central Region of the State of Veracruz (Gulf Area, Mexico).

Oncologists partner with Watson on genomics.

Science.gov (United States)

2015-08-01

A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

Did John B. Watson Really "Found" Behaviorism?

Science.gov (United States)

Malone, John C

2014-05-01

Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.

Molecular differentiation of Culicoides biting midges (Diptera: Ceratopogonidae) from the subgenus Culicoides Latreille in Denmark

DEFF Research Database (Denmark)

Lassen, S. B.; Nielsen, S. Achim; Skovgård, H.

2012-01-01

complexes are hard to distinguish. We evaluated the use of the mitochondrial DNA cytochrome oxidase I gene (COI) barcode region in the identification of species within the subgenus Culicoides. COI barcode sequence divergence within species was ... impunctatus, and Culicoides grisescens. Additionally, this study confirms the existence of Culicoides halophilus as a valid taxon and presents the first Culicoides deltus barcode sequences. Three additional groups of specimens were identified: Culicoides dk1 with a COI barcode diverging by 14.3% to 17.2% from...... other subgenus Culicoides species and Culicoides Kalix and Culicoides dk3, which diverged by 5.9% from each other and showed 12.5% to 17.6% divergence in COI barcode to subgenus Culicoides specimens....

Evaluation of the Nutraceutical and Cosmeceutical Potential of Two Cultivars of Rubus fruticosus L. under Different Cultivation Conditions.

Science.gov (United States)

Papaioanou, Maria; Chronopoulou, Evangelia G; Ciobotari, Gheorghii; Efrose, Rodica C; Sfichi-Duke, Liliana; Chatzikonstantinou, Marianna; Pappa, Evangelia; Ganopoulos, Ioannis; Madesis, Panagiotis; Nianiou-Obeidat, Irini; Zeng, Taofen; Labrou, Nikolaos E

2017-01-01

The starting point for the development of new, functional products derived from Rubus fruticosus L. is to determine the optimal cultivation conditions that produce maximal yield of fruits containing desirable bioactive properties. Towards that goal, the effect of soil, soil/peat mixture and light intensity on the nutraceutical and cosmeceutical potential of two cultivars ('Thornfree' and 'Loch Ness') of Rubus fruticosus L. were evaluated. The assessment was carried out employing a range of methods for evaluating fruit properties associated with promoting good health such as total antioxidant capacity, secondary metabolites content (vitamin C, polyphenols, flavonoids and anthocyanins) and inhibition analysis of skin-regulating enzymes. 'Thornfree' cultivar produced fruits in all light conditions, while 'Loch Ness' did not produce fruits in low light conditions. The results showed that in Rubus fruticosus L. fruit, the chemical composition and bioactivity are strongly affected by both genetics factors and growing conditions. Extract from 'Thornfree' fruits obtained under low light and soil/peat conditions displayed superior properties such as high antioxidant capacity, high concentrations of phenolics, flavonoids and anthocyanins and high inhibitory potency towards the enzymes tyrosinase and elastase. This extract was used for the development of a topical skin care cream with excellent compatibility and stability. Our findings conclude that Rubus fruticosus L. cultivation may be efficiently and effectively manipulated through conventional cultivation techniques to produce promising bioactive ingredients with potential use in commercial cosmetics and pharmaceuticals. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

Science.gov (United States)

Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

2007-01-01

In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

On the West-African species of the subgenus Eupalaemon Ortm

NARCIS (Netherlands)

Man, de J.G.

1911-01-01

In addition to my description of Palaemon (Eupalaemon) Lenzii de Man (see p. 225 of this volume) I give here a key to the species of the subgenus Eupalaemon Ortm. as yet known to occur in the rivers of West-Africa. Six species are at present known from there, viz.: 1. Pal. (Eupalaemon) macrobrachion

[From humanism to nihilism: dialectics on Jean Watson's caring theory].

Science.gov (United States)

Krol, Pawel J; Lavoie, Mireille

2015-09-01

nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

Phylogeny of osmophillic aspergilli (subgenus Aspergillus) and taxonomic revision of section Restricti

Science.gov (United States)

Aspergillus section Restricti together with sister sect. Aspergillus (formerly Eurotium) comprises osmophilic species, that are able to grow on substrates with low water activity and in extreme environments. We addressed the monophyly of both sections within subgenus Aspergillus and applied multidis...

Ethnobotanical review of wild edible plants of Slovakia

Directory of Open Access Journals (Sweden)

Łukasz Łuczaj

2012-11-01

Full Text Available This paper is an ethnobotanical review of wild edible plants gathered for consumption from the 19th century to the present day, within the present borders of Slovakia. Twenty-four sources (mainly ethnographic documenting the culinary use of wild plants were analysed. The use of 106 species (over 3% of the Slovak flora has been recorded. Nowadays most of them are no longer used, or used rarely, apart from a few species of wild fruits. The most frequently used plants include the fruits of Rubus idaeus, Fragaria spp., Rubus subgenus Rubus, Vaccinium myrtillus, V. vitis-idaea, Fagus sylvatica, Corylus avellana, Prunus spinosa, Pyrus spp., Malus spp., Crataegus spp. and the leaves of Urtica dioica, Rumex acetosa, Chenopodiaceae species, Cardamine amara, Glechoma spp., Taraxacum spp. and Oxalis acetosella. The most commonly used wild food taxa are nearly identical to those used in Poland, and the same negative association of wild vegetables with famine exists in Slovakia, resulting in their near complete disappearance from the present-day diet.

77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2012-11-13

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

Science.gov (United States)

2013-06-04

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

A history of the term radical behaviorism: From Watson to Skinner

Science.gov (United States)

Schneider, Susan M.; Morris, Edward K.

1987-01-01

This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958

Watson's theorem and resonant pion photoproduction amplitude in the delta channel

International Nuclear Information System (INIS)

Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.

1984-01-01

The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)

A new species of Cladotanytarsus (Lenziella) from Oregon supports the systematic concept of the subgenus (Diptera: Chironomidae).

Science.gov (United States)

Puchalski, Mateusz; Giłka, Wojciech

2017-05-18

A new species of the genus Cladotanytarsus Kieffer, 1921 and the small subgenus Lenziella Kieffer, 1922 is described from Southern Oregon, USA. The adult male of C. (L.) glaber Giłka et Puchalski, sp. nov., featuring tibial lobes armed with dense setae and a large globular swelling of the hypopygial inferior volsella, supports the recently defined systematic concept for Lenziella. This subgenus is known from seven species distributed in the Northern Hemisphere (1 European, 1 Palaearctic and 5 Nearctic), the males of which are included in an updated identification key.

Watson's behaviorism: a comparison of the two editions (1925 and 1930).

Science.gov (United States)

Carpintero, Helio

2004-05-01

J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.

Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

Science.gov (United States)

Doyle-Lindrud, Susan

2015-02-01

IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

A conversation with Geoff Watson

OpenAIRE

Beran, R. J.; Fisher, N. I.

1998-01-01

Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...

Anthocyanins, phenolics, and antioxidant capacity in diverse small fruits: vaccinium, rubus, and ribes.

Science.gov (United States)

Moyer, Richard A; Hummer, Kim E; Finn, Chad E; Frei, Balz; Wrolstad, Ronald E

2002-01-30

Fruits from 107 genotypes of Vaccinium L., Rubus L., and Ribes L., were analyzed for total anthocyanins (ACY), total phenolics (TPH), and antioxidant capacities as determined by oxygen radical absorbing capacity (ORAC) and ferric reducing antioxidant power (FRAP). Fruit size was highly correlated (r = 0.84) with ACY within Vaccinium corymbosum L., but was not correlated to ACY across eight other Vaccinium species, or within 27 blackberry hybrids. Certain Vaccinium and Ribes fruits with pigmented flesh were lower in ACY, TPH, ORAC, and FRAP compared to those values in berries with nonpigmented flesh. ORAC values ranged from 19 to 131 micromol Trolox equivalents/g in Vaccinium, from 13 to 146 in Rubus, and from 17 to 116 in Ribes. Though ACY may indicate TPH, the range observed in ACY/TPH ratios precludes prediction of ACY from TPH and vice versa for a single genotype. In general, TPH was more highly correlated to antioxidant capacity than ACY was. This study demonstrates the wide diversity of phytochemical levels and antioxidant capacities within and across three genera of small fruit.

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Sphincterochilidae from Tunisia, with a note on the subgenus Rima Pallary, 1910 (Gastropoda, Pulmonata

Directory of Open Access Journals (Sweden)

Intidhar Abbes

2011-12-01

Full Text Available In order to establish an updated checklist of terrestrial gastropod from Tunisia, a revision of the species of Sphincterochilidae is presented, using bibliographic and museum records and the results of our own field work. As a result, only two species, Sphincterochila candidissima and S. tunetana, are accepted to occur in Tunisia, and their type specimens are illustrated. The study of the morphological characters of the genital organs of both species clarified their subgeneric affiliation. Comparison of S. tunetana with S. cariosa from Lebanon showed that the first has to be classified within the subgenus Albea, and the latter within Sphincterochila s. str.; the subgenus Rima Pallary, 1910 remains in the synonymy of Sphincterochila s. str. Bibliographic records of S. baetica and S. otthiana from Tunisia could not be confirmed, the latter probably lives close to the border with Algeria.

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Elementary? Question Answering, IBM's Watson, and the Jeopardy ...

Indian Academy of Sciences (India)

IAS Admin

One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...

Phylogeography, population structure and evolution of coral-eating butterflyfishes (Family Chaetodontidae, genus Chaetodon , subgenus Corallochaetodon )

KAUST Repository

Waldrop, Ellen; Hobbs, Jean-Paul A.; Randall, John E.; DiBattista, Joseph; Rocha, Luiz A.; Kosaki, Randall K.; Berumen, Michael L.; Bowen, Brian W.

2016-01-01

This study compares the phylogeography, population structure and evolution of four butterflyfish species in the Chaetodon subgenus Corallochaetodon, with two widespread species (Indian Ocean – C. trifasciatus and Pacific Ocean – C. lunulatus

Saccharomyces cerevisiae Mixed Culture of Blackberry (Rubus ulmifolius L.) Juice: Synergism in the Aroma Compounds Production

OpenAIRE

Bautista-Rosales, Pedro Ulises; Ragazzo-Sánchez, Juan Arturo; Ruiz-Montañez, Gabriela; Ortiz-Basurto, Rosa Isela; Luna-Solano, Guadalupe; Calderón-Santoyo, Montserrat

2014-01-01

Blackberry (Rubus sp.) juice was fermented using four different strains of Saccharomyces cerevisiae (Vitilevure-CM4457, Enoferm-T306, ICV-K1, and Greroche Rhona-L3574) recognized because of their use in the wine industry. A medium alcoholic graduation spirit (

Relativistic generalisation of the Kroll-Watson formula

International Nuclear Information System (INIS)

Kaminski, J.Z.

1985-01-01

The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

Nitrogen fertilization interacts with light to increase Rubus spp. cover in a temperate forest

Science.gov (United States)

Christopher A. Walter; Devon T. Raiff; Mark B. Burnham; Frank S. Gilliam; Mary Beth Adams; William T. Peterjohn

2016-01-01

Nitrogen additions have caused species composition changes in many ecosystems by facilitating the growth of nitrophilic species. After 24 years of nitrogen fertilization in a 40 year-old stand at the Fernow Experimental Forest (FEF) in Central Appalachia, USA, the cover of Rubus spp. has increased from 1 to 19 % of total herbaceous-layer cover....

A comparative study of the second-order Born and Faddeev-Watson approximations for electron-atom collisions

International Nuclear Information System (INIS)

Fargher, H.E.; Roberts, M.J.

1983-01-01

Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)

Compostos bioativos presentes em amora-preta (Rubus spp. Bioactive compounds of blackberry fruits (Rubus spp. grown in Brazil

Directory of Open Access Journals (Sweden)

Daniela Souza Ferreira

2010-09-01

Full Text Available A amora-preta (Rubus spp., pequena fruta de clima temperado, possui coloração atraente, variando do vermelho púrpura ao azul, devido ao elevado teor de antocianinas. As antocianinas, juntamente com os carotenoides, compõem os pigmentos naturais, majoritários encontrados em diversas frutas. Diversos estudos têm relatado a importância destes pigmentos naturais como protetores e/ou inibidores de doenças degenerativas, porém são escassos os estudos sobre compostos bioativos presentes em amora-preta cultivada no Brasil. Os objetivos do presente estudo foram identificar as antocianinas e os carotenoides presentes em amora-preta, determinar os conteúdos totais de compostos fenólicos, carotenoides, flavonoides, antocianinas totais, monoméricas, poliméricas e copigmentadas, e a capacidade antioxidante frente aos radicais livres ABTS e DPPH. O teor total de carotenoides foi baixo (86,5 ± 0,2 µg/100 g, com all-trans-β-caroteno (39,6 % e all-trans-luteína (28,2 % como os majoritários. As amoras-pretas apresentaram elevado potencial antioxidante principalmente pelo teor representativo de antocianinas monoméricas (104,1 ± 1,8 mg/100 g de fruto, presença de antocianinas poliméricas (22,9 ± 0,4 %, baixa porcentagem de antocianinas copigmentadas (1,6 ± 0,1 % e altos teores de compostos fenólicos (241,7 ± 0,8 mg equivalente de ácido gálico/100 g e de flavonoides totais (173,7 ± 0,7 mg equivalente de catequina/100 g. Cianidina 3-glucosídeo foi a antocianina majoritária (92,9 %. Diante destes resultados, a amora-preta pode ser considerada uma fonte natural rica em antioxidantes e pigmentos.The blackberry (Rubus spp., a small fruit grown in temperate climate, shows an attractive color ranging from purple red to blue, due to the high content of anthocyanins. The anthocyanins, along with carotenoids, are the major natural pigments found in several fruits. Many studies have reported the importance of these natural pigments as protectors

Phytochemicals in blackberry/ Fitoquímicos em amora-preta (Rubus spp

Directory of Open Access Journals (Sweden)

Rui Carlos Zambiazi

Full Text Available Among the options for fruit species with market prospects, the blackberry (Rubus spp stands out as one of the most promising. This is a species that has shown an increase of cultivated area in recent years in Rio Grande do Sul (main Brazilian producer. Regular consumption of fruits and vegetables is associated with low risk of incidence and mortality from cancer and heart disease due to the presence of compounds derived from secondary metabolism, especially flavonoids and anthocyanins, which have great capacity to react with free radicals that cause oxidative stress, and therefore contribute to the prevention of these diseases. The phenolic acids and flavonoids were identificated in the group of phenolic compounds in blackberry. Among the flavonoids, stands out the anthocyanins, which vary in concentration according to the stage of maturation of fruits. Based on the antocyanin content related in literature and the great variation between different genetic materials, there is great potential in the production of blackberry and its utilization as a natural colorant in the food and pharmaceuticals industry. In addition to these compounds, the blackberry also has other phytochemicals such as vitamin C, vitamin E and carotenoids. This paper aims to review literature of the main phytochemicals in blackberry (Rubus spp.Dentre as opções de espécies frutíferas com perspectivas de comercialização, a amoreira-preta (Rubus spp se destaca como uma das mais promissoras. Esta é uma das espécies que tem apresentado um crescimento de área cultivada nos últimos anos no Rio Grande do Sul (principal produtor brasileiro. O consumo regular de frutas e hortaliças está associado com o baixo risco de incidência e mortalidade por câncer e doenças cardíacas, devido à presença de compostos oriundos do metabolismo secundário, especialmente flavonóides e antocianinas, os quais apresentam grande capacidade de reagir com radicais livres que causam estresse

Mistaken Identity: Clarification of Rubus coreanus Miquel (Bokbunja

Directory of Open Access Journals (Sweden)

Jungmin Lee

2014-07-01

Full Text Available In the U.S., there has been a recent surge in Korean black raspberry products available and in the number of reports about this species appearing in the scientific literature. Despite this, the majority of products sold and the work carried out has been on Rubus occidentalis L., not R. coreanus Miquel. The importance of accurate recognition of all starting material is multiplied for research downstream, including genetics/genomics, plant breeding, phenolic identification, food processing improvements and pharmacokinetic investigations. An overview of distinguishing characteristics separating R. coreanus from R. occidentalis will be presented. Research conducted on correctly identified fruit will also be summarized to aid future studies that might showcase the unique qualities that bokbunja can offer.

First a hero of science and now a martyr to science: the James Watson Affair - political correctness crushes free scientific communication.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and

Chromosome-scale scaffolding of the black raspberry (Rubus occidentalis L.) genome based on chromatin interaction data

Science.gov (United States)

Black raspberry (Rubus occidentalis L.) is a niche fruit crop valued for its flavour and potential health benefits. The improvement of fruit and cane characteristics via molecular breeding technologies has been hindered by the lack of a high-quality reference genome. The recently released draft geno...

The form of electron-atom excitation amplitudes at high momentum transfers in the Faddeev-Watson approximation

International Nuclear Information System (INIS)

Catalan, G.; Roberts, M.J.

1979-01-01

A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)

O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante

Directory of Open Access Journals (Sweden)

Cláudio Ivan de Oliveira

Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.

A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3

International Nuclear Information System (INIS)

Roberts, M.J.

1988-01-01

Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)

[Polymorphism of KPI-A genes from plants of the subgenus Potatoe (sect. Petota, Estolonifera and Lycopersicum) and subgenus Solanum].

Science.gov (United States)

Krinitsyna, A A; Mel'nikova, N V; Belenikin, M S; Poltronieri, P; Santino, A; Kudriavtseva, A V; Savilova, A M; Speranskaia, A S

2013-01-01

Kunitz-type proteinase inhibitor proteins of group A (KPI-A) are involved in the protection of potato plants from pathogens and pests. Although sequences of large number of the KPI-A genes from different species of cultivated potato (Solanum tuberosum subsp. tuberosum) and a few genes from tomato (Solanum lycopersicum) are known to date, information about the allelic diversity of these genes in other species of the genus Solanum is lacking. In our work, the consensus sequences of the KPI-A genes were established in two species of subgenus Potatoe sect. Petota (Solanum tuberosum subsp. andigenum--5 genes and Solanum stoloniferum--2 genes) and in the subgenus Solanum (Solanum nigrum--5 genes) by amplification, cloning, sequencing and subsequent analysis. The determined sequences of KPI-A genes were 97-100% identical to known sequences of the cultivated potato of sect. Petota (cultivated potato Solanum tuberosum subsp. tuberosum) and sect. Etuberosum (S. palustre). The interspecific variability of these genes did not exceed the intraspecific variability for all studied species except Solanum lycopersicum. The distribution of highly variable and conserved sequences in the mature protein-encoding regions was uniform for all investigated KPI-A genes. However, our attempts to amplify the homologous genes using the same primers and the genomes of Solanum dulcamarum, Solanum lycopersicum and Mandragora officinarum resulted in no product formation. Phylogenetic analysis of KPI-A diversity showed that the sequences of the S. lycopersicum form independent cluster, whereas KPI-A of S. nigrum and species of sect. Etuberosum and sect. Petota are closely related and do not form species-specific subclasters. Although Solanum nigrum is resistant to all known races of economically one of the most important diseases of solanaceous plants oomycete Phytophthora infestans aminoacid sequences encoding by KPI-A genes from its genome have nearly or absolutely no differences to the same from

Two new species of the acifer species group of Polypedilum subgenus Tripodura Townes from China (Diptera: Chironomidae).

Science.gov (United States)

Zhang, Ruilei; Song, Chao; Wang, Liqing; Wang, Xinhua

2015-02-13

Polypedilum (Tripodura) falcatum sp. n. and P. (T.) procerum sp. n. of the acifer species group of Polypedilum subgenus Tripodura Townes are described and illustrated as male imagines from China. The male adult of P. (T.) falcatum sp. n. is distinguished by the presence of two faint markings on wing; short and interrupted abdominal tergite bands; the sickle-like superior volsella bearing 0-2 outer setae and a tuft of short setae on its apex. The male adult of P. (T.) procerum sp. n. differs in having short abdominal tergite bands; a long, slender and apically curved superior volsella; a high fore leg ratio (2.30-2.33). A key to known male imagines of Polypedilum subgenus Tripodura from China is presented.

Taxonomic study on the subgenus Uresipedilum (Diptera: Chironomidae: Polypedilum, with description of a new species from the Yaewyama Islands, Okinawa, Japan

Directory of Open Access Journals (Sweden)

Nao Yamamoto

2015-07-01

Full Text Available As a result of a multi-year survey, we recognized four species including a new species of the subgenus Uresipedilum from the Yaeyama Islands, the Ryukyus, Japan. Polypedilum (Uresipedilum paraconvictum sp. nov. is described. P. (U. classiglobum Zhang et Wang (2004 P. (U. bingoparadoxum Kawai et al. (1998 and P. (U. iriofegeum Sasa et Suzuki (2000 are re-described. The first species is newly recorded from Japan, and the second species is new to the Ryukyus. The diagnostic characters of the subgenus are discussed.

The Game is aFoot, Watson: DeepQA systems and the future of HCI

OpenAIRE

Keates, Simeon; Varker, Philip

2012-01-01

In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...

A comment on Watson, Deary, and Austin and Watson, Roberts, Gow, and Deary : How to investigate whether personality items form a hierarchical scale?

NARCIS (Netherlands)

Meijer, Rob R.

I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..

Optimizing shoot culture media for Rubus germplasm: the effects of NH4+, NO3-, and total nitrogen

Science.gov (United States)

The nitrogen components of Murashige and Skoog (MS) medium were significant factors for improved growth in our earlier study that modeled the effects of mineral nutrition on growth and development of micropropagated red raspberry(Rubus idaeus L.). In this study, a mixture component design was applie...

Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

Science.gov (United States)

Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

2017-07-01

The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

Watson-Crick hydrogen bonding of unlocked nucleic acids

DEFF Research Database (Denmark)

Langkjær, Niels; Wengel, Jesper; Pasternak, Anna

2015-01-01

We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....

Watson, Skinner y Algunas Disputas dentro del Conductismo

Directory of Open Access Journals (Sweden)

RICARDO PELLÓN SUÁREZ DE PUGA

2013-01-01

Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.

IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

Science.gov (United States)

Chen, Ying; Elenee Argentinis, J D; Weber, Griff

2016-04-01

Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Review of Cycadophila Xu, Tang & Skelley (Coleoptera: Erotylidae: Pharaxonothinae) inhabiting Cycas (Cycadaceae) in Asia, with descriptions of a new subgenus and thirteen new species.

Science.gov (United States)

Skelley, Paul; Xu, Guang; Tang, William; Lindström, Anders J; Marler, Thomas; Khuraijam, Jibankumar Singh; Singh, Rita; Radha, P; Rich, Stephen

2017-05-12

The genus Cycadophila Xu, Tang & Skelley (Coleoptera: Erotylidae: Pharaxonothinae) associated with Cycas L. (Cycadacaeae) in Asia is reviewed. Strobilophila, new subgenus, with five species is described: Cycadophila (Strobilophila) assamensis new species, C. (S.) hiepi new species, C. (S.) kwaiensis new species, C. (S.) tansachai new species and C. (S.) yangi new species, all associated with Cycas. For the nominate subgenus Cycadophila eight new species are described, Cycadophila (Cycadophila) abyssa new species, C. (C.) collina new species,C. (C.) samara new species, C. (C.) convexa new species, C. (C.) cyclochasma new species, C. (C.) eurynota new species, C. (C.) papua new species, and C. (C.) torquata new species and four new generic combinations are proposed: C. (C.) vittata (Arrow) new combination, C. (C.) discimaculata (Mader) new combination, C. (C.) intermedia (Chûjô) new combination, and C. (C.) lata (Grouvelle) new combination. Only the first three listed species of the nominate subgenus have known associations with Cycas. Species are distinguished on the basis of morphology and/or by analysis of 16S rRNA gene sequences. The larva of subgenus Strobilophila is described based on individuals collected together with adults and matched with analysis of 16S rRNA gene sequences. Keys to subgenera and species of known adults and larvae are provided.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-01-01

Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.

Saccharomyces cerevisiae Mixed Culture of Blackberry (Rubus ulmifolius L.) Juice: Synergism in the Aroma Compounds Production

Science.gov (United States)

Ragazzo-Sánchez, Juan Arturo; Ortiz-Basurto, Rosa Isela; Luna-Solano, Guadalupe; Calderón-Santoyo, Montserrat

2014-01-01

Blackberry (Rubus sp.) juice was fermented using four different strains of Saccharomyces cerevisiae (Vitilevure-CM4457, Enoferm-T306, ICV-K1, and Greroche Rhona-L3574) recognized because of their use in the wine industry. A medium alcoholic graduation spirit (component analysis (PCA), and factorial discriminant analysis (DFA) permit to demonstrate the synergism between the strains. PMID:25506606

Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

Science.gov (United States)

26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

Interview with Mark Watson

Directory of Open Access Journals (Sweden)

Katy Shaw

2016-04-01

Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.

Watson: A new link in the IIE iron chain

Science.gov (United States)

Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

1994-01-01

Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

Indian Academy of Sciences (India)

Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

Science.gov (United States)

Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

2017-12-01

Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as

Portrait of a discovery. Watson, Crick, and the double helix.

Science.gov (United States)

de Chadarevian, Soraya

2003-03-01

This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.).

Science.gov (United States)

Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

2017-01-01

Raspberries ( Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm-plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus . These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop.

Watson-Crick base pairing controls excited-state decay in natural DNA.

Science.gov (United States)

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

Science.gov (United States)

Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

2015-01-01

Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

Science.gov (United States)

Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

2015-03-19

Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland

DEFF Research Database (Denmark)

Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.

2013-01-01

For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Alnus subgenus Alnus in the Eocene of western North America based on leaves, associated catkins, pollen, and fruits.

Science.gov (United States)

Liu, Xiaoyan; Manchester, Steven R; Jin, Jianhua

2014-11-01

The fossil record of alder (Alnus) is well known in the Cenozoic deposits throughout the northern hemisphere, based on numerous reports of the distinctive pollen, cone-like infructescences, staminate inflorescences, and leaves. However, our understanding of the systematic position of these fossils relative to the modern phylogeny of the genus has been limited because most fossils were described from only one organ. We examined well-preserved leaves and associated fruiting and staminate catkins from the middle Eocene, Clarno Formation, Oregon, USA by stereomicroscopy. In situ and dispersed pollen were cleaned with HF and acetolized for light and scanning electron microscopy. We reconstructed a new extinct species based on multiple organs and discuss significant phytogeographic and phylogenetic implications for Alnus. Alnus clarnoensis sp. nov. is described based on serrate leaves with 1-4 small teeth between each primary tooth, associated cone-like fruiting catkins with fruits in situ, and associated slender pollen catkins bearing in situ 3- to 6-pored pollen with arci between the pores. Combined investigations of each organ indicate that they probably derive from the same species and can be confidently attributed to subgenus Alnus Furlow based on leaf architecture and pollen pore number frequency. The Clarno fossils are most similar to the extant North American species of subgenus Alnus rather than to those from Asia and Europe, indicating that this modern subgenus was already distinct by the middle Eocene and that the intercontinental migration likely occurred earlier. © 2014 Botanical Society of America, Inc.

Benefits of blackberry nectar (Rubus spp.) relative to hypercholesterolemia and lipid peroxidation Beneficios del néctar de mora (Rubus spp.) en relación con la hipercolesterolemia y la peroxidación lipídica

OpenAIRE

P. R. Ferreira de Araujo; V. da Silva Santos; A. Rodrigues Machado; C. Gevehr Fernandes; J. A. Silva; R. da Silva Rodrigues

2011-01-01

Introduction: In humans, the normal metabolic activity produces free radicals that constantly, along with other risk factors, including hypercholesterolemia may be responsible for the onset of degenerative diseases. Some bioactive compounds present in blackberry (Rubus spp.) have the ability to act as natural antioxidants can make the food to minimize effects on the body caused by reactive oxygen species. Objective: This study verified the benefits of blackberry nectar through the quantificat...

Evolution of fruit traits in Ficus subgenus Sycomorus (Moraceae)

DEFF Research Database (Denmark)

Harrison, Rhett D.; Rønsted, Nina; Xu, Lei

2012-01-01

Fig trees are a ubiquitous component of tropical rain forests and exhibit an enormous diversity of ecologies. Focusing on Ficus subgenus Sycomorus, a phenotypically diverse and ecologically important Old World lineage, we examined the evolution of fruit traits using a molecular phylogeny construc......, such as flowering phenology, nutrient economy, and habitat preference. Thus, plant life-history, both directly and through its influence on fig placement, appears to have played a prominent role in determining fruit traits in these figs....

Annual and perennial alleyway cover crops vary in their effects on Pratylenchus penetrans in Pacific Northwest red raspberry (Rubus idaeus)

Science.gov (United States)

Cover crop use is not common in established red raspberry (Rubus idaeus) fields in the Pacific Northwest. Raspberry growers are concerned about resource competition between the cover crop and raspberry crop, as well as increasing population densities of the plant-parasitic nematode Pratylenchus pene...

IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

Science.gov (United States)

Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

2016-10-11

We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix

In vivo evaluation of the genetic toxicity of Rubus niveus Thunb. (Rosaceae) extract and initial screening of its potential chemoprevention against doxorubicin-induced DNA damage.

Science.gov (United States)

Tolentino, Flora; Araújo, Priscila Alves de; Marques, Eduardo de Souza; Petreanu, Marcel; Andrade, Sérgio Faloni de; Niero, Rivaldo; Perazzo, Fábio F; Rosa, Paulo César Pires; Maistro, Edson Luis

2015-04-22

Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48 h, and the doses selected were 500, 1000 and 2000 mg/kg b.w. administered by gavage alone or prior to DXR (30 mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000 mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

First report of a resistance-breaking strain of Raspberry bushy dwarf virus in red raspberry (Rubus idaeus) in North America

Science.gov (United States)

Raspberry bushy dwarf virus (RBDV) is pollen-transmitted and the most important virus of Rubus worldwide. Infection of RBDV is associated with drupelet abortion, resulting in crumbly fruit. Multiple RBDV strains have been reported, with the Scottish-type (D200) strains being the most prevalent, and...

Sesquiterpene lactones. XXXIII. Guaianolides in the subgenus Psephellus (Cass. Schmalh., genus Centaurea L.

Directory of Open Access Journals (Sweden)

Gerard Nowak

2014-01-01

Full Text Available Sesquiterpene lactones were found to occur in all of the studied species of the subgenus Psephellus (Cass. Schmalh. Differing compositions were found in the representatives of three sections. In Centaurea declinata MB. from the section Leucophylle (Sosn. Sosn.. 15-deoxyrepin, linichlorin B and cynaropicrin were found. Linichlorin B dominated in Centaurea hypoleucu DC. from section Hypoleucae (Sosn. Sosn., while in the species classified in section Psephellus Sosn., repin, acroptilin, jenerin, centaurepensin and, in some, also cynaropicrin. dominated.

Impact parameter representation from the Watson-Sommerfeld transform

International Nuclear Information System (INIS)

Islam, M.M.

1976-01-01

Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)

Comparison between four blackberry (Rubus sp.) cultivars to light variation

International Nuclear Information System (INIS)

Enciso, B.E.; Gómez, C.

2004-01-01

Abstract: This paper compares four Colombian blackberry cultivars- (Rubus sp.) light compensation points, leaf area, chlorophyll concentration and photosynthetic capacity. Time can be saved and efficiency improved by adapting different cultivars to differing luminosity once these parameters have been determined and established. The four cultivars involved were -Guarne-, -San Antonio-, -Sara 3- and -Pacho 2- forming part of Corpoica-s blackberry collection at the Sena farm in Manizales. The results revealed that all four cultivars had different light compensation points. They also showed that net photosynthesis varied amongst cultivars, even when grown in the same environmental conditions and that total chlorophyll and leaf area may be used as indicators of response to the conditions being evaluated. Key words: Photosynthesis, leaf area, radiation, compensation point, photons flow density (PFD), chlorophyll [es

Typification of the Linnaean names Plantago serraria and P. subulata (Plantago subgenus i>Coronopus>, Plantaginaceae)

DEFF Research Database (Denmark)

Hassemer, Gustavo; Iamonico, Duilio; Rønsted, Nina

2017-01-01

Plantago subg. Coronopus is a mainly Mediterranean group of plantains whose taxonomy is very complex. Two Linnaean names within this subgenus still remain untypified: P. serraria and P. subulata. We here discuss the possible types for these names, and designate lectotypes for both. For nomenclatu....... For nomenclatural purposes, the names P. triquetra and P. pungens are also included in the treatment of P. subulata....

Some Econometric Results for the Blanchard-Watson Bubble Model

DEFF Research Database (Denmark)

Johansen, Soren; Lange, Theis

The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...

Phylogenetic patterns of geographical and ecological diversification in the subgenus Drosophila.

Directory of Open Access Journals (Sweden)

Ramiro Morales-Hojas

Full Text Available Colonisation of new geographic regions and/or of new ecological resources can result in rapid species diversification into the new ecological niches available. Members of the subgenus Drosophila are distributed across the globe and show a large diversity of ecological niches. Furthermore, taxonomic classification of Drosophila includes the rank radiation, which refers to closely related species groups. Nevertheless, it has never been tested if these taxonomic radiations correspond to evolutionary radiations. Here we present a study of the patterns of diversification of Drosophila to test for increased diversification rates in relation to the geographic and ecological diversification processes. For this, we have estimated and dated a phylogeny of 218 species belonging to the major species groups of the subgenus. The obtained phylogenies are largely consistent with previous studies and indicate that the major groups appeared during the Oligocene/Miocene transition or early Miocene, characterized by a trend of climate warming with brief periods of glaciation. Ancestral reconstruction of geographic ranges and ecological resource use suggest at least two dispersals to the Neotropics from the ancestral Asiatic tropical disribution, and several transitions to specialized ecological resource use (mycophagous and cactophilic. Colonisation of new geographic regions and/or of new ecological resources can result in rapid species diversification into the new ecological niches available. However, diversification analyses show no significant support for adaptive radiations as a result of geographic dispersal or ecological resource shift. Also, cactophily has not resulted in an increase in the diversification rate of the repleta and related groups. It is thus concluded that the taxonomic radiations do not correspond to adaptive radiations.

Phylogenetic patterns of geographical and ecological diversification in the subgenus Drosophila.

Science.gov (United States)

Morales-Hojas, Ramiro; Vieira, Jorge

2012-01-01

Colonisation of new geographic regions and/or of new ecological resources can result in rapid species diversification into the new ecological niches available. Members of the subgenus Drosophila are distributed across the globe and show a large diversity of ecological niches. Furthermore, taxonomic classification of Drosophila includes the rank radiation, which refers to closely related species groups. Nevertheless, it has never been tested if these taxonomic radiations correspond to evolutionary radiations. Here we present a study of the patterns of diversification of Drosophila to test for increased diversification rates in relation to the geographic and ecological diversification processes. For this, we have estimated and dated a phylogeny of 218 species belonging to the major species groups of the subgenus. The obtained phylogenies are largely consistent with previous studies and indicate that the major groups appeared during the Oligocene/Miocene transition or early Miocene, characterized by a trend of climate warming with brief periods of glaciation. Ancestral reconstruction of geographic ranges and ecological resource use suggest at least two dispersals to the Neotropics from the ancestral Asiatic tropical disribution, and several transitions to specialized ecological resource use (mycophagous and cactophilic). Colonisation of new geographic regions and/or of new ecological resources can result in rapid species diversification into the new ecological niches available. However, diversification analyses show no significant support for adaptive radiations as a result of geographic dispersal or ecological resource shift. Also, cactophily has not resulted in an increase in the diversification rate of the repleta and related groups. It is thus concluded that the taxonomic radiations do not correspond to adaptive radiations.

Phylogeny and nomenclature of the genus Talaromyces and taxa accommodated in Penicillium subgenus Biverticillium

Science.gov (United States)

Samson, R.A.; Yilmaz, N.; Houbraken, J.; Spierenburg, H.; Seifert, K.A.; Peterson, S.W.; Varga, J.; Frisvad, J.C.

2011-01-01

The taxonomic history of anamorphic species attributed to Penicillium subgenus Biverticillium is reviewed, along with evidence supporting their relationship with teleomorphic species classified in Talaromyces. To supplement previous conclusions based on ITS, SSU and/or LSU sequencing that Talaromyces and subgenus Biverticillium comprise a monophyletic group that is distinct from Penicillium at the generic level, the phylogenetic relationships of these two groups with other genera of Trichocomaceae was further studied by sequencing a part of the RPB1 (RNA polymerase II largest subunit) gene. Talaromyces species and most species of Penicillium subgenus Biverticillium sensu Pitt reside in a monophyletic clade distant from species of other subgenera of Penicillium. For detailed phylogenetic analysis of species relationships, the ITS region (incl. 5.8S nrDNA) was sequenced for the available type strains and/or representative isolates of Talaromyces and related biverticillate anamorphic species. Extrolite profiles were compiled for all type strains and many supplementary cultures. All evidence supports our conclusions that Penicillium subgenus Biverticillium is distinct from other subgenera in Penicillium and should be taxonomically unified with the Talaromyces species that reside in the same clade. Following the concepts of nomenclatural priority and single name nomenclature, we transfer all accepted species of Penicillium subgenus Biverticillium to Talaromyces. A holomorphic generic diagnosis for the expanded concept of Talaromyces, including teleomorph and anamorph characters, is provided. A list of accepted Talaromyces names and newly combined Penicillium names is given. Species of biotechnological and medical importance, such as P. funiculosum and P. marneffei, are now combined in Talaromyces. Excluded species and taxa that need further taxonomic study are discussed. An appendix lists other generic names, usually considered synonyms of Penicillium sensu lato that

Delineation of Culicoides species by morphology and barcode exemplified by three new species of the subgenus Culicoides (Diptera: Ceratopogonidae) from Scandinavia

DEFF Research Database (Denmark)

Nielsen, Søren Achim; Kristensen, Michael

2015-01-01

new species initially separated by DNA barcoding with mitochondrial COI can be distinguished by morphological characters. In this context a key to Scandinavian subgenus Culicoides using wing and maxillary palp characters is presented. The key is including the three new species Culicoides boyi...... is considered, as well as the evolutionary relationships between species within this genus remains problematic. In recent years molecular barcoding has assisted substantially in the identification of biting midges in the multiple entomological survey projects which were initiated in many European countries...... following the bluetongue outbreak in 2006–2009. These studies revealed potentially new species and “species-complexes” with large genetic and morphological variability. Here we use molecular barcoding, together with morphological analysis, to study subgenus Culicoides Latreille from Scandinavia with focus...

Phenotypic differentiation and phylogenetic signal of wing shape in western European biting midges, Culicoides spp., of the subgenus Avaritia

DEFF Research Database (Denmark)

Muñoz-Muñoz, F.; Talavera, S.; Carpenter, S.

2014-01-01

of cytochrome oxidase subunit I barcode sequencing and geometric morphometric analyses to investigate wing shape as a means to infer species identification within this subgenus. In addition the congruence of morphological data with different phylogenetic hypotheses is tested. Five different species...

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

Science.gov (United States)

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

GENETIC VARIATION IN RED RASPBERRIES (RUBUS IDAEUS L.; ROSACEAE) FROM SITES DIFFERING IN ORGANIC POLLUTANTS COMPARED WITH SYNTHETIC TANDEM REPEAT DNA PROBES

Science.gov (United States)

Two synthetic tandem repetitive DNA probes were used to compare genetic variation at variable-number-tandem-repeat (VNTR) loci among Rubus idaeus L. var. strigosus (Michx.) Maxim. (Rosaceae) individuals sampled at eight sites contaminated by pollutants (N = 39) and eight adjacent...

Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

Science.gov (United States)

Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

2018-01-01

Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist

Simulium hiroyukii, a new species of the subgenus Gomphostilbia (Diptera: Simuliidae) from Mount Murud, Sarawak, Malaysia.

Science.gov (United States)

Ya'cob, Zubaidah; Takaoka, Hiroyuki; Sofian-Azirun, Mohd

2015-01-20

Simulium (Gomphostilbia) hiroyukii is described based on females, males, pupae and larvae collected in Mount Murud, Sarawak, Malaysia. This new species is assigned to the Simulium darjeelingense species-group of the subgenus Gomphostilbia, and is characterized by the darkened fore coxae and the pupal gill with eight long filaments, of which middle and dorsal triplets have elongated primary and secondary stalks, respectively. 

de Jean Watson

Directory of Open Access Journals (Sweden)

Thaís Schossler

2008-01-01

Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.

Formation of base triplets by non-Watson-Crick bonds mediates homologous recognition in RecA recombination filaments.

OpenAIRE

Rao, B J; Radding, C M

1994-01-01

Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

Science.gov (United States)

Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

2005-06-16

The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

Ed Watson 1940-2006

CERN Multimedia

2006-01-01

Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues?  In...

When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.

Science.gov (United States)

Malone, John C; García-Penagos, Andrés

2014-07-25

Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor

Directory of Open Access Journals (Sweden)

FELIPE PARRADO CORREDOR

2013-12-01

Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.

Studies on Colombian cryptogams. V. Taxonomy, distribution and ecology of macrolichens of the Colombian Paramos: 1. Cladonia subgenus Cladina

NARCIS (Netherlands)

Sipman, H.J.M.; Cleef, A.M.

1979-01-01

Morphology, chemistry, distribution and ecology of 6 species of Cladonia subgenus Cladina (Lichenes) from the Colombian paramos are described: C. arcuata Ahti, C. boliviano Ahti, C. confusa Sant., C. polia Sant., C. rangiferina (L.) Wigg. var. abbayesii Ahti, and C. colombiana spec. Nov. C. bicolor

On the extension of the Fermi-Watson Theorem to high energy diffraction

International Nuclear Information System (INIS)

Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati

1995-12-01

The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition

The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

Science.gov (United States)

Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

2010-01-01

The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

"Elementary, my dear Watson". Per una falsa citazione

Directory of Open Access Journals (Sweden)

Irene Minella

2014-12-01

Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.

Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

Science.gov (United States)

Charlton, Bruce G

2008-01-01

Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

Science.gov (United States)

Beck, Hall P.; Levinson, Sharman; Irons, Gary

2009-01-01

In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

Science.gov (United States)

Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

2018-04-24

A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that

A chat with James Watson

CERN Multimedia

2011-01-01

On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano.      var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');

Taxonomic review on the subgenus Tripodura Townes (Diptera: Chironomidae: Polypedilum) from China with eleven new species and a supplementary world checklist.

Science.gov (United States)

Zhang, Ruilei; Song, Chao; Qi, Xin; Wang, Xinhua

2016-07-05

The subgenus Tripodura Townes of Polypedilum Kieffer from China including 26 species is reviewed. Eleven new species, named P. (T.) absensilobum Zhang & Wang sp. n., P. (T.) apiculusetosum Zhang & Wang sp. n., P. (T.) arcuatum Zhang & Wang sp. n., P. (T.) bilamella Zhang & Wang sp. n., P. (T.) conghuaense Zhang & Wang sp. n., P. (T.) dengae Zhang & Wang sp. n., P. (T.) mengmanense Zhang & Wang sp. n., P. (T.) napahaiense Zhang & Wang sp. n., P. (T.) parallelum Zhang & Wang sp. n., P. (T.) pollicium Zhang & Wang sp. n. and P. (T.) trapezium Zhang & Wang sp. n. are described and illustrated based on male imagines. Three species, P. (T.) quadriguttatum Kieffer, P. (T.) unifascia (Tokunaga) and P. (T.) udominutum Niitsuma are firstly recorded in China. A key to known male imagines of Chinese species and an updated world checklist of subgenus Tripodura are presented.

Taxonomic review of the subgenus Andrena (Poecilandrena) (Hymenoptera: Andrenidae) in Israel and the Levant.

Science.gov (United States)

Pisanty, Gideon; Scheuchl, Erwin; Dorchin, Netta

2018-01-18

Andrena (Poecilandrena) Hedicke is a subgenus of small solitary bees, with the greatest diversity in the Eastern Mediterranean Region-an important but understudied biodiversity hotspot for bees. We studied Andrena (Poecilandrena) collected mostly in Israel and the West Bank, and make several additions to the regional fauna. We provide the first comprehensive review of Andrena (Poecilandrena) species currently known from Israel, the West Bank, Jordan, Lebanon and Syria, including diagnostic keys to females and males, descriptions of new species and unknown sexes, and detailed information for each taxon regarding distribution, phenology and flower visitation. Our review includes fourteen species of Andrena (Poecilandrena) from the Levant, including five species new to science: A. freidbergi Pisanty Scheuchl n. sp., A. galilaea Pisanty Scheuchl n. sp., A. hierosolymitana Pisanty Scheuchl n. sp., A. sedumella Scheuchl Pisanty n. sp., and A. stenofovea Scheuchl Pisanty n. sp. We also report four species as new to the region, and provide the first description of the male of A. rusticola Warncke. We exclude A. arabica Scheuchl Gusenleitner from the subgenus, and synonymize it with A. helouanensis Friese. We anticipate that more collecting work in this region will yield additional undescribed taxa as well as new records, especially of taxa already known from Turkey. In the appendix to this work we provide information on 35 new records of other Andrena subgenera from Israel and the West Bank that have accumulated in recent years.

Building Watson: An Overview of the DeepQA Project

OpenAIRE

Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris

2010-01-01

IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Meltwater chemistry and solute export from a Greenland ice sheet catchment, Watson River, West Greenland

DEFF Research Database (Denmark)

Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent

2014-01-01

–2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

AVE bond index in the H-bond of the Watson-Crick pairs

International Nuclear Information System (INIS)

Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

1981-01-01

The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

Science.gov (United States)

Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

2018-02-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

The species of Aplysia belonging to the subgenus Tullia Pruvot-Fol, 1933: On a generic character in statu nascendi

NARCIS (Netherlands)

Engel, H.; Eales, Nellie B.

1957-01-01

Mme PRUVOT-FOL, 1933, p. 400, established the subgenus Tullia for Aplysia juliana QUOY et GAIMARD, and 1934, p. 41 added other species of Aplysia with a distinct sucking disk at the end of the foot. Living animals have been figured and their variation has been described by BABA 1937a, p. 211, and

Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

Science.gov (United States)

IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

General overview of Tillandsia subgenus Tillandsia in Peru: The three-pinnate species and the case of two endemic species

Directory of Open Access Journals (Sweden)

Blanca León

2013-03-01

Full Text Available A recent collection of a specimen with three-pinnate inflorescence was the inspiration to evaluate Tillandsia subgenus Tillandsia taxa with three pinnate inflorescences for the Peruvian flora. Tillandsia extensa characteristics are clarified, confirming its distribution for northeastern Peru, and recognizing a specimen, previously considered being the second record for this species, as T. platyphylla.

The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

Science.gov (United States)

Caplan, R M

1982-06-01

The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

Thalassornectes (Alcidectes) aukletae, new subgenus and species (Acari: Hypoderatidae) from the crested and parakeet auklets (Aves: Charadriiformes; Alcidae).

Science.gov (United States)

Pence, D B; Hoberg, E P

1991-03-01

In the genus Thalassornectes, a new subgenus, Alcidectes, and a new species, T. (Alcidectes) aukletae, are described from deutonymphs in the subcutaneous adipose tissue of the crested auklet, Aethia cristatella (Pallas), and the parakeet auklet, Cyclorrhynchus psittacula (Pallas), from the eastern Pacific USSR. The new subgenus and species differ from one or both of the single species in each of the other two subgenera, Thalassornectes and Rallidectes, by (1) the normal size, position, and parallel arrangement of the genital papillae; (2) the larger size of seta sce; (3) the greater length and stronger development of setae sci, d1, l1, h, and sh; (4) the equal size of tarsi III and IV or their size subequal, with tarsus IV slightly longer than tarsus III; (5) both epimera I and sternum well developed and nearly equal in length; and (6) the free sclerotized posteriad extension from epimerite II on the ventral cuticular surface. This is the first hypoderatid reported from the host order Charadriiformes. The distribution of T. (Alcidectes) aukletae among auklets may be attributed to either cospeciation or may have an ecological basis; data are insufficient at present to sustain either hypothesis.

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

Science.gov (United States)

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Microbiological and Pharmacological Evaluation of the Micropropagated Rubus liebmannii Medicinal Plant

Directory of Open Access Journals (Sweden)

Adelina Jiménez-Arellanes

2012-01-01

Full Text Available Rubus liebmannii is an endemic species from Mexico used in traditional medicine primarily to treat dysentery and cough. The in vitro activity against Giardia lamblia and Entamoeba histolytica that produces the ethanolic extract of the aerial parts of the plant led us to expand the pharmacological and phytochemical research of this species. Gastrointestinal disorders including amebiasis remain one of the health problems that need to be addressed and it is of interest to find alternatives that improve their treatment. Also, it is important to emphasize that R. liebmannii grows wild in the country and is not found in abundance; therefore, alternatives that avoid overexploitation of the natural resource are mandatory. Ongoing with the evaluation of the potentialities that R. liebmannii possesses for treating infectious gastrointestinal diseases, the aim of the present study was to evaluate the biological effects and the chemical composition of the micropropagated plant.

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

Science.gov (United States)

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

Science.gov (United States)

Hicks, R. E.; Southey, G. N.

1990-01-01

The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

Taxonomy of the African large carpenter bees of the genus Xylocopa Latreille, 1802, subgenus Xenoxylocopa Hurd & Moure, 1963 (Hymenoptera, Apidae

Directory of Open Access Journals (Sweden)

Jonathan R. Mawdsley

2017-02-01

Full Text Available The taxonomy of the genus Xylocopa Latreille, 1802, subgenus Xenoxylocopa Hurd & Moure, 1963, is reviewed. There is a single valid species in this subgenus, Xylocopa (Xenoxylocopa inconstans Smith, 1874, which is widely distributed throughout sub-Saharan Africa, from Senegal to Ethiopia and south to northern Republic of South Africa. Synonyms of X. inconstans include X. abyssinica Radoszkowski, 1899, proposed for a male specimen from Ethiopia, as well as three names proposed for females with yellow (rather than white dorsal pubescence: Mesotrichia chiyakensis Cockerell, 1908 (new synonym, X. inconstans var. flavescens Vachal, 1899, and X. inconstans var. flavocincta Friese, 1909. Quantitative analyses of body measurements and examination of male reproductive structures support the new synonymy of Mesotrichia chiyakensis with X. inconstans. Males and females of X. (X. inconstans are illustrated, along with male reproductive structures, and diagnostic characters and keys are provided to separate the males and females of X. (X. inconstans from those of species in other closely-allied African subgenera of the genus Xylocopa.

Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

Science.gov (United States)

Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

2017-06-01

The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

The Effect of Nonzero Autocorrelation Coefficients on the Distributions of Durbin-Watson Test Estimator: Three Autoregressive Models

Directory of Open Access Journals (Sweden)

Mei-Yu LEE

2014-11-01

Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson

The McLean-Watson line strength formula and its implementation

International Nuclear Information System (INIS)

Hey, J D

2009-01-01

We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

Science.gov (United States)

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the

On the colour types in Lycodes nakamurae (Tanaka, 1914) and species composition of the subgenus Furcimanus (Perciformes: Zoarcidae: Lycodes) in the sea of Japan.

Science.gov (United States)

Saveliev, Pavel A; Balanov, Andrey A; Kukhlevskii, Andrey D

2014-05-30

Two colour types were revealed in a zoarcid fish of the subgenus Furcimanus, genus Lycodes, in the Sea of Japan. A comparison of morphometric, meristic and genetic characters in dark coloured and light coloured individuals suggests that the two colour morphs represent a single species, determined to be Lycodes nakamurae (Tanaka, 1914). Variability in colouration within L. nakamurae and a lack of morphological or molecular characters distinguishing L. nakamurae from L. nishimurai Shinohara & Shirai, 2005 suggest that the latter should be considered a synonym of L. nakamurae (Tanaka, 1914). A record of L. pectoralis in the waters of the Republic of Korea is regarded as a misidentification. Thus, we conclude that only one species of the Lycodes subgenus Furcimanus, L. nakamurae, with dark and light colour morphs as well as specimens of intermediate colouration, inhabits the Sea of Japan.

Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season

Directory of Open Access Journals (Sweden)

Lina Affifatusholihah

2017-04-01

In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.

James Watson's most inconvenient truth: race realism and the moralistic fallacy.

Science.gov (United States)

Rushton, J Philippe; Jensen, Arthur R

2008-11-01

Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.

Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

Science.gov (United States)

Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

2004-09-28

Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

Science.gov (United States)

Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

2010-06-15

The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

Foliar Essential Oil Glands of Eucalyptus Subgenus Eucalyptus (Myrtaceae Are a Rich Source of Flavonoids and Related Non-Volatile Constituents.

Directory of Open Access Journals (Sweden)

Jason Q D Goodger

Full Text Available The sub-dermal secretory cavities (glands embedded within the leaves of Eucalyptus (Myrtaceae were once thought to be the exclusive repositories of monoterpene and sesquiterpene oils. Recent research has debunked this theory and shown that abundant non-volatile compounds also occur within foliar glands. In particular, glands of four species in subgenus Eucalyptus contain the biologically active flavanone pinocembrin. Pinocembrin shows great promise as a pharmaceutical and is predominantly plant-sourced, so Eucalyptus could be a potential commercial source of such compounds. To explore this we quantified and assessed the purity of pinocembrin in glands of 11 species of E. subg. Eucalyptus using Electro-Spray Ionisation Liquid Chromatography Mass Spectrometry of acetonitrile extracts and Gas Chromatography Mass Spectrometry analyses of hexane extracts of isolated glands which were free from other leaf tissues. Our results showed that the glands of subgenus Eucalyptus contain numerous flavanones that are structurally related to pinocembrin and often present in much greater abundance. The maximum concentration of pinocembrin was 2 mg g-1 dry leaf found in E. stellulata, whereas that of dimethylpinocembrin (5,7-dimethoxyflavanone was 10 mg g-1 in E. oreades and that of pinostrobin (5-hydroxy-7-methoxyflavanone was 12 mg g-1 in E. nitida. We also found that the flavanones are exclusively located within the foliar glands rather than distributed throughout leaf tissues. The flavanones differ from the non-methylated pinocembrin in the degree and positions of methylation. This finding is particularly important given the attractiveness of methylated flavonoids as pharmaceuticals and therapeutics. Another important finding was that glands of some members of the subgenus also contain flavanone O-glucosides and flavanone-β-triketone conjugates. In addition, glands contain free β-triketones, β-triketone heterodimers and chromone C-glucosides. Therefore, the

Foliar Essential Oil Glands of Eucalyptus Subgenus Eucalyptus (Myrtaceae) Are a Rich Source of Flavonoids and Related Non-Volatile Constituents.

Science.gov (United States)

Goodger, Jason Q D; Seneratne, Samiddhi L; Nicolle, Dean; Woodrow, Ian E

2016-01-01

The sub-dermal secretory cavities (glands) embedded within the leaves of Eucalyptus (Myrtaceae) were once thought to be the exclusive repositories of monoterpene and sesquiterpene oils. Recent research has debunked this theory and shown that abundant non-volatile compounds also occur within foliar glands. In particular, glands of four species in subgenus Eucalyptus contain the biologically active flavanone pinocembrin. Pinocembrin shows great promise as a pharmaceutical and is predominantly plant-sourced, so Eucalyptus could be a potential commercial source of such compounds. To explore this we quantified and assessed the purity of pinocembrin in glands of 11 species of E. subg. Eucalyptus using Electro-Spray Ionisation Liquid Chromatography Mass Spectrometry of acetonitrile extracts and Gas Chromatography Mass Spectrometry analyses of hexane extracts of isolated glands which were free from other leaf tissues. Our results showed that the glands of subgenus Eucalyptus contain numerous flavanones that are structurally related to pinocembrin and often present in much greater abundance. The maximum concentration of pinocembrin was 2 mg g-1 dry leaf found in E. stellulata, whereas that of dimethylpinocembrin (5,7-dimethoxyflavanone) was 10 mg g-1 in E. oreades and that of pinostrobin (5-hydroxy-7-methoxyflavanone) was 12 mg g-1 in E. nitida. We also found that the flavanones are exclusively located within the foliar glands rather than distributed throughout leaf tissues. The flavanones differ from the non-methylated pinocembrin in the degree and positions of methylation. This finding is particularly important given the attractiveness of methylated flavonoids as pharmaceuticals and therapeutics. Another important finding was that glands of some members of the subgenus also contain flavanone O-glucosides and flavanone-β-triketone conjugates. In addition, glands contain free β-triketones, β-triketone heterodimers and chromone C-glucosides. Therefore, the foliar glands

Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2005-01-01

We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

Science.gov (United States)

D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

2007-02-07

A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Aplicação da Teoria do Cuidado Transpessoal de Jean Watson: uma década de produção brasileira Aplicación de la Teoría del Cuidado Transpersonal de Jean Watson: una década de producción brasileña Jean Watson's Theory of Human Caring: a decade of Brazilian publications

Directory of Open Access Journals (Sweden)

Luciane Favero

2009-01-01

Full Text Available Esta revisão sistemática objetivou descrever e analisar a aplicação da Teoria do Cuidado Transpessoal de Jean Watson nas pesquisas divulgadas em publicações de Enfermagem brasileiras dos últimos dez anos. O levantamento bibliográfico abrangeu 34 produções científicas selecionadas nas bases de dados eletrônicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latino Americana e do Caribe em Ciências da Saúde, BDENF (Base de dados de Enfermagem e SciELO (Scientific Electronic Library On-line, que após aplicação dos critérios de inclusão estabelecidos, compuseram a amostra do estudo. Os resultados apontaram que a Região Sul concentra 61,8% das produções referidas ao tema de estudo, que ela pode ser aplicada nos níveis de atenção primária, secundária e terciária e que 64,7% das produções utilizam os fatores de cuidado propostos por Jean Watson em 1979. Emerge a necessidade de aprimoramento das pesquisas acerca da transformação ocorrida na Teoria do Cuidado Transpessoal, com abordagem do Processo Clinical Caritas, porém como são escassos os estudos referentes a esta temática, dificultam sua utilização prática.Esta revisión sistemática tuvo como objetivo describir y analizar la aplicación de la Teoría del Cuidado Transpersonal de Jean Watson en las investigaciones divulgadas en publicaciones de Enfermería brasileñas de los últimos diez años. El levantamiento bibliográfico abarcó 34 producciones seleccionadas en las bases de datos electrónicas MEDLINE (MEDLARS [Medical Literature Analysis and Retrieval System] On-line, LILACS (Literatura Latinoamericana y del Caribe en Ciencias de la Salud, BDENF (Base de datos de Enfermería y SciELO (Scientific Electronic Library On-line, que después de la aplicación de los criterios de inclusión establecidos, compusieron la muestra del estudio. Los resultados señalaron que la región Sur concentra el 61,8% de las

Intraspecies differences in natural susceptibility to amphotericine B of clinical isolates of Leishmania subgenus Viannia.

Directory of Open Access Journals (Sweden)

Carlos Franco-Muñoz

Full Text Available Amphotericin B (AmB is a recommended medication for the treatment of cutaneous and mucosal leishmaniasis in cases of therapeutic failure with first-line medications; however, little is known about the in vitro susceptibility to AmB of clinical isolates of the subgenus Viannia, which is most prevalent in South America. This work aimed to determine the in vitro susceptibility profiles to AmB of clinical isolates of the species L. (V. panamensis, L. (V. guyanensis and L. (V. braziliensis. In vitro susceptibility to AmB was evaluated for 65 isolates. Macrophages derived from the U937 cell line were infected with promastigotes and exposed to different AmB concentrations. After 96 hours, the number of intracellular amastigotes was quantified by qPCR, and median effective concentration (EC50 was determined using the PROBIT model. The controls included sensitive strains and experimentally derived less sensitive strains generated in vitro, which presented EC50 values up to 7.57-fold higher than the values of the sensitive strains. The isolates were classified into groups according to their in vitro susceptibility profiles using Ward's hierarchical method. The susceptibility to AmB differed in an intraspecies-specific manner as follows: 28.21% (11/39 of L. (V. panamensis strains, 50% (3/6 of L. (V. guyanensis strains and 34.61% (9/26 of L. (V. braziliensis strains were classified as less sensitive. The latter subset featured three susceptibility groups. We identified Colombian isolates with different AmB susceptibility profiles. In addition, the capacity of species of subgenus Viannia to develop lower susceptibility to AmB was demonstrated in vitro. These new findings should be considered in the pharmacovigilance of AmB in Colombia and South America.

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

Science.gov (United States)

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

Science.gov (United States)

Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

2015-09-01

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

Science.gov (United States)

Kottemann, Molly C; Smogorzewska, Agata

2013-01-17

The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

ITS2 secondary structure improves phylogeny estimation in a radiation of blue butterflies of the subgenus Agrodiaetus (Lepidoptera: Lycaenidae: Polyommatus

Directory of Open Access Journals (Sweden)

Wolf Matthias

2009-12-01

Full Text Available Abstract Background Current molecular phylogenetic studies of Lepidoptera and most other arthropods are predominantly based on mitochondrial genes and a limited number of nuclear genes. The nuclear genes, however, generally do not provide sufficient information for young radiations. ITS2 , which has proven to be an excellent nuclear marker for similarly aged radiations in other organisms like fungi and plants, is only rarely used for phylogeny estimation in arthropods, although universal primers exist. This is partly due to difficulties in the alignment of ITS2 sequences in more distant taxa. The present study uses ITS2 secondary structure information to elucidate the phylogeny of a species-rich young radiation of arthropods, the butterfly subgenus Agrodiaetus. One aim is to evaluate the efficiency of ITS2 to resolve the phylogeny of the subgenus in comparison with COI , the most important mitochondrial marker in arthropods. Furthermore, we assess the use of compensatory base changes in ITS2 for the delimitation of species and discuss the prospects of ITS2 as a nuclear marker for barcoding studies. Results In the butterfly family Lycaenidae, ITS2 secondary structure enabled us to successfully align sequences of different subtribes in Polyommatini and produce a Profile Neighbour Joining tree of this tribe, the resolution of which is comparable to phylogenetic trees obtained with COI+COII . The subgenus Agrodiaetus comprises 6 major clades which are in agreement with COI analyses. A dispersal-vicariance analysis (DIVA traced the origin of most Agrodiaetus clades to separate biogeographical areas in the region encompassing Eastern Anatolia, Transcaucasia and Iran. Conclusions With the inclusion of secondary structure information, ITS2 appears to be a suitable nuclear marker to infer the phylogeny of young radiations, as well as more distantly related genera within a diverse arthropod family. Its phylogenetic signal is comparable to the

Rubus fruticosus L.: constituents, biological activities and health related uses.

Science.gov (United States)

Zia-Ul-Haq, Muhammad; Riaz, Muhammad; De Feo, Vincenzo; Jaafar, Hawa Z E; Moga, Marius

2014-07-28

Rubus fruticosus L. is a shrub famous for its fruit called blackberry fruit or more commonly blackberry. The fruit has medicinal, cosmetic and nutritive value. It is a concentrated source of valuable nutrients, as well as bioactive constituents of therapeutic interest highlighting its importance as a functional food. Besides use as a fresh fruit, it is also used as ingredient in cooked dishes, salads and bakery products like jams, snacks, desserts, and fruit preserves. R. fruticosus contains vitamins, steroids and lipids in seed oil and minerals, flavonoids, glycosides, terpenes, acids and tannins in aerial parts that possess diverse pharmacological activities such as antioxidant, anti-carcinogenic, anti-inflammatory, antimicrobial anti-diabetic, anti-diarrheal, and antiviral. Various agrogeoclimatological factors like cultivar, environmental conditions of the area, agronomic practices employed, harvest time, post-harvest storage and processing techniques all influence the nutritional composition of blackberry fruit. This review focuses on the nutrients and chemical constituents as well as medicinal properties of different parts of R. fruticosus. Various cultivars and their physicochemical characteristics, polyphenolic content and ascorbic acid content are also discussed. The information in the present work will serve as baseline data and may lead to new biomedical applications of R. fruticosus as functional food.

Rubus Fruticosus L.: Constituents, Biological Activities and Health Related Uses

Directory of Open Access Journals (Sweden)

Muhammad Zia-Ul-Haq

2014-07-01

Full Text Available Rubus fruticosus L. is a shrub famous for its fruit called blackberry fruit or more commonly blackberry. The fruit has medicinal, cosmetic and nutritive value. It is a concentrated source of valuable nutrients, as well as bioactive constituents of therapeutic interest highlighting its importance as a functional food. Besides use as a fresh fruit, it is also used as ingredient in cooked dishes, salads and bakery products like jams, snacks, desserts, and fruit preserves. R. fruticosus contains vitamins, steroids and lipids in seed oil and minerals, flavonoids, glycosides, terpenes, acids and tannins in aerial parts that possess diverse pharmacological activities such as antioxidant, anti-carcinogenic, anti-inflammatory, antimicrobial anti-diabetic, anti-diarrheal, and antiviral. Various agrogeoclimatological factors like cultivar, environmental conditions of the area, agronomic practices employed, harvest time, post-harvest storage and processing techniques all influence the nutritional composition of blackberry fruit. This review focuses on the nutrients and chemical constituents as well as medicinal properties of different parts of R. fruticosus. Various cultivars and their physicochemical characteristics, polyphenolic content and ascorbic acid content are also discussed. The information in the present work will serve as baseline data and may lead to new biomedical applications of R. fruticosus as functional food.

Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia

Directory of Open Access Journals (Sweden)

Roberta Maria Savieto

2016-03-01

Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.

Systematic studies on Anopheles galvaoi Causey, Deane & Deane from the subgenus Nysssorhynchus blanchard (Diptera: Culicidae

Directory of Open Access Journals (Sweden)

Maria Anice Mureb Sallum

2002-12-01

Full Text Available Anopheles galvaoi, a member of the subgenus Nyssorhynchus, is redescribed based on morphological characters of the adults male and female, fourth-instar larva and pupa. Female, male genitalia, larval and pupal stages are illustrated. Data about medical importance, bionomics, and distribution are given based on literature records. Adult female of An. galvaoi can be easily misidentified as An. benarrochi Gabaldón and An. aquasalis Curry. A few characters are indicated for identifying female and immatures of An. galvaoi. Phylogenetic relationships among An. galvaoi and six other species of the Oswaldoi Subgroup are estimated using COII mtDNA and ITS2 rDNA gene sequences. Lectotype of An. galvaoi, an adult female from Rio Branco, State of Acre, is invalidated.

LICOR DE MORA DE CASTILLA (Rubus glaucus Benth CON DIFERENTES PORCENTAJES DE PULPA BLACKBERRY LIQUOR (Rubus glaucus Benth WITH DIFFERENT PULP PERCENTAGES

Directory of Open Access Journals (Sweden)

Álvaro Montoya Gómez

2005-12-01

Full Text Available La mora de Castilla (Rubus glaucus Benth es una fruta de interés comercial y altamente perecedera, que presenta deterioro debido a su fragilidad e inadecuado manejo poscosecha, cantidades apreciables de fruta son afectadas, básicamente en sus características físicas, siendo este producto apto para el procesamiento industrial. Veinte kg de mora fueron despulpados, homogenizados y caracterizada la pulpa, determinando; grados brix de 6,0; porcentaje de acidez de 2,91 % y densidad de 0,991 g/ml en promedio. Se formularon licores, con una participación de la pulpa del 25 %, 30 %, 35 %, 40 %, 45 %, 50 % y 55 % iniciando con 35 °Brix, para todos los casos en el mosto fermentable, ajustando las formulaciones con sacarosa; la levadura inoculada fue Saccharomyces cerevisiae Meyen ex E.C. Hansen en concentración del 0,2 %; la fermentación se llevó a cabo en reactores con capacidad de 2 litros, con desfogue de manguera de látex, el mosto fermentable fue dejado en los reactores durante 20 semanas, luego los licores fueron filtrados y caracterizados físico-químicamente, evaluando el porcentaje de alcohol por destilación, encontrando que el porcentaje de 40 % de participación de pulpa, fue el de mayor concentración con 8,36 % de volumen de alcohol en promedio. Los resultados estadísticos mostraron una diferencia significativa entre los porcentajes de participación de pulpa y su influencia sobre la producción de alcohol para los valores de 25 % y 30 % con respecto a los porcentajes 35 %, 40 %, 45 %, 50 % y 55 %. Un modelo matemático lineal apropiado para la producción de alcohol en función de la participación de pulpa fue obtenido. La prueba sensorial con 10 jueces, mostró que el licor preparado con 35 % de participación de pulpa, fue el de mayor aceptación.The blackberry (Rubus glaucus Benth is a fruit of commercial interest that is highly perishable, showing appreciable damage due to fragileness and inadequate pos-harvesting handling

Overlooked cryptic endemism in copepods: systematics and natural history of the calanoid subgenus Occidodiaptomus Borutzky 1991 (Copepoda, Calanoida, Diaptomidae).

Science.gov (United States)

Marrone, Federico; Lo Brutto, Sabrina; Hundsdoerfer, Anna K; Arculeo, Marco

2013-01-01

Our comprehension of the phylogeny and diversity of most inland-water crustaceans is currently hampered by their pronounced morphological bradytely, which contributed to the affirmation of the "Cosmopolitanism Paradigm" of freshwater taxa. However, growing evidence of the existence of cryptic diversity and molecular regionalism is available for calanoid copepods, thus stressing the need for careful morphological and molecular studies in order to soundly investigate the systematics, diversity and distribution patterns of the group. Diaptomid copepods were here chosen as model taxa, and the morphological and molecular diversity of the species belonging to the west-Mediterranean diaptomid subgenus Occidodiaptomus were investigated with the aim of comparing the patterns of morphological and molecular evolution in freshwater copepods. Three species currently lumped under the binomen Hemidiaptomus (Occidodiaptomus) ingens and two highly divergent clades within H. (O.) roubaui were distinguished, thus showing an apparent discordance between the molecular distances recorded and Occidodiaptomus morphological homogeneity, and highlighting a noteworthy decoupling between the morphological and molecular diversity in the subgenus. Current Occidodiaptomus diversity pattern is ascribed to a combined effect of ancient vicariance and recent dispersal events. It is stressed that the lack of sound calibration points for the molecular clock makes it difficult to soundly temporally frame the diversification events of interest in the taxon studied, and thus to asses the role of morphological bradytely and of accelerated molecular evolutionary rates in shaping the current diversity of the group. Copyright © 2012 Elsevier Inc. All rights reserved.

Comparison of protein patterns after two-dimensional gel electrophoresis from leaves of in vitro cultures and seedlings of Rubus chamaemorus L.

Directory of Open Access Journals (Sweden)

Barbara Thiem

2014-01-01

Full Text Available Proteins from leaves of Rubus chamaemorus propagated in vitro were subjected to miniaturized 2-D electrophoresis. The 2-DE patterns of proteins showed qualitative differences between plants propagated in vitro and control seedlings. More proteins of a high molecular weight were observed in leaves of plants from in vitro culture. A two-dimensional map of proteins from leaves provides detailed data concerning both polymorphism and protein patterns of this species. This makes it possible to start constructing a protein map of R. chamaemorus. The reasons for qualitative differences are discussed.

Evaluación de un sistema para la micorrización in vitro en plantas de mora de castilla (Rubus glaucus)

OpenAIRE

Pérez Moncada, Urley Adrián

2011-01-01

El efecto benéfico que tiene los Hongos Formadores de Micorriza Arbuscular (HFMA) sobre la nutrición y el crecimiento de plantas micropropagadas ha sido bien documentado. Sin embargo, la mayoría de estos estudios han sido realizados bajo condiciones ex vitro, en invernadero o campo. Hasta el momento no se han realizado estudios de la respuesta de mora de castilla (Rubus glaucus) a la micorrización in vitro. En este trabajo, se pudo obtener un sistema de micorrización in vitro en sistemas de c...

Leishmania naiffi and Leishmania guyanensis reference genomes highlight genome structure and gene evolution in the Viannia subgenus.

Science.gov (United States)

Coughlan, Simone; Taylor, Ali Shirley; Feane, Eoghan; Sanders, Mandy; Schonian, Gabriele; Cotton, James A; Downing, Tim

2018-04-01

The unicellular protozoan parasite Leishmania causes the neglected tropical disease leishmaniasis, affecting 12 million people in 98 countries. In South America, where the Viannia subgenus predominates, so far only L. ( Viannia ) braziliensis and L. ( V. ) panamensis have been sequenced, assembled and annotated as reference genomes. Addressing this deficit in molecular information can inform species typing, epidemiological monitoring and clinical treatment. Here, L. ( V. ) naiffi and L. ( V. ) guyanensis genomic DNA was sequenced to assemble these two genomes as draft references from short sequence reads. The methods used were tested using short sequence reads for L. braziliensis M2904 against its published reference as a comparison. This assembly and annotation pipeline identified 70 additional genes not annotated on the original M2904 reference. Phylogenetic and evolutionary comparisons of L. guyanensis and L. naiffi with 10 other Viannia genomes revealed four traits common to all Viannia : aneuploidy, 22 orthologous groups of genes absent in other Leishmania subgenera, elevated TATE transposon copies and a high NADH-dependent fumarate reductase gene copy number. Within the Viannia , there were limited structural changes in genome architecture specific to individual species: a 45 Kb amplification on chromosome 34 was present in all bar L. lainsoni , L. naiffi had a higher copy number of the virulence factor leishmanolysin, and laboratory isolate L. shawi M8408 had a possible minichromosome derived from the 3' end of chromosome 34 . This combination of genome assembly, phylogenetics and comparative analysis across an extended panel of diverse Viannia has uncovered new insights into the origin and evolution of this subgenus and can help improve diagnostics for leishmaniasis surveillance.

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Impact of agrochemicals on Peronospora sparsa and phenolic profiles in three Rubus arcticus cultivars.

Science.gov (United States)

Hukkanen, Anne; Kostamo, Katri; Kärenlampi, Sirpa; Kokko, Harri

2008-02-13

The main arctic bramble ( Rubus arcticus) cultivars are susceptible to downy mildew ( Peronospora sparsa), which seriously threatens the cultivation. The efficiency of Aliette, Euparen M, phosphite-containing Phosfik, Phostrol, Farm-Fos-44, and Kaliumfosfiet, as well as Bion was evaluated in the greenhouse. Fewer symptoms and less Peronospora DNA were found in plants treated with Euparen M and Bion, whereas Aliette, Phosfik, and Phostrol gave moderate protection. Three arctic bramble cultivars showed varying susceptibility to P. sparsa. An inexpensive and fast in vitro plate test gave results parallel with those obtained in the greenhouse. Quantitative differences were found in the phenolic profiles of the leaves of different cultivars and in different treatments. Several phenolic compounds were tentatively identified in arctic bramble for the first time, for example, monomeric and oligomeric ellagitannins and galloylglucoses. Negative correlation was found between the amount of P. sparsa DNA and flavonol glycosides and some ellagitannins in the leaves 8 days after inoculation, suggesting a possible role for these phenolics in the defense.

Phylogeography, population structure and evolution of coral-eating butterflyfishes (Family Chaetodontidae, genus Chaetodon , subgenus Corallochaetodon )

KAUST Repository

Waldrop, Ellen

2016-01-11

Aim This study compares the phylogeography, population structure and evolution of four butterflyfish species in the Chaetodon subgenus Corallochaetodon, with two widespread species (Indian Ocean – C. trifasciatus and Pacific Ocean – C. lunulatus), and two species that are largely restricted to the Red Sea (C. austriacus) and north-western (NW) Indian Ocean (C. melapterus). Through extensive geographical coverage of these taxa, we seek to resolve patterns of genetic diversity within and between closely related butterflyfish species in order to illuminate biogeographical and evolutionary processes. Location Red Sea, Indian Ocean and Pacific Ocean. Methods A total of 632 individuals from 24 locations throughout the geographical ranges of all four members of the subgenus Corallochaetodon were sequenced using a 605 bp fragment (cytochrome b) of mtDNA. In addition, 10 microsatellite loci were used to assess population structure in the two widespread species. Results Phylogenetic reconstruction indicates that the Pacific Ocean C. lunulatus diverged from the Indian Ocean C. trifasciatus approximately 3 Ma, while C. melapterus and C. austriacus comprise a cluster of shared haplotypes derived from C. trifasciatus within the last 0.75 Myr. The Pacific C. lunulatus had significant population structure at peripheral locations on the eastern edge of its range (French Polynesia, Johnston Atoll, Hawai\\'i), and a strong break between two ecoregions of the Hawaiian Archipelago. The Indian Ocean C. trifasciatus showed significant structure only at the Chagos Archipelago in the central Indian Ocean, and the two range-restricted species showed no population structure but evidence of recent population expansion. Main conclusions Patterns of endemism and genetic diversity in Corallochaetodon butterflyfishes have been shaped by (1) Plio-Pleistocene sea level changes that facilitated evolutionary divergences at biogeographical barriers between Indian and Pacific Oceans, and the Indian

Growth and differentiation on a trypanosome of the subgenus Schizotrypanum from the bat Phyllostomus hastatus

Directory of Open Access Journals (Sweden)

Sônia I. Hamanaka

1993-12-01

Full Text Available The effects of temperature, pH, osmolarity and aeration on the growth and differentiation of a trypanosome ofthe subgenus Schizotrypanum isolatedfrom the bat Phyllostomus hastatus were studied. In general, the growth characteristics ofthe flagellate were similar to those of Trypanosoma (Schizotrypanum cruzi. However, the parasite did not growth at 33 or 37C. Increase in the osmolarity and aeration promoted growth at 33C. Significant metacyclogenesis was detected only in the growth condition where maximal growth occured (28C, pH 7.3, 380m0s/kg, in tissue cullure flasks, at the end ofthe exponential growth phase. The begining of the metacyclogenesis process was coincident with most glucose utilization and lowest pH. During metacyclogenesis both culture medium pH and osmolarity increased steadly.

Systematics and biology of Xylocopa subgenus Schonnherria (Hymenoptera, Apidae) in Argentina.

Science.gov (United States)

Lucia, Mariano; Gonzalez, Victor H; Abrahamovich, Alberto H

2015-01-01

Biological information on the species of the large carpenter bee Xylocopa subgenus Schonnherria occurring in Argentina is revised. Based on the appraisal of museum specimens, the study of type material, and field surveys conducted across 15 provinces between 2007 and 2011, the following seven species are recognized for the country: Xylocopa bambusae Schrottky, Xylocopa chrysopoda Schrottky, Xylocopa macrops Lepeletier de Saint Fargeau, Xylocopa simillima Smith Xylocopa splendidula Lepeletier de Saint Fargeau, Xylocopa pulchra Smith, and Xylocopa viridis Smith. Previous literature records of Xylocopa dimidiata Latreille, Xylocopa subcyanea Pérez, and Xylocopa varians Smith for the province of Misiones appear to have been misidentified specimens, although the presence of these species in Argentina cannot be entirely ruled out given the proximity of this province to Brazil and Paraguay where they occur; Xylocopa boops Maidl was described from a male specimen with unusually enlarged eyes and is newly synonymized under Xylocopa macrops. Males and females of all species are diagnosed, described, and figured, including details of the male genitalia. Taxonomic comments, data on the geographical distribution and nesting substrates, and identification keys to all Argentinean species of Schonnherria are provided. The nesting biologies of Xylocopa splendidula and Xylocopa viridis are documented.

Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

Science.gov (United States)

Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

2010-01-01

Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

Two new species and a new subgenus of toothed Brachyhypopomus electric knifefishes (Gymnotiformes, Hypopomidae) from the central Amazon and considerations pertaining to the evolution of a monophasic electric organ discharge.

Science.gov (United States)

Sullivan, John P; Zuanon, Jansen; Cox Fernandes, Cristina

2013-01-01

We describe two new, closely related species of toothed Brachyhypopomus (Hypopomidae: Gymnotiformes: Teleostei) from the central Amazon basin and create a new subgenus for them. Odontohypopomus, new subgenus of Brachyhypopomus, is diagnosed by (1) small teeth present on premaxillae; (2) medialmost two branchiostegal rays thin with blades oriented more vertically than remaining three rays; (3) background color in life (and to lesser extent in preservation) distinctly yellowish with head and sides peppered with small, widely spaced, very dark brown stellate chromatophores that greatly contrast with light background coloration; (4) a dark blotch or bar of subcutaneous pigment below the eye; (5) electric organ discharge waveform of very long duration (head-positive phase approx. 2 milliseconds or longer, head-negative phase shorter or absent) and slow pulse repetition rate (3-16 Hz). The type species of the new subgenus, Brachyhypopomus (Odontohypopomus) walteri sp. n., is diagnosed by the following additional character states: (1) subcutaneous dark pigment at base of orbit particularly prominent, (2) body semi-translucent and nearly bright yellow background coloration in life, (3) a biphasic electric organ discharge (EOD) waveform of very long duration (between 3.5 and 4 milliseconds at 25° C) with head-positive first phase significantly longer than second head-negative phase in both sexes. Brachyhypopomus (Odontohypopomus) bennetti sp. n. is diagnosed by two character states in addition to those used to diagnose the subgenus Odontohypopomus: (1) a deep electric organ, visible as large semi-transparent area, occupying approximately 14-17% body depth directly posterior to the abdominal cavity in combination with a short, but deep, caudal filament, and (2) a monophasic, head-positive EOD waveform, approximately 2.1 milliseconds in duration in both sexes. These are the only described rhamphichthyoid gymnotiforms with oral teeth, and Brachyhypopomus bennetti is the first

Capalictus, a new subgenus of Lasioglossum Curtis 1833 from South Africa, with description of three new species (Hymenoptera, Apoidea, Halictidae

Directory of Open Access Journals (Sweden)

Jason Gibbs

2012-11-01

Full Text Available Capalictus, a new subgenus of Lasioglossum Curtis, 1833 (Hymenoptera, Apoidea, Halic-tidae, endemic to the South African Cape Province, is described. The type species is Halictus mosselinus Cockerell, 1945. Evylaeus (Sellalictus fynbosensis (Pauly et al., 2008 is a new junior synonym of L. (C. mosselinum. Three new species are described: Lasioglossum (Capalictus hantamense sp. nov., L. (C. tigrinum sp. nov. and L. (C. timmermanni sp. nov. DNA sequence data from three nuclear genes support morphologically-determined species limits. Capalictus is a basal clade of the Hemihalictus series of Lasioglossum.

Saccharomyces cerevisiae mixed culture of blackberry (Rubus ulmifolius L.) juice: synergism in the aroma compounds production.

Science.gov (United States)

Bautista-Rosales, Pedro Ulises; Ragazzo-Sánchez, Juan Arturo; Ruiz-Montañez, Gabriela; Ortiz-Basurto, Rosa Isela; Luna-Solano, Guadalupe; Calderón-Santoyo, Montserrat

2014-01-01

Blackberry (Rubus sp.) juice was fermented using four different strains of Saccharomyces cerevisiae (Vitilevure-CM4457, Enoferm-T306, ICV-K1, and Greroche Rhona-L3574) recognized because of their use in the wine industry. A medium alcoholic graduation spirit (industrial scale was obtained. Alcoholic fermentations were performed at 28°C, 200 rpm, and noncontrolled pH. The synergistic effect on the aromatic compounds production during fermentation in mixed culture was compared with those obtained by monoculture and physic mixture of spirits produced in monoculture. The aromatic composition was determined by HS-SPME-GC. The differences in aromatic profile principally rely on the proportions in aromatic compounds and not on the number of those compounds. The multivariance analysis, principal component analysis (PCA), and factorial discriminant analysis (DFA) permit to demonstrate the synergism between the strains.

Mass of 17O from Penning-trap mass spectrometry and molecular spectroscopy: A precision test of the Dunham-Watson model in carbon monoxide

International Nuclear Information System (INIS)

Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.

2010-01-01

By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .

Palaearctic Hoplitis bees of the subgenus Platosmia (Megachilidae, Osmiini): biology, taxonomy and key to species.

Science.gov (United States)

Müller, Andreas

2015-03-18

Platosmia, a subgenus of the osmiine bee genus Hoplitis (Megachilidae), contains ten species, which are confined to desertic and semidesertic areas of the Palaearctic region. Analysis of female pollen loads and field observations indicate that several H. (Platosmia) species are strictly oligolectic on Reseda (Resedaceae) and possibly Hedysareae (Fabaceae), while others are mesolectic on both Reseda and Fabaceae. The few data available so far suggest that preexisting cavities in stones and rocks serve as nesting sites of H. (Platosmia). The taxonomic revision of H. (Platosmia) revealed the existence of an undescribed species from the Arabian peninsula, H. arabiae spec. nov.. Hoplitis incognita Zanden, 1996 and H. quarzazati (Zanden, 1998) are newly synonymized with H. maghrebensis (Zanden, 1992) and H. platalea (Warncke, 1990), respectively. Identification keys for all H. (Platosmia) species are given including the hitherto unknown male or female sex of three species.

[The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

Science.gov (United States)

Hagemann, Rudolf

2007-01-01

At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

Science.gov (United States)

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Saccharomyces cerevisiae Mixed Culture of Blackberry (Rubus ulmifolius L. Juice: Synergism in the Aroma Compounds Production

Directory of Open Access Journals (Sweden)

Pedro Ulises Bautista-Rosales

2014-01-01

Full Text Available Blackberry (Rubus sp. juice was fermented using four different strains of Saccharomyces cerevisiae (Vitilevure-CM4457, Enoferm-T306, ICV-K1, and Greroche Rhona-L3574 recognized because of their use in the wine industry. A medium alcoholic graduation spirit (<6GL° with potential to be produced at an industrial scale was obtained. Alcoholic fermentations were performed at 28C°, 200 rpm, and noncontrolled pH. The synergistic effect on the aromatic compounds production during fermentation in mixed culture was compared with those obtained by monoculture and physic mixture of spirits produced in monoculture. The aromatic composition was determined by HS-SPME-GC. The differences in aromatic profile principally rely on the proportions in aromatic compounds and not on the number of those compounds. The multivariance analysis, principal component analysis (PCA, and factorial discriminant analysis (DFA permit to demonstrate the synergism between the strains.

From introduced American weed to Cape Verde Islands endemic: the case of Solanum rigidum Lam. (Solanaceae, Solanum subgenus Leptostemonum).

Science.gov (United States)

Knapp, Sandra; Vorontsova, Maria S

2013-01-01

A Solanum species long considered an American introduction to the Cape Verde Islands off the west coast of Africa is identified as Solanum rigidum, a member of the Eggplant clade of Old World spiny solanums (Solanum subgenus Leptostemonum) and is probably endemic to the Cape Verde Islands. Collections of this species from the Caribbean are likely to have been introduced from the Cape Verde Islands on slave ships. We discuss the complex nomenclatural history of this plant and provide a detailed description, illustration and distribution map. The preliminary conservation status of Solanum rigidum is Least Concern, but needs to be reassessed in light of its endemic rather than introduced status.

Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

Science.gov (United States)

Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

2014-01-01

The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

Quality baseline of the castilla blackberry (Rubus glaucus in its food chain

Directory of Open Access Journals (Sweden)

Fernanda Iza

2016-09-01

Full Text Available A proposal for improvement in the performance of the food chain of castilla blackberry (Rubus glaucus in order to potentiate their productivity can only start from a baseline or situational diagnosis of the quality of the fruit and hence identify the main points of improvement. The food chain of the fruit identifies three stages, harvest, post-harvest (storage and transport and marketing or sale. The diagnosis in each stage began with reverse mode. It was identified the most representative producer and the supplying for traders to the point of sale. The quality evaluation of the fruit was performed through chemical and physical characterization in the four stages. Weight loss or losses were evident in all stages, light no significant changes of color from bright red bluish hue in the collection stage until opaque bluish red or off, at the stage of sale due to the short cycle time and the characteristics non-climacteric fruit. However, at all stages of collection, storage, transportation and sale, they presented significant changes in the indices of maturity which meant an increase of sugars, decreased of pH, and increase acidity. The results indicate that the fruit changed its physicochemical characteristics during the stages of the food chain affecting its productivity.

A new subgenus of the weevil genus Otiorhynchus Germar, 1822 (Coleoptera: Curculionidae: Entiminae for a new species from Mediterranean Turkey associated with the carob tree, Ceratonia siliqua L. (Fabaceae

Directory of Open Access Journals (Sweden)

Genrik E. Davidian

2017-03-01

Full Text Available A new species Otiorhynchus ceratoniae Davidian, Gültekin & Korotyaev sp. nov. is described from eastern Mediterranean Turkey. A new monotypic subgenus Arnoldinus Davidian, Gültekin & Korotyaev subgen. nov. is erected for this species. The new species was found only under Ceratonia siliqua L. trees with lower leaves damaged by adults.

The phenology of Rubus fruticosus in Ireland: herbarium specimens provide evidence for the response of phenophases to temperature, with implications for climate warming

Science.gov (United States)

Diskin, E.; Proctor, H.; Jebb, M.; Sparks, T.; Donnelly, A.

2012-11-01

To date, phenological research has provided evidence that climate warming is impacting both animals and plants, evidenced by the altered timing of phenophases. Much of the evidence supporting these findings has been provided by analysis of historic records and present-day fieldwork; herbaria have been identified recently as an alternative source of phenological data. Here, we used Rubus specimens to evaluate herbaria as potential sources of phenological data for use in climate change research and to develop the methodology for using herbaria specimens in phenological studies. Data relevant to phenology (collection date) were recorded from the information cards of over 600 herbarium specimens at Ireland's National Herbarium in Dublin. Each specimen was assigned a score (0-5) corresponding to its phenophase. Temperature data for the study period (1852 - 2007) were obtained from the University of East Anglia's Climate Research Unit (CRU); relationships between temperature and the dates of first flower, full flower, first fruit and full fruit were assessed using weighted linear regression. Of the five species of Rubus examined in this study, specimens of only one ( R. fruticosus) were sufficiently abundant to yield statistically significant relationships with temperature. The results revealed a trend towards earlier dates of first flower, full flower and first fruit phenophases with increasing temperature. Through its multi-phenophase approach, this research serves to extend the most recent work—which validated the use of herbaria through use of a single phenophase—to confirm herbarium-based research as a robust methodology for use in future phenological studies.

The ultrastructure of epidermal surface of stem and branch internods and spores of horsetails of subgenus Equisetum (Equisetum L., Equisetaceae

Directory of Open Access Journals (Sweden)

D. S. Feoktistov

2016-03-01

Full Text Available Ultrastructure of epidermal surface of stems and branches internodes of 5 species and 3 interspecific hybrids were studied using scanning electron microscopy, as well as spore surface of 5 species of horsetail subgenus Equisetum (Equisetum, Equisetaceae: E. arvense L., E. fluviatile L., E. palustre L., E. pratense Ehrh., E. sylvaticum L., E. × mildeanum Rothm. (E. pratense × E. sylvaticum, E. × sergijevskianum C. N. Page et Gureeva (E. pratense × E. palustre, E. × lofotense Lubienski (E. arvense × E. sylvaticum. Sculptural elements from silica differ in shape, size and location on the ridges and furrows of stem and branches internodes. There are: the thin longitudinal some­times anastomosing thread-like structures (ribs, cylindrical, rounded on the tip, or conical mamillae, tubercles and spines. The thin longitudinal ribs, tubercles and spines are situated on the ridges of stem and branches; separate mamillae and groups of fused mamillae occupy the furrows. The fine surface sculpturing consists of hemispherical, globose or slightly elongate pilulae covering mamillae, surface in furrows, and especially stomata. Equisetum palustre has specific club-shaped rods arranged into regular ranks along either side of the stomatal slit. A detailed description of silica sculpture, shape, disposition and ornamentation of stomata area are presented for all studied species and hybrids. Such features as the presence, shape and arrangement of sculpture elements, ornamentation, shape and arrangement of sto­mata can be used in the taxonomy and phylogenetics of horsetails. Spores of the members of subgenus Equisetum are spherical in shape. They have not specific ornamentation, their features may not be used in systematics of horsetails.

The conchostracan subgenus Orthestheria (Migransia) from the Tacuarembó Formation (Late Jurassic-?Early Cretaceous, Uruguay) with notes on its geological age

Science.gov (United States)

Yanbin, Shen; Gallego, Oscar F.; Martínez, Sergio

2004-04-01

Conchostracans from the Tacuarembó Formation s.s. of Uruguay are reassigned to the subgenus Orthestheria (Migransia) Chen and Shen. They show more similarities to genera of Late Jurassic age in the Congo Basin and China than to those of Early Cretaceous age. On the basis of the character of the conchostracans, we suggest that the Tacuarembó Formation is unlikely to be older than Late Jurassic. It is probably Kimmeridgian, but an Early Cretaceous age cannot be excluded. This finding is consistent with isotopic dating of the overlying basalts, as well as the age range of recently described fossil freshwater sharks.

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

Science.gov (United States)

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

Science.gov (United States)

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

Science.gov (United States)

Bende, Attila; Muntean, Cristina M

2014-03-01

The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Rubus rosaefolius extract as a natural preservative candidate in topical formulations.

Science.gov (United States)

Ostrosky, Elissa Arantes; Marcondes, Elda Maria Cecilio; Nishikawa, Suzana de Oliveira; Lopes, Patricia Santos; Varca, Gustavo Henrique Costa; Pinto, Terezinha de Jesus Andreoli; Consiglieri, T Vladi Olga; Baby, Andre Rolim; Velasco, Maria Valéria Robles; Kaneko, Telma Mary

2011-06-01

Even though the synthetic preservatives may offer a high antimicrobial efficacy, they are commonly related to adverse reactions and regarded as having potentially harmful effects caused by chronic consumption. The development of natural preservatives provides a way of reducing the amount of synthetic preservatives normally used in pharmaceutical and cosmetic preparations. In addition, these agents have less toxic effects and represent a possible natural and safer alternative of the preservatives. The purpose of this research was to evaluate the Rubus rosaefolius Smith extract efficiency as a natural preservative in base formulations. Of the extract, 0.2% (w/w) was assayed for its effectiveness of antimicrobial protection in two different base formulations (emulsion and gel). The microbial challenge test was performed following the standard procedures proposed by The United States Pharmacopoeia 33nd, European Pharmacopoeia 6th, Japanese Pharmacopoeia 15th, and the Cosmetics, Toiletries, and Fragrance Association using standardized microorganisms. The results demonstrated that R. rosaefolius extract at the studied concentration reduced the bacterial inocula, satisfying the criterion in all formulations, even though it was not able to present an effective preservative behavior against fungi. Thus, the investigation of new natural substances with preservative properties that could be applied in pharmaceutical and cosmetic products is relevant due to the possibility of substituting or decreasing the concentration of synthetic preservatives, providing a way for the development of safer formulas for the use of consumers.

Identification and quantification of phenolic compounds in berries of Fragaria and Rubus species (family Rosaceae).

Science.gov (United States)

Määttä-Riihinen, Kaisu R; Kamal-Eldin, Afaf; Törrönen, A Riitta

2004-10-06

High-performance liquid chromatography combined with diode array and electrospray ionization mass spectrometric detection was used to study soluble and insoluble forms of phenolic compounds in strawberries, raspberries (red and yellow cultivated and red wild), arctic bramble, and cloudberries. Hydroxycinnamic acids were present as free forms in cloudberries and mainly as sugar esters in the other berries. Quercetin 3-glucuronide was the typical flavonol glycoside in all of the berries studied. The composition of the predominant anthocyanins can be used to distinguish the studied red Rubus species from each other since cyanidin was glycosylated typically with 3-sophorose (56%) in cultivated red raspberry, with 3-sophorose (30%) and 3-glucose (27%) in wild red raspberry, and with 3-rutinose (80%) in arctic bramble. Ellagic acid was present as free and glycosylated forms and as ellagitannins of varying degrees of polymerization. Comparable levels of ellagitannins were obtained by the analysis of soluble ellagitannins as gallic acid equivalents and by the analysis of ellagic acid equivalents released by acid hydrolysis of the extracts.

Characterization of seed oils from fresh Bokbunja (Rubus coreanus Miq.) and wine processing waste.

Science.gov (United States)

Ku, C S; Mun, S P

2008-05-01

The physicochemical characteristics, fatty acid (FA) profile, and triacylglyceride (TAG) composition of seed oils from fresh Bokbunja (Rubus coreanus Miq.) fruits and traditional Bokbunja wine processing waste were determined in this study. Oil contents of the fresh seeds and the seeds from wine processing waste were similar, accounting for about 18% of dry weight. The free fatty acid (FFA) content between the two seed oils was significantly different (0.50% for fresh seed oil and 73.14% for wine seed oil). Iodine, conjugated diene, saponification values, and unsaponifiable matter were very similar in the oil samples, but the specific extinction coefficients at 232 and 270 nm of wine seed oil were higher than those of fresh seed oil. Linoleic (C18:2, 50.45-53.18%, L) and linolenic (C18:3, 29.36-33.25%, Ln) acids were the dominant FAs in the two seed oils, whereas oleic (C18:1, 7.32-8.04%, O), palmitic (C16:0, 1.55-1.65%, P), and stearic (C18:0, 0.65-0.68%, S) acids were the minor FAs. LLL, OLL, LLLn, OOL, LLnLn, and OOO were the abundant TAGs, representing >90% of the oils.

Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

Czech Academy of Sciences Publication Activity Database

Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

2003-01-01

Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

Science.gov (United States)

Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

2014-01-01

In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

Science.gov (United States)

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition

Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

Science.gov (United States)

Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

2014-04-01

The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Preliminary assessment of AFLP fingerprinting of Rubus glaucus Benth. elite genotypes

Directory of Open Access Journals (Sweden)

Duarte Delgado Diana

2011-04-01

Full Text Available

The Andean blackberry (Rubus glaucus Benth. is a promissory fruit crop for Colombia with potential to become an international commodity due to its high nutritional and nutraceutical value. Farmer genotypes from the national R. glaucus collection were selected from eight outstanding accessions according to their nutritional and agronomic value, for distribution among local producers. The goal of this work is to evaluate the genomic fingerprint by AFLP analysis of these elite genotypes using three primer combinations. From 179 total amplified loci produced by the three combinations, 20% resulted polymorphic. The EAGG/MCTT combination was the most informative with a 32% polymorphism and greater discrimination power. The genotypes tested showed a high average similarity (96% and the accessions San Antonio and ILS-1863 formed independent groups with good statistical support in the clustering analysis. The remaining accessions did not form discrete groups with good support (<50%, probably due to genetic homogeneity among them and/or low resolving power of markers. This study is one of the first attempts to generate a genomic fingerprint of these farmer elite genotypes for protection, seed certification and future support to breeding programs.

El relato de la experiencia depresiva: Aplicando los factores cuidativos de Jean Watson The expression of the depressive experience: the application of Jean Watson caring factors

Directory of Open Access Journals (Sweden)

Carme Ferré-Grau

2008-03-01

Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with

The Towers Watson Approach to Improving Corporate Wellness.

Science.gov (United States)

Wootton, Adam

2012-06-01

Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.

Case study: IBM Watson Analytics cloud platform as Analytics-as-a-Service system for heart failure early detection

OpenAIRE

Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto

2016-01-01

In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...

Evaluación del desarrollo de Salíx humboldtiana, Erythrina edulis y Trichantera gigantea asociados al cultivo de mora sin espina (Rubus glaucus Benth)

OpenAIRE

Guapacha, Cristiam Camilo; Mesa, Jhon Jairo; Patiño, Andrés Alfonso

2015-01-01

En el Municipio de Quinchía, Departamento de Risaralda (Colombia), se evaluó el desarrollo de los tutores vivos Salíx humboldtiana, Erythrina edulis y Trichantera gigantea asociados al cultivo de mora sin espina (Rubus glaucus Benth), también la incidencia de Peronospora sparsa y Oidium sp en plantas de mora asociadas a estos sistemas agroforestales. Se utilizo un diseño de bloques al azar con tres repeticiones cada uno. Los resultados indican que Erythrina edulis es el tutor con mejor adapta...

Teoria do cuidado transpessoal de jean watson no cuidado domiciliar de enfermagem a crianca: uma reflexao

Directory of Open Access Journals (Sweden)

Ingrid Meireles Gomes

2013-09-01

Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.

Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration

Science.gov (United States)

Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell

2018-01-01

Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.

Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-06-21

Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

Science.gov (United States)

Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

2018-04-01

Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

Applications of the Galton-Watson process to human DNA evolution and demography

CERN Document Server

Neves, A G M

2005-01-01

We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...

William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

Science.gov (United States)

Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

2013-11-01

William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

EVALUACIÓN DE TRES NIVELES DE NITRÓGENO EN MEDIO DE CULTIVO, EN LAS FASES DE ENRAIZAMIENTO in vitro Y ADAPTACIÓN A SUSTRATO DE Rubus glaucus (BENTH)

OpenAIRE

Vaca, Ivonne; Landazuri, Pablo

2013-01-01

El presente trabajo fue desarrollado en el Cantón Rumiñahui, provincia de Pichincha, Ecuador. El objetivo fue evaluar tres concentraciones nitrógeno de las sales Murashige y Skooog (MS) en el medio de cultivo, en las fases de enraizamiento in vitro y adaptación a sustrato de Rubus glaucus. La dosis de 4,88mMde nitrógeno en elmedio presentó el mayor número de raíces con un promedio de 3,72 raíces por planta, mayor longitud de raíz con 1,8cm de largo, mayor porcentaje de enraizamiento ...

Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

Science.gov (United States)

Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

Mosquito Studies (Dipera: Culicidae) 34. A Revision of the Albimanus Section of the Subgenus Nyssorhynchus of Anopheles. (Contributions of the American Entomological Institute. Volume 15, Number 7, 1980)

Science.gov (United States)

1980-01-01

Lake, 20 Feb 1934, PAX 36, lM, 3F. Largo Reme [Remo], 1926, D. Curry, 1F. Mindi, 10 May 1941, C. Brown, PAX 176,31M, 28F. Mojinga Swamp, PA 1165...Pompeu Memoria 1956: 1-3; Guedes, Amorim and Schreiber 1957: 247-248; Schreiber and Guedes 1959b, 1960, 196 1) have studied the salivary glands of...of the taxonomy of anophelines (subgenus Nyssorhyn- thus). W H 0, Bull. 24:657-658. Schreiber, Giorgio and J. M. Pompeu Memoria 1956. Alguns

Mapping of A1 conferring resistance to the aphid Amphorophora idaei and dw (dwarfing habit in red raspberry (Rubus idaeus L. using AFLP and microsatellite markers

Directory of Open Access Journals (Sweden)

Knight Victoria H

2007-03-01

Full Text Available Abstract Background Raspberry breeding programmes worldwide aim to produce improved cultivars to satisfy market demands and within these programmes there are many targets, including increased fruit quality, yield and season, and improved pest and disease resistance and plant habit. The large raspberry aphid, Amphorophora idaei, transmits four viruses and vector resistance is an objective in raspberry breeding. The development of molecular tools that discriminate between aphid resistance genes from different sources will allow the pyramiding of such genes and the development of raspberry varieties with superior pest resistance. We have raised a red raspberry (Rubus idaeus F1 progeny from the cross 'Malling Jewel' × 'Malling Orion' (MJ × MO, which segregates for resistance to biotype 1 of the aphid Amphorophora idaei and for a second phenotypic trait, dwarf habit. These traits are controlled by single genes, denoted (A1 and (dw respectively. Results The progeny of 94 seedlings was scored for the segregation of 95 AFLP and 22 SSR markers and a linkage map was constructed that covers a total genetic distance of 505 cM over seven linkage groups. The average linkage group length was 72.2 cM and there was an average of 17 markers per linkage group, of which at least two were codominant SSRs, allowing comparisons with previously published maps of raspberry. The two phenotypic traits, A1 and dw, mapped to linkage groups 3 and 6 respectively. Conclusion The mapping of A1 will facilitate the discrimination of resistance genes from different sources and the pyramiding of aphid resistance genes in new raspberry cultivars; the mapping of dw will allow further investigations into the genetics of dwarfing habit in Rubus.

Extracts and Constituents of Rubus chingii with 1,1-Diphenyl-2-picrylhydrazyl (DPPH Free Radical Scavenging Activity

Directory of Open Access Journals (Sweden)

Hsiou-Yu Ding

2011-06-01

Full Text Available The 1,1-diphenyl-2-picrylhydrazyl (DPPH free radical scavenging activity of the fruits of Rubus chingii was studied in vitro. Ethanolic extract, ethyl acetate and n-butanol fractions from dried R. chingii fruits revealed strong DPPH free radical scavenging activity with IC50 values of 17.9, 3.4 and 4.0 µg/mL, respectively. The ethyl acetate and n-butanol fractions were further purified by a combination of silica gel chromatography, Lobar RP-8 chromatography, and high-pressure liquid chromatography (HPLC. Nine compounds were isolated, where methyl (3-hydroxy-2-oxo-2,3-dihydroindol-3-yl-acetate (2, vanillic acid (5, kaempferol (7, and tiliroside (9 showed stronger DPPH free radical scavenging activity than that of ascorbic acid (131.8 µM with IC50 values of 45.2, 34.9, 78.5, and 13.7 µM, respectively. In addition, rubusine (1 is a new compound discovered in the present study and methyl (3-hydroxy-2-oxo-2,3-dihydroindol-3-yl-acetate (2, methyl dioxindole-3-acetate (3, and 2-oxo-1,2-dihydroquinoline-4-carboxylic acid (4 were isolated from the fruits for the first time.

Application of Ultrasound in a Closed System: Optimum Condition for Antioxidants Extraction of Blackberry (Rubus fructicosus) Residues.

Science.gov (United States)

Zafra-Rojas, Quinatzin Y; Cruz-Cansino, Nelly S; Quintero-Lira, Aurora; Gómez-Aldapa, Carlos A; Alanís-García, Ernesto; Cervantes-Elizarrarás, Alicia; Güemes-Vera, Norma; Ramírez-Moreno, Esther

2016-07-21

Blackberry processing generates up to 20% of residues composed mainly of peel, seeds and pulp that are abundant in flavonoids. The objective of this study was to optimize the ultrasound conditions, in a closed system, for antioxidants extraction, using the response surface methodology. Blackberry (Rubus fructicosus) residues were analyzed for total phenolics, total anthocyanins, and antioxidant activity by ABTS and DPPH. The selected independent variables were ultrasound amplitude (X₁: 80%-90%) and extraction time (X₂: 10-15 min), and results were compared with conventional extraction methods. The optimal conditions for antioxidants extraction were 91% amplitude for 15 min. The results for total phenolic content and anthocyanins and antioxidant activity by ABTS and DPPH were of 1201.23 mg gallic acid equivalent (GAE)/100 g dry weight basis (dw); 379.12 mg/100 g·dw; 6318.98 µmol Trolox equivalent (TE)/100 g·dw and 9617.22 µmol TE/100 g·dw, respectively. Compared to solvent extraction methods (water and ethanol), ultrasound achieved higher extraction of all compounds except for anthocyanins. The results obtained demonstrated that ultrasound is an alternative to improve extraction yield of antioxidants from fruit residues such as blackberry.

Critique of the Watson-Glaser Critical Thinking Appraisal Test: The More You Know, the Lower Your Score

Directory of Open Access Journals (Sweden)

Kevin Possin

2014-12-01

Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.

Phenolic extracts of Rubus ulmifolius Schott flowers: characterization, microencapsulation and incorporation into yogurts as nutraceutical sources.

Science.gov (United States)

Martins, Ana; Barros, Lillian; Carvalho, Ana Maria; Santos-Buelga, Celestino; Fernandes, Isabel P; Barreiro, Filomena; Ferreira, Isabel C F R

2014-06-01

Rubus ulmifolius Schott (Rosaceae), known as wild blackberry, is a perennial shrub found in wild and cultivated habitats in Europe, Asia and North Africa. Traditionally, it is used for homemade remedies because of its medicinal properties, including antioxidant activity. In the present work, phenolic extracts of R. ulmifolius flower buds obtained by decoction and hydroalcoholic extraction were chemically and biologically characterized. Several phenolic compounds were identified in both decoction and hydroalcoholic extracts of flowers, ellagitannin derivatives being the most abundant ones, namely the sanguiin H-10 isomer and lambertianin. Additionally, comparing with the decoction form, the hydroalcoholic extract presented both higher phenolic content and antioxidant activity. The hydroalcoholic extract was thereafter microencapsulated in an alginate-based matrix and incorporated into a yogurt to achieve antioxidant benefits. In what concerns the performed incorporation tests, the obtained results pointed out that, among the tested samples, the yoghurt containing the microencapsulated extract presented a slightly higher antioxidant activity, and that both forms (free and microencapsulated extracts) gave rise to products with higher activity than the control. In conclusion, this study demonstrated the antioxidant potential of the R. ulmifolius hydroalcoholic extract and the effectiveness of the microencapsulation technique used for its preservation, thus opening new prospects for the exploitation of these natural phenolic extracts in food applications.

Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

Science.gov (United States)

Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

2017-11-16

 Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

How many tautomerization pathways connect Watson-Crick-like G*·T DNA base mispair and wobble mismatches?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.

ANALISIS KESALAHAN SISWA KELAS X MIA 3 SMA NEGERI 1 TANJUNGPINANG TAHUN PELAJARAN 2015/2016 DALAM MENYELESAIKAN PERMASALAHAN PELUANG DENGAN MENGGUNAKAN KATEGORI KESALAHAN WATSON

Directory of Open Access Journals (Sweden)

Susilawati Susilawati

2016-06-01

Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52

Estudios preliminares para la propagación clonal "in vitro" de mora (Rubus glaucus L. Preliminary studies on In Vitro clonal propagation of Blackberry (Rubus glaucus l.

Directory of Open Access Journals (Sweden)

Ramirez del Castillo Amparo

1990-12-01

Full Text Available Con el objeto de obtener in vitro plántulas de mora (Rubus glaucus L. que permitan adelantar la micropropagación de la especie, se obtuvieron yemas axilares activas de plantas de mora cultivadas en invernadero. Dichos explantes fueron llevados a" tubo de ensayo, despuésde eliminar primordios
foliares más'externos. Se encontró que una inmersión en hipoclorito de sodio al 0,5% por cinco minutos dio el mejor resultado para desinfección: concentraciones y tiempos mayores no promueven supervivencia del explante. En segundotérmino sedefinió el uso del mejor antioxidante, ya que se detectó un proceso de oxidación generalizado desde el inicio del cultivo in vitro. Al probar varios antioxidantes y clases de sustratos se determinó como el mejor antioxidante el ácido ascórbico (100 ppm adicionado a la solución nutritiva y como mejor sustrato el líquido sobre papel. Se realizaron ensayos con el objeto de obtener un balance hormonal óptimo. Se probó el efecto de Kinetina y la BAP en diferentes concentraciones adicionadas a un medio básico MS suplementado con ANA (0,1 ppm; calificando desarrollo de ptántula, número de follolos y presenciade callo; se determinó la BAP (2ppm como responsable del mejor resultado. En el siguiente ensayo se probó interacción citoqulninagiberelina; los mejores resultados se obtuvieron
con AG3 (1ppm y BAP (2ppm. Posteriormente se planteó un ensayo con el objeto de obtener tallos verdaderos y brotes múltiples, para lo cual se quiso probar AlA en interacción con las hormonas anteriormente probadas, con concentraciones de AlA de 0.1 ppm, BAP (2ppm y AG3 (1ppm obteniendo como resultado de esta interacción plántulas óptimas para micropropagación. Los datos de la valoración de desarrollo de las plántulas, brotes múltiples, tallo verdadero, número de folíolos, presencia o no de callos, presencia o ausencia de raíces, fueron analizados estadísticamente con base en un diseño completamente al

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

Science.gov (United States)

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society

Directory of Open Access Journals (Sweden)

Gerry Joseph Nagtzaam

2014-03-01

Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action.  In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence.  Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.

Establecimiento y multiplicación in vitro de mora de castilla (Rubus glaucus Benth. variedad sin espinas, mediante ápices meristemáticos Stablishment and in vitro multiplication of thornless blackberry (Rubus glaucus Benth. by shoot apical meristems

Directory of Open Access Journals (Sweden)

Alina Katil Sigarroa-Rieche

2011-12-01

Full Text Available Se evaluó una técnica de micropropagación de plantas de mora (Rubus glaucus de la variedad sin espinas, a partir de ápices meristemáticos. En la fase de establecimiento se evaluó un protocolo de desinfección utilizando por 5 min solución de jabón detergente comercial y agua + alcohol 70% por 2 min + hipoclorito 3% con dos tiempos de exposición diferentes: T1 por 5 min y T2 por 10 min. Después de desinfectar las microestacas se extrajeron los ápices meristemáticos y se establecieron in vitro bajo un diseño completamente al azar para evaluar dos medios de cultivo: M1 y M2. A partir de las plántulas desarrolladas se efectuó la multiplicación en los medios de cultivo M1, M3 y M4. Ambos tratamientos de desinfección resultaron efectivos alcanzando 100% de desinfección de los explantes con cada uno de ellos. La siembra de ápices meristemáticos permitió el establecimiento de cultivos asépticos y un adecuado desarrollo de los explantes después de seis semanas de cultivo, con prendimiento de 83.4% para M1 y 66.6% para M2. El análisis de varianza (Anova y la prueba de rangos múltiples mostraron que la multiplicación fue mejor en el medio M1 con una mayor tasa de crecimiento y desarrollo del explante, al obtener coeficientes de multiplicación de 7.5 brotes/plántula y una altura promedio de 1.95 cm.We evaluated a technique of micropropagation in a thornless variety of blackberry (Rubus glaucus from shoot apical meristems. In the establishment phase, we evaluated a disinfection protocol: soapy solution (commercial detergent and water for 5 minutes + 70% alcohol for 2 minutes + 3% hypochlorite with two different exposure times: T1 for 5 minutes and T2 for 10 minutes. When the microcuttings were disinfected, the meristematic shoots were removed and established in vitro in a completely random design to evaluate two cultivation mediums: M1 and M2. From the seedlings developed, the multiplication was performed, which tested three

LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci

Energy Technology Data Exchange (ETDEWEB)

Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)

1994-09-01

The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).

Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Species phylogeny of the subgenus parides (Lepidoptera: papilionidae) based in sequences of citochrome oxidase I gene

International Nuclear Information System (INIS)

Gutierrez R, Ingrid Marcela; Fagua, Giovanny

2012-01-01

Parides hubner is a terminal taxon of troidini, an aposematic butterfly group that is diverse in the tropics and subtropics, and a model of Mullerian and Batesian mimetic complexes. Several American species of parides are sympatric and include populations with intraspecific variation in color pattern, thus creating confusion on their taxonomic status, mainly in Colombia where the biota of North and South America converge. This work presents a phylogenetic hypothesis of these butterflies and proposes a more robust definition of some taxa. For this, 15 taxa of the subgenus parides were analyzed as ingroup; species of other two genera of troidini, closer to parides, were used as out-group. DNA was extracted using the pascual et al. (1997) protocol and quiagen dnaeasy kit. A terminal fragment of cytochrome oxidase I gen (476 bp) were amplified. We obtained a phylogenetic approximation using maximum parsimony and evaluated the branch support with jackknife and absolute bremer support. We also conducted a bayesian analysis. The resulting phylogenetic hypothesis suggested that parides is a paraphyletic group; the molecular evidence support one species and five subspecies. The analyzed taxa were divided in three principal groups coincident with the lysander (group 1) and aeneas (groups 1 and 2) groups proposed by rothschild and jordan (1906).

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

Science.gov (United States)

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

Science.gov (United States)

Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

2018-04-01

This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

A new extinct dwarfed buffalo from Sulawesi and the evolution of the subgenus Anoa: An interdisciplinary perspective

Science.gov (United States)

Rozzi, Roberto

2017-02-01

The fossil and extant faunas of Sulawesi, the largest island within the Wallacea biogeographic region, exhibit a high degree of endemism. The lowland anoa Bubalus depressicornis and the mountain anoa Bubalus quarlesi, two closely-related dwarfed buffaloes, are among the most peculiar endemic mammals of the region. Here, I describe a new species, Bubalus grovesi, from the Late Pleistocene/Holocene of South Sulawesi and I give a revised diagnosis of Anoa. Bubalus grovesi sp. nov. differs from all previously described Bubalus in both the size and proportions of the skeleton and in possessing a unique combination of discrete character states. Body mass estimates suggest an average mass of 117 kg for Bubalus grovesi sp. nov. and a body size reduction of about 90% with respect to a typical water buffalo. A comprehensive overview of body mass estimates of dwarfed buffaloes and differences in their dental and postcranial features is included. Finally, new evidence on the taxonomy and island dwarfing of the anoas and available data from different disciplines are used to discuss the timing and mode of their evolution. The representatives of the subgenus Anoa would be dwarfed forms of the Asian water buffalo that arose following dispersal to Sulawesi during the Middle/Late Pleistocene.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

Science.gov (United States)

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.

Science.gov (United States)

Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M

2014-01-01

Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.

Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

Science.gov (United States)

Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

2013-04-18

Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-05-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Non-Watson-Crick structures in oligodeoxynucleotides: Self-association of d(TpCpGpA) stabilized at acidic pH

International Nuclear Information System (INIS)

Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.

1988-01-01

The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs

Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

International Nuclear Information System (INIS)

Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

2007-01-01

The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

The rediscovery of Passiflora kwangtungensis Merr. (subgenus Decaloba supersection Disemma: a critically endangered Chinese endemic

Directory of Open Access Journals (Sweden)

Shawn Krosnick

2013-06-01

Full Text Available Passiflora kwangtungensis is a critically endangered Chinese species known from Guangxi, Guangdong, and Jiangxi Provinces. The species belongs to Passiflora subgenus Decaloba, supersection Disemma, section Octandranthus. Field observations decreased rapidly during the 1970s to 1980s, and it was suspected that this species might have been extirpated due to repeated deforestation events throughout southern China. In recent years, however, small isolated populations of this species have been rediscovered in Hunan Province, representing new locality records for P. kwangtungensis. New herbarium collections, color photographs, and silica gel collections have provided an unexpected opportunity to examine the evolutionary significance of this species. The current study presents a revised morphological description of P. kwangtungensis based on fresh material, along with an updated distribution map. Using nrITS sequence data, preliminary insights into the phylogenetic position of P. kwangtungensis are presented. Molecular data support the placement of P. kwangtungensis within supersection Disemma section Octandranthus. However, the exact placement of P. kwangtungensis within this lineage is unclear. The nrITS data suggest that P. kwangtungensis may be sister to a clade containing Passiflora from China, Nepal, India, and Southeast Asia. Morphologically, P. kwangtungensis displays the most similarity P. geminiflora (Nepal, India and P. henryi (China. Lastly, conservation status and recommendations are made for P. kwangtungensis following the IUCN Red List Criteria, where this species is classified as CR C1+C2a(i; D.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

Science.gov (United States)

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

Science.gov (United States)

Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

2016-05-05

Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model

Energy Technology Data Exchange (ETDEWEB)

Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)

2016-03-15

Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.

The case of the missing fingerprints or Dr Watson's cosmology

International Nuclear Information System (INIS)

Longair, M.S.

1987-01-01

The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)

Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

Science.gov (United States)

Durgun Ozan, Yeter; Okumuş, Hülya

2017-06-01

Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

Comparación entre bioimpedancia espectroscópica y fórmula de Watson para medición de volumen corporal en pacientes en diálisis peritoneal

Directory of Open Access Journals (Sweden)

Gonzalo Martínez Fernández

2016-01-01

Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.

Optimization of microwave-assisted extraction for anthocyanins, polyphenols, and antioxidants from raspberry (Rubus Coreanus Miq.) using response surface methodology.

Science.gov (United States)

Teng, Hui; Lee, Won Young; Choi, Yong Hee

2013-09-01

Anthocyanins (Acys), polyphenols, and antioxidants were extracted from raspberry (Rubus Coreanus Miq.) using a highly efficient microwave-assisted extraction technique. Different solvents, including methanol, ethanol, and acetone, were tested. The colors of the extracts varied from light yellow to purple red or dark red. SEM and other nutrient analyses verified that ethanol was the most favorable medium for the microwave-assisted extraction of raspberry due to its high output and low toxicity. Effects of process parameters, including microwave power, irradiation time, and solvent concentration, were investigated through response surface methodology. Canonical analysis estimated that the highest total Acys content, total polyphenols content, and antioxidant activity of raspberry were 17.93 mg cyanidin-3-O-glucoside equivalents per gram dry weight, 38.57 mg gallic acid equivalents per gram dry weight, and 81.24%, respectively. The polyphenol compositions of raspberry extract were identified by HPLC with diode array detection, and nine kinds of polyphenols were identified and quantified, revealing that chlorogenic acid, syringic acid, and rutin are the major polyphenols contained in raspberry fruits. Compared with other fruits and vegetables, raspberry contains higher Acy and polyphenol contents with stronger antioxidant activity, suggesting that raspberry fruits are a good source of natural food colorants and antioxidants. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

A revision of Ornithogalum subgenus Aspasia section Aspasia, the chincherinchees (Hyacinthaceae

Directory of Open Access Journals (Sweden)

J. C. Manning

2007-08-01

Full Text Available The species of Ornithogalum L. subgenus Aspasia section Aspasia are revised. Section Aspasia is defined by a rosette of  lanceolate to oblong leaves; large, boat-shaped, ± petaloid bracts; moderately-sized white, yellow or orange flowers, sometimes with dark central markings; thin-textured, ellipsoid capsules that are enclosed by and concealed within the persistent, papery perianth; and angular, colliculate to echinulate seeds. Twelve species are recognized in the section, separable into three series based on seed morphology. O. conicum is redefined to exclude specimens from the Eastern Cape, which are recognized as O. synanthifolium, and O. conicum subsp.  strictum is raised to species status as O. strictum. The circumscription of O. duhium is expanded to include O.fimbrimarginatum and O. subcoriaceum, previously distinguished on account of their longer styles.Collections from the Roggeveld Escarpment and Klein Roggeveld that were previously included in O. fimbrimaiginatum are recognized as the new species O. corticatum Mart.-Azarin, on the basis of their unusual, thick, cartilaginous outer tunics and puberulous adaxial leaf surface. O. ceresianum is removed from the synonomy of O. thyrsoides and recognized as a distinct species on account of its extensive glossy black tepal markings, winged inner filaments, and glossy black ovary. The poorly known  O. puberuhim is more ftilly described based on several recent collections, and  O. leeupoortense is neotypified in the absence of any original type material.  O. rupestre and O. multifolium are regarded as colour forms of the same species, for which  O. rupestre is the older name. Similarly, O. roussouwii is a depauperate, pale form of O. maculatum and is thus included in the synonomy of that species. The circumscription of O. pruinosum remains unchanged. The species O. haurii, O. diphyllum and O. sephtonii from the Drakensberg Mountains of Eastern Cape and KwaZulu-Natal are excluded from

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit

2015-09-17

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

Science.gov (United States)

Risqi, A. M.; Yudiarsah, E.

2017-07-01

Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

2015-01-01

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

Science.gov (United States)

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

Science.gov (United States)

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Case of the missing fingerprints or Dr. Watson's cosmology

Energy Technology Data Exchange (ETDEWEB)

Longair, M.S.

1987-01-01

The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).

Case Study: IBM Watson Analytics Cloud Platform as Analytics-as-a-Service System for Heart Failure Early Detection

Directory of Open Access Journals (Sweden)

Gabriele Guidi

2016-07-01

Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.

7 CFR 319.37-1 - Definitions.

Science.gov (United States)

2010-01-01

...: mechanical transmission of the pest to an indicator plant for Dianthus, Malus, Prunus, Rubus, and Syringa..., Rubus, and Syringa; serology for Dianthus, Malus, Prunus, Pyrus, Rubus, and Syringa; electron microscopy for Dianthus and Prunus, and nucleic acid probes for Chaenomeles, Cydonia, Malus, and Pyrus. Inspector...

On the calculation of line strengths, oscillator strengths and lifetimes for very large principal quantum numbers in hydrogenic atoms and ions by the McLean–Watson formula

International Nuclear Information System (INIS)

Hey, J D

2014-01-01

As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

Gracilaria, Subgenus Textoriella (Gracilariaceae, Rhodophyta in the Gulf of Mexico and the Mexican Caribbean Gracilaria, subgénero Textoriella (Gracilariaceae, Rhodophyta en el golfo de México y el Caribe mexicano

Directory of Open Access Journals (Sweden)

Kurt M. Dreckmann

2009-12-01

Full Text Available Four species of Gracilaria (Gracilariaceae, Rhodophyta with textorii-type spermatangial conceptacles (subgenus Textoriella Yamamoto are recorded for the Gulf of Mexico and the Mexican Caribbean: Gracilaria blodgettii, G. cervicornis, G. mammillaris, and G. tikvahiae. The general distribution of the subgenus for Central America, both Pacific and Atlantic, displays a disjunct pattern explainable based on the geologic vicariant events that interrupted the connection between Pacific and Atlantic at the Isthmuses of Panama (closed 3.1-2.8 million years ago, and Tehuantepec (southern Mexico, closed 4-3.5 million years ago. Gracilaria cuneata/G. crispata, and G. mammillaris (G. hayi/G. veleroae are 2 pairs of sibling species, or sister taxa, that diverged as a result of the final emergence of the Isthmus, and of the same age as the Central American Isthmus itself.Se registran 4 especies de Gracilaria (Gracilariaceae, Rhodophyta con conceptáculos espematangiales tipo textorii- (subgénero Textoriella Yamamoto para el golfo de México y Caribe mexicano: Gracilaria blodgettii, G. cervicornis, G. mammillaris y G. tikvahiae. La distribución general del subgénero para Atlántico y Pacífico de Centroamérica despliega un patrón disyunto explicable por los eventos geológicos vicariantes que interrumpieron la conexión entre Pacífico y Atlántico en los istmos de Panamá (cerrado hace aprox. 3.1-2.8 millones de años y Tehuantepec (sur de México, cerrado hace aprox. 4-3.5 millones de años. Gracilaria cuneata/G. crispata y G. mammillaris (= G. hayi/ G. veleroae corresponden a 2 pares de especies hermanas que divergieron como resultado de la emersión del istmo, y con aproximadamente la misma edad del istmo centroamericano.

Leishmania-specific surface antigens show sub-genus sequence variation and immune recognition.

Directory of Open Access Journals (Sweden)

Daniel P Depledge

2010-09-01

Full Text Available A family of hydrophilic acylated surface (HASP proteins, containing extensive and variant amino acid repeats, is expressed at the plasma membrane in infective extracellular (metacyclic and intracellular (amastigote stages of Old World Leishmania species. While HASPs are antigenic in the host and can induce protective immune responses, the biological functions of these Leishmania-specific proteins remain unresolved. Previous genome analysis has suggested that parasites of the sub-genus Leishmania (Viannia have lost HASP genes from their genomes.We have used molecular and cellular methods to analyse HASP expression in New World Leishmania mexicana complex species and show that, unlike in L. major, these proteins are expressed predominantly following differentiation into amastigotes within macrophages. Further genome analysis has revealed that the L. (Viannia species, L. (V. braziliensis, does express HASP-like proteins of low amino acid similarity but with similar biochemical characteristics, from genes present on a region of chromosome 23 that is syntenic with the HASP/SHERP locus in Old World Leishmania species and the L. (L. mexicana complex. A related gene is also present in Leptomonas seymouri and this may represent the ancestral copy of these Leishmania-genus specific sequences. The L. braziliensis HASP-like proteins (named the orthologous (o HASPs are predominantly expressed on the plasma membrane in amastigotes and are recognised by immune sera taken from 4 out of 6 leishmaniasis patients tested in an endemic region of Brazil. Analysis of the repetitive domains of the oHASPs has shown considerable genetic variation in parasite isolates taken from the same patients, suggesting that antigenic change may play a role in immune recognition of this protein family.These findings confirm that antigenic hydrophilic acylated proteins are expressed from genes in the same chromosomal region in species across the genus Leishmania. These proteins are

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

Science.gov (United States)

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

Science.gov (United States)

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

CERN Multimedia

Patrice Loiez

1999-01-01

UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper

The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

Czech Academy of Sciences Publication Activity Database

Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

2003-01-01

Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

Comparative genomics of 12 strains of Erwinia amylovora identifies a pan-genome with a large conserved core.

Directory of Open Access Journals (Sweden)

Rachel A Mann

Full Text Available The plant pathogen Erwinia amylovora can be divided into two host-specific groupings; strains infecting a broad range of hosts within the Rosaceae subfamily Spiraeoideae (e.g., Malus, Pyrus, Crataegus, Sorbus and strains infecting Rubus (raspberries and blackberries. Comparative genomic analysis of 12 strains representing distinct populations (e.g., geographic, temporal, host origin of E. amylovora was used to describe the pan-genome of this major pathogen. The pan-genome contains 5751 coding sequences and is highly conserved relative to other phytopathogenic bacteria comprising on average 89% conserved, core genes. The chromosomes of Spiraeoideae-infecting strains were highly homogeneous, while greater genetic diversity was observed between Spiraeoideae- and Rubus-infecting strains (and among individual Rubus-infecting strains, the majority of which was attributed to variable genomic islands. Based on genomic distance scores and phylogenetic analysis, the Rubus-infecting strain ATCC BAA-2158 was genetically more closely related to the Spiraeoideae-infecting strains of E. amylovora than it was to the other Rubus-infecting strains. Analysis of the accessory genomes of Spiraeoideae- and Rubus-infecting strains has identified putative host-specific determinants including variation in the effector protein HopX1(Ea and a putative secondary metabolite pathway only present in Rubus-infecting strains.

Caracterización de la resistencia a la antracnosis causada por Glomerella cingulata y productividad de cinco genotipos de mora (Rubus glaucus Benth.

Directory of Open Access Journals (Sweden)

Juan Manuel López-Vásquez

2013-04-01

Full Text Available En la vereda Betania, municipio de Guática, Risaralda (Colombia a 2160 m.s.n.m., se evaluaron cinco materiales promisorios de mora (Rubus glaucus Benth. por su resistencia a la antracnosis (Colletotrichum gloeosporioides y por su alta productividad, los cuales fueron previamente seleccionados por el grupo de Investigación en Biodiversidad y Biotecnología de la Universidad Tecnológica de Pereira. Diez meses después del establecimiento las plantas fueron inoculadas con diferentes cepas del hongo a una concentración de 1.2 x 10(6 conidios/ml de agua. Las variables evaluadas fueron incidencia (presencia o ausencia de lesiones en tallo, severidad (según escala de 1 a 9 y rendimiento (kg/planta. Los genotipos se clasificaron en tres grupos según su resistencia al patógeno y por su rendimiento: el primero, lo conformaron UTP-8 y UTP-7, los cuales produjeron 21 y 17.6 t/ha, respectivamente; el segundo grupo estuvo formado por el genotipo UTP-1 el cual produjo 14.3 t/ha, y el tercero por UTP-2 y UTP-4 con 9.8 y 7.9 t/ha, respectivamente.

Western Palaearctic Ectoedemia (Zimmermannia) Hering and Ectoedemia Busck s. str. (Lepidoptera: Nepticulidae): five new species and new data on distribution, hostplants and recognition

NARCIS (Netherlands)

Nieukerken, van E.J.; Laštůvka, A.; Laštůvka, Z.

2010-01-01

The nine western Palaearctic species of the subgenus Zimmermannia Hering, 1940 and 48 species in the subgenus Ectoedemia Busck, 1907 of the genus Ectoedemia are reviewed. One species in the subgenus Zimmermannia and four species in the subgenus Ectoedemia are described as new: Ectoedemia

Growth and differentiation on a trypanosome of the subgenus Schizotrypanum from the bat Phyllostomus hastatus

Directory of Open Access Journals (Sweden)

Sônia I. Hamanaka

1993-12-01

Full Text Available The effects of temperature, pH, osmolarity and aeration on the growth and differentiation of a trypanosome ofthe subgenus Schizotrypanum isolatedfrom the bat Phyllostomus hastatus were studied. In general, the growth characteristics ofthe flagellate were similar to those of Trypanosoma (Schizotrypanum cruzi. However, the parasite did not growth at 33 or 37C. Increase in the osmolarity and aeration promoted growth at 33C. Significant metacyclogenesis was detected only in the growth condition where maximal growth occured (28C, pH 7.3, 380m0s/kg, in tissue cullure flasks, at the end ofthe exponential growth phase. The begining of the metacyclogenesis process was coincident with most glucose utilization and lowest pH. During metacyclogenesis both culture medium pH and osmolarity increased steadly.Foram estudados os efeitos da temperatura, do pH, da osmolaridade e da areaçâo sobre o crescimento e a diferenciação de um tripanosoma do subgenêro Schizotrypanum, isolado do morcego Phyllostomus hastatus. Em geral, as características do crescimento do flagelado foram semelhantes àquelas do Trypanosoma (Schizotrypanum cruzi. Entretanto, o parasita não de desenvolveu a 33 ou 37°C. O aumento na osmolaridade e areaçâo estimulou o crescimento a 33°C. Metaciclogênese sifhificativa foi detectada somente na condição de crescimento, onde ocorreu desenvolvimento máximo (28°C, pH 7.3, 320m0/kg H20, em frascos de cultura de tecido, no final da fase do crescimento exponencial. O início do processo de metaciclogênese coincidiu com maior utilização de glucose e menor pH. Durante a metaciclogênese, o pHdo meio de cultura e a osmolaridade aumentaram constantemente.

Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

Science.gov (United States)

Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

2016-03-16

We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

Insectos plagas y benéficos asociados al cultivo de mora (Rubus glaucus, benth en La Sabana, Madriz, Nicaragua

Directory of Open Access Journals (Sweden)

Edgardo Jiménez-Martínez

2006-12-01

Full Text Available LA MORA (RUBUS GLAUCUS, BENTH ES UNA PLANTA en proceso de domesticación que se cultiva en pequeñas parcelas. Es hospedera de muchos insectos plaga y enfermedades. En Nicaragua se establecieron plantaciones de mora desde hace unos tres años, como alternativa de diversificación de fincas cafetaleras en los departamentos de Madriz y Nueva Segovia. Hasta ahora no hay información formal sobre los principales insectos plaga y benéficos presentes en este cultivo, que está tomando gran importancia. Por ello, se hizo una investigación para describir la fluctuación poblacional de los insectos plaga y sus depredadores naturales, asociados a este cultivo. El estudio se realizó en la finca La Patasta, municipio La Sabana, departamento de Madriz, entre septiembre de 2004 y abril de 2005. El monitoreo se realizó semanalmente en cinco sitios específicos, mediante capturas manuales de especimenes, con ayuda de bolsas de plástico y vasos de vidrio con alcohol. Como resultado, se identificó y describió la fluctuación poblacional de insectos de las principales familias Scarabaeidae, Chrysomelidae, Curculionidae, Cantharidae, y de los órdenes Hemíptero (Cicadellidae, Pentatomidae, Miridae y Orthóptero (Acrididae y Tettigonidae. Igualmente, se identificó y describió la fluctuación poblacional de depredadores naturales de insectos de la familia Staphilinidae, Coccinelidae, Vespidae y Aracnidae, presentes en este cultivo.

Saturated linkage map construction in Rubus idaeus using genotyping by sequencing and genome-independent imputation

Directory of Open Access Journals (Sweden)

Ward Judson A

2013-01-01

Full Text Available Abstract Background Rapid development of highly saturated genetic maps aids molecular breeding, which can accelerate gain per breeding cycle in woody perennial plants such as Rubus idaeus (red raspberry. Recently, robust genotyping methods based on high-throughput sequencing were developed, which provide high marker density, but result in some genotype errors and a large number of missing genotype values. Imputation can reduce the number of missing values and can correct genotyping errors, but current methods of imputation require a reference genome and thus are not an option for most species. Results Genotyping by Sequencing (GBS was used to produce highly saturated maps for a R. idaeus pseudo-testcross progeny. While low coverage and high variance in sequencing resulted in a large number of missing values for some individuals, a novel method of imputation based on maximum likelihood marker ordering from initial marker segregation overcame the challenge of missing values, and made map construction computationally tractable. The two resulting parental maps contained 4521 and 2391 molecular markers spanning 462.7 and 376.6 cM respectively over seven linkage groups. Detection of precise genomic regions with segregation distortion was possible because of map saturation. Microsatellites (SSRs linked these results to published maps for cross-validation and map comparison. Conclusions GBS together with genome-independent imputation provides a rapid method for genetic map construction in any pseudo-testcross progeny. Our method of imputation estimates the correct genotype call of missing values and corrects genotyping errors that lead to inflated map size and reduced precision in marker placement. Comparison of SSRs to published R. idaeus maps showed that the linkage maps constructed with GBS and our method of imputation were robust, and marker positioning reliable. The high marker density allowed identification of genomic regions with segregation

Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

International Nuclear Information System (INIS)

Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

2000-01-01

This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

Berry fruits: compositional elements, biochemical activities, and the impact of their intake on human health, performance, and disease.

Science.gov (United States)

Seeram, Navindra P

2008-02-13

An overwhelming body of research has now firmly established that the dietary intake of berry fruits has a positive and profound impact on human health, performance, and disease. Berry fruits, which are commercially cultivated and commonly consumed in fresh and processed forms in North America, include blackberry ( Rubus spp.), black raspberry ( Rubus occidentalis), blueberry ( Vaccinium corymbosum), cranberry (i.e., the American cranberry, Vaccinium macrocarpon, distinct from the European cranberry, V. oxycoccus), red raspberry ( Rubus idaeus) and strawberry ( Fragaria x ananassa). Other berry fruits, which are lesser known but consumed in the traditional diets of North American tribal communities, include chokecherry ( Prunus virginiana), highbush cranberry ( Viburnum trilobum), serviceberry ( Amelanchier alnifolia), and silver buffaloberry ( Shepherdia argentea). In addition, berry fruits such as arctic bramble ( Rubus articus), bilberries ( Vaccinuim myrtillus; also known as bog whortleberries), black currant ( Ribes nigrum), boysenberries ( Rubus spp.), cloudberries ( Rubus chamaemorus), crowberries ( Empetrum nigrum, E. hermaphroditum), elderberries ( Sambucus spp.), gooseberry ( Ribes uva-crispa), lingonberries ( Vaccinium vitis-idaea), loganberry ( Rubus loganobaccus), marionberries ( Rubus spp.), Rowan berries ( Sorbus spp.), and sea buckthorn ( Hippophae rhamnoides), are also popularly consumed in other parts of the world. Recently, there has also been a surge in the consumption of exotic "berry-type" fruits such as the pomegranate ( Punica granatum), goji berries ( Lycium barbarum; also known as wolfberry), mangosteen ( Garcinia mangostana), the Brazilian açaí berry ( Euterpe oleraceae), and the Chilean maqui berry ( Aristotelia chilensis). Given the wide consumption of berry fruits and their potential impact on human health and disease, conferences and symposia that target the latest scientific research (and, of equal importance, the dissemination of

8 May 2014 - W. Watson-Wright, Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim visiting the CMS cavern with CMS Collaboration Deputy Spkokesperson K. Borras. Adviser to the Director-General, in charge of Relations with International Organisations M. Bona present throughout.

CERN Multimedia

Brice, Maximilien

2014-01-01

Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Application of the Faddeev-Watson expansion to thermal collisions of Rydberg atoms with neutral particles

International Nuclear Information System (INIS)

de Prunele, E.

1983-01-01

The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit

2013-10-10

The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

Rapid Identification of Flavonoid Constituents Directly from PTP1B Inhibitive Extract of Raspberry (Rubus idaeus L.) Leaves by HPLC–ESI–QTOF–MS-MS

Science.gov (United States)

Li, Zhuan-Hong; Guo, Han; Xu, Wen-Bin; Ge, Juan; Li, Xin; Alimu, Mireguli; He, Da-Jun

2016-01-01

Many potential health benefits of raspberry (Rubus idaeus L.) leaves were attributed to polyphenolic compounds, especially flavonoids. In this study, the methanol extract of R. idaeus leaves showed significant protein tyrosine phosphatase-1B (PTP1B) inhibitory activity with IC50 value of 3.41 ± 0.01 µg mL−1. Meanwhile, a rapid and reliable method, employed high-performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry, was established for structure identification of flavonoids from PTP1B inhibitive extract of R. idaeus leaves using accurate mass measurement and characteristic fragmentation patterns. A total of 16 flavonoids, including 4 quercetin derivatives, 2 luteolin derivatives, 8 kaempferol derivatives and 2 isorhamnetin derivatives, were identified. Compounds 3 and 4, Compounds 6 and 7 and Compounds 15 and 16 were isomers with different aglycones and different saccharides. Compounds 8, 9 and 10 were isomers with the same aglycone and the same saccharide but different substituent positions. Compounds 11 and 12 were isomers with the same aglycone but different saccharides. Compounds 2, 8, 9 and 10 possessed the same substituent saccharide of glycuronic acid. Most of them were reported in R. idaeus for the first time. PMID:26896347

Effect of organic fertilizers on soil chemical properties and performance of blackberry (Rubus adenotrichus) in two agroecology zones of Costa Rica

International Nuclear Information System (INIS)

Orozco Rodriguez, Rafael; Munoz Hernandez, Roger

2012-01-01

The effect of two organic fertilizers on soil chemical properties and plant performance blackberry (Rubus adenotrichus cv.Vino) in two areas of Costa Rica were evaluated. For this purpose, two experiments were established, one in Buena Vista of Perez Zeledon (BVPZ) and another in San Martin of Leon Cortes (SMLC), both in the province of San Jose, Costa Rica. The research was conducted between August 2005 and July 2008. Three treatments were evaluated in each experiment: Compost (C) and Vermicompost (L), at the rate of 4 kg/plant and 3 kg/plant respectively, and a control without fertilizer (T). The frequency of application of fertilizer at planting was given at 6, 12, 18 and 24 months for a total of 6,6 t/ha for C and 4,9 t/ha for L. Soil samples were taken at 0, 6, 12, 18, 24 and 35 months, after planting for analysis. The results have shown that in both agro-ecosystems, the application of C and L has increased soil pH, reduced acidity, has increased the availability of Ca, Mg, K, N, and P, and has favored the effective cation exchange capacity (ICC) and the percentage of organic matter. The accumulation of Mn, Cu and Zn was not observed. Performance-wise, in BVPZ only significant have found differences (P = 0,00188) between C (1,8 t/ha) and T (0,9 t/ha), while in SMLC, found no differences statistical significant (P [es

De-novo RNA sequencing and metabolite profiling to identify genes involved in anthocyanin biosynthesis in Korean black raspberry (Rubus coreanus Miquel.

Directory of Open Access Journals (Sweden)

Tae Kyung Hyun

Full Text Available The Korean black raspberry (Rubus coreanus Miquel, KB on ripening is usually consumed as fresh fruit, whereas the unripe KB has been widely used as a source of traditional herbal medicine. Such a stage specific utilization of KB has been assumed due to the changing metabolite profile during fruit ripening process, but so far molecular and biochemical changes during its fruit maturation are poorly understood. To analyze biochemical changes during fruit ripening process at molecular level, firstly, we have sequenced, assembled, and annotated the transcriptome of KB fruits. Over 4.86 Gb of normalized cDNA prepared from fruits was sequenced using Illumina HiSeq™ 2000, and assembled into 43,723 unigenes. Secondly, we have reported that alterations in anthocyanins and proanthocyanidins are the major factors facilitating variations in these stages of fruits. In addition, up-regulation of F3'H1, DFR4 and LDOX1 resulted in the accumulation of cyanidin derivatives during the ripening process of KB, indicating the positive relationship between the expression of anthocyanin biosynthetic genes and the anthocyanin accumulation. Furthermore, the ability of RcMCHI2 (R. coreanus Miquel chalcone flavanone isomerase 2 gene to complement Arabidopsis transparent testa 5 mutant supported the feasibility of our transcriptome library to provide the gene resources for improving plant nutrition and pigmentation. Taken together, these datasets obtained from transcriptome library and metabolic profiling would be helpful to define the gene-metabolite relationships in this non-model plant.

Mis maitse on maasikvaarikal? / Marge Starast

Index Scriptorium Estoniae

Starast, Marge, 1967-

2016-01-01

Maasikvaarikas Rubus illecebrosus on roosõieliste sugukonda Rosaceae, murakate perekonda Rubus ja vaarikate alamperekonda Idaeobatus kuuluv taimeliik. Tegu pole maasika ja vaarika vahelise hübriidiga, vaid vaarika lähisugulasliigiga

Improved recovery of cryotherapy-treated shoot tips following thermotherapy of in vitro-grown stock shoots of raspberry (Rubus idaeus L.).

Science.gov (United States)

Wang, Qiaochun; Valkonen, Jari P T

2009-01-01

Raspberry bushy dwarf virus (RBDV) can be efficiently eradicated from raspberry plants (Rubus idaeus) by a procedure combining thermotherapy and cryotherapy. However, the bottleneck of this procedure is that, following thermotherapy, cryopreserved shoot tips become chlorotic during regrowth and eventually die after several subcultures. In addition, survival of heat-treated stock shoots and recovery of cryopreserved shoot tips following thermotherapy are low. The present study focused towards improving regrowth of cryopreserved raspberry shoot tips following thermotherapy. Results showed that preconditioning stock shoots with salicylic acid (SA; 0.01-0.1 mM) markedly increased survival of stock shoots after 4 weeks of thermotherapy. Regrowth of cryopreserved shoot tips following thermotherapy was also significantly enhanced when SA (0.05-0.1 mM) was used for preconditioning stock shoots. Addition of either Fe-ethylenediaminetetracetic acid (Fe-EDTA, 50 mg per L) or Fe-ethylenediaminedi(o)hydroxyphenylacetic acid (Fe-EDDHA, 50 mg per L) to post-culture medium strongly promoted regrowth and totally prevented chlorosis of shoots regenerated from cryopreserved shoot tips following thermotherapy. Using the parameters optimized in the present study, about 80 percent survival of heat-treated stock shoots and about 33 percent regrowth of cryopreserved shoot tips following thermotherapy were obtained. Morphology of plants regenerated from cryopreserved shoot tips following thermotherapy was identical to that of control plants, based on observations of leaf shape and size, internode length and plant height. Optimization of the thermotherapy procedure followed by cryotherapy will facilitate the wider application of this technique to eliminate viruses which can invade meristems.

Biomolecules and Natural Medicine Preparations: Analysis of New Sources of Bioactive Compounds from Ribes and Rubus spp. Buds

Directory of Open Access Journals (Sweden)

Dario Donno

2016-02-01

Full Text Available It is well known that plants are important sources for the preparation of natural remedies as they contain many biologically active compounds. In particular, polyphenols, terpenic compounds, organic acids, and vitamins are the most widely occurring groups of phytochemicals. Some endemic species may be used for the production of herbal preparations containing phytochemicals with significant bioactivity, as antioxidant activity and anti-inflammatory capacities, and health benefits. Blackberry sprouts and blackcurrant buds are known to contain appreciable levels of bioactive compounds, including flavonols, phenolic acids, monoterpenes, vitamin C, and catechins, with several clinical effects. The aim of this research was to perform an analytical study of blackcurrant and blackberry bud-preparations, in order to identify and quantify the main biomarkers, obtaining a specific phytochemical fingerprint to evaluate the single botanical class contribution to total phytocomplex and relative bioactivity, using a High Performance Liquid Chromatograph−Diode Array Detector; the same analyses were performed both on the University laboratory and commercial preparations. Different chromatographic methods were used to determine concentrations of biomolecules in the preparations, allowing for quantification of statistically significant differences in their bioactive compound content both in the case of Ribes nigrum and Rubus cultivated varieties at different harvest stages. In blackcurrant bud-extracts the most important class was organic acids (50.98% followed by monoterpenes (14.05%, while in blackberry preparations the main bioactive classes were catechins (50.06% and organic acids (27.34%. Chemical, pharmaceutical and agronomic-environmental knowledge could be important for obtaining label certifications for the valorization of specific genotypes, with high clinical and pharmaceutical value: this study allowed to develop an effective tool for the natural

Biomolecules and Natural Medicine Preparations: Analysis of New Sources of Bioactive Compounds from Ribes and Rubus spp. Buds.

Science.gov (United States)

Donno, Dario; Mellano, Maria Gabriella; Cerutti, Alessandro Kim; Beccaro, Gabriele Loris

2016-02-05

It is well known that plants are important sources for the preparation of natural remedies as they contain many biologically active compounds. In particular, polyphenols, terpenic compounds, organic acids, and vitamins are the most widely occurring groups of phytochemicals. Some endemic species may be used for the production of herbal preparations containing phytochemicals with significant bioactivity, as antioxidant activity and anti-inflammatory capacities, and health benefits. Blackberry sprouts and blackcurrant buds are known to contain appreciable levels of bioactive compounds, including flavonols, phenolic acids, monoterpenes, vitamin C, and catechins, with several clinical effects. The aim of this research was to perform an analytical study of blackcurrant and blackberry bud-preparations, in order to identify and quantify the main biomarkers, obtaining a specific phytochemical fingerprint to evaluate the single botanical class contribution to total phytocomplex and relative bioactivity, using a High Performance Liquid Chromatograph-Diode Array Detector; the same analyses were performed both on the University laboratory and commercial preparations. Different chromatographic methods were used to determine concentrations of biomolecules in the preparations, allowing for quantification of statistically significant differences in their bioactive compound content both in the case of Ribes nigrum and Rubus cultivated varieties at different harvest stages. In blackcurrant bud-extracts the most important class was organic acids (50.98%) followed by monoterpenes (14.05%), while in blackberry preparations the main bioactive classes were catechins (50.06%) and organic acids (27.34%). Chemical, pharmaceutical and agronomic-environmental knowledge could be important for obtaining label certifications for the valorization of specific genotypes, with high clinical and pharmaceutical value: this study allowed to develop an effective tool for the natural preparation quality

[Phylogenetic relationships of the species of Oxytropis DC. subg. Oxytropis and Phacoxytropis (Fabaceae) from Asian Russia inferred from the nucleotide sequence analysis of the intergenic spacers of the chloroplast genome].

Science.gov (United States)

Kholina, A B; Kozyrenko, M M; Artyukova, E V; Sandanov, D V; Andrianova, E A

2016-08-01

The nucleotide sequence analysis of trnH–psbA, trnL–trnF, and trnS–trnG intergenic spacer regions of chloroplast DNA performed in the representatives of the genus Oxytropis from Asian Russia provided clarification of the phylogenetic relationships of some species and sections in the subgenera Oxytropis and Phacoxytropis and in the genus Oxytropis as a whole. Only the section Mesogaea corresponds to the subgenus Phacoxytropis, while the section Janthina of the same subgenus groups together with the sections of the subgenus Oxytropis. The sections Chrysantha and Ortholoma of the subgenus Oxytropis are not only closely related to each other, but together with the section Mesogaea, they are grouped into the subgenus Phacoxytropis. It seems likely that the sections Chrysantha and Ortholoma should be assigned to the subgenus Phacoxytropis, and the section Janthina should be assigned to the subgenus Oxytropis. The molecular differences were identified between O. coerulea and O. mandshurica from the section Janthina that were indicative of considerable divergence of their chloroplast genomes and the species independence of the taxa. The species independence of O. czukotica belonging to the section Arctobia was also confirmed.

Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

Science.gov (United States)

Bandyopadhyay, D; Bhattacharyya, D

2006-10-15

It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

Albucacrispa and A. grandis (Hyacinthaceae: Omithogaloideae, two new species of subgenus Albuca, the rediscovery of A. albucoides (sub­ genus Osmyne, and the identity of A. reflexa

Directory of Open Access Journals (Sweden)

J. C. Manning

2009-08-01

Full Text Available Albuca crispa is a new species of section Falconera series Trianthera with crispulate leaves from the Great Karoo, known  at least since 1947 but overlooked until now. A second new species. A grandis. from the southwestern Cape was previously included in  A. fragrans Jacq. (section  Falconera series  Falconera. It is a robust species that flowers in winter and early spring and the styles are rugulose with ± isodiametric epidermal cells, unlike typical  A. fragrans which is a more slender species flowering in early summer and with derived, smooth styles with fusiform epidermal cells. The recent discovery of a flowering population matching the type of A. albucoides (Aiton J.C.Manning & Goldblatt (subgenus Osmyne allows for a full description and illustration of this poorly know n and taxonomically neglected species that has often been included in A. suaveolens (Jacq. J.C.Manning & Goldblatt. Lastly, examination of the type  of A. reflexa Krause & Dinter from Namibia shows it to be conspecific w ith Drimia indica (Roxb. Jessop.

Evaluation of the Antioxidant Properties and Aromatic Profile During Maturation of The Blackberry (Rubus glaucus Benth and The Bilberry (Vaccinium meridionale Swartz / Evaluación las Propiedades Antioxidantes y el Perfil Aromático Durante la Maduración

Directory of Open Access Journals (Sweden)

Luisa Juana Bernal

2014-03-01

Full Text Available The blackberry (Rubus glaucus Benth and thebilberry (Vaccinium meridionale Swartz are natural sourcesof antioxidants; they are known for their preventive role against degenerative diseases. In this study, the aromatic profile was evaluated using an electronic nose, including the antioxidant properties and the vitamin C, phenolic and anthocyanin contents during three stages of blackberry and bilberry ripening. A completely random statistical design was followed and the results presented differences in the aromatic profile: a higher anthocyanin content (1.59 mg of cyn-3-glu g-1 in the bilberry and 0.26 mg of cyn-3-glu g-1 in the blackberry and total phenols (5.57 mg of caffeic acid g-1 bilberry and 2.68 mg caffeic acid g-1 blackberry. The behavior of the evaluated properties was independent in each of the fruits. / Los frutos como la mora (Rubus glaucus Benth y el agraz (Vaccinium meridionale Swartz son fuentes naturales de sustancias antioxidantes reconocidas por su papel preventivo en el desarrollo de enfermedades degenerativas. En este estudio se evaluó el perfil aromático por medio de nariz electrónica, las propiedades antioxidantes y el contenido de vitamina C, fenoles y antocianinas totales, durante tres estados de maduración de mora y agraz. El diseño estadístico que se siguió fue completamente aleatorio y los resultados muestran que las frutas en el último estado de madurez evaluado se diferencian por su perfil aromático, un contenido mayor de antocianinas (1,59 y 0,26 mg cyn-3-glu g-1 en agraz y mora, respectivamente y fenoles totales (5,57 y 2,68 mg ácido caféico g-1 en agraz y mora, respectivamente. El comportamiento de las propiedades evaluadas es independiente en cada una de las frutas.

Performance characterization of Watson Ahumada motion detector using random dot rotary motion stimuli.

Directory of Open Access Journals (Sweden)

Siddharth Jain

Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.

Rapid Identification of Flavonoid Constituents Directly from PTP1B Inhibitive Extract of Raspberry (Rubus idaeus L.) Leaves by HPLC-ESI-QTOF-MS-MS.

Science.gov (United States)

Li, Zhuan-Hong; Guo, Han; Xu, Wen-Bin; Ge, Juan; Li, Xin; Alimu, Mireguli; He, Da-Jun

2016-01-01

Many potential health benefits of raspberry (Rubus idaeus L.) leaves were attributed to polyphenolic compounds, especially flavonoids. In this study, the methanol extract of R. idaeus leaves showed significant protein tyrosine phosphatase-1B (PTP1B) inhibitory activity with IC50 value of 3.41 ± 0.01 µg mL(-1) Meanwhile, a rapid and reliable method, employed high-performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight tandem mass spectrometry, was established for structure identification of flavonoids from PTP1B inhibitive extract of R. idaeus leaves using accurate mass measurement and characteristic fragmentation patterns. A total of 16 flavonoids, including 4 quercetin derivatives, 2 luteolin derivatives, 8 kaempferol derivatives and 2 isorhamnetin derivatives, were identified. Compounds 3: and 4: , Compounds 6: and 7: and Compounds 15: and 16: were isomers with different aglycones and different saccharides. Compounds 8: , 9: and 10: were isomers with the same aglycone and the same saccharide but different substituent positions. Compounds 11: and 12: were isomers with the same aglycone but different saccharides. Compounds 2: , 8: , 9: and 10: possessed the same substituent saccharide of glycuronic acid. Most of them were reported inR. idaeus for the first time. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Composição química, compostos bioativos e dissimilaridade genética entre cultivares de amoreira (Rubus spp. cultivadas no Sul de Minas Gerais

Directory of Open Access Journals (Sweden)

Mayara Neves Santos Guedes

2014-03-01

Full Text Available Frutos das cultivares Arapaho, Brazos, Caingangue, Cherokee, Choctaw, Comanche, Ébano, Guarani, Tupy e Xavante, e uma espécie de amoreira-vermelha (Rubus rosifolius Smith foram avaliados quanto à composição química. Avaliou-se também a variação genética entre as cultivares de amoreira-preta e a espécie de amoreira-vermelha. Os resultados demonstraram variações na composição química dos frutos estudados. A amora- vermelha apresentou menor teor de umidade e maiores valores para os componentes cinzas, açúcares totais, açúcares redutores, açúcares näo redutores, pectina total, pectina solúvel, fenóis, flavonoides, licopeno, β-caroteno e vitamina A. Os teores de umidade e antocianinas, a porcentagem de solubilização e a atividade antioxidante foram maiores nos frutos da cultivar Ébano. Verificou-se que os frutos da amoreira-vermelha e da cultivar Ébano apresentaram o maior grau de divergência genética para as variáveis analisadas. Isto indica a possibilidade de uso das mesmas em programas de melhoramento que visem à melhoria da composição química.

Plastid genome evolution across the genus Cuscuta (Convolvulaceae): two clades within subgenus Grammica exhibit extensive gene loss.

Science.gov (United States)

Braukmann, Thomas; Kuzmina, Maria; Stefanovic, Sasa

2013-02-01

The genus Cuscuta (Convolvulaceae, the morning glory family) is one of the most intensely studied lineages of parasitic plants. Whole plastome sequencing of four Cuscuta species has demonstrated changes to both plastid gene content and structure. The presence of photosynthetic genes under purifying selection indicates that Cuscuta is cryptically photosynthetic. However, the tempo and mode of plastid genome evolution across the diversity of this group (~200 species) remain largely unknown. A comparative investigation of plastid genome content, grounded within a phylogenetic framework, was conducted using a slot-blot Southern hybridization approach. Cuscuta was extensively sampled (~56% of species), including groups previously suggested to possess more altered plastomes compared with other members of this genus. A total of 56 probes derived from all categories of protein-coding genes, typically found within the plastomes of flowering plants, were used. The results indicate that two clades within subgenus Grammica (clades 'O' and 'K') exhibit substantially more plastid gene loss relative to other members of Cuscuta. All surveyed members of the 'O' clade show extensive losses of plastid genes from every category of genes typically found in the plastome, including otherwise highly conserved small and large ribosomal subunits. The extent of plastid gene losses within this clade is similar in magnitude to that observed previously in some non-asterid holoparasites, in which the very presence of a plastome has been questioned. The 'K' clade also exhibits considerable loss of plastid genes. Unlike in the 'O' clade, in which all species seem to be affected, the losses in clade 'K' progress phylogenetically, following a pattern consistent with the Evolutionary Transition Series hypothesis. This clade presents an ideal opportunity to study the reduction of the plastome of parasites 'in action'. The widespread plastid gene loss in these two clades is hypothesized to be a

A new species of the genus Eurhadina Haupt (Hemiptera: Auchenorrhyncha: Cicadellidae: Typhlocybinae) from Korea, with a key to Korean species.

Science.gov (United States)

Oh, Sumin; Lim, Jongok; Jung, Sunghoon

2016-04-11

The leafhopper genus Eurhadina Haupt, 1929 belongs to the tribe Typhlocybini of subfamily Typhlocybinae (Hemiptera: Auchenorrhyncha: Cicadellidae). Currently, genus Eurhadina includes 3 subgenera, Eurhadina Haupt 1929, Singhardina Mahmood 1967, Zhihadina Yang & Li 1991. A total of 20 valid species of subgenus Eurhadina have been described in the Nearctic and Palaearctic region and the subgenus Singhardina includes 57 species in the Oriental and Palaearctic region (Huang & Zhang 1999, Dworakowska 2002). The subgenus Zhihadina includes only 1 species from China (Yang & Lee, 1991). So far, four species of subgenus Eurhadina were recorded in the Korean Peninsula (Kwon & Huh 2001): Eurhadina (Eurhadina) betularia Anufriev, 1969, E. (E.) koreana Dworakowska, 1971, E. (E.) pulchella (Fallen, 1806), and E. (E.) wagneri Dworakowska, 1969. The majority of species belonging to the subgenus Eurhadina are difficult to distinguish by external appearance because the color patterns of the forewings are very similar among species.

Apple mosaic virus

Science.gov (United States)

Apple mosaic virus (ApMV), a member of the ilarvirus group, naturally infects Betula, Aesculus, Humulus, and several crop genera in the family Rosaceae (Malus, Prunus, Rosa and Rubus). ApMV was first reported in Rubus in several blackberry and raspberry cultivars in the United States and subsequentl...

First report of Raspberry bushy dwarf virus in blackberry in Ecuador

Science.gov (United States)

During the past two decades, several viruses have been identified from Rubus (blackberry and raspberry) in wild and commercial plantings around the world (1) In Ecuador; approximately 14 tons of blackberries (Rubus glaucus) are produced each year in an estimated area of 5,500 hectares. This crop pro...

Anatomia do escapo floral de espécies brasileiras de Paepalanthus subgênero Platycaulon (Eriocaulaceae Anatomy of the inflorescence scape of Brazilian species of the Paepalanthus subgenus Platycaulon (Eriocaulaceae

Directory of Open Access Journals (Sweden)

Vera Lucia Scatena

1998-08-01

Full Text Available Foi estudada a anatomia dos escapos de 17 espécies de Paepalanthus subgênero Platycaulon, sendo 10 da sect. Divisi e sete da sect. Conferti. O trabalho foi realizado para caracterizar anatomicamente os escapos. como contribuição para o entendimento do grupo, uma vez que. morfologicamente, esse é o caráter laxonômico mais importante. Procurou-se, também, confirmar ou não o reconhecimento das duas seções dentro do subgênero. Para os estudos anatômicos utilizou-se material proveniente do Brasil, obtido de exsicatas de diferentes herbários e/ou coletado na Serra do Cipó, MG. Neste trabalho observou-se que Paepalanthus subg. Platycaulon é caracterizado morfologicamente por apresentar escapos pluricapitulados no ápice. Anatomicamente, as espécies estudadas da sect. Divisi apresentam escapos com vários cilindros vasculares, na região mediana e, ainda apresentam, em Paepalanthus vellozioides e P. spixianus, feixes vasculares corticais, características únicas na família. Diferentemente, as espécies avaliadas da sect. Conferti apresentam escapos com cilindro vascular único na região mediana, padrão análogo ao das demais Eriocaulaccae, e ainda apresentam, em Paepalanthus itatiaiensis, P. planifolius e P. paulensis, feixes vasculares medulares, que até então não haviam sido referidos para a família.The scape anatomy of 17 taxa of Paepalanthus subgenus Platycaylon were studied, being 10 taxa of sect. Divisi and seven of sect. Conferti. The study was carried out to see whether scape morphology and anatomy provide valid taxonomic characters at the subgeneric level in Paepalanthus and to lest a proposal to recognize two sections within Paepalanthus subgenus Platycaylon: sect. Divisi and sect. Conferti. The material for anatomical study was collected in Brazil, partly from herbarium specimens and partly from fresh material collected in the field, from the Serra do Cipó. Minas Gerais State. In this work, we observe that

Leucaena lanceolata S. Watson ssp. lanceolata, ESPECIE FORESTAL CON POTENCIAL PARA SER INTRODUCIDA EN SISTEMAS SILVOPASTORILES

Directory of Open Access Journals (Sweden)

María L. Román-Miranda

2013-01-01

Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.

The effects of pesticides on morphology, viability, and germination of Blackberry (Rubus glaucus Benth.) and Tree tomato (Solanum betaceum Cav.) pollen grains.

Science.gov (United States)

Padilla, Flavio; Soria, Norman; Oleas, Abrahan; Rueda, Darwin; Manjunatha, Bangeppagari; Kundapur, Rajesh R; Maddela, Naga Raju; Rajeswari, Bugude

2017-07-01

The objective of this study was to determine the effect of application of pesticides on morphology, viability, and germination of pollen grains of Blackberry (Rubus glaucus Benth.) and Tree tomato (Solanum betaceum Cav.). The study was performed at Patate, Tungurahua province, Ecuador and was divided into two phases. Phase one dedicated to the study of morphology, viability, and identification of nutrient solution for better germination of pollen grains and phase two for the analysis of the effect of conventional, organic, and biological pesticides on pollen grain germination and pollen tube length. To study pollen morphology, pollens were extracted by hand pressure and was analyzed by optical and electron microscopy. The viable pollen grains were identified by staining with 1% acetocarmine. Even though Tree tomato and Blackberry pollen grains are morphologically similar, their exine shapes differ. We observed four times increase in pollen germination rate when suspended in nutrient solution (Sucrose with Boric acid) than control (water). Pollen grains under nutrient solution were subjected to different groups of pesticides for the period of 2, 4, and 6 h. With respect to pesticide affect, the Blackberry pollen grain germination followed the following order: Lecaniceb > Beauveb > Metazeb => Myceb > Control. However, the effect on Tree tomato pollen grains was as follows: Lecaniceb > Myceb > Cantus > Bacillus thuringiensis > Kripton > Control. As per as pollen grain germination is concerned, we observed that the chemical pesticides are more harmful than other pesticides. So, it is necessary to perform screening test for different pesticides and their effect on pollen grain germination before applying to the fields.

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

Science.gov (United States)

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Foliar flavonoids of nine species of Bauhinia

OpenAIRE

SALATINO, ANTONIO; BLATT, CECÍLIA T.T.; SANTOS, DÉBORAH Y.A.C. DOS; VAZ, ANGELA M.S.F.

1999-01-01

Foliar flavonoids of nine species of Bauhinia were isolated and identified. All the compounds correspond to glycosides derived from kaempferol, quercetin, isorhamnetin and myricetin. Derivatives of the latter aglyconhe seem to be rare in Bauhinia. Derivatives of isorhamnetin are commonly found in species of subgenus Bauhinia and were not detected in the two species of subgenus Phanera. Flavonoid patterns of species of the former subgenus are in general more complex than those of the latter. ...

Intramolecular CH···O hydrogen bonds in the AI and BI DNA-like conformers of canonical nucleosides and their Watson-Crick pairs. Quantum chemical and AIM analysis.

Science.gov (United States)

Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M

2011-08-01

The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.

Polyphyly of the Padus group of Prunus (Rosaceae) and the evolution of biogeographic disjunctions between eastern Asia and eastern North America.

Science.gov (United States)

Liu, Xiao-Lin; Wen, Jun; Nie, Ze-Long; Johnson, Gabriel; Liang, Zong-Suo; Chang, Zhao-Yang

2013-05-01

Prunus subgenus Padus is a group with a wide distribution in temperate eastern Asia and eastern North America with one species extending to Europe and one to Central America. Phylogenetic relationships of subgenus Padus were reconstructed using sequences of nuclear ribosomal ITS, and plastid ndhF gene, and rps16 intron and rpl16 intron. Prunus subgenus Padus is shown to be polyphyletic. Taxa of subgenus Padus and subgenus Laurocerasus are highly intermixed in both the ITS and the plastid trees. The results support two disjunctions between eastern North America and Eurasia within the Padus group. One disjunction is between Prunus virginiana of eastern North America and P. padus of Eurasia, estimated to have diverged at 2.99 (95 % HPD 0.59-6.15)-4.1 (95 % HPD 0.63-8.59) mya. The other disjunction is between P. serotina and its Asian relatives. The second disjunction may have occurred earlier than the former one, but the age estimate is difficult due to the unresolved phylogenetic position of the P. serotina complex.

A case study on toxicological aspects of the pest and disease control in the production of the high-quality raspberry (Rubus idaeus L.).

Science.gov (United States)

Sadło, Stanisław; Szpyrka, Ewa; Piechowicz, Bartosz; Grodzicki, Przemysław

2015-01-01

The field studies on the residue levels of the fungicides and insecticides used in commercial raspberry (Rubus idaeus L.) plantation have been performed. Starting on the first day of harvesting (on June 19), 20 laboratory samples of fruit, 10 laboratory samples of leaves and 4 samples of soil were analyzed and the residue levels were compared to the Maximum Residue Limits (MRL) and Acceptable Daily Intakes (ADI). All analyses were carried out using extraction method and gas chromatography technique. Esfenwalerate (Sumi-alpha 050 EC) and beta-cyfluthrin (Bulldock 025 EC), the insecticides belonging to the group of synthetic pyrethroids, were not found in harvested ripe fruits, while cypermethrin residues (Cyperkill 25 EC) applied on May 24, 25 days later was still found on low levels in fruits (0.026 mg kg(-1)) and in leaves (2.58 mg kg(-1)). In turn, residues of chlorpyrifos (Dursban 480 EC), applied to the soil on May 15 against the cockchafers Melolontha melolontha and Otiorhynchus sp., were found at the level 0.004 mg kg(-1). The content of pesticides in ripe fruits depended mainly on the dose and on the time that has elapsed from the date of their application and were as follows: boscalid -0.950, pyrimethanil -0.917, pyraclostrobin -0.253 cypermethrin -0.026 and chlorpyrifos -0.004 mg kg(-1) while in leaves: boscalid -30.64, pyrimethanil -8.13, pyraclostrobin -15.82, cypermethrin -2.58 and chlorpyrifos -0.15 mg kg(-1). The highest average daily intake was in the case of boscalid, and in fruits and leaves reached the levels 0.205 and 6.63, in total 0.33% and 12.18% of ADI, respectively.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

Science.gov (United States)

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

Science.gov (United States)

Takezawa, Yusuke; Shionoya, Mitsuhiko

2012-12-18

With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

Science.gov (United States)

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Persistent negative temperature response of mesophyll conductance in red raspberry (Rubus idaeus L.) leaves under both high and low vapour pressure deficits: a role for abscisic acid?

Science.gov (United States)

Qiu, Changpeng; Ethier, Gilbert; Pepin, Steeve; Dubé, Pascal; Desjardins, Yves; Gosselin, André

2017-09-01

The temperature dependence of mesophyll conductance (g m ) was measured in well-watered red raspberry (Rubus idaeus L.) plants acclimated to leaf-to-air vapour pressure deficit (VPDL) daytime differentials of contrasting amplitude, keeping a fixed diurnal leaf temperature (T leaf ) rise from 20 to 35 °C. Contrary to the great majority of g m temperature responses published to date, we found a pronounced reduction of g m with increasing T leaf irrespective of leaf chamber O 2 level and diurnal VPDL regime. Leaf hydraulic conductance was greatly enhanced during the warmer afternoon periods under both low (0.75 to 1.5 kPa) and high (0.75 to 3.5 kPa) diurnal VPDL regimes, unlike stomatal conductance (g s ), which decreased in the afternoon. Consequently, the leaf water status remained largely isohydric throughout the day, and therefore cannot be evoked to explain the diurnal decrease of g m . However, the concerted diurnal reductions of g m and g s were well correlated with increases in leaf abscisic acid (ABA) content, thus suggesting that ABA can induce a significant depression of g m under favourable leaf water status. Our results challenge the view that the temperature dependence of g m can be explained solely from dynamic leaf anatomical adjustments and/or from the known thermodynamic properties of aqueous solutions and lipid membranes.​. © 2017 John Wiley & Sons Ltd.

NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2012-01-01

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

A comparative study on composition and antioxidant activities of supercritical carbon dioxide, hexane and ethanol extracts from blackberry (Rubus fruticosus) growing in Poland.

Science.gov (United States)

Wajs-Bonikowska, Anna; Stobiecka, Agnieszka; Bonikowski, Radosław; Krajewska, Agnieszka; Sikora, Magdalena; Kula, Józef

2017-08-01

Large quantities of blackberry seeds are produced as a pomace during the processing of juice and jam production; this by-product is a very interesting raw material both for oil manufacturing and as a source of bioactive compounds. In this work the composition, yield and antioxidant activity of three types of Rubus fructicosus pomace extracts isolated by liquid extraction using solvents of different polarity, as well with supercritical CO 2 fluid extraction have been compared. The highest extract yield was reported for Soxhlet extraction using ethanol as a solvent (14.2%). Supercritical carbon dioxide and hexane extracts were characterised by the highest content of phytosterols (1445 and 1583 mg 100 g -1 of extract, respectively) among which β-sitosterol was the main one, while the concentration of tocopherols, with predominant γ-isomer, was the highest for both hexane and ethanol extracts, being 2364 and 2334 mg 100 g -1 , respectively. Using a GC-MS method 95 volatiles, in which non-saturated aldehydes were predominant, were identified in the essential oil of seed pomace and in the volatile oil isolated from supercritical extract. The ethanolic extract which is characterised by the highest phenolic content (9443 mg GAE 100 g -1 ) exhibited the highest antioxidant activity (according to the ABTS •+ and DPPH • assays). All pomace extracts examined were of high quality, rich in essential omega fatty acids and with a very high content of bioactive compounds, such as phytosterols and tocopherols. The high nutritional value of extracts from berry seed pomace could justify the commercialisation of specific extracts not only as food additives but also as cosmetic components. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Establecimiento y multiplicación in vitro de mora de castilla (Rubus glaucus Benth. variedad sin espinas, mediante ápices meristemáticos

Directory of Open Access Journals (Sweden)

Alina Katil Sigarroa-Rieche

2011-12-01

Full Text Available Se evaluó una técnica de micropropagación de plantas de mora (Rubus glaucus de la variedad sin espinas, a partir de ápices meristemáticos. En la fase de establecimiento se evaluó un protocolo de desinfección utilizando por 5 min solución de jabón detergente comercial y agua + alcohol 70% por 2 min + hipoclorito 3% con dos tiempos de exposición diferentes: T1 por 5 min y T2 por 10 min. Después de desinfectar las microestacas se extrajeron los ápices meristemáticos y se establecieron in vitro bajo un diseño completamente al azar para evaluar dos medios de cultivo: M1 y M2. A partir de las plántulas desarrolladas se efectuó la multiplicación en los medios de cultivo M1, M3 y M4. Ambos tratamientos de desinfección resultaron efectivos alcanzando 100% de desinfección de los explantes con cada uno de ellos. La siembra de ápices meristemáticos permitió el establecimiento de cultivos asépticos y un adecuado desarrollo de los explantes después de seis semanas de cultivo, con prendimiento de 83.4% para M1 y 66.6% para M2. El análisis de varianza (Anova y la prueba de rangos múltiples mostraron que la multiplicación fue mejor en el medio M1 con una mayor tasa de crecimiento y desarrollo del explante, al obtener coeficientes de multiplicación de 7.5 brotes/plántula y una altura promedio de 1.95 cm.

Establecimiento y multiplicación in vitro de mora de castilla (Rubus glaucus Benth. variedad sin espinas, mediante ápices meristemáticos

Directory of Open Access Journals (Sweden)

Sigarroa Rieche Alina Katil

2011-12-01

Full Text Available Se evaluó una técnica de micropropagación de plantas de mora (Rubus glaucus de la variedad sin espinas, a partir de ápices meristemáticos. En la fase de establecimiento se evaluó un protocolo de desinfección utilizando por 5 min solución de jabón detergente comercial y agua + alcohol 70% por 2 min + hipoclorito 3% con dos tiempos de exposición diferentes: T₁ por 5 min y T₂ por 10 min. Después de desinfectar las microestacas se extrajeron los ápices meristemáticos y se establecieron in vitro bajo un diseño completamente al azar para evaluar dos medios de cultivo: M1 y M2. A partir de las plántulas desarrolladas se efectuó la multiplicación en los medios de cultivo M1, M3 y M4. Ambos tratamientos de desinfección resultaron efectivos alcanzando 100% de desinfección de los explantes con cada uno de ellos. La siembra de ápices meristemáticos permitió el establecimiento de cultivos asépticos y un adecuado desarrollo de los explantes después de seis semanas de cultivo, con prendimiento de 83.4% para M1 y 66.6% para M2. El análisis de varianza (Anova y la prueba de rangos múltiples mostraron que la multiplicación fue mejor en el medio M1 con una mayor tasa de crecimiento y desarrollo del explante, al obtener coeficientes de multiplicación de 7.5 brotes/plántula y una altura promedio de 1.95 cm.

Taxonomic review of Chinese species of ground beetles of the subgenus Pseudoophonus (genus Harpalus) (Coleoptera: Carabidae).

Science.gov (United States)

Kataev, Boris M; Liang, Hongbin

2015-02-19

A taxonomic review of 23 species of the subgenus Pseudoophonus Motschulsky, 1844, the genus Harpalus Latreille, 1802, occurring in China is given, and a key to these species is provided. The species are divided in three species groups and five subgroups, the distinctive characters of which are listed. The following new synonyms are established: Harpalus calceatus Duftschmid, 1812 = Anisodactylus propinquus Ballion, 1870, syn. n.; H. davidi (Tschitschérine, 1897) = H. kailiensis Huang, 1992, syn. n.; = H. adenticulatus Huang, 1992, syn. n.; = H. cilihumerus Huang, Hu & Sun, 1994, syn. n.; H. fokienensis Schauberger, 1930 = H. muciulus Huang, 1992, syn. n.; H. griseus (Panzer, 1796) = H. xinjiangensis Huang, Hu & Sun, 1994, syn. n.; H. hauserianus Schauberger, 1929 = H. disaogashimensis Huang, 1995, syn. n.; H. pastor pastor Motschulsky, 1844 = H. penglainus Huang, Hu & Sun, 1994, syn. n.; = H. chiloschizontus Huang, 1995, syn. n.; H. rufipes (DeGeer, 1774) = H. scabripectus Huang, Hu & Sun, 1994, syn. n.; H. singularis Tschitschérine, 1906 = H. chengjiangensis Huang, 1993, syn. n.; H. sinicus Hope, 1845 = H. periglabellus Huang, 1992, syn. n.; = H. longihornus Lei & Huang, 1997, syn. n.; and H. tridens Morawitz, 1862 = H. hypogeomysis Huang, 1993, syn. n.; = H. pilosus Huang, 1995, syn. n. Statuses of H. yinchuanensis Huang, 1993 and H. disimuciulus Huang, Lei, Yan & Hu, 1996 are discussed. Lectotypes are designated for H. capito Morawitz, 1862, H. japonicus Morawitz, 1862 and H. eous Tschitschérine, 1901. New data on distribution of Pseudoophonus species in China are provided. Harpalus babai Habu, 1973 is reported from China (Jiangxi) for the first time. The following taxa are recorded from the following Chinese provinces for the first time: H. ussuriensis Chaudoir, 1863 from Hunan; H. aenigma (Tschitschérine, 1897) from Hubei, Jiangxi, and Guangxi; H. pastor Motschulsky, 1844 from Beijing and Xizang; H. fokienensis Schauberger, 1930 from Anhui and Jiangxi; H

FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

Science.gov (United States)

Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

2018-01-01

The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

Histological Comparisons of Parasitism by Schistonchus spp. (Nemata: Aphelenchoididae) in Neotropical Ficus spp.

Science.gov (United States)

Center, Barbara J.; Giblin-Davis, Robin M.; Herre, E. Allen; Chung-Schickler, Genevieve C.

1999-01-01

Syconia (enclosed infructescences) infested with host-specific species of Schistonchus (Aphelenchoididae) were collected from six species of Ficus (Moraceae) native to Florida or Panama. They were sectioned and histologically examined to assess the effects of parasitism. Parasitism by Schistonchus spp. was associated with hypertrophied cells, tissue necrosis, and the presence of an exudate in all species. Occasional hypertrophy of the outer epidermal cells occurred on seed florets, wasp florets, and on the endothecial cells of male florets in F. aurea (subgenus Urostigma) from Florida. Aberrations of the inner mesocarp occurred under the hypertrophied cells on seed florets. In F. laevigata (subgenus Urostigma) from Florida, Schistonchus sp. infested immature male florets and was associated with hypertrophy of endothecial cells, epidermal cells of the anther filaments, and anthers. Schistonchus sp. also caused aberrations of the anther filament, anthers, and pollen. Ficus poponoei (subgenus Urostigma) and F. glabrata (subgenus Pharmacosycea), both from Panama, had hypertrophied outer epidermal cells on seed florets. Ficus poponoei also had Schistonchus sp. within the pedicel of an aborted floret, with hypertrophy of the cortical parenchyma. Ficus trigonata (subgenus Urostigma) from Panama had hypertrophy of the outer epidermis of seed florets. When the outer epidermis on these florets was missing, the inner mesocarp was hypertrophied. Ficus maxima (subgenus Pharmacosycea) from Panama had hypertrophy on the outer epidermis of seed and aborted florets. Schistonchus spp. were not found in wasp larvae or pupae in any of the Ficus spp. examined. Hypertrophy was never observed in the absence of Schistonchus spp. PMID:19270912

New chromosome numbers in the genus Trigonella L. (Fabaceae ...

African Journals Online (AJOL)

Jane

10 Jan 2011 ... b: Subgenus Trifoliastrum: Calyx campanulate and pod inflated. c: Subgenus Foenum-graecum: Calyx tubular and pod not inflated. Several investigators have attempted to employ the taxonomy of the genus Trigonella; Sirjaev (1935) has given in Latin an elaborate and systematic account of its taxonomy.

A new species of Ascocotyle (Trematoda: Heterophyidae) from the South American sea lion, Otaria flavescens, off Patagonia, Argentina.

Science.gov (United States)

Hernández-Orts, Jesús Servando; Montero, Francisco Esteban; Crespo, Enrique Alberto; García, Néstor Aníbal; Raga, Juan Antonio; Aznar, Francisco Javier

2012-08-01

We describe a new heterophyid species, Ascocotyle (Ascocotyle) patagoniensis n. sp., based on specimens collected from the intestines of the South American sea lion Otaria flavescens from Patagonia (Argentina). Ascocotyle (A.) patagoniensis n. sp. is distinguished from the other species of the subgenus by the number of circumoral spines, which are arranged in 2 rows of 18 to 23. The new species also differs from the other species in having a gonotyl without papillae. The specimens exhibited the widest seminal receptacle described for a species of this subgenus. Species of the subgenus Ascocotyle usually infect fish-eating birds or mammals in freshwater or brackish habitats. Ascocotyle (A.) patagoniensis n. sp. is the first species of the subgenus described from a marine mammal. However, no metacercariae of Ascocotyle spp. were found in 542 marine teleosts from 20 species collected in the same locality. The life cycle of the marine species from the Ascocotyle -complex infecting pinnipeds remains elusive.

Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

Science.gov (United States)

Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

2012-12-04

The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

Science.gov (United States)

Srivastava, Ruby

2018-03-01

We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

Physico-chemical profiles of the wobble ↔ Watson-Crick G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) tautomerisations: a QM/QTAIM comprehensive survey.

Science.gov (United States)

Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M

2017-12-20

This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.

NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

International Nuclear Information System (INIS)

Gao, X.; Patel, D.J.

1988-01-01

The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

Taxonomic and nomenclatural rearrangements in Artemisia subgen. Tridentatae, including a redefinition of Sphaeromeria (Asteraceae, Anthemideae)

Science.gov (United States)

Sonia Garcia; Teresa Garnatje; E. Durant McArthur; Jaume Pellicer; Stewart C. Sanderson; Joan Valles

2011-01-01

A recent molecular phylogenetic study of all members of Artemisia subgenus Tridentatae, as well as most of the other New World endemic Artemisia and the allied genera Sphaeromeria and Picrothamnus, raised the necessity of revising the taxonomic framework of the North American endemic Artemisia. Composition of the subgenus Tridentatae is enlarged to accommodate other...

AMPHIBLESTRUM (AVICULAMPHIBLESTRUM RUGGEROI SP. N., SUBGEN. N. (BRYOZOA FROM THE WESTERN MEDITERRANEAN SEA

Directory of Open Access Journals (Sweden)

ANTONIETTA ROSSO

1999-11-01

Full Text Available A new species and a new subgenus Amphiblestrum (Aviculamphiblestrum ruggeroi sp.n. are described from deep circalittoral-epibathyal bottoms from the Sicily Strait and the north-western Mediterranean. The new subgenus is created to distinguish, within Amphiblestrum, species with both gymnocystal adventitious and large interzooidal avicularia, both originating from basal pore chambers. 

Insights into Watson-Crick/Hoogsteen breathing dynamics and damage repair from the solution structure and dynamic ensemble of DNA duplexes containing m1A.

Science.gov (United States)

Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M

2017-05-19

In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Presenting a new kinetic model for methanol to light olefins reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson mechanism

Science.gov (United States)

Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima

2017-10-01

In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.

Chromosomal organization of the ribosomal RNA genes in the genus Chironomus (Diptera, Chironomidae

Directory of Open Access Journals (Sweden)

Larisa Gunderina

2015-05-01

Full Text Available Chromosomal localization of ribosomal RNA coding genes has been studied by using FISH (fluorescence in situ hybridization in 21 species from the genus Chironomus Meigen, 1803. Analysis of the data has shown intra- and interspecific variation in number and location of 5.8S rDNA hybridization sites in 17 species from the subgenus Chironomus and 4 species from the subgenus Camptochironomus Kieffer, 1914. In the majority of studied species the location of rDNA sites coincided with the sites where active NORs (nucleolus organizer regions were found. The number of hybridization sites in karyotypes of studied chironomids varied from 1 to 6. More than half of the species possessed only one NOR (12 out of 21. Two rDNA hybridization sites were found in karyotypes of five species, three – in two species, and five and six sites – in one species each. NORs were found in all chromosomal arms of species from the subgenus Chironomus with one of them always located on arm G. On the other hand, no hybridization sites were found on arm G in four studied species from the subgenus Camptochironomus. Two species from the subgenus Chironomus – Ch. balatonicus Devai, Wuelker & Scholl, 1983 and Ch. “annularius” sensu Strenzke, 1959 – showed intraspecific variability in the number of hybridization signals. Possible mechanisms of origin of variability in number and location of rRNA genes in the karyotypes of species from the genus Chironomus are discussed.

Archeological Investigations in Cochiti Reservoir, New Mexico. Volume 1. A Survey of Regional Variability.

Science.gov (United States)

1977-06-01

pear Opuntia spp. Cholla Upper Sonoran Deciduous Quercus gambeiii Gambels oak Cercocarpus sp. Mountain mahogany Upper Sonoran Deciduous Mixture of Upper...x P’unus melanocarpe x Quercus spp. x x x Rhui tilobata x x Ribes spp. x x x x Rosa spp. x Rubus paruiflorus x Rubus arizonensis x Rudbeckia...laciniata x x Rumex spp. Sambucus spp. x x x Smilacina amplexicaulis x Typha latifolia x x x Vitis arizonica x x Yucca $pp. x TABLE 11.2.4 NUMBER OF EDIBLE

「覆盆子」の生薬学的研究(第1報): 韓国産「覆盆子」の基源(I)

OpenAIRE

難波, 恒雄; 小松, かつ子; 小野, 淳子; 鳴橋, 直弘; 御影, 雅幸

1986-01-01

"Fu-pen-zi" (覆盆子) is the fruit drug, used in Chinese traditional medicine as the remedies for impotence, pollution and premature ejaculation, bet-wetting, frequency of urination, etc. "Fu-pen-zi" from China Continent is considered to be derived from immature fruits of Rubus chingii Hu in general, while in local from other Rubus fruits. On the other hand, the botanical origin of "Fu-pen-zi" produced in Korea is regarded as R. coreanus MIQ., R. crataegifolius BUNGE, R. parvifolius L., etc. Rubu...

Richard Watson.

Science.gov (United States)

Wright, Ian; Bevin, William

2017-11-25

An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

The nature of the transition mismatches with Watson-Crick architecture: the G*·T or G·T* DNA base mispair or both? A QM/QTAIM perspective for the biological problem.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So

Phlebotomus (Euphlebotomus barguesae n. sp. from Thailand (Diptera – Psychodidae

Directory of Open Access Journals (Sweden)

Léger Nicole

2009-01-01

Full Text Available Abstract Background A few studies have been carried out on the Phlebotomine sandflies from Thailand. Within the Phlebotomine sandflies, the genus Phlebotomus Rondani & Berté, 1840 contains the vectors of leishmaniases in Europe, Africa and Asia. It includes several subgenera. Among them the subgenus Euphlebotomus Theodor, 1948 contains at the present time 12 taxa. The type-species of this subgenus is P. argentipes Annandale & Brunetti, 1908, the vector of Leishmania donovani (Laveran & Mesnil, 1903 in India. Results A new species of sandfly, P. barguesae n. sp. is described from limestone caves in Thailand. The male-female gathering in the same species is based on ecological, morphological and molecular criteria (homology of mtDNA cytochrome c oxidase I sequences. The inclusion of P. barguesae n. sp. in the subgenus Euphlebotomus is justified on the basis of characters of the male genitalia (five spines on the style, bifurcated paramere, and no basal lobe on the coxite and of female pharyngeal armature (two kinds of teeth. It well differenciated from another sympatric species: P. mascomai. Conclusion The new species described in the present study has smooth spermathecae. This original morphology opens a discussion on the heterogeneity of this subgenus.

Sleeping under the stars

Science.gov (United States)

Zirkel, Jack

Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

Veronica: Chemical characters for the support of phylogenetic relationships based on nuclear ribosomal and plastid DNA sequence data

DEFF Research Database (Denmark)

Albach, Dirk C.; Jensen, Søren Rosendal; Özgökce, Fevzi

2005-01-01

Molecular phylogenetic analyses have revealed many relationships in Veronica (Plantaginaceae) never anticipated before. However, phytochemical characters show good congruence with DNA-based analyses. We have analysed a combined data set of 49 species and subspecies derived from the nuclear...... are monophyletic sister groups with the annual species consecutive sisters to them. All species of Veronica that contain cornoside are found in this subgenus, although some species seem to have secondarily lost the ability to produce this compound. Subgenera Pocilla and Pentasepalae are well supported sister...... species in the genus analysed to date to contain melittoside and globularifolin. Subgenus Pentasepalae appears to be a clade of diverse lineages from southwestern Asia and a single European clade. Species shown to have 6-hydroxyflavones do not form a monophyletic group. Subgenus Pseudolysimachium seems...

The morphology of hairs in species of Plantago L. sectio Oreades Decne

Directory of Open Access Journals (Sweden)

Emilia Andrzejewska-Golec

2014-01-01

Full Text Available The hairs of three taxa of sectio Oreades Decne genus Plantago have been studied. We have found that hair typical for the majority of representatives of the genus Plantago, that is, with a unicellular stalk and head vertically divided into two cells, occur in these studied taxa. Some of the headless hairs occurring here are similar to those occurring in sectio Arnoglossum Decne. Rahn's (1978 suggestion of transferring sectio Oreades to the subgenus Psyllium seems wrong since the representatives of this section, in contrast to subgenus Psyllium, do not have hairs with the stalks consisting of several cells and unicellular heads, club-like hairs or iridoid-plantarenaloside. They contain, however, hairs with overlapping cells and iridoid-catapol, which is absent in the taxa of subgenus Psyllium.

Western Palaearctic Ectoedemia (Zimmermannia Hering and Ectoedemia Busck s. str. (Lepidoptera: Nepticulidae: five new species and new data on distribution, hostplants and recognition

Directory of Open Access Journals (Sweden)

Erik van Nieukerken

2010-01-01

Full Text Available The nine western Palaearctic species of the subgenus Zimmermannia Hering, 1940 and 48 species in the subgenus Ectoedemia Busck, 1907 of the genus Ectoedemia are reviewed. One species in the subgenus Zimmermannia and four species in the subgenus Ectoedemia are described as new: Ectoedemia (Zimmermannia vivesi A. Laštůvka, Z. Laštůvka & Van Nieukerken sp. n. from southern Spain and Cyprus with unknown host plant, Ectoedemia (E. hendrikseni A. Laštůvka, Z. Laštůvka & Van Nieukerken sp. n. from southern France on Quercus suber, E. (E. heckfordi Van Nieukerken, A. Laštůvka & Z. Laštůvka sp. n. from southern England on Quercus petraea and Q. robur, E. (E. phaeolepis Van Nieukerken, A. Laštůvka & Z. Laštůvka sp. n. from Spain and Portugal probably on Quercus ilex and Q. rotundifolia and E. (E. coscoja Van Nieukerken, A. Laštůvka & Z. Laštůvka sp. n. from Spain on Quercus coccifera. The following species are redescribed: Ectoedemia (Zimmermannia hispanica Van Nieukerken, Ectoedemia (Zimmermannia reichli Z. & A. Laštůvka, 1998, Ectoedemia (E. algeriensis van Nieukerken, 1985, E. (E. pseudoilicis Z. & A. Laštůvka, 1998 and E. (E. alnifoliae van Nieukerken, 1985. Ectoedemia albiformae Puplesis & Diškus, 2003 is synonymised with E. spinosella (Joannis, 1908. Ectoedemia jacutica Puplesis, 1988, previously synonymised with E. agrimoniae (Frey, 1858, is here synonymised with E. spiraeae Gregor & Povolný, 1983. Updated keys to the subgenus Zimmermannia and the Quercus feeding Ectoedemia are provided.

Morphology and Ecological Notes on the Larvae and Pupae of Simulium (Simulium from Korea

Directory of Open Access Journals (Sweden)

Sam-Kyu Kim

2015-10-01

Full Text Available Morphological features of larvae and pupae of twelve species of Simulium (Simulium from Korea are investigated and redescribed. Detailed descriptions of immature stages of each species are provided with photographs. For the Korean members of subgenus Simulium, combinations of the following characteristics can be used to separate them from other Korean subgenera: larval abdomen without a pair of conical-shaped ventral tubercles; postgenal cleft variously shaped, viz., miter shaped, spearhead, bullet shaped or triangular; rectal papillae 3 simple lobe or compound lobes; pupal gill of 6-16 filaments; cocoon shoe, boot or slipper shaped; and head trichomes 3 pairs (1 facial+2 frontal. Habitat information and other ecological aspects of each species are provided. Updated keys to larvae and pupae of the Korean species of the subgenus Simulium are also provided to facilitate species identification. Taxonomic treatment based on external morphologies of larvae and pupae of Korean species of the subgenus Simulium are focused and included in this study. To understand their interspecific relationships, phylogenetic analyses using multiple data from molecule, morphology, and ecology are warranted in future research. Also continued exploration for new character systems is needed to establish more stable boundaries for subgenus and species delimitations.

On Fair Lotteries

OpenAIRE

STONE, PETER

2008-01-01

PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)

A revised subgeneric position for Polypedilum (Probolum) simantokeleum, with description of a new Uresipedilum species in Japan (Diptera: Chironomidae).

Science.gov (United States)

Yamamoto, Nao; Yamamoto, Masaru

2015-08-11

Two Japanese Polypedilum species including a new species are redescribed and described based on the males. Polypedilum (Probolum) simantokeleum, Sasa, Suzuki et Sakai, 1998, is transferred to the subgenus Uresipedilum. Polypedilum (Uresipedilum) dissimilum sp. nov. is easily distinguished from other members of Uresipedilum by having a T-shaped tergal band. Definition of the subgenus Probolum is briefly discussed: we suggest Probolum should be defined as the species with the superior volsella bearing inner lobe pending adequate larval information.

Two new species of Romulea (Iridaceae: Crocoideae from the west­ ern Karoo, Northern Cape and notes on infrageneric classification and range extensions

Directory of Open Access Journals (Sweden)

J. C. Manning

2004-09-01

Full Text Available Two new species of Romulea are described from Northern Cape, raising the number of species in southern Africa to 76. R. collina J.C.Manning & Goldblatl is endemic to the Hantamsberg near Calvinia. It is distinguished in subgenus Spatalanthus by its clumped habit, yellow flowers with dark markings in the throat, and short papery bracts. A re-examination of rela­tionships within the subgenus suggests that section Cruciatae is not monophyletic and it is accordingly no longer recog­nized as separate from section  Spatalanthus. R. eburnea J.C.Manning & Goldblatt is a distinctive species of subgenus Spatalanthus from the Komsberg near Sutherland. It is distinguished by its golden yellow flowers with the apical third of the tepals coloured pale creamy apricot, bracts with broad, translucent margins and tips, and an unusually long perianth tube, 10-13 mm long.

Phytochemical composition and antioxidant activity of Tuscan bee pollen of different botanic origins

Directory of Open Access Journals (Sweden)

V. Domenici

2015-06-01

Full Text Available Within the apicultural products, the honey bee-pollen is growing in commercial interest due to its high nutritional properties. For the first time, bee-pollen samples from Tuscany (Italy were studied to evaluate botanical origin, phytochemical composition and antioxidant activity. The investigated pollen loads were composed of three botanical families: Castanea, Rubus and Cistus.The highest levels of proteins and lipids were detected in Rubus pollen. Castanea pollen contained greater polyphenols, flavonoids and anthocyanins content, while the highest flavonols level wasdetected in Cistus pollen. These results were also confirmed by front-face fluorescence spectroscopy, used here, for the first time, as a fast tool to characterize bee-pollens.

The ITS1-5.8S rRNA gene -ITS2 sequence variability during the divergence of sweet-grass species (gen us Glyceria R. Br.

Directory of Open Access Journals (Sweden)

Alexander V Rodionov

2011-12-01

Full Text Available Comparative analysis of the sequence ITS1-5.8S rRNA gene-ITS2 of the nuclear genome of 13 species of genus Glyceria, 4 species of Melica and a species of monotypic genus Pleuropogon showed that the species of the genus Glyceria have 3 haplotypes: 1 Haplotype A was found only in species of the subgenus Glyceria section Glyceria (G. septentrionalis, G. fluitans, G. declinata, G. occidentalis, G. notata, G. borealis, G. leptostachya and in Pleuropogon sabinii; 2 Haplotype C is characteristic of the subgenus Hydropoa, section Hydropoa (G. grandis, G. х amurensis, G. triflora, G. maxima and sect. Lithuanicae (G. leptolepis; 3 Haplotype B is found in the species of the subgenus Hydropoa sections Striatae (G. elata, G. striata, G. neogaea, G. canadensis, Scolochloiformes (G. alnasteretum, G. spiculosa and G. lithuanica of sect. Lithuanicae. Species carring haplotype B are located at the base of the phylogenetic tree of the genus Glyceria and/or clustered with low bootstrap indices. On the phylogenetic trees inferred by the analysis of the sequences ITS and 5.8S rDNA both sect. Glyceria and sect. Hydropoa represented two sister monophyly branches. The species Pleuropogon sabinii belong to the branch of subgenus Glyceria as a sister monotypic branch to the branch of the sect. Glyceria.

Proteomic Characterization of the Venom of Five Bombus (Thoracobombus) Species

OpenAIRE

Barkan, Nezahat Pınar; Bayazit, Mustafa Bilal; Ozel Demiralp, Duygu

2017-01-01

Venomous animals use venom, a complex biofluid composed of unique mixtures of proteins and peptides, to act on vital systems of the prey or predator. In bees, venom is solely used for defense against predators. However, the venom composition of bumble bees (Bombus sp.) is largely unknown. The Thoracobombus subgenus of Bombus sp. is a diverse subgenus represented by 14 members across Turkey. In this study, we sought out to proteomically characterize the venom of five Thoracobombus species by u...

Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing

Science.gov (United States)

2010-03-01

that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross

Molecular dynamics analysis of stabilities of the telomeric Watson-Crick duplex and the associated i-motif as a function of pH and temperature.

Science.gov (United States)

Panczyk, Tomasz; Wolski, Pawel

2018-06-01

This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.

New or little-known species of Chaetocladius s. str. Kieffer, 1911 (Diptera: Chironomidae: Orthocladiinae) from the Amur River basin (Russian Far East).

Science.gov (United States)

Makarchenko, Eugenyi A; Makarchenko, Marina A; Semenchenko, Alexander A

2017-03-27

Chironomids of the subgenus Chaetocladius s. str. from the Amur River basin are revised using both morphological characters and molecular data. Three new species, C. egorych sp. nov., C. lopatinskiy sp. nov. and C. yavorskayae sp. nov., are described and figured. The pupa of C. fedotkin is described for the first time. Adult males of C. ligni and C. piger, little-known in the Far East, are redescribed and annotated, and key to males of the Chaetocladius s. str. from the Amur River basin is provided. A reference 658 bp barcode sequence from a fragment of the mitochondrial gene cytochrome oxidase I (COI) was used as a tool for species delimitation. Comparisons with corresponding regions of COI between 5 species in the subgenus produced K2P genetic distances of 8.3-12.6%, values well associated with interspecific variation. Molecular data were also used for the reconstruction of the phylogenetic relationships within the subgenus Chaetocladius s. str.

The sub-genera of Avian Plasmodium

Directory of Open Access Journals (Sweden)

Landau I.

2010-03-01

Full Text Available The study of the morphology of a species of Plasmodium is difficult because these organisms have relatively few characters. The size of the schizont, for example, which is easy to assess is important at the specific level but is not always of great phylogenetic significance. Factors reflecting the parasite’s metabolism provide more important evidence. Thus the position of the parasite within the host red cell (attachment to the host nucleus or its membrane, at one end or aligned with it has been shown to be constant for a given species. Another structure of essential significance that is often ignored is a globule, usually refringent in nature, that was first described in Plasmodium vaughani Novy & MacNeal, 1904 and that we consider to be characteristic of the sub-genus Novyella. Species without this structure, previously classified in this sub-genus, are now included in the new sub-genus Papernaia n. sg.

The unexpectedly dull tadpole of Madagascar’s largest frog, Mantidactylus guttulatus

Directory of Open Access Journals (Sweden)

Arne Schulze

2016-12-01

Full Text Available The Madagascar-endemic mantellid genus Mantidactylus contains one subclade with two described frog species characterized by very large body sizes. This subclade is classified as the subgenus Mantidactylus and is widespread in eastern and northern Madagascar, but their reproductive biology and larval stages are still unknown. We here provide a detailed description of the larvae of one species in this subgenus, M. guttulatus, on the basis of genetic assignment (16S DNA barcoding. The tadpoles were collected in the dry season from shallow waters near a stream in the Mahajanga Province in northwestern Madagascar. Their body and tail shape is remarkably generalized as typical for stream-adapted tadpoles, and the oral disc and labial keratodont row formula (4(2-4/3(1 are similar to those of other lotic mantellid frog larvae with generalized mouthparts like those in the subgenus Brygoomantis. The well-separated positions of these subgenera in the mantellid phylogeny suggest extensive homoplasy in the evolution of larval mouthpart morphology within Mantidactylus.

In situ morphometric survey elucidates the evolutionary systematics of the Eurasian Himantoglossum clade (Orchidaceae: Orchidinae

Directory of Open Access Journals (Sweden)

Richard M. Bateman

2017-01-01

Full Text Available Background and Aims The charismatic Himantoglossum s.l. clade of Eurasian orchids contains an unusually large proportion of taxa that are of controversial circumscriptions and considerable conservation concern. Whereas our previously published study addressed the molecular phylogenetics and phylogeography of every named taxon within the clade, here we use detailed morphometric data obtained from the same populations to compare genotypes with associated phenotypes, in order to better explore taxonomic circumscription and character evolution within the clade. Methods Between one and 12 plants found in 25 populations that encompassed the entire distribution of the Himantoglossum s.l. clade were measured in situ for 51 morphological characters. Results for 45 of those characters were subjected to detailed multivariate and univariate analyses. Key Results Multivariate analyses readily separate subgenus Barlia and subgenus Comperia from subgenus Himantoglossum, and also the early-divergent H. formosum from the less divergent remainder of subgenus Himantoglossum. The sequence of divergence of these four lineages is confidently resolved. Our experimental approach to morphometric character analysis demonstrates clearly that phenotypic evolution within Himantoglossum is unusually multi-dimensional. Conclusions Degrees of divergence between taxa shown by morphological analyses approximate those previously shown using molecular analyses. Himantoglossum s.l. is readily divisible into three subgenera. The three sections of subgenus Himantoglossum—hircinum, caprinum and formosum—are arrayed from west to east with only limited geographical overlap. At this taxonomic level, their juxtaposition combines with conflict between contrasting datasets to complicate attempts to distinguish between clinal variation and the discontinuities that by definition separate bona fide species. All taxa achieve allogamy via food deceit and have only weak pollinator specificity

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

Science.gov (United States)

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Micropropagation of Rubus spp.

Directory of Open Access Journals (Sweden)

Åke Finne

1986-09-01

Full Text Available Rapid micropropagation of ‘Black Satin’, ‘Thornless Evergreen’ and ‘Bedford Giant’ was achieved by culturing shoot tips in a 1/1 MS. The best medium in the introduction stage contained 2.0 mg/l BAP. Shoot proliferation occurred with 3.0 mg/1BAP. Some problems with callus and phenolic compounds appeared in both introduction and shoot multiplication stages. The plantlets were rooted either in 1/10 MS without hormones or directly in peat. Two months later most of ‘Black Satin’ and ‘Bedford Giant’ and about half of ‘Thornless Evergreen’ were growing steadily. Theoretically it is possible to produce 60,000 plants within a half year by this method.

Sources of solutes to the proglacial Watson River (Akuliarusiarsuup Kuua) near Kangerlussuaq, West Greenland

Science.gov (United States)

Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.

2013-12-01

Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW

Revisiting the evolutionary events in Allium subgenus Cyathophora (Amaryllidaceae): Insights into the effect of the Hengduan Mountains Region (HMR) uplift and Quaternary climatic fluctuations to the environmental changes in the Qinghai-Tibet Plateau.

Science.gov (United States)

Li, Min-Jie; Tan, Jin-Bo; Xie, Deng-Feng; Huang, De-Qing; Gao, Yun-Dong; He, Xing-Jin

2016-01-01

The respective roles that the Hengduan Mountains Region (HMR) uplift around 4-3 Ma and Quaternary climatic oscillations played in causing the environmental changes in the Qinghai-Tibet Plateau (QTP) remain unknown. Here, we reconstruct the evolutionary history of two varieties of Allium cyathophorum and A. spicatum of subgenus Cyathophora, restricted to the HMR and the western QTP, respectively. Forty-five populations were surveyed for chloroplast and nuclear sequence variation to evaluate phylogenetic relationships, dates of divergence and ancestral area/inflorescence reconstructions. In addition, analyses were conducted on discernable micromorphologies, cytotypes and seed size variation. Our results indicated that two varieties of A. cyathophorum are separate species, i.e. A. farreri and A. cyathophorum, and the initial split of Cyathophora was triggered by the HMR uplift around 4-3 Ma. Subsequently, A. spicatum originated through the strengthened aridification in the western QTP induced vicariance of the ancestral populations in the HMR during the early Pleistocene. A self-sustaining allotetraploid species from A. farreri and A. cyathophorum was established during an interglacial period of penultimate glaciation of the QTP. Seed size variation also supports these by the colonization-competition tradeoff among small and large seeds. Our findings appear to suggest that the HMR uplift could have strengthened the development of the Asian monsoon regimes in this region and aridification in the western QTP, while the Quaternary climatic oscillations spurred the allopatric species' range shifts and created new open microhabitat for the alloploid species. Copyright © 2015 Elsevier Inc. All rights reserved.

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

Contributions to the phylogeny of Ixodes (Pholeoixodes canisuga, I. (Ph. kaiseri, I. (Ph. hexagonus and a simple pictorial key for the identification of their females

Directory of Open Access Journals (Sweden)

Sándor Hornok

2017-11-01

Full Text Available Abstract Background In Europe, hard ticks of the subgenus Pholeoixodes (Ixodidae: Ixodes are usually associated with burrow-dwelling mammals and terrestrial birds. Reports of Pholeoixodes spp. from carnivores are frequently contradictory, and their identification is not based on key diagnostic characters. Therefore, the aims of the present study were to identify ticks collected from dogs, foxes and badgers in several European countries, and to reassess their systematic status with molecular analyses using two mitochondrial markers. Results Between 2003 and 2017, 144 Pholeoixodes spp. ticks were collected in nine European countries. From accurate descriptions and comparison with type-materials, a simple illustrated identification key was compiled for adult females, by focusing on the shape of the anterior surface of basis capituli. Based on this key, 71 female ticks were identified as I. canisuga, 21 as I. kaiseri and 21 as I. hexagonus. DNA was extracted from these 113 female ticks, and from further 31 specimens. Fragments of two mitochondrial genes, cox1 (cytochrome c oxidase subunit 1 and 16S rRNA, were amplified and sequenced. Ixodes kaiseri had nine unique cox1 haplotypes, which showed 99.2–100% sequence identity, whereas I. canisuga and I. hexagonus had eleven and five cox1 haplotypes, respectively, with 99.5–100% sequence identity. The distribution of cox1 haplotypes reflected a geographical pattern. Pholeoixodes spp. ticks had fewer 16S rRNA haplotypes, with a lower degree of intraspecific divergence (99.5–100% sequence identity and no geographical clustering. Phylogenetic analyses were in agreement with morphology: I. kaiseri and I. hexagonus (with the similar shape of the anterior surface of basis capituli were genetically more closely related to each other than to I. canisuga. Phylogenetic analyses also showed that the subgenus Eschatocephalus (bat ticks clustered within the subgenus Pholeoixodes. Conclusions A simple

Anatomía floral comparativa del género Polianthes (Agavaceae Comparative floral anatomy of the genus Polianthes (Agavaceae

Directory of Open Access Journals (Sweden)

Héctor Serrano-Casas

2011-03-01

Full Text Available Se realizó un estudio anatómico de las flores de algunas especies en los subgéneros Polianthes y Bravoa del género Polianthes L. (Agavaceae, con el propósito de investigar si la actual clasificación subgenérica es adecuada. Los taxa analizados del subgénero Polianthes fueron P. densiflora, P. nelsonii y P. platyphylla, y del subgénero Bravoa, P. geminiflora var. geminiflora, P. howardii y P. multicolor. Las características anatómicas florales entre las especies son similares y comparten con otros miembros de la familia Agavaceae los nectarios septales y los óvulos anátropos, bitégmicos y crasinucelados. En los taxa del subgénero Bravoa, los filamentos se originan en la base del tubo floral, mientras que en el subgénero Polianthes se originan por debajo de los tépalos internos del perianto. Anteriormente, sin considerar la anatomía de las flores, se planteaba que los filamentos se originaban en ambos subgéneros desde la base del tubo del perianto y que éstos permanecían adnados al mismo, separándose a diferentes niveles. En el nivel interespecífico, P. howardii presenta nectarios de mayor longitud que los lóculos, en relación con los de las otras especies estudiadas.An anatomical floral study of some species of the genus Polianthes (Agavaceae, of both subgenus Polianthes and subgenus Bravoa (Agavaceae was carried out, with the aim of testing the adequacy of the present subgeneric classification. The taxa studied of subgenus Polianthes were P. densiflora, P. nelsonii and P. platyphylla; and P. geminiflora var. geminiflora, P. howardii and P. multicolor of subgenus Bravoa. The anatomical characters between these species are similar, sharing with other members of the Agavaceae family the septal nectaries and the anatropous, bitegmic, and crassinucellated ovules. In the taxa of subgenus Bravoa, the filaments originate from the floral tube base, while in subgenus Polianthes they originate near the base of the internal tepals

Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer

Science.gov (United States)

2010-10-01

DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and

Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

Science.gov (United States)

2011-10-01

or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding

Scientific and Technological Achievements, 1946-2011, of the AFRL Electromagnetics Technology Division (AFRL/RYH) and Its Progenitors

Science.gov (United States)

2012-07-01

like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH

The taxonomic implication of frontal tubercles in Polypedilum subgenera diagnoses, with re-description of Polypedilum isigabeceum Sasa & Suzuki (Diptera, Chironomidae).

Science.gov (United States)

Yamamoto, Nao; Yamamoto, Masaru

2016-11-15

Polypedilum isigabeceum Sasa et Suzuki, 2000 was described as belonging to subgenus Polypedilum s. str. However, if we accept the conclusion of Sæther et al. (2010), the species might be placed into Kribionympha with P. unagiquartum Sasa, 1985 because of the presence of distinct frontal tubercles in the adult males. However, other taxonomic characters do not support their treatment. P. isigabeceum is re-described and reconfirmed to be assigned to the subgenus Polypedilum s. str. The taxonomic meaning of frontal tubercles is discussed for defining the subgeneric rankings within genus Polypedilum.

VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

Directory of Open Access Journals (Sweden)

M. R. Barrón-Yánez

2009-01-01

(Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

78 FR 41499 - Endangered and Threatened Wildlife and Plants; Threatened Status for the Northern Mexican...

Science.gov (United States)

2013-07-10

...), willows (Salix ssp.), canyon grape (Vitis arizonica), blackberry (Rubus ssp.), Arizona sycamore (Platanus... (Quercus gambelii), and ponderosa pine (Pinus ponderosa) (Rosen and Schwalbe 1988, pp. 34- 35). Rosen and...

Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

International Nuclear Information System (INIS)

Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

2002-01-01

3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

Science.gov (United States)

2008-07-11

Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

A new species of Bryconops (Teleostei: Characidae from the rio Madeira basin, Northern Brazil

Directory of Open Access Journals (Sweden)

Juliana M. Wingert

Full Text Available A new species of Bryconops is described from a tributary to the rio Madeira in the Amazon basin, State of Rondônia, Brazil. Bryconops piracolina belongs to the subgenus Bryconops by having no teeth or rarely one tooth in the maxilla, and a naked area on cheek between the second and third infraorbitals. The new species is distinguished from all species of this subgenus by the presence of a large black blotch on dorsal-fin base. Furthermore, it is distinguished from all congeners, except B. inpai, by possessing the adipose fin entirely black. It differs from B. inpai by the lack of humeral spots. It further differs from all species of the subgenus Bryconops, except B. caudomaculatus, by having the last scales of the longitudinal series of scales that bears the lateral line series not pored beyond the end of the hypural plate, and differs from B. caudomaculatus by the smaller number of pored lateral line scales (31-36, mean 34.6, vs. 37-43, mean = 40.6, respectively.

Phylogenetic relationships in Peniocereus (Cactaceae) inferred from plastid DNA sequence data.

Science.gov (United States)

Arias, Salvador; Terrazas, Teresa; Arreola-Nava, Hilda J; Vázquez-Sánchez, Monserrat; Cameron, Kenneth M

2005-10-01

The phylogenetic relationships of Peniocereus (Cactaceae) species were studied using parsimony analyses of DNA sequence data. The plastid rpl16 and trnL-F regions were sequenced for 98 taxa including 17 species of Peniocereus, representatives from all genera of tribe Pachycereeae, four genera of tribe Hylocereeae, as well as from three additional outgroup genera of tribes Calymmantheae, Notocacteae, and Trichocereeae. Phylogenetic analyses support neither the monophyly of Peniocereus as currently circumscribed, nor the monophyly of tribe Pachycereeae since species of Peniocereus subgenus Pseudoacanthocereus are embedded within tribe Hylocereeae. Furthermore, these results show that the eight species of Peniocereus subgenus Peniocereus (Peniocereus sensu stricto) form a well-supported clade within subtribe Pachycereinae; P. serpentinus is also a member of this subtribe, but is sister to Bergerocactus. Moreover, Nyctocereus should be resurrected as a monotypic genus. Species of Peniocereus subgenus Pseudoacanthocereus are positioned among species of Acanthocereus within tribe Hylocereeae, indicating that they may be better classified within that genus. A number of morphological and anatomical characters, especially related to the presence or absence of dimorphic branches, are discussed to support these relationships.

Fidelity Mechanisms of DNA Polymerase Alpha

Science.gov (United States)

2008-07-23

between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α

Two new species of nocturnal bees of the genus Megalopta (Hymenoptera: Halictidae) with keys to species.

Science.gov (United States)

Gonzalez, Victor H; Griswold, Terry; Ayala, Ricardo

2010-03-01

Megalopta Smith, 1853, is a Neotropical genus of nocturnal or crepuscular bees. Two subgenera are recognized with most of its nearly 30 species placed in the nominate subgenus. Species of Megalopta s. str. are more commonly collected than species of Noctoraptor Engel et al. 1997, all presumably parasites of Megalopta s. str. Two new species of Megalopta are described here: M. (Megalopta) tetewana, n. sp., from Mexico and M. (Noctoraptor) huaoranii, n. sp., from Ecuador. Identification keys to the Central American species of Megalopta s. str. and the species of the parasitic subgenus Noctoraptor are presented.

Notas e descrições em Bisaltes Thomson, 1868 e Ptericoptus Lepeletier & Audinet-Serville, 1830 (Coleoptera, Cerambycidae, Lamiinae, Apomecynini Notes and descriptions in Bisaltes Thomson, 1868 and Ptericoptus Lepeletier & Audinet-Serville, 1830 (Coleoptera, Cerambycidae, Lamiinae, Apomecynini

Directory of Open Access Journals (Sweden)

Maria Helena M. Galileo

2003-01-01

Full Text Available The following new species are described in the subgenus Bisaltes (Bisaltes: B. (B. picticornis sp. nov. from Bolivia; B.(B. taua sp. nov. from Brazil (Paraná and Santa Catarina and B. (B. unicolor sp. nov. from Ecuador. Bisaltes (B. pictus Breuning, 1940 is transferred to the subgenus Craspedocerus. In Ptericoptus, P. hybridus hybridus Breuning, 1939 is considered a synonym of P. acuminatus (Fabricius, 1801; P. dorsalis Audinet-Serville, 1835 previously in the synonymy of P. acuminatus is revalidated and Saperda vitta Newman, 1838 is considered its synonym; P. corumbaensis sp. nov. is described from Brazil (Mato Grosso do Sul.

Pseudocapillaria (Ichthyocapillaria) ophisterni sp. n. (Nematoda : Capillariidae) from the swamp-eel Ophisternon aenigmaticum (Pisces) in Mexico.

Science.gov (United States)

Moravec, F; Salgado-Maldonado, G; Jiménez-García, I

2000-04-01

A new nematode species, Pseudocapillaria ophisterni sp. n., is described from the intestine and rarely from the stomach of the swamp-eel, Ophisternon aenigmaticum Rosen et Greenwood, from Catemaco Lake, Veracruz, Mexico. In having both caudal lobes in the male interconnected by a distinct dorsal membrane, it belongs to the subgenus Ichthyocapillaria. It differs from the three species in this subgenus mainly in possessing either a distinctly longer spicule or a smaller length of oesophagus relative to body length. It also differs in host type and geographical distribution. P. ophisterni is the first capillariid species reported from synbranchiform fishes.

Responses of southeast Alaska understory species to variation in light and soil environments

Science.gov (United States)

Thomas A. Hanley; Bernard T. Bormann; Jeffrey C. Barnard; S. Mark Nay

2014-01-01

Aboveground growth rates of seedlings of bunchberry (Cornus canadensis L.), oval-leaf blueberry (Vaccinium ovalifolium Sm.), salmonberry (Rubus spectabilis Pursh), devilsclub (Oplopanax horridus (Sm.) Miq.), and western hemlock (Tsuga heterophylla (Raf.) Sarg.) were...

How Healthcare Can Refocus on Its Super-Customers (Patients, n =1) and Customers (Doctors and Nurses) by Leveraging Lessons from Amazon, Uber, and Watson.

Science.gov (United States)

Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene

2016-06-01

Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.

Efecto de abonos orgánicos en las propiedades químicas del suelo y el rendimiento de la mora (Rubus adenotrichus en dos zonas agroecológicas de Costa Rica

Directory of Open Access Journals (Sweden)

Rafael Orozco Rodríguez

2012-05-01

Full Text Available El objetivo de esta investigación es evaluar el efecto de dos abonos orgánicos en las propiedades quími- cas del suelo y el rendimiento de plantas de mora (Rubus adenotrichus cv.’Vino’ en dos zonas de Costa Rica. Para ello se establecieron dos experimentos, uno en Buena Vista de Pérez Zeledón (BVPZ y otro en San Mar tín de León Cor tés (SMLC, ambos en la provin- cia de San José, Costa Rica. La investigación se realizó entre agosto del 2005 y julio del 2008. Se evaluaron tres tratamientos en cada experimen- to: Compost (C y Lombricompost (L, a razón de 4 kg/planta y 3 kg/planta respectivamente, y un testi- go sin abono (T. La frecuencia de aplicación de los abonos a la siembra se dio a los 6, 12, 18 y 24 meses para un total de 6,6 t/ha para el C y 4,9 t/ha para el L. Se tomaron muestras de suelo a los 0, 6, 12, 18, 24 y 35 meses, después de la siembra para su análisis. Los resultados muestran que, en ambos agro-ecosis- temas, la aplicación del C y L incrementó el pH del suelo, redujo la acidez, incrementó la disponibilidad de Ca, Mg, K, N, y P, y favoreció la capacidad de in- tercambio catiónico efectiva (CICE y el porcentaje de materia orgánica. No se observó acumulación de Mn, Cu y Zn. En cuanto al rendimiento, en BVPZ solo se encon- traron diferencias significativas (P=0,00188 entre C (1,8 t/ha y el T (0,9 t/ha; mientras que en SMLC, no se encontraron diferencias estadísticas significativas (P

Contemporary Danish book art

DEFF Research Database (Denmark)

Larsen, Poul Steen

the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog......the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog...

78 FR 6805 - Information Collection: Arctic National Wildlife Refuge Recreation Visitor Study-2013

Science.gov (United States)

2013-01-31

.... ADDRESSES: Comments concerning this notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness... . The public may inspect comments received at the Aldo Leopold Wilderness Research Institute, USDA... FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research Institute, (406) 542-4197...

Systematics and Population Level Analysis of Anopheles darlingi

Directory of Open Access Journals (Sweden)

Conn JE

1998-01-01

Full Text Available A new phylogenetic analysis of the Nyssorhynchus subgenus (Danoff-Burg and Conn, unpub. data using six data sets {morphological (all life stages; scanning electron micrographs of eggs; nuclear ITS2 sequences; mitochondrial COII, ND2 and ND6 sequences} revealed different topologies when each data set was analyzed separately but no heterogeneity between the data sets using the arn test. Consequently, the most accurate estimate of the phylogeny was obtained when all the data were combined. This new phylogeny supports a monophyletic Nyssorhynchus subgenus but both previously recognized sections in the subgenus (Albimanus and Argyritarsis were demonstrated to be paraphyletic relative to each other and four of the seven clades included species previously placed in both sections. One of these clades includes both Anopheles darlingi and An. albimanus, suggesting that the ability to vector malaria effectively may have originated once in this subgenus. Both a conserved (315 bp and a variable (425 bp region of the mitochondrial COI gene from 15 populations of An. darlingi from Belize, Bolivia, Brazil, French Guiana, Peru and Venezuela were used to examine the evolutionary history of this species and to test several analytical assumptions. Results demonstrated (1 parsimony analysis is equally informative compared to distance analysis using NJ; (2 clades or clusters are more strongly supported when these two regions are combined compared to either region separately; (3 evidence (in the form of remnants of older haplotype lineages for two colonization events; and (4 significant genetic divergence within the population from Peixoto de Azevedo (State of Mato Grosso, Brazil. The oldest lineage includes populations from Peixoto, Boa Vista (State of Roraima and Dourado (State of São Paulo.

The phylogeny of Simulium (Chirostilbia (Diptera: Simuliidae and perspectives on the systematics of the genus in the Neotropical Region

Directory of Open Access Journals (Sweden)

Leonardo Henrique Gil-Azevedo

2012-03-01

Full Text Available Recently, knowledge of Neotropical Simuliidae has been accumulating quickly. However, information about supra-specific relationships is scarce and diagnoses of Simulium subgenera are unsatisfactory. To investigate the relationships among Simulium (Chirostilbia species and test the subgenus monophyly, we performed a cladistic analysis. The ingroup included all species of this subgenus and the outgroup included representatives of the 17 species groups of Neotropical Simulium and three Holarctic species. The study was based on a data matrix with 31 terminal taxa and 45 morphological characteristics of adult, pupa and larva. The phylogenetic analysis under equal weights resulted in eight most-parsimonious trees (length = 178, consistency index = 34, retention index = 67. The monophyly of the S. (Chirostilbia was not supported in our analysis. The Simulium subpallidum species group was closer to Simulium (Psilopelmia and Simulium (Ectemnaspis than to the Simulium pertinax species group. Additionally, we describe the three-dimensional shape of the terminalia of male and female of Simulium (Chirostilbia for the first time and provide comments about the taxonomic problems involving some species of the subgenus: Simulium acarayense, Simulium papaveroi, S. pertinax, Simulium serranum, Simulium striginotum and S. subpallidum.

A new species of Geodiscelis Michener & Rozen (Hymenoptera: Colletidae: Xeromelissinae) from Peru.

Science.gov (United States)

Ferrari, Rafael R

2015-10-22

A new species of the bee genus Geodiscelis Michener & Rozen, 1999, G. antiminera sp. nov., is here described and illustrated. This is the sixth species of the genus, and the second recorded from Peru. The combination of malar area ~1.5x longer than wide, wing veins dark-brown, metepisternum nearly glabrous, and medioventral process on gonocoxa conical and well-developed, separates G. antiminera sp. nov. from all other Geodiscelis species. An updated identification key for all known species is provided. Phylogenetic analyses show that G. antiminera sp. nov. belongs to the subgenus Nazcoediscelis Packer & Dumesh, 2014 and is sister to the other three species in the subgenus.

A new Gephyromantis (Phylacomantis frog species from the pinnacle karst of Bemaraha, western Madagascar

Directory of Open Access Journals (Sweden)

Angelica Crottini

2011-02-01

Full Text Available We describe a new mantellid frog of the subfamily Mantellinae from the karstic Bemaraha Plateau, western Madagascar. The new species belongs to the genus Gephyromantis, subgenus Phylacomantis, which previously included G. azzurrae, G. corvus and G. pseudoasper. Gephyromantis atsingy sp. n. has a snout-vent length of 35–43 mm and is a scansorial frog living among the Tsingy de Bemaraha pinnacles and inside the caves present in the area. A morphological analysis and biomolecular comparison revealed the degree of differentiation between these four species of the Phylacomantis subgenus. The new species seems to be endemic to Tsingy de Bemaraha.

Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

Comparison of approximate methods for multiple scattering in high-energy collisions. II

International Nuclear Information System (INIS)

Nolan, A.M.; Tobocman, W.; Werby, M.F.

1976-01-01

The scattering in one dimension of a particle by a target of N like particles in a bound state has been studied. The exact result for the transmission probability has been compared with the predictions of the Glauber theory, the Watson optical potential model, and the adiabatic (or fixed scatterer) approximation. The approximate methods optical potential model is second best. The Watson method is found to work better when the kinematics suggested by Foldy and Walecka are used rather than that suggested by Watson, that is to say, when the two-body of the nucleon-nucleon reduced mass

75 FR 54296 - Information Collection; Trends in Use and Users in the Boundary Waters Canoe Area Wilderness, MN

Science.gov (United States)

2010-09-07

... notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness Research Institute, USDA Forest... submitted by e-mail to: [email protected] . The public may inspect comments received at the Aldo Leopold... to the building. FOR FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research...

Commentary on Malone: Who Founded Behaviorism?

Science.gov (United States)

Reese, Hayne W

2015-05-01

Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.

2-Hydroxy-4-methoxybenzaldehyde: A romantic taste modifying ...

African Journals Online (AJOL)

Rubososide, another sweet ent-kaurene glycoside, has been isolated [13] from the leaves of Rubus .... Although the isolation of the glycoside may suggest that 1 is an artifact formed during the isolation procedure, the fact .... 1969, 181, 27. 21.

A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching

NARCIS (Netherlands)

Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.

1995-01-01

In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters

Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space

Science.gov (United States)

Fukawa-Connelly, Timothy Patrick; Newton, Charlene

2014-01-01

Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…

the use of research in protected area management in Madagascar

African Journals Online (AJOL)

they are also expected to contribute to social objectives (Watson et al. 2014). ...... . Chapman, J. M., Algera ... Fuller, R. A., Lee, J. R. and Watson, J. E. M. 2014. Achieving open ... Kremen, C., Cameron, A., Moilanen, A., Phillips, S. J., Thomas, C. D., et al. 2008. Aligning ...

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Science.gov (United States)

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Dredging Operations Technical Support Program. Colonial Waterbird Habitats and Nesting Populations in North Carolina Estuaries: 1983 Survey.

Science.gov (United States)

1986-06-01

Verbena braziliensis 1 -- -- Part henocissus quinquefolia 1 3 4 Ptilimniwn capillacewn -- 6 -- Spartina cynosuroides -- 4 - Sonchus oleraceus -- 4...ty Zis castanea -- 2 -- Verbena spp. I- -- Calium hispiduiwn -- I -- Rubus flagilaris -- 1 2 Phytolacca canericana 1 4 Sonchus as per -- I -- Acer

Kirsipuu (Prunus avium) : [luuletused] / R. W. Stedingh ; tlk. ja saatesõna: Jüri Talvet

Index Scriptorium Estoniae

Stedingh, R. W.

2003-01-01

Sisu: Kirsipuu (Prunus avium) ; Rubus spectabilis ; Rododendron (Rhododendron macrophyllum) ; Lysuchitum americanum ; Tulp (Tulipa gesneriana) ; Kanada hani (Branta canadensis) ; Metsorava pärastlõuna (Sciurus carolinensis) ; Ohakalind (Spinus tristis) ; Shakespeare'i mälestusmärk (kogust "Stanley pargi süit")

Mycoflore de quelques variétés du fraisier (Fragaria ananassa L ...

African Journals Online (AJOL)

SARAH

5 et 19,1%, il est ... antagonist and saprophyte which can give indication about the health of the plants growing in this region ...... espèces de mauvaises herbes du genre Rubus ..... compost et les Trichoderma spp. seul ou en.

Genetics by the Numbers

Science.gov (United States)

... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...

Description of two new species of Clivina Latreille (Coleoptera, Carabidae, Clivinini from southeastern United States

Directory of Open Access Journals (Sweden)

Yves Bousquet

2012-03-01

Full Text Available Two new species of the genus Clivina Latreille are described. One, C. choatei Bousquet & Skelley, belongs to the nominotypical subgenus and is known from six specimens collected in northern Florida. The species is structurally similar to C. myops Bousquet, known only from the holotype found in North Carolina, but differs among others by its smaller size and wider elytral striae. The second species, C. alabama Bousquet, belongs to the subgenus Antroforceps Barr and is known from two specimens collected in north-central Alabama. The species is structurally most similar to C. sasajii Ball, known only from Latimer County in Oklahoma, but differs among others in the absence of eyes and inthe pronotum and elytra proportionally wider.

Does Size Matter?

Science.gov (United States)

Watson, David

2014-01-01

In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…

Educational Technologists: Leading Change for a New Paradigm of Education

Science.gov (United States)

Aslan, Sinem; Reigeluth, Charles M.

2013-01-01

The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…

The role of defensive ecological interactions in the evolution of conotoxins.

Science.gov (United States)

Prashanth, J R; Dutertre, S; Jin, A H; Lavergne, V; Hamilton, B; Cardoso, F C; Griffin, J; Venter, D J; Alewood, P F; Lewis, R J

2016-01-01

Venoms comprise of complex mixtures of peptides evolved for predation and defensive purposes. Remarkably, some carnivorous cone snails can inject two distinct venoms in response to predatory or defensive stimuli, providing a unique opportunity to study separately how different ecological pressures contribute to toxin diversification. Here, we report the extraordinary defensive strategy of the Rhizoconus subgenus of cone snails. The defensive venom from this worm-hunting subgenus is unusually simple, almost exclusively composed of αD-conotoxins instead of the ubiquitous αA-conotoxins found in the more complex defensive venom of mollusc- and fish-hunting cone snails. A similarly compartmentalized venom gland as those observed in the other dietary groups facilitates the deployment of this defensive venom. Transcriptomic analysis of a Conus vexillum venom gland revealed the αD-conotoxins as the major transcripts, with lower amounts of 15 known and four new conotoxin superfamilies also detected with likely roles in prey capture. Our phylogenetic and molecular evolution analysis of the αD-conotoxins from five subgenera of cone snails suggests they evolved episodically as part of a defensive strategy in the Rhizoconus subgenus. Thus, our results demonstrate an important role for defence in the evolution of conotoxins. © 2015 John Wiley & Sons Ltd.

Variability and genetic differentiation among Anopheles (Ano. intermedius Chagas, 1908 and Anopheles (Ano. mattogrossensis Lutz & Neiva, 1911 (Diptera: Culicidae from the Brazilian Amazon

Directory of Open Access Journals (Sweden)

Joselita Maria Mendes dos Santos

2005-10-01

Full Text Available Anopheles (Anopheles intermedius and Anopheles (Ano. mattogrossensis are Brazilian anopheline species belonging to the scarcely studied Anopheles subgenus. Few studies have been done on the genetic differentiation of these species. Both species have been found infected by Plasmodium and are sympatric with other anopheline species from the Nyssorhynchus subgenus. Eighteen enzymatic loci were analyzed in larval specimens of An. intermedius and An. mattogrossensis aiming to estimate the variability and genetic differentiation between these species. An. mattogrossensis population showed higher genetic variability (P = 44.4 and Ho = 0.081 ± 0.031 than that of An. intermedius (P = 33.3 and Ho = 0.048 ± 0.021. Most analyzed loci showed genotypic frequencies according to Hardy-Weinberg equilibrium, except for LAP1 and LAP2 in An. intermedius, and EST1 and PGM loci in An. mattogrossensis. The genetic distance between these species (D = 0.683 was consistent with the inter-specific values reported for Anopheles subgenus. We verified that the polymorphism and heterozygosity percentile values found in both species and compared to those in the literature, showed no relation between the level of isozyme variability and geographical distribution. The low variability found in these two species is probably more related to the niche they occupy than to their geographic distribution.

Environmental Assessment: Tailwater West Trail and Frisbee Golf Course at Coralville Reservoir, Johnson County, Iowa.

Science.gov (United States)

1986-08-01

Cirsium sp.), goldenrod (Sol4dago sp.), and blackberry (Rubus sp.). Immature honey locust (Gleditsia triacanthos), red cedar (Juniperus virginiana ...cherry ( Prunus sp.), elm, silver maple, and box elder are widely scattered throughout the meadow. V. ENVIRONMENTAL CONSEQUENCES OF THE PREFERRED ACTION

Separation, purification and identification of flavonoid glycosides using reversed phase hplc

International Nuclear Information System (INIS)

Hasan, A.; Khan, M.A.

2002-01-01

Optimal high performance liquid chromatography (HPLC) separation conditions and semi-preparative scale isolation of flavonoid glycosides from three plant species namely Vitex nagunda, Rubus ulmifolious and Malotus philipensis is reported. Identification of purified flavonoid glycoside was achieved using spiking technique in HPLC. (author)

Antioxidant and Antimicrobial Activity of Polyphenol Extracts from ...

African Journals Online (AJOL)

Purpose: To assess the antioxidant and antimicrobial activities of polyphenolic extracts of three wild red wild berry fruit species from Southeast Serbia, viz, European cornel (Cornus mas), blackthorn (Prunus spinosa L.) and wild blackberry (Rubus fruticosus). Methods: Polyphenol content was determined using ...

The association between chromaticity, phenolics, carotenoids, and in vitro antioxidant activity of frozen fruit pulp in Brazil: an application of chemometrics.

Science.gov (United States)

Zielinski, Acácio Antonio Ferreira; Ávila, Suelen; Ito, Vivian; Nogueira, Alessandro; Wosiacki, Gilvan; Haminiuk, Charles Windson Isidoro

2014-04-01

A total of 19 Brazilian frozen pulps from the following fruits: açai (Euterpe oleracea), blackberry (Rubus sp.), cajá (Spondias mombin), cashew (Anacardium occidentale), cocoa (Theobroma cacao), coconut (Cocos nucifera), grape (Vitis sp.), graviola (Annona muricata), guava (Psidium guajava), papaya (Carica papaya), peach (Prunus persica), pineapple (Ananas comosus), pineapple and mint (A. comosus and Mentha spicata), red fruits (Rubus sp. and Fragaria sp.), seriguela (Spondias purpurea), strawberry (Fragaria sp.), tamarind (Tamarindus indica), umbu (Spondias tuberosa), and yellow passion fruit (Passiflora edulis) were analyzed in terms of chromaticity, phenolic compounds, carotenoids, and in vitro antioxidant activity using ferric reducing antioxidant power (FRAP) and 1,1-diphenyl-2-picrylhydrazyl (DPPH) assays. Data were processed using principal component analysis (PCA) and hierarchical cluster analysis (HCA). Antioxidant capacity was measured by DPPH and FRAP assays, which showed significant (P antioxidant activity. © 2014 Institute of Food Technologists®

Music Technology and Musical Creativity: Making Connections

Science.gov (United States)

Thompson, Douglas Earl

2012-01-01

This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…

Bringing Precision Medicine to Community Oncologists.

Science.gov (United States)

2017-01-01

Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.

Behaviorism

Science.gov (United States)

Moore, J.

2011-01-01

Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…

Anti-parallel triplexes

DEFF Research Database (Denmark)

Kosbar, Tamer R.; Sofan, Mamdouh A.; Waly, Mohamed A.

2015-01-01

about 6.1 °C when the TFO strand was modified with Z and the Watson-Crick strand with adenine-LNA (AL). The molecular modeling results showed that, in case of nucleobases Y and Z a hydrogen bond (1.69 and 1.72 Å, respectively) was formed between the protonated 3-aminopropyn-1-yl chain and one...... of the phosphate groups in Watson-Crick strand. Also, it was shown that the nucleobase Y made a good stacking and binding with the other nucleobases in the TFO and Watson-Crick duplex, respectively. In contrast, the nucleobase Z with LNA moiety was forced to twist out of plane of Watson-Crick base pair which......The phosphoramidites of DNA monomers of 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine (Y) and 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine LNA (Z) are synthesized, and the thermal stability at pH 7.2 and 8.2 of anti-parallel triplexes modified with these two monomers is determined. When, the anti...

Possible role of double scattering in electron-atom scattering in a laser field

International Nuclear Information System (INIS)

Rabadan, I.; Mendez, L.; Dickinson, A.S.

1996-01-01

By considering observations of double-scattering effects in the excitation of the 2 1 P level of He, gas density values estimated for the laser-assisted elastic scattering experiments of Wallbank and Holmes (1993, 1994a,b) for which the Kroll-Watson approximation appears to fail. Using comparable densities for He and lower densities for Ar, and assuming the Kroll-Watson approximation for single-scattering events, differential cross sections are calculated including double scattering for laser-assisted scattering for a range of energies and scattering angles. Comparison with the observed values shows that double-scattering effects can give a semi-quantitative explanation of the apparent breakdown of the Kroll-Watson approximation in both He and Ar. (author)

Extended low-frequency approximation for laser-modified electron scattering: Coulomb effects

International Nuclear Information System (INIS)

Mittleman, M.H.

1988-01-01

The Kroll-Watson [N.M. Kroll and K. M. Watson, Phys. Rev. A 8, 804 (1973)] theory for electron scattering in the field of a low-frequency laser has been extended by L. Rosenberg [Phys. Rev. A 23, 2283 (1981); 28, 2727 (1983)] to apply to higher intensities. That result is rederived in another way so as to make the correction second order. The correction terms are obtained and shown to be small in the high-intensity low-energy regime in which the original theory is weakest. The special case of a Coulomb potential is analyzed and shown to present special peculiarities in the extended theory just as in the original Kroll-Watson theory

Various Extraction Methods Influence the Adhesive Properties of Dried Distiller’s Grains and Solubles, and Press Cakes of Pennycress (Thlaspi arvense L. and Lesquerella [Lesquerella fendleri (A. Gary S. Watson], in the Fabrication of Lignocellulosic Composites

Directory of Open Access Journals (Sweden)

Brent Tisserat

2018-04-01

Full Text Available Lignocellulosic composite (LC panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS, pennycress (Thlaspi arvense L. press cake (PPC, or lesquerella [Lesquerella fendleri (A. Gary S. Watson] press cake (LPC reinforced with Paulownia elongata L. wood (PW particles. The goal in this study was to assess the mechanical properties of composites utilizing these low-cost matrix materials, which were subjected to various oil extraction methods. Three types of oil extraction methods were utilized: ethanol, supercritical CO2, and hexane, in order to generate matrix materials. These matrix materials were mixed with equal proportions of PW and hot pressed to generate panels. Overall, hexane extraction was the best method to enhance the mechanical properties of the matrices used to fabricate lignocellulosic composites. LPC’s produced a matrix that gave the resulting composite superior flexural properties compared to composites generated from DDGS and PPC matrices. The mechanical properties of composites generated from soy products (soybean meal flour or soy protein isolate were similar to those derived from DDGS, PPC, or LPC. The dimensional stability properties of LCs were improved when the hexane extraction method was employed, unlike with the other extraction methods that were used to generate matrices.

Příspěvek k rozšíření ostružiníků v severní části Ještědského hřbetu

Czech Academy of Sciences Publication Activity Database

Petřík, Petr

2001-01-01

Roč. 36, - (2001), s. 49-58 ISSN 0032-7786 R&D Projects: GA AV ČR KSK6005114 Institutional research plan: CEZ:AV0Z6005908 Keywords : Rubus species * distribution * Ještědský hřbet Ridge Subject RIV: EF - Botanics

Antioxidants in Raspberry: On-line analysis links antioxidant activity to a diversity of individual metabolites

NARCIS (Netherlands)

Beekwilder, M.J.; Jonker, H.H.; Hall, R.D.; Meer, van der I.M.; Vos, de C.H.

2005-01-01

The presence of antioxidant compounds can be considered as a quality parameter for edible fruit. In this paper, we studied the antioxidant compounds in raspberry (Rubus idaeus) fruits by high-performance liquid chromatography (HPLC) coupled to an on-line postcolumn antioxidant detection system. Both

What’s really in our black raspberry products? – chemotaxonomy by anthocyanin

Science.gov (United States)

This presentation will focus on the phytochemical portion of our research into breeding commercial black raspberry (Rubus occidentalis L.; blackcap) cultivars with better fruit quality. A North American native, it was traditionally used as a food and a natural colorant, but renewed US consumer inter...

A Systems Thinking Framework for Assessing and Addressing Malaria Locally: An Alternative to the Globalization of Anti-Malaria Policies

Science.gov (United States)

Willis, Derek W.

2010-01-01

This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…

Penicillium daejeonium sp. nov., a new species isolated from a grape and schisandra fruit in Korea.

Science.gov (United States)

Sang, Hyunkyu; An, Tae-Jin; Kim, Chang Sun; Choi, Young Phil; Deng, Jian-Xin; Paul, Narayan Chandra; Sung, Gi-Ho; Yu, Seung Hun

2013-08-01

Two isolates of monoverticillate Penicillium species were collected from a grape and schisandra fruit in Korea. Multigene phylogenetic analyses with the nuclear ribosomal internal transcribed spacer (ITS) region and genes encoding β-tubulin (benA) and calmodulin (cmd), as well as morphological analyses revealed that the two isolates are members of the P. sclerotiorum complex in Penicillium subgenus Aspergilloides, but different from species of the P. sclerotiorum complex. The isolates are closely related to P. cainii, P. jacksonii, and P. viticola in terms of their multigene phylogeny, but their colony and conidiophore morphologies differ from those of closely related species. The name P. daejeonium is proposed for this unclassified new species belonging to the P. sclerotiorum complex in subgenus Aspergilloides.

Description of Lutzomyia velezi, a new species of phlebotomine sand fly (Diptera: Psychodidae) from the Department of Antioquia, Colombia.

Science.gov (United States)

Bejarano, Eduar Elías; Vivero, Rafael José; Uribe, Sandra

2010-05-01

The phlebotomine sand fly Lutzomyia velezi sp.nov. was described and illustrated from male specimens collected by light trap in the Reserva Natural Cañon del Río Claro in the Central Cordillera of the Colombian Andes. The new species belongs to the series sanguinaria of the subgenus Helcocyrtomyia, which is represented in Colombia by Lutzomyia cirrita, Lutzomyia hartmanni, Lutzomyia sanguinaria, Lutzomyia scorzai, Lutzomyia sp. of Pichindé and Lutzomyia tortura. The new species can be differentiated from others of the subgenus by the combination of the following characteristics: long antennal ascoids, reaching level of the papilla, coxite with a single basal seta and fifth palpomere longer than or equal to the sum of the lengths of the third and fourth palpomeres.

Description of Lutzomyia velezi, a new species of phlebotomine sand fly (Diptera: Psychodidae from the Department of Antioquia, Colombia

Directory of Open Access Journals (Sweden)

Eduar Elías Bejarano

2010-05-01

Full Text Available The phlebotomine sand fly Lutzomyia velezi sp.nov. was described and illustrated from male specimens collected by light trap in the Reserva Natural Cañon del Río Claro in the Central Cordillera of the Colombian Andes. The new species belongs to the series sanguinaria of the subgenus Helcocyrtomyia, which is represented in Colombia by Lutzomyia cirrita, Lutzomyia hartmanni, Lutzomyia sanguinaria, Lutzomyia scorzai, Lutzomyia sp. of Pichindé and Lutzomyia tortura. The new species can be differentiated from others of the subgenus by the combination of the following characteristics: long antennal ascoids, reaching level of the papilla, coxite with a single basal seta and fifth palpomere longer than or equal to the sum of the lengths of the third and fourth palpomeres.

Next Generation Sequencing of Elite Berry Germplasm and Data Analysis Using a Bioinformatics Pipeline for Virus Detection and Discovery

Science.gov (United States)

Berry crops (members of the genera Fragaria, Ribes, Rubus, Sambucus and Vaccinium) are known hosts for more than 70 viruses and new ones are identified continually. In modern berry cultivars, viruses tend to be be asymptomatic in single infections and symptoms only develop after plants accumulate m...

Next-Generation Sequencing of Elite Berry Germplasm and Data Analysis Using a Bioinformatics Pipeline for Virus Detection and Discovery

Science.gov (United States)

Berry crops (members of the genera Fragaria, Ribes, Rubus, Sambucus and Vaccinium) are known hosts for more than 70 viruses and new ones are identified frequently. In modern berry cultivars, viruses tend to be asymptomatic in single infections and symptoms only develop after plants accumulate multip...

Vegetation description and phytoclimatic gradients of subtropical forests of nandiar khuwar catchment district battagram

International Nuclear Information System (INIS)

Haq, F.; Iqbal, Z.; Ahmad, H.

2015-01-01

This paper communicates an analytical exploration of the vegetational profile in the subtropical zone of Nandiar Khuwar catchment area, District Battagrtam, Pakistan. On the basis of physiognomy of vegetation the study area was divided into 16 stands. Six plant communities were recognized by TWINSPAN classification. Among biological spectrum nanophanerophytes was dominated with 36 species and leaf size spectra were dominated by microphyll contributing 63 species. Similarity index was maximum (33.61) between Pinus, Micromeria, Rubus community and Pinus, Rubus, Cynodon community. In Bray-Curtis ordination the maximum ordination scores were recorded for axis 2 (0.921). The gradient length was maximum (3.35) for axis 1 with eigenvalue 0.50. Total variance (inertia) in the species data were 2.92, explanatory variables account for 100%. Among environmental variables the maximum positive strength were recorded for altitude (0.818) and Phosphorous (0.801) while maximum negative strength were recorded for wind speed (-0.864), barometric pressure (-0.825) and temperature (-0.820). (author)

Phylogenetic relationships of Palaearctic Formica species (Hymenoptera, Formicidae based on mitochondrial cytochrome B sequences.

Directory of Open Access Journals (Sweden)

Anna V Goropashnaya

Full Text Available Ants of genus Formica demonstrate variation in social organization and represent model species for ecological, behavioral, evolutionary studies and testing theoretical implications of the kin selection theory. Subgeneric division of the Formica ants based on morphology has been questioned and remained unclear after an allozyme study on genetic differentiation between 13 species representing all subgenera was conducted. In the present study, the phylogenetic relationships within the genus were examined using mitochondrial DNA sequences of the cytochrome b and a part of the NADH dehydrogenase subunit 6. All 23 Formica species sampled in the Palaearctic clustered according to the subgeneric affiliation except F. uralensis that formed a separate phylogenetic group. Unlike Coptoformica and Formica s. str., the subgenus Serviformica did not form a tight cluster but more likely consisted of a few small clades. The genetic distances between the subgenera were around 10%, implying approximate divergence time of 5 Myr if we used the conventional insect divergence rate of 2% per Myr. Within-subgenus divergence estimates were 6.69% in Serviformica, 3.61% in Coptoformica, 1.18% in Formica s. str., which supported our previous results on relatively rapid speciation in the latter subgenus. The phylogeny inferred from DNA sequences provides a necessary framework against which the evolution of social traits can be compared. We discuss implications of inferred phylogeny for the evolution of social traits.

Examining Current Conceptualizations of Psychopathology With the MMPI-2/MMPI-2-RF Restructured Clinical Scales: Preliminary Findings From a Cross-Cultural Study.

Science.gov (United States)

Shkalim, Eleanor; Almagor, Moshe; Ben-Porath, Yossef S

2017-01-01

Watson ( 2005 ) proposed a hierarchical reorganization of the underlying structure of emotional disorders. This study cross-culturally evaluated Watson's (2005) structure of mood and anxiety disorders, using mainly dichotomous criteria, and explored the placement of obsessive-compulsive disorder (OCD) in this model. It also tested Sellbom, Ben-Porath, and Bagby's (2008) proposed elaboration of the 2-factor model (positive and negative activation) that incorporates a higher order dimension of demoralization. One hundred men and 133 women from psychiatric settings in Israel completed the Minnesota Multiphasic Personality Inventory-2 (Butcher et al., 2001 ) and the Maudsley Obsessional-Compulsive Inventory (Hodgson & Rachman, 1977 ). They were interviewed using the Mini International Neuropsychiatric Interview (Sheehan et al., 1998 ). Confirmatory factor analyses replicated Watson's structure for women but not for men. Mixed results were obtained regarding OCD's location in the model. Findings among women support the applicability of Watson's (2005) model across a variety of assessment modalities, as well as in a different language and for diversified cultural backgrounds. This conclusion, however, should be tempered in consideration of the results among men. Findings also provide evidence of the importance of demoralization in mood and anxiety disorders.

Effect of Raspberry bushy dwarf virus, Raspberry leaf mottle virus, and Raspberry latent virus on plant growth and fruit crumbliness in ‘Meeker’ red Raspberry

Science.gov (United States)

Raspberry crumbly fruit in red raspberry (Rubus idaeus L.), widespread in the Pacific Northwest of the United States and British Columbia, Canada, is most commonly caused by a virus infection. Raspberry bushy dwarf virus (RBDV) has long been attributed as the causal agent of the disease. Recently, t...

Toll-Like Receptor-9-Mediated Invasion in Breast Cancer

Science.gov (United States)

2011-07-01

AMBER starting from the in-vacuum minimized Watson - Crick based paired 9-mer hairpin structures. These models were then used with NMR derived distance...the cell. The oligonucleotides studied adopt many different secondary structures such as Watson - Crick duplex, hairpin, quadruplex, and single...deoxyoligonucleotide. Although the mechanism(s) for this induction is unknown, our studies reveal key insights into the structural and sequence requirements for DNA

Nonequilibrium Phase Transitions Associated with DNA Replication

Science.gov (United States)

2011-02-11

polymerases) catalyzing the growth of a DNA primer strand (the nascent chain of nucleotides complementary to the template strand) based on the Watson ...the fraction (error rate) of monomers for which y, where y is the correct Watson - Crick complementary base of , can be obtained by ¼ X...Nonequilibrium Phase Transitions Associated with DNA Replication Hyung-June Woo* and Anders Wallqvist Biotechnology High Performance Computing

Pterostichus neilgaimani sp. nov., a new species of ground beetles (Coleoptera: Carabidae) from relict sacred grove in Eastern Georgia.

Science.gov (United States)

Chaladze, Giorgi; Kalatozishvili, Levan; Janiashvili, Zurab; Bakuradze, Giorgi

2017-10-03

A new species of ground beetles (Coleoptea: Carabidae) belonging to the subgenus Aphaonus Reitter, 1887 (genus Pterostichus Bonelli, 1810) is described, based on two specimens collected from the sacred grove of Khevsha (Eastern Georgia).

Automated problem list generation and physicians perspective from a pilot study.

Science.gov (United States)

Devarakonda, Murthy V; Mehta, Neil; Tsou, Ching-Huei; Liang, Jennifer J; Nowacki, Amy S; Jelovsek, John Eric

2017-09-01

An accurate, comprehensive and up-to-date problem list can help clinicians provide patient-centered care. Unfortunately, problem lists created and maintained in electronic health records by providers tend to be inaccurate, duplicative and out of date. With advances in machine learning and natural language processing, it is possible to automatically generate a problem list from the data in the EHR and keep it current. In this paper, we describe an automated problem list generation method and report on insights from a pilot study of physicians' assessment of the generated problem lists compared to existing providers-curated problem lists in an institution's EHR system. The natural language processing and machine learning-based Watson 1 method models clinical thinking in identifying a patient's problem list using clinical notes and structured data. This pilot study assessed the Watson method and included 15 randomly selected, de-identified patient records from a large healthcare system that were each planned to be reviewed by at least two internal medicine physicians. The physicians created their own problem lists, and then evaluated the overall usefulness of their own problem lists (P), Watson generated problem lists (W), and the existing EHR problem lists (E) on a 10-point scale. The primary outcome was pairwise comparisons of P, W, and E. Six out of the 10 invited physicians completed 27 assessments of P, W, and E, and in process evaluated 732 Watson generated problems and 444 problems in the EHR system. As expected, physicians rated their own lists, P, highest. However, W was rated higher than E. Among 89% of assessments, Watson identified at least one important problem that physicians missed. Cognitive computing systems like this Watson system hold the potential for accurate, problem-list-centered summarization of patient records, potentially leading to increased efficiency, better clinical decision support, and improved quality of patient care. Copyright © 2017

Improving the Army’s Next Effort in Technology Forecasting

Science.gov (United States)

2010-09-01

DC: Center for Technology and National Security Policy, National Defense University, August 2005). 6 James D. Watson and Francis Crick , “A...occurred within the life sciences disciplines. Most notably this occurred early on in 1953 via the discovery of DNA’s double helix structure by Watson and... Crick .6 A confluence of organic chemistry, physics, genomics, and information technology further provided the ability to amplify and replicate the

OSA Proceedings on Ultrafast Electronics and Optoelectronics Held in San Francisco, California on January 25 -27, 1993. Volume 14,

Science.gov (United States)

1993-01-27

Fetterman , University of California, Los Angeles M. Fischetti, IBM T. J. Watson Research Center D. Grischkowski, IBM T. J. Watson Research Center E. P. Ippen...Spectroscopy System ............................. 112 Jeffrey S. Bostak, Daniel W. Van Der Weide, Ikuro Aoki, Bertram A. Aul" and David M. Bloom Sub-Picosecond...Martin, F. K. Oshita, and H. R. Fetterman ix On-Wafer Optoelectronic Techniques for Millimeter-Wave Generation, Control, and Circuit Characterization

How does the long G·G* Watson-Crick DNA base mispair comprising keto and enol tautomers of the guanine tautomerise? The results of a QM/QTAIM investigation.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-08-14

The double proton transfer (DPT) in the long G·G* Watson-Crick base mispair (|C6N1(G*)N1C6(G)| = 36.4°; C1 symmetry), involving keto and enol tautomers of the guanine (G) nucleobase, along two intermolecular neighboring O6H···O6 (8.39) and N1···HN1 (6.14 kcal mol(-1)) H-bonds that were established to be slightly anti-cooperative, leads to its transformation into the G*·G base mispair through a single transition state (|C6N1N1C6| = 37.1°; C1), namely to the interconversion into itself. It was shown that the G·G* ↔ G*·G tautomerisation via the DPT is assisted by the third specific contact, that sequentially switches along the intrinsic reaction coordinate (IRC) in an original way: (G)N2H···N2(G*) H-bond (-25.13 to -10.37) → N2···N2 van der Waals contact (-10.37 to -9.23) → (G)N2···HN2(G*) H-bond (-9.23 to 0.79) → (G*)N2···HN2(G) H-bond (0.79 to 7.35 Bohr). The DPT tautomerisation was found to proceed through the asynchronous concerted mechanism by employing the QM/QTAIM approach and the methodology of the scans of the geometric, electron-topological, energetic, polar and NBO properties along the IRC. Nine key points, that can be considered as part of the tautomerisation repertoire, have been established and analyzed in detail. Furthermore, it was shown that the G·G* or G*·G base mispair is a thermodynamically and dynamically stable structure with a lifetime of 8.22 × 10(-10) s and all 6 low-frequency intermolecular vibrations are able to develop during this time span. Lastly, our results highlight the importance of the G·G* ↔ G*·G DPT tautomerisation, which can have implications for biological and chemical sensing applications.

Novelties in Malesian Rosaceae

NARCIS (Netherlands)

Kalkman, C.

1993-01-01

The treatment of the family Rosaceae in Flora Malesiana (Ser. I, vol. 11, 2) will be published in 1993. Since almost all novelties were already published in precursors, only three remain to be formalized: a new variety in Prunus arborea, a new name replacing an illegitimate name in Rubus, and a new

Growdon Gate/Road Relocation and Property Acquisition Environmental Assessment. Volume 1

Science.gov (United States)

2012-11-01

black walnut (Juglans nigra), pecan ( Carya illinoensis ), blackberry (Rubus sp.), greenbriar (Smilax sp.), poison ivy (Rhus radicans), giant...Riparian Cedar elm (Ulmus crassifolia), black willow (Salix nigra), hackberry (Celtis laevigata), chinaberry (Melia azedarach), pecan ( Carya ... illinoensis ), Canada wildrye (Elymus candensis), poison ivy (Rhus radicans), greenbrier (Smilax spp.), and giant ragweed (Ambrosia trifida) Urban

Ecological regime and distribution of @iVirgulinella@@ spp. in the inshore sediments of western India

Digital Repository Service at National Institute of Oceanography (India)

Nigam, R.; Setty, M.G.A.P.

@iVirgulinella@@ Cushman, 1932 was distinguished as a subgenus from @iVirgulina@@ d'Orbigny, 1826 (non @iVirgulina@@ Bory, 1823 = @iFursenkoina@@) on the basis of the development of numerous small arched sutural openings alternating with bridges...

Assessment of genetic and biochemical diversity of ecologically ...

African Journals Online (AJOL)

USER

2010-03-22

Mar 22, 2010 ... variant Russula species on the basis of RAPD and isozyme analysis. Key words: ..... Singh RP, Singh U (eds) Molecular Methods in Plant Pathology, CRC. Press INC., pp. ... Speciation and synonymy in Penicillium subgenus ...

Effect of Temperature and Drought Stress on Germination of Slender Amaranth (Amaranthus viridis L. and Prostrate Pigweed (Amaranthus blitoides S. Watson Seeds

Directory of Open Access Journals (Sweden)

Marjan Diayanat

2018-02-01

Full Text Available Introduction: Slender amaranth (Amaranthus viridis L. and prostrate pigweed (Amaranthus blitoides S. Watson are two common weeds in vegetables and summer crop fields of Iran. The two Amaranthus species have all the attributes required by ecologically successful annual weeds: rapid growth, early reproduction and continuous seed production. Knowledge of the germination requirements of these weeds will helps determine the proper conditions for germination and emergence and allow better management of them. Water and temperature are determining factors for seed germination of weed. Both factors can, separately or jointly, affect the germination percentage and germination rate. Water stress is one of the main constraints on plant growth and the most common environmental stresses around the world. Water stress affects the different aspects of plant growth and causes reduction and delay in seed germination. Seed germination of all plant species requires a minimum of water to be absorbed and swelled and that is why osmotic potential should not be less than a certain amount. Materials and Methods: Seeds were harvested from vegetable fields of Karaj. For breaking dormancy, seeds were treated with concentrated sulfuric acid for two minutes. Two experiments were conducted at Islamic Azad University, Science and Research Branch, Ecology lab, in 2016. First experiment was based on completely randomized design with 4 replications .The seeds were treated with different temperatures (5, 10, 15, 20, 25, 30, 35, 40 and 45oC. Germination percentage and germination rate were measured and seed were considered to have germinated with the emergence of the radical. Intersected lines model is used to determine the cardinal temperature. Second experiment was conducted to determine the effects of simulated dry conditions (use PEG and temperature on seed germination of slender amaranth and prostrate pigweed. Exposure to polyethylene glycol (PEG-6000 solutions has been

The First Comprehensive Phylogeny of Coptis (Ranunculaceae) and Its Implications for Character Evolution and Classification

Science.gov (United States)

Xiang, Kun-Li; Wu, Sheng-Dan; Yu, Sheng-Xian; Liu, Yang; Jabbour, Florian; Erst, Andrey S.; Zhao, Liang; Wang, Wei; Chen, Zhi-Duan

2016-01-01

Coptis (Ranunculaceae) contains 15 species and is one of the pharmaceutically most important plant genera in eastern Asia. Understanding of the evolution of morphological characters and phylogenetic relationships within the genus is very limited. Here, we present the first comprehensive phylogenetic analysis of the genus based on two plastid and one nuclear markers. The phylogeny was reconstructed using Bayesian inference, as well as maximum parsimony and maximum likelihood methods. The Swofford-Olsen-Waddell-Hillis and Bayesian tests were used to assess the strength of the conflicts between traditional taxonomic units and those suggested by the phylogenetic inferences. Evolution of morphological characters was inferred using Bayesian method to identify synapomorphies for the infrageneric lineages. Our data recognize two strongly supported clades within Coptis. The first clade contains subgenus Coptis and section Japonocoptis of subgenus Metacoptis, supported by morphological characters, such as traits of the central leaflet base, petal color, and petal shape. The second clade consists of section Japonocoptis of subgenus Metacoptis. Coptis morii is not united with C. quinquefolia, in contrast with the view that C. morii is a synonym of C. quinquefolia. Two varieties of C. chinensis do not cluster together. Coptis groenlandica and C. lutescens are reduced to C. trifolia and C. japonica, respectively. Central leaflet base, sepal shape, and petal blade carry a strong phylogenetic signal in Coptis, while leaf type, sepal and petal color, and petal shape exhibit relatively higher levels of evolutionary flexibility. PMID:27044035

A new species of Trechisibus from Peruvian Andes (Coleoptera: Carabidae, Trechinae

Directory of Open Access Journals (Sweden)

Pedro Delgado

2016-06-01

Full Text Available In this work the new species Trechisibus (s. str. delestali sp. n., is described from the southern Peruvian Andes. The morphological differences with the geographically closest species of the subgenus are also presented and discussed.

Description of Lutzomyia (Trichophoromyia) pabloi n. sp. and the female of L. howardi (Diptera: Psychodidae) from Colombia.

Science.gov (United States)

Barreto, Mauricio; Burbano, María Elena; Young, David G

2002-07-01

A new Lutzomyia species in the subgenus Trichophoromyia, L. pabloi, is described and illustrated. A description of the previously unknown female of L. howardi Young is also presented. These specimens were captured in the Amazon region of Colombia.

Glutamate Receptor Aptamers and ALS

Science.gov (United States)

2009-01-01

considered difficult because such a process uses the one-to-one correspondence of Watson - Crick pairing. In contrast, the transfer of function is...same nucleotides in M1 exhibited no NMIA reactivity. In general, non-reactive nucleotides were thought to be Watson - Crick based- paired. A number of...about 14 rounds of selections, the SELEX was terminated. The DNA pool from the 11th, 12th and 14th rounds were cloned and sequenced. Consensus

Adaptive evolution of drug targets in producer and non-producer organisms

DEFF Research Database (Denmark)

Hansen, Bjarne Gram; Sun, Xin E.; Genee, Hans Jasper

2012-01-01

MPA (mycophenolic acid) is an immunosuppressive drug produced by several fungi in Penicillium subgenus Penicillium. This toxic metabolite is an inhibitor of IMPDH (IMP dehydrogenase). The MPA-biosynthetic cluster of Penicillum brevicompactum contains a gene encoding a B-type IMPDH, IMPDH-B, which...... confers MPA resistance. Surprisingly, all members of the subgenus Penicillium contain genes encoding IMPDHs of both the A and B types, regardless of their ability to produce MPA. Duplication of the IMPDH gene occurred before and independently of the acquisition of the MPAbiosynthetic cluster. Both P....... brevicompactum IMPDHs are MPA-resistant, whereas the IMPDHs from a non-producer are MPA-sensitive. Resistance comes with a catalytic cost: whereas P. brevicompactum IMPDH-B is >1000-fold more resistant to MPA than a typical eukaryotic IMPDH, its value of kcat/Km is 0.5%of ‘normal’. Curiously, IMPDH...